text stringlengths 1 18.8k | meta dict |
|---|---|
Methicillin-resistant *Staphylococcus aureus* (MRSA) emerged in the 1960s and has since become a major cause of illness and death in the healthcare setting ([@R1]*,*[@R2]). Risk factors for infection with healthcare-associated MRSA (HA-MRSA) include hospitalization, residence in a long-term care facility, older age, invasive devices (e.g., catheters, feeding tubes), and exposure to antimicrobial agents. HA-MRSA isolates are often resistant to several antimicrobial drug classes in addition to β-lactams ([@R3]).
In the 1990s, investigators began describing serious MRSA infections among persons who did not have typical risk factors for infections with this organism ([@R2]*,*[@R4]*--*[@R8]). These community-associated MRSA (CA-MRSA) infections affected young, healthy persons ([@R4]*,*[@R5]*,*[@R7]) and were associated with factors such as participating in contact sports, sharing towels or athletic equipment, using illegal intravenous drugs, and living in crowded or unsanitary areas (e.g., prisons, hurricane evacuee centers) ([@R9]*,*[@R10]).
Pulsed-field gel electrophoresis (PFGE) demonstrated that MRSA strains causing these community-associated infections (USA300 and USA400) were different than those causing healthcare-associated infections (USA100 and USA200) ([@R11]). USA300 and USA400 MRSA strains typically have the staphylococcal cassette chromosome (SCC) *mec* type IV, not the SCC*mec* type II carried by most USA100 and USA200 isolates ([@R12]). In addition, USA300/400 isolates usually carry the gene that encodes the Panton-Valentine leukocidin (pvl), a bicomponent (*luk*F-PV and *luk*S-PV) pore-forming leukotoxin ([@R8]*,*[@R13]*--*[@R15]). Currently, the role of PVL in the pathogenesis of infections caused by USA300/400 isolates is controversial. Epidemiologic studies and a study by **Labandeira-Rey** et al. suggest that PVL is associated with virulence and causes the necrosis characteristic of infections with these strains ([@R16]). In contrast, a study by Voyich et al. found no difference in virulence between the wild-type parent strains and the isogenic knockout strains that did not produce PVL ([@R17]).
A recent multicenter study by Moran et al. showed that USA300 MRSA is now the most common cause of skin and soft tissue infections (SSTIs) among adults seeking treatment in emergency departments in 11 large metropolitan areas ([@R15]). USA300 also causes serious invasive infections such as necrotizing pneumonia, bloodstream infections, and surgical site infections, some of which are acquired in hospitals ([@R18]*--*[@R22]). Although most USA300 and USA400 isolates are currently resistant to fewer classes of antimicrobial drugs than are HA-MRSA isolates ([@R13]), a recent paper by Han et al. identified a USA300 subtype that is resistant to erythromycin, clindamycin (constitutive), tetracycline, mupirocin, and fluoroquinolones ([@R23]).
Most epidemiologic studies of CA-MRSA have examined isolates from SSTIs infections ([@R7]*,*[@R15]*,*[@R18]), and most studies that evaluated patients with invasive disease have involved single healthcare facilities ([@R21]*,*[@R24]) or isolates obtained primarily from large urban areas ([@R22]). We describe the molecular epidemiology of invasive infections caused by USA300 and USA400 in a rural state. We characterized invasive MRSA from 1999--2005 (select isolates) and in 2006 (all isolates) submitted to the statewide surveillance system in Iowa for invasive MRSA infections.
Methods
=======
As part of a statewide surveillance system, the Iowa Department of Public Health has mandated since 1999 that clinical microbiology laboratories submit invasive isolates of MRSA to the University Hygienic Laboratory (UHL), Iowa's public health laboratory ([@R25]*,*[@R26]). After performing antimicrobial drug susceptibility testing on all isolates, we further characterized (by PFGE, PVL detection, and SCC*mec* typing) all isolates from 1999--2005 that were resistant to [\<]{.ul}3 non--β-lactam antimicrobial drug classes (i.e., consistent with USA300/400) and all 343 isolates from unique patients with invasive infections submitted to the UHL during 2006.
Antimicrobial Drug Susceptibility Testing
-----------------------------------------
All invasive MRSA isolates during 1999--2006 were tested for antimicrobial drug susceptibility by the broth dilution method described by the Clinical and Laboratory Standards Institute ([@R27]). Invasive isolates were defined as any organism from a normally sterile body site such as blood, cerebrospinal fluid, pleural fluid, joint fluid, or fluid from a liver abscess. Isolates from urine were excluded.
Isolates were tested for susceptibility to tetracycline, erythromycin, clindamycin, trimethoprim/sulfamethoxazole, gentamicin, levofloxacin, moxifloxacin, linezolid, daptomycin, vancomycin, and rifampin. Multidrug-resistant isolates were defined as MRSA isolates that were resistant to more than 3 of 8 representative antimicrobial drug classes: macrolides (erythromycin), lincosamides (clindamycin), quinolones (levofloxacin or moxifloxacin), tetracyclines, sulfa drugs (trimethoprim/sulfamethoxazole), aminoglycosides (gentamicin), glycopeptides (vancomycin), and rifampin.
Molecular Typing and PCR to Assess SCC*mec* Type and Presence of the PVL Gene
-----------------------------------------------------------------------------
PFGE was performed as previously described ([@R28]). Each gel accommodated bacteriophage Lambda ladders (at 3 places on the gel), DNA from 17 isolates, type strains for USA300 and USA400 from the Centers for Disease Control and Prevention (Atlanta, GA, USA), and *S. aureus* NCTC-8325 (at 3 places on the gel). The gel images were saved as TIFF files and BioNumerics computer software (Biosystematica, Llandysul, Wales, UK) was used to perform cluster analysis. Isolates were classified as the same strain if cluster analysis indicated that they were [\>]{.ul}80% similar. PFGE patterns for clinical isolates were compared visually and by computer-assisted gel analysis with the type strains for USA300 and USA400. We defined CA-MRSA as MRSA isolates in either the USA300 or the USA400 pulsetypes. Multiplex PCR was performed, as previously described, to type the SCC*mec* A ([@R29]) and to detect the PVL genes ([@R30]).
Epidemiologic Data Collection
-----------------------------
Epidemiologic data on the isolates were obtained from UHL. These data were age, sex, race/ethnicity, inpatient status, intensive care unit status, long-term-care facility status, hospital admission date, specimen type, specimen collection date, the hospital code number, and the Iowa Reporting Region. Isolates were considered to have been acquired nosocomially if the specimen culture date minus the admission date was [\>]{.ul}2 days.
Statistical Methods
-------------------
PFGE patterns and antimicrobial drug susceptibility test results were merged with the demographic data. These data were analyzed with SAS version 9.1 (SAS Institute, Cary, NC, USA) to assess trends in the frequency of USA300/400 in Iowa and to identify possible risk factors for invasive infections with these strains. We used χ^2^ and adjusted χ^2^ tests to analyze categorical data and linear regression and logistic regression to analyze continuous data. Alpha was set at 0.05 and all reported p values were 2-tailed.
Seasonality of infections was analyzed by χ^2^ analysis. Winter was defined as December 22 to March 19, spring as March 20 to June 20, summer as June 21 to September 22, and fall as September 23 to December 21.
The relationships between CA-MRSA and potential risk factors were assessed by univariate analysis. Subsequently, stepwise logistic regression was used to identify factors independently associated with invasive CA-MRSA infection.
Results
=======
Patients infected by USA300/400 MRSA were younger than those infected by other strains (p\<0.0001 for both time periods; [Tables 1](#T1){ref-type="table"}, [2](#T2){ref-type="table"}). During 2006, more males than females were infected with USA300/400 (p = 0.06). Most isolates during both time periods were obtained from blood cultures and the distribution of strains did not vary by body site. Most patients were hospitalized for their infections and the proportion of patients admitted to intensive care units did not vary by strain (p = 0.27 and p = 0.35). However, the proportion of MRSA infections that met the definition of nosocomial decreased significantly from 26.1% from 1999--2005 to 16.6% in 2006 (p = 0.0003). During 2006, patients infected with other MRSA strains were more likely than those infected with USA300/400 to have infections that met the definition of nosocomial (p = 0.0006).
###### Descriptive epidemiology of invasive MRSA in Iowa, USA, 1999--2005\*
Characteristic† Total no. (%), N = 1,323 USA type p value
---------------------- -------------------------- ------------------ ------------------ ----------
Mean age, y 67.8 (SD = 17.6) 46.0 (SD = 22.0) | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#s0005}
===============
Dental caries, a persistent infectious disease, affects billions of people with large individual differences in numbers of caries lesions and activity ([@bb0220]; [@bb0190]; [@bb0110]). At least half of school children and the vast majority of adults worldwide experience accordingly caries, and the economic burden of caries and dental diseases represents about 4.6% of global health expenditures ([@bb0140]). However, in Sweden and countries with a low caries prevalence, many children are either free of caries or have a low disease level while 15--20% have a high caries burden ([@bb0220]; [@bb0100]). These high caries cases are poorly explained by life style-related variables, such as sugar consumption, oral hygiene, or fluoride use (*i.e.* relative risks 0.9--1.2) and seem to be largely unaffected by traditional prevention based on the same factors ([@bb0100]). Accordingly, life style, saliva, and bacteria are poor predictors of caries development ([@bb0220]; [@bb0190]), and better etiological models and diagnostic and preventive tools are needed.
In spite of many advances in etiological and biochemical mechanisms related to caries disease during the last decades ([@bb0220]; [@bb0170]), dental caries is still generally considered a life style condition in which plaque acidification from sugar consumption shifts the oral ecology toward aciduric and acid-producing species; of these, *Streptococcus mutans* is the most well-known ([@bb0220]; [@bb0230]; [@bb0040]; [@bb0195]; [@bb0005]). The bacterium was early identified as the primary caries pathogen and vaccine candidate, but the inability of *S. mutans*, or any other species, to match or predict individual caries development has hampered its use in individualized oral care ([@bb0220]; [@bb0190]).
*S. mutans* (serotypes *c* \> \> *e* \> *f* and *k*) infects the oral cavity of 40--80% of subjects depending on age, ethnicity and disease prevalence and colonize individuals with a dominant and largely unique genotype transmitted from parent to child through saliva ([@bb0120]; [@bb0065]). Cariogenic properties besides acid production that dissolves enamel are oxygen tolerance, bacteriocin production and adhesion and colonization at tooth surfaces ([@bb0040]; [@bb0195]). Together, sucrose-independent adhesion of SpaP or Cnm adhesins to host salivary agglutinin/DMBT1 and collagen, respectively, and sucrose-dependent adhesion of glycosyltransferases to bacterial polysaccharides allow *S. mutans* to colonize naked and cavitated tooth surface and promote plaque growth ([@bb0170]).
Salivary agglutinin, originally identified by its ability to agglutinate *S. mutans*, is identical to DMBT1 or gp340 ([@bb0205]). Salivary agglutinin or DMBT1 is a pattern-recognition receptor composed of multiple domains designed to bind *S. mutans* and a wide array of microbes along with many innate and adaptive immunity factors ([@bb0155]; [@bb0145]; [@bb0150]). DMBT1 thus modulates innate and adaptive immunity, including complement activation, NF-κb signaling via Toll receptors and cellular proliferation ([@bb0155]). A 6.2 kb *dmbt1* deletion variant has been associated with cancer ([@bb0155]) and inflammatory bowel disease by increased NF-κb mediated inflammation in human cases ([@bb0215]). The corresponding salivary size variant (designated gp340 or DMBT1 size variant I) coincides with increased levels of caries and *S. mutans* adhesion in children ([@bb0095]).
The AgI/II adhesin SpaP of *S. mutans* and AgI/II orthologs in various oral streptococci have been extensively explored for structural organization and interaction with its salivary receptor DMBT1 ([@bb0025]). AgI/II adhesins have an unusual tertiary structure where a central variable domain (V-domain) is presented at the tip of a stalk formed by intertwined, flanking alanine- and proline-rich regions ([@bb0125]). The carboxy-terminal domain (C-domain) to which a small N-terminal domain is bound is attached to the cell-wall via a cell-wall anchoring region ([@bb0080]). The SpaP binding sites for the DMBT1 agglutinin localize to the V-domain and the C-domain ([@bb0075]), and SpaP holds a supramolecular functional architecture at the cell surface ([@bb0085]). The SpaP adhesin harbors variants A, B and C (also referred to as A, B~1~, and B~2~) with clustered amino acid substitutions and different DMBT1 binding levels despite similar levels of SpaP expression ([@bb0065]). The interaction of SpaP and AgI/II orthologs with DMBT1 depends on whether DMBT1 is in the fluid- or surface-bound form and also depending on the *S. mutans* strain ([@bb0145]; [@bb0075]), suggesting that SpaP polymorphisms may modulate adhesion and aggregation by DMBT1 and consequently caries activity.
*S. mutans* also harbors collagen-binding Cnm and Cbm adhesins in 15% and 3% of clinical isolates, respectively, and more frequently in serotype *e*, *f* and *k* than in *c* isolates ([@bb0015]). Cnm/Cbm are highly homologous and consist, similar to collagen-binding proteins in *Staphylococcus aureus* and other bacteria ([@bb0105]; [@bb0255]), of an N-terminal collagen-binding domain presented on a stalk formed by several threonine-rich repeat domains and a cell wall anchoring region ([@bb0175], [@bb0180]). Whereas *S. mutans* (serotypes *c*, *e*, *f* and *k*) may cause infective endocarditis ([@bb0090]), serotypes *f* and *k* in which Cnm and Cbm are more frequent coincide with inflammatory bowel disease ([@bb0115]) and Cnm phenotypes with hemorrhagic stroke ([@bb0165]; [@bb0250]). The Cnm/Cbm phenotypes also increase strain virulence in endocarditis ([@bb0185]). As potential virulence mechanisms in these so-called extra-oral infections, Cnm/Cbm mediate invasion of endothelial cells ([@bb0010], Review), formation of thrombus or heart valve vegetations or inhibition of platelet aggregation and wound healing ([@bb0165]; [@bb0015]).
The aim of this study was to clarify the role of *S. mutans* as a caries pathogen by matching sucrose-independent adhesin types SpaP A, B, C and Cnm/Cbm with individual differences in caries development. We analyzed 452 Swedish children for the presence of *S. mutans* adhesin types and related them to baseline caries and 5-year increment and to cariogenic properties.
2. Methods {#s0010}
==========
2.1. Study Participants and Registration of Caries {#s0015}
--------------------------------------------------
A total of 452 12-year-old children were collected as two independent samples (*n* = 218, *n* = 234) from 13 clinics in the northern county of Västerbotten, Sweden (Fig. S1). Included in the first sample were children born in 1996 and caries cases (≥ 1 Decayed and Filled Surfaces, DFS, in the permanent dentition) and caries-free controls in a 1:1 ratio; and for the second sample, they were born in 1998 and caries cases (≥ 2 DFS) and controls in a 2.1 ratio, and receiving ordinary dental care at Public Dental Service Clinics. The exclusion criterion was unwillingness to participate in the study. Both samples were re-examined after 5 years, for a total of 390 examined children with 14% drop-out rate (62/452) for having moved out of the area (20 children) or repeatedly missed the examination (42 children). The children received operative treatment and prevention of caries between 12 and 17 years of age, and 15% of the children orthodontic treatment with multibrackets after 12 years of age (as established from dental records), according to ordinary routines and policies at the clinics. The study was approved by the Ethics Committee for Human Experiments at Umeå University, Sweden, and informed consent was obtained from the children and their parents before participation. All parents signed consent to participate.
Caries was recorded by three dentists (intra- and inter-examiner kappa ≥ 0.979) by a mirror, probe and two bitewing radiographs and mean number of [D]{.ul}ecayed ([e]{.ul}namel caries included), [F]{.ul}illed Surfaces in the permanent dentition (DeFS) was the primary caries outcome measure. The 5-year caries increment (ΔDeFS) was calculated by subtracting latest from earliest DeFS, dividing that value by the number of observed years and multiplying the result by 5. The 1:1 ratio (first sample) and increased 2:1 ratio (second sample) of caries cases *versus* controls and DeFS index generated a continuous gradient of discriminatory caries DeFS scores in the entire sample at baseline (Fig. S1, Table S1).
2.2. Genotyping of *S. Mutans* Adhesin Types in Whole Saliva {#s0020}
------------------------------------------------------------
Whole saliva, collected by chewing on paraffin for 5 min that was stored frozen at − 80 °C, was genotyped for *cnm*, *c | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Single-cell RNA-sequencing (scRNAseq) analysis plays an important role in investigating tumour evolution, and is more powerful to characterize the intra-tumor cellular heterogeneity \[[@CR1], [@CR2]\]. Compared with traditional RNA sequencing (i.e. bulk RNAseq) which measures the specific gene expression level within a cell population, scRNAseq quantifies the specific gene expression level within only an individual cell \[[@CR3], [@CR4]\]. scRNAseq is more likely to understand the detailed biological processes of cell developmental trajectories and cell-to-cell heterogeneity, providing us fresh insights into cell composition, dynamic cell states, and regulatory mechanisms \[[@CR5]--[@CR8]\].
However, there are still several big challenges we have to carefully deal with before analyzing scRNAseq data \[[@CR9], [@CR10]\]. The first challenge is that the scRNAseq data is easy to involve some unwanted variables \[[@CR11], [@CR12]\], e.g. batch effects, confounding factors, etc. Moreover, the scRNAseq data set has their own characterizes, such as gene expression matrix is extremely sparse because of the quite small number of mRNAs represented in each cell \[[@CR13]\]; current sequencing technologies, e.g. CEL-Seq2 \[[@CR14]\] and Drop-seq \[[@CR15]\], etc, do not have enough power to quantify the actual concentration of mRNAs (i.e. well-known "dropout events") \[[@CR16]\]; the heavy amplifications may result into strong amplification bias \[[@CR17]\]; cell cycle state, cell size or other unknown factors may contribute to cell-cell heterogeneity even within the same cell type \[[@CR18]\].
The second important feature of the scRNAseq data set is of count nature \[[@CR19]\]. In most RNA sequencing studies, the number of reads mapped to a given gene or isoform is often used as an intuitive estimate of its expression level. To account for the count nature of the RNA sequencing data, and the resulting mean-variance dependence, most statistical methods were developed using discrete distributions in differential expression analysis, i.e., PQLseq \[[@CR20]\], edgeR/DESeq \[[@CR21], [@CR22]\], and MACAU \[[@CR23]\]. Therefore, a nature choice of analyzing scRNAseq data is to develop count-based dimensionality reduction methods. Although several dimensionality reduction techniques have been already applied to scRNAseq data analysis, such as principal component analysis (PCA) \[[@CR24]\]; independent components analysis (ICA) \[[@CR25]\], and diffusion map \[[@CR26]\]; partial least squares (PLS) \[[@CR27], [@CR28]\]; nonnegative matrix factorization (or factor analysis) \[[@CR29], [@CR30]\], gene expression levels are inherently quantified by counts, i.e., count nature of scRNAseq data \[[@CR31], [@CR32]\].
Therefore, developing the bespoke scRNAseq dimensionality reduction method has been triggered within the last two years. The first factor analysis method, ZIFA, is trying to model the drop-out events via the zero-inflated model, but the method does not take into account the count nature of the data \[[@CR33]\]; pCMF is trying to build sparse Gamma-Poisson factor model within the Bayesian framework, but such method does not include the covariates \[[@CR34]\]; ZINB-WaVE is trying to involve both gene-level and sample-level covariates via a hierarchical model, but the method is really time-consuming when sample size is large \[[@CR35], [@CR36]\].
Here, in this paper, we propose a fast and efficient count-based matrix factorization method that utilizes the negative binomial distribution to account for the over-dispersion problem of the count nature of scRNAseq data, single-cell Negative Binomial-based Matrix Factorization, scNBMF. The reason of choosing negative binomial model instead of zero-inflated negative binomial model is that not only the most scRNAseq data sets do not show much technical contribution to zero-inflation (Fig. [1](#Fig1){ref-type="fig"}a), but also can largely reduce the computation burden in estimating drop-out parameters for each gene. With the stochastic optimization method Adam \[[@CR37]\] implemented within TensorFlow framework, scNBMF is roughly 10 -- 100 times faster than the existing count-based matrix factorization methods, such as pCMF and ZINB-WaVE. To make the proposed method scalable, we apply scNBMF to analyze three publicly available scRNAseq datasets. The results demonstrate that scNBMF is more efficient and powerful than other matrix factorization methods. Fig. 1A simple example to show the parameter effect or optimizer effect of NMI and ARI in scRNA-seq data on clustering. **a** This figure shows the relationship between mean gene expression levels and dropout rates. The black line indicates observed value, which is computed by the number of unexpressed cells divided by the number of cells; The red line represents expected value, which is calculated by negative binomial distribution with mean gene expression levels and dispersion parameter *ψ*(*ψ*=*mean*(*ψ*~*i*~))**b** This figure shows how optimizers affect the performance of different methods on NMI and ARI. **c**-**d** These two figure indicate how the number of factors affect the NMI and ARI, respectively
Materials and methods {#Sec2}
=====================
scNBMF: model and algorithm {#Sec3}
---------------------------
scNBMF is to fit the logarithm likelihood function of negative binomial model-based matrix factorization. Given *n* cells and *p* genes, we denote *Y* as a gene expression matrix, and its element *y*~*ij*~ is the count of gene *i* and cell *j*. To account for the over-dispersion problem, we model the gene expression level *y*~*ij*~ as a random variable following the negative binomial distribution with parameters *μ*~*ij*~ and *ϕ*~*i*~, i.e., $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document} $$y_{ij} \sim NB(\mu_{ij},\phi_{i}) $$ \end{document}$$ where the rate parameter *μ*~*ij*~ denotes the mean expression level for gene *i* and cell *j*; the parameter *ϕ*~*i*~ represents variance of gene expression, typically means gene-specific over-dispersion; *NB* is the negative binomial distribution, i.e. $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document} $$ \text{Pr}_{NB}(y_{ij}|\mu_{ij},\phi_{i}) \,=\, \left(\! \begin{array}{c} y_{ij} + \phi_{i} - 1\\ y_{ij} \end{array} \!\!\right) \!\!\left(\frac{\mu_{ij}} {\mu_{ij} + \phi_{i} } \!\right)^{y_{ij}}\!\! \left(\frac{ \phi_{i}} {\mu_{ij} + \phi_{i}} \!\right)^{\phi_{i}}\!. $$ \end{document}$$
For the rate parameter *μ*~*ij*~, we consider the following regression model $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document} $$log(\mu_{ij}) = log(N_{j}) + {\sum}_{k = 1}^{K} W_{ik} X_{kj}. $$ \end{document}$$ where *N*~*j*~ is the total read count for the individual cell *j* (a.k.a read depth or coverage); *W*~*ik*~ is the loadings while *H*~*kj*~ is the factors represents the coordinates of the cells, which can be used to identify cell type purpose; *K* is the pre-defined number of components; When all *ϕ*~*i*~→0, the negative binomial distribution will reduce to the standard Poisson distribution.
Therefore, the log-likelihood function for gene *i* and cell *j* is $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document} $$\begin{array}{*{20}l} \mathcal{L}_{NB}(\mu,\phi| Y) = &\sum\limits_{i = 1}^{p} \sum\limits_{j = 1}^{n} log \text{Pr}_{NB} \left(y_{ij}|\mu_{ij},\phi_{i}\right)\\ = &\sum\limits_{i = 1}^{p} \sum\limits_{j = 1}^{n} y_{ij} log (\mu_{ij}) + \phi_{i} log(\phi_{ | {
"pile_set_name": "PubMed Central"
} |
Competing interest statement
============================
Conflict of interest: the authors declare no potential conflict of interest.
Introduction {#sec1-1}
============
As dramatic progress has been made in the therapeutic strategies for multiple myeloma (MM), in particular the development of proteasome inhibitors (PIs) and immunomodulatory drugs (IMiDs), extramedullary disease (EMD) is observed with increasing frequency.^[@ref1]^ To date, visceral organ involvement of spleen, liver, kidneys, lymph nodes, and cutaneous tissue has been reported.^[@ref2]^ The prognosis of MM patients with extramedullary relapse is very poor.^[@ref3]^ EMD is often associated with high serum lactate dehydrogenase levels,^[@ref4]^ plasmablastic cell morphology, and complex cytogenetic abnormality.^[@ref5]^
In the largest retrospective analysis of relapse patterns following autologous hematopoietic stem cell transplantation for MM, Alegre *et al*. reported that increased EMD was evident both at diagnosis and after therapy.^[@ref6]^ Also they found that the risk of extramedullary relapse was not significantly increased after the use of PIs and IMiDs.^[@ref6]^ However, it has been suggested that PIs and IMiDs may increase the incidence of EMD by attenuating the biology of MM.^[@ref7]^
The mechanism of EMD development is elusive, but it is suggested that oncogenes,^[@ref10],[@ref11]^ instability of chromosomes,^[@ref12]^ cell adhesion molecules,^[@ref7],[@ref8],[@ref13]^ and tumor microenvironment^[@ref14]^ may have important role.
Here, we report a surprisingly large tumor mass occupying the left upper limb in the course of MM treatment including PIs and IMiDs. EMD of this large size has not been reported before, and this case may provide a clue to understand the features of EMD in MM.
Case Report {#sec1-2}
===========
A 66-year-old woman developed pain in her left shoulder and was diagnosed with pathological fracture. Her serum IgG was elevated to 3811 mg/dL and IgG-lambda type M-protein was detected by serum immunoelectrophoresis assay. She had 19.6% of bone marrow plasmacytosis with normal cytogenetics. The diagnosis of ISS stage 1 IgG-lambda type MM was established. No other bone lesion, anemia or kidney injury was found. Her left upper extremity was treated with 8 Gy single fraction using a 4MV photon beam by parallel opposed portals, prior to the conventional vincristine/adriamycin/dexamethasone (VAD) induction therapy. After the three courses of VAD treatment, she was switched to a bortezomib/dexamethasone (BD) regimen because of a Helicobacter cinaedi bacteremia developed in the third course of VAD. After the completion of 3 courses of BD regimen, her bone marrow plasmacytes was decreased to 0.4%, however, a tumor of 1×1 cm large developed in her left arm. With a clinical diagnosis of plasmacytoma, second course of radiotherapy with 8 Gy irradiation (left upper extremity was treated with 8 Gy single fraction using a 4MV photon beam by parallel opposed portals), was performed, after which the patient underwent lenalidomide/dexamethasone therapy. Lenalidomide/dexamethasone was effective, and her EM nodule decreased in size to visually undetectable level; however, 6 months later, after 4 courses of Lenalidomide/dexamethasone treatment the nodule enlarged again. There were 15×15 mm tumor in flexor side of her left arm and 20×20 mm tumor in her extensor side of forearm. MRI revealed those tumors were not connected to cortical bones, in addition, no other tumors in her left arm were found. A needle biopsy of a tumor in her left arm was performed and an accumulation of atypical plasmacytes were detected. As a third line therapy, 2 courses of bortezomib/cyclophosphamide/dexamethasone regimen, followed by melphalan/thalidomide/prednisolone (MPT) was administered, however, during the 6th course of MPT, the extramedullary plasmacytoma occupied her left upper limb.
Then, pomalidomide/dexamethasone as a fourth line was started, which was initially effective; the size of the tumor mass decreased, and the vessels on the surface of the bulk of the tumor appeared to be reduced. However, in the 3rd course of pomalidomide treatment, the EMD enlarged again and extended to her left forearm and back of the hand ([Figure. 1](#fig001){ref-type="fig"}). On the contrary, there were only scarce MM cells in the bone marrow (3.6%). Those MM cells were morphologically plasmablastic and harbored complex cytogenetic abnormality. She died of severe respiratory failure. Pleural and pulmonary tumor infiltration was suspected. Post-mortem examination revealed extensive MM involvement of multiple organs, including not only the left upper limb, but also lung, liver, kidney, stomach, and thyroid ([Figure 2](#fig002){ref-type="fig"}). However, the bone marrow had only scattered patchy myeloma cells.
Discussion {#sec1-3}
==========
We demonstrate a remarkably large plasmacytoma developing in the left arm of a patient with refractory MM. The presence of this large extramedullary plasmacytoma may be rare; so far, no cases of EMD of a similar size have been reported.
Consistent with prior reports, the patient had plasmablastic MM cells, complex karyotype, elevated LDH, and presented a very aggressive course. Although MM cells were seen to invade multiple organs, including lung, liver, and kidney, there was no evidence of plasma cell leukemia, and only 3.6% bone marrow plasmacyotosis was detected. This dissociation between bone marrow and peripheral blood findings and aggressive visceral organ invasion may be significant. The difference between marrow and visceral organ involvement has been reported. For example, in the largest retrospective analysis of relapse patterns following autologous hematopoietic stem cell transplantation for MM, Alegre *et al*. found that 14% of cases that relapsed were EMD and were not associated with BM infiltration.^[@ref6]^
Also this dissociation may indicate the heterogeneity of MM; for a long time, it has been recognized that not all tumor cells are identical.^[@ref15]^ For example, tumors are heterogeneous in their proliferative ability and only a subset of tumor cells have long-term renewal potential.^[@ref15]^ In addition, it has been noticed that clonal evolution, in which tumor cells accumulate mutations, some of which confer increased fitness and survival advantage can occur.^[@ref16]^
Furthermore this dissociation may imply there are biological difference between myeloma homing in bone marrow and myeloma forming EMD. Regarding the biology of EMD formation, genetic abnormalities^[@ref10],[@ref11],[@ref12]^ decreased cell adhesion molecules expression, down regulation of chemokine receptors,^[@ref7],[@ref8],[@ref13]^ and tumor microenvironment^[@ref14]^ may have important role.
In the courses of the pomalidomide treatment, the vessel pattern in the bulk of the tumor had reduced. This is compatible with the widely recognized phenomenon that IMiDs antagonize tumor angiogenesis.
Conclusions {#sec1-4}
===========
We discussed an extremely large EMD developing in a patient with refractory MM. MM cells extensively invaded multiple organs without significant bone marrow infiltration. This case may provide clues for a better understanding of the EMD.
{#fig001}
{#fig002}
[^1]: Contributions: JT and SH committed the clinical practice and wrote the paper. KO and TI evaluated the post-mortem examination. DN and KN contributed essential advice regarding clinical practice and writing the article. SH and KN supervised the study.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-ijms-20-01218}
===============
Mitochondrial transcription factor A (mtTFA, mtTF1, TFAM) is critical in regulating mitochondrial DNA (mtDNA) transcription, packaging and copy number \[[@B1-ijms-20-01218],[@B2-ijms-20-01218],[@B3-ijms-20-01218]\]. It was pointed out that suppressing the expression of TFAM inhibited the proliferation of cancer cells \[[@B4-ijms-20-01218],[@B5-ijms-20-01218]\], increased the sensitivity of cancer cells to chemotherapeutic drugs or ionizing irradiation \[[@B6-ijms-20-01218],[@B7-ijms-20-01218],[@B8-ijms-20-01218]\], and triggered apoptosis \[[@B9-ijms-20-01218]\]. The increased expression of TFAM can be considered as a prognosis marker for poor clinical outcomes of specific type of cancer \[[@B10-ijms-20-01218]\]. At the same time, the decreased expression of TFAM and mitochondrial dysfunction was associated with the pathogenesis of brain and bone diseases \[[@B11-ijms-20-01218],[@B12-ijms-20-01218]\]. TFAM can be up-regulated by ionizing radiation in cancer cell lines, to decrease radiation induced cell death \[[@B13-ijms-20-01218]\]. However, the mechanisms on how TFAM is regulated in irradiated tumor cells remain largely known.
Cyclooxygenase-2 (COX-2), encoded by the *PTGS2* gene, plays important roles in tumorigenesis and inflammation \[[@B14-ijms-20-01218],[@B15-ijms-20-01218],[@B16-ijms-20-01218]\]. The increased expression of COX-2 is considered as a marker for the proliferation of tumor cells \[[@B17-ijms-20-01218]\]. COX-2 plays a critical role in the production of prostaglandin E2 (PGE2). Previous studies showed that COX-2-derived PGE2 induced Id1-dependent radiation resistance and self-renewal in experimental glioblastoma \[[@B18-ijms-20-01218]\]. Other studies have confirmed that the inhibition of COX-2 expression increases the sensitivity of cancer cells to radiation, and COX-2 signaling is a potential therapeutic target for consolidating cancer treatment \[[@B19-ijms-20-01218],[@B20-ijms-20-01218],[@B21-ijms-20-01218]\]. It was reported that a majority of COX-2 in tumor cells were co-localized with heat shock protein-60 in mitochondria, and the mitochondrial localization of COX-2 might confer resistance to apoptosis in different cancer cell lines \[[@B22-ijms-20-01218]\]. Dynamin-related protein 1 (DRP1), a key mediator of mitochondrial fragmentation, is encoded by the *DNM1L* gene \[[@B23-ijms-20-01218]\]. Recent studies have shown that radiation-induced the localization of DRP1 to the mitochondria, and accelerated mitochondrial fragmentation \[[@B24-ijms-20-01218]\]. Preventing mitochondrial fragmentation impaired mitochondrial functions, and led to the loss of mitochondrial DNA \[[@B25-ijms-20-01218]\], indicating that the potential association between mitochondrial morphologies and TFAM was involved in the regulation of mitochondrial biogenesis \[[@B3-ijms-20-01218],[@B26-ijms-20-01218],[@B27-ijms-20-01218]\].
Both TFAM and COX-2 contribute to the resistance of cancer cells to radiation, and they are considered as potential targets for improving the efficacy of radiation treatment in cancers. Besides, they are mitochondrial proteins, and affect mitochondrial functions. Therefore, in this research, we aimed at exploring the interconnections between TFAM and COX-2 in irradiated cancer cells. We identified that COX-2 derived PGE2 enhanced the activation of p38-MAPK, which further stimulated DRP1-mediated up-regulation of TFAM. Our results provided new information on the mechanisms for how COX-2 affects mitochondrial functions, and its implications in increasing the sensitivity of cancer cells to radiation during therapy. The results are described in the following section.
2. Results {#sec2-ijms-20-01218}
==========
2.1. Concomitant Up-Regulation of TFAM and COX-2 in Irradiated Tumor Cells {#sec2dot1-ijms-20-01218}
--------------------------------------------------------------------------
TFAM-knockdown U-2 OS and Hep G2 cells were established by transfecting short hairpin RNA (shRNA) plasmids targeting human *TFAM* ([Figure 1](#ijms-20-01218-f001){ref-type="fig"}A). In TFAM knockdown cells, radiation induced elevation of mtDNA copy number was suppressed ([Figure 1](#ijms-20-01218-f001){ref-type="fig"}B). Clonogenic survival assay was applied to test the role of TFAM in sensitizing tumor cells to γ-ray irradiation. As shown in [Figure 1](#ijms-20-01218-f001){ref-type="fig"}C, plots were fitted according to the linear quadratic model, S = exp (−α × *D* − β × *D*^2^), where S is the surviving fraction, *D* is the radiation dose (Gy), and α and β are the fitting parameters. According to the surviving fraction curves, for U-2 OS cells transfected with scramble shRNA plasmid, the 10% survival dose (*D*~10~) and 37% survival dose (*D*~0~) were 5.32 Gy and 2.7 Gy. The *D*~10~ and *D*~0~ for U-2 OS cells transfected with shTFAM1 and shTFAM2 plasmids were 3.64 Gy, 1.54 Gy and 4.18 Gy, 1.85 Gy, respectively. For Hep G2 cells transfected with scramble shRNA plasmid, the 10% survival dose (*D*~10~) and 37% survival dose (*D*~0~) were 5.62 Gy and 2.9 Gy, respectively. The *D*~10~ and *D*~0~ for Hep G2 cells transfected with shTFAM1 and shTFAM2 plasmids were 4.38 Gy, 1.83 Gy, and 3.49 Gy, 1.44 Gy respectively. These results indicated that the knockdown of TFAM expression increased the sensitivity of U-2 OS and Hep G2 cells to radiation. Since COX-2 has been reported to be a pro-survival protein in a wide range of tumor cells, we next detected the expression levels of TFAM and COX-2 after γ-ray irradiation. As shown in [Figure 1](#ijms-20-01218-f001){ref-type="fig"}D, 12 h post-4 Gy γ-ray radiation, the expression levels of both TFAM and COX-2 in U-2 OS, HeLa, and MCF7 cells displayed notable enhancement. We then checked the radiation dose dependency of TFAM and COX-2 expression in U-2 OS cells, 12 h post radiation. As shown in [Figure 1](#ijms-20-01218-f001){ref-type="fig"}E, the expression levels of TFAM and COX-2 were enhanced, with the dose increasing from 1 Gy to 8 Gy, to around 3- and 3.5-fold, compared to those observed in the non-irradiated cells. Next, the time-course for the expression of TFAM and COX-2 were investigated in U-2 OS cells ([Figure 1](#ijms-20-01218-f001){ref-type="fig"}F). The expression levels of TFAM and COX-2 increased within 12 h after radiation, reaching around 2.8- and 3-fold, compared to the non-irradiated controls respectively. Also, due to TFAM up-regulation decreasing the sensitivity of tumor cells to radiation, and because it was concomitantly up-regulated with COX-2, we then aimed at determining whether COX-2 affected the expression of TFAM in irradiated cells.
2.2. Activation of COX-2 Up-Regulates TFAM in Irradiated Cells {#sec2dot2-ijms-20-01218}
--------------------------------------------------------------
To test whether COX-2 contributed to the up-regulation of TFAM or not, the selective COX-2 chemical inhibitor NS-398 was added into cell culture medium 6 h before 4 Gy γ-radiation at a final concentration of 20 μmol/L. At 6 and 12 h post-radiation, the expression levels of TFAM in U-2 OS and HeLa cells were detected. As displayed in [Figure 2](#ijms-20-01218-f002){ref-type="fig"}A, the addition of NS-398 obviously inhibited the induction of TFAM by radiation. Since NS-398 functions in blocking the enzymatic activity of COX-2, which is desired for the synthesis of prostaglandin, we therefore detected whether prostaglandin E2 (PGE2), the major form of physiological prostaglandin, stimulated the expression of TFAM. As shown in [Figure 2](#ijms-20-01218-f002){ref-type="fig"}B, in U-2 OS and HeLa cells, PGE2 treatment resulted in the elevation of TFAM expression by over 60% at 1 ng/mL, and by over 100% at a final concentration of 10 ng/mL. Further, we tested the effect of NS-398 on the radio-sensitivity of U-2 OS cell under 4 Gy of radiation. As shown in [Figure 2](#ijms-20-01218-f002){ref-type="fig"}C, | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S1}
============
Multiple sclerosis (MS) is a chronic inflammatory, demyelinating disease of the central nervous system (CNS) with axonal injury, characterized by varying clinical course, pathology, and inflammatory patterns ([@B1]). It develops in susceptible hosts after interaction with environmental factors which trigger the disease by promoting the activation of myelin-specific T cells that normally circulate in the peripheral lymph organs of all individuals ([@B2]). It has been suggested that some infectious agents, in particular viruses, may be potential triggers of MS ([@B2]--[@B4]). Among different infective agents, Epstein--Barr virus (EBV) has been mostly associated with increased MS risk ([@B5]). Recently, it has been shown increased CD8^+^ T cell response to EBV lytic antigens in active MS and also in relapses ([@B6]). Infection with murine gamma herpesvirus 68 (γHV-68), the murine homolog to EBV, polarizes the adaptive immune response and heightens CNS pathology following experimental autoimmune encephalomyelitis (EAE) induction and likely, influences MS pathogenesis ([@B7]).
Experimental autoimmune encephalomyelitis is the experimental model of MS, induced in susceptible animals by active immunization with myelin antigens mixed with adjuvant ([@B8]). Immunized mice develop ascending paralysis with CD4^+^ T cells and macrophages in infiltrations in the white matter of the spinal cord, and with minimal brain inflammation in the majority of experimental models. However, in MS, the vast majority of myelin lesions are found within the brain parenchyma with infiltrations that contain equivalent numbers of CD8^+^ T and CD4^+^ T cells ([@B9], [@B10]). Despite these differences, EAE is considered as a valuable tool for research of MS pathogenesis. Moreover, several therapeutics that are now being used to treat MS were developed in EAE ([@B11]). BALB/c mice are found partially or completely resistant to the induction of EAE with encephalitogenic peptide, myelin oligodendrocyte glycoprotein (MOG~35--55~).
Cytomegalovirus (CMV) classified within the *Betaherpesvirinae* subfamily establishes life-long latent infections in 70--100% of the human population ([@B12]). After a primary infection of fibroblasts, epithelial, endothelial, and smooth muscle cells ([@B6]), mostly asymptomatic in the immunocompetent host, CMV persists in myeloid precursor cells ([@B7]). During latency periodic asymptomatic reactivations occur ([@B13]). CMV contains a large number of latent and lytic genes, many of which code proteins that have the role in immunoregulation ([@B5]). When monocytes that carry CMV enter visceral parenchyma and differentiate into macrophages and myeloid dendritic cells, virus reactivates and through expression of different genes can modulate the immune response of the host ([@B14]).
Data on the role of CMV infection in etiopathogenesis of MS are controversial. CMV has been found in demyelinating plaques and the cerebrospinal fluid of MS patients ([@B15]) and causes demyelination mainly in the CNS of immunocompromised hosts ([@B16]). Further, enhancement of numbers of EBV and CMV-specific CD8^+^ T cells among T cells in chronic inflammatory lesions of brain of MS patients was reported ([@B17]). Several studies involving human subjects indicate correlation between CMV infection and MS development, greater rate of relapses and greater brain atrophy ([@B18]--[@B20]). Other studies indicate that CMV seropositivity is associated with a decreased MS risk and predicts a better clinical and radiological outcome in MS patient ([@B21]), suggesting a protective effect of CMV on autoimmune neuropathology ([@B22]). Furthermore, CMV encodes multiple factors that trigger immunomodulatory or evasion mechanisms, which can decrease the immune response in MS patients ([@B23], [@B24]).
We have recently shown that deletion of an immunoregulatory pathway, IL-33/ST2 axis, may enhance susceptibility to EAE in resistant BALB/c strain ([@B25], [@B26]). The present study was done with the aim to explore whether infection with murine CMV (MCMV) create "fertile field" ([@B27], [@B28]) that facilitates the expansion and activation of encephalitogenic cells leading to autoimmune disease of CNS.
Here, we show that MCMV infected and MOG~35--55~ immunized BALB/c mice develop very pronounced neuroinflammation with extensive infiltrations in brain and spinal cord parenchyma containing large proportion of CD8^+^ cells in infiltrates in addition to accentuation of Th1 and Th17 immune response and skewing microglia to M1 phenotype. Our results are compatible with the notion that MCMV abrogates inherent resistance of BALB/c mice to EAE induction with MOG~35--55~ peptide through enhancement of inflammatory dendritic cells in the periphery, M1 type of microglia and recruitment of MOG~35--55~ responsive CD8^+^ T cells in the CNS. Thus, CMV-induced inflammatory environment may enhance autoimmunity in CNS.
Materials and Methods {#S2}
=====================
Infection, Induction, and Scoring of EAE {#S2-1}
----------------------------------------
Female 8-week-old BALB/c mice were used throughout this study. Mice were infected subcutaneously (footped) with 10^5^ plaque-forming units of tissue culture MCMV, strain MW97.01 ([@B29]). EAE was induced 10 days after infection by subcutaneous administration of 200 µL suspension at two sites over the hind flanks. Depletion of CD4^+^ lymphocytes, where indicated, was performed with intraperitoneal injection of 100 µg of anti-CD4 mAb, 1 day prior to and 5 days after MOG~35--55~ immunization. The suspension consisted of 300 µg MOG~35--55~ peptide (Sigma-Aldrich, Germany) in 100 µL of PBS, emulsified with 100 µL complete Freund's adjuvant (Sigma-Aldrich, Germany) with 0.7 mg heat-inactivated *Mycobacterium tuberculosis* (strain H37 RA; Difco Laboratories, Detroit, MI, USA). Each mouse was immediately thereafter, injected intraperitoneally and 48 h later with 300 ng pertussis toxin (List Biological Laboratories, Campbell, CA, USA) in 100 µL 0.9% NaCl. Clinical signs of EAE were assessed daily by the following scoring system: grade 0, no signs; grade 1, paralyzed tail; grade 2, ataxic; grade 2.5, one hind leg paralyzed; grade 3, both hind legs paralyzed; grade 3.5, three legs paralyzed; grade 4, both hind legs and front limbs completely paralyzed; grade 5, moribund as previously described ([@B30], [@B31]). Mice were monitored daily with fluid administration and mashed chow on the base of cages for all mice displaying a clinical score of 3. Mice were maintained in our animal facilities in a temperature-controlled environment with a 12-h light/12-h dark cycle and were administered standard laboratory food and water *ad libitum*. All experiments were approved by and conducted in accordance with the Guidelines of the Animal Ethics Committee of Faculty of Medical Sciences, University of Kragujevac, Serbia. Endangered animal species were not used in this study.
Isolation of Mononuclear Cells from CNS and Lymph Nodes {#S2-2}
-------------------------------------------------------
At day 15 post-EAE induction (mean clinical score of 3 for MCMV EAE mice), mice were perfused with PBS, and brain and spinal cord were carefully removed. The mononuclear cells from CNS were isolated as described previously ([@B25]). Briefly, the brains and spinal cords were homogenized in RPMI 1640 (Sigma-Aldrich) with 10% FBS and 1 mg/mL collagenase type I (Sigma-Aldrich) and incubated at 37°C for 60 min. After digestion, the tissue was passed through a 40-µm mesh, pelleted, resuspended in 10 mL 30% Percoll (Sigma-Aldrich), overlaid onto 5 mL 70% Percoll, and centrifuged at 390 *g* for 20 min. The myelin layer was removed, and the mononuclear cells accumulated in the intermediate phase were collected, washed twice in PBS, and resuspended in RPMI 1640 containing 10% FBS. Total cell numbers were determined by counting on a hemocytometer, and viability was assessed by trypan blue exclusion. Lymph nodes were minced in RPMI 1640 (Sigma-Aldrich) and forced gently through 40-µm cell-strainer nylon mesh (Falcon) using a sterile syringe plunger and centrifuged at 400 *g* for 5 min. Pellet from lymph nodes was resuspended in RPMI 1640 containing 10% FBS.
Flow Cytometry {#S2-3}
--------------
Single-cell suspensions of brain and spinal cord tissue were prepared according to standard protocols. For cytofluorometry, following antibodies were used: CD4, CD8, CD45, CCR6, CXCR3, TCRβ, CD11c, CD11b, CD49b, CCR2, CD86, T-bet, RORγt, IL-17, IFN-γ, TNF-α, and IL-12 with conjugated fluorochromes (BD Biosciences). Antibodies were incubated with cells in PBS with 2% FBS for 30 min at 4°C, and then cells were analyzed. For intracellular staining of cytokines, cells were stimulated for 4 h in RPMI 1640 containing 10% FBS (Gibco), 10 ng/mL phorbol 12-myristate 13-acetate (Sigma-Aldrich), and 500 ng/mL ionomycin (Sigma-Aldrich) with addition of Brefeldin A (BD Biosciences). Antibodies for the cell surface markers were added | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-biomedicines-08-00069}
===============
Replacement therapy using plasma-derived Factor IX (FIX) products is a life-saving treatment for patients with hemophilia B. Both recombinant and plasma-derived FIX show high efficacy in clinical trials \[[@B1-biomedicines-08-00069]\]. Production of FIX normally involves multiple steps. High purity FIX is obtained from prothrombin complex concentrate (PCC), which is a mixture of vitamin K-dependent clotting factors, e.g., factor II (prothrombin), V, VII, IX, and X, and clotting inhibitors, e.g., protein C, Z, and S \[[@B2-biomedicines-08-00069]\]. PCC preparation is a highly complex mixture of proteins and may contain up to 50% of proteins other than FIX \[[@B3-biomedicines-08-00069]\]. Both highly purified FIX and PCC can be used for hemophilia B treatment \[[@B4-biomedicines-08-00069]\]. Also, PCC preparation may be useful for prevention of bleeding due to overdose of oral anticoagulants and liver dysfunctions \[[@B2-biomedicines-08-00069],[@B3-biomedicines-08-00069]\].
As it is with all plasma-derived products, the viral safety of FIX-rich PCC is a critical issue \[[@B5-biomedicines-08-00069]\]. According to current regulations, at least two orthogonal virus clearance steps must be implemented to ensure viral safety of the final product \[[@B6-biomedicines-08-00069]\]. The steps to mitigate virus contamination of FIX and PCC products include donor screening for known blood-borne viruses, i.e., HIV 1--2, HBV, HCV, HAV, and parvo B19; virus inactivation, such as solvent/detergent, mixed chemical inactivation (tri-n-butyl phosphate) and detergent (nonionic, polysorbate, and polyethylene oxide) treatment; and incubating intermediate product in controlled temperature (usually 6 h at 25 °C) \[[@B3-biomedicines-08-00069],[@B7-biomedicines-08-00069],[@B8-biomedicines-08-00069]\]. Dry heat treatment may also be used after lyophilization, e.g., 100 °C for 1 h or 80 °C for 72 h. In the past, steam treatment at 60 °C (190 mbar) for 10 h or 80 °C (375 mbar) for 1 h was reported \[[@B3-biomedicines-08-00069],[@B7-biomedicines-08-00069],[@B8-biomedicines-08-00069]\]. Presently, virus removal nanofiltration has become widely used as a robust and reliable method for ensuring viral safety. Nanofiltration is attractive because it is capable of physically removing all types of viruses from protein solution as opposed to virus inactivation. Several authors have described the application of virus removal nanofiltration for FIX industrial products using Planova 15/20/35N \[[@B9-biomedicines-08-00069],[@B10-biomedicines-08-00069],[@B11-biomedicines-08-00069],[@B12-biomedicines-08-00069],[@B13-biomedicines-08-00069],[@B14-biomedicines-08-00069],[@B15-biomedicines-08-00069]\], Viresolve NFP \[[@B11-biomedicines-08-00069],[@B16-biomedicines-08-00069],[@B17-biomedicines-08-00069],[@B18-biomedicines-08-00069],[@B19-biomedicines-08-00069]\], and Ultipor DV50 filters \[[@B2-biomedicines-08-00069]\]. The conclusion of these studies is that filtration of plasma-derived FIX-rich products is challenging due to the presence of large molecular weight impurities and protein aggregates.
It is known that the levels of different impurities are highly dependent on the type of chromatographic separation that was used during plasma treatment \[[@B3-biomedicines-08-00069],[@B18-biomedicines-08-00069],[@B20-biomedicines-08-00069]\]. The most extensively described impurities in vitamin K-dependent clotting factors include inter-α-trypsin-inhibitor (ITI), complement 4b binding protein (C4BP), and vitronectin (VN). C4BP is a large glycoprotein of 570 kDa \[[@B21-biomedicines-08-00069]\] in the shape of an octopus that consists of seven α-chains connected to a single β-chain by disulfide bonds \[[@B22-biomedicines-08-00069],[@B23-biomedicines-08-00069],[@B24-biomedicines-08-00069]\]. The α-chains are responsible for binding C4b, while the β-chain has high-affinity for VN (protein S), forming large complexes \[[@B22-biomedicines-08-00069],[@B25-biomedicines-08-00069]\]. The molecular conformation of C4BP is highly dependent on the surrounding medium composition \[[@B11-biomedicines-08-00069],[@B19-biomedicines-08-00069]\]. In the charged state the α-chains repel each other, thereby occupying much larger volume than the same molecule in the uncharged state. In its open structure form, C4BP would have a diameter of approximately 66 nm since each α-chain arm is 33 nm long \[[@B11-biomedicines-08-00069],[@B22-biomedicines-08-00069]\]. Varying salt concentrations have been shown to affect the compactness of C4BP molecule and thereby the flux properties of the virus removal filter \[[@B19-biomedicines-08-00069]\]. Another large Mw impurity present often in FIX products is ITI. ITI (225 kDa) is a large complex that consists of one light and several heavy chains (H1-H3) covalently linked by a chondroitin sulfate chain. The heavy chains of ITI proteins function as hyaluronic acid (HA) binding proteins, whereas the light chain, also called bikunin, functions as a serine protease inhibitor upon activation \[[@B26-biomedicines-08-00069]\]. The third extensively described impurity is VN \[[@B27-biomedicines-08-00069]\]. The monomeric form of VN has a cryptic hydrophobic pocket, which upon exposure and conformational changes exhibits heparin- and C5b-7 binding activity \[[@B28-biomedicines-08-00069]\]. Normally, only 2% of VN in plasma shows heparin-binding activity but its fraction increases manifold during coagulation \[[@B29-biomedicines-08-00069]\]. VN also presents a free thiol group capable of disulfide bonding \[[@B30-biomedicines-08-00069]\]. When unfolded VN is highly prone to polymerization and may form aggregates with Mw up to 1000 kDa \[[@B28-biomedicines-08-00069]\]. Studies on nanofiltration of FIX products where VN aggregates were detectable confirmed its role as a filter foulant \[[@B27-biomedicines-08-00069]\]. Extensive coverage of various impurities at different intermediate stages during FIX manufacturing is discussed elsewhere \[[@B15-biomedicines-08-00069],[@B18-biomedicines-08-00069]\].
So far successful virus removal filtration of FIX products has been described in the literature only for a limited number of commercial filters. A novel type of virus removal filter paper was developed at Uppsala University, which is produced by adapting traditional paper making technology and consists of 100% cellulose nanofibers \[[@B31-biomedicines-08-00069],[@B32-biomedicines-08-00069]\]. The pore size and flux properties of the filter paper can be controlled, which opens new opportunities to model fundamental aspects of bioprocessing \[[@B32-biomedicines-08-00069],[@B33-biomedicines-08-00069],[@B34-biomedicines-08-00069]\]. The filter paper was previously validated in numerous studies to remove several large and small-size model viruses, including retroviruses (xMuLV, 100 nm) \[[@B35-biomedicines-08-00069]\], parvoviruses (MVM, 20 nm) \[[@B32-biomedicines-08-00069],[@B36-biomedicines-08-00069]\], and model phages (ΦX174, 28 nm) \[[@B37-biomedicines-08-00069],[@B38-biomedicines-08-00069],[@B39-biomedicines-08-00069]\]. Recently, it was shown that this nanocellulose-based virus removal filter paper is useful for bioprocessing human plasma-derived IgG \[[@B40-biomedicines-08-00069]\].
In this article, for the first time the filtration of FIX-rich PCC using a nanocellulose-based virus removal filter paper is described. Furthermore, a two-step size-exclusion nanofiltration process is developed to remove foulants and ensure efficient | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Silage is one of the most common feedstuff for ruminants in Europe. In 2015, the area of land harvested in Poland for this purpose exceeded 500.000 ha, and is still increasing each year (Central Statistical Office of Poland [@CR7]). Silage is mostly composed of maize, grass, clover, sugar beet tops, alfalfa and milo (Storm et al. [@CR40]). The ensiling process allows for preservation of fodder for livestock for longer periods of time, without degradation, and with minimum loss of nutrients (Tangni et al. [@CR42]). It enables its use as forage during the periods of feed scarcity (Alonso et al. [@CR3]).
However, silage can become contaminated with toxigenic fungi, either pre-harvest (e.g. *Alternaria* spp. and *Fusarium* spp.), post-harvest (e.g. *Penicillium* spp.) (Rasmussen et al. [@CR34]) or at both times (e.g. *Aspergillus* spp*.*). The occurrence of these fungal contaminants depends on many factors, such as climate, storage conditions and agricultural practice (Storm et al. [@CR40]). Under specific conditions, growth of toxigenic moulds can result in the production of mycotoxins. The intake of these secondary metabolites can exert several adverse effects on livestock animals (Scudamore and Livesey [@CR38]). Therefore, the occurrence of mycotoxins in livestock animals is one of the most serious health threats in agriculture. Moreover, production of feedstuff without any mycotoxins is very difficult (Wambacq et al. [@CR44]).
Hundreds of mycotoxins are known of (Berthiller et al. [@CR4]), but European Union regulation on feed has so far been established only for aflatoxins (AFB~1~, AFB~2~, AFG~1~, AFG~2~) by Directive 32/2002 (European Communities [@CR23]), additional "guidance values" have been published by the European Commission for several other compounds, namely deoxynivalenol (DON), fumonisins (FB~1~, FB~2~), ochratoxin A (OTA), zearalenone (ZEN) (European Commission [@CR20]) and for T-2 and HT-2 toxins (European Commission [@CR22]). Because there are no specific regulations on mycotoxins in silage (e.g. grass silage, only for maize-based product guidance value is available), currently recommended levels for animal feed could also be considered as guidelines for silage (Cheli et al. [@CR8]). Regarding to DON and ZEN is recommended not to exceed 12 mg/kg and 3 mg/kg, respectively.
In recent years, researchers have additionally paid more attention to the presence of "emerging mycotoxins" in food and feed, especially for the enniatins (ENNs) and beauvericin (BEA). Data on the toxicity and occurrence of emerging mycotoxins are limited, and further investigation of these compounds is needed for a proper risk assessment. Nevertheless, there have been some studies describing their potential implications for food safety (EFSA [@CR16]). Based on recent scientific opinion of European Food Safety Authority (EFSA), some "opinion" papers about the risk to human and animal health to the presence of regulated, modified and emerging mycotoxins have been published (EFSA [@CR13], [@CR14], [@CR15], [@CR17], [@CR18], [@CR19]).
The determination of mycotoxins in silage is also an analytical challenge. Silage has a complex matrix that contains many compounds, such as organic acids, sugars, chlorophyll and others, that are difficult to remove using sample extract preparation (Rasmussen et al. [@CR34]). Hence, it is necessary to develop a suitable method of analysis for mycotoxins in silage. Altogether, several multi-analyte methods for the simultaneous determination of mycotoxins in silage do exist, and have been described in the literature so far, mostly based on liquid chromatography with tandem mass spectrometry (LC-MS/MS). This core technique can provide the highest sensitivity and specificity, enabling detection of low levels of mycotoxins in various samples and reducing the number of sample preparation steps and analysis time (Wang et al. [@CR45]).
Until now, most researchers paid attention on mycotoxins occurrence in grains, cereals (Monbailu et al. [@CR32]; Schenzel et al. [@CR36]; Kovalsky et al. [@CR29]; Abdallah et al. [@CR1]) and maize silage (Dagnac et al. [@CR9]; Gallo et al. [@CR24]; Grajewski et al. [@CR26]; Kosicki et al. [@CR28]; Storm et al. [@CR41]; Zachariasova et al. [@CR46]). Only few studies on the occurrence of mycotoxins in grass silage have been published (Driehuis et al. [@CR10]; McElhinney et al. [@CR31]). In the aforementioned studies, the research was focused mainly on regulated mycotoxins, with *Fusarium* toxins the most frequently detected compounds. Data on emerging toxins are scarce, and further surveys are needed for a proper risk assessment. Therefore, the aim of this study was to assess the contamination levels of silage in Poland, and to study possible correlations between different toxins.
Materials and methods {#Sec2}
=====================
Chemicals and reagents {#Sec3}
----------------------
Acetonitrile (ACN, analytical grade), methanol (MeOH, LC-MS grade), acetic acid and C18 bulk sorbent were purchased from J.T. Baker of Avantor Performance Materials (Netherlands). Formic acid and ammonium acetate (LC/MS grade) were supplied by Sigma-Aldrich (Germany). Magnesium sulphate was obtained from Chempur (Poland). Water was purified by a Milli-Q apparatus (USA).
Standard solutions {#Sec4}
------------------
From Sigma-Aldrich (Germany), the standards were obtained for AFB~1~, AFB~2~, AFG~1~, AFG~2~, 3-acetyldeoxynivalenol (3-AcDON), 15-acetyldeoxynivalenol (15-AcDON), citrinin (CIT), beauvericin (BEA), diacetoxyscirpenol (DAS), DON, enniatins A (ENN A), A~1~ (ENN A~1~), B (ENN B), B~1~ (ENN B~1~), FB~1~ and FB~2~, fusarenon X (FUS-X), nivalenol (NIV), OTA, sterigmatocystin (STC), HT-2, T-2, ZEN and β-zearalenol (β-ZEL). All standards were stored according to their manufacturer's recommendations. Primary standard stock solutions were prepared: in acetonitrile for 3-AcDON, 15-AcDON, DON, FUS-X, HT-2, STC, T-2 and ZEN; in methanol for AFs, ENNs, NIV, OTA and β-ZEL and in 50% solution of ACN in H~2~O for FB~1~ and FB~2~. The stock solutions were used to prepare working standard solutions containing the 24 analytes in concentrations corresponding to the lowest regulatory levels or guidance levels (GL) in feedstuffs (Supplementary Table [S2](#MOESM1){ref-type="media"}).
Samples {#Sec5}
-------
One hundred twenty visibly mould-free samples of silage, consisting of maize (87) and grass (33), were collected from 16 provinces (voivodeships) of Poland, with eight samples coming from each region (Fig. [1](#Fig1){ref-type="fig"}). Samples were collected between July and December of 2015 by the Veterinary Inspection officers working with feed manufacturers. The types of silage sampled were representative of the different regions of Poland, and were taken in compliance with European regulations (European Commission [@CR21]), as part of a national monitoring programme. The samples, weighing about 5 kg each, were divided separately into 1-kg subsamples, frozen and chopped (grass). Silage was homogenised (using a Waring Blender 8010EB, USA), and stored in the dark at − 20 °C until the date of analysis.Fig. 1Map of Poland illustrating localization of surveyed samples
Sample preparation {#Sec6}
------------------
The protocol for sample preparation was adapted from a previous study (Jedziniak et al. [@CR27]), with some modifications. Five grams of sample was placed into a glass tube and extracted using a 20 ml of mixture consisting of acetonitrile:water:formic acid (79:20:1, *v*/*v*/*v*), with a homogeniser (Polytron PT 3000, Switzerland) for 2 min (2240 × g). The sample was then put into storage for 12 h at 4 °C. Subsequently, the whole sample was put into a 50-ml polypropylene tube and shaken vertically (200 cycles/min) for 30 min. The sample was centrifuged (2643 × g, 15 min), and 2 ml of supernatant was transferred to a plastic test tube containing MgSO~4~ (150 mg) and | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Ulcerative colitis (UC) a chronic intestinal tract inflammatory disorder that is a type of inflammatory bowel disease (IBD) \[[@b1-medscimonit-26-e919530],[@b2-medscimonit-26-e919530]\]. UC usually causes bloody diarrhea, abdominal pain, and extraintestinal manifestations \[[@b3-medscimonit-26-e919530],[@b4-medscimonit-26-e919530]\]. According to data of the Fifth International Meeting on inflammatory bowel diseases, about 0.4% of people in the United States and 0.5% of people in Canada have IBD \[[@b5-medscimonit-26-e919530]\]. Moreover, the incidence of UC has increased during the past 20 years \[[@b6-medscimonit-26-e919530]\]. However, despite numerous studies on UC, the underlying mechanisms are still unclear.
Nod-like receptor protein 3 (NLRP3) is a newly-found inflammation-related factor, which is involved in inflammatory response of many diseases \[[@b7-medscimonit-26-e919530]\]. It was reported that NLRP3 promoted angiogenesis in early stages of wound healing \[[@b8-medscimonit-26-e919530]\]. A recent study also showed the inhibition of NLRP3 could protect against peritonitis \[[@b9-medscimonit-26-e919530]\]. Studies showed high-mobility group box 1 protein (HMGB1) could promote the activation of severe NLRP3 bioprocesses \[[@b10-medscimonit-26-e919530]\]. Several studies also found NLRP3 and HMGB1 were abnormally expressed in IBD, and it was found that fecal HMGB1 was elevated in patients with UC and Crohn's disease \[[@b11-medscimonit-26-e919530]\]. NLRP3 was also found to be increased in a mouse UC model \[[@b12-medscimonit-26-e919530]\].
However, despite these studies, clinical evidence for NLRP3 and HMGB1 is still inadequate and few studies have reported on the relationship between NLRP3 and HMGB1 in UC patients. In the present study, we demonstrated that both serum NLRP3 and HMGB1 were elevated in UC patients. The serum levels of NLRP3 were positively correlated with serum levels of HMGB1, ET-1, IL-1β, and TNF-α, as well as severity of UC patients. This research might give more clinical evidence for NLRP3 and HMGB1 in UC and might provide potential new biomarkers for UC diagnosis.
Material and Methods
====================
Patients
--------
This prospective observational study included a total of 62 cases with active ulcerative colitis who came to our hospital during January 2017 to December 2018. All patients who met the inclusion criteria were consecutively enrolled into the research. The diagnosis of ulcerative colitis was confirmed by colonoscopy according to the standards of the Digestive Society of the Chinese Medical Association and British Society of Gastroenterology \[[@b13-medscimonit-26-e919530],[@b14-medscimonit-26-e919530]\]. None of the patients had received any related treatment before the study. The patients were divided into a mild/moderate group or a severe group according to Sutherland Disease Activity Index (DAI) score, in which 3\~5 represents mild, 6\~10 represents moderate, and 11\~12 represents severe UC DAI \[[@b15-medscimonit-26-e919530]\]. The following patients were excluded: patients \<18 years or \>70 years; patients with other severe intestinal disease such as Crohn's disease, local stenosis, intestinal obstruction, intestinal perforation, rectal polyps, toxic colonic dilatation, and colorectal cancer; patients with other severe liver, renal, cardiovascular, or inflammatory diseases; and patient who were pregnant. All patients received standard treatment according to the Chinese Medical Association after diagnosis. Written informed consent was obtained from all patients. The present study was approved by HwaMei Hospital, University of the Chinese Academy of Sciences.
Clinical activity index and endoscopic index
--------------------------------------------
The clinical activity index and endoscopic index were measured to determine the severity of patients \[[@b16-medscimonit-26-e919530]\]. The clinical activity index was recorded for the first week after admission, and the endoscopic index was recorded at colonoscopy.
Measurement of serum inflammatory factors
-----------------------------------------
Serum levels of inflammatory factors NLRP3 (kit: NLRP3 ELISA kit, LifeSpan Biosciences, LS-F31954), HMGB1 (kit: HMGB1 ELISA kit, LifeSpan Biosciences, LS-F26519), endothelin-1 (ET-1, kit: ET-1 ELISA kit, R&D Systems, QET00B), IL-1β (kit: IL-1β ELISA kit, Abcam, ab46052), and TNF-α (kit: IL-1β ELISA kit, Abcam, ab181421) were determined by enzyme-linked immunosorbent assay (ELISA) using commercial kits according to the manufacturer's instructions.
Statistical analysis
--------------------
Measurement data are expressed as mean±SD. Comparison between 2 groups was performed using the *t* test. Correlations were analyzed using Pearson's analysis. P\<0.05 was considered as statistically significant. All calculations were made using SPSS 20.0.
Results
=======
Basic characteristics for mild/moderate and severe UC patients
--------------------------------------------------------------
In all patients, 41 cases were diagnosed as mild/moderate UC and 21 cases were diagnosed as severe UC. The mean age of all patients was 40.68±13.72, with a male: female sex ratio of 37: 25. The Sutherland DAI score, clinical activity index, and endoscopic index were all significantly higher in severe patients than in the mild/moderate group ([Table 1](#t1-medscimonit-26-e919530){ref-type="table"}, P\<0.05). No significant difference was found in age of sex.
Relationship between serum NLRP3, HMGB1, and other inflammatory factors
-----------------------------------------------------------------------
Serum levels of NLRP3, HMGB1, endothelin-1, IL-1β, and TNF-α were determined by ELISA. Results showed all factors were significantly higher in severe UC patients (P\<0.05, [Figure 1](#f1-medscimonit-26-e919530){ref-type="fig"}). Pearson's analysis was used to determine the correlation among factors. It was found NLRP3 level was positively correlated with HMGB1, ET-1, IL-1β, and TNF-α levels (all P\<0.05). Similar results were also found for HMGB1.
Relationship between serum NLRP3, HMGB1, and clinical outcomes
--------------------------------------------------------------
We used Pearson's analysis to assess whether serum levels of NLRP3 and HMGB1 were correlated with Sutherland DAI score, clinical activity index, and endoscopic index. As shown in [Figure 2](#f2-medscimonit-26-e919530){ref-type="fig"}, both NLRP3 and HMGB1 were positively correlated with Sutherland DAI score, clinical activity index, and endoscopic index, indicating both factors were positively correlated with UC severity.
Discussion
==========
Although there have been numerous studies on ulcerative colitis, the diagnosis of UC still needs more effective biomarkers, and the molecular mechanisms of UC remain unclear. In recent years, the NLRP3/HMGB1 axis was shown to be involved in inflammatory response in many diseases. Some studies also found NLRP3 and HMGB1 might be associated with UC \[[@b11-medscimonit-26-e919530],[@b12-medscimonit-26-e919530]\]. However, the relationship between NLRP3 and HMGB1 in UC patients has seldom been reported, and the clinical significance of NLRP3 and HMGB1 is unclear. In the present study, we further confirmed that serum levels of BLRP3 and HMGB1 were upregulated in UC patients. We found a positive correlation between NLRP3 and HMGB1, as well as between NLRP3/HMGB1 and other inflammatory factors of ET-1, IL-1β, and TNF-α. We also found NLRP3 and HMGB1 were associated with severity of UC.
NLRP3 was reported to be associated with inflammatory response in many studies. Coll et al. found a kind of NLRP3 inhibitor, MCC950, and demonstrated that inhibition of NLRP3 by MCC950 could significantly improve autoinflammatory and autoimmune diseases and reduced IL-1β level \[[@b17-medscimonit-26-e919530]\]. Wu et al. demonstrated that NLRP3 was elevated in a lung inflammation model and that activation of NLRP3 contributed to lung inflammation-induced injury \[[@b18-medscimonit-26-e919530]\]. A relationship has also been reported between NLRP3 and ulcerative colitis. Itani et al. demonstrated that NLRP3 level in colon tissues of IBD patients was correlated with histological scores \[[@b12-medscimonit-26-e919530]\]. It was also found the NLRP3 inflammasome was activated in UC patients with long-standing disease \[[@b19-medscimonit-26-e919530]\]. However, the clinical evidence for NLRP3 in UC is still inadequate. In the present research, we demonstrated that the elevated NLRP3 level was positively correlated with levels of HMGB1, ET-1, IL-1β, and TNF-α, as well as UC severity.
The role of HMGB1 and its relationship with NLRP3 in inflammation have also been demonstrated. Ana et al | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-molecules-24-04165}
===============
Natural products play the central role in drug discovery \[[@B1-molecules-24-04165]\] due to their inherent biological activity and because have a wide span of structural diversity. Spirocyclic compounds have also occupied a special place in medicinal chemistry \[[@B2-molecules-24-04165]\]. Spirocycles are thought to possess a good balance of conformational rigidity and flexibility to be, on one hand, free from absorption and permeability issues characteristic of conformationally more flexible, linear scaffolds. On the other hand, spirocycles are more conformationally flexible compared to, for example, flat aromatic heterocycles and can adapt to many proteins as biological targets; thus, increasing the chances of finding bioactive hits \[[@B3-molecules-24-04165]\]. Spirocycles are distinctly three-dimensional and initial hits can be further optimized via manipulation of the molecular periphery whose three-dimensional positioning is well defined \[[@B4-molecules-24-04165]\]. We thought it worthwhile to gain insight into the structural diversity of naturally-occurring spirocyclic compounds in relation to the information of their biological activity which would provide a new angle for designing novel bioactive, druglike compounds. Modern literature features a limited number of reviews devoted to total syntheses of spirocyclic natural products \[[@B5-molecules-24-04165]\], including one for spirolactones \[[@B6-molecules-24-04165]\] and one for spirooxyindoles \[[@B7-molecules-24-04165]\]. Illustrative examples of approved natural-product drugs containing a spirocyclic motif include antifungal drug griseofulvin (**1**) and diuretic drug spironolactone (**2**). Interesting related compounds that have not achieved clinical approval include isochromanquinone antibiotic griseusin B (**3**) \[[@B8-molecules-24-04165],[@B9-molecules-24-04165]\] and spirotriprostatin (**4**) \[[@B10-molecules-24-04165]\] ([Figure 1](#molecules-24-04165-f001){ref-type="fig"}).
For the purpose of the analysis presented in this review, we considered the chemical diversity of structurally unique and well characterized (i.e., those whose structures were assigned using modern analytical techniques) spirocyclic compounds registered in the ChemBL or SciFinder databases, or the Dictionary of Natural Products (DNP). The occurrence of various ring combinations (A = any atom, mostly carbon or oxygen) selected for discussion in this review is presented in [Table 1](#molecules-24-04165-t001){ref-type="table"}.
Considering the uneven distribution of the ring combination occurrence statistics ([Table 1](#molecules-24-04165-t001){ref-type="table"}), the present review is structured according to the size of the \[x.y.0\] spirocyclic system. The review aims to cover either rare representatives of the spirocyclic systems that seldom occur in the natural product realm or only structurally-unique, representative compounds for those spirocyclic systems that are more widely populated with natural products reported in the literature, with an emphasis on their associated biological activities and the solid structure assignment techniques employed (structures assigned solely based on mass-spectrometric measurements are not taken into account).
2. \[2.4.0\] Spirocyclic System {#sec2-molecules-24-04165}
===============================
Spirocyclic motifs containing a cyclopropane unit were found in some sesquiterpenes (**5**--**7**) which were isolated from the essential oils of South-American *Schinus terebinthifolius* fruit \[[@B11-molecules-24-04165]\] ([Figure 2](#molecules-24-04165-f002){ref-type="fig"}).
In 2017, a novel condensed \[2.4.0\] spirocycle (**8**) was reported \[[@B12-molecules-24-04165]\]. It was isolated and characterized among the secondary metabolites of the *Helminthosporium velutinum* plant and was named cyclohelminthol X ([Figure 3](#molecules-24-04165-f003){ref-type="fig"}). This compound was shown to inhibit the growth of a human colon adenocarcinoma (COLO201) cell line with moderate potency (IC~50~ = 16 μM), and, much more potently (IC50 = 0.35 μM)---leukemia HL60 cell line \[[@B12-molecules-24-04165]\].
Bioassay-guided separation of *Valerianae Radix* plant extract led to the isolation and characterization of valtrate (**9**), which inhibited Rev protein mediated transport of HIV-1 from the nucleus to cytoplasm ([Figure 4](#molecules-24-04165-f004){ref-type="fig"}). This compound also inhibited p-24 production of HIV-1 virus without any notable cytotoxicity displayed against MT-4 cells. The presence of the chemically labile oxirane ring as part of the generalized \[2.4.0\] spirocyclic system is likely critical for the observed inhibition, as **9** was shown to covalently interact with cysteine \[[@B13-molecules-24-04165]\].
Additional two compounds (**31** and **32**) containing this and another (\[4.4.0\]) spirocyclic system are discussed in [Section 7](#sec7-molecules-24-04165){ref-type="sec"} of this review.
3. \[2.5.0\] Spirocyclic System {#sec3-molecules-24-04165}
===============================
This group of spirocyclic natural products is represented by sesquiterpenoids illudins M and S (**10** and **11**, respectively) isolated from fungi, including the highly poisonous Jack-o′-lantern mushroom *Omphalotus illudens*. Compound **11** is currently in Phase II clinical trials against ovarian, prostate, and gastrointestinal cancers ([Figure 5](#molecules-24-04165-f005){ref-type="fig"}).
Structurally analogous to illudins are sesquiterpenes **12**--**14** isolated from fungus *Agrocybe aegerita* \[[@B14-molecules-24-04165]\] also containing a \[2.5.0\] spirocyclic system ([Figure 6](#molecules-24-04165-f006){ref-type="fig"}). These compounds displayed antifungal activity against *Candida albicans* and *Candida kefyr*.
An oxirane-bearing sesquiterpene (−)-ovalicin (**15**) also containing a \[2.5.0\] spirocyclic system was isolated from fungus *Pseudorotium ovalis Stolk* \[[@B15-molecules-24-04165]\]. It---and the structurally similar monoester fumagillin (**16**) displayed potent antiparasitic activities and are generally devoid of toxicity \[[@B16-molecules-24-04165]\] ([Figure 7](#molecules-24-04165-f007){ref-type="fig"}). For both compounds **15** and **16**, total syntheses have been reported \[[@B17-molecules-24-04165]\].
A \[2.5.0\] spirocyclic system is recognizable in the structure of duocarmycin SA (**17**) and duocarmycin A (**18**)---new antitumor antibiotics isolated from *streptomyces* sp. ([Figure 8](#molecules-24-04165-f008){ref-type="fig"}) \[[@B18-molecules-24-04165]\].
4. \[3.4.0\] Spirocyclic System {#sec4-molecules-24-04165}
===============================
This is an exceedingly rare type of spirocyclic motif encountered among natural products. The only compound reported in the literature to date containing such a spirocyclic system presented as a combination of a β-lactone and a pyrrolidine ring (**19**) was isolated from marine-derived *Streptomyces* strain collected in the southern area of the Korean Jeju Island \[[@B19-molecules-24-04165]\] ([Figure 9](#molecules-24-04165-f009){ref-type="fig"}). This structurally intriguing compound displayed antibacterial activity.
5. \[3.5.0\] Spirocyclic System {#sec5-molecules-24-04165}
===============================
The only spirocyclic combination of a four and six-membered rings represented in natural products is rather simple achiral 1-oxaspiro\[3.5\]nonan-7-ol substituted cleroindicin A (**20**) \[[@B20-molecules-24-04165]\]. This compound was isolated from fungus *Clerodendrum japonicum* ([Figure 10](#molecules-24-04165-f010){ref-type="fig"}).
6. \[3.7.0\] Spirocyclic System {#sec6-molecules-24-04165}
===============================
This intriguing spirocyclic combination of four and eight-membered rings is represented in only four closely-related sesquiterpene bis-lactones, **21**--**24** ([Figure 11](#molecules-24-04165-f011){ref-type="fig"}), isolated from poisonous plants in the *Illicium* genus grown in China \[[@B21-molecules-24-04165]\]. These structures could also be viewed as possessing a \[3.5.0\] spirocyclic motif.
7. \[4.4.0\] Spirocyclic System {#sec7-molecules-24-04 | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
There is a paucity of information concerning side-by-side comparison of real-time 3D echocardiography (RT3DE) and cardiac computed tomography (CCT) ventricular systolic performance assessment. We sought to compare those techniques with different temporal and spatial resolution, regarding left ventricle (LV) systolic function and volumes.
Methods
=======
We studied 67 consecutive patients (37 males, 55 ± 11 years) by RT3DE and by 64-slice CCT. We analysed by both techniques the LVEF, LVEDV and LVESV, and by RT3DE the LV dyssynchrony percentage indexes (DI%) (6, 12, 16 segment model). RT3DE and CCT data were compared by coefficients of determination (*r*: Pearson), Bland-Altman test and linear regression, 95% CI.
Results
=======
RT3DE data: LVEF ranged from 30 to 78.6 (63.1 ± 7.33)%; LVEDV ranged from 44.1 to 210 (104.9 ± 29.7) ml; LVESV from 11.4 to 149 (38.9 ± 19.3) ml; 6S DI% ranged from 0.25 to 29.7 (1.92 ± 4.67)%; 12S DI% ranged from 0.29 to 26.78 (2.10 ± 5.10)%; 16S DI% ranged from 0.29 to 27.81 (2.57 ± 4.37)%. CCT data: LVEF ranged from 28 to 86 (66 ± 8.4)%; LVEDV ranged from 51 to 212 (110.3 ± 31.2) ml; LVESV from 7 to 152 (38.2 ± 19.2) ml. Correlations relative to RT3DE and CCT were: LVEF (*r*= 0.74, *P*\< 0.0001, 95% CI = 0.6169 to 0.8379); LVEDV (*r*= 0.8213, *P*\< 0.0001, 95% CI = 0.7229 to 0.8870); LVESV (*r*= 0.9096, *P*\< 0.0001, 95% CI = 0.8929 to 0.9627). RT3DE (*x*) LVEF was compared with CCT (*y*) LVEF as: *y =*19.7862 + 0.6525 *x*, *R*^2^= 0.5586, *P*\< 0.0001, coefficient slope = 0.6525; RT3DE (*x*) LVEDV was compared with CCT (*y*) LVEDV as: *y =*15.7057 + 0.7823 *x*, *R*^2^= 0.6745, coefficient slope = 0.7823, *P*\< 0.0001; and RT3DE (*x*) LVESV was compared with CCT (*y*) LVESV as: *y =*2.7997 + 0.9439 *x*, *R*^2^= 0.8828, coefficient slope = 0.9439, *P*\< 0.0001.
Conclusion
==========
In this series, adequate correlation was observed between real-time 3D echocardiography and cardiac computed tomography regarding ventricular systolic function and geometry assessment.
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#S0001}
============
Capillaroscopy is a non-invasive diagnostic technique designed to evaluate small vessels of the microcirculation \[[@CIT0001]\]. Nailfold capillaries were first observed in the 17^th^ century with primitive magnifying equipment, and in the early 19^th^ century the first associations between inflammation and capillary alterations were made. Beginning with the works of Maurice Raynaud\'s \[[@CIT0002]\], research in the second half of the 19^th^ and first decades of the 20^th^ century established a direct link between capillary abnormalities and certain medical conditions. In the 1930s, interest in capillaroscopy began to decline, to rise again in the 1980s and 1990s. With the advent of modern digital equipment and evidence-based methodology, at the beginning of the 21^st^ century, we can witness a renaissance of the capillaroscopic technique and widespread recognition of its significance.
Principles of capillaroscopy {#S0002}
============================
Microcirculation {#S20003}
----------------
The vasculature of the microcirculation consists of the smallest blood vessels in the human body -- arterioles, capillaries and venules. The capillaries, in turn, are formed by an arterial limb, capillary loop and venous limb. This pattern is found in every tissue except liver, spleen and bone marrow, where capillaries are replaced by sinusoids. Microcirculation\'s main function is capillary exchange -- delivery of oxygen and nutrients to tissues and removal of carbon dioxide and waste products \[[@CIT0003]\]. In a systemic disease in which vascular damage is one of the pathogenetic factors, abnormalities in capillary morphology can be observed long before the onset of clinical symptoms. In patients already diagnosed with a systemic disease, damage to the capillaries may reflect the involvement of internal organs and help determine the stage of the disease \[[@CIT0004]\].
Microcirculation in capillaries is routinely evaluated within the skin of the nailfold. The entire skin abounds in capillaries; however, they run perpendicular to the skin surface, and only the tip of the loop is visible. In the nailfold, terminal rows of capillaries run parallel to the skin surface and, therefore, all morphological details and the nature of the blood flow can be examined \[[@CIT0005]\].
Performing capillaroscopy {#S20004}
-------------------------
A range of optical devices can be used to perform capillaroscopic examination, for example a dermatoscope, an ophthalmoscope or a traditional microscope. However, it is best to perform the examination with equipment dedicated for capillaroscopy, i.e. a stereomicroscope or a digital videocapillaroscope. Of these two, the latter is preferred, as a hand-held probe can be easily used in every situation, e.g. for bedside examination or in patients with severe flexion contractures.
In order to enhance skin transparency, a drop of immersion oil is applied to the nailfold before capillaroscopy. In a routine examination, all fingers except the thumbs are evaluated. Each finger should be examined in two magnifications: × 50, showing the general architecture of the terminal capillary row, and × 200--300, in which morphological details of a single capillary can be assessed. Digital equipment allows the obtained images to be stored and used for an objective comparison if the patient needs subsequent examinations \[[@CIT0006]\].
Patient preparation {#S20005}
-------------------
Environmental factors can cause physiological constriction of capillaries, thus greatly affecting the capillaroscopic image. Before the examination, patients should be acclimatised at a temperature of 20--22°C for 15--20 minutes, and should refrain from smoking and drinking caffeine for 4 hours. Capillaroscopy should not be performed if the patient has recently (in the last 3 weeks) undergone any cosmetic procedure involving the nailfold area, since the consequent micro-traumas can give false-positive results \[[@CIT0006]\].
Important capillaroscopic parameters and normal capillary image {#S0006}
===============================================================
There are several parameters which should be evaluated during capillaroscopy ([Table I](#T0001){ref-type="table"}) \[[@CIT0001], [@CIT0007], [@CIT0008]\]. A normal capillaroscopic image of a healthy control is shown in [Figure 1](#F0001){ref-type="fig"}.
{#F0001}
######
Important capillaroscopic parameters
Capillaroscopic parameter Normal image
------------------------------------------------------ -----------------------------------------------------
Skin transparency and visibility Transparent, capillaries clearly visible
Pericapillary oedema Absent
Subpapillary venous plexus Visible in up to 30% of healthy people
Capillary array and architecture Straight capillaries, perpendicular to the nailfold
Capillary morphology U-shaped
Capillary loop diameter \< 20 µm
Tortuosity Usually absent
Dilated (20--50 µm) and giant (\> 50 µm) loops Absent
Ramified capillaries Absent
Neoangiogenesis Absent
Haemorrhages, hemosiderin deposits Usually absent, may be present after local trauma
Capillary density 9--13 in 1 linear millimetre
Avascular areas (distance between 2 loops \> 500 µm) Absent
Capillary blood flow Dynamic, no stasis or thrombosis
Raynaud\'s phenomenon {#S0007}
=====================
The most important indication for capillaroscopy is Raynaud\'s phenomenon (RP) \[[@CIT0008]\]. This condition usually presents in the fingers or toes, more rarely in the nose and ears, and involves a sequence of skin colour changes, attributed to vasospasm and subsequent vessel dilation. These include skin turning white (vasoconstriction), then blue (hypoxia) and finally red (reperfusion). Raynaud\'s phenomenon can be primary (idiopathic) or secondary to numerous conditions. Capillaroscopy plays a pivotal role in differentiating one from another \[[@CIT0009]\].
In primary RP capillaries of the nailfold are normal, with no apparent abnormalities. It should be stressed that diagnosis of the primary condition cannot be based solely on capillaroscopy; it also requires normal levels of acute phase reactants and absence of any other clinical symptoms. It is recommended to perform capillaroscopy every 12--24 months in primary RP, since up to 10% of these patients will develop a connective tissue disease, sometimes after decades.
In RP secondary to non-rheumatic conditions, the capillaroscopic image may be normal or present nonspecific alterations. On the other hand, in connective tissue diseases, especially in scleroderma spectrum disorders, microangiopathy of the peripheral microcirculation is prominent, with the presence of specific patterns that can be attributed to particular diseases \[[@CIT0010]\].
Scleroderma spectrum disorders {#S0008}
==============================
Scleroderma spectrum disorders are a heterogeneous group of connective tissue diseases linked to systemic sclerosis (SSc) and exhibiting characteristic capillaroscopic abnormalities \[[@CIT0011]\]. These include giant capillaries, loss of capillaries with areas of avascularisation, ramified capillaries with pathological neoangiogenesis and severe derangement of capillary architecture. All of these pathologies may be present to a different extent in scleroderma spectrum disorders. In SSc, however, they appear and evolve in a clearly defined sequence called the scleroderma pattern.
Systemic sclerosis {#S0009}
==================
Systemic sclerosis (SSc) is a rare connective tissue disease presenting with diffuse fibrosis and dysfunction of internal organs due to microangiopathy \[[@CIT0012]\]. In well over 95% of SSc patients, peripheral microangiopathy follows a typical scleroderma pattern, consisting of 'early', 'active' and 'late' phases ([Table II](#T0002){ref-type="table"}, [Fig. 2](#F0002){ref-type="fig"}) \[[@CIT0013]\]. Differentiation of these patterns is of great clinical significance, since the 'early' pattern can be detected many years before full clinical manifestation of SSc, and progression to 'active' and 'late' patterns closely corresponds to internal organ involvement \[[@CIT0014]\]. The importance of capillaroscopy is underlined by its inclusion in the current EULAR classification criteria of SSc \[[@CIT0015]\].
{#F0002}
######
Scleroderma pattern \[[@CIT0013]\]
------------------ --------------------------------------------------------
'Early' pattern Preserved capillary architecture\
Few giant capillaries and microhaemorrhages\
No evident capillary loss
'Active' pattern Slight disorganisation of capillary architecture\
Numerous giant capillaries and microhaemorrhages\
Moderate capillary loss\
Few ramified capillaries
'Late' pattern Severe derangement of capillary architecture\
Almost absent giant capillaries and microhaemorrhages\
Significant capillary loss with avascularisation\
Numerous ramified capillaries with neoangiogenesis
------------------ --------------------------------------------------------
Capillaroscopy can be useful in predicting development of finger ulcerations in SSc patients. The capillaroscopic skin ulceration risk index (CSURI) is a tool devised by Sebastiani et al., based on the formula D × M/N^2^ (D -- diameter of the biggest giant loop | {
"pile_set_name": "PubMed Central"
} |
In a unique collaboration between The Seventh Hospital of Hangzhou, the International Society for Traumatic Stress Studies (ISTSS), and the Zhejiang Behavior Medicine Association, the international conference "Posttraumatic stress: state-of-the-art research and clinical implications for China" was organized in Hangzhou, China, on 17--19 October 2014.
The organizational team was led by Dr Zhonglin Tan, a psychiatrist from The Seventh Hospital of Hangzhou, who has spent a year with Professor Olff\'s research team in Amsterdam, The Netherlands. With the support of Dr Zhang, Director of The Seventh Hospital of Hangzhou, and with guidance from Professor Olff, Dr Zhonglin Tan successfully created a full program. Over 300 participants, the majority of them from China, enjoyed one full day in both English and Chinese (with simultaneous translation) and the rest of the meeting in Chinese only.
The renowned board members of ISTSS (Kaysen, Stappenbeck, Rhew, & Simpson, [@CIT0005]; Kim, [@CIT0006]; Kudler, [@CIT0007]; O\'Donnell, [@CIT0008]; Olff et al., [@CIT0009]; Schnyder, [@CIT0012]) and other international experts (Jongedijk, [@CIT0004]; Wu, [@CIT0015]) had volunteered to speak at this first ISTSS conference in China, as part of ISTSS\'s *global meetings program* (see [www.istss.org](http://www.istss.org)). Recognizing that trauma is a global issue (Schnyder, [@CIT0011]), ISTSS is opening doors to parts of the world where, up till now, no ISTSS conferences have been held, being eager to spread knowledge, to collaborate, and to learn from each other, and thus to advance the field of traumatic stress worldwide.
Next to the international speakers, a strong representation of Chinese PTSD experts was seen who gave keynotes on topics ranging from biological stress systems (Bao & Swaab, [@CIT0019]) web-based interventions (Wang, [@CIT0020]; Wang & Mearcker, [@CIT0014]) and post-disaster psychosocial care (Zhang S, [@CIT0017]) to the exciting field of Chinese traditional medicine for PTSD (Zhang Y-H, [@CIT0018]).
Apart from keynote lectures, this collection contains the abstracts of a selection of over 100 submissions, the authors of which were awarded for their excellent contribution to the field with a certificate and abstract publication in the *European Journal of Psychotraumatology* (Cao, Wang, Wang, Qing, & Zhang, [@CIT0001]; Hall, Chen, Wu, Zhou, & Latkin, [@CIT0002]; Hong, Cao, & Efferth, [@CIT0003]; Reifels et al., [@CIT0010]; Teng, Hall, & Li, [@CIT0013]; Xu et al., [@CIT0016]).
Miranda Olff
Editor-in-Chief
Zhonglin Tan
Hangzhou Mental Health Center
Hangzhou Seventh Peoples' Hospital
Hangzhou, People\'s Republic of China
| {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Recent studies have demonstrated that several major nosocomial pathogens are shed by patients and contaminate environmental surfaces at concentrations sufficient for transmission \[[@CR1]--[@CR3]\]. Such pathogens can survive for extended periods despite cleaning with chlorine-releasing disinfectants \[[@CR4], [@CR5]\] and can be transferred to the hands of healthcare workers \[[@CR6]\]. The spread of nosocomial pathogens has been linked to poor hand-hygiene practices. However, healthcare workers are more likely to contaminate their hands from touching the patient environment than from patient contact \[[@CR6]\].
Mounting evidence demonstrates that outbreak strains of methicillin-resistant *Staphylococcus aureus* (MRSA), extensively drug-resistant (XDR) *Acinetobacter baumannii*, *Pseudomonas aeruginosa* and (extended spectrum beta-lactamase)-producing *Enterobacteriaceae* survived significantly longer on environmental surfaces than non-outbreak strains, indicating a possible fitness advantage \[[@CR7]--[@CR13]\].
In healthcare settings, surfaces are usually decontaminated using liquid chemical disinfectants, often chlorine derivatives \[[@CR14]\]. However, these products have some drawbacks, they are usually toxic to humans, they display chemical reactivity, and they require long periods of contact (up to 15 min) with surfaces to kill microorganisms \[[@CR15]\]. Moreover, some nosocomial pathogens are resistant to many disinfectants \[[@CR16]--[@CR18]\].
The development of portable steam generators has made the disinfection of environments more practical \[[@CR19]--[@CR21]\]. The aim of the present study was to assess "in vitro" the ability of the overheated dry-saturated steam vapour system to kill multidrug and XDR nosocomial pathogens on surfaces, and to define the antimicrobial spectrum and the contact times required by this system. Our results were then compared with those obtained using sodium hypochlorite, an agent commonly used in clinical sanitation procedures \[[@CR14], [@CR15]\].
Methods {#Sec2}
=======
Surfaces {#Sec3}
--------
The in vitro tests were carried out in a microbiology laboratory. Glass surfaces were chosen because they are flat, inert, easy to contaminate and highly resistant to chemical products and to heat.
The dimensions of the surfaces were 50 × 50 cm, with a thickness of 30 mm and a weight of 38 kg/m^2^.
Disinfection using the overheated dry-saturated steam vapour system {#Sec4}
-------------------------------------------------------------------
The steam generator device consists of a professional steam generator (Sani System Polti, Medical Division Polti s.p.a., Como, Italy) (Fig. [1](#Fig1){ref-type="fig"}). The dimensions of the unit were 47 × 45 × 90.5 cm, with a weight of 27.5 kg. The portable unit was outfitted with a hose connected to a steam dispenser. The overheated dry-saturated steam vapour was high temperature steam generated in the steel boiler that reached a pressure of 6 bar and was then further superheated in an expansion chamber to generate a dry saturated steam vapour at 180 °C. The unit was filled with tap water. Fifteen minutes before use, the unit was activated to reach the maximum operating boiler pressure (6 bar) in accordance with the manufacturer's instructions (Sani System Polti). Protection equipment, such as heat-resistant gloves, safety aprons or glasses, is not required by workers when operating this system.Fig. 1Overheated dry-saturated steam vapour disinfection device used in this study. (Sani System Polti, Medical Division Polti s.p.a., Como, Italy)
Disinfection with sodium hypochlorite {#Sec5}
-------------------------------------
The commercial product Decs containing sodium hypochlorite at 2.8 % (2.7 % active *chlorine)* (Lombarda H s.r.l, Albairate, Milan, Italy) was used in this study. The stock solution of the product was diluted in sterilised water to a final concentration of 5 % to obtain approximately 1400 ppm active chlorine. This is the concentration of sodium hypochlorite solution usually used for disinfection in hospitals \[[@CR22]\].
Culture methods {#Sec6}
---------------
The bactericidal effects of the overheated dry-saturated steam vapour and of sodium hypochlorite were evaluated using seven environmental organisms, including Gram-positive and Gram-negative bacteria, yeast and fungi: XDR *A. baumannii* (strain 4500/2010), *P. aeruginosa* (strain 3637/2006), MRSA (strain 3582/2006), high-level aminoglycoside-resistant (HLAR) *Enterococcus faecalis* (strain 3084/2005), carbapenemase-producing *Klebsiella pneumoniae* (KPC; strain 4640/2012), *Candida parapsilosis* (strain 4093/2009) and *Aspergillus fumigatus* (strain 3430/2006). These environmental strains were isolated between January 2005 and December 2012 in the neonatal and the adult intensive care units of the University Hospital "Federico II" in Naples, Italy, during environmental microbiological investigations performed to identify sources and reservoirs of infection in the course of nosocomial outbreaks \[[@CR10], [@CR11]\].
Environmental isolates were identified by commercial systems (VITEK^®^ 2 automatic system; bioMèrieux Marcy-L'Etoile, France and Becton--Dickinson Phoenix, Phoenix Technologies Ltd, San Jose, CA, USA). All isolates were stored at −80 °C in glycerol solution.
Susceptibility testing and screening {#Sec7}
------------------------------------
The strains used in our study were selected because of their antimicrobial resistance phenotypes.
Antimicrobial susceptibility patterns were analysed using an automated system (BD Phoenix) and by manual methods (i.e., Kirby-Bauer disk diffusion assay, Etest and microdilution tests) and the results were interpreted according to EUCAST \[[@CR23]\]. Antimicrobial susceptibility testing revealed a multidrug-resistant antibiotype for all of the isolated microorganisms. The antimicrobial susceptibility patterns of strains included in the study are listed in Tables [1](#Tab1){ref-type="table"} and [2](#Tab2){ref-type="table"}.Table 1Antimicrobial susceptibility patterns of the strains tested in this studyAntibioticMIC value*KPC*-*K. pneumoniaeXDR A. baumanniiP. aeruginosaE. faecalis HLARC. parapsilosisA. fumigatus*Amikacin\<4\>32\>32Amoxicillin-clavulanate\>16/8\>16\>32Ampicillin\>16\>32Ampicillin-sulbactam\>16/8Aztreonam\>16Cefazolin\>16\>64Cefepime2Cefotaxime\>16\>32\>64Ceftazidime\>32\>16\>16Ceftriaxone\>32Chloramphenicol16\>16Ciprofloxacin\>2\>2Gentamicin≤2\>8\>8Gentamicin high-level\>2000Imipenem8\>8\>8Levofloxacin≤1\>2\>2Meropenem8\>8\>8Netilmicyn high-level\>2000Nitrofurantoina≤16\>512Norfloxacina≤2Piperacillin\>64\>6416Piperacillin--tazobactam≥64/4≥64/416Streptomycin high-level\>2000Tetracycline\>8\>8Trimethoprim--sulfamethoxazole≤0.5/9.5\>2/385-Flucytosine\>32^a^Fluconazole\>64^a^Itraconazole\>1^a^\>1^a^Anidulafungin\>2^a^\>2^aa^Sensititre YeastoneTable 2Disk diffusion susceptibility test and Etest values of *K. pneumoniae* strain identified as a KPC producerDouble disk test (mm zone diameter)MIC of drug Etest value (mg/L)MEM (10 µg)MEM plus boronic acid (600 µg)MEM/MEM boronic acidInterpretationErtapenemInterpretation1621\>4+\>1+
### In vitro time-kill tests {#Sec8}
The bactericidal effects of the overheated dry-saturated steam vapour and the sodium hypochlorite on multidrug-resistant nosocomial pathogens were assessed by measuring viable cell counts using the quantitative time-kill test \[[@CR24]\] as recommended by the European Committee for Standardization (CEN EN1276) with or without bovine serum albumin (BSA 0.3 g/100 mL) \[[@CR25]\]. The quantitative time-kill test was performed as previously described \[[@CR24]\]. In brief, a logarithmic-phase culture was adjusted to ca. 10^9^ CFU/mL for bacteria and 10^7^ CFU/mL for yeasts and fungi in Luria--Bertani broth. The test was carried out on glass surfaces initially contaminated with 100 μL of microbial suspension, prepared as above, with and without BSA. The surfaces were sanitised with the overheated dry-saturated steam vapour generated at 180 °C at different time points (1, 2, 3 min, up to 8 min). At each time point, the surfaces were rinsed with 1 mL of a sterile physiological | {
"pile_set_name": "PubMed Central"
} |
Problem
=======
Quality and concise handover between clinicians is essential for patient safety \[[@R1]\]. At this time of increased risk during the patient\'s pathway the handover sheet is an important adjunct helping to reduce this risk \[[@R2]\]. The handover sheet within elective orthopaedic ward care takes on a variety of formats, with Microsoft (MS) Word or Excel being utilised frequently. These are susceptible to the erroneous deletion of data and on occasions the complete document. The change of team to which the patient is allocated within the speciality can also lead to data loss when being deleted from one list and added to another. Documents are rarely automated, requiring time to be spent ordering the patients by location and formatting the document. Following the amalgamation of two services into a large, new hospital it was recognised that a complete solution was required for the day to day management and handover of elective patients.
Background
==========
The GMC\'s Good Medical Practice states that doctors should share all relevant information with colleagues involved in their patients' care within and outside the team, including when they hand over care and go off duty \[[@R3]\]. Poor handover leaves on-call weekend doctors with busier shifts, a more stressful time prioritising patients and tasks whilst "fire-fighting" the new issues as they arise \[[@R4]\]. Clear patient handovers with concise and necessary information only lead to time-efficient, safer ward rounds. The handover sheet allows a snap shot to the patient\'s problems, the ongoing plan, outstanding jobs, and other relevant information. Keeping them up to date can be time consuming and this normally falls to the junior doctors to undertake. Their importance is evident within the current rules for working hours where most juniors rarely work a "normal" week, which leads to increased frequency of handovers \[[@R2]\]. They are also crucial when changing from the well staffed week-day rota to the weekend on-call team who have not met all of the patients. At this time the handover list and the information contained within is relied upon heavily \[[@R5]\].
As afore mentioned, IT is recognised as being an important part of patient handover, providing uniformity, continuity and an audit trail \[[@R6],[@R7]\].
Baseline measurement
====================
Research was conducted within the orthopaedic junior doctors cadre to establish any concerns as to the current documents being used to conduct patient handover (MS Word). A questionnaire was distributed among the doctors (Pre-intervention questionnaire). Replies were completed by 6 doctors.
Options on the questionnaire - dependant on question type - see pre-intervention questionnaire for further details.
ALWAYS / MOSTLY / RARELY / NEVER
0-2 / 3-4 / 5-6 / 7-8 / 9-10
The questionnaire demonstrated the following results (Median):
1. Handover lists were readily accessible - MOSTLY
2. Handover lists were regularly updated by the SHO covering those patients - MOSTLY
3. Handover lists were automatically arranged into sensible layouts - NEVER
4. Patient data was lost when patients were transferred from one list to another - 3-4 TIMES
5. Patients were dropped off patient lists accidentally - 5-6 TIMES
6. These patients were dropped off these lists predominantly at the WEEKEND
7. Handover sheets allowed time efficiency at the weekend - RARELY
Comments from freehand notes:
Only 1 person on each team could access the list at once
Messy spreadsheet rarely contained ward locations
There was a lack of continuity as to the layout of handover sheets between the four teams
Patients who switched team due to changing consultant had been taken off a list and not added to another resulting in them not being reviewed/managed correctly
See supplementary file: ds4728.docx - "Pre-intervention questionnaire"
Design
======
It was deduced that the solution for this issue was within a bespoke computer interface. The author had reasonable experience with MS Access and its functions, and chose to create a system that could be implemented and serviced without the hospital IT department\'s assistance.
A table was created within MS Access, on which the data was to be stored, this was to be the "foundations" of the database with the information it held being interrogated/updated indirectly by users.
Queries that could sort and display relevant data according to criteria were created to subdivide by Consultant and therefore into the four teams that made up the department.
A form was created to allow the information from the table, selected by a query, to be accessed by the teams and edited as required. Specific functions were embedded within these forms, allowing new patients to be added and patients to be discharged (a two stage process preventing accidental deletion). Movement between team lists was enabled using similar function enabled buttons.
Reports were created allowing team lists to be generated from information within the relevant form at the click of a button, this could then be printed. The patients on the list were ordered by ward and then by surname alphabetically. A weekend report was also available which allowed patient lists to be printed by ward. This enabled better time efficiency during an already busy shift avoiding checking of multiple lists. Reports were automatically headed with the date and had a list of useful telephone numbers within the footnote.
Finally the robustness of the Database was ensured, with a "Save and Close" button with a number of background functions running. It saved the document followed by closing the document. Each time the Database was closed it would save a copy of the background Table as an Excel spreadsheet to an archive folder allowing teams to check back through lists at a later date.
Strategy
========
PDSA cycle 1
The Pre-implementation questionnaire was produced and handed out to members of the team. This allowed for an assessment of the current state of patients lists and their uses and downfalls, enabling a set of criteria on which to improve. These criteria also formed that basis upon which the new database was subsequently built.
PDSA cycle 2
\- Following feedback from the questionnaire and initial demonstration/teaching session a number of ideas had been put forward:
\- Multi-user functionality was poor and needed improving.
\- A couple of program issues had been identified preventing the smooth running and failing its aim of being a robust system.
\- A few spelling corrections were required!
These were all addressed, with multi-user functionality being addressed by the "splitting" of the database, programming issues (navigation buttons not working correctly) were resolved. Spelling errors were corrected.
PDSA cycle 3 - The database was again demonstrated to the junior doctors. On this occasion there were deemed to be no new issues. It was subsequently run in parallel with the old (MS Word) system for a two day period allowing for a safety net should any major errors arise. From this point onwards, no further formal updates to the program were required but instead as minor issues were found they were corrected on the live system.
PDSA cycle 4 - The questionnaire used in cycle 1 was again distributed. This revealed a general improvement across all aspects along with patient safety.
See supplementary file: ds4735.docx - "PDSA Cycles 1-4"
Post-measurement
================
Whilst information for the QI project is somewhat opinion based it has been formalised into a questionnaire in order to try and quantify/qualify these opinions. Indeed there is no obvious measure that can demonstrate an improvement in handover other than the lack of adverse incidents and near misses. When patients are found on the ward having been dropped from a list the doctors instinct is not to tell the author about the case but to ensure the patients safety and catch up on anything outstanding in the patient\'s care.
Following the implementation of the database the questionnaire was re-distributed with the results summarised as follows: The handover list was now always accessible and was no longed dependant on another doctor not having the document open simultaneously. The automated layout was sensible and continuous across all four teams. The incidence of patients and/or patient data being dropped from these lists had fallen dramatically with the discharge of a patient from the database now requiring a two stage process. Changing of team produced no loss in data as this was done by changing the allocated consultant within the database. The "Print all patients" button allowed for all elective inpatients to be listed by ward and then surname order allowing for a logical and time efficient ward round.
See supplementary file: ds4741.pdf - "Database screenshots"
Lessons and limitations
=======================
When the system was taken "online" as the sole patient handover management system there were a number of issues that had to be resolved and this was done so whilst the author was in work. A problem arose a couple of weeks further down the line whilst the author was not in work. The result of an error within the spelling of a consultant\'s name had led to a patient being left off a list. This was one of the specific aims this project was seeking to resolve, thankfully the patient\'s team were aware of this and flagged it up to the author resulting in a further review of all spellings to ensure this didn\'t happen again.
This kind of project needs to be future proofed, allowing someone who is less IT literate to manage its upkeep once the author has moved on.
Conclusion
==========
Reviewing the issues that led to the creation of this database:
\- There was a lack of continuity as to the layout of handover sheets between the four teams
\- Patients who switched team due to changing consultant had been taken off a list and not added to | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Carbon nanotubes (CNTs) have attracted particular interest because of their remarkable mechanical and electrical properties \[[@B1]\]. The combination of these properties with very low densities suggests that CNTs are ideal candidates for high-performance polymer composites \[[@B2]\]. In order to increase the application range of polymers, highly conductive nanoscale fillers can be incorporated into the polymeric matrix. As CNTs present high electrical conductivity (10^3^-10^4^S/cm), they have been widely used \[[@B3]\]. Therefore, CNT/polymer composites are expected to have several important applications, namely, in the field of sensors and actuators \[[@B4]\]. However, in order to properly tailor the composite material properties for specific applications, the relevant conduction mechanisms must be better understood.
The experimental percolation thresholds for CNT composites results in a wide range of values for the same type of CNT/polymer composites \[[@B5]\], being a deviation from the bounds predicted by the excluded volume theory and a dispersion for the values of the critical exponent (*t*) \[[@B6],[@B7]\]. It was demonstrated that the conductivity of CNT/polymer composites can be described by a single junction expression \[[@B8]\] and that the electrical properties also strongly depend on the characteristics of the polymer matrix \[[@B9]\]. This article explores the effects of nanotubes surface modifications in the electrical response of the composites.
Experimental
============
Preparation and characterization of the modified CNT samples
------------------------------------------------------------
Commercial multi-walled CNTs (Nanocyl - 3100) have been used as received (sample CNTs). Further details on this material can be found elsewhere \[[@B10]\]. CNTs sample was functionalized by oxidation under reflux with HNO~3~(7 M) for 3 h at 130°C, followed by washing with distilled water until neutral pH, and drying overnight at 120°C (sample CNTox was obtained). The CNTox material was heat treated under inert atmosphere (N~2~) at 400°C for 1 h (sample CNTox400) and at 900°C for 1 h (sample CNTox900), to selectively remove surface groups. The obtained samples were characterized by adsorption of N~2~at -196°C, temperature-programmed desorption (TPD) and determination of pH at the point of zero charge (pH~PZC~) from acid-base titration according to the method of the literature \[[@B11]\]. The total amounts of CO and CO~2~evolved from the samples were obtained by integration of the TPD spectra.
Composites preparation
----------------------
Polymer films with thicknesses between 40 and 50 μm were produced by mixing different amounts of CNT (from 0.1 to 1.0%) with *N, N*-dimethylformamide (DMF, Merck 99.5%) and PVDF (Solef 1010, supplied by Solvay Inc., molecular weight = 352 × 10^3^g/mol) according to the procedure described previously \[[@B9]\]. Solvent evaporation, and consequent crystallization, was performed inside an oven at controlled temperature. The samples were crystallized for 60 min at 120°C to ensure the evaporation of all DMF solvents. After the crystallization process, the samples were heated until 230°C and maintained at that temperature for 15 min to melt and erase all polymer memory. This procedure produced α-PVDF crystalline phase samples \[[@B12]\].
Sample characterization
-----------------------
Topography of the samples and CNT distribution was performed by scanning electron microscopy (SEM, FEI - NOVA NanoSEM 200). The dielectric response of the nanocomposites was evaluated by dielectric measurements with a Quadtech 1920. Circular gold electrodes of 5-mm diameter were evaporated by sputtering onto both sides of each sample. The complex permittivity was obtained by measuring the capacity and tan δ in the frequency range of 100 Hz to 100 kHz at room temperature. The volume resistivity of the samples was obtained by measuring the characteristic *I*-*V*curves at room temperature using a Keithley 6487 picoammeter/Voltage source.
Results and discussion
======================
Characterization of CNT samples
-------------------------------
Oxidations with HNO~3~originate materials with large amounts of surface acidic groups, mainly carboxylic acids and, to a smaller extent, lactones, anhydrides, and phenol groups \[[@B10],[@B13],[@B14]\]. These oxygenated groups (Figure [1](#F1){ref-type="fig"}) are formed at the edges/ends and defects of graphitic sheets \[[@B15]\]. The different surface-oxygenated groups created upon oxidizing treatments decompose by heating, releasing CO and/or CO~2~, during a TPD experiment. As this release occurs at specific temperatures, identification of the surface groups is possible \[[@B10],[@B13],[@B14]\]. It is well known that CO~2~formation results from the decomposition of carboxylic acids at low temperature, and lactones at higher temperature; carboxylic anhydrides originate both CO and CO~2~; phenols and carbonyl/quinone groups produce CO \[[@B10],[@B13],[@B14]\].
{#F1}
Figure [2](#F2){ref-type="fig"} shows the TPD spectra of the CNT before and after the different treatments. It is clear that the treatment with HNO~3~produces a large amount of acidic oxygen groups, such as carboxylic acids, anhydrides, and lactones, which decompose to release CO~2~. Part of these groups (carboxylic acids) is removed by heating at 400°C. A treatment at 900°C removes all the groups, so that the obtained sample is similar to the original. The total amounts of CO and CO~2~evolved from the samples, obtained by integration of the TPD spectra, are presented in Table [1](#T1){ref-type="table"}.
{#F2}
######
BET surface areas obtained by adsorption of N~2~at -196°C and amounts of CO~2~and CO obtained by integration of areas under TPD spectra
Sample CNTs CNTox CNTox400 CNTox900
--------------------------- ------ ------- ---------- ----------
BET surface area (m^2^/g) 254 400 432 449
pH~PZC~ 7.3 4.2 6.9 7.4
CO~2~(μmol/g) 70 778 230 24
CO (μmol/g) 193 1638 1512 204
CO/CO~2~ 2.76 2.11 6.57 8.50
All the samples release higher amounts of CO than CO~2~groups (Table [1](#T1){ref-type="table"}). The CNTox sample has the highest amount of surface oxygen. This sample also presents the lowest ratio CO/CO~2~and the lowest value of pH~PZC~, indicating that this is the most acidic sample. CNTox900 presents the highest CO/CO~2~ratio, suggesting the less-acidic characteristics, which matches well with the pH~PZC~results (Table [1](#T1){ref-type="table"}). The acidic character of the samples decreases by increasing the thermal treatment temperature, since the acidic groups are removed at lower temperatures than neutral and basic groups, as seen in previous studies \[[@B10],[@B13],[@B14]\].
The CNT samples have N~2~adsorption isotherms of type II (not shown), as expected for non-porous materials \[[@B16]\]. The surface areas of the samples, calculated by the BET method (S~BET~), are included in Table [1](#T1){ref-type="table"}. It can be observed that the oxidation treatments lead to an increase of the specific surface area. This occurs because the process opens the endcaps of CNTs and creates sidewall openings \[[@B17]\]. The specific surface areas of the samples slightly increase as the thermal treatment temperature increases, since carboxylic acids and other groups, introduced during oxidation, are removed.
Composites processing and characterization
------------------------------------------
The morphology and fiber distribution of the composite samples were analyzed by SEM to evaluate the CNT dispersion in the polymeric matrix and determine how the composites influence the polymer crystallization microstructure. Figure [3](#F3){ref-type="fig"} shows the SEM images for the PVDF/CNT composites. The main relevant microstructural feature of the composite is that the CNT are randomly distributed into the polymeric matrix. The spherulitic structure characteristic of the pure PVDF is still present in all the composites samples \[[@B12],[@B18]\].
{#F3}
CNT agglomerates are nevertheless more often observed for the CNTox composites samples, especially for the ones treated at the highest temperatures. With respect to the electrical properties, oxidation reduces the composite conductivity for a given concentration and shifts the percolation threshold to higher concentrations (Figure [4](#F4){ref-type | {
"pile_set_name": "PubMed Central"
} |
Sir,
Leiomyoma is the most common tumor of uterus and female pelvis. Leiomyosarcoma almost always arise de novo and almost it doesn't results from sarcomatous transformation of a leiomyoma. One of the most controversial concepts on the subject of uterine smooth muscle tumors is smooth muscle tumor of uncertain malignant potential (STUMP), a term first used by Kempson in 1973.\[[@ref1]\] These are a group of heterogeneous and uncommon uterine smooth muscle tumors which fulfill some but not all the diagnostic criteria for leiomyosarcoma. This makes them unclassifiable by currently available criteria as unequivocally benign or malignant.\[[@ref1]\] In these tumors, it is simply impossible with current tools to predict the behavior with certainty and this makes their management difficult.\[[@ref2]\] What makes the management more complicated is the difficulty in counselling patients with regards to the likely clinical behavior. However, data from literature suggest a low risk of recurrence and a generally good clinical outcome.\[[@ref2][@ref3]\] Since recurrence of STUMP has been reported to be regional and resectable, surgical resection has been recommended as the primary modality for the treatment of recurrence.\[[@ref2]\] Recurrence rates have been similar for patients who underwent myomectomy and those who underwent hysterectomy.\[[@ref4]\] Moreover, leiomyosarcomatous transformation likelihood is low and there is no evidence that adjuvant treatments improve long-term outcomes. As a result, most authors have recommended expectant management of STUMP in the form of close clinical observation in all patients.\[[@ref2]\]
Herein, we briefly report a case of 29 years nulligravid woman presented in 2011 with a two years history of menometrorrhagia and pelvic pain. Ultra sonography revealed a pedunculated subserosal myomatous mass measuring 65 × 50 × 50 mm as well as three small intramural myomatous masses with the greatest diameter of 17 mm. The patient underwent myomectomy. On pathologic examination, one of the small intramural masses was found to be STUMP. Since the gynaecologists frequently decide not to remove small myomatous masses during myomectomy procedure, the question is which myomatous masses should be considered for surgical removal. She recovered completely without complication. The problem becomes more challenging when considering the fact that the preoperative diagnosis of STUMP is usually leiomyoma\[[@ref2]\] This question is open to more discussions and suggestions by experts in this field.
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Ultrasonic nebulizers or atomizers are very important due to their many applications such as drug delivery, mass spectrometry, humidity control, spray pyrolysis, coating, etc. In almost all cases, the distribution of droplet sizes is an important parameter. For example, in many drug delivery systems, droplets need to be sufficiently small to reach the lower parts of the pulmonary tract, as larger droplets are deposited predominantly at the start of the airways^[@CR1]^. Despite extensive research^[@CR2]--[@CR12]^, many aspects of the nebulization process are still poorly understood, mainly because of the very complicated dynamics and the small length and time scales on which it takes place. This work is the first study that focusses primarily on the droplet size distribution for ultrasonic nebulization. We show that, where direct measurements are mostly inaccessible, the shape of the size distribution can be used as an indirect measure for the breakup mechanism. Depending on the type of nebulizer, the mechanism of nebulization can be very different. This is reflected in the droplet sizes, that unlike what is commonly observed, can be both narrowly or broadly distributed.
The process of ultrasonic nebulization is mostly explained by the capillary wave mechanism. The formation of capillary waves on the surface of a fluid supported by a vibrating solid was first described by Faraday in 1831, and are therefore also referred to as Faraday waves^[@CR13]^. Later, Kelvin derived the formula for the capillary wavelength *λ*^[@CR14]^, relating it to the surface tension *σ*, density of the fluid $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\rho $$\end{document}$, fluid depth *h* and frequency *f* of the standing waves as follows:$$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\lambda {[\tanh (\frac{2\pi h}{\lambda })]}^{-1/3}={(\frac{2\pi \sigma }{\rho {f}^{2}})}^{1/3},$$\end{document}$$where for a sufficiently deep liquid layer, i.e. *h*/$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\lambda \gg 1$$\end{document}$, one can take $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\tanh (2\pi h/\lambda )=1$$\end{document}$. As with many parametric oscillators, the frequency of the nonlinear standing waves is half the excitation frequency *F*, i.e. $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$f=F$$\end{document}$/2. For ultrasonic nebulizers, according to the capillary wave mechanism, the amplitude of the oscillation is large enough to cause droplet pinch-offs, thereby nebulizing the fluid (Fig. [1a](#Fig1){ref-type="fig"}). Since the size of the pinch-off droplets is proportional to the capillary wavelength, the median droplet size (designated as *D*~50~) is given by$$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$${D}_{50}=\kappa \lambda =\kappa \,{(\frac{8\pi \sigma }{\rho {F}^{2}})}^{1/3},$$\end{document}$$where *F* is the frequency of the nebulizer and $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\kappa $$\end{document}$ a proportionality constant. Lang was the first to experimentally determine this constant and found $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\kappa =0.34$$\end{document}$, where *D*~50~ is the median droplet size for the *number* (not *volume*) distribution^[@CR2]^. For all that follows, we will use *D*~50~ only to indicate the median particle size by *volume*. Although Lang's prediction works well in many cases, there are often slight and sometimes even significant differences in the proportionality constant $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$\kappa $$\end{document}$^[@CR12],[@CR15]^. This and the fact that many nebulizers are distinctly different has led to the formulation of many different scaling laws and different nebulization mechanisms, one example being cavitation^[@CR4],[@CR5],[@CR10]^.Figure 1(**a**) Ideal case of standing capillary waves of wavelength *λ*. If the amplitude exceeds a certain value, equal sized ligaments are produced, leading to the break-off of monodisperse droplets of size *d* \~ *λ*. (**b**) Capillary waves in a system with maximum interference, leading to a distribution of wavelengths and amplitudes. This results in a broader distribution of droplet sizes set by the average ligament roughness and the distribution of ligament sizes. (**c**) Faraday waves are superposed on larger waves of the order of the wavelength of the chip material. The motion of these larger waves initiates breakup of the smaller superposed capillary waves. High-speed camera images show that jets of small droplets are formed at the crests of these larger waves at maximum acceleration.
In studies of ultrasonic nebulizers, the focus is mostly on the median droplet size. The spread around this median is however just as important, especially for their implementation in different applications. For sprays and jets, the shape of the droplet size distribution is well understood^[@CR16]--[@CR21]^. There, it is set by the ligament corrugation and the distribution of ligament sizes. Assuming that capillary waves are the droplet formation mechanism, the droplet sizes are determined by the initial size of the waves and the roughness of the pinch-off ligaments (Fig. [1](#Fig1){ref-type="fig"}), and would therefore be comparable with the breakup of sprays. In this case, waves can be more or less spread in size, giving more or less dispersion in droplet sizes (Fig. [1b](#Fig1){ref-type="fig"}). Similarly, ligaments can be very corrugated, leading to a broad distribution, or very smooth giving a narrow size distribution.
In this work we investigate three types of ultrasonic nebulizers, working at different frequencies. We find that for these devices the capillary wave hypothesis works well, with proportionality constants depending on the type of nebulizer. We further show that droplet size distributions also depend on the type of nebulizer. Distributions can be surprisingly broad, presumed to be due to large variability in wavelengths and rough pinch-off ligaments, but also very narrow as predicted by the classical picture of capillary wave breakup, where waves are similar sized with smooth pinch-offs.
Nebulizers {#Sec2}
==========
SAWN {#Sec3}
----
The surface acoustic wave nebulizer (SAWN) consists of two interdigital transducers (IDT) with lithium niobate as the piezoelectric substrate. Between the two IDTs there is a space (delay zone) where a droplet can be placed for nebulization (Fig. [2b](#Fig2){ref-type="fig"} with holder and Fig. [3a](#Fig3){ref-type="fig"}). For this particular chip, the | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Alpha (α)-asarone \[1,2,4-trimethoxy-5-\[(E)-pro-1-enyl\] benzene; Pubchem CID: 636822; **Figure [1](#F1){ref-type="fig"}**), is one of the main pharmacologically active compounds present in *Acorus calamus* Linn (Acoraceae), *Acorus tatarinowii* Schott (Acoraceae), and *Acorus gramineus* Solander (Acoraceae; [@B30]). The various neuropharmacological activities of α-asarone in numerous preclinical studies were reported in the literature including anticonvulsant ([@B11]), neuroprotective ([@B15]), anxiolytic ([@B16]), and nootropic effects ([@B15]; [@B13]). Recently, the antidepressant-like effect of an essential oil from *Acorus tatarinowii* Schott have been reported in well-validated animal models of depression such as TST and forced swim test (FST). In the same study, the acute treatment of α-asarone at lower doses (10 and 20 mg/kg, i.p.) showed an antidepressant-like activity in both established mouse models ([@B9]). Besides that, other reports claimed that α-asarone possess CNS depressant-like effect whereby mice treated with α-asarone at higher doses (≥50 mg/kg, i.p.) affected locomotor activity and potentiated the pentobarbitone-induced sleeping time, a test that is used for the screening of potential CNS depressants ([@B21]; [@B26]; [@B16]). Similarly, CNS depressant-like activity of roots, rhizome and leaf extracts of *Acorus calamus* have been reported ([@B23]; [@B27]). In our previous study, *Acorus calamus* leaf extracts significantly increased the immobility time in FST, and diazepam-induced sleeping time and significantly reduced the spontaneous locomotor activity without affecting motor coordination ([@B27]). Conversely, antidepressant-like activities of methanolic extract of rhizomes and leaves of *Acorus calamus* in FST and TST have been reported in other studies ([@B28]; [@B29]). These seemingly contradictory reports led us to try and find answers by conducting further studies to determine dose-dependent effect of α-asarone, the active phytoconstituent of *Acorus* species, at doses that are beyond those that have been reported, which is more than 20 mg/kg in the TST. Additionally, the underlying mechanism(s) involved in the antidepressant-like activity of α-asarone was examined using its interaction with noradrenergic neuromodulators such as AMPT, prazosin, and yohimbine and serotonergic neuromodulators PCPA and WAY100635 in the TST.
![**Chemical structure of α-asarone (1, 2, 4-trimethoxy-5-\[(E)-pro-1-enyl\] benzene)**.](fphar-07-00072-g001){#F1}
Materials and Methods {#s1}
=====================
Animals
-------
Adult male, ICR mice (Institute for Cancer Research) of age 8--10 weeks, bred and supplied by the Animal Experimental Unit (AEU, Faculty of Medicine, University of Malaya, Kuala Lumpur) were used in all our experiments. The mice were housed (four mice per cage) in an individually ventilated cage at the Satellite Animal Facility (SAF), Department of Pharmacology, Faculty of Medicine, University of Malaya, Kuala Lumpur, and acclimatized for a week in a controlled environment \[22 ± 2°C, 50--70% humidity and 12 h light/dark (lights on at 7.00 am)\] with food and water available *ad libitum*. AEU and SAF have been accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC). All experimental protocols adhered to the guidelines of the National Research Council of the National Academies of the USA ("Guide for the Care and Use of Laboratory Animals," Eighth Edition; [@B7]) and were assessed and approved by the Faculty of Medicine-Institutional Animal Care and Use Committee (FOM-IACUC), University of Malaya (Ethics Approval no: 2014-10-14/PHAR/R/VP). The behavioral experiments were performed during the light cycle between 10.00 am and 6.00 pm. All efforts were made to minimize suffering in the mice, and to reduce the number of mice used in the experiments.
Drugs and Treatment
-------------------
The following drugs were used: α-asarone (Lot \# S18779V; Purity 98% w/w), Tween 80 (polyethylene sorbitan monooleate; Lot \# MKBP0682V; Purity ≥ 99% v/v), α-methyl-*p*-tyrosine (AMPT; Lot \# STBD4408V; Purity 98% w/w), and 4-chloro-[D-L]{.smallcaps}-phenylalanine methyl ester hydrochloride (PCPA or Fenclonine; Lot \# SHBD9164V; Purity 97% w/w) ± 8-hydroxy-2-dipropylamino tetralin hydrobromide (8-OH-DPAT; Lot \# 053M4102V; Purity ≥ 98% w/w), prazosin hydrochloride (Lot \# 129K1137V; Purity ≥ 99% w/w) and yohimbine hydrochloride (Lot \# 13CBM8231V; Purity ≥ 98% w/w; purchased from Sigma-Aldrich, St. Louis, MO, USA); bupropion hydrochloride (Lot \#2596608; Purity ≥ 99.5% w/w) and fluoxetine hydrochloride (Lot \#2597489; Purity 99.8% w/w; obtained from LKT laboratories, Inc., St. Paul, MN, USA); *N*-\[2-\[4-(2-methoxyphenyl) piperazin-1-yl\] ethyl\]- *N*-pyridin-2-ylcyclohexanecarcoxamide hydrochloride (WAY100635; Lot \# 6-GJF-12-1; Purity 98% w/w; purchased from Toronto Research Chemicals, Inc., Toronto, ON, Canada). The α-asarone was suspended in 5% v/v Tween 80 prepared in normal saline. Bupropion, fluoxetine, PCPA, WAY100635, 8-OH-DPAT, prazosin and yohimbine were dissolved in normal saline and AMPT was suspended in 10% v/v Tween 80 prepared in normal saline. All the drugs were administered i.p., whereas WAY100635 was administered s.c. on a constant dose volume of 10 mL/kg body weight of mice. The mice in the control group received the appropriate vehicle used in this study. The administration schedule and dose of drugs used in this study was chosen as reported in the published literature and standardized in our laboratory.
Behavioral Procedures
---------------------
### Tail Suspension Test
The TST was performed for 6 min as described previously ([@B34]). Briefly, both acoustically and visually isolated mice were suspended 25-cm above the floor by adhesive tape placed approximately 1 cm from the tip of the tail. Mice were considered immobile when they hung passively and completely motionless. The motionless hanging posture represents depression-like behavior of the animals. The experiment was recorded and monitored using a Logitech webcam (C270) connected to a personal computer and the immobility time in second was measured using a digital stop-watch during the 6 min test by an experienced observer (blinded to the experiment). Antidepressants decrease the immobility time in the TST ([@B34]).
### Horizontal Wire Test
The experiment was performed as described previously ([@B12]) with slight modifications. The mouse was lifted by the tail and the forepaws were allowed to grasp the center of the horizontal metallic wire (2 mm diameter, 70 cm long) suspended in the air about 40 cm from the surface of the table and then the tail was released to let the mouse to hang with its forelimb. The ability of the mouse to actively grasp the wire within the first 10 s (grasping reflex) and hang on, or climb up within 20 s test was measured. The mouse which tends to grasp, hang or climb-up, was considered as a normal motor coordination. On the other hand, mouse which failed to grasp or fall off from the wire within 20 s was considered as mouse with impaired motor coordination. The data are expressed as % of mice with normal motor coordination.
Spontaneous Locomotor Activity
------------------------------
The spontaneous locomotor activity was assessed using actimeter (Model: ACT-01, Orchid's Scientific, Nasik, India) fabricated with clear square Plexiglas arena (50 cm × 50 cm), equipped with 32-infrared sensors. The mouse was placed in the center of the arena and the locomotor activity was measured for the duration of 10 min. The data are expressed as the total light beam interruptions (locomotor counts). The floor of the apparatus was cleaned with 20% v/v ethanol between tests.
Experimental Design
-------------------
### Effect of α-Asarone *per se* in the TST
The | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec001}
============
Dopamine (DA) is a biogenic amine neurotransmitter found in both vertebrates and invertebrates that affects a wide variety of physiological and behavioral functions, including reproduction\[[@pone.0193999.ref001],[@pone.0193999.ref002]\], hormone synthesis and release\[[@pone.0193999.ref003]\], locomotion\[[@pone.0193999.ref004]\], respiration\[[@pone.0193999.ref005]\], feeding behavior\[[@pone.0193999.ref006]\], and the circadian rhythm\[[@pone.0193999.ref007]\]. The dopamine receptors can be divided into five subtypes (DA~1~-DA~5~), which all belong to the family of G protein-coupled receptors (GPCRs). According to their conserved structures, signaling mechanisms and pharmacological profiles, these receptors are further classified into two types the D1-like and D2-like receptors\[[@pone.0193999.ref001]\]. The D1-like receptors include the DA~1~ and DA~5~ subtypes, which activate adenylyl cyclase, resulting in increased levels of intracellular cyclic adenosine monophosphate (cAMP); regulate cell metabolism, including ion channel function, and desensitize GPCRs, leading to the release of neurotransmitters. D2-like receptors consist of the DA~2~, DA~3~, and DA~4~ subtypes, which inhibit adenylyl cyclase through the coupled signal transduction pathway and thus decrease cAMP; D2-like receptors can be blocked by the pertussis toxin\[[@pone.0193999.ref008]\]. In mammals, these receptors occur in the brain, peripheral nervous system, cornea of the eye, heart, kidney and lymphocytes\[[@pone.0193999.ref002]\]. However, only a few studies on the dopamine receptor in crustaceans have been reported. Using RACE technology and a degenerate PCR strategy with conventional library screening, the gene and protein sequences of DA~1α~, DA~1β~ and DA~2α~ in *Panulirus interruptus* have been obtained\[[@pone.0193999.ref008],[@pone.0193999.ref009]\]. In the sequencing of transcriptomes from the nervous systems of *Cancer borealis* and *Homarus americanus*, DA~1α~, DA~1β~ and DA~2α~were found in both decapod crustaceans\[[@pone.0193999.ref010]\]. In addition, a type 1 dopamine receptor from *Penaeus monodon* has been identified\[[@pone.0193999.ref002]\]. However, information is still lacking on gene and protein sequences of dopamine receptors in economically valuable decapod crustaceans, such as *E*. *sinensis*, a richly nutritious species with high market demand that has become economically important in Chinese freshwater aquaculture\[[@pone.0193999.ref011]\].
Light influences the growth and development of crustaceans\[[@pone.0193999.ref012],[@pone.0193999.ref013]\], such as *Macrobrachium rosenbergii* and *Portunus pelagicus*, and daily changes in dopamine synthesis and release depend on the interactions between the photoreceptors and the dopaminergic neurons, where dopamine release is induced by light\[[@pone.0193999.ref014],[@pone.0193999.ref015]\]. High levels of dopamine have been detected during light periods and low levels during dark periods\[[@pone.0193999.ref016]--[@pone.0193999.ref018]\], for this reason, it is believed that dopamine promotes light adaptation. However, constant light results in a dramatic reduction in dopamine levels in chicken retina\[[@pone.0193999.ref019]\]. Constant light and constant darkness have significant effects on survival and growth of larvae of *P*. *pelagicus*\[[@pone.0193999.ref012]\] and *M*. *rosenbergii*\[[@pone.0193999.ref013]\], but the effects of different photoperiods on dopamine receptors in crablets remain uncertain.
In addition to promoting light adaptation, dopamine can also participate in feeding regulation. Exogenous injection of DA has been found to significantly decrease food intake compared to that of a control group in neonatal layer-type chickens\[[@pone.0193999.ref006]\], and cannabinoid-induced feeding behavior may be modulated by dopamine receptor 2\[[@pone.0193999.ref020]\]. However, by promoting either the initiation or cessation of feeding behavior, increased activity of DA neurons can either increase or reduce food intake\[[@pone.0193999.ref021]\]; inhibition of D1-type dopamine receptor neurons decreases food intake\[[@pone.0193999.ref022]\]. Dopamine receptors have also been found to be distributed in the intestinal tract and are considered to be involved in regulating gastrointestinal motility\[[@pone.0193999.ref023],[@pone.0193999.ref024]\]. In addition, the presence of specific receptors on the membranes of target cells is essential for dopamine to produce any physiological effects. Inhibitors of dopamine receptors can block the effects of dopamine\[[@pone.0193999.ref025]\]. Due to the diversity of dopamine receptors, light stimulation has different effects on their expression levels. An understanding of the variation of receptors will help to identify cellular targets of DA and to understand which receptors are activated for particular processes.
The present study describes the molecular cloning and characterization of the dopamine receptor 2 full-length cDNA from *E*. *sinensis* and its expression profile in various tissues under different photoperiods and feeding statuses.
Materials and methods {#sec002}
=====================
Animals and sampling {#sec003}
--------------------
In this study, the experimental animals (n = 48) were healthy crablets (exhibiting secondary sexual characteristics) with initial masses of 13.43±1.81 g, collected from the Shuxin crab base in Chongming, Shanghai (China). Crabs were housed for one week for acclimatization in clear glass aquaria (length× width× height = 120×60×40cm) with sufficient ambient medium and cyclic water flow. Crabs were fed once a day at 09:00.
Thirty crabs were acclimatized to 26±1°C and assigned randomly to three groups: a control group (L:D = 12h:12h), a group held in constant darkness (L:D = 0h:24h) and a group held in constant light (L:D = 24h:0h). There were 10 crabs per group, and treatments continued for 14 days\[[@pone.0193999.ref026]\]. Then crabs from the control group were frozen on ice and dissected, and different tissues, including the gill, heart, muscle, hepatopancreas, intestine, cranial ganglia, thoracic ganglia, eyestalks, and hemolymph were harvested. At the same time, eyestalks, cranial ganglia and thoracic ganglia were harvested on ice from the constant darkness group and constant light group.
For a separate group of 18 crabs, the hepatopancreas and intestine were collected on ice after a week of rearing. Tissues were collected at 08:00 (before feeding, n = 6), 10:00 (feeding period, feeding time was 09:00 to 10:00, n = 6), or 16:00 (after feeding, feces were mostly in the hind gut and the crabs began to evacuate 6h after feeding, n = 6), \[[@pone.0193999.ref027]\]. All the samples were stored at -80°C until RNA isolation.
Nucleic acid extraction {#sec004}
-----------------------
Total RNA was extracted from *E*. *sinensis* using the RNAiso Plus reagent (RNA Extraction Kit, TaKaRa, Japan) according to the manufacturer's instructions. Briefly, tissues were ground in a mortar with liquid nitrogen and collected in 1.5 ml centrifuge tubes. The RNAiso Plus reagent was added (1 ml), and samples were left at room temperature for 5 min. Samples were then centrifuged 5 min at 4°C and 12000 rpm, and the supernatant was collected in new 1.5 ml tubes. Chloroform (200 μl) was added, and samples were then oscillated and again left at room temperature for 5 min before a 15 min centrifugation at 4°C and 12000 rpm. The supernatant was collected in new 1.5 ml tubes and 500 μl of isopropyl alcohol was added. Samples were left at room temperature for 10 min and then centrifuged 10 min at 4°C and 12000 rpm. Pellets were washed with 1 ml of 75% alcohol and centrifuged 10 min at 4°C and 7500 rpm. The supernatant was removed, and the remaining pellets were dried and dissolved in 30 μl of DEPC-treated water. The concentration and quality of the total RNA were estimated by micro-volume ultraviolet-visible spectrophotometer (Quawell Q5000; Thmorgan, China) and agarose-gel electrophoresis, respectively.
Cloning of full-length *E*. *sinensis* DA~2~ cDNA {#sec005}
-------------------------------------------------
Transcriptomes sequences were obtained from the Y-organ of *E*. *sinensis*. The amino acid sequence of the EST (length: 637bp) was verified to be highly homologous to the *C*. *borealis* dopamine receptor 2 (AOG14374.1) using BlastX analysis. A pair of gene primers, DA~2~-F and DA~2~-R ([Table 1](#pone.0193999.t001){ref-type="table"}), was designed to amplify the full-length DA~2~ cDNA from * | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Antibodies are the primary tools of the immune system, which participate in the protection of the organism against pathogenic microorganisms. The significance of antibodies is growing as researchers become aware of their potential not only as tools to be used in diagnostics, but in therapy as well \[[@R1]\]. Antibodies have been successfully used to treat certain forms of oncological conditions. Over the past decades, monoclonal antibodies have been widely used in diagnostics and for research purposes. Yet, the conventional methods used to obtain monoclonal antibodies, based on dealing with animal-origin cells, make difficult their use as therapeutic agents. Introduction of these monoclonal bodies into the human organism may result in the onset of an undesirable immune reaction, particularly, if used repeatedly \[[@R2]\]. In order to prevent the emergence of such an immune response, the following approaches have been developed: production of recombinant immunoglobulins in which the regions that are not responsible for antigen recognition are replaced by corresponding fragments of human origin (humanized antibodies), or removal of the domains that are not involved in antigen binding (mini-antibodies). The so-called recombinant technologies, based on the use of libraries comprising sequences from human antibodies, have found increasing application over the past decade. When constructing these libraries, variable domains of the heavy and light strands are linked in the expression vector via random screening within one reading frame via the linker sequence \[[@R3]\]. It is rather laborious to deal with cumbersome libraries of these single-stranded antibodies (scFv), and only in rare cases is a highly affine antibody finally obtained. Certain difficulties are associated with the instability of genetic constructions, the low level of product expression, and its solubility \[[@R4]\].
A significant breakthrough in this field has been the detection of non-canonical antibodies in members of the Camelidae biological family. These antibodies do not contain light strands and represent a dimer of shortened heavy strands \[[@R5], [@R6]\]. An immune response with the participation of these antibodies can be induced by conventional immunization. There are a number of advantages in using the repertoire of these non-canonical antibodies to create libraries of sequences of variable domains (for the heavy strand only). The single-domain structure of the recognizing variable domain stipulates a small size of the antigen-binding fragment (mini-antibodies), high stability, and solubility \[[@R7]\].
Thanks to their structure, mini-antibodies can be used to reveal epitopes that are hidden for the conventional immunoglobulins. The expression from a single gene simplifies genetic engineering procedures and, therefore, the work with the libraries containing the sequences of variable domains. Low immunogenicity (conditioned by the high homology of the sequences of mini-antibodies with a variable domain of heavy strands of human IgG3) and the relative simplicity of the humanization procedure open broad opportunities for the application of mini-antibodies in the design of novel pharmaceutical agents \[[@R8]\].
These features of the structure of mini-antibodies and the simplicity with which their genes can be manipulated enable efficient and economical production of large amounts of a mini-antibody, using various expression systems \[[@R9]\].
The use of the prokaryotic expression system to produce mammalian proteins has to do with the possibly low functional activity of the proteins obtained, due to the absence of a system for post-translational modification in prokaryotic cells. Moreover, no matter how thorough the purification, the final product can still be contaminated with pyrogenes.
One of the promising methods for delivering genetic material to target cells is the use of viral vectors. Expression constructions bearing one or several recombinant genes are incorporated into the viral genome using methods of genetic engineering. Vectors based on the genome of the adeno-associated virus have been proposed in a number of studies \[[@R10], [@R11]\] for delivery of mini-antibody genes to target cells.
Adenoviral vectors are among the most universal tools used for delivery and expression of recombinant genes in mammalian cells. It is known that recombinant adenoviruses efficiently transfer the genes of bacterial and viral antigens, cytokines, growth factors, and other proteins to the target cells, ensuring a high level and duration of target gene expression \[[@R12]\]. Adenoviral vectors are capable of transducing both dividing and postmitotic cells. Adenoviral DNA remains in its extrachromosomal form, whereas the recombinant virus is excreted from the organism within 4--5 weeks \[[@R13], [@R14]\].
The production of recombinant adenoviruses is characterized by the following feature: the virus is capable of reproducing only *in vitro* in special cell lines, which ensures the vector's safety \[[@R15]\].
The fact that recombinant adenoviral vectors can be used efficiently for the expression of antigen-binding fragments of antibodies is borne out by the example of mini-antibodies to the cell epitope (the epidermal growth factor receptor (erbB-2) and anthrax toxin component) \[[@R16], [@R17]\].
The aim of the present work is to examine how recombinant adenoviral vectors can be used for delivery and efficient expression of single-domain mini-antibodies (nanoantibodies) obtained using the novel technology of generation of special single-stranded antibodies extracted from camel. The nanoantibody earlier obtained and characterized to the cell cytokeratine-8 \[[@R18]\] was selected as the model antibody. It was subsequently used to demonstrate the fundamental possibility of expressing the single-domain antibodies obtained by immunization of members of the Camelidae family via recombinant adenoviruses.
EXPERIMENTAL
============
**Enzymes**
In this study, restriction endodeoxyribonucleases, T4 DNA ligase, alkaline phosphatase (CIAP) purchased from Fermentas MBI (Lithuania), and Taq-polymerase purchased from Promega (United States) were used.
**Cell lines**
The HEK-293 cell line (human embryonic kidney cell culture transformed by the E1-region of human adenovirus serotype 5) and Н1299 cell line (human lung cancer cells) were used. The cells were cultured in a DMEM medium containing 10% of fetal bovine serum (FBS) purchased from HyClone (United States).
**Production of the cDNA clone encoding the single-domain mini-antibody (nanoantibody) which specifically recognizes the endogenous mouse cytokeratin-8**
Antibody aCyK-V ~H~ H, which specifically recognizes mouse cytokeratin-8, was obtained earlier by S.V. Tillib's research group ( Institute of Gene Biology, Moscow) in collaboration with the laboratory headed by S. Muyldermans (Vrije Universiteit Brussel) and used (via binding to the fluorescent protein sequence) to obtain fluorescent nanoantibodies (or chromobodies) aimed at demonstrating the new method for tracing antigens in a living cell. It should be noted that the aCyK-V ~H~ H nanoantibody was one of the first antibodies to endogenous structural eukaryotic proteins. The first stage of its production comprised immunization of the Bactrian camel ( *Camelus bactrianus* ) with a protein extract from mouse soft tissue cells (predominantly from the liver). The subsequent selection procedure, based on the phage display method, was performed as described in the online supplement to the article \[[@R18]\]. The fundamental stage after selection of the most enriched antibody clones was the identification of the unknown antigen recognized by these nanoantibodies. The proteins from the nanoantibody-binding region upon Western blotting were additionally separated by electrophoresis to obtain individual products. Western blotting was then used to analyze the recognition of each product by a nanoantibody. The product recognized by a nanoantibody was identified using mass spectrometrical analysis of its trypsin hydrolysate. The resulting nanoantibody aCyK-V ~H~ H recognized cytokeratin-8, a fact attested to via the immunofluorescent staining of С2С12 (mouse myoblast cell line) with these antibodies, revealing the characteristic distribution of cytokeratin intermediate filaments in the cytoplasm.
The nanoantibody aCyK-V ~H~ H produced in the bacterial periplasm was modified by binding an antigen-recognizing sequence of two additional small fragments, epitope of influenza virus haemogglutinine (HA-tag) and six histidine residues (His ~6~ -tag), in order to purify it and simplify its detection.
**Obtaining recombinant adenovirus**
Plasmids and the recombinant adenoviral vector were obtained using the gene of antibody to cytokeratin *aCyK-V ~H~ H* . The nucleotide sequence encoding the nanoantibody was obtained by chemical synthesis in "Evrogen" JSC. The AdEasy Adenoviral Vector System (Stratagene, United States) was used in order to construct the рAd-aCyK-V ~H~ H plasmid vector containing the genome of the recombinant adenovirus with E1 region deletion, and a transgene expression cassette incorporated instead of it via homologous recombination in *E. coli* cells. The recombinant adenovirus was obtained via transfection of HEK-293 cell lines with the рAd-aCyK-V ~H~ H plasmid construct linearized on the PacI site. Lipofectamine 2000 (Invitrogen, United States) was used for the transfection, according to the manufacturer's recommendations. The recombinant human adenovirus of serotype 5 with E1 region deletion and an incorporated transgene-free cassette expression (Ad-null) inserted instead of it was used as the control.
To accumulate adenoviral preparations, an infected cell suspension (10 ^7^ PFU of the virus per Petri dish with a diameter of 15 cm) was coated to the HEK-293 cell monolayer with 50--70% confluence. The infected cell suspension was destroyed by three freeze | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Starting with winter semester 2003/2004, the University of Cologne introduced the new degree course at the medical faculty called 4C (Competence-based Curriculum Concept Cologne) \[[@R1]\], \[[@R2]\], \[[@R3]\]. Apart from fulfilling the goals of the Medical Licensure Act (Approbationsordnung für Ärzte \[[@R4]\]), the specific profile of the 4C model is defined in the so-called General Teaching Principles (Leitbild Lehre) \[[@R5]\], according to which Cologne graduates:
have the necessary knowledge and skills to identify important and common diseases and acutely life-threatening situations and to induce their treatment;show behavior and attitudes that are conducive to their acceptance by patients and medical staff and to improving the standing of physicians in society;are willing and capable to engage in independent and science-based CPD in general practice but also in a clinical discipline or a basic subject of their choice.
These goals are primarily achieved through the following new elements in the curriculum \[[@R1]\], \[[@R2]\] which are combined with traditional subject and cross-subject teaching:
interdisciplinary competence areas (88 in total, each with 5-12 hours of lectures on important and common topics of in- and out-patient treatment; competence areas 1-24 are for undergraduate students)patients treatment in parallel to the course ("Studipat") in which medical students are brought into contact with one patient each at a GP surgery for the first four years of studyorganization of week-long block placement from the 5th semester onwardsoffering electives at the end of each semester via compulsory blocks of electivesscientific qualification through two projects in which the students immerse themselves into a scientific subjectskills training in the KIS^S^ (Cologne Inter-Professional Skills Lab and Simulation Center).
KIS^S^ is a central institution of the deanery of student affairs and serves to provide training and independent practice of practical medical skills in all outcome-areas as defined by Harden \[[@R6]\], \[[@R7]\]. In contrast to the traditional process-based separation of knowledge, skills and attitudes in the German-speaking world, outcome-based trainings starts by defining outcomes (elsewhere also vaguely termed "competence-based" \[[@R8]\], \[[@R9]\]. Three different levels for curriculum development are discussed (which build on each other). The first is "Doing the right thing" which refers to the knowledge level and the ability to handle the daily clinical routine. The second is "Doing the things right", the level of emotional, analytic and creative intelligence to use knowledge and skills appropriately. The third level focuses on the person and their future development - "The right one doing it", the professional role in its social and societal reality. Recently more and more curricula have been developed from this point of view and as a result, there are also calls for the adaptation to accreditation criteria from the English-speaking world \[[@R10]\]. This is somewhat surprising, especially in view of the thin to non-existent proofs of efficacy, in particular with regard to the 3rd level "Attitudes" and "Professionalism\" \[[@R11]\].
Based on these development criteria, and bearing in mind the requirements of the medical licensure act, clinical skills are grouped into three fields in Cologne: emergency skills, communication skills and technical skills. These elements transcend the entire degree course as a teaching and learning helix, with the educational objective of students reaching Clerkship Maturity after five semesters and the Internship Maturity ("PJ-Reife") after ten semesters. Table 1 [(Tab. 1)](#T1){ref-type="fig"} shows the teaching content of skills training taught up to Clerkship Maturity divided into semesters.
In a subsequent formative OSCE (Objective Structured Clinical Examination, cf Harden & Gleeson \[[@R12]\]) with six stations during the 5th semester, students receive feedback on their practical skills on a German-English bilingual certificate, "Famulaturreife - Clerkship Maturity".
The program running from the first semester of study to Clerkship Maturity was developed in 2003/2004 by an expert task force of the Advisory Board of Study Affairs of the Medical Faculty of the University of Cologne. Starting with the winter semester 2003/2004, and with broad participation from many different disciplines (anesthesia, psychosomatic medicine, transfusion medicine, internal medicine) and following the Delphi-model the "Leitbild Lehre" was developed \[[@R5]\]. To validate this procedure retrospectively, two questions were investigated:
What skills are required by the physicians and GPs supervising students on clerkships?How frequently were students able to perform these skills as part of their clinical clerkship and which advantages did the Clerkship Maturity examination bring them from their point of view?
Materials and methods
=====================
To evaluate the opinions of the teaching staff, a semi-standardized, machine-readable questionnaire was designed. Some of the content is shown in Table 2 [(Tab. 2)](#T2){ref-type="fig"}^1^. The questions were primarily developed on the immediate basis of the earlier KIS^S^ planning. In addition, open questions were used for additional information. The questionnaire was tested using ten randomly selected students to ensure its comprehensibility and subsequently sent to the senior physicians of the Cologne Teaching Hospitals, the GP surgeries and the senior physicians at the University Clinic of Cologne by post.
To evaluate the opinion of the students a semi-standardized, machine-readable questionnaire based on the above described questionnaire was designed to reflect the reality of education. In this context the primary concern was not an evaluation of the importance of the skills training content by the students but data on the frequency of skills used ("empirical relevance") as part of the clerkships (For Questionnaire Excerpts see Table 3 [(Tab. 3)](#T3){ref-type="fig"})^2^. The questionnaire was sent to every student of the target group (7^th^semester).
Both questionnaires looked at the teaching/learning on offer in the KISs skills lab and the skills actually required during the clerkships. In addition, the form collected socio-demographic data regarding the age, sex, year of study, number of completed weeks on clerkship and additional medical training that may have been gained.
The completed questionnaires were digitized using Remark^®^. The data was evaluated statistically using Microsoft Excel^®^ 2003. Mean values and standard deviation are also shown. The graphics were generated using Microsoft Excel^®^ 2003. The open questions were analyzed using qualitative, structured content analysis after Mayring \[[@R13]\].
Results
=======
**Results of the teaching staff questionnaire:** 36 of 80 (45%) hospital-based physicians and 77 of 140 (55%) GPs returned completed questionnaires. There was no follow-up due to anonymisation. Figure 1 [(Fig. 1)](#F1){ref-type="fig"} shows the evaluation of the necessity/importance of different skills for Clerkship Maturity as viewed by the teaching staff. While frequently needed skills such as disinfecting hands or taking blood pressure and pulse are rated quite high, more rarely needed skills or skills deemed as premature for this stage were rated low (such as placing a stomach tube or a CVL). Significant differences between the hospital-based physicians and GPs were only seen with a few items such as taking blood samples, iv/im injections and suturing techniques (see Figure 2 [(Fig. 2)](#F2){ref-type="fig"}). It became clear that skills desirable for the ward round where rated more highly by hospital-based physicians significantly more frequently.
Interpersonal skills were rated differently by hospital-based physicians and GPs too. While empathy with 64% was the most frequently mentioned criterion by GPs, only 36% of hospital-based physicians rated this skill as being important. With 20%, both groups equally mention the "ability to listen/handle patients" or "interest in the patient" as an important skill for students.
Additional suggestions for skills that should be included in the KIS^S^ offer regarding Clerkship Maturity are only given sporadically (e.g. computer skills, wound management or team skills) and thus do not allow a consistent overview.
**Results of the student questionnaire:**The questionnaire was sent to 140 students of which 75 were returned completed, a return rate of (54%). 24 of the 75 students who responded were male, 45 female (6 did not specify). The mean age of the students was 26 years. 59 students were attending the 7^th^ semester, 7 the 8th semester and 3 higher semesters. 7 students listed a qualification in the medical field, including 3 paramedics (most frequent mention). Only 5 students who had returned their questionnaires were studying under the regular degree course. For this reason, there is no comparison between the regular and the model degree course responses. Figure 1 [(Fig. 1)](#F1){ref-type="fig"} contrasts the student responses regarding the frequency of skills needed during the clerkship and their importance as rated by the teaching staff. It is clear that the frequency and necessity (importance) of some skills diverge rather drastically (especially in emergency care). While the teaching staff rate training in examination-skills as very important (1.4±0.9) whereas the students rate this as less important (2.9±1.7).
Students suggested the following in the open questions regarding possible improvements of the skills training prior to Clerkship Maturity:
better knowledge transfer (9 mentions)more | {
"pile_set_name": "PubMed Central"
} |
**Core tip:** This article reviews the current role of diffusion weighted imaging for various oncological and non-oncological applications in the liver.
INTRODUCTION
============
Diffusion-weighted imaging (DWI) is a functional imaging technique, allowing qualitative and quantitative assessment of the diffusion properties of various types of tissues\[[@B1],[@B2]\]. Numerous studies over the past decade have validated the role of DWI in oncologic and non-oncologic applications in the body\[[@B1],[@B3]-[@B6]\]. Multiphase contrast enhanced MRI is an established technique for evaluation of a wide spectrum of liver diseases including focal lesions and diffuse parenchymal abnormalities. DWI compliments routine MRI of the liver by providing both qualitative and quantitative assessment for both focal and diffuse hepatic parenchymal processes. Factors such as the ease of acquisition and ability to obtain functional information in the absence of intravenous contrast, especially in patients with abnormal renal function, have contributed to the growing interest in exploring clinical applications of DWI. DWI improves sensitivity in detection of focal lesions, helps differentiate benign from malignant focal hepatic lesions, and also permits evaluation of treatment response to systemic and loco-regional therapies in primary and secondary hepatic malignancies. This review article focused on the basic principles, technique, current clinical applications and recent updates in DWI of the liver.
DWI: BASIC PRINCIPLES AND TECHNIQUE
===================================
DWI exploits the regional differences in the motion of water molecules within the extracellular/extravascular compartment of tissues. In highly cellular tissues (*e.g*., lymphoma, carcinoma and abscess), the compact nature of the extracellular space causes increased impediment to motion of water molecules and the resultant water diffusion in such tissues is said to be "restricted". On the contrary, in tissues that are necrotic or fluid filled (*e.g*., cysts), there is unrestricted motion of water molecules and water diffusion in such tissues, which is said to be "free". Therefore, the diffusion properties in different tissues provide information on tissue cellularity and the integrity of cellular membranes\[[@B1],[@B2]\]. DWI is basically a modified T2 weighted sequence where the signal intensity depicts the tissue diffusion characteristics.
Single-shot spin-echo (SE) echo-planar technique is the most commonly utilized technique to acquire DW-MRI in combination with fat suppression\[[@B7]\]. To obviate the effect of motion, it can be acquired either using breath-hold or free breathing sequences with multiple signal acquisitions (in combination with respiratory and/or cardiac triggering). Free breathing sequences provide improved signal to noise ratios (SNR), thinner image sections, and higher number of b-values obtainable compared to breath-hold sequences. However, these take longer time (3-6 min) to acquire than breath hold sequences to evaluate the liver compared to free breathing EPI which takes (40-60 s)\[[@B8]\]. The free breathing technique has been shown to have better reproducibility of ADC values than other acquisition techniques like breath-hold, respiratory-triggered (RT), and navigator-triggered DWI\[[@B9],[@B10]\]. Although cardiac motion also impacts quantitative ADC measurements, cardiac triggering is not routinely used in clinical practice\[[@B11]\].
Intravoxel incoherent motion (IVIM) imaging is a technique that has been introduced to quantitatively study the effects of tissue perfusion on the signal acquired with DWI and it resolves DWI measurements into true molecular-based (*D*) and perfusion-related (*D\**, *f*) diffusion\[[@B12]\].
In patients with renal failure, gadolinium is contraindicated due to risk for developing nephrogenic systemic fibrosis (NSF)\[[@B13]\]. These patients also have a risk of worsening renal failure with iodinated CT contrast. MRI without contrast is a reasonable option for these patients but non-contrast protocols do not have a diagnostic accuracy comparable to multi-phase contrast MRI. DWI does not require administration of intravenous contrast, and because of its performance in oncological applications in general, it has generated much interest recently. The diagnostic performance of DWI has been tested in metastatic liver disease and HCC, and the results were comparable to contrast MRI\[[@B14]-[@B16]\].
CLINICAL APPLICATIONS IN LIVER
==============================
Imaging of focal liver lesions
------------------------------
**Lesion detection:** Multiphase contrast enhanced-MRI is currently the state-of-the-art imaging method for liver lesion detection and characterization. DWI at high *b*-values (≥ b100) provides a low background signal from normal liver parenchyma and thereby results in increased contrast between the background liver and lesions, enhancing the detection of focal liver lesions\[[@B17]\]. DWI is especially useful in detection of small lesions around vessels and in the periphery of liver which can be challenging to detect on routine T2 weighted images\[[@B18],[@B19]\]. The DW-MRI can be particularly valuable in oncologic patients with compromised renal function who cannot get intravenous gadolinium based contrast agents\[[@B14]-[@B16]\]. DWI adds value in oncologic patients (Table [1](#T1){ref-type="table"})\[[@B15],[@B20]-[@B22]\] by depicting more metastatic liver lesions when combined with multiphase contrast enhanced-MRI protocols, and improves reader confidence in lesion detection\[[@B22]-[@B25]\]. DW-MRI alone is less sensitive than gadoxetic acid-enhanced MRI for detecting liver metastases, but increases the sensitivity of detection for liver metastases (90.6%-95.5%) when combined with multiphase contrast enhanced MRI\[[@B25]\]. A major impact has been noted in the detection of metastases measuring ≤ 10 mm\[[@B17],[@B22],[@B24]-[@B27]\] (Figure [1](#F1){ref-type="fig"}). DWI has been used in detection of metastatic liver lesions from colorectal, pancreatic and neuroendocrine primaries\[[@B25],[@B28],[@B29]\].
######
Comparison of SSEPI diffusion-weighted magnetic resonance imaging *vs* conventional magnetic resonance sequences for detection of hepatic metastases\[[@B15],[@B20]-[@B22],[@B27]\]
**Ref**. ***b* value** **(s/mm^2^)** **Compared with (Seq)** **Sensitivity of DWI *vs* other sequences** **Accuracy of DWI *vs* other sequences** **Advantages of DWI**
------------------------------------------------ ------------------------------- ------------------------------------------------------------------------------------- --------------------------------------------- --------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Bruegel et al\[[@B27]\] 50, 300, 600 5 different T2-TSE (Turbo Spin Echo) sequences 0.88-0.91 compared to 0.45-0.62 0.91-0.92 compared to 0.47-0.67 Better sensitivity and accuracy
Zech et al\[[@B21]\] 50 Fat suppressed T2WI 83% *vs* 61% \- Better image quality
Fewer artifacts
Better sensitivity
Hardie et al\[[@B15]\] 0, 50, 500 Gadolinium enhanced T1WI 66.3% *vs* 73.5% 88.2% and 88.2% for DW-MRI, 90.2% and 92.2% for CE MRI, respectively, for observers 1 and 2 Not significantly different
Donati et al\[[@B20]\] 0, 150, 500 Combined (Gd-EOB-DTPA) enhanced MRI/DWI *vs* Gd-EOB-DTPA enhanced MRI and DWI alone \- Gd- EOB-DTPA/DWI: 0.84 and 0.83 *vs* 0.73 and 0.72 for DWI alone Increase in diagnostic confidence
No significant increase in diagnostic accuracy
Colagranade et al\[[@B22]\] 0-500 Added value of DWI for lesion detection in unenhanced and Gd-EOB-DTPA enhanced MRI -62.5% for unenhanced MRI w/o DWI -81.1% for unenhanced MRI w/o DWI DWI improved all statistical parameters in the unenhanced examinations, as for nodules either smaller or greater than 1 cm. In EOB-enhanced examinations DWI increased specificity/negative predictive value
-85.0% for unenhanced MRI+ DWI -89% for unenhanced MRI + DWI
-95.6% for CE MRI -92.9% for CEMRI
-97.3% for CE MRI + DWI -95.5% for CE MRI + DWI
DWI: Diffusion-weighted imaging; MRI: Magnetic resonance imaging.
{# | {
"pile_set_name": "PubMed Central"
} |
I. INTRODUCTION & BACKGROUND {#acm20054-sec-0001}
============================
Magnetic resonance imaging (MRI) is increasingly used in radiation oncology departments for radiation treatment planning because of the excellent contrast for soft tissues and tumors.^(^ [^1^](#acm20054-bib-0001){ref-type="ref"} ^--^ [^3^](#acm20054-bib-0003){ref-type="ref"} ^)^ MRI is also considered a primary imaging modality for Gamma Knife (GK) stereotactic radiosurgery treatment planning. Important MRI safety issues that may be new to the radiation oncology clinic include potential damage and injury to property, patients and staff from several sources: the rapid acceleration of nearby ferromagnetic objects by the high‐static magnetic field (up to 3 T for clinical units);^(^ [^4^](#acm20054-bib-0004){ref-type="ref"} ^--^ [^11^](#acm20054-bib-0011){ref-type="ref"} ^)^ the gradient fields, which have been shown to induce nerve stimulation in humans;^(^ [^12^](#acm20054-bib-0012){ref-type="ref"} ^,^ [^13^](#acm20054-bib-0013){ref-type="ref"} ^)^ the cryogenics, which can cause severe frostbite, suffocation, and substantial explosions if the pressure relief system of the cryogen containers become defective;^(^ [^14^](#acm20054-bib-0014){ref-type="ref"} ^)^ and the radiofrequency (RF) fields, which are likely the primary source of MRI‐induced thermal injury.^(^ [^9^](#acm20054-bib-0009){ref-type="ref"} ^,^ [^15^](#acm20054-bib-0015){ref-type="ref"} ^--^ [^23^](#acm20054-bib-0023){ref-type="ref"} ^)^
This study is motivated by the increasing number of reports of MRI‐induced patient thermal injuries, including burns,^(^ [^9^](#acm20054-bib-0009){ref-type="ref"} ^,^ [^13^](#acm20054-bib-0013){ref-type="ref"} ^--^ [^23^](#acm20054-bib-0023){ref-type="ref"} ^)^ and by our clinic\'s use of a dedicated 3T MR simulator^(^ [^1^](#acm20054-bib-0001){ref-type="ref"} ^,^ [^2^](#acm20054-bib-0002){ref-type="ref"} ^)^ that serves as an integral part of an active GK radiosurgery program. The causes of reported MRI‐induced thermal injuries and burns are often not well understood, are sometimes described as unknown or mysterious, and seem to originate with different heating mechanisms. In some cases, burns were associated with wires used with electronic monitoring equipment or implanted biomedical devices such as pacemakers,^(^ [^8^](#acm20054-bib-0008){ref-type="ref"} ^--^ [^11^](#acm20054-bib-0011){ref-type="ref"} ^,^ [^15^](#acm20054-bib-0015){ref-type="ref"} ^,^ [^17^](#acm20054-bib-0017){ref-type="ref"} ^,^ [^20^](#acm20054-bib-0020){ref-type="ref"} ^--^ [^24^](#acm20054-bib-0024){ref-type="ref"} ^)^ while in other cases, thermal injuries have occurred with no wires present near the patient, in the extremities or around tattoos,^(^ [^24^](#acm20054-bib-0024){ref-type="ref"} ^)^ for instance. While the specific situations leading to these injuries may be difficult to pinpoint, the heating mechanisms causing them are not mysterious. They are the well‐understood physical phenomena of electromagnetic induction and the antenna effect, both originating with the radiofrequency (RF) outputs of the MRI machine.
In 2003, headframe and GK manufacturer, Elekta, (Elekta AB, Stockholm, Sweden) notified users of the availability of "insulated posts", with the stated use for "high tesla MR units and high frequency MR sequences".^(^ [^25^](#acm20054-bib-0025){ref-type="ref"} ^)^ Beginning at approximately the same time, reports to the US Food and Drug Administration (FDA) documented thermal injuries due to MR‐induced heating for patients wearing stereotactic headframes.^(^ [^26^](#acm20054-bib-0026){ref-type="ref"} ^--^ [^33^](#acm20054-bib-0033){ref-type="ref"} ^)^
The physical explanation of these reported thermal injuries has not been given. Thus, this study seeks to prevent MRI‐induced burns in GK patients by first understanding the physical mechanisms that could lead to these injuries and, subsequently, validating the technique recommended to prevent them. The manufacturer\'s recommended burn prevention technique is to replace the tapped holes at the GK headframe screw--post interface, a metal‐to‐metal junction, with snap‐in insulated nuts. The use of the insulated headframe posts is required for both 1.5 T and 3 T MRI scans.^(^ [^34^](#acm20054-bib-0034){ref-type="ref"} ^)^ The use of uninsulated posts is permitted for X‐ray‐only procedures, such as CT scans or biplanar projection angiography.
A. MRI‐induced heating mechanisms {#acm20054-sec-0002}
---------------------------------
Previous studies of MRI‐induced burns considered three potential heating mechanisms:^(^ [^15^](#acm20054-bib-0015){ref-type="ref"} ^,^ [^16^](#acm20054-bib-0016){ref-type="ref"} ^)^ 1) resistive heating from currents induced by direct electromagnetic induction, 2) the unlikely coincidental presence of a conducting loop arranged perpendicular to the RF field and containing the right combination of inductance and capacitance to result in a resonant frequency equal to that of the MRI RF field (a special case of electromagnetic induction), and 3) the antenna effect, which is antinodal heating at the tips of wires or other conductors of appropriate length that act as antennas. A brief review of these potential heating mechanisms is presented.
The first mechanism, electromagnetic induction, is described by Faraday\'s law: $$\oint\overset{\rightarrow}{E} \cdot \overset{\rightarrow}{dl} = - d/_{dt}\left( \int{\overset{\rightarrow}{B} \cdot d\overset{\rightarrow}{a}} \right)$$ where $\overline{E}$ is the electric field, $\overline{l}$ is the distance around the loop, $\overline{B}$ is the magnetic flux density, and $\overline{a}$ is the cross‐sectional area enclosed by a conducting loop. This can be stated more simply as: $$V \propto dB/dt$$ where *V* is the voltage induced in the loop, *B* is the magnetic field, and *t* is time. In this case, the rapidly changing magnetic fields induce a current in loops of wire or other conducting material, with the area enclosed by the loop oriented perpendicular to the changing magnetic field. The voltage in turn induces a current: $$i = V/R$$ where *V* is the voltage and *R* is the resistance of the loop. The induced current is then dissipated as heat at a rate: $$P = i^{2}R$$ with the greatest heating occurring at locations with the highest resistance. These loops can be formed by wires, other conducting material such as the GK headframe posts, and/or loops of human tissue such as a patient with his arm forming a closed loop, or human tissue plus a section of wire forming a loop. The current will dissipate via resistive heating, the majority of which will occur at the position of highest electrical resistance which tends to occur at the skin--skin interface (e.g., loop formed by the arm), or the wire--skin interface (e.g., loop formed by a wire).
In the study by Dempsey et al.^(^ [^16^](#acm20054-bib-0016){ref-type="ref"} ^)^ different diameter loops of copper wire were placed perpendicular to the RF field and the temperature rise was recorded. Larger diameter loops resulted in more heating, consistent with Faraday\'s law. No resistor was placed in the loop and, therefore, the resistive heating was distributed evenly around the loop, resulting in a temperature rise along the whole loop. Had a resistor been placed in the loop, most of the heat would have been dissipated locally at and near the resistor, resulting in a higher temperature rise over a much smaller region of the loop. Whether the induced currents originated with the RF field or with the gradient field was not resolved in the Dempsey study. However, direct measurement of the induced voltage waveform in a loop of wire showed that the source of the heating is primarily the RF field.^(^ [^17^](#acm20054-bib-0017){ref-type="ref"} ^)^ Subsequent measurements confirmed this result, showing that reducing the magnitude of the RF signal reduces the induced voltage in the loop of wire.^(^ [^17^](#acm20054-bib-0017){ref-type="ref"} ^)^
Resonance heating is a second possible heating mechanism. Dempsey et al.^(^ [^16^](#acm20054-bib-0016){ref-type="ref"} ^)^ found very high temperature rises of up to 61°C in loops with appropriately valued inductance and capacitance to cause resonance. The resonant frequency of the loop is given by: $$f | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
The epidemiological effects of public disease-risk mitigation measures such as quarantines, school closures, vaccinations, trade interdictions, or travel restrictions have attracted considerable attention (see (Chowell et al. [@CR14]; Ferguson et al. [@CR21]; Chowell et al. [@CR15]; Shim and Galvani [@CR49]) for examples relating to SARS, ebola, and avian influenza). The net social benefits of such measures have also been assessed (Gupta et al. [@CR27]; Bridges et al. [@CR10]; Cauchemez et al. [@CR13]; Sadique et al. [@CR46]; Sadique et al. [@CR45]; Sander et al. [@CR47]). Less attention has been paid to the benefits of private disease-risk mitigation measures such as contact reduction, prophylaxis, private vaccination, or preferential mixing according to health status (Fenichel [@CR17]; Fenichel et al. [@CR20]; Gross et al. [@CR26]; Maharaj and Kleczkowski [@CR39]), and almost no attention has been paid to the net social benefits of private disease-risk mitigation (Reluga [@CR43]). We address this problem here.
We focus on the class of infectious diseases that allow recovery with immunity (see Table [2](#Tab2){ref-type="table"}). Since we model neither memory nor learning, recovery with immunity allows us to treat each outbreak as an independent event. We also ignore births and deaths. We suppose that susceptible and infected people behave in different ways as a function of disease risk, and not as a function of the infection itself (as in the case of, for example, gonorrhea (Yorke et al. [@CR54]; Blank et al. [@CR7])). Within each health class, we assume that all individuals respond to risk in the same way and so ignore any sources of heterogeneity in the behavioral response of individuals due to, for example, age, gender, or occupation (Albarracín et al. [@CR1]; Klepac and Caswell [@CR35]; Khan et al. [@CR34]). Among possible risk mitigation strategies, we focus on the case where reactive individuals, defined as susceptible, asymptomatic, or recovered asymptomatic individuals, preferentially mix with healthy people and avoid sick people.[1](#Fn1){ref-type="fn"} How much reactive people adjust their pattern of contacts depends on the relative costs of preferential mixing and the expected cost of illness. If the disease risk is positive, where risk is the probability of illness multiplied by its cost, individuals will invest in preferential mixing up to the point at which the marginal expected costs of disease and of disease avoidance are equalized. Investment in preferential mixing will increase with the cost of disease and decrease with the cost of disease avoidance.
We show that preferential mixing always reduces the size of epidemics, but increases their duration. We then compare the cost of epidemics with and without preferential mixing to measure when, and under what conditions, private disease-risk mitigation is socially beneficial. We show that the social net benefit of private disease-risk mitigation is systematically related to the characteristics both of the disease and of the society in which the disease occurs. If the benefit of avoided illness is high compared to the cost of avoidance, we find that private disease-risk mitigation always yields net benefits to society. As the relative benefits of avoided illness become smaller, however, so do the net benefits to society. Whether proportionate or preferential mixing is more costly then depends on the weight that society gives to the private cost of illness and the rate at which they discount future relative to present costs. We show the conditions under which private disease-risk mitigation results in a net loss to society and consider what this means for infectious disease management in general, for a rich/poor world in particular.
A mathematical model of private disease-risk mitigation {#Sec2}
=======================================================
Our modeling approach builds on existing affinity-based mixing compartment models (Hadeler [@CR29]; Hadeler and Castillo-Chavez [@CR30]; Busenberg and Castillo-Chavez [@CR11]; Morin et al. [@CR40]), where compartments represent different disease states. In most models, the probability of contact between individuals in different compartments depends only on their prevalence in the population (proportionate mixing). By contrast, we suppose that individuals mix preferentially, conditional on their own disease state and the (observable) disease states of others. As in (Fenichel et al. [@CR20]), a mixing strategy depends on the relative costs of illness and illness avoidance.
The core of the model is an affinity framework for the preferential mixing structure. This framework has been shown to provide the most mathematically general solution to the problem of *who mixes with whom* (Blythe et al. [@CR8]; Levin [@CR37]). Groups may be defined by various shared attributes, including economic status, cultural or ethnic identity, geographical location, age, or disease awareness. In this paper, we define groups by their epidemiological status. The use of the affinity framework allows for three different factors to control the volume of contact between groups: (1) the size of each group, (2) the nominal activity levels of each group, and (3) the relative affinity/disaffinity between groups. We model the decision process behind changes in the affinity/disaffinity between groups, focusing on decisions made by susceptible or asymptomatically infectious (a subset of reactive) individuals. We hold the nominal level of activity (volume of contacts) constant throughout the course of the epidemic to measure more accurately the effect of changes in mixing preferences (see (Fenichel et al. [@CR20]) for a treatment that affects only the volume of contacts for the reactive class and (Morin et al. [@CR40]) for more details on varying contact volume versus contact type). To illustrate the approach, we first focus on a susceptible-infectious-recovered, *SIR*, model:$$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ \begin{array}{l}\frac{dS(t)}{dt}=-c\beta S(t){P}_{SI},\hfill \\ {}\frac{dI(t)}{dt}=c\beta S(t){P}_{SI}-\gamma I(t),\hfill \\ {}\frac{dR(t)}{dt}=\gamma I(t).\hfill \end{array} $$\end{document}$$
As is standard with such a model, we let *c* be the nominal contact volume of all individuals. *P* ~*SI*~ is the conditional probability that a contact made by a susceptible individual, *S*(*t*), is with an infectious individual, *I*(*t*), and *γ* is the rate at which an individual recovers and becomes immune, *R*(*t*).
The affinity-based mitigation framework involves specification of a mixing matrix, *P* = (*P* ~*ij*~), that is generally taken to satisfy three mixing axioms at each moment in time *t* (Busenberg and Castillo-Chavez [@CR11]; Blythe et al. [@CR8]; Castillo-Chavez et al. [@CR12]):0 ≤ *P* ~*ij*~ ≤ 1, for all *i*, *j* ∈ {*S*, *I*, *R*},$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ {\displaystyle \sum_{j\in \left\{S,I,R\right\}}{P}_{ij}}=1 $$\end{document}$, for all *i* ∈ {*S*, *I*, *R*},*i*(*t*)*P* ~*ij*~ = *j*(*t*)*P* ~*ji*~, for all *i*, *j* ∈ {*S*, *I*, *R*}.
The first two axioms imply that *P* is a matrix of conditional probabilities, and the third implies that it is symmetric. Susceptible individuals carry the same expected risk of encountering infection as the expected risk of infectious individuals encountering susceptible individuals. It has been shown that the unique solution to these mixing axioms is given by$$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ {P}_{ij}=j(t)\left[\frac{M_i{M}_j}{V}+{\phi}_{ij}\right], $$\end{document}$$where$$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ \begin{array}{l}{M}_i=1-{\displaystyle \sum_{k\in \left\{S,I | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .447}
{#sp2 .448}
{#sp3 .449}
{#sp4 .450}
{#sp5 .451}
{#sp6 .452}
{#sp7 .453}
{#sp8 .454}
{#sp9 .455}
{#sp10 .456}
{#sp11 .456-1}
{#sp12 .457}
{#sp13 .458}
{#f1 .456-1}
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The morphogenesis and functional development of the mammalian central nervous system is regulated by the interaction of genes expressed at specific times and locations during development. The roles of these genes can be better understood by studying their spatial and temporal expression patterns. Most studies of gene expression pattern analysis use invasive methods to generate their data. As a result, little spatial information is preserved during sample processing, and pattern analysis is restricted to a local area. To relate the genetic information to the brain anatomy, the Mouse Biomedical Informatics Research Network (BIRN) project has generated a multimodal atlas for adult mouse brain and created an atlas interface (Mouse BIRN Atlasing Toolkit---MBAT) which can incorporate genetic information in an anatomical context (Boline et al., [@B2], <http://www.nbirn.net/tools/index.shtm>). The ultimate goal is to use the atlas as a framework for centralizing gene expression data collected using different methods and from separate laboratories, so the cross-community, cross-modality data correlation can be standardized. Currently, this atlas interface incorporates gene expression data obtained with microarray assay to the atlas space based on anatomical concepts. It also allows registration of *in situ* data of adult mouse brain to the orthogonal planes of adult brain atlas. In this study, we aim to extend the anatomical framework to a neonatal developmental stage and use it to incorporate data of gene expression assays shown in image formats, which are usually used to compensate for the low resolution of microarray assay.
To study the contribution of genes in brain development, a high-resolution anatomical framework at an early developmental stage is essential to correlate the distribution of gene products and the cell type within each structure. Although the basic anatomical architecture of a mouse brain at postnatal day 0 (P0) is similar to an adult one, the neonatal brain is not simply a smaller version of the adult brain. Due to incomplete nerve myelineation and differentiated maturation for different brain structures at P0, some of the anatomical structures at P0 cannot easily be referenced from the atlas of adult brain. Currently available high-resolution brain atlases for early developmental stages only provide a limited number of sections and structural delineations (Jacobowitz and Abbott, [@B8]; Schambra et al., [@B16]). In addition, since these neonatal atlases use paper format and individual atlas planes are not spatially in register, it is difficult to use them to integrate and present the information acquired from other sources into the atlas space.
Previously, we defined a standard atlas space with stereotaxic coordinates for the neonatal (P0) C57BL/6J mouse brain using MRI brain volumes (Lee et al., [@B9]). Although this atlas represents a native space of brain volumes and provides a 3D anatomical framework, it does not provide cellular scale resolution. Here, we extend past efforts by incorporating high-resolution Nissl-stained data, which reveals cytoarchitecture of brain structures, into the previously developed P0 digital atlas. As images with detailed anatomy are co-registered to the standard space, high-resolution anatomical space can be indexed using the stereotaxic coordinates. The neonatal atlas therefore provides a region-specific framework which allows data association based on anatomical and/or spatial relations.
The serviceability of the high-resolution anatomical framework of the atlas can be illustrated by incorporating gene expression data generated using invasive staining methods, such as *in situ* hybridization and immunohistochemistry staining, to the atlas space. Gene expression analyses using these methods are performed by staining thin brain slices; therefore, the results of single assays are restricted to a single plane. In order to differentiate between different gene products, one or a few genes are assayed in a single data image. It is labor intensive to perform sample preparation throughout the whole brain, and many laboratories focus their experiments on specific regions. Thus, results from single experiments usually provide only a regional picture of gene activity. These assays reveal the precise anatomical location where the gene product is distributed but reconstruction of the gene expression patterns using multiple assays compensates for the restrictions due to the staining methods, and greatly enhances the significance of single studies. This can be achieved by combining gene expression datasets in a common atlas framework. Co-displaying the data with brain anatomy also allows one to establish relationships between the differentiated distribution pattern of gene products and specific anatomical systems, potentially providing better data realization and interpretation.
Individual images can be related to the 3D atlas space with a plane equation that computes the atlas brain slice corresponding to the experimental data. Since the functions of anatomical structures are the result of the interaction of several genes, associating high-resolution gene expression data with high-resolution anatomical models would provide a better insight into how gene products contribute to functional differentiation during early brain development.
Materials and Methods
=====================
Constructing the high-resolution P0 atlas
-----------------------------------------
### Preparation of histological volume
Brain slices of 25 μm thickness were collected coronally from a C57BL/6J mouse on the first day after birth (P0). These slices were stained, aligned, and warped to a reference MRI volume using the same protocols described in MacKenzie-Graham et al., [@B13]. The registration procedures employed corrected the slice distortions introduced during sample preparation. The 3D histological volume was reconstructed using 150 registered histological sections 50 μm apart. All animals were housed and treated in accordance with the UCLA Animal Research Committee guidelines.
### Labeling anatomical structures
Tissue labeling of the histological image volume was delineated on the images after 2D non-linear distortion were corrected. Labeling was done using BrainSuite2 (Shattuck et al., [@B17], <http://www.loni.ucla.edu/Software>). The delineation was based on coronal sections, aided by consultation of the orthogonal planes. Primary references were the prenatal mouse brain atlases of Jacobowitz et al., [@B8] and Schambra et al., [@B16]. Because the boundaries of most structures were left undefined in these primary references, delineations were inferred from the cytoarchitectural atlas of adult mouse brain (Paxinos and Franklin, [@B15]) based on cell arrangement, and relative position to the surrounding structure and 3D morphology.
The nomenclature and abbreviation used were primarily based on Paxinos and Franklin\'s mouse brain atlas, thus remaining consistent with those used in the predefined atlas-based database (MacKenzie-Graham et al., [@B13]). If the structures in the anatomical database were hard to discriminate in the stained slices, they were labeled as their parent structures based on the hierarchical relations defined in the adult mouse brain (Paxinos and Franklin, [@B15]) and Brain Architecture Management System (Bota et al., [@B3], BAMS <http://brancusi.usc.edu/bkms>). The relationships between anatomical structures were organized hierarchically and modeled using BrainGraph (MacKenzie-Graham et al., [@B12]).
### Registering histological image volume to the standard space
The reconstructed histological brain volume was re-sampled to the standard atlas space with the registration protocol described in Lee et al., [@B9]. In brief, the histological brain was first co-registered to the MRI-based atlas using a 12-parameter transformation (Woods et al., [@B19]). An anatomical label volume was reconstructed from the delineations based on the defined anatomical hierarchical relations such that it had the same 13 features defined in the low-resolution MRI-based atlas. Feature-based warping was then performed by maximizing the mutual information between the anatomical labels of the two brain volumes (Leow et al., [@B11]).
Manage gene expression data using the atlas framework
-----------------------------------------------------
Two XML-format documents are used to manage the gene expression data. An in-house atlas visualization interface uses these documents to display and manage data in the atlas space. The "contours" document is used to specify the areas with enriched gene expression in each image, and the "DataSet" document is used to group image data assayed for the same target (e.g., brain slices from the same batch of assay). Data management using XML format allows flexible data modeling in various atlas interfaces and will facilitate data sharing across different information systems.
### "Contours" document
This document describes the spatial locations of the regions of interest (ROI, e.g., areas with positive signal in gene expression data) for each image and the expression level of these areas within that image. Each ROI is represented with a "contour" element, and the "contour" elements with the same ROI properties are organized under a "contours" element. The property of these grouped ROI (e.g., expression pattern, level) is indicated with the "ID" attribute of the "contours" element. The location of ROI in the source image is specified with pixel coordinates of the corresponding contour points and the coordinate values of each contour are retained using multiple "vertex" elements. In summary, the "contours" document represents the gene expression patterns in an image with the following schema organization: 
The "Volume-Source" schema specifies the image file presenting these contours, and "Space-type" indicates whether pixel or real coordinates are used in the "vertex" schema. Note that the vertex coordinates of this document report the locations of the ROI on the experimental image. Therefore, documentation and delineation of the gene expression pattern is independent of the data-to-atlas spatial relations. Once the data-to-atlas spatial relationship is identified, the coordinates of the vertices may be transformed to the 3D atlas coordinates.
### "DataSet | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec001}
============
The *pugilist* (*pug*) gene of *Drosophila melanogaster* encodes an enzyme with three activities in tetrahydrofolate metabolism. Null mutations of *pug* cause a subtle, transitory and recessive reduction in pteridine pigmentation in the eyes of newly-eclosed flies. The dominant *pug*^D^ mutation reduces pigment throughout the eye, with an effect that is especially noticeable in a background where only pteridines are present, e.g. *vermillion* (*v*). The eyes of such flies (*v; pug*^*D*^*/+*) exhibit an unusual ring of pigmentation around the periphery of the eye and a few scattered spots of pigment in the center of the eye, but are otherwise completely white-eyed. Ommochrome pigmentation is also affected by *pug*^*D*^, but to a lesser degree \[[@pone.0151377.ref001]\]. The protein encoded by *pug* has also been implicated in the response to Parkinson\'s disease, aging and oxidative stress, immunity \[[@pone.0151377.ref002]--[@pone.0151377.ref006]\].
The *pug*^*D*^ mutation was created at one of the junctions of an X-ray induced inversion on chromosome *3*. The mutant allele consists of three parts assembled from three different genomic locations. The upstream regulatory elements and the first approximately one-third of the coding region, including the start codon, are derived from the *pug* gene, which normally encodes the tri-functional methylenetetrahydrofolate dehydrogenase (MTHFD, located at 86C) and generates products that participate in 1-carbon transfer reactions. This activity is prominently involved in purine synthesis, and since pteridine biosynthesis is based on GTP, this provides one possible connection between *pug*^*D*^ and pigment deposition (reviewed \[[@pone.0151377.ref007]\]). The portion of the gene that remains in the *pug*^*D*^ allele should encode approximately two-thirds of the methylene tetrahydrofolate dehydrogenase and cyclohydrolase domain \[[@pone.0151377.ref008]\]. It lacks the ATP-binding site and the entire formyltetrahydrofolate synthetase domain. It seems unlikely that *pug*^*D*^ retains any of its normal enzymatic functions. The second *pug*^*D*^ coding segment is approximately one kb of highly repetitive sequence, consisting almost entirely of iterations of the satellite sequence AGAGAGA (although oriented with TCTCTCT on the sense strand in *pug*^*D*^). These almost certainly derive from centric heterochromatin where such repeats are abundant \[[@pone.0151377.ref009]\], and were captured at the inversion junction during repair of the breakpoint that generated the inversion. Transcription and translation of both coding segments is necessary for the mutant phenotype \[[@pone.0151377.ref001]\]. The translated repeats constitute about two-thirds of the pug^D^ protein. The third portion consists of *rab7* oriented in the opposite direction, and does not contribute to the *pug*^*D*^ phenotype.
Because *pug*^*D*^ does not simply reproduce the phenotype of a *pug* null allele, we consider *pug*^*D*^ to be a gain-of-function, rather than loss-of-function allele. The strong phenotype produced by *pug*^*D*^ relative to *pug*-*null* alleles, even in the presence of two copies of *pug*^*+*^, also indicates that it is not merely an antimorph. For these reasons, we consider the *pug*^D^ mutation to be neomorphic. This does not exclude the possibility that it also interferes with the action of *pug*^*+*^, but the Pug^D^ protein is clearly doing more than that.
The ring pattern of pigmentation produced by *pug*^*D*^ is certainly the most unusual aspect of its pug^D^ phenotype. A very limited number of mutations have been identified that produce a ring or partial ring pattern of pigmentation. The cause for such patterns has not been identified in any of these cases. In this study we explore the genesis of ring pigment patterns in *pug*^*D*^. We have observed that *pug*^*D*^ transgenes show a large degree of phenotypic variation, primarily in the thickness of the pigmented ring. The phenotypes range from those that are essentially identical to the original *pug*^*D*^, to weak alleles that are indistinguishable from wildtype \[[@pone.0151377.ref001]\]. The work we report here was carried out to determine the basis for the phenotypic variation, and to investigate models for the ring pattern of pigmentation.
Materials and Methods {#sec002}
=====================
Fly Stocks {#sec003}
----------
Mutations and chromosomes not described here are described by Lindsley and Zimm \[[@pone.0151377.ref010]\]. Flies carrying a *GMR-wg* construct were provided by Andrew Tomlinson \[[@pone.0151377.ref011]\]. Flies carrying the *Gla*^*1*^ mutation were provided by Konrad Basler \[[@pone.0151377.ref012]\]. Flies with the construct p*P\[w*^*+*^, *GMRP35\]* were provided by Bruce Hay \[[@pone.0151377.ref013]\]. Flies with the construct p*P\[sev-wg\]* were provided by Kenneth Cadigan \[[@pone.0151377.ref014]\].
*Glazed* and *GMR*-wg Crosses {#sec004}
-----------------------------
To assess the effect of ubiquitous *wingless* expression in the eye we crossed *v; pug*^*D*^*/TM6* females to either *GMR-wg/TM7* males, to *Gla*^*1*^ *Bc bw/CyO* males \[[@pone.0151377.ref012]\] or to *+/Gla*^*1*^ *Bc Elp* males (in which the + homolog carried an unidentified deficiency). The *v* sons with the desired *wg* allele were examined for pigmentation.
Eye Injection Experiments {#sec005}
-------------------------
Pupae of *v; pug*^*D*^ */TM3*, *Ser* were picked at stages ranging from 0 to 2 days into pupation. They were mounted on slides with double stick tape. A glass needle similar to that used for embryo injections was employed to inject solutions into the eyes of these pupae. Injected pupae were left on slides placed on moist paper. The solutions injected were: (1) 0.85 mM guanosine in pH2.0 HCl solution (guanosine); (2) pH2.0 HCl solution (HCl); (3) 0.5X PBS solution (PBS).
*pug*^*D*^ Transgenes {#sec006}
---------------------
The construction of *pug*^*D*^ transgenes in the vector *P\[X97\]* has been previously described \[[@pone.0151377.ref001]\]. The construct used for most experiments reported here carried the 3.4 kb *Kpn*I---*Bam*HI *pug*^*D*^ genomic fragment. This fragment contains only the promoter for the two short transcripts identified for this gene (pug-RA, pug-RC), and contains no coding sequences from the adjacent gene CG14863 (Flybase: \[[@pone.0151377.ref015]\]). The *pug*^*S*^ gene was a derivative of the original *pug*^*D*^ clone in which the AGAGAGA repeats were spontaneously reduced to 300 bp during overnight bacterial culturing.
*P* Element Transposition Screen {#sec007}
--------------------------------
The *X* chromosome insertion 1A carries the *P* element construct of p*P\[X97*, *pug*^*D*^*\]* which has the *v*^*+*^ marker \[[@pone.0151377.ref001]\]. Females of the genotype *v P\[X97*, *pug*^*D*^*\]1A; ry* were crossed to *w*^*1118*^*; Sb Δ2--3 (99B)/TM6*, *Ubx* males, which carry the *Δ2--3 (99B)* insertion to provide P transposase \[[@pone.0151377.ref016]\]. Individual *v P\[X97*, *pug*^*D*^*\]1A; Sb Δ2--3 (99B)/ry* males were mated to two or three *v; ry* females. *Sb*^*+*^ male offspring that are *v*^*+*^ (with or without any pigmentation defect) were retained. From the offspring of a single male, one fertile male was kept among the *v*^*+*^ males with the same pigmentation pattern. This ensured that only males with independent *P* transposition events to autosomes were retained. Lines were established from these males. Each line was assigned with a number. All the v^+^ lines with normal pigmentation were later discarded except three: 46A, 50 and 74. All the lines were mapped by segregation from dominantly marked autosomes. No insertion on chromosome *4* or *Y* was recovered.
FLP-Mediated DNA Mobilization {#sec008}
-----------------------------
Mobilization experiments were done as described \[[@pone.0151377.ref017]\]. Briefly, for insertions on chromosome *3*, females that were *w*^*1118*^ *P\[ry*^*+*^, *70FLP\]3F; P\[RS3r\]/TM6 | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
*Diuraphis noxia* (Kurdjumov, Hemiptera: Aphididae---or Russian wheat aphid, RWA) biotypes are morphologically similar, yet display vast differences in their capacity to damage wheat cultivars upon feeding (i.e., their virulence) (Botha, [@B11]). In South Africa, the virulence of the four wild type and the mutant RWA biotypes is as follows in order from least to most virulent: SA1 \< SA2 \< SA3 \< SA4 \< SAM (Swanevelder et al., [@B92]; Jankielsohn, [@B51]). Despite the emergence of new RWA biotypes in South Africa (Tolmay et al., [@B96]; Jankielsohn, [@B50], [@B51]), and other parts of the world, including the United States of America (USA) (Haley et al., [@B42]; Burd et al., [@B19]; Randolph et al., [@B76]) and Argentina (Clua et al., [@B26]), the molecular mechanism(s) underlying the development of new biotypes is currently unknown (Shufran and Payton, [@B84]; Botha et al., [@B12]). The known genealogy of SA1 and SAM (Swanevelder et al., [@B92]), their genetic similarity (Burger and Botha, [@B20]) and their position on either end of the virulence spectrum, renders them particularly useful in the present study, to improve the understanding of the process of biotypification. The possibility of a link between RWA methylation and biotype virulence has previously been suggested (Gong et al., [@B38]; Breeds et al., [@B18]). In 2012, Gong et al. investigated the methylation of four genes encoding salivary gland proteins (putative effector genes) in RWA biotypes US1 and US2, and found these genes to be differentially methylated in the different biotypes. In the initial investigation of South African RWA methylation (Breeds et al., [@B18]), the different biotypes exhibited different banding patterns (after restriction of their DNA with methylation-sensitive enzymes), methylation levels and methylation trends, all of which support a role for methylation in biotypification.
The epigenetic modification of DNA methylation involves the covalent addition of a methyl group to the 5′ position of cytosine (Glastad et al., [@B35]; Lyko and Maleszka, [@B63]). In insects, methylation occurs predominantly within genes (Walsh et al., [@B100]; Zemach et al., [@B107]; Glastad et al., [@B35]; Lyko and Maleszka, [@B63]), where to date it is reported to perform two major functions. Firstly, intragenic methylation affects alternative splicing by recruiting or interfering with different DNA binding factors (Hunt et al., [@B47]; Glastad et al., [@B34]; Yan et al., [@B106]), and secondly, it prevents the initiation of spurious transcription at cryptic binding sites within genes (Hunt et al., [@B45], [@B46],[@B47]). Three classes of DNA methyltransferase (DNMT) proteins are involved in methylation of DNA and these perform different functions, with DNMT3 and DNMT1 establishing and maintaining methylation patterns, respectively, but with a less clear function for DNMT2. This class is known to show strong conservation in sequence and is suggested to be an ancient DNA methyltransferase that changed its substrate specificity from DNA to tRNA (Sunita et al., [@B91]; Iyer et al., [@B48]; Jurkowski and Jeltsch, [@B55]; Raddatz et al., [@B75]). Insects have a variety of combinations of the *DNMT* genes, with some lineages having lost one (e.g., *Bombyx mori* and *Triboleum castaneum*) or two (e.g., *Drosophila melanogaster* and *Anopheles gambiae*) classes of *DNMTs*, and others having multiple homologs (e.g., *Apis mellifera, Nasonia vitripennis*, and *Acyrthosiphon pisum*) within a certain *DNMT* class (Kunert et al., [@B59]; Marhold et al., [@B65]; Walsh et al., [@B100]; Xiang et al., [@B105]; Glastad et al., [@B35]; Feliciello et al., [@B30]). Despite their important function in DNA methylation, knowledge of RWA *DNMTs* is still lacking.
DNA methylation is removed through the process of demethylation, which can occur both passively and actively, with 5-hydroxymethylcytosine (5hmC) being a measurable intermediate of one of the active demethylation pathways (Branco et al., [@B17]; Kohli and Zhang, [@B57]). Hydroxymethylcytosine is formed through the oxidation of 5mC by ten-eleven translocation enzymes (TETs) (Tahiliani et al., [@B95]; Shen et al., [@B83]). The presence of 5hmC has only been reported in a few insects including *A. mellifera, T. castaneum, N. vitripennis* and *D. melanogaster* (Cingolani et al., [@B25]; Feliciello et al., [@B30]; Wojciechowski et al., [@B103]; Delatte et al., [@B28]; Pegoraro et al., [@B73]; Rasmussen et al., [@B77]). To determine the presence and extent of 5hmC in the RWA, an antibody specific to 5hmC was used, providing the first insight into RWA demethylation.
The objective in this study was firstly to sequence and compare the epigenome of RWA biotypes SA1 and SAM, and determine the level, location (e.g., intergenic or genic, exonic or intronic), and contexts of DNA methylation (i.e., CpG, CHH, CHG) within the genomes of these RWA biotypes with differential virulence. Secondly, to quantify global methylation (5mC) and demethylation (5hmC) in the South African biotypes with shared genealogy; and thirdly, to characterize the DNA methyltransferases (*DNMTs*) and ten-eleven translocase enzyme-like (*TET*) genes and expression in these aphids, to relate these observations to the reported difference in virulence levels of the South African RWA biotypes SA1 and SAM.
Materials and Methods {#s2}
=====================
Aphid Rearing
-------------
For whole genome bisulfite sequencing and measurement of global methylation (5mC) and hydroxymethylation (5hmC) levels, colonies of apterous parthenogenetic female aphids of South African RWA biotypes SA1 and SAM were separately established in BugDorm cages (MegaView Science Education Services Co. Ltd., Taiwan) in an insectary with the following conditions: 22.5 ± 2.5°C, 40% relative humidity, and continuous artificial lighting from high pressure sodium lamps as previously described (Breeds et al., [@B18]). In all instances triplicate colonies of each biotype were established. Stock colonies of RWA biotype SA1 were maintained on the wheat line Tugela (susceptible) and biotype SAM on the near isogenic wheat line Tugela-*Dn1* (resistant). To avoid any environmental effects due to feeding on different wheat plants, aphid biotypes were transferred to the susceptible cultivar "SST356" 1 month prior to DNA extraction for the whole genome bisulfite sequencing. In all instances, treatments were conducted using separate BugDorm cages in triplicate (*n* = 3 × 2).
For *DnDNMT* expression analysis (0h), RWA biotype SA1 was maintained on the "SST 356" wheat cultivar (susceptible), while the highly virulent SAM biotype was maintained on "SST 398" (RWA resistant), and then transferred to the susceptible "SST 356" wheat cultivar 1 month prior to RNA extraction and cDNA synthesis.
For the RNAseq analysis, colonies of apterous parthenogenetic female aphids of South African RWA biotypes SA1 and SAM were separately established in BugDorm cages (MegaView Science Education Services Co. Ltd., Taiwan) in an insectary with the following conditions: 22.5 ± 2.5°C, 40% relative humidity, and continuous artificial lighting from high pressure sodium lamps as previously described (Breeds et al., [@B18]). RWA biotype SA1 was maintained on the wheat line Tugela (susceptible) and biotype SAM on the near isogenic wheat line Tugela-*Dn5* (resistant). Multiple individual replicates, consisting of 50 aphids of various life stages, were collected for each biotype. Collected aphids were flash frozen in liquid nitrogen and RNA was extracted following the protocol of Qiagen\'s RNeasy RNA extraction kit performing the optional on column Qiagen DNase treatment. Extracted RNA was assessed for quality through both bleach-gel electrophoresis (Aranda et al., [@B3]) and with an Agilent 2100 Bioanalyser using the RNA Nano 6000 kit (Babu and Gassmann, [@B4]). Three RNA samples, from each biotype, representing three biological repeats, with the highest RIN values (at least above 7) were used in | {
"pile_set_name": "PubMed Central"
} |
The sequence data for L. infantum 263 AMB1000.1 is available at the EMBL European Nucleotide Archive (<http://www.ebi.ac.uk/ena>) under study accession ERP001815.
Introduction {#sec001}
============
Protozoan parasites belonging to the *Leishmania* genus cause several vector-borne diseases collectively referred as leishmaniases. Currently, *Leishmania* species threaten *ca*. 350 million people in 88 countries worldwide \[[@pntd.0005171.ref001]\]. Control measures primarily rely on prevention and chemotherapy (reviewed in \[[@pntd.0005171.ref002]\]). The old-fashioned and toxic antimonial derivatives top the short list of registered compounds against *Leishmania* spp. In addition to their toxicity, pentavalent antimonials require long treatment schedules and are associated with resistance \[[@pntd.0005171.ref001], [@pntd.0005171.ref003]\]. Amphotericin B (AmB) liposomal formulations were introduced for the treatment of visceral leishmaniasis in antimonial-non-responsive regions of Bihar (India) \[[@pntd.0005171.ref004]\]. Clinical resistance to AmB is rare \[[@pntd.0005171.ref005]\] but a recent study in India has reported a *L*. *donovani* field strain resistant to AmB \[[@pntd.0005171.ref006]\]. Another leishmanicidal drug introduced in the early 21^st^ century is the alkyl-phospholipid analogue miltefosine (MF). It was the first effective oral drug showing high cure rates in the treatment of several forms of leishmaniasis. However, since its registration in 2002, it has had increasing relapse rates and the emergence of drug resistance strains \[[@pntd.0005171.ref007], [@pntd.0005171.ref008]\].
None of these drugs have a well-defined mode of action against *Leishmania* spp. and primary protein drug targets are unlikely \[[@pntd.0005171.ref009]\]. AmB seems to generate channel-like pores spanning the lipid bilayer by binding preferentially to ergosterol within the membranes, hence leading to cells death \[[@pntd.0005171.ref010], [@pntd.0005171.ref011]\]. Several reports suggest that MF is able to target lipid metabolism, in addition to glycosylphosphatidylinositol (GPI) anchor biosynthesis and signal transduction \[[@pntd.0005171.ref012]\]. MF-treated parasites show an increase in phosphatidylethanolamine (PE) and *lyso*-phosphatidylcholine (PC) content in their membrane \[[@pntd.0005171.ref013]\].
Both MF and AmB affect lipids in cellular membranes \[[@pntd.0005171.ref011], [@pntd.0005171.ref014]\], and resistance mechanisms seem to involve changes in lipids. AmB-resistance in *Leishmania* mainly implies changes in cell membrane fluidity (reviewed in \[[@pntd.0005171.ref015]\]). The sterol content of *L*. *donovani* AmB-resistant promastigotes analysed by gas chromatography coupled to mass spectrometry (GC-MS) revealed an enrichment in cholesta-5,7,24-trien-3*β*-ol \[[@pntd.0005171.ref011]\], which suggests a more fluid cellular surface. On the other hand, resistance to MF primarily implies a transport defect with inactivation of the P-type ATPase miltefosine transporter (MT), or of its regulatory subunit LdRos3, causing a decrease in the uptake of *lyso*-phospholipids \[[@pntd.0005171.ref016]--[@pntd.0005171.ref018]\]. A recent study has reported changes to the metabolism of lipids in *L*. *infantum* MF-resistant parasites \[[@pntd.0005171.ref019]\], further supporting that MF influences fatty acid and/or sterol metabolism \[[@pntd.0005171.ref020]\].
We report here that the MT is mutated in both MF and AmB resistant mutants. The mutations are associated with cross-resistance and correlate with major changes in membrane lipid composition. These modifications in lipid composition were analysed through a range of lipidomic approaches and we show that different mutations in MT trigger changes in lipid compositions leading to both MF and AmB resistance. These findings are of potential clinical relevance as the sequential treatment of liposomal AmB followed by a short 7-days administration of MF has been used against visceral leishmaniasis in India \[[@pntd.0005171.ref021],[@pntd.0005171.ref022]\].
Material and Methods {#sec002}
====================
*Leishmania* cultures {#sec003}
---------------------
The *Leishmania infantum* (MHOM/MA/67/ITMAP-263) wild-type strain (Ldi263 wt) and the *in vitro* generated resistant mutants AmB1000.1 and MF200.5 \[[@pntd.0005171.ref023], [@pntd.0005171.ref024]\], which are respectively resistant to 1000 nM of AmB and 200 μM MF, were grown in SDM-79 medium at 25°C supplemented with 10% fetal bovine serum, 5 μg/mL of haemin at pH 7.0 with either 200 μM of MF (Miltefosine, Cayman Chem.) or 1 μM AmB (Amphotericin B solution, Sigma) for the mutant strains, and 40 μg/mL G418 (Geneticin, Gibco-BRL) for the episomal overexpressors. EC~50~ values were calculated based on dose-response curves analysed by non-linear regression with GraphPad Prism 5.01 software. An average of at least three independent biological replicates was performed for each determination. Statistical significance between the mock-transfected wild-type and the tested strains was evaluated by unpaired two-tailed t test.
Whole genome sequencing for AmB1000.1 strain {#sec004}
--------------------------------------------
Genomic DNA was prepared from a mid-log phase clonal culture of *L*. *infantum* 263 AmB1000.1. A paired-ends sequencing library was prepared with the Nextera DNA sample prep kit and sequenced on an Illumina MiSeq platform with 250-nucleotide paired-ends reads. An average genome coverage of over 50-fold was obtained for the mutant. This approach allowed us to identify point mutations when comparing with the reference genome sequence of *L*. *infantum JPCM5* (TriTrypDB version 8.0) \[[@pntd.0005171.ref025]\] and *L*. *infantum* 263 wt \[[@pntd.0005171.ref026]\]. Sequence reads were aligned to the *L*. *infantum* JPCM5 genome using the software bwa-mem \[[@pntd.0005171.ref027]\]. The maximum number of mismatches was 4, the seed length was 32 and 2 mismatches were allowed within the seed. Read duplicates were marked using Picard (<http://broadinstitute.github.io/picard>) and we applied GATK for indel realignment and snp and indel discovery \[[@pntd.0005171.ref028], [@pntd.0005171.ref029]\] in *L*. *infantum* 263 AmB1000.1. PCR amplification and conventional DNA sequencing verified all putative point mutations detected by whole genome sequencing. Copy numbers variations were derived from read depth coverage by comparing the coverage of uniquely mapped reads between *L*. *infantum* 263 AMB1000.1 and *L*. *infantum* 263 wt along small non-overlapping genomic windows (5 kb) for the 36 chromosomes (normalized to the total number of uniquely-mapped reads for each strain) \[[@pntd.0005171.ref030]\]. Several python and bash scripts were created to further analyze the data. The sequence data for *L*. *infantum* 263 AmB1000.1 is available at the EMBL European Nucleotide Archive (<http://www.ebi.ac.uk/ena>) under study accession ERP001815 and sample accession ERS176091.
DNA constructs and transfection {#sec005}
-------------------------------
The LinJ.13.1590 and LinJ.16.1240 genes of *L*. *infantum* (LinJ10_V5.0) were amplified from genomic DNA using compatible primer pairs and PCR fragments were ligated into pGEM T-easy (Promega, Madison, WI, USA) for confirming the quality of the insert by standard sequencing, and then cloned in the *Leishmania* expression vector pSP72αNeoα \[[@pntd.0005171.ref031]\], which contains the gene neomycin phosphotransferase (NEO) as selectable marker in *Leishmania*. A total of 20 μg of plasmid DNA for episomal expression, either the empty vector (mock) or carrying the genes of interest, were transfected into *Leishmania* promastigotes by electroporation as described previously \[[@pntd.0005171.ref031]\]. Selection was achieved in the presence of 40 μg/mL G418.
Miltefosine uptake {#sec006}
------------------
Miltefosine uptake was performed as described previously \[[@pntd.0005171.ref019]\]. Briefly, *Leishmania* parasites were incubated in the presence of MT-11C-BODIPY \[[@pntd.0005171.ref032]\] for 1 h. Then fluorescence emission was recorded and used to calculate the moles of internalized MF analogue. An average of three independent biological replicates run in triplicate was performed. Statistical significance between the mock-transfected wild-type and the tested strains was evaluated by unpaired two-tailed t test.
Macrophage infections {#sec007}
---------------------
As previously published \[[@pntd.0005171.ref | {
"pile_set_name": "PubMed Central"
} |
{#sp1 .466}
| {
"pile_set_name": "PubMed Central"
} |
Transplant patients may have preexisting diabetes mellitus or develop transient postoperative hyperglycemia or permanent new-onset diabetes after transplantation (NODAT). NODAT increases mortality rate due to allograft rejection and also leads to increased cardiovascular disease.\[[@ref1]\] NODAT excludes transient posttransplant hyperglycemia and pretransplant undiagnosed diabetes, which are often unrecognized due to lack of effective pretransplant screening.\[[@ref2]\] Posttransplant diabetes mellitus, that is, presence of diabetes in posttransplant setting irrespective of timing of diabetes, may be preferred nomenclature.\[[@ref3]\] NODAT risk is highest in the first 6 months post transplant and increases progressively over time.\[[@ref1]\] Perioperative stress, infection, high calcineurin inhibitors\' (CNI) exposure, and glucocorticoid induction can cause transient post-transplantation hyperglycemia (TPH) in 90% of kidney allograft recipients, so diagnosis of NODAT should be delayed until the patient is on stable maintenance doses of immunosuppressants, with stable kidney graft function and in the absence of acute infections.\[[@ref4][@ref5]\] TPH is also a risk factor for NODAT.\[[@ref1]\]
The prevalence of NODAT is variable and is reported to be between 2% and 50%, probably owing to inconsistent definitions used for diagnosing NODAT.\[[@ref1]\] Though fasting glucose has a low sensitivity for diagnosing NODAT and oral glucose tolerance test (OGTT) is considered the gold standard test for diagnosis of NODAT screening patients using fasting glucose or afternoon glucose monitoring (induced by morning steroid) can identify high-risk patients requiring OGTTs.\[[@ref6]\] HbA1c greater than 6.5% is unlikely to be false-positive but may not exclude NODAT in the initial 3 months post transplantation due to anemia and rapid diabetes onset, so a lower HbA1c cut-off may be more sensitive. No glycemic indicator post transplantation is co-related with long-term outcomes.
There are many nonmodifiable and modifiable risk factors for NODAT, both conventional and novel. Pretransplant risk assessment can help individualize therapy and reduce NODAT risk. Nonmodifiable risk factors such as age, sex, and HLA type help in identifying patients at risk, and interventions on modifiable risk factors such as obesity, metabolic syndrome (MS), and HCV/CMV infection may prevent complications and improve outcomes. General risk factors include family history of diabetes mellitus, ethnicity, genetic polymorphisms, increasing age, obesity, MS, and prediabetes.\[[@ref1]\] Transplant-specific risk factors include donor sex, type of underlying renal disease, graft dysfunction, biopsy-proven rejection, specific antirejection agents, cumulative steroid use, tacrolimus level, human leukocyte antigen and ABO mismatch, TPH, and hypomagnesemia.\[[@ref1]\] Pretransplantation insulin resistance contributing to MS is a risk factor for NODAT, but increasingly pancreatic beta cell dysfunction, supported by several genetic (KNNJ11, TCF7L2) polymorphism studies, has gained prominence.\[[@ref1]\] The recent Indian study by Choudhury *et al*. found 17% prevalence of NODAT with beta-cell secretory defect, high waist circumference, and trough tacrolimus level as important factors for predicting NODAT.\[[@ref7]\]
Antirejection therapies such as glucocorticoids and sirolimus lead to increase in insulin resistance, while steroids increase hepatic glucose output and decrease insulin secretion in high doses. Low-dose corticosteroid is preferred but not steroid withdrawal as it increases acute rejection requiring pulse steroid which counterbalance metabolic beneficial effect.\[[@ref1]\] Split corticosteroid dosing may also reduce glycemic variability and peak hyperglycemia. CNI causes dose-dependent reduction in insulin secretion due to vacuolization and degranulation of islet cells and insulin gene transcription defect. Tacrolimus has five times higher risk of diabetes than cyclosporine. Immunosuppressive regimen therapies providing best patient and graft survival should be used irrespective of their NODAT risks as transplant rejection outweighs risks of NODAT.\[[@ref5]\]
Admission evaluation includes medical history, family and past history of dysglycemia, MS. Patients discharged without hyperglycemia should have fasting plasma glucose testing at least weekly during the first month, then every 3 months for 1 year, and annually thereafter.\[[@ref2]\] Lifestyle modification (LSM) may reduce risk of NODAT.\[[@ref2]\] Stepwise approach with LSM followed by oral antihyperglycemic agents (AHA) and then insulin is appropriate for management of late (\>6 months) NODAT, but in TPH and early NODAT the reverse regimen is preferred.\[[@ref2]\] Dose adjustments or cessation of oral AHA agents in the context of renal allograft dysfunction should be individualized. Insulin is the only safe and effective agent during high glucocorticoid doses and acute illness early post transplant. Basal insulin therapy in early posttransplant hyperglycemia (\<3 weeks) reduced risk of NODAT within the first year post transplantation by 73%.\[[@ref8]\] Insulin therapy in early postoperative phase may prevent NODAT through β-cell protection.\[[@ref8]\]
In summary, NODAT has a sudden onset and rapid development of complications such as graft failure, infection, and cardiovascular disease compared with a garden variety of type 2 diabetes mellitus. NODAT have unique causal factors, some of which may be modifiable. But there are diagnostic difficulties and treatment targets and agents are not well-defined. Early and aggresive management of hyperglycemia post transplant may prevent β-cell apoptosis and possibly prevent NODAT and its complications. NODAT confers an adverse prognostic outcome for transplant survival and mortality, so pretransplant risk stratification and posttransplant NODAT screening is imperative.
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction
===============
Importance of C-allocation in biotechnology and ecology
Recently, microalgae have attracted increased attention in the field of biomass production and biosynthesis of feed stock components or high valuable products like polyunsaturated fatty acids, antioxidants, pigments like carotenoids which can be used for food colorants, *etc*. The most challenging approach to increase the productivity is not only to develop photo-bioreactors which offer optimal conditions for algae growth, but also to increase the yield of a special product \[[@B1-metabolites-04-00453]\]. Since an increasing number of algal genomes are now available and genetic transformation protocols have been published to apply system biology for the green alga *Chlamydomonas reinhardtii* \[[@B2-metabolites-04-00453]\], but also for *Ostreococcus tauri* \[[@B3-metabolites-04-00453]\], the diatom *Phaeodactylum tricornutum* \[[@B4-metabolites-04-00453]\] and for *Nannochloropsis sp.* \[[@B5-metabolites-04-00453]\], there is increasing need to develop quantitative methods to measure the carbon flow from photosynthetic primary products into the component of interest. Typically, metabolic engineering is used to channel the carbon from sugar to lipid, starch, protein or secondary products like pigments. For this purpose the cells are genetically transformed either by inhibition of competitive pathways or by stimulation of the pathways that lead to the product. After having checked integration, expression and translation of the new gene, the simplest test to look for the metabolic effect of the transformation is to measure the content of the compound of interest during growth. However, genetic transformations of microalgae can also alter the overall activity of the cells leading for example to lower photosynthetic performance. In that case it is difficult to decide if the concentration of the product is influenced due to inefficient metabolic engineering or due to the impaired photosynthetic activity.
To understand changes in metabolic fluxes in the cellular network of carbon allocation the method of choice is metabolic profiling using carbon isotopes in pulse chase experiments. However, this methodology is time consuming, costly and can be improved by well-defined sampling, when the time points of the metabolic switch from one pathway to another can be identified (see below). Since a metabolic profile is a snap shot of the metabolic state at a given moment, the changes in the carbon allocation network can be detected only by comparing snap shots from different time points. However, cells grown in a light dark cycle or in batch culture change the metabolic profile also in response to the environmental conditions, internal clock oscillations or reorganize the metabolic network during a transition period to turn back to the initial state. This problem can be solved if the time scale of metabolic dynamics can be measured by fast and easy to handle methods which can be used to find a well-defined sampling. Here we present a new method of choice involving the application of Fourier Transform Infrared (FTIR) spectroscopy, which delivers information about the relative size of the cellular macromolecular pools that might change in response to metabolic engineering (e.g., protein, carbohydrate and lipid). A second problem of metabolic engineering is to measure cell internal carbon flux rates. A metabolic profile delivers at best relative concentrations of a set of metabolites but it does not tell the kinetics of changes in the pool size of the components identified. This is especially important for those metabolites which occur in different compartments in different activated states, e.g., phosphorylated *versus* non-phosphorylated or oxidized *versus* reduced form. Here again FTIR spectroscopy of intact cells can be used to measure flux rates between and into the macromolecular pools, but with much less molecular resolution than metabolic profiling. The paper gives an example for this approach.
2. Methodology of FTIR Spectroscopy and Statistics in Spectra Interpretation
============================================================================
Traditional analysis of C-allocation or protein:lipid:carbohydrate ratios by means of biochemical methods require relative huge amount of biomass (in the mg range) and due to their time consuming procedure they are not suitable for high throughput measurements. However, analyzing the macromolecular composition that consider the whole pool of cellular compounds need new approaches to become faster and decrease the amount of sample necessary to measure. UV-VIS spectroscopy itself has been established and accepted for quantifying a wide range of cellular compounds (e.g., pigments in algae cells). Far less attention has been given to FTIR spectroscopic methods, although a single spectra can be obtained in the range from less than 500.000 cells down to single cells compared to several mg necessary for standard biochemical methods. FTIR spectroscopy was used for the first time on phototrophic organisms by Kansiz *et al.* \[[@B6-metabolites-04-00453]\] to discriminate different cyanobacterial strains but not to quantify the biomass composition. However, this work initiated a variety of different methods and applications using FTIR spectroscopy to analyze cell biochemical features in phototrophic prokaryotes and algae. Within this review we will focus on the determination of biochemical cell composition and quantification of cell constituents (e.g., lipid content). Some key works in the last decade showed the applicability of IR spectroscopic methods for quantifying cellular protein, lipid and carbohydrate contents in phototropic prokaryotes and algae. The methods in general are based on the absorption of IR light by specific chemical bonds reviewed in Movasaghi *et al.* \[[@B7-metabolites-04-00453]\]. By absorbing IR radiation changes in dipole moment of chemical bonds are required. This leads to the generation of specific vibrational features e.g., bending and stretching at different wavenumbers due to the different frequencies (energy value) of IR radiation \[[@B8-metabolites-04-00453]\]. Therefore, a single macromolecule has a very characteristic absorption spectrum in the far red region of the light spectra composed of different absorption bands like amide I, amide II and amide III band for protein. These absorbance features of single macromolecules result in a complex cell spectrum ([Figure 1](#metabolites-04-00453-f001){ref-type="fig"}) which is composed of all IR active biochemical cell components. Since vibrational bands of macromolecules are strongly overlapping each other, the interpretation of cell spectra is one of the crucial challenges in IR spectroscopy.
Several methods have been developed so far, ranging from the use of peak ratios \[[@B9-metabolites-04-00453]\] over the determination of peak integrals \[[@B10-metabolites-04-00453],[@B11-metabolites-04-00453],[@B12-metabolites-04-00453]\] up to a complex mathematical fitting procedure of spectra using single reference spectra for a multiple linear regression analysis \[[@B13-metabolites-04-00453]\]. Different extinction coefficients for each chemical bond makes the interpretation even more complicate \[[@B8-metabolites-04-00453]\]. Therefore, it has to be distinguished between semi-quantitative changes of biochemical components on the one hand and absolute quantitative determination on the other hand. For semi-quantitative determination of changes in C-allocation like altered ratios of protein per lipid it may be sufficient to use absorbance peak ratios \[[@B14-metabolites-04-00453],[@B15-metabolites-04-00453]\]. Furthermore, ratios of band integrals can be used to monitor for example the relative lipid content \[[@B12-metabolites-04-00453]\]. These methods can be adequate for most of the applications e.g., monitoring cultures for responses to nutrient limitations (see below), but cannot provide absolute values. A semiquantitative approach for the determination of the macromolecular pools in species of different algae strains has been introduced by \[[@B16-metabolites-04-00453]\]. Within this study the cellular protein contents were measured by biochemical methods to correlate the ratio between the FTIR absorbance of the pool of interest and that of proteins \[[@B16-metabolites-04-00453]\]. Other applications that need more precise information on absolute quantitative amounts of protein, lipid and carbohydrate require more complex examinations. Here, two different main methodical approaches are established. The use of band integrals calibrated by external single standard substances for quantitative analysis of biomass composition has been performed by Pistorius *et al.* \[[@B10-metabolites-04-00453]\]. Here the absorption bands for lipid, protein and carbohydrate were baseline corrected and subsequently integrated ([Figure 1](#metabolites-04-00453-f001){ref-type="fig"}a). A calibration of these integrals has been performed using single substance spectra of phosphatidyl choline for lipid, creatine phosphokinase for protein and malt extract from starch hydrolysate for carbohydrate.
![Comparison of two different methods for spectra interpretation. (**a**) Peak integral quantification of macromolecule contents \[[@B10-metabolites-04-00453]\]. Peak integrals have been marked (green: lipid; blue: protein; orange: carbohydrate); (**b**) Spectra reconstruction by reference spectra (green: lipid; blue: protein; orange: carbohydrate) of the same cell spectra according to \[[@B13-metabolites-04-00453]\]. Vertical lines indicate main peaks of the cell spectra.](metabolites-04-00453-g001){#metabolites-04-00453-f001}
Since Pistorius *et al.* \[[@B10-metabolites-04-00453]\] measured in transmission mode, similar procedures can also be applied to attenuated total reflectance (ATR) spectroscopy \[[@B11-metabolites-04-00453],[@B17-metabolites-04-00453]\]. Mayers *et al.* \[[@B11-metabolites-04-00453]\] characterized 30 samples by biochemical methods and subsequently | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Head and neck cancer (HNC) is the sixth most common cancer worldwide \[[@CR1]\]. Currently, there are more than 62,000 people living with head and neck cancer in the UK \[[@CR2]\]. In Scotland, where incidence rates are significantly higher than the rest of the UK, a 37 % rise is predicted in the next 10 years \[[@CR3]\]. Patients are surviving longer and, due to human papillomavirus, are younger at diagnosis. The functional, psychological and social consequences of HNC cancer and its treatment can be severe and chronic. Treatment includes a combination of surgery, radiotherapy and/or chemotherapy, and the side effects of these can interfere with some of the most fundamental aspects of daily living, including eating, drinking, communication and appearance. Improved survival has been achieved at the expense of increased morbidity, especially in relation to swallowing problems or 'dysphagia' \[[@CR4]\].
Dysphagia affects up to two thirds of patients undergoing combined chemoradiotherapy (CRT) \[[@CR5]\]. Patients report major deterioration in their swallowing, and little evidence of recovery over time, with younger survivors reporting the most severe problems \[[@CR6]\]. Early side effects of CRT[1](#Fn1){ref-type="fn"} include pain, mucositis (inflammation of the mucous membranes) and xerostomia (dry mouth). Late effects include fibrosis (scarring) of the soft tissues, affecting the safety and efficiency of swallowing \[[@CR7], [@CR8]\]. Aspiration rates (food or fluid entering the airway) are high (≥60 %), leading to frequent hospitalisation for chest infection, pneumonia and even death \[[@CR5], [@CR8]\]. The effects of CRT contribute to significant weight loss, and 50--70 % of patients require a feeding tube during or after treatment \[[@CR9]\]. Tube dependency reduces the need to swallow, so increasing the likelihood of fibrosis of the muscles involved in swallowing, and in the long-term, 'disuse atrophy', sometimes leading to complete inability to swallow. Swallowing difficulties have a significant negative emotional and physical impact on social eating, return to work and everyday quality of life \[[@CR7]\].
Recent reviews \[[@CR10], [@CR11]\] suggest that prophylactic swallowing exercises may improve a range of short- and long-term outcomes, as they increase the blood flow to muscles, reducing or preventing fibrosis, and maintaining the range and speed of swallowing movements. However, not all trials have had positive results \[[@CR12]--[@CR14]\], and a number of questions remain, including the optimal timing, selection and duration of exercises, the achievement of intervention fidelity and, importantly, the support necessary to improve adherence \[[@CR10]\]. Only 13--14 % of participants practise swallowing exercises as recommended \[[@CR15], [@CR16]\]. An unpublished study found that patients with high levels of pain during treatment struggled with performing regular exercises and that it was difficult to focus on preventative exercises in the context of facing a potentially life-limiting disease. Furthermore, the intervention was not seen as integral to their overall care \[[@CR17]\]. There is, however, evidence that those who maintain their exercise schedule achieve improved swallowing outcomes \[[@CR18]\] and are significantly less likely to need a feeding tube \[[@CR19]\]---an important consideration given that feeding tubes are associated with significantly poorer quality of life \[[@CR20]\].
The multi-dimensional nature and impact of swallowing difficulties and the importance of psychological and behavioural factors on adherence to swallowing exercises has not been adequately studied \[[@CR21], [@CR22]\]. The need for further research, particularly prospective randomised trials to investigate the benefit of an intervention which includes pre-, peri- and post-treatment swallowing exercises has been highlighted repeatedly \[[@CR10], [@CR23], [@CR24]\].
This study aims to develop and test the feasibility of a Swallowing intervention Package (SiP) designed in partnership with patients, speech and language therapists (SLTs) and other members of the head and neck multi-disciplinary team (MDT), for patients undergoing primary or adjuvant CRT or radiotherapy for head and neck cancer. A development phase (phase 1), informed by focus groups with patients and consensus workshops with professionals, produced a swallowing exercise schedule, staff manual and SiP package for patients, including written materials, videos, reminder materials and an electronic e-SiP 'app' to support adherence. This protocol, based on version 5 (24.2.16) describes the feasibility study (phase 2) for this complex intervention, which aims to answer four research questions in preparation for a future multi-centre trial:What is the feasibility of delivery and potential impact of the SiP for patients and head and neck cancer teams?What are the barriers and facilitators to adherence and fidelity to the SiP?Does an e-support system (e-SiP) have potential to support patients to perform their exercises and for collecting patient-reported data through video diaries?Are the study processes and outcome measures feasible and acceptable to patients and staff?
Methods/design {#Sec2}
==============
This feasibility study uses quantitative and qualitative research methods, within a quasi-experimental parallel group design, to assess whether patients will tolerate and adhere to the SiP intervention, which aspects of the intervention can be implemented and which cannot, whether treatment fidelity can be achieved across different contexts, whether study processes and outcome measures will be feasible and acceptable and to what extent the intervention is likely to have an impact on swallowing dysfunction and quality of life.
Forty patients will be recruited to the SiP intervention group, from three hospital outpatient settings in Scotland, and a maximum of 30 patients will be recruited to a 'usual care' group, from sites in Scotland and the North East of England. This is a pragmatic design to allow for different service delivery models in different geographical areas. There is a trade-off between precision (recruitment parameter of numbers retained by study endpoint) and number of patients recruited to the study. A sample size of 59 is thought to be sufficient to identify any potential problems in feasibility which have a 5 % probability of occurrence at least once, with 95 % confidence \[[@CR25]\]. Several new sites have expressed an interest in participating and are being adopted in order to enhance recruitment.
To identify the variety of practical issues and problems faced by a 'real world' and inclusive 'typical' cohort of patients with head and neck cancer and the applicability of the intervention across this cohort, we will include people with/without prophylactic feeding tubes, from different demographic, diagnostic (e.g. oral, pharyngeal, laryngeal) and treatment (CRT and radiotherapy alone) groups.
Inclusion criteria:
Patients diagnosed with an index primary mucosal squamous cell carcinoma of oral cavity, nasopharynx, pharynx or larynx or unknown primary, who are planned for chemoradiotherapy or radiotherapy ≥30 fractions. This may include patients who have undergone surgery before their chemoradiation or radiotherapy. Patients must be able to give informed consent.
Exclusion criteria:
Patients with synchronous or metachronous head and neck cancer primaries, those undergoing palliative treatment, nonEnglish speakers, previously diagnosed dysphagia unrelated to HNC and those who have undergone total glossectomy or total laryngectomy.
Screening, recruitment and consent {#Sec3}
----------------------------------
All potentially eligible patients will be identified from the head and neck cancer MDT meetings. Eligible patients will be seen at routine appointments for treatment planning and invited to participate in the study by a member of the clinical team. The e-SiP app is being tested in Tayside, where patients eligible for the intervention are also eligible for the app version. The delegated individual will explain the study to the patient, give them the Patient Information Sheet (PIS) and answer any questions. Consent will be sought a minimum of 24 h later by a research nurse. The PIS for the intervention group explains that a Swallowing intervention Package of exercises and support has been developed and that we are now asking people to try this out and report their experiences, with the hope that we will be able to use these findings to underpin a larger trial. The PIS for the control group explains that patients will have no change to their usual care and will continue to have the swallowing support normally provided by their treatment centre. Both intervention and control patients are informed that taking part in the study will not affect any usual treatment that they may receive and that taking part may not benefit them personally.
At the time of consent the participant will also be asked to fill in the baseline study questionnaires, and a standard letter will be sent to their GP specifying the recruiting hospital and whether or not the patient is in the intervention or 'usual care' group. All patients will also be asked whether they and/or a close family member or friend would be willing to be approached for a subsequent qualitative interview with the research fellow, between 6 weeks and 3 months after treatment finishes, to explore their experiences.
In order to assess the representativeness of the sample, a screening log will record the number of patients who are (a) ineligible, (b) refuse to participate in the intervention or control cohorts and (c) decline specific aspects of the study (e.g. clinical assessments, questionnaires), as well as their reasons, where possible. The rights of patients to refuse to participate or withdraw without giving reasons will be respected. If patients do volunteer a reason for refusal, or for wishing not to use the e-SiP app versions, then these will be logged.
Clinical and socioeconomic characteristics {#Sec4}
------------------------------------------
At the point of recruitment, all participants are allocated a unique ID number. At baseline, the following data will be extracted from NHS patient records and recorded by research nurses/clinical teams in the study case report form:
Date of birth, sex, ethnicity, Index of Multiple Deprivation derived from | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
The World Health Organization (WHO) announced on Wednesday, March 11, 2020, the new coronavirus "COVID-19" disease as "a global epidemic" (WHO [@CR37]). In response to that, governments around the world have been taking a range of actions and measures, including the closing of schools, worship places, and workplaces, postponing and canceling huge public events, restricting public transport, the lockdown of movement of people, and ceasing domestic and international flights (Bherwani et al. [@CR9]; Bashir et al. [@CR6]). According to many studies, the COVID-19 is believed to transmit through airborne bioaerosol droplets. Nevertheless, different parameters such as the extent of urban air pollution and weather conditions might have a significant impact on the elevated rates of COVID-19 cases (Farhan Bashir et al. [@CR13]; Fareed et al. [@CR12]).
After the discovery of the first case of COVID-19 in the KSA on March 2, 2020, a series of actions were taken in response to the COVID-19 pandemic. The first three significant actions taken to control the spread of the pandemic were as follows: (i) suspension of Umrah pilgrimage (March 4), (ii) suspension of all schools and universities (March 8), and (iii) suspension of all international flights (March 9). With the spread of COVID-19 and the absence of vaccine and medication globally, the Saudi government imposed nationwide partial lockdown (from 7 PM to 6 AM) on March 23 followed by the restriction on movement between provinces on March 25. After that, the full lockdown was imposed nationwide on April 6. On May 28, the lockdown was partially lifted in all cities except Mecca, the movement between regions was eased, and shopping malls were opened. Following this, prayers were allowed in mosques except for the Great Mosque of Mecca, and the restrictions on domestic flights, restaurants and cafes, and parks were eased on May 31. The latest action was on June 21, where the partial lockdown was lifted on all regions. However, international flights remain suspended except repatriation flights for residents. Lastly, the Pilgrimage (Haj) was allowed to domestic residents and Saudi nationals only with limited numbers (MoH [@CR21]).
The COVID-19 lockdown measures affected many aspects of human activities including vehicle use, public transportation, and industrial processes (Pata [@CR26]; Gautam [@CR14]; Bashir et al. [@CR7]; Shehzad et al. [@CR29]). In addition, several researchers around the world reported that there is a mitigation of air pollution during COVID-19 lockdown compared with before period. For instance, Berman and Ebisu ([@CR8]) assessed the air quality during the COVID-19 pandemic using air quality data, including PM~2.5~ and NO~2,~ monitored in the USA between 2017 and 2020. The study found that statistically significant PM~2.5~ and NO~2~ reductions were noticed as 11% and 26%, respectively. Shakoor et al. ([@CR27]) investigated the changes in levels of air pollutants before and after lockdown periods in USA and China. The results showed that CO, NO~2~, and PM~2.5~ concentration reduced by 19%, 37%, and 1.1%, respectively in USA, while CO, NO~2~, SO~2~, PM~2.5~, and PM~10~ concentration decreased by 27%, 39%, 18%, 18%, and 38%, respectively, in China. Agarwal et al. ([@CR1]) found that lockdown measures in India and China resulted in improvements for the air quality indexes of PM~2.5~ and NO~2~ by 65% and 66% in India and 45% and 37% in China, respectively. Singh and Chauhan ([@CR31]) analyzed air quality changes before and after COVID-19 lockdown measures over India using ground-level and satellite observations. Their results demonstrated that the PM~2.5~ concentrations dropped by to 35%%, compared with pre-lockdown phase. In another study, Sharma et al. ([@CR28]) studied the changes in concentrations of air pollutants before and after lockdown periods in seven cities of India. They reported that PM~2.5~, PM~10~, NO~2~, and SO~2~ reduced by 23--58%, 24--44%, 30--64%, and 3.5--70%, respectively. Zambrano-Monserrate and Ruano ([@CR39]) reported that NO~2~ and PM~2.5~ levels in Ecuador importantly reduced just after the implementation of lockdown measures. At the regional scale, researchers studied the effect of climatic parameters on the spread of COVID-19. Their result showed that transportation and population numbers have a forward association with the infection rates (Barbieri et al. [@CR5]; Ahmadi et al. [@CR2]).
This study focuses on investigating the possible effects of the lockdown due to the COVID-19 pandemic on the air quality using meteorological and air quality datasets in the Eastern Province of the KSA.
Methodology {#Sec2}
===========
Description of the study area {#Sec3}
-----------------------------
The Eastern Province is the easternmost of the thirteen provinces of the KSA and located between latitudes of 29.16° N and 19.11° N and longitudes of 44.65° E and 55.66° E. The Eastern Province is the third most populated province with a total population of 4.9 million and the largest province (by area) of the KSA. The weather is hot in the summer season and mild for the rest of the seasons of the year. The long-term annual average values of the temperature and relative humidity are 27 °C and 41%, respectively. Wind systems from northern directions dominate over the area with an average ground-level wind speed of 4.2 m/s. The region has an arid precipitation regime and receives a total of 100 mm rainfall in a year between November and April (Anil et al. [@CR4]). The Eastern Province has been facing severe local and long-range dust storms because of the pressure gradients. During the summer season, hot, dry, and low-level northwesterly winds called "Shamal winds" blowing at a minimum speed of 10 m/s lift dust and sand to the local and remote regions (Karaca et al. [@CR16]; Anil et al. [@CR3], [@CR4]). Remarkable amounts of PM~10~ have been inhaled during episodic periods, resulting in a tremendous rise in the number of hospital admissions regarding respiratory issues (Tsiouri et al. [@CR34]). Tawabini et al. ([@CR32]) recently reported that the daily average PM~10~ concentrations of Dhahran, Khobar, and Dammam districts of the Eastern Province were 177, 380, and 126 μg/m^−3^, respectively, which were quite above than the WHO's daily PM~10~ guideline value of 50 μg/m^−3^ (WHO [@CR36]).
Air quality data and study period {#Sec4}
---------------------------------
The air quality dataset discussed in this research was obtained from the database of the General Authority of Meteorology and Environment Protection (GAMEP) including CO, SO~2~, NO~2~, O~3~, and PM~10~ in seven different locations of Eastern Province, which are Jubail (Station no. 1), Qatif (Station no. 2), Dammam (Stations nos. 3--5), and Al Ahsa (Stations nos. 7--8) cities. Furthermore, hourly concentrations of air pollutants have been measured and recorded at the fully automated mobile air quality monitoring station (Station no. 6) located inside the Dammam south campus of Imam Abdulrahman Bin Faisal University (IAU). The geographic locations of the air quality monitoring stations (AQMS) are given in Fig. [1](#Fig1){ref-type="fig"}. To reveal the impact of the lockdown due to the COVID-19 on the air quality, the obtained air quality datasets were divided into three periods: (i) pre-lockdown (September 15, 2019--March 22, 2020), (ii) during-lockdown (March 23, 2020--June 20, 2020), and (iii) post-lockdown (June 21, 2020--July 18, 2020).Fig. 1Locations of air quality monitoring stations in the Eastern Province
Meteorology data {#Sec5}
----------------
The meteorology data of the region during the study period was recorded by using a Davis® Vantage Pro 2+ wireless meteorology station, located at the roof of the college of engineering building of IAU (Station no. 6). The wind rose plots for the study region during the whole study, pre-lockdown, lockdown, and post-lockdown periods are illustrated in Fig. [2](#Fig2){ref-type="fig"}. The northwesterly winds governed the wind regime during the pre-lockdown, lockdown, and post-lockdown periods with the frequencies of 48.8%, 50.5%, and 58.6%, respectively. The average wind speeds of pre-lockdown, lockdown, and post-lockdown periods were calculated as 3.72 (± 2.35), 4.51 (± 2.77), and 3.92 (± 2.66) m/s, respectively.Fig. 2Wind rose plots for the study region during: **a** the whole study, **b** pre-lockdown, ** | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Breast cancer (BRCA) is among the most common cancers diagnosed in women in Europe where it also is the third cause of cancer death after lung and colorectal cancer \[[@CR1]\]. Approximately 75% of breast tumours is characterized by the expression of estrogen receptor alpha (ERα), encoded by the estrogen receptor 1 (*ESR1*) gene. These tumours require estrogen signals for continued growth and, consequently, patients generally receive endocrine treatment to inhibit ER signalling \[[@CR2]\]. Endocrine treatment comprises selective estrogen receptor modulators including tamoxifen, selective estrogen receptor down-regulators including fulvestrant, and AIs (e.g., anastrozole, letrozole and exemestane) that inhibit the production of estrogen from androgen. Unfortunately, resistance to endocrine therapy (ET) develops in approximately 30% of ER+ BRCA patients resulting in recurrence of the tumour \[[@CR3]\]. Despite many efforts the precise mechanisms leading to acquired treatment resistance remain mostly unknown and, therefore, therapies to prevent or revert resistance are currently lacking. Therefore, the identification of biomarkers, including epigenetic markers, that can predict endocrine resistance are considered of great value for patient stratification prior to ET \[[@CR4]\].
In general, BRCA development, progression, and (endocrine) drug resistance result from the cumulative burden of genetic and epigenetic changes. Moreover, post-transcriptional and post-translational modifications are likely to contribute as well \[[@CR5]--[@CR7]\]. The association of epigenetic changes with tumour characteristics, subtypes, prognosis, and treatment outcome is only partially characterized \[[@CR8]\]. Epigenetic changes have been shown to drive resistance acquisition (RA) through their effect on gene expression and/or chromosomal stability \[[@CR9]\]. For example, using RNA-seq and ChIP-seq analysis of the acetylation of lysine 27 on histone 3 (H3K27ac), an established active enhancer marker, revealed that epigenetic activation of the cholesterol biosynthesis pathway causes activation of ERα resulting in resistance \[[@CR10]\]. DNA methylation is also perturbed during BRCA development and may largely affect gene expression \[[@CR4], [@CR11]\]. Since DNA methylation has also been shown to be altered in endocrine resistant tumours \[[@CR12]\], the identification of methylation markers for disease diagnosis, prognosis, and treatment outcome is receiving increased attention. Moreover, BRCA treatment might benefit from the regulation of methylation activity by using DNA methyltransferase inhibitors \[[@CR4]\]. Treatment with the DNA methyltransferase inhibitor 5-aza-2′ deoxycytidine caused a significant reduction in promoter methylation and a concurrent increase in expression of the gene *ZNF350* that encodes a DNA damage response protein, and of *MAGED1* which is a tumour antigen and putative regulator of P53, suggesting that a methylation-targeted therapy might be beneficial \[[@CR13]\]. However, current inhibitors have weak stability, lack specificity for cancer cells and are inactivated by cytidine deaminase thus limiting their use in the treatment of BRCA \[[@CR14]\].
Several studies investigated DNA methylation in relation to disease outcome and therapy resistance. Lin et al. observed significant differences in DNA methylation profiles between tamoxifen sensitive and tamoxifen resistant cell lines \[[@CR15]\]. There, a large number of genes, several of which have been previously implicated in BRCA pathogenesis, were shown to have increased DNA methylation of their promoter CpG islands in the resistant cell lines. Similarly, Williams et al. observed a large number of hypermethylated genes in a tamoxifen-resistant cell line \[[@CR13]\]. In a meta-analysis of two human BRCA gene expression datasets, 144 genes for which methylation levels had been linked to BRCA survival were shortlisted as putative epigenetic biomarkers of survival. Kaplan-Meier survival analysis on the expression of these genes further reduced this list to 48 genes, and a subsequent correlation analysis of gene expression and DNA methylation provided evidence for the potential association of DNA methylation with survival in different BRCA subtypes including ER+/HER2- \[[@CR16]\]. Another study compared ductal carcinoma in situ to invasive BRCA and suggested that methylation changes indicate an early event in the progression of cancer and, therefore, might be of relevance for clinical decision making \[[@CR17]\]. In contrast to studies that showed the impact of promoter methylation, it has also been demonstrated that endocrine response in cell lines is mainly modulated by methylation of estrogen-responsive enhancers \[[@CR18]\]. There, increased *ESR1*-responsive enhancer methylation in primary tumours was found to be associated with endocrine resistance and disease relapse in ER+ (luminal A) human BRCA, suggesting that methylation levels can be used to identify patients that positively respond to ET. Note that, although limited ER-responsive enhancer methylation may already be present in the primary tumour, the analysis of methylation profiles of matched relapse samples showed that enhancer DNA methylation increased during treatment. Therefore, a combination of pre-existing and acquired differences in enhancer DNA methylation could be associated with the development of ET resistance.
Current evidence on the association of DNA methylation and endocrine resistance is largely based on cell line models. The largest BRCA patient cohort to study genome-wide DNA methylation profiles and their association with resistance to ET is provided by The Cancer Genome Atlas (TCGA) \[[@CR19]\]. However, to the best of our knowledge, these data have hardly been used to find candidate methylation sites associated with endocrine resistance. One exception is a recent study by Zhang et al., who used the TCGA BRCA cohort to identify regions that were differentially methylated between patients resistant and sensitive to ET \[[@CR20]\]. However, their analysis was based on only a small subset of 32 samples selected based on either short-term (less than 30 months; resistant) or long-term (more than 100 months; sensitive) survival.
In the current work we investigated if DNA methylation profiles of primary ER+/HER2- tumours provide information to predict endocrine resistance. We selected methylation profiles provided by TCGA from patients treated with tamoxifen or AIs, and assumed that patient survival is a proxy for absence of therapy resistance. To identify specific DNA methylation markers, we tested the association with survival using a Cox proportional hazards model. We were able to identify DNA methylation markers associated with patient outcome in a cohort of 552 ER+/HER2- patients, a sub-cohort of 172 patients treated with TAM, and a sub-cohort of 210 patients treated with AIs. We validated these markers and associated gene sets using DNA methylation profiles generated in a time course experiment using the T47D cell line treated with tamoxifen or deprived from estrogen.
Methods {#Sec2}
=======
Data {#Sec3}
----
We used clinical, biospecimen, gene expression (RNAseq V2) and DNA methylation (Illumina Human Methylation 450 K) data of 1098 patients with breast invasive carcinoma from TCGA ([cancergenome.nih.gov](http://cancergenome.nih.gov)). Samples represented in TCGA were all collected prior to adjuvant therapy \[[@CR21]\]. TCGA also recorded patient follow-up information describing clinical events such as type of treatment, the number of days from the date of initial pathological diagnosis to a new tumour event, death, and date of last contact. Since clinical and biospecimen data are scattered over multiple files in the TCGA repository, we first merged all information in a single table with one row per patient using the patient identifiers provided in the clinical and biospecimen data. Subsequently, we corrected drug names for tamoxifen and AIs (anastrozole, exemestane and letrozole) for spelling variants and mapped synonyms to their generic drug names (Additional File [1](#MOESM1){ref-type="media"}).
Patient cohorts {#Sec4}
---------------
For all patients with DNA methylation data available we selected data from primary tumours (indicated with "01" in the patient barcode) of female ER+/HER2- BRCA patients (Fig. [1](#Fig1){ref-type="fig"}). The molecular subtype was determined using TCGA gene expression data for these samples (see below). The ER+/HER2- cohort was further subdivided according to the endocrine treatment (AI or tamoxifen) that patients received during follow-up. Patients who received both drugs were included in both sub-cohorts. Consequently, we considered three patient cohorts, i.e., ER+/HER2-, AI, and TAM. Fig. 1Study flow chart and cohort definition. This figure shows the steps taken to define each of the three cohorts. First the molecular subtype was determined using TCGA BRCA gene expression data and ER+/HER2- patient samples were selected. Next, patients without follow-up data and patients for whom no methylation profiles were measured were removed. Finally, male patients were removed leading to the study cohort of ER+/HER2- patients. Patients who received tamoxifen form the TAM sub-cohort and patients who received AI form the AI sub-cohort. Dashed arrows indicate filter steps. ‡42 patients received both tamoxifen and AI and are included in both the TAM and AI sub-cohort. No missing data for TAM and AI cohorts. AI, aromatase inhibitor; BRCA, breast invasive carcinoma; ER, estrogen receptor; HER2, human epidermal growth factor receptor 2; TAM, tamoxifen; TCGA, The Cancer Genome Atlas
Subtype determination {#Sec5}
---------------------
Information for BRCA subtyping by immunohistochemistry of ER or HER2 is missing for 192 out of 1098 patients. Therefore, we used TCGA BRCA RNAseq V2 gene expression data to determine molecular subtypes (Additional File [2](#MOESM2){ref-type="media"}). To this end, gene expression data from primary tumours were retrieved from the Genomic Data Commons legacy archive using the R package *TCGAbiolinks* \[[@CR22]\]. RSEM estimated abundances were normalised using the upper quartile method from the R package *edgeR* \[[@CR23]\] and subsequently log2-transformed with an offset of one. BRCA subtypes ER− | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The rising utilization and success of *in vitro* fertilization (IVF) can be attributed to the optimization of several clinical and laboratory protocols \[[@B1]\]. One such example is the optimization of controlled ovarian stimulation (COS) by incorporating gonadotropin-releasing hormone antagonist (GnRH-ant)-based COS protocols \[[@B2][@B3]\]. These COS protocols have several advantages over traditional long GnRH-agonist protocols, including lower utilization of gonadotropins \[[@B2][@B3]\], a lower risk of ovarian hyperstimulation syndrome \[[@B2][@B3]\], and a lower rate of ovarian cyst formation \[[@B4]\]. COS with GnRH-ant based protocols can be preceded by pretreatment with oral contraceptive pills (OCPs) or estrogen, with the goal of synchronizing follicular growth \[[@B5][@B6]\]. Most of these findings have been reported in studies comparing OCPs \[[@B7][@B8][@B9][@B10][@B11][@B12]\] or estrogen \[[@B5][@B13][@B14][@B15][@B16]\] to no pretreatment. However, scarce data are available comparing transdermal pretreatment modalities to standard pretreatment modalities in terms of COS, embryological, or pregnancy outcomes. Thus, the primary objective of this study was to compare the impact of pretreatment with transdermal estradiol (E~2~) to OCPs on COS response in normal responders undergoing fresh IVF-embryo transfer (ET) cycles with GnRH-ant based protocols.
Methods
=======
1. Inclusion and exclusion criteria
-----------------------------------
All patients undergoing fresh IVF-ET cycles between January 2008 and June 2013 at the Round O. Perelman and Claudia Cohen Center for Reproducrive Medicine were analyzed for inclusion. Patients qualified as normal responders \[[@B17]\] when they met the following criteria: (1) age \<40 years, (2) cycle day (CD) 2/3 follicle stimulating hormone (FSH) level \<12 mIU/mL, (3) CD 2/3 E~2~ level \<75 pg/mL, and (4) anti-Müllerian hormone (AMH) level \>1 ng/mL. Patients not meeting the aforementioned criteria as well as those with known history of polycystic ovarian syndrome, or poor response or cancellation in a prior IVF-ET cycle were excluded from the analysis. The institutional review board at Weill Cornell Medical College approved our retrospective study protocol.
2. Clinical and laboratory protocols
------------------------------------
Previously described protocols for COS, ovulatory trigger, oocyte retrieval, and ET were utilized \[[@B18][@B19]\]. Patients were assigned to pretreatment with E~2~ or OCPs based on physician preference. E~2~ was administered via 0.1-mg E~2~ patches (Vivelle-Dot estradiol transdermal system, Novartis Pharmaceuticals Co., East Hanover, NJ, USA). The active E~2~ component in these patches is estra-1,3,5 (10)-triene-3,17\<β-diol. Patients applied 0.1-mg E~2~ patches 10 days after detection of the luteinizing hormone (LH) surge of the preceding menstrual cycle, and changed them every other day until the onset of menses \[[@B18]\]. COS with gonadotropins began on CD 2 of their menstrual cycle. Patient without menses after the application of the fourth E~2~ patch were underwent an assessment of their serum FSH, LH, E~2~, and β-human chorionic gonadotropin (β-hCG) levels as well as transvaginal pelvic ultrasonography, and if the findings were normal, proceeded with COS \[[@B8][@B12]\]. Patients undergoing pretreatment with OCPs began the pill (Ortho-Novum, Ortho-McNeil-Janssen Pharmaceuticals, Titusville, NJ, USA) on CD 1 of their preceding menstrual cycle. Following treatment with OCPs for 10 to 14 days, COS ensued approximately 2 to 3 days after discontinuation of the last pill.
The gonadotropin doses for COS were based on the patient\'s age, body mass index (BMI, kg/m^2^), antral follicle count, and serum AMH level. COS was initiated with gonadotropins (Gonal-F, EMD Serono, Rockland, MA, USA or Follistim, Merck, Kenilworth, NJ, USA; and Menopur, Ferring Pharmaceuticals, Parsippany, NJ, USA). Ovulation was suppressed with once-daily 0.25-mg Ganirelix acetate (Merck) injections, which were started when the lead follicle was \>13 mm or the E~2~ level was 300 pg/mL \[[@B18][@B19]\]. The hCG trigger (Pregnyl, Merck or Novarel, Ferring Pharmaceuticals) was given when the two lead follicles attained a mean diameter of \>17 mm. Oocyte retrieval was performed approximately 34 to 35 hours after the hCG trigger under conscious sedation. Intramuscular progesterone (50 mg daily) was started the day after retrieval. Fertilization of oocytes was achieved with conventional *in vitro* insemination or intracytoplasmic sperm injection \[[@B20]\]. All embryos were incubated in in-house culture media \[[@B18]\]. All ETs were performed with Wallace catheters (Smiths Medical, Norwell, MA, USA).
3. Outcome variables
--------------------
Baseline demographics recorded for patients included age (years), gravidity, BMI (kg/m^2^), infertility diagnosis, CD 2/3 FSH level (mIU/mL), AMH level (ng/mL), and number of previous IVF attempts. COS parameters included total days of ovarian stimulation, total days of GnRH-ant administration, total dosage of gonadotropins (IU), E~2~ level (pg/mL) on the day of trigger, peak endometrial thickness (mm), total number of oocytes retrieved, mature oocytes retrieved, and fertilization rate (%). The number of cycles canceled as well as the number of surplus embryos cryopreserved at the blastocyst stage were also noted. Any pregnancy with positive hCG but without a gestational sac was considered a biochemical pregnancy. Clinical pregnancy was defined as the number of intrauterine gestations with fetal cardiac activity per IVF-ET cycle. Pregnancy loss after visualizing an intrauterine gestation was considered a spontaneous miscarriage. A live birth was any birth after 24 weeks of gestation.
4. Statistical analysis
-----------------------
Categorical variables were expressed as number of cases and percentage of occurrence and assessed using the chi-square test with the Mantel-Haenszel correction. Non-parametric variables were expressed as median (interquartile range) and were tested with the Wilcoxon rank-sum test. All continuous variables were checked for normality using the Shapiro-Wilk test and expressed as mean±standard deviation. The independent *t*-test was utilized for statistical comparisons of continuous variables. Statistical significance was set at *p*\<0.05. Based on the study of Hauzman et al. \[[@B14]\] that showed a gonadotropin dosage difference of 65 IU between the E~2~ (1,692±488 IU) and OCP (1,627±565 IU) groups, a sample of size of 1,036 patients per group was estimated, assuming an α-error of 5% and a power of 80%.
Results
=======
A total of 2,092 patients met the inclusion criteria: 1,057 patients in the E~2~ group and 1,035 patients in the OCP group. As shown in [Table 1](#T1){ref-type="table"}, the demographics and baseline characteristics were similar across both groups. Most patients had roughly two unsuccessful IVF-ET cycles elsewhere prior to pursuing treatment at our center. [Table 2](#T2){ref-type="table"} summarizes the COS outcomes of the study cohort. Patients in the OCP group had a longer duration of COS (10.7±1.63 days) than the transdermal E~2~ group (9.92±1.94 days). Furthermore, patients in the OCP group required higher cumulative doses of gonadotropins (2,657.3±1,187.9 IU) than the E~2~ group (2,550.1±1,270.2 IU, *p*=0.002). Overall, no difference was noted in the total days of GnRH-ant administration, E~2~ level on the day of trigger, peak endometrial thickness, number of total or mature oocytes retrieved, and the fertilization rate. No difference in IVF-ET cycle cancelation was observed in the E~2~ and OCP pretreatment groups.
[Table 3](#T3){ref-type="table"} presents the pregnancy outcomes of the study cohort. No significant difference was found in the mean age of patients or the number of embryos transferred. The number of surplus embryos cryopreserved at the blastocyst stage was also comparable among the pretreatment groups. Overall, no statistically significant differences were found in the rates of biochemical pregnancy, clinical pregnancy, spontaneous miscarriage, or live birth when comparing both groups. These findings remained unchanged even after adjusting for duration of COS, gonadotropin dose, and E~2~ level on the day of the trigger.
Discussion
==========
Hormonal pretreatment modalities are used to suppress a patient\'s endogenous gonadotropin secretion, thereby promoting the coordinated growth of early antral follicles in response to exogenous gonadotropins \[[@B5][@B6]\]. The resulting synchronization of follicles has shown to increase oocyte and embryo yield and therefore, the overall chances of pregnancy \[[@B6 | {
"pile_set_name": "PubMed Central"
} |
I am writing regarding the systematic review about clinical validity, understandability, and actionability of online cardiovascular disease (CVD) risk calculators recently published by Dr Bonner and colleagues \[[@ref1]\].
Although Dr Bonner and colleagues used a comprehensive two-step research strategy to identify Web addresses that contained a CVD risk calculator, which led to the identification of 67 Web pages, a very important CVD risk model, the Systematic COronary Risk Evaluation (SCORE) risk assessment model \[[@ref2]\], was ignored. Developed by the European Society of Cardiology, this model was derived from 12 European cohort studies (250,000 patients data collected and 3 million person-years of observation) and is based on classical risk factors such as gender, age, total cholesterol, systolic blood pressure, and smoking status. The SCORE risk assessment model should have been included because it satisfies Dr Bonner's inclusion criteria as it predicts the risk of developing a CVD event and an electronic interactive version of this model is freely available on the European Society of Cardiology\'s Web page \[[@ref3]\].
Furthermore, there are other risk assessment models locally developed in countries such as China, India, and Korea that are not taken into account in this study. Thus, it would have been useful if the authors had added to their research strategy a literature search of review documents focusing on cardiovascular risk assessment as was carried out by Zhao and colleagues \[[@ref4]\].
**Editorial note**: Authors were invited to respond but declined. They agree that additional calculators exist that could have been included if a different method was used.
CVD
: cardiovascular disease
SCORE
: Systematic COronary Risk Evaluation
| {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The incidence and mortality rates of colorectal cancer (CRC) vary around the world ([@b1-or-43-04-1187],[@b2-or-43-04-1187]). Early stage CRC commonly shows limited clinical signs, and patients are often diagnosed at the metastatic stage, rendering therapy difficult ([@b3-or-43-04-1187]). Therefore, early diagnosis and treatment of CRC remains challenging for patients and surgeons. In 2016, CRC ranked fourth and second among the most frequently diagnosed and the deadliest malignancies, respectively, in the USA ([@b4-or-43-04-1187]--[@b7-or-43-04-1187]). According to the American Cancer Society, there were approximately 13,450 newly diagnosed cancer patients in the US in 2016, 30% of whom presented with CRC ([@b8-or-43-04-1187]). In 2015, 376,000 new CRC cases were diagnosed in China, with 191,000 succumbing to the malignancy ([@b9-or-43-04-1187]). National polyp screening programs constitute an early diagnosis tool, which can markedly improve CRC prognosis ([@b10-or-43-04-1187]--[@b14-or-43-04-1187]). Early diagnosis and treatment of CRC is becoming increasingly important to surgeons. Surgery remains the principal therapeutic option for loco-regional CRC. At present, robotic and laparoscopic surgeries are performed for CRC, with improve patient outcome in comparison with traditional surgical techniques ([@b15-or-43-04-1187]--[@b17-or-43-04-1187]). However, patient prognosis is not significantly enhanced. In order to improve the prognosis of CRC patients, surgeons and pathologists have made unremitting efforts to examine the prognostic values of various tumor markers. The American Joint Committee on Cancer (AJCC) tumor-node-metastasis (TNM) staging system provides a universal modality and guides clinical treatment ([@b18-or-43-04-1187]--[@b21-or-43-04-1187]). Based on the original version, AJCC-8 (American Joint Committee on Cancer 8 edition) provides improved guidance for the individualized treatment of CRC patients and more effective treatment of patients with IVC peritoneal metastases.
Tumor invasion and metastasis of CRC result from well-coordinated events involving many intracellular and extracellular factors ([@b22-or-43-04-1187]--[@b24-or-43-04-1187]). While many factors affect prognosis in CRC ([@b25-or-43-04-1187],[@b26-or-43-04-1187]), Ki67 is broadly employed in pathological analyses to evaluate cell proliferation in various malignancies ([@b27-or-43-04-1187]--[@b30-or-43-04-1187]). Although Ki67 is expressed in benign tumors, its levels are very low; however, it is found at high levels in multiple malignant lesions, and tightly associated with distant metastasis, resulting in poor patient prognosis. The prognostic value of Ki67 has been assessed in various types of cancers, particularly brain, neuroendocrine, and lymphoid tissue malignancies, and its levels are commonly utilized to grade tumors ([@b31-or-43-04-1187]). Nevertheless, its prognostic and predictive roles remain debatable mostly as standard quantification techniques for Ki67 are in existence ([@b32-or-43-04-1187]). Ki67 expression is usually examined as a percentage, which is closely related to the pathologist\'s clinical experience.
Hashimoto *et al* assessed the rate and clinical significance of fascin expression in association with CRC progression and cancer cell proliferation based on Ki67 ([@b33-or-43-04-1187]). Most often, Ki67 is assessed visually by pathologists although no consensus is available concerning the specific regions to score ([@b34-or-43-04-1187]). Meanwhile, whether automated techniques could yield suitable accuracy and prognostic power for Ki67 is not known. Indeed, head-to-head comparisons between scores from automated and pathologist-based techniques in terms of prognostic value have been rarely reported, and discrepant findings in breast cancer have been obtained ([@b35-or-43-04-1187]--[@b37-or-43-04-1187]). Previous reports ([@b38-or-43-04-1187],[@b39-or-43-04-1187]) discussed the role of Ki67 expression in lung and breast cancers, examining ways to define the cutoff of Ki67 expression. Similar questions remain for CRC. How to grade Ki67 expression remains therefore an open question. A 20% cutoff has been reported ([@b38-or-43-04-1187]). Nonetheless, a previous meta-analysis assessing various cut-off levels of Ki67 in regards to prognosis suggested a visual cut-off \>25% to provide a higher discriminatory power in mortality risk compared with the remaining cut-off points evaluated ([@b39-or-43-04-1187]). Signal intensity scores were 0 (negative), 1 (weak), 2 (moderate) and 3 (strong); positivity extent was scored as 0 (\<5%), 1 (5--25%), 2 (\>25--50%, 3 (\<50--75%) and 4 (\>75%). Both sub-scores were multiplied to yield the final score, which was considered to be positive if \>5 ([@b40-or-43-04-1187]). Can a suitable cutoff increase the prognostic value of Ki67 expression in colorectal cancer? This is the starting point of the present research; as not many studies have been reported. Some scholars hold opposite views on the relationship between Ki67 expression and prognosis in CRC, suggesting that high Ki67 expression instead reflects better prognosis ([@b41-or-43-04-1187]). Other studies have reported that mean Ki67 expression is higher in p53-positive cases, and Ki67 and p53 are not correlated to clinical and pathological parameters ([@b42-or-43-04-1187]). Whether Ki67 expression is related to clinicopathological indicators and prognosis remains controversial. Meanwhile, the cutoffs vary, and the outcomes are rather controversial among previous studies. Therefore, we analyzed the associations of Ki67 expression with clinicopathological parameters and the prognosis of CRC patients in this study.
Here we divided cases into four grades based on 25% intervals of Ki67 immunohistochemical signals. Associations of Ki67 expression levels with clinicopathological factors and CRC prognosis were analyzed. Prognosis in CRC was also analyzed based on Ki67 expression according to 5-year disease-free survival (DFS) and overall survival (OS) in and out of the AJCC-8 stratification.
Patients and methods
====================
### Patients
In total, 2,080 CRC cases were enrolled at Huzhou Central Hospital between January 2006 and December 2012. A total of 400 cases did not undergo surgery, 400 succumbed to non-CRC causes, and 190 were lost to follow-up and thus were excluded from the present study. Therefore, 1,090 cases (stage 0 to stage IV) were involved in the final analysis. Inclusion criteria were CRC diagnosis by colonoscopy, computed tomography and pathology; no pre-surgical adjuvant therapy, radical surgery and normal lymph nodes harvested; other organ metastases found before or during surgery, and combined resection to achieve R0 resection; complete postoperative clinical and pathological data; postoperative routine immunohistochemical and pathological analyses; post-surgical chemotherapy based on the National Comprehensive Cancer Network (NCCN) guidelines; adenocarcinoma by pathological diagnosis; complete follow-up data, including recurrence and metastasis at follow-up. Exclusion criteria included severe heart, brain, liver or lung disease which may influence tolerance to surgery; non-CRC parameters causing death, interstitial or neuronal tumor, lymphoma, melanoma and other non-adenocarcinomas concomitant with CRC ([Fig. 1](#f1-or-43-04-1187){ref-type="fig"}).
### Follow-up
Routine follow-up was carried out in the outpatient clinic two weeks post-operation, at 3- and 6-month intervals for the first and second years, respectively, and yearly for the remaining 3 years. Phone calls and mail were also used for follow-up. During the follow-up period, the patient statuses included i) death, censored and ii) death and recurrence and censored.
### Ethics statement
The current trial followed the 2008 Declaration of Helsinki, and had approval from the Ethics Committee of Huzhou Central Hospital (Huzhou, Zhejiang, China). All patients provided signed informed consent for the use of their tissue samples for Ki67 immunohistochemistry immunoassay and medical records for research.
### Detection of tissue Ki67
Immunohistochemistry was performed by the Envision two-step method \[cat. no. ZM-0166 (Beijing Zhongshang Jinqiao Co.); K5007 (Dako)\]. The primary antibody was raised against Ki67 (cat. no. ZM-0166, 1:200 dilution) and K5007 (Dako; no dilution) was used as the secondary antibody. The steps included: i) Dewaxing with hot water; ii) antigen repair under high pressure citric with acid at pH 6.0; iii) hydrogen peroxide blocking of endogenous peroxidase; iv) primary antibody incubation at 37°C for 30 min; v) secondary antibody incubation at 37°C for 15 min; vi) DAB staining at 22°C for 5 min; vii) dehydration and mounting. We compared conventional hematoxylin and eosin (H&E) staining with Ki67 DBA immunostaining and defined + as \>0 and ≤25%; ++ as \>25 and ≤50%; +++ as \>50 and ≤75%; and ++++ as \>75% ([Fig. 2](# | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The *Salmonella*e are major human pathogens and represent a significant global public health issue causing morbidity and mortality resulting in a high social and economic burden worldwide ([@ref-19]). The genus consists of two species; *Salmonella enterica* and *S. bongori*. There are six subspecies of *S. enterica* differentiated by biochemical variations, namely subspecies *enterica* (I), *salamae* (II), *arizonae* (IIIa), *diarizonae* (IIIb), *houtenae* (IV) and *indica* (VI) ([@ref-30]). Subspecies I, *S. enterica* subsp. *enterica* cause 99% of human and animal infections. The two main pathologies associated with *S. enterica* are gastroenteritis and typhoidal disease. The typhoidal *Salmonella*e include *S*. Typhi and *S*. Paratyphi A, B and C. They are host restricted, monophyletic, rarely undergo recombination events and exhibit convergent evolution driven by genome degradation ([@ref-31]). The majority of gastroenteritis in the UK is caused by the host generalist serovars, such as *S*. Typhimurium and *S*. Enteritidis, and host adapted serovars that are adapted to a specific animal reservoir but can infect man and include *S*. Dublin, *S*. Gallinarum *S*. Choleraesuis, and *S*. Bovismorbificans ([@ref-17]).
Approximately 8,000 isolates are referred to the *Salmonella* Reference Service (SRS) at Public Health England (PHE) each year from local and regional hospital laboratories. In April 2015, PHE implemented whole genome sequencing (WGS) as the routine typing tool for public health surveillance of *Salmonella* infections. Prior to April 2015, presumptive *Salmonella* isolates referred to SRS were speciated and sub-speciated using PCR ([@ref-13]; [@ref-12]) and grouped into serovars as described in the White-Kauffman-Le Minor scheme ([@ref-9]; [@ref-10]; [@ref-15]). This methodology is based on reactions of rabbit antisera to the lipopolysaccharide (O antigen encoded by *rfb* genes) and flagellar antigens (phases 1 and 2 of H antigen encoded by *fli*C and *flj*B). The scheme utilises this phenotypic variation, expressed as an antigenic formulae, to divide *Salmonella* into more than 2,600 serovars. Epidemiological investigations of *Salmonella* infecting humans and animals have relied on serotyping for over 70 years; national and international governmental agencies base guidelines and regulations on the serotyping method and the use of this nomenclature is a globally recognised form of communication ([@ref-26]; [@ref-7]). Furthermore, serovars have often been shown to correlate with host range and disease sequelae ([@ref-8]; [@ref-31]; [@ref-17]).
There are, however, a number of issues with the serotyping approach; specifically, the expense and expertise required to produce the antisera and, furthermore, serotyping does not reflect the genetic relatedness between serovars, nor does it provide an evolutionary perspective. Alternative molecular serotyping methods have been described previously including Pulsed-field gel electrophoresis, ribotyping, repetitive extragenic palindromic sequence-based PCR (rep-PCR) and combined PCR- and sequencing-based approach that directly targets O- and H-antigen-encoding genes ([@ref-22]; [@ref-24]). In 2012, [@ref-1] proposed a sequenced based approach, multilocus sequence typing (MLST), based on the sequences of multiple house-keeping genes. Isolates that possess identical alleles for the seven gene fragments analysed are assigned a common sequence type (ST) and related STs from clonal complexes are termed e-Burst Groups (eBGs). They showed that ST and eBGs strongly correlated with serovar and so utilising this approach would facilitate backward compatibility with historical data, minimise disruption for reference laboratory service users and facilitate data exchange with other colleagues in the field.
Advances in whole genome sequencing (WGS) methodologies have resulted in the ability to perform high throughput sequencing of bacterial genomes at low cost making WGS an economically viable alternative to traditional typing methods for public health surveillance and outbreak detection ([@ref-16]). Whilst WGS provides the opportunity to resolve bacterial strains to the single nucleotide resolution needed for identifying cases linked to a common source of infection ([@ref-4]), grouping isolates into higher taxonomical clones (e.g., those defined by serotyping) is an important step. The decision to adopt WGS as a routine typing method at PHE provided the opportunity to review our approach to typing *Salmonella* and to implement the MLST approach in parallel with WGS.
The aim of this study was to evaluate MLST, as derived from WGS data, as a replacement for conventional serotyping of *Salmonella* for routine public health surveillance and to provide insight into the genetic population structure of all *Salmonella* species in England and Wales during a 12 month period.
Methods
=======
Bacterial strains
-----------------
All isolates (*n* = 7,465) of *Salmonella* from human cases of gastrointestinal disease submitted to SRS from local and regional hospital laboratories in England & Wales between 1st April 2014 and 31st March 2015 were sequenced in parallel with phenotypic serotyping ([Table S1](#supp-1){ref-type="supplementary-material"}). Of these, 7,338 were identified as subspecies I and included 263 different serovars. The ten most common serovars in this dataset were Enteriditis (2,310), Typhimurium (1,407), Infantis (184), Typhi (184), Newport (173), Virchow (162), Kentucky (160), Stanley (146), Paratyphi A (135) and Java (99). One hundred and twenty seven isolates were identified as subspecies II--IV (*S. enterica* subspecies *salamae n* = 28; *S. enterica* subspecies *arizonae n* = 25; *S. enterica* subspecies *diarizonae n* = 49; *S. enterica* subspecies *houtenae n* = 20) and there was one isolate of *S. bongori*. No isolates belonging to subspecies VI (*S. enterica* subspecies *indica*) were submitted to SRS during the study period.
DNA extraction for WGS
----------------------
DNA extraction of *Salmonella* isolates was carried out using a modified protocol of the Qiasymphony DSP DNA midi kit (Qiagen). In brief, 0.7 ml of overnight *Salmonella* culture in a 96 deep well plate was harvested. Bacterial cells were pre-lysed in 220 µl of ATL buffer (Qiagen) and 20 µl Proteinase K (Qiagen), and incubated shaking for 30 min at 56 °C. Four µl of RNase at 100 mg/ml (Qiagen) was added to the lysed cells and re-incubated for a further 15 min at 37 °C. This step increases the purity of the DNA for further downstream sequencing. Extraction of DNA from the treated cells was performed on the Qiasymphony SP platform (Qiagen) and eluted in 100 µl of water. DNA concentration using the GloMax system (Promega) was determined for the following sequencing steps.
DNA sequencing
--------------
Extracted DNA was then processed using the NexteraXT sample preparation method and sequenced with a standard 2x101 base protocol on a HiSeq 2500 Instrument in fast mode (Illumina, San Diego, CA, USA).
Bioinformatics workflow
-----------------------
FASTQ reads were quality trimmed using Trimomatic ([@ref-3]) with bases removed from the trailing end that fell below a PHRED score of 30. If the read length post trimming was less than 50 bp the read and its pair were discarded. The PHE KmerID pipeline (<https://github.com/phe-bioinformatics/kmerid>) was used to compare the sequenced reads with 1,769 published genomes to identify the bacterial species (and *Salmonella* subspecies) and to detect cultures submitted by the local and regional hospital laboratories that contained more than one bacterial species (mixed cultures). KmerID determines a similarity index between the FASTQ reads and each of the 1,769 published reference genomes by calculating the percentage of 18-mers in the reference that are also present in the FASTQs. Only 18-mers that occur at least twice in the FASTQ are considered present. Mixed cultures are detected by comparing the list of similarities between the sample and the references with the similarities of the references to each other, and filtering this comparison for inconsistencies. ST assignment was performed using the Metric Orientated Sequence Typer (MOST), a modified version of SRST ([@ref-14]), available from <https://github.com/phe-bioinformatics/MOST>. The primary difference between SRST and MOST is in the metrics provided around the result, while SRST gives a single score, MOST provides a larger array of metrics to give users more details on the read level associated with their result. Preliminary analysis was undertaken using the MLST database described in [@ref-1]. It takes approximately 10--15 min to run MOST using a single core on the PHE infrastructure which consists of Intel Xeon CPU E5-2680 0@ 2.70GHz, 16 cores sharing 125 Gb Memory.
For isolates that had novel STs, or a ST but no associated serovar in the | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Metalloporphyrin π-cation radicals are of immense interest due to their occurrence as intermediates in the catalytic cycle of many heme containing enzymes, *e.g.*, peroxidases,[@cit1] catalases,[@cit2] cytochrome P450 [@cit1a],[@cit3] *etc.*, and their photosynthetic reaction center.[@cit4] In spite of the common active intermediates, the reactivity differs from enzyme to enzyme. The extent of coupling between metal center and porphyrin π-cation radical may be linked to the various activities in the heme enzymes, and this has therefore led to the study of metalloporphyrin π-cation radicals and mixed valence π-cation radicals (where one electron is removed per two porphyrin rings).[@cit5],[@cit6]
Numerous diheme enzymes such as MauG[@cit7],[@cit8] and bacterial diheme cytochrome c peroxidases (bCcP)[@cit9] serve as active catalysts in various important chemical transformations in biology. For instance, bCcP mediates peroxidase activity, whereby it transfers the oxidizing equivalents from H~2~O~2~ to cytochrome c or other small redox proteins.[@cit9] MauG ([Fig. 1](#fig1){ref-type="fig"}) is a terminal enzyme involved in the biosynthesis of the catalytic tryptophan tryptophylquinone (TTQ) cofactor of methylamine dehydrogenase (MADH). Although the two heme units are physically separated in both enzymes, they share electrons efficiently behaving as a single diheme unit rather than as independent heme centers. A tryptophan residue is, however, positioned in between two heme centers and has been proposed to act as a bridge in order to promote the electronic communication between the heme centers.[@cit7]--[@cit9]
).[@cit7a]](c5sc03120f-f1){#fig1}
High-valent Fe([iv]{.smallcaps})0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000O intermediates are frequently invoked in the catalytic cycles of Fe-dependent oxidizing enzymes.[@cit1]--[@cit3] In heme-dependent enzymes, the two-electron oxidized intermediate (compound I) consists of an Fe([iv]{.smallcaps}) species (*S* = 1) coupled to an organic radical (*S* = 1/2) that is located on the porphyrin ring/axial ligand or a nearby amino acid residue (compound ES). In MauG, however, two oxidizing equivalents derived from H~2~O~2~ are distributed within the diheme system as two positive charges, giving rise to a bis-Fe([iv]{.smallcaps}) redox state ([Scheme 1](#sch1){ref-type="fig"}) in which one heme is present as Fe([iv]{.smallcaps})0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000O and the other as Fe([iv]{.smallcaps}) with axial histidine and tyrosine ligation.[@cit8] As the two hemes are physically separated by 14.5 Å, a hole-hopping mechanism was proposed wherein the tryptophan residue reversibly oxidized and reduced in order to boost the effective electronic coupling element and magnify the rate of electron transfer between the heme centers in the bis-Fe([iv]{.smallcaps}) MauG.[@cit8]
![Conversion of the hemes of MauG from diferric to bis-Fe([iv]{.smallcaps}) redox state.[@cit8]](c5sc03120f-s1){#sch1}
The electronic communication between the porphyrin moieties in the ground and/or excited state can be facilitated by using covalently connected linkers in conjugation with porphyrin rings. In this context, a large number of porphyrin dimers connected *via* conjugated linkers, *viz.* alkene, alkyne, imino, and azo bridges, have been studied due to their unique optical properties.[@cit10] Our recent efforts have been directed towards exploring the role of intermacrocyclic interactions in modulating various properties, *viz.* redox potential, spin state *etc.*[@cit11] However, interactions between a pair of porphyrin π-cation radicals connected through a linker remain unexplored.
In the present study, we have made synthetic analogs of the diheme centers of MauG in which two porphyrin rings have been covalently connected through a conjugated but rigid ethylene bridge which would separate the two macrocycles to the furthest extent. Step-wise oxidations up to two oxidizing equivalents have been performed using chemical oxidants. Unlike the bis-Fe([iv]{.smallcaps}) state as obtained in MauG, the two electron oxidized complex stabilizes two ferric hemes, each coupled with a porphyrin cation radical, a scenario resembling the binuclear dication diradical complex. This work describes an alternative mechanism to store two oxidizing equivalents above the ferric state in dihemes. Spectroscopic investigations have unraveled strong electronic communications between two porphyrin π-cation radicals *via* the ethylene bridge which eventually alter the nature of such bridge. The extensive π-conjugation also allows antiferromagnetic coupling between iron([iii]{.smallcaps}) centers and porphyrin radical spins of both rings. DFT calculations have been employed which further support our spin-coupling model as obtained from the magnetic measurements and also provide insight into the preferential stabilization of various geometrical conformers under certain conditions.
In earlier work on monomeric metalloporphyrin π-cation radicals, spin coupling between the metal ion and the oxidized porphyrin ring in a number of derivatives that differed in metal ion, axial ligation, and/or porphyrin ligand were investigated.[@cit5],[@cit6] The inter-ring coupling was found to be closely related only to the degree of the ring overlap. In the present investigation, however, the inter-ring coupling between two monomeric Fe([iii]{.smallcaps})porphyrin π-cation radicals has been demonstrated to occur only through the bridge although they are widely separated in space.
Result and discussion
=====================
Dichlorodiiron([iii]{.smallcaps}) ethylene bridged octaethyl porphyrin dimers have been synthesized both in *cis* (*cis*-**1**) and *trans* (*trans*-**1**) isomers using the procedures reported earlier.[@cit11j],[@cit12] Oxidation of these complexes has been performed in a step-wise manner using chemical oxidants and monitored using UV-vis-NIR spectroscopy. [Scheme 2](#sch2){ref-type="fig"} shows the synthetic outline and list of diheme dication diradical intermediates reported here along with the abbreviations used.
{#sch2}
[Fig. 2](#fig2){ref-type="fig"} shows the UV-visible spectral changes upon step-wise oxidations of *cis*-**1** using Fe(ClO~4~)~3~ as an oxidant. Gradual addition of a CH~3~CN solution of Fe(ClO~4~)~3~ as an oxidizing agent in up to one equivalent to a dichloromethane solution of *cis*-**1** leads to a sharp decrease in the Soret band intensity at 390 nm along with the appearance of a low energy band at 989 nm, which is characteristic of the intra-valence charge transfer obtained due to the formation of a mixed-valence π-cation radical dimer.[@cit6],[@cit13] The absorbance of the 989 nm band has showed a linear dependence on the concentration, ruling out the possibility of intermolecular dimerization as its origin.[@cit6] On further addition of the Fe(ClO~4~)~3~ solution in up to two equivalents, the Soret band at 390 nm decreases gradually again along with the appearance of two new bands at 326 and 477 nm, while the intensity of the absorbance at 989 nm decreases with the appearance of a new broad band near 1150 nm. The 2e-oxidized complex thus obtained has been isolated in the solid state as a dication diradical species (*trans*-**2**) in good yields and has been structurally characterized. Further addition of the oxidant showed no observable change in the absorption spectra.
{#fig2}
Similar spectral changes have also been obtained during the oxidation of *cis*-**1** when FeCl~3~ was used as an oxidant ([Fig. 3](#fig3){ref-type="fig"}). Upon one-electron oxidation, a sharp decrease in the Soret band intensity at 390 nm has been observed along with the appearance of a low energy band at 989 nm due to the formation | {
"pile_set_name": "PubMed Central"
} |
J. Liu, D. Reta, J. A. Cleghorn, Y. X. Yeoh, F. Ortu, C. A. P. Goodwin, N. F. Chilton, D. P. Mills, *Chem. Eur. J.* **2019**, *25*, 7749.
Introduction {#chem201901167-sec-0001}
============
Since the discovery of ferrocene \[Fe(Cp)~2~\] (Cp=cyclopentadienyl, C~5~H~5~) in the middle of the 20th century,[1](#chem201901167-bib-0001){ref-type="ref"} there has been an explosion of research in organometallic chemistry, leading to applications in some unexpected areas such as optical and redox devices, batteries, sensing, catalysis and medicine.[2](#chem201901167-bib-0002){ref-type="ref"} Following the landmark discovery of ferrocene, derivatized metallocenes \[M(Cp^R^)~2~\] (Cp^R^=substituted Cp) have been synthesised across the s‐, p‐, d‐ and f‐block elements.[3](#chem201901167-bib-0003){ref-type="ref"} The first examples of lanthanide (Ln) Cp complexes were synthesised in 1954,[4](#chem201901167-bib-0004){ref-type="ref"} and this area has grown to the extent that Ln organometallic chemistry is now dominated by Cp^R^ ligands.[5](#chem201901167-bib-0005){ref-type="ref"}
Although isolated d‐block metallocenium cations have been known since ferrocenium, \[Fe(Cp)~2~\]^+^, was isolated in 1952[6](#chem201901167-bib-0006){ref-type="ref"} and Ln metallocenium cations, \[Ln(Cp)~2~\]^+^, were first predicted in 1956 by Birmingham and Wilkinson,[7](#chem201901167-bib-0007){ref-type="ref"} it was only recently with the report of the dysprosocenium complex \[Dy(Cp^ttt^)~2~\]\[B(C~6~F~5~)~4~\] (Cp^ttt^=C~5~H~2~ *t*Bu~3~‐1,2,4, **1**‐**Dy**),[8](#chem201901167-bib-0008){ref-type="ref"} and heavy Ln metallocenium homologues \[Ln(Cp^ttt^)~2~\]\[B(C~6~F~5~)~4~\] (**1**‐**Ln**, Ln=Y, Gd, Tb, Ho, Er, Tm, Yb, Lu),[8](#chem201901167-bib-0008){ref-type="ref"}, [9](#chem201901167-bib-0009){ref-type="ref"}, [10](#chem201901167-bib-0010){ref-type="ref"} that structurally authenticated Ln metallocenium complexes with no equatorial interactions were achieved. The paucity of isolated Ln metallocenium cations prior to 2017 can be attributed to the propensity for large electropositive Ln^III^ cations to maximise their coordination numbers, coupled with their preference for hard donor ligands not being well‐satisfied by soft Cp^R^ coordination.[5](#chem201901167-bib-0005){ref-type="ref"} Of most relevance here, \[Sc(Cp\*)~2~{(C~6~F~5~‐κ^2^‐*F*)B(C~6~F~5~)~3~}\] (Cp\*=C~5~Me~5~)[11](#chem201901167-bib-0011){ref-type="ref"} and \[Ln(Cp\*)~2~{(μ‐C~6~F~5~‐κ^1^‐*F*)~2~B(C~6~F~5~)~2~}\]~2~ (Ln=Pr, Nd)[12](#chem201901167-bib-0012){ref-type="ref"} exhibit equatorial interactions with F atoms of the weakly coordinating anion in the solid state.
Complex **1**‐**Dy** is a single‐molecule magnet (SMM) that exhibits magnetic hysteresis at 60 K;[8](#chem201901167-bib-0008){ref-type="ref"} this was a leap of 46 K over the previous record temperature for molecular magnetic hysteresis (at a comparable sweep rate) of 14 K set by Evans and Long in 2011.[13](#chem201901167-bib-0013){ref-type="ref"} Since the publication of **1**‐**Dy** peralkylated \[Dy(Cp^R^)~2~\]^+^ cations have been shown to exhibit hysteresis up to 72 K[14](#chem201901167-bib-0014){ref-type="ref"} and 80 K.[15](#chem201901167-bib-0015){ref-type="ref"} The high hysteresis temperature of **1**‐**Dy** and derivatives cannot solely be attributed to their strong axial ligand fields stabilising the most magnetic *m~J~*=±15/2 states,[16](#chem201901167-bib-0016){ref-type="ref"} as the previous record effective barrier to the reversal of magnetization was seen for \[Dy(*t*BuO)~2~(pyridine)~5~\] (1261 cm^−1^) but this complex does not exhibit hysteresis above 4 K.[17](#chem201901167-bib-0017){ref-type="ref"} State‐of‐the‐art calculations of the spin--phonon coupling in **1**‐**Dy** show that magnetic relaxation in the Orbach (over‐barrier) regime occurs due to localised molecular vibrations, and suggests that the high magnetic hysteresis temperature arises from the constrained metal--ligand vibrational modes intrinsic to the *bis*‐η^5^‐Cp^ttt^ coordination geometry.[8](#chem201901167-bib-0008){ref-type="ref"} We have subsequently shown that isolated \[Ln(Cp^ttt^)~2~\]^+^ cations exhibit anomalously low Raman exponents, distinct from analogues with equatorial ligands, suggesting the unique vibrational modes of Cp^ttt^ are important across a wide temperature range.[8](#chem201901167-bib-0008){ref-type="ref"}, [9](#chem201901167-bib-0009){ref-type="ref"}, [10](#chem201901167-bib-0010){ref-type="ref"}
We previously reported that the bulky *bis*‐Cp^ttt^ framework in combination with the weakly coordinating anion \[B(C~6~F~5~)~4~\]^−^ provide isolated Ln metallocenium cations for smaller, heavier Ln.[8](#chem201901167-bib-0008){ref-type="ref"}, [9](#chem201901167-bib-0009){ref-type="ref"}, [10](#chem201901167-bib-0010){ref-type="ref"} These studies showed that \[H(SiEt~3~)~2~\]\[B(C~6~F~5~)~4~\][18](#chem201901167-bib-0018){ref-type="ref"} is effective at abstracting either fluoride or chloride from \[Ln(Cp^ttt^)~2~(X)\] precursors to yield **1**‐**Ln**. Herein, we extend these studies to the lighter, larger Ln to define the characteristic features of analogous \[Ln(Cp^ttt^)~2~\]^+^ cations across the Ln series. We find that for the largest members of the **1**‐**Ln** series one *meta*‐F of the \[B(C~6~F~5~)~4~\]^−^ anion coordinates to the exposed equatorial site in the solid state, giving \[Ln(Cp^ttt^)~2~{(C~6~F~5~‐κ^1^‐F)B(C~6~F~5~)~3~}\] (**1**‐**Ln**; Ln=La, Ce, Pr, Nd). However, smaller Sm^III^ yields an isolated cation, \[Sm(Cp^ttt^)~2~\]\[B(C~6~F~5~)~4~\] (**1**‐**Sm**), which is structurally analogous to the heavier members of the series. We were unable to complete the series with the Eu analogue **1‐Eu** as the stability associated with the +2 oxidation state[5](#chem201901167-bib-0005){ref-type="ref"} precluded the synthesis of \[Eu(Cp^ttt^)~2~(X)\] (X=F, Cl) precursors.
Results and Discussion {#chem201901167-sec-0002}
======================
According to previously published synthetic methods for the synthesis of **1‐Ln** (Ln=Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Y),[8](#chem201901167-bib-0008){ref-type="ref"}, [9](#chem201901167-bib-0009){ref-type="ref"}, [10](#chem201901167-bib-0010){ref-type=" | {
"pile_set_name": "PubMed Central"
} |
{
"pile_set_name": "PubMed Central"
} | |
Introduction {#s1}
============
Friedreich\'s ataxia (FRDA) is an autosomal recessive progressive hereditary neurodegenerative disorder caused by a GAA repeat expansion in the first intron of the *FXN* gene on chromosome 9 ([@B1]). The prevalence in the Caucasian populations is 2--5:100.000 ([@B2]). FRDA is characterized by early onset and progressive deterioration of the motor and sensory functions, scoliosis, cardiomyopathy, and eventually nystagmus ([@B3], [@B4]). Age at onset (AAO), clinical progression and severity are not uniform across patients, but variably correlate with the short-allele expansion size ([@B5]). Magnetic Resonance Imaging (MRI) studies have provided several insights over the damage in cerebellar, cerebral, and spinal cord areas involved in FRDA.
Cerebral, cerebellar, and spinal cord involvement in FRDA has been documented and established with different MRI-based techniques. Volumetric MRI studies have shown widespread involvement of white (WM) and gray matter (GM). Atrophy has been documented in the infratentorial compartment at the level of dentate nuclei (DN) ([@B6]), peridentate WM ([@B7]), posterior cerebellar lobules, vermian cortex, as well as in the dorsal medulla ([@B7]--[@B10]) and in supratentorial GM areas ([@B6], [@B8], [@B9]). Diffusion Tensor Imaging (DTI) studies further characterized structural changes in WM revealing alterations in the cerebellar peduncles ([@B6], [@B11]--[@B16]) and in the cerebellum ([@B11], [@B13]). Alterations in the corticospinal tracts (CST) were observed at the level of subcortical pre-central WM, posterior limb of internal capsule (PLIC) ([@B11]) and in the brainstem ([@B6], [@B11], [@B13], [@B15]). Furthermore, other DTI based studies have reported alterations of the posterior thalamic radiations ([@B14], [@B15], [@B17]), optic radiations ([@B18]), and the long associative tracts ([@B11], [@B14], [@B15]).
Few functional MRI (fMRI) studies have been performed in FRDA, including either motor ([@B19]--[@B23]) or non-motor tasks ([@B15], [@B24], [@B25]). These studies reported overall significant differences of activation in the posterior cerebellar lobules ([@B20], [@B22]) and in the cortical motor and sensory areas ([@B19]--[@B22]).
The rationale behind the present work is the existence of a pattern of functional and structural alterations characterizing WM and GM in FRDA which correlates with specific clinical measures known as ataxia scales ([@B26]--[@B28]) routinely used to assess disease severity. Once identified, this pattern could be directly used for the implementation of longitudinal studies possibly overcoming some of the sensibility limitations recently demonstrated for the clinical scales ([@B29], [@B30]). For this reason, we designed a cross-sectional study of FRDA from a neuroimaging (Voxel-Based Morphometry, DTI, fMRI) and a clinical prospective in order to provide a composite overview of the CNS damage in FRDA versus healthy controls (HCs). In addition, we investigated the correlation between clinical functional scales and neuroimaging metrics.
Materials and methods {#s2}
=====================
Participants
------------
We recruited a cohort of 21 patients with a molecularly confirmed diagnosis of FRDA at the research centers "Eugenio Medea" in Conegliano/Pieve di Soligo (TV, Italy) and Bosisio Parini (LC, Italy). The recruited patients were older than 12 years and had an early onset FRDA (under 25 years old). All participants, but three, were native Italians, mostly originating from Central and North Italy. Non-Italian patients came from Albania (*n* = 2) and Germany (*n* = 1). A group of 18 age and sex matched HCs was recruited for inter-group comparison following a detailed anamnestic interview and cognitive assessment. The demographic data of patients and controls are presented in Table [1](#T1){ref-type="table"}.
######
Demographic and clinical data.
**FRDA (*n* = 21)** **HC (*n* = 18)**
---------------- ----------------------------- -------------------
Gender F (%) 16 (76.19) 11 (61.11)
Hand dominance 19R, 2L 18R
AAV (y) 26.95 ± 10.35 (12--50) 27.05 ±9 (16--46)
GAAsr 671.24 ± 210.5 (170--946) --
GAAlr 812.6 ± 225.04 (350--1230) --
AAO (y) 10.62 ± 4.58 (4--20) --
DD (y) 16.33 ± 8.82 (3--32) --
SARA 21.38 ± 7.76 (8--32) --
ICARS 52.95 18. 53 (22--84) --
FARS -ne 62.25 ± 19.37 (31.33--92.5) --
*FRDA, Friedreich\'s Ataxia, HC, healthy control GAAsr, GAA short repeat; GAAlr, GAA long repeat; SARA, Scale for the Assessment and Rating of Ataxia (0--40); ICARS, International Cooperative Ataxia Rating Scale (0--100); FARS-ne, Friedreich Ataxia Rating Scale -neurological examination (0--117)*.
Ethic committee approval and patients consent
---------------------------------------------
The study has been reviewed and approved by the Ethic Committee IRCCS E. Medea---Associazione La Nostra Famiglia---Bosisio Parini (LC) (Prot. No 051/11-CE) and all participants gave their written informed consent in accordance with the Declaration of Helsinki.
Clinical measurement tools
--------------------------
All patients underwent a complete clinical and neurological assessment. The Scale for the Assessment and Rating of Ataxias scale (SARA) ([@B28]), International Cooperative Ataxia Rating Scale (ICARS) ([@B26]), and the neurological section of the Friedreich Ataxia Rating Scale (FARS) ([@B27]) were implemented.
Patients and HCs underwent a cognitive assessment specific for 2 age groups: 12--16 and 16--50 years old. The cognitive functions of the subjects aged 12--16 years were assessed by using the Wechsler Intelligence Scale for Children III (WISC-III) ([@B31]). The group of adults and older adolescents in both FRDA and HCs were assessed by using the Wechsler Adult Intelligence Scale Revised (WAIS- R) ([@B32]).
Neuroimaging protocol
---------------------
FRDA and HCs underwent an MRI session with a 3T Philips Achieva Scanner (Philips Medical System, The Netherlands), equipped with a digital 32-channel head coil. The acquisition protocol included a T1-weighted (T1w) high resolution sequence (TE/TR = 3.5/8 ms, flip angle 8°, SENSE factor 2, voxel-size 1 × 1 × 1 mm^3^ matrix size 256 × 256 × 160), a multi-shell diffusion MRI acquisition (15 directions at b = 300 s/mm^2^, 53 directions at b = 1,100 s/mm^2^, 8 volumes at b = 0 s/mm^2^, TE/TR = 100/8,800 ms, SENSE factor 2, SPIR fat suppression, voxel size 2.2 × 2.2 × 2.2 mm^3^, matrix size 112 × 112 × 80), a T2-weighted (T2w) fat suppressed scan (for DTI processing purposes, TE/TR = 100/4,700 ms, SENSE factor 2, voxel-size 1.5 × 1.5 × 1.5 mm^3^, matrix size 160 × 146 × 110), and a fMRI sequence (FOV = 240 × 240 mm^2^, 40 slices interleaved without gap, voxel size 2.5 × 2.5 × 3.5 mm^3^, TE/TR = 20/2,000 ms, flip angle 85°, 178 time points).
fMRI motor task
---------------
The fMRI protocol included a standard block design finger tapping task involving both hands. Subjects were asked to press the buttons of an MRI-compatible response-device using all the fingers in sequence from the thumb to the little finger, always starting from the thumb. Blocks lasted 20 s for each hand with 16 s inter-stimulus interval. The fMRI task was paced according to the screen commands that were provided with a regular pattern. A drawing of the right or left hand with a caption ("right hand" or "left hand") was projected on MR compatible goggles worn by the patients during the stimulus. A fixation point was projected in the inter-stimulus interval. Subjects were trained before the scan to familiarize with the projected instructions and with the hand device and to ensure comprehension of the task.
Gray matter analysis
--------------------
Voxel-Based Morphometry (VBM) pipeline ([@B33]) was applied to T1w images to detect morphological differences in the volumes between patients compared to HCs. Data was pre-processed with the N4 tool of ANTs ([@B34], [@B35]) to remove intensity field inhomogeneity, then the F | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S1}
============
In human and nonhuman primates, the face plays an important role in social communication ([@R10]; [@R49]; [@R64]). In some species, such as macaques (*Macaca mulatta*, *M. fuscata*), and mandrills (*Mandrillus sphinx*), facial morphology may signal fertility ([@R21]; [@R53]; [@R56]). The face may also provide cues to health in humans ([@R31]; [@R36]; [@R61]) and rhesus macaques ([@R42]). In mandrills and drills (*Mandrillus leucophaeus*), males with stronger facial color saturation tend to be higher ranking ([@R43]; [@R57]). In rhesus macaques, male facial coloration may indicate mate quality ([@R22]; [@R63]) and is linked to competition for mating opportunities ([@R51]), but is not related to dominance status ([@R32]).
In addition to coloration, other aspects of facial morphology may play a role in signaling social status. One such measure is the facial width-to-height ratio (fWHR), which measures bizygomatic width---the distance between the zygomatic arches---divided by superior facial height (mid-face height, i.e., nasion-prosthion) (see [Fig. 1](#F1){ref-type="fig"}). Sexual dimorphism in fWHR was inversely related to dimorphism in canine size across 14 primate species ([@R71]), suggesting that weak dimorphism in canine size is not due to low sexual selection, but instead to selection for sexually dimorphic face width. The authors theorized that sexual dimorphism in human fWHR might be driven by female mate choice for larger cheek bones ([@R72]), a feature indicative of facial attractiveness ([@R18]; [@R19]), although other facial features may be stronger attractiveness indicators ([@R45]). Mate choice might not be the only driver of sexual dimorphism; fWHR may be a signal in male-male competition ([@R12]), indicating differences in dominant and aggressive tendencies that could be linked to facial morphology through underlying differences in testosterone levels ([@R39]; [@R47]).
Since these reports, additional studies have established that fWHR is not sexually dimorphic in humans ([@R37]; [@R38]; [@R48]); however, fWHR has been linked to aggressiveness and fighting ability in human males ([@R4]; [@R30]; [@R62]; [@R76]). Wider male faces are also perceived as being more aggressive ([@R2]; [@R39]; [@R44]; [@R58]), suggesting that relative face width is a social cue to aggressive and assertive behavior. While a meta-analysis of 19 studies (*N* \> 4000) found support for the link between fWHR and aggression ([@R30]), a recent study in a large sample of humans (*N* \> 137,000) found little evidence for any link between fWHR and self-reported behaviors such as impulsiveness ([@R35]). Moreover, researchers have conducted most human studies of fWHR in western, educated, industrialized, rich, and democratic populations ([@R33]), which are largely socially monogamous and not representative of the diversity among human mating and societal systems.
Given these limitations and the debates within the current literature, returning to the roots of this literature and considering the role of fWHR in nonhuman primates could improve our understanding of the potential role of human facial morphology in mate choice and mate competition. Doing so provides two specific benefits. First, examining fWHR links to dominance in other primate species could allow a better appreciation of the social selection pressures that led to this association, particularly regarding sex differences. Examining links to dominance behavior among species with varying levels of fWHR dimorphism could provide a stronger ecological basis for understanding the fWHR-dominance relationship found in humans. Second, as human studies often rely on self-reported measures or proxies of dominance ([@R35]), by examining nonhuman primates we can assess not only trait ratings of assertive behavior but also specifically rank, which could be more biologically relevant for understanding behavioral links to fWHR. We also examined a second facial metric, the facial lower-height-full-height ratio (fLHFH), which is introduced after fWHR.
Given the inverse relationship between canine height sexual dimorphism and fWHR dimorphism ([@R71]), brown capuchins (*Sapajus apella*) proved an ideal candidate for exploring fWHR links to dominance, given their low sexual dimorphism in canine size, similar to humans, but apparent dimorphism in fWHR ([@R40]; [@R71]). Findings in brown capuchins revealed that in adults of both sexes, fWHR was positively related to ratings of Assertiveness, and furthermore, fWHR was higher among alpha individuals ([@R40]). Whether the dimensions of the capuchin face are a social cue of assertiveness is still debated ([@R74]). However, as has been suggested in humans, a higher fWHR could prove advantageous in male-male competition, possibly through links to stronger bite force or more robust skull structure ([@R40]). Research in the *Macaca* genus supports the theory that fWHR is a cue to fighting ability ([@R9]). Across 11 macaque species, those with despotic dominance styles, such as in rhesus macaques, had higher fWHR in both sexes compared to more socially tolerant species, such as Tonkean macaques (*Macaca tonkeana*). These findings suggest that face width could be a signal of aggressive tendencies, particularly in females, that reduces the need for conflict within species for which escalated conflict could have serious consequences ([@R9]). This result fits with findings that rhesus macaques can differentiate human faces of varying fWHR, looking longer at faces with lower fWHR ([@R17]).
In both humans ([@R28]; [@R47]; [@R69]) and capuchins ([@R11]) it has been suggested that the relationship between fWHR and aggressive behavior is driven by low social status, as it is significant only among low-status individuals. In brown capuchins, for example, although higher ranking individuals are typically higher in Assertiveness, correlations between fWHR and Assertiveness are significant only in non-alpha individuals ([@R11]). Given that group members are typically aware of which is the highest ranking member of their group, there may be no need for high-ranking individuals to physically advertise dominance, as social knowledge obviates the need for this. This hypothesis proposes that low-status individuals are not necessarily low in the Assertiveness personality dimension. Assertiveness is a construct of multiple assessments of behavior, and tends to capture, among other descriptors, how independent, submissive, bullying, and manipulative ([@R68]) an individual is.
While the current literature on facial morphology provides insights into the social role of physical features, to date, investigations of social behavior and physical features have focused on only a few species. In the current study, we expand this line of research to focus on an Old World monkey species. Given the links between fWHR and female social tolerance across the *Macaca* genus ([@R9]), we aimed to explore whether this ratio is linked specifically to dominance behavior in a despotic macaque species ([@R60]), rhesus macaques. In contrast to brown capuchins, which have low canine dimorphism and higher fWHR dimorphism ([@R40]; [@R71]), rhesus macaques exhibit both medium fWHR and canine height dimorphism, as well as being relatively more despotic with high levels of intragroup aggression ([@R59]), at least among females, factors that make them a useful comparison species for exploring links between fWHR and dominant/aggressive behaviors. This study should therefore help to build a bigger picture, across the primate lineage, of what factors might drive fWHR as a cue for dominance.
In two samples of captive rhesus macaques we studied the relationships between fWHR and two different measures of dominance: 1) hierarchical dominance status measured using normalized David's scores and 2) a rater-derived personality dimension, Assertiveness, which assesses overall tendencies toward assertive and aggressive behavior, rather than dominance status. If rhesus macaques parallel brown capuchins, fWHR might be positively related to ratings of Assertiveness, similar to links to despotism ([@R9]), with higher fWHRs found among individuals with higher social rank. Moreover, if there is a relationship between fWHR and Assertiveness, and the association is driven by low social status, then we could find a significant association between fWHR and dominance status only among individuals with lower social status, but not higher social status, as measured by normalized David's scores ([@R40]). Following earlier work on personality and facial morphology ([@R73]), we also simultaneously examined fWHR associations with ratings on five other personality dimensions, labeled Confidence, Openness, Friendliness, Activity, and Anxiety ([@R68]), a conservative approach that allowed us to control for covariance between dimensions.
Brown capuchin males have higher fWHR than females, although this is particularly driven by mature, alpha males that have even higher fWHRs ([@R40]). Similarly, the link between fWHR and behavior is found predominantly among human males ([@R50]; [@R71]), so it would be consistent for fWHR associations in rhesus macaques to be driven by males. If fWHR--personality associations are driven by intrasexual selection, then given low male--male competition in rhesus, we might not find similar male-driven effects. Moreover, r | {
"pile_set_name": "PubMed Central"
} |
Dear Editor-in-Chief
====================
Most of anti-cancer drugs have mutagenic, clastogenic, and carcinogenic properties. Studies on oncology nurses and personnel handling cytostatic drugs showed that the frequencies of chromosomal aberrations, sister chromatid exchanges, and micronuclei were significantly increased in personnel handling anti-cancer drugs compared to control group ([@B1]). β-Lapachone (β-Lap) is an anti-cancer drug which exerts cytotoxic effect via its induction of ROS generation which ultimately leads to DNA damage ([@B2]). Nucleotide excision repair (NER), base excision repair (BER), and non-homologous end joining repair (NHEJ) pathways are very important in genome stability. XRCC1 (OMIM: 194360, an essential scaffolding protein for both long and short patch BER), GADD45A (OMIM: 126335, a growth arrest and DNA-damage-inducible protein) and LIG4 (OMIM: 601837) have important roles in the BER, NER, and NHEJ pathways, respectively. LIG4 efficiently joined single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction ([@B3]). LIG4 efficiently joined single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. LIG4 efficiently joined single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. Depletion of XRCC1 dramatically sensitized cells to β-Lap ([@B4]) and Gadd45a-null mice showed genomic instability ([@B5]). β-Lap efficiency can be affected by NHEJ performance ([@B2]). Due to anti-cancer property of β-Lap, so it's occupationally exposure as a public health concern is expected.
To our knowledge there is no study on the effect of β-Lap on the transcript levels of *XRCC1*, *GADD45A* and *LIG4* genes. Therefore the present study was carried out.
SH-SY5Y neuroblastoma cell was cultured in DMEM/F12 enriched with 10% FBS (Gibco), penicillin (100 U/ml, Sigma) and streptomycin (100 μg/ml, Sigma). The cells were seeded at 3 × 10^5^ cells/ml and incubated at 37 °C for 24 h and then cells were treated with β-Lap. Cells were harvested after 24 h and RNA extraction was done. Quantitative real-time PCR and primers specific for the examined genes were described previously ([@B6]). 3.2 and 2.0 μm M β-Lap showed about 18% cytotoxicity and no cytotoxicity, respectively. The experiments were done in triplicates. Data were shown as means ± standard error (SE).
[Figure 1](#F1){ref-type="fig"} shows the alteration of mRNA levels of *XRCC1*, *GADD45A* and *LIG4* genes in different treatments. The *XRCC1* mRNA level was significantly decreased at non-toxic concentration. The *GADD45A* mRNA levels did not alter at nontoxic concentration of β-Lap, however, it was significantly increased at toxic concentration of β-Lap, compared with the control culture. The mRNA levels of *LIG4* were significantly decreased at both toxic and non-toxic concentrations of β-Lap. The expression levels of the *XRCC1* and *LIG4* significantly decreased at nontoxic concentrations of β -Lap, cellular DNA repair system cannot repair DNA damages.
{#F1}
We know that nurses of oncology departments and workers handling neoplastic drugs showed higher chromosomal damage compared to control persons ([@B1]), which may interpreted by their lower DNA repair capacity due to exposure of non-toxic levels of anti-cancer drugs. Alterations in mRNA levels of DNA repair related genes seem to be a rapid, simple and sensitive method for biomonitoring of effect(s) of occupationally exposure to anti-cancer drugs.
For public health programs, the early detection of alterations may permit the adoption of preventive biological controls such as hygienic improvements in the workplace or the reduction of work hours. Further experiments needs to investigate the effects of other anti-cancer drugs of expression levels of DNA repair genes at non-toxic concentrations.
This work was supported by the Shiraz University, Iran (Grant number: 93GCU1M1741).
**Conflict of interest**
The authors declare that there is no conflict of interests.
| {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
*Acanthaspis cincticrus* (Stål) (Hemiptera: Reduviidae) is a predatory assassin bug, which feeds on ants and can be found in the vicinity of ant nests, waiting for the preys^[@CR1]^. This species is native to Oriental Region with one generation per year. Nymphs of this species have five instars and exhibit both natural and corpse camouflaging behaviors^[@CR1]^. They cover themselves with a range of materials found in their environment, including ants corpses and other insects, dust and soil particles, which they affix on themselves with the viscid secretions from specialized setae on the abdomen^[@CR2]^. Camouflaging in *A. cincticrus* is specific to the nymphs (Fig. [1A](#Fig1){ref-type="fig"}) and is absent in the adults (Fig. [1B](#Fig1){ref-type="fig"}). This behavior has been documented in some neuropterans^[@CR3]^. Camouflaging may benefit nymphs in two ways: by being less visible in stalking their preys and by not being obvious to potential predators. While studies on *A. cincticrus* thus far have focused on the morphology, biology and behaviors related to camouflaging in nymphs^[@CR1],[@CR2]^, the molecular mechanisms underlying development and predation are unknown.Figure 1The nymph and adult of *A. cincticrus*. (**A**) A masked nymph camouflaged with ant corpses, dust and soil particles. (**B**) An adult male. Photographs were taken by F.K.
In predatory insects, arousing, paralyzing and sucking are important for predatory process^[@CR4]^. These processes are influenced or regulated by several genes or pathways involved in the identification of chemical signals, and in the regulation of neuromodulators for agonistics and the digestion of the prey^[@CR5]--[@CR7]^. Predators locate and interact with their prey by using species-specific semiochemicals, such as the detection and discrimination of odorant-binding proteins (OBPs) and chemosensory proteins (CSPs)^[@CR5]^. After locating the target, aggression is displayed by predaceous arthropods against their prey^[@CR8]^. Factors that affect aggressiveness and/or fighting success in predaceous arthropods include body size^[@CR9]^ and contestants' age^[@CR10]^. Previous studies reported that many genes, such as *cyp6Q20*, *tyramine receptor*, *octopamine receptor* and *metabotropic glutamate receptor B*, were likely to be involved in the regulation of complex behavioral phenotypes^[@CR11],[@CR12]^. *Tyramine receptor* and *octopamine receptor* serve as aggression modulating neurotransmitters that affect excessive aggressiveness and impulsiveness in the biogenic amine signaling pathway^[@CR11]^; *metabotropic glutamate receptor B* is a part of G protein coupled metabotropic receptors family, which is the major excitatory neurotransmitter acting through multiple independent receptors, involved in regulating aggressive behavior of mice^[@CR12]^.
The paralyzing and digestion process of assassin bugs includes extra oral digestion (EOD)^[@CR13]^ which is a chemical pretreatment to mobilize nutrients and is common in the predation of Heteroptera^[@CR7]^. Venom and/or digestive enzymes have a biochemical role of typically stunning, killing prey and even aiding in prey digestion^[@CR7],[@CR14]^. The venomous saliva of predatory reduviid bugs is known to contain a complex mixture of proteins^[@CR15]^, peptides^[@CR16]^ and enzymes^[@CR17]^. The most abundant enzymes that are present in the salivary secretion include proteinases, phospholipase, trypsin like enzymes, esterase, serine proteases, etc^[@CR18]^. Serine proteases, found in many organisms, have attracted broad interests because they have diverse physiological functions that affect processes such as digestion, immune response, cellular differentiation and prothrombin activator^[@CR7],[@CR13]^. The presence of trypsin-like enzyme in the salivary glands of *Zelus renardii* indicates that it has evolved or retained *trypsin-like* genes for protein digestion^[@CR7]^. Although most reduviids are common predators, studies on the factors influencing the feeding process focused on digestion^[@CR7],[@CR15]--[@CR18]^.
The transcriptomic and bioinformatic approaches presented in previous studies have been served as a foundation to explore the relationships between gene regulation and behavioral evolution in other species^[@CR5],[@CR11]^. In this study, we performed a comprehensive transcriptome analysis during eight life stages of *A. cincticrus*, including egg, five instar nymphs, female and male adults. We identified 13,479 significantly differentially expressed genes (SDEGs) and also identified and characterized 115 SDEGs involved in predation, indicating differences between genders and among life stages. We performed quantitative real-time PCR (qRT-PCR) analysis to determine the expression profiles of ten SDEGs involved in predation from different life stages. The results could help elucidate the role of venom-related, aggression-related and olfactory-related genes involved in the predation of reduviids.
Results {#Sec2}
=======
Whole-transcriptome sequencing and annotation of the predicted proteins {#Sec3}
-----------------------------------------------------------------------
cDNA libraries from all life stages of *A. cincticrus* yielded about 176 million clean sequence reads with an average quality value ≥ 30. GC content of the sample was averaged at 38.03% (Table [S1](#MOESM1){ref-type="media"}). After assembling the clean reads, we obtained 164,745 transcripts and 84,055 unigenes with an average sequence length of 1,366 bp and 667 bp, and N50 with average lengths of 2,731 bp and 1,087 bp, respectively (Table [1](#Tab1){ref-type="table"}). The length of unigenes ranged from 210 bp to 29,391 bp (Fig. [2A](#Fig2){ref-type="fig"}). Of which, 12, 679 (or 15.09%) unigenes had sequence length more than 1,000 bp. The result is similar to the number of unigenes reported in the moths *Dendrolimus punctatus* (70,664)^[@CR19]^ and *Athetis lepigone* (81,356)^[@CR20]^. A proportion of unigenes was annotated based on the available protein database for *A. cincticrus*. 24,402 unigenes (or 29.03%) were annotated as coding hypothetical proteins. Homology analysis of *A. cincticrus* unigenes showed that they best matched with the species from Hemiptera, the pea aphid *Acyrthosiphon pisum* and the bean bug *Riptortus pedestris* (Fig. [2B](#Fig2){ref-type="fig"}).Table 1Summary of *Acanthaspis cincticrus* transcriptomes.Length rangeTranscriptsUnigenes200--30039,146(23.76%)33,985(40.43%)300--50031,343(19.03%)23,125(27.51%)500--100029,635(17.99%)14,266(16.97%)1000--200028,485(17.29%)7,202(8.57%)2000+36,136(21.93%)5,477(6.52%)Total number164,74584,055Total length225,069,31156,032,206N50 length2,7311,087Mean length1,366667 Figure 2The statistics of assembly and homology analyses. **(A**) Size distribution of unigenes. (**B**) Species distribution of the BLASTX against NCBI-NR database, proportions of more than 1% were shown.
Functional classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis {#Sec4}
-------------------------------------------------------------------------------------
The functions of unigenes were predicted by Gene Ontology (GO) analysis at the macro level. In total, 11,682 unigenes were classified into 58 sub-categories belonging to three GO functional categories: cellular component (CC), molecular function (MF) and biological process (BP) (Fig. [S1](#MOESM1){ref-type="media"}). The GO classification of unigenes indicated that 'cell part' (20.79%) and 'cell' (20.68%) were the dominant sub-categories in the CC category, 'catalytic activity' (42.40%) and 'binding' (38.83%) were the most dominant sub-categories in the MF category, and 'metabolic process' (24.23%) and 'cellular process' (21.81%) were the most dominant sub-categories in the BP category.
We also annotated the unigenes by searching the Cluster of Orthologous Groups (COG) database to classify the functions of the predicted proteins. A total of 6,822 unigenes had a COG classification. Among the 25 COG categories (Fig. [S2](#MOESM1){ref-type="media"}), the cluster for 'general function prediction only' was the most dominant group (18.25%), followed by 'translation, ribosomal structure and biogenesis' (8.66%) and 'post-translational modification, protein turnover, chaperones' (8.58%).
In order to identify the biological pathways represented in the transcriptome of *A. cincticrus*, 7,193 un | {
"pile_set_name": "PubMed Central"
} |
Background
==========
ERK mitogen-activated protein (MAP) kinases are commonly activated by 7TMRs, which leads to a wide array of cellular processes including cell proliferation and cell differentiation. In the last decade, a tremendous amount of works have been dedicated to elucidate the cell signaling mechanisms whereby 7TMRs activate ERK. To achieve ERK activation, some 7TMRs, such as the lutropin receptor \[[@B1]\], rely solely on G protein activation and to second messenger production. Besides, several reports support the view that MAP kinase activation requires receptor internalization, mediated by β-arrestins \[[@B2]\]. Originally, β-arrestins have been viewed as responsible for receptor desensitization, by uncoupling an agonist-activated receptor from its effector G proteins, and then by driving the uncoupled receptor to clathrin-coated pits \[[@B3],[@B4]\]. β-arrestin-dependent internalization of 7TMRs involves the direct interaction of the carboxy-terminal part of β-arrestins with the β2-adaptin subunit of the adaptor protein (AP)-2 complex \[[@B5]\]. Mutation of two arginines in this region abrogates both the β-arrestin/AP2 interaction and the clustering of β2-adrenergic receptor into clathrin-coated pits \[[@B6]\]. Furthermore, β-arrestins bind directly to clathrin *in vitro*\[[@B7]\]. As endocytic adaptors, β-arrestins also interact with the small GTPase ADP-ribosylation factor (ARF)-6 and its exchange factor nucleotide-binding site opener (ARNO), and with the N-ethylmaleimide-sensitive fusion protein (NSF) \[[@B8]\]. In HEK 293 cells stimulated by isoproterenol, overexpression of β-arrestin V53D, or of a β-arrestin (319--418) peptide, both impaired in their receptor-binding ability \[[@B9]\], not only reduces the β2-adrenergic receptor internalization level, but also decreases ERK activation \[[@B10]\]. Likewise, inhibition of β-arrestin 1 or 2 expression by RNA interference levels off the isoproterenol-induced ERK phosphorylation \[[@B11]\]. Besides, fission of the clathrin endocytic vesicle from the plasma membrane is in part achieved by the GTPase dynamin. Overexpression of a defective K44A dynamin mutated in its catalytic domain \[[@B12]\] impairs both receptor internalization as well as ERK stimulation transduced by the δ-opioid receptor \[[@B13]\]. In sharp contrast, some 7TMRs, such as the α2a adrenergic receptor \[[@B14]\], activate ERK without being internalized, whereas some others, such as the metabotropic glutamate mGlu1 receptor, require β-arrestins to activate ERK, but not through their endocytosis-promoting ability \[[@B15]\]. Therefore, whether 7TMR-mediated ERK activation will depend on β-arrestin-promoted internalization or not seems to be a receptor-related issue.
The follicle-stimulating hormone receptor (FSH-R) is a 7TMR whose main effector is adenylate cyclase \[[@B16]\]. Once bound to its agonist, the FSH-R gets phosphorylated by G protein-coupled receptor kinases (GRKs), recruits β-arrestins \[[@B17]\] and undergoes internalization \[[@B18]-[@B21]\]. Overexpression of β-arrestin 1 or 2 or of the β-arrestin (319--418) peptide respectively reduces or increases cAMP in response to FSH, as measured by a luciferase gene reporter assay \[[@B17],[@B22]\]. The FSH-R is expressed by two cell types of the gonad, namely Sertoli cells in the testis, and granulosa cells in the ovarian follicle \[[@B23]\]. ERK MAP kinases have been shown to be activated upon FSH stimulation of primary cultures of both cell types \[[@B24]-[@B26]\], and this signaling pathway mediates the mitogenic response of Sertoli cells to the hormone \[[@B24]\]. Previously, overexpression of β-arrestin 1 or 2 \[[@B21]\] or of the β-arrestin (319--418) peptide and of the dynamin K44A \[[@B20]\] mutant had been shown to affect the FSH-R internalization. But to date, nothing is known about the role of β-arrestin-dependent internalization in ERK activation by the FSH-R. Here, we addressed this question in HEK 293 cells transiently expressing the FSH-R, by enhancing internalization with overexpressed wild-type β-arrestins or by interfering with receptor internalization with the β-arrestin (319--418) construct or by the dynamin K44A mutant.
Methods
=======
Materials
---------
Porcine FSH (apparent molecular weight = 33,500 g/mol) was purified by Dr Jean Closset (Université de Liège, Belgium) \[[@B27]\]. Amphotericin B, penicillin, streptomycin, glutamin, phenylmethylsulfonyl (PMSF), Na~3~VO~4~, leupeptin, pepstatin and aprotinin were from Sigma Chemical Co (St. Louis, MO). Dulbecco\'s minimum essential medium (DMEM), minimum essential medium (MEM) with Earle\'s salt, foetal calf serum (FCS), non essential amino acids, trypsin-EDTA were all from Gibco-BRL Life Technologies (Gaithersburg, MD). The Transfast™ transfection reagent was from Promega Corp., Madison, WI.
Plasmids
--------
The pRK-FSHR/3 was a kind gift of Dr R. Sprengel (Heidelberg, Germany). The pCMV5-rat β-arrestin 1 and pCMV5-rat β-arrestin 2 were gifts of Dr R.J. Lefkowitz (Durham, NC). The pcDNA3-β-arrestin (319--418) was given by Dr J.L. Benovic (Philadelphia, PA) and the pcDNA3-dynamin-K44A plasmid was provided by Dr S.L. Schmid (La Jolla, CA).
Cell culture and transfection
-----------------------------
HEK 293 cells were grown in MEM supplemented with 20 μM glutamin, 100 μM non essential amino acids, 10% heat-inactived FCS, 10 U/ml penicillin and 10 μg/ml streptomycin.
HEK 293 cells were grown and transfected in 75 cm^2^flasks. Cells were maintained at 37°C in a humidified atmosphere of 5% CO~2~. Fifty to eighty % confluent cells in FCS-free medium were incubated for 1 hour with Transfast reagent (800 ng per cm^2^culture) and plasmid DNA encoding the FSH-R (200 ng per cm^2^) and β-arrestin (319--418) (600 ng per cm^2^) or wild-type β-arrestins (200 ng per cm^2^) or dynamin K44A (600 ng per cm^2^), unless otherwise stated. Empty plasmid was added in every culture wells to equalize transfected plasmid concentrations. Twenty-four hours after transfection, cells were treated for 90 sec with 3 ml 0.25% trypsin and 1 mM EDTA, centrifuged 10 min at 100 *g*and seeded in 9.6 cm^2^culture plates with a dilution factor of 0.4. Seventy hours after transfection, cells were FCS-starved for 2 hours in 1 ml, and then stimulated with 1 to 10 nM pFSH. Media were collected and cells were scrapped. For further Western blot analysis, HEK 293 cells were scrapped directly in Laemmli sample buffer (Tris HCl 0. 25 M pH 6.8, 5% SDS, 50% glycerol, 50 mM β-mercaptoethanol, 0.01% bromophenol blue).
Western blots
-------------
HEK 293 cell lysates were preincubated for 30 min at 37°C before gel loading. Samples were resolved by SDS-PAGE, electrophoretically transferred to polyvinylidene difluoride (PVDF) membranes (NEN Life Science Products, Boston, MA) and hybridized with the antibodies mentionned in the following. Anti-p44^ERK1^/p42^ERK2^rabbit polyclonal antibody (Cell Signaling Technology Inc.) was used at 1:1,000 dilution. The anti-ERK rabbit polyclonal antibody purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), was used at 1:10,000 dilution. The anti-arrestin A1CT polyclonal antibody kindly provided by R.J. Lefkowitz (Durham, NC), was used at a 1:10,000 dilution. It recognizes the C-terminus of β-arrestins, and therefore recognizes endogenous, overexpressed wild-type as well as overexpressed (319--418) β-arrestins. Primary antibodies were incubated with membranes in TBS (20 mM Tris, 150 mM NaCl) 0.1% Tween-20 supplemented with 5% unfat milk for 18 hours at 4°C under constant agitation. Horseradish peroxydase-coupled anti-rabbit antibody (Bio-Rad Laboratories Inc., Marnes-la-Coquette, France) was used at 1:5,000 dilution, to detect antigen-antibody interactions by enhanced chemioluminescence (NEN Life Science Products). To monitor protein loading, a first Western blot was hybridized with the anti-P-ERK antibody, the membrane was stripped 30 min at 50°C in 100 mM β-mercaptoethanol, 2% SDS, and rinsed twice for 10 min at room temperature in 150 mM NaCl, | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
The bacteria *Streptococcus pneumoniae* (pneumococcus) and *Haemophilus influenzae* type b (Hib) are leading causes of childhood pneumonia and meningitis and are major contributors to worldwide mortality in children younger than 5 years of age. In 2011, an estimated 411,000 deaths occurred worldwide due to pneumococcal pneumonia and 197,000 due to Hib pneumonia \[[@CR1]\]. In China, it is estimated that there are 261,000 cases and 11,000 deaths each year in children under 5 years of age due to pneumococcal pneumonia and meningitis \[[@CR2]\], and 19,000 childhood deaths result from Hib infection \[[@CR3]\].
Pneumococcus and Hib colonize the upper airways. Asymptomatic carriers can still transmit to other individuals, with disease resulting if the pathogens descend the airway into the lower respiratory tract \[[@CR4], [@CR5]\]. Over 90 different serotypes of pneumococcus have been found, and vaccinations need to strike a reasonable balance between the financial cost against the value of including more serotypes known to cause disease \[[@CR6]\]. In contrast to the serotypic diversity with pneumococcus, Hib is a much more predominant cause of disease than non-type b *H. influenzae* \[[@CR7]\].
The Hib conjugate vaccine has been available since 1987 in the US \[[@CR7]\] and 2000 in China \[[@CR8]\], and a pneumococcal conjugate vaccine (PCV) was licensed in the US in 2000 \[[@CR9]\] and introduced to China in 2008 \[[@CR10]\], although it was taken off the market in China in 2014 \[[@CR11]\]. Neither the Hib vaccine nor PCV are included on the publically-funded Expanded Program on Immunization (EPI) in China, but they are available at immunization clinics for a fee. The Hib vaccine costs \$13--\$17 whereas PCV is much more expensive (\$127) \[[@CR10]\]. As a result coverage of Hib vaccine is much higher than PCV (50.9 % versus 11.4 % in Shanghai); moreover, although infants as young as 6 weeks are eligible for Hib vaccine and PCV administration, vaccination is typically delayed until after 1 year of age. Coverage at 12 months is around 20 % for Hib vaccine and \<5 % for PCV and at 24 months, coverage is approximately 40 % for Hib vaccine and 5 % for PCV \[[@CR12]\].
The first PCV protected against 7 serotypes of pneumococcus (PCV-7), but more recently, 10-valent (PCV-10) and 13-valent (PCV-13) vaccines have been licensed \[[@CR6]\], and a 15-valent vaccine (PCV-15) is under development \[[@CR13]\]. The World Health Organization (WHO) recommends that countries choose a PCV depending on the distribution of serotypes within their population, along with vaccine supply and cost-effectiveness considerations \[[@CR6]\]. Two studies in China have previously evaluated the coverage between PCVs and serotypes in the population. A study of clinical isolates from 8 cities in China during 2005 and 2006 found coverage of PCV-7 was 62.6 %, PCV-10 was 64.8 %, and PCV-13 was 79.6 % \[[@CR14]\]. Similarly, a study of clinical isolates from 2006 to 2008 found coverage of 60.3, 66.7 and 87.8 % for the 3 vaccines, respectively \[[@CR15]\]. Because the distribution of pneumococcal serotypes may vary geographically, however, these findings may not be representative of potential coverage from vaccines in all areas.
Few studies have been published from China in the English literature looking at Hib and pneumococcal carriage. This information is important for modeling the burden of disease and underscoring the importance of vaccination, particularly in a country with low coverage of Hib and pneumococcal vaccines but with widespread resistance to antibiotics \[[@CR16], [@CR17]\]. In this study, we calculate the prevalence of nasopharyngeal carriage of Hib and pneumococcus (including specific pneumococcal serotypes), describe the prevalence of antimicrobial resistance in children with carriage, and examine risk factors for nasopharyngeal colonization with pneumococcus or Hib.
Methods {#Sec2}
=======
In 2009, April and May for spring, October and November for autumn, healthy children aged 12--18 months were recruited from a total of 5 immunization clinics in Shanghai. We purposely sampled in both the spring and autumn in order to determine if there was a seasonal fluctuation in carriage (although this has not been borne out in previous studies in the UK \[[@CR18]\] or Italy \[[@CR19]\]). These clinics purposefully selected from 3 districts (Huangpu, Xuhui, and Pudong) to represent different areas of the city. For 1 or 2 days, research staff from the municipal Centers for Disease Control and Prevention (CDC) and district CDCs attended these clinics, and enrolled children between 12 and 18 months who attended the clinic on those days. Children were excluded for the following reasons: 1) antibiotic use within 15 days of enrollment; 2) congenital anomalies of the nasopharynx; 3) existence of a long-term infectious disease (such as chronic otitis media, or chronic sinusitis); 4) previous immunization for pneumococcal disease; 5) coagolopathy; or 6) body temperature over 38 °C at time of enrollment.
Parents of the children were asked about their residency status (local or Shanghai residency vs non-local residency), their household monthly income, daycare attendance, household size, number of children, highest educational level attainment of father and mother, smoking in the household,, if child was breastfed, child history of serious disease, and number of doses of Hib vaccine the child had received.
Research staff obtained a nasopharyngeal sample using one infant-sized calcium alginate swab (Thermo Fisher Scientific, Hampton, NH, USA) for each child. These specimens were streaked on Columbia agar and chocolate agar immediately upon collection, then transported in 12 h to the Shanghai Municipal CDC for culturing and preliminary pathogen identification. The swabs were streaked directly onto the plates. Positive isolates were stored at −70 °C, then transported to a centralized laboratory in Beijing for pathogen confirmation, pneumococcal serotyping, and antibiotic resistance testing. The site of specimen collection (nasopharynx), swab material (calcium alginate fiber), storage temperature (−70 °C), and choice of agar (5 % sheep blood) followed standard methods \[[@CR20]\].
Isolate confirmation {#Sec3}
--------------------
The specimens streaked on the Columbia and chocolate agar were incubated at 37 °C in 5 % CO~2~-enriched atmosphere for 24--48 h. Identification of pneumococcal colonies was based on the following conventional microbiological methods: colony morphology, growth on Columbia agar, susceptibility to optochin, and bile solubility. Colony morphology, growth on chocolate agar, and the X + V factor were requirements for identification of *H. influenzae* colonies. For both pneumococcus and Hib, a diameter in the inhibition zone \>7 mm was recorded as a positive result. *S. pneumoniae* isolates were serotyped by the Neufeld (Quellung) reaction, by inoculating a broth with culture from the agar plate, and then mixing a selection from the broth with antiserum and determining if a reaction occurred.
Antimicrobial susceptibility tests {#Sec4}
----------------------------------
Minimum inhibitory concentrations (MICs) of anti-microbial agents were determined by E-test method. The pneumococcal and Hib isolates were tested for susceptibility to azithromycin, cefuroxime, ceftriaxone, levofloxacin, and moxifloxacin. Pneumococcal isolates were additionally tested for resistance to amoxicillin/clavulanic acid, erythromycin, and penicillin. *H. influenzae* isolates were tested for susceptibility to ampicillin. Standard references were included for quality control.
Statistical analysis {#Sec5}
--------------------
Descriptive statistics were used to illustrate the prevalence of Hib and pneumococcal carriage, antibiotic resistance, *S. pneumoniae* serotypes, season of enrollment, and other demographic characteristics of the enrolled children. For bivariate analyses, the Pearson chi-square test was used to test the association between dichotomous demographic factors and 1) carriage of *S. pneumoniae* and 2) carriage of Hib. The Cochran-Armitage Trend Test was used to compute *P*-values for ordinal variables (age of child, age of mother at childbirth, urbanicity, household income, size of house, mother's education, father's education, feeding pattern, and Hib vaccine history). Exact tests were used if any cell counts were ≤5. Correction for multiple testing was done through the sequential Holm-Bonferroni Method.
For the multivariable analysis, the explanatory variables input into the logistic regression model were either related due to (1) a priori considerations (age of child), (2) selection criteria (season, urbanicity), or (3) variables found to be significant (*P*-value \<0.05) in the bivariate analysis. Mother's education level and father's education level were not placed in the same model together because of concerns about multicollinearity. Analyses were performed in SAS version 9.3 (SAS Institute, Inc, Cary, NC, USA). *P*-value correction for multiple testing was computed in R version 3.0.3 (R Foundation for Statistical Computing, Vienna, Austria).
Results {#Sec6}
=======
In this study, 6 parents refused to participate, leaving | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
Our group has previously demonstrated that antibodies to a 140 kDa protein detected by protein immunoprecipitation (known as anti-p140 or P140) in JDM were strongly associated with the development of calcinosis, a major cause of morbidity \[[@keu259-B1]\]. The presence of autoantibodies to a 142 kDa antigen (anti-MJ) in JDM has also been shown by others to be associated with a severe disease course, worse functional status and persistent disease activity \[[@keu259-B2]\]. It is now clear that the target of these autoantibodies is a 140 kDa protein, NXP2 (molecular weight 140 kDa). Anti-NXP2 autoantibodies are common in JDM and identifiable in 13--23% of patients \[[@keu259-B1], [@keu259-B2]\].
JDM is a heterogeneous disease and autoantibodies are potentially useful biomarkers to divide patients into homogeneous subgroups and inform on prognosis. Anti-NXP2 autoantibodies are of particular interest, given their frequency in JDM and their association with important disease features such as calcinosis, a major cause of morbidity. In addition to autoantibody status, age at disease onset has also been shown to influence the clinical phenotype and overall prognosis in JDM, although the nature of the relationship between age at disease onset and outcome has been variably reported \[[@keu259-B3], [@keu259-B4]\].
Here we analyse the clinical associations of anti-NXP2 measured by ELISA and protein immunoprecipitation within an extended and large cohort of juvenile myositis patients stratified by age of onset. We specifically assess the relationships between autoantibody status, calcinosis and disease activity.
Methods
=======
Patients
--------
Patient serum samples and clinical data were obtained through the UK Juvenile Dermatomyositis Cohort and Biomarker Study (JDCBS). The JDCBS is a large cohort of UK patients with idiopathic inflammatory myopathies (IIMs), the majority with JDM \[[@keu259-B5]\]. Patients are recruited consecutively on presentation to paediatric rheumatology departments across the UK. Children and young people ≤16 years of age are included based on a diagnosis of definite or probable JDM or PM by Bohan and Peter criteria \[[@keu259-B6]\], as well as JDM or PM with overlap CTD features. Multicentre research ethics approval was obtained for the JDCBS and parental consent for children and consent or age-appropriate assent was obtained for all patients in accordance with the Declaration of Helsinki. The JDCBS Steering Committee approved this project and biological samples and clinical data were provided in accordance with JDCBS ethics and consent.
Remission in JDM was defined as a full-strength Childhood Myositis Assessment Score (CMAS) \>48 \[[@keu259-B7]\], the absence of skin disease (no rash, no Gottron's, no oedema and no ulceration) and a Physician's Global Assessment Score (PGAS) \<1. While this definition of remission has not been validated, all are standard outcome measures in JDM. Where possible, we also utilized the recently proposed PRINTO criteria for disease inactivity in JDM, defined as at least three of the following criteria: creatinine kinase ≤150, CMAS ≥48, manual muscle test (MMT) ≥78 and PGAS ≤0.2 \[[@keu259-B8]\].
Autoantibody detection
----------------------
Immunoprecipitation of radio-labelled K562 cells was performed on all samples to determine the presence of autoantibodies. Anti-NXP2 ELISA was subsequently performed on all samples. Patients were classified as anti-NXP2 positive if a 140 kDa band was seen on immunoprecipitation and anti-NXP2 ELISA was subsequently positive.
### Immunoprecipitation
Ten microlitres of sera were mixed with 2 mg of protein A--Sepharose beads (Sigma, St Louis, MO, USA) in immunoprecipitation (IPP) buffer (10 mM Tris--HCl, pH 8.0, 500 mM NaCl, 0.1% v/v Igepal) at room temperature for 30 min. Beads were washed in IPP buffer prior to the addition of 120 µl of \[^35^S\]methionine-labelled K562 cell extract in IPP buffer. Samples were mixed at 4°C for 2 h. Beads were washed in IPP buffer and Tris-buffered saline (TBS) (10 mM Tris--HCl, pH 7.4, 150 mM NaCl) before being resuspended in 50 µl of SDS sample buffer (Sigma). After heating, proteins were fractionated by 9% SDS-PAGE gels, enhanced, fixed and dried. Labelled proteins were analysed by autoradiography.
### ELISA
ELISA was conducted as previously described \[[@keu259-B9]\], with some modifications. Ninety-six-well polystyrene plates were coated with rNXP2 (Origene Technologies, Rockville, MD, USA) at 4°C for 16 h. Samples were diluted to 1:200. Secondary antibodies were conjugated goat anti-human IgG/M (Sigma). Tetramethylbenzidine liquid substrate (Sigma) was then added. All samples were tested in duplicate and optical density was read using an automatic plate reader. The negative cut-off was defined as \>3 [s.d.]{.smallcaps} above the mean of 42 normal healthy (adult) serum controls.
Data analysis
-------------
Multivariate regression analyses were performed using generalized additive models within R \[[@keu259-B10]\], which allows for the possibility of non-linear relationships between covariates and response variables \[[@keu259-B11]\]. Within this framework, models were used to assess the significance of age at disease onset and anti-NXP2 in relation to calcinosis as well as disease outcome 2 and \>4 years post-diagnosis. Disease duration was adjusted for. Potential differences between two groups were assessed using chi-squared analysis with Yates's continuity correction. The Mann--Whitney *U* test was used to compare non-normally distributed continuous data.
Results
=======
Demographic data and key findings are summarized in [Table 1](#keu259-T1){ref-type="table"}. T[able]{.smallcaps} 1Demographic data and key findings of 285 patients analysedAll patientsAnti-NXP2 positiveFemale, *n*/*N* (%)206/285 (72)41/56 (73)IIM subtype^a^, *n*/*N* (%) DM242/285 (85)55/56 (98) PM1/278 (0.4)0 Overlap33/285 (12)1/56 (2)^b^Age at onset, average (IQR), years6.2 (4--10)6.5 (4--10)Time to diagnosis, average (IQR), months4 (2--10)4 (2--10)Length of follow-up, average (IQR), years9 (5--12)9 (5--12)Proportion with calcinosis, *n*/*N* (%)94/283 (29)24/56 (43), *P* = **0.025**Lowest ever CMAS score, average (IQR)40 (27--48)29.6 (18--43), *P* \< **0.001**[^1]
Autoantibody detection
----------------------
Of the 365 patients enrolled in the JDCBS at the time of analysis, 285 (78%) had both data and serum available. This group was representative of the cohort as a whole, showing no significant differences in gender (72% *vs* 68% female), age at disease onset (median 6.2 *vs* 6.7 years) or JDM clinical type (12% *vs* 14% JDM overlap) compared with those patients not analysed.
Anti-NXP2 autoantibodies were identified in 56/285 (20%) patients. Two further patients were positive by anti-NXP2 ELISA but did not have a 140 kDa band on immunoprecipitation. Further analysis was carried out on only those patients definitively positive using both techniques.
Calcinosis
----------
Overall, 33% of patients developed calcinosis during the follow-up period. Age at disease onset influenced the likelihood of calcinosis allowing for the duration of disease and there was a significant decrease in calcinosis with increasing age at disease onset \[odds ratio (OR) 0.90, 95% CI 0.83, 0.97, *P* = 0.005\]. Furthermore, this relationship with age proved to be near linear, a striking result given the flexibility of the model meant there were no prior constraints on its shape ([Fig. 1](#keu259-F1){ref-type="fig"}). F[ig]{.smallcaps}. 1The effect of anti-NXP2 autoantibodies on the risk of calcinosis by age at disease onset (with 95% CI)A near-linear relationship is seen between younger age at disease onset and increased risk of calcinosis.
There was a significant association with anti-NXP2 autoantibodies and calcinosis: 43% anti-NXP2-positive patients developed calcinosis *vs* 30% anti-NXP2-negative patients (OR 2.10, 95% CI 1.10, 4.01, *P* = 0.025 unadjusted for age, *P* = 0.039 adjusted). The presence of anti-NXP2 autoantibodies increased the risk of calcinosis after allowance for the possible effects of other variables, including age.
As some patients were recruited an appreciable time after | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Secondary amyloidosis can complicate chronic inflammatory autoimmune diseases such as rheumatoid arthritis (RA) and ankylosing spondylitis. However, the clinical findings of primary amyloidosis may mimic those of primary rheumatologic disorders. We present the case of a 53-year-old woman with a history of hypertension, bilateral carpal tunnel syndrome, and irritable bowel syndrome (IBS) who presented for evaluation of fingernail changes for the previous three years. The nails had vertical ridges and had cracked to the nail base. Occasionally, she also had mild pallor and bluish discoloration of her fingers on exposure to cold, suggestive of Raynaud\'s phenomenon. She had had diarrhea alternating with constipation and mild abdominal cramping for 3 years. Colonoscopy was done a year earlier and showed only diverticulosis of sigmoid colon; she was given a diagnosis of IBS by a gastroenterologist. Other symptoms included diffuse alopecia, dry eyes, fatigue, and numbness in both forearms and fingers bilaterally. She had had unilateral carpal tunnel release in the prior year; tissue was not sent for pathologic examination. Family history was significant for her mother having myelofibrosis and acute leukemia, but there was no family history of autoimmune disease. Her physical examination was normal except for vertical ridging of dystrophic nails of the first, second, and third digits of both hands, diffuse alopecia with no scalp rash, scaling or scarring, and numbness in her first, second, and third digits of both hands with positive Phalen and Tinel test. She had no skin tightening, rashes, or telangiectasias. Complete blood count and complete metabolic panel including serum calcium, urinalysis, erythrocyte sedimentation rate, and C-reactive protein were unremarkable except for total protein of 5.4 g/dL (normal: 6.1--7.9 g/dL). She had a normal serum iron, vitamin B12, folic acid, TSH, free T4, and chest X-ray. Serologic testing revealed an ANA of 1 : 1280 in a nucleolar pattern. Antibodies to SSA, SSB, Smith, RNP, centromere, Scl-70, and dsDNA were negative; C3 and C4 were normal. She was initially diagnosed with Undifferentiated Connective Tissue Disease (UCTD) by her rheumatologist. But, given her neuropathy, serum protein electrophoresis (SPEP) was sent and it showed an increase in *α*2-globulin fraction (16.7%; normal: 8.9--14.5%) and decrease in *γ*-globulin level and fraction (0.4 and 7.0%, resp.; normal: 0.6--1.9 g/dL; 9.8--24.4%) with an albumin-to-globulin ratio of 1.4. Serum immunofixation did not show any evidence of monoclonal gammopathy. Serum-free light chain assay revealed elevated free lambda light chains of 34.22 mg/dL (normal: 0.57--2.63 mg/dL) with low free kappa light chains of \<0.29 mg/dL (normal: 0.33--1.94 mg/dL) and global decrement of IgG, IgA, and IgM. Urine protein electrophoresis and immunofixation were unremarkable.
She was referred to the Hematology-Oncology consultation team for further evaluation of the light chain monoclonal gammopathy. A bone marrow biopsy (Figures [1](#fig1){ref-type="fig"} and [2](#fig2){ref-type="fig"}) showed normocellular bone marrow with 15% plasma cells and lambda light chain restriction; Congo red staining was negative. A skeletal survey, LDH, and *β*2-microglobulin were negative. Given her constellation of symptoms, amyloidosis remained a diagnostic concern. An abdominal fat pad biopsy was performed, revealing positive Congo red staining ([Figure 3](#fig3){ref-type="fig"}). Electron microscopic examination revealed clusters of filamentous material with average diameter of 8.7 nm, lined between lipid droplets, compatible with amyloid; no amyloid typing was performed. The patient was diagnosed with free lambda light chain amyloidosis. Echocardiogram, pro-BNP, and Troponin T were obtained for staging; these were within normal limits. The patient was treated with 4 cycles of bortezomib and dexamethasone. When near-complete remission was achieved with near-normalization of serum-free lambda light chains, decreasing to 3.07 mg/dL over 3 months, she subsequently underwent autologous peripheral blood stem cell transplantation after melphalan conditioning. Her posttransplantation serum-free lambda light chains decreased to 2.69 mg/dL at three months and then normalized to 2.57 mg/dL at six-month follow-up. The patient returned to her normal level of excellent function, with resolution of her initial symptoms, and returned to work one month after the transplant procedure. She had no clinical features of autoimmune disease. No posttransplant serologies were obtained.
2. Discussion {#sec2}
=============
Deposits of amyloid may be distributed in many organs of the body (systemic amyloidosis) or may be restricted to a single organ (localized amyloidosis) \[[@B1], [@B2]\]. As demonstrated here, primary (AL) amyloidosis may mimic primary rheumatologic diseases such as SLE and Sjögren\'s syndrome. When this occurs, no typical pathologic findings of rheumatologic diseases are found in the biopsies of joints, salivary glands, or blood vessels except amyloid accumulation in these tissues \[[@B2], [@B6]\]. Others also have described amyloidosis in rheumatic diseases such as Sjögren\'s syndrome, scleroderma, and primary biliary cirrhosis as a secondary phenomenon \[[@B6], [@B4]\]. In our patient, dry eyes can likely be explained by the amyloid deposition in lacrimal glands, masquerading as Sjögren\'s syndrome \[[@B2]\]. AL amyloidosis associated with multiple myeloma may result in an arthropathy resembling RA \[[@B5]\]. In this setting, treating the underlying hematologic malignancy is the most important intervention as patients tend to respond better to multiple myeloma treatment than to treatment of the amyloid arthropathy. Sensitivity of selected physical and laboratory findings for detecting amyloidosis in cases of multiple myeloma (MM) associated arthropathy has been illustrated in literature ([Table 1](#tab1){ref-type="table"}) \[[@B5]\]. While our patient did not have arthropathy, she had bilateral carpal tunnel syndrome and hypogammaglobulinemia, which raised the suspicion of AL amyloidosis. The carpal tunnel symptoms of the prior year are consistent with the typical 2-year delay between the onset of symptoms and the recognition of amyloidosis \[[@B3]\].
Amyloid-associated rheumatic disease manifestations in primary amyloidosis have been associated with an anticentromere antibody pattern of ANA \[[@B3]\]. However, to the best of our knowledge, a nucleolar pattern ANA has not been previously described in this setting. Given the association of a nucleolar pattern ANA and scleroderma, our patient warrants follow-up for the progression to the development of scleroderma, though this seems unlikely in the setting of a successful stem cell transplantation and resolution of symptoms.
Alopecia or nail dystrophy can rarely present as a sign of occult amyloidosis \[[@B7], [@B8]\]. Unusual manifestations of primary cutaneous amyloidosis in association with Raynaud\'s phenomenon and livedo reticularis have been reported \[[@B1]\], but, in this case, Raynaud\'s phenomenon preceded the cutaneous amyloidosis by ten years. Histopathology described in scalp biopsies of amyloid patients with alopecia has demonstrated that amyloid deposits were seen to be compressing pilosebaceous units, accompanied by atrophy of these structures and loss of hair from the shafts \[[@B9]\]. Nail biopsy may show amyloid deposits in papillary dermis of the matrix, nail bed, and perivascular areas, which perhaps cause vascular impairment with subsequent nail brittleness, crumbling, onycholysis, subungual thickening, striation, or anonychia \[[@B10]\].
Initially, the bone marrow biopsy in our patient was performed for the purpose of diagnosing plasma cell dyscrasia. The biopsy revealed lambda light chain restriction on*in situ* hybridization but negative Congo red staining. The diagnostic yield of bone marrow biopsy in primary amyloidosis is estimated at 63% \[[@B11], [@B12]\]. We interpreted that the false-negative results could be due to variable and sometimes pale staining of amyloid fibrils, inadequate material, or improper use of polarizing instruments. In addition, the correct interpretation of Congo red staining requires experience and is somewhat subjective \[[@B12]\]. Thioflavin staining is another option to confirm the validity of negative Congo red staining because it can detect smaller deposits, although it is less specific \[[@B12]\].
Abdominal fat pad aspiration has replaced most of the previously used tissue biopsies because it is easy to perform and safe and involves minimal patient discomfort and morbidity. Studies have shown that, in about 11 percent of cases, fat pad biopsy can be positive in the setting of negative bone marrow staining \[[@B3]\]. The sensitivity and specificity for abdominal fat pad aspiration are 55--85% and 75--100%, respectively \[[@B11], [@B12]\]. Labial salivary gland (LSG) biopsy is a good diagnostic modality to consider for diagnosing amyloidosis mimicking Sjögren\'s syndrome because it shares the advantages of abdominal fat pad aspiration with similar diagnostic yield and offers the ability to rule | {
"pile_set_name": "PubMed Central"
} |
All relevant data are within the paper.
Introduction {#sec005}
============
Preparedness is a state of readiness to respond to crises \[[@pone.0156536.ref001]\], with one aim being to reduce negative outcomes. When preventive work is effective, it is invisible. Preparedness for disaster often includes a written emergency plan. The plan represents a structured definition of working roles and how to act in disaster situations. Such plans aim to clarify the working roles. Working during a disaster is a dynamic and ongoing process, and a written emergency plan, even though helpful, often does not cover the unfamiliar and unexpected demands that may occur in major disasters. During a disaster, it is important to obtain a balance between a standardization of behavior using plans as well as an ability to improvise and exercise professional judgment \[[@pone.0156536.ref002]\]. This is particularly critical when rescue workers are in situations of compromised security and uncertainty. Weisæth and Kjeserud \[[@pone.0156536.ref003]\] state that emergency planning and management of disasters cannot only be learned, but must be experienced in order to attain the knowledge one needs. They infer that very few people without training will be able to spontaneously manage a disaster or serious emergency, and conclude that readiness without training is of sparse value. Preparedness in rescue workers are obtained through an emergency plan, but even more through every-day experience with physically traumatized people either at the site of the accident or in hospital, through disaster drills or during simulation training with a team \[[@pone.0156536.ref004], [@pone.0156536.ref005]\].
Successful training will most likely have an effect on a better understanding of the tasks and roles during the operation, which may lead to less psychological distress during and after the operations, and even help mastering of future disaster operations. However, studies on the effects of training on rescue operations after terror attacks are limited. Some papers present an evaluation after a disaster drill, followed by suggestions for future events \[[@pone.0156536.ref006]\]. In a review studying the effects of disaster training, a lack of evidence between training interventions and improvement of knowledge and skills during a disaster response was found \[[@pone.0156536.ref007]\]. Few studies explore emergency preparedness per se and most of the work remains unreported in the literature. Some information and preliminary reports have been presented at conferences \[[@pone.0156536.ref008]\]. The predictors of post-traumatic stress symptoms in rescue workers after a disaster have been studied, but the results are conflicting regarding the relationship with prior experience, preparation and training as resilient factors \[[@pone.0156536.ref009]\].
On July 22, 2011, Norway was struck by two terror attacks. A car bomb was detonated in the Oslo Government district. Eight people were killed, many were wounded and governmental buildings were severely damaged. Approximately two hours after the first attack, the terrorist initiated shooting on a political youth camp on Utøya Island, where 69 were killed and many physically injured \[[@pone.0156536.ref010]--[@pone.0156536.ref012]\]. More than 500 people participated in the youth camp and were psychologically traumatized by the shooting \[[@pone.0156536.ref013]\]. The terror attacks of July 22, presented an unusual requirement for those who took part in the rescue operations and subsequent treatment of the wounded. Because so many were killed, wounded or emotionally traumatized, the pressure on rescue workers was demanding and extraordinary compared to their normal daily routines. In addition to facing severe human and material losses, the rescue workers also had to be prepared for the possibility of more terror attacks.
An ongoing disaster presents the possibility for real-life training. In this study we define rescue workers as personnel with professional education/training, affiliated either in the police force, fire department or in the emergency departments of a hospital. They are familiar with an emergency preparedness plan.
To the best of our knowledge, there is no systematic examination of preparedness of rescue workers and their response capabilities during large-scale disaster operations. On the basis of what is outlined above, we had two aims for the present study:
To examine
1. The level of preparedness, exposure and role clarity, and;
2. The relationship between demographic, preparedness and exposure and Role clarity during the rescue operations and;Achieved mastering for future disaster operations.
Material and Methods {#sec006}
====================
Study design and setting {#sec007}
------------------------
This cross-sectional study investigated professional personnel involved in rescue operations after the terror attacks in Norway. The present study is part of a larger project examining the challenges that the professional personnel met during these operations \[[@pone.0156536.ref014]\].
A questionnaire, which included background variables, contributions and exposure during the rescue operations, and how the events affected them, was sent to the rescue workers. The questionnaire was distributed approximately eight to 11 months after the terror attacks on July 22, 2011 (mean = 10 months) to personnel who worked with the terror victims or their relatives from July 22 to August 5, 2011, with a reminder sent one month after the first request. Those surveyed were kept anonymous. The questionnaire was distributed with an information letter while the return of the questionnaire was assumed to imply informed consent.
Subjects {#sec008}
--------
One could assume that personnel affiliated to an organization with a written plan were prepared for disaster, therefore three organizations with a consistent emergency preparedness plan were selected from the study population: healthcare professionals working in hospitals (n = 859), police officers (n = 252) and firefighters (n = 102). Police officers from three counties, firefighters from 10 independent units in four counties and healthcare providers from three hospitals were included. Among health care workers, 16% of the emergency medical service personnel worked close to the scene of terror. The corresponding numbers were 37% and 97% for police officers and the firefighters respectively. The other worked at their regular working place. The leader from each unit was responsible for the distribution and collection of the questionnaires. The respondent placed the completed questionnaire in an envelope. The envelope could be sealed, and were dropped in a sealed box. In the current paper, general and psychosocial healthcare personnel working within a hospital organization were merged into one group (n = 859). Personnel working in municipal emergency services (n = 72) and a center for next-of-kin outside a hospital (n = 95) were excluded, as they were unlikely to be working in an organization with a consistent emergency plan. Personnel working in a rehabilitation ward in one of the hospitals (n = 28) were excluded because their work started after August 5, and eight respondents with incomplete questionnaires were also excluded. The response rates were 54% among healthcare providers, 51% among police officers and 82% among firefighters.
Assessments {#sec009}
-----------
Most of the items included in the questionnaire were developed by The Norwegian Centre for Violence and Stress Studies, and used in a cross-sectional study of Norwegian personnel mobilized during the 2004 Indian Ocean tsunami. A replica of some assessments from that study made it possible to compare data from two samples of Norwegian rescue workers \[[@pone.0156536.ref009]\].
### Sociodemographic characteristics {#sec010}
Age, sex, duration of work at their current organization and working place during the rescue operation measured sociodemographic characteristics. These were classified as shown in [Table 1](#pone.0156536.t001){ref-type="table"}.
10.1371/journal.pone.0156536.t001
###### Background characteristics.
{#pone.0156536.t001g}
Healthcare providers Police officers Fire-fighters *P value*
------------------------------------------------------------------------------------------------------ ---------------------- ----------------- --------------- -----------------------------------------------
**Gender**, male, n (%) 287 (33.6) 169 (67.9) 100 (99.0) \<.001[\*\*](#t001fn003){ref-type="table-fn"}
\< 30 years 144 (16.8) 29 (11.6) 11 (10.8)
30--49 years 524 (61.3) 172 (69.1) 68 (66.7)
\>50 years 187 (21.9) 48 (19.3) 23 (22.5)
\< 1 year 44 (5.2) 19 (7.6) 2 (2.0)
1--5 years 242 (28.4) 74 (29.6) 18 (17.6) .015[\*](#t001fn002){ref-type="table-fn"}
\>5 years 567 (66.5) 156 (62.7) 82 (80.4)
Work experience in similar tasks 541 (63.9) 163 (64.7) 70 (68.6) ns
Training based on simulation 585 (68.8) 176 (69.8) 74 (72.5) ns
Disaster drill 588 (69.2) 173 (68.9) 68 (66.7) ns
Previous event with \>5 fatalities 223 (26.1) 66 (26.3) 31 (30.4) ns
Sites of terror 138 (16.2) 92 (36.8) 99 (97 | {
"pile_set_name": "PubMed Central"
} |
Findings {#Sec1}
========
Infections are uncommon causes of scleral inflammation \[[@CR1]\]. Diagnosis is often difficult and gets delayed as the clinical picture appears similar to the more common cause: the immune-mediated disease. Fungal infections of the sclera have been reported following surgeries for retinal detachment \[[@CR2]--[@CR5]\], pterygium \[[@CR6], [@CR7]\], cataract \[[@CR8], [@CR9]\] and as a part of systemic fungal infections \[[@CR10], [@CR11]\]. All these reports are in immunocompetent individuals with a significant inflammatory response.
Acquired immune deficiency syndrome (AIDS) patients are prone to many opportunistic fungal infections, but ocular fungal infections are rare and usually do not involve the sclera \[[@CR12]\]. We report a case of fungal scleral abscess caused by *Candida albicans* in a patient with AIDS and its successful resolution following antifungal therapy.
Case report {#Sec2}
-----------
A 57-year-old Asian (Indian) male was first seen at our hospital in July 2015. He came to us with a history of redness in his right eye for 15 days associated with pain and watering. He had no complaints regarding his vision. He was a known diabetic for 20 years and was detected to be infected with human immunodeficiency virus (HIV) 10 years back. His CD4 count was 461 cells/mm^3^, and he was on highly active antiretroviral therapy (HAART). His blood sugar levels were moderately controlled. There was no history of trauma or any other significant history.
On examination, his best corrected visual acuity (BCVA) was 6/9, N6 in both eyes. Slit lamp examination of the right eye revealed evidence of conjunctival congestion and an oval scleral ulcerative lesion around 3 mm posterior from the corneal limbus at around 6 o'clock meridian, measuring 6 mm by 4.5 mm (Fig. [1](#Fig1){ref-type="fig"}). The ulcer had dense infiltrates with a pseudomembrane. The cornea was clear and the anterior chamber was deep and quiet. Posterior segment examination showed a clear vitreous and a normal fundus. Left eye examination was within normal limits. Intraocular pressure by applanation tonometry was 14 mmHg in both the eyes. On systemic examination, there was no *Candida* or any fungal infection elsewhere in the body.Fig. 1Slit lamp photograph showing the scleral abscess of about 6 mm by 4.5 mm
He was diagnosed as an infective scleral abscess of the right eye. Scraping of the lesion was done and was put on empirical treatment of oral indomethacin and topical moxifloxacin eye drops one hourly.
Scraping did not reveal any fungal or bacterial elements, apart from occasional pus cells. He was advised to continue medications. However, after 3 days, culture on Sabouraud's dextrose agar showed *C. albicans* species (Fig. [2](#Fig2){ref-type="fig"}) which confirmed the clinical suspicion. He was given amphotericin B 0.25 % eyedrops one hourly, voriconazole 1 % eyedrops one hourly and ciprofloxacin 0.3 % eyedrops four times per day along with oral voriconazole 200 mg tablet twice daily. The patient was continued on the same medication, while the lesion started increasing in size.Fig. 2Sabouraud's dextrose agar (SDA) showing the isolates of *Candida albicans*
Two days later, the scleral abscess showed signs of improvement. The epithelial defect and congestion persisted. Culture and sensitivity was done which revealed the fungus sensitive to amphotericin B and natamycin and resistant to voriconazole, fluconazole and itraconazole. Hence, topical natamycin was added and voriconazole was stopped. The rest of the medications were continued as earlier. The lesion started regressing and the patient was reviewed after 2 weeks.
At 2 weeks follow-up, his BCVA was 6/9, N6 in both the eyes. The patient had no fresh complaints. Slit lamp examination revealed complete healing of the lesion (Fig. [3](#Fig3){ref-type="fig"}). He was advised to stop topical and oral medications and was continued on only topical lubricants. At 1 month of follow-up, there was complete resolution of the lesion. His viral load was increasing along with decrease in CD4 counts and was shifted to second line HAART. At his last visit in January 2016, his viral load was less than 150 copies/ml and was doing well on second line HAART.Fig. 3Slit lamp photograph showing completely resolved scleral lesion
Discussion {#Sec3}
----------
Fungal infections of the sclera are devastating cause of infectious scleritis as they are difficult to diagnose and often diagnosed late. The reported incidence of fungal scleritis is around 11 to 38 % of the total infectious causes of scleritis \[[@CR13]--[@CR15]\].
*C. albicans* is a dimorphic commensal fungus. Candidiasis is usually seen in immunocompromised individuals like HIV-infected patients. Candidiasis has a varied presentation. *C. albicans* usually causes keratitis, chorioretinitis and endogenous endophthalmitis in HIV/AIDS patients \[[@CR16]--[@CR18]\]. Scleral infection by *C. albicans* is very rare. Ahn et al. have reported two cases of fungal scleral infection in immunocompetent individuals \[[@CR19]\]. Garelick et al. have described a case of *Cryptococcus albidus* in a patient with AIDS \[[@CR20]\].
No case of scleral abscess has been reported in any patient with HIV/AIDS. Our patient is a HIV-positive patient and has a scleral abscess caused by *C. albicans*. Hence, it should be considered as a possible diagnosis and early investigation and treatment should be done, as it can lead to devastating complication like endophthalmitis. Our case also highlights the fact that a strong degree of clinical suspicion backed by appropriate anti infective (antifungal therapy) is a must in complete resolution of the lesion.
Our case demonstrates the utility of culture and sensitivity in choosing the appropriate antifungal agent, since the initial use of a broad spectrum antifungal did not yield the required result. Based on culture and sensitivity, specific drugs were used which lead to complete resolution of lesions.
Conclusion {#Sec4}
----------
In conclusion, we report an uncommon presentation of a *C. albicans* scleral abscess in an AIDS patient, who was treated promptly by appropriate topical and oral antifungals. Proper scraping and culture and sensitive reporting are an essential component of diagnosis and treating such a rare case thus preventing grave consequences.
Consent {#Sec5}
=======
Written informed consent was obtained from the patient.
AIDS
: acquired immune deficiency syndrome
BCVA
: best corrected visual acuity
HAART
: highly active antiretroviral therapy
HIV
: human immunodeficiency virus
The authors declare no financial interest or sources of support. This paper has never been submitted to any journal nor published in any form of media before.
**Competing interests**
The authors declare that they have no competing interests.
**Authors' contributions**
HS was involved in the data analysis and drafting of the manuscript. SS helped in the patient interaction and diagnosis and was involved in revising the manuscript critically. LT did the microbiological support and drafting of the manuscript. MA helped in the patient interaction and diagnosis and was involved in revising the manuscript critically. JB helped in the patient interaction and diagnosis, was involved in revising the manuscript critically and gave final approval of the version to be published. All authors read and approved the final manuscript.
We acknowledge the Departments of Uvea and Microbiology for their support.
| {
"pile_set_name": "PubMed Central"
} |
1.. Introduction {#s0001}
================
Carbonic anhydrases (CAs, EC 4.2.1.1) are important metalloenzymes involved in the hydration of carbon dioxide, a quite simple reaction whose balance is important in many cellular and physiological processes, spanning from pH homoeostasis and respiration to biosynthetic pathways including lipogenesis, glucogenesis, and ureagenesis[@CIT0001].
Human CAs (hCAs) exist in fifteen isoforms, which possess different characteristics as catalytic activity, tissues distribution, cellular localisation (cytosol, mitochondria and cell membrane) and sensibility to inhibitors. The researches of the last years showed all the consequences of their altered activity, either in the case of excessive or deficient ones[@CIT0004]^,^[@CIT0005]. In this regard, investigations on synthetic and natural compounds have been done with the aim to discover new selective and potent inhibitors and/or activators, which could restore the normal functions of these enzymes[@CIT0006].
One of the most studied alterations has been observed in tumours, where some hCA isoforms appear overexpressed; the so-called tumour-related isoforms, hCA IX and XII which are transmembrane enzymes, participate along with cytosolic hCA II in the complex pH machinery which controls the *milieu* of hypoxic tumours, promoting drug resistance as well as proliferation, migration, invasion and metastasis of tumour cells[@CIT0014]. To reverse this condition, efforts have been made to develop inhibitors that act effectively and selectively towards these targets.
The design of more molecules and scaffolds, and the obtaining of co-crystals of some of them with hCA enzymes (mostly with hCA II), prompted the discovery of four different mechanisms of inhibition for hCAs[@CIT0018]^,^[@CIT0019]. The most recently reported one was observed for the first time with 2(benzylsulfinyl)benzoic acid ([Figure 1](#F0001){ref-type="fig"}) co-crystallized with hCA II[@CIT0020]. This compound showed an atypical mechanism involving the occupancy of a pocket next to the entrance of the active site, where it established some interactions holding the His64 residue in the "*out*" conformation. This amino acid, which exists in two conformations called "*in*" and "*out*", acts as a proton-shuttle system transferring a proton from the zinc-coordinated water molecule to the environment, to reconstitute the catalytic active form. Interfering with this process (the rate-determining step of the entire catalytic cycle) is equal to block or strongly reduce the enzymatic activity, obtaining the enzyme inhibition. Our lead compound was inactive against hCA I and XII (*K*~i~ hCA I/XII \>10 µM), while showed inhibitory activity in the low micromolar range towards both hCA II and IX, with a slight preference for the former (*K*~i~ hCA II = 0.15 µM, *K*~i~ hCA IX = 1.29 µM). With this in mind, we developed a novel series of derivatives based on the lead compound scaffold, pursuing some changes on its structure in order to improve activity and selectivity ([Figure 1](#F0001){ref-type="fig"}).
{#F0001}
The carboxylic acid moiety (red in [Figure 1](#F0001){ref-type="fig"}) was replaced with methyl ester, amide, *N*-methyl amide, hydroxamic acid and ketone. The selected functionalities possess different hydrogen-bond acceptor/donator profiles if compared with the carboxylic acid one; furthermore, except for amide and hydroxamic acid moieties that still conserve a "deprotonatable" group, the others lack this feature whose importance has been in this way deepened.
The benzyl moiety (blue in [Figure 1](#F0001){ref-type="fig"}) was challenged through the insertion of substituents or by its entire substitution with benzoylmethyl and phenylacetic moieties as well as unsaturated C~3~--C~5~ alkyl chains. The aim of these changes was to understand the importance of the hydrophobic interactions with Phe231 and Asn232 that the phenyl ring established in the hCA II-inhibitor adduct. The addition of substituents on this phenyl ring changed the π-system charge distribution along with its hydro/lipophilicity. On the contrary, moving the phenyl group away from the sulphur atom with the addition of a carbonyl group (in the benzoylmethyl or phenylacetic derivatives) shed light on the importance of this system in that position and its conformational freedom. Attempts with unsaturated alkyl chains with increasing lengths have been done in order to evaluate if the presence of groups, able to give hydrophobic interactions, could work similarly to the phenyl ring. The role of sulphur atom was also challenged (yellow, green and violet in [Figure 1](#F0001){ref-type="fig"}), evaluating how both its oxidation state and its bioisosteric replacement affected the inhibitory activity. In the first case, we performed sulphide oxidation in order to obtain sulphinyl (sulfoxides) and sulphonyl (sulfones) derivatives. This synthesis was performed without chiral auxiliaries, obtaining sulfoxides in a mixture of enantiomers (racemate) that were resolved using a chiral HPLC system[@CIT0021]^,^[@CIT0022] and individually tested; this permitted the evaluation of how chirality could affect inhibitory activity of these derivatives. On the contrary, the bioisosteric replacement of sulphur atom with oxygen and nitrogen ones or with methylene group has been done, unravelling the importance of that atom for the inhibitory activity (violet in [Figure 1](#F0001){ref-type="fig"}).
2.. Chemistry and HPLC enantioseparation {#s0002}
========================================
In order to obtain the novel compounds, we followed the synthetic strategies reported in Schemes 1--4. For the synthesis of derivatives **1--3** and **16--18** we started from 1--(2-bromophenyl)ethan-1-one and 2-nitrobenzamide, respectively ([Scheme 1](#SCH0001){ref-type="scheme"}); both of them (individually) underwent an aromatic nucleophilic substitution with benzyl mercaptan. The reactions were performed in *N,N'*dimethylformamide (DMF) at reflux, in the presence of K~2~CO~3~. The so obtained compounds (**1** and **16**) were treated in the next oxidative reaction with *meta*-chloroperbenzoic acid (mCPBA). Although many routes able to afford sulphur oxidation exist[@CIT0023], we have deliberately chosen this approach to obtain the two oxidation products, the sulfoxide and the sulphone, in the same reaction.
{#SCH0001}
In fact, controlling the amount of oxidant added during the reaction we obtained both the species that were easily separated owing to the different chromatographic profiles. Compounds **7--12** and **19--21** were obtained with a nucleophilic substitution reaction between methyl 2-mercaptobenzoate and (un)substituted benzyl bromides, followed by the oxidative step. The carboxylic acid derivatives were obtained through the hydrolysis of compound **7** with aqueous 2 N sodium hydroxide (NaOH) in a mixture of equal amounts of water and 1,4-dioxane (50/50, *v*/*v*) to give **4**, that was subsequently oxidised to **5** and **6** ([Scheme 1](#SCH0001){ref-type="scheme"}). Compounds **13**--**15** were synthesised performing the first step of nucleophilic substitution between methyl 2-mercaptobenzoate and benzoyl bromide at room temperature, with successive oxidation in the same conditions previously seen ([Scheme 2](#SCH0002){ref-type="scheme"}). The synthetic pathway of derivatives **22**--**38** is reported in [Scheme 3](#SCH0003){ref-type="scheme"}. Methyl 2mercaptobenzoate was reacted in the presence of bromoalkanes of increasing length, in DMF at reflux in the presence of K~2~CO~3~ to obtain intermediates **E2--E5** (**E1**, methyl 2-(methylthio)benzoate, was commercially available). Only two of the **E** intermediates bearing butyl and pentyl chain respectively (**E4** and **E5**), underwent the oxidative step obtaining the sulphinyl derivatives **22--23**. All the **E1**--**E5** intermediates were hydrolysed with aqueous 2 N sodium hydroxide in a mixture of equal amounts of water and 1,4-dioxane (50/50, *v*/*v*). After synthesis completion, the reactions were quenched with hydrochloric acid (HCl), giving the intermediates **A1--A5** ([Scheme 3](#SCH0003){ref-type="scheme"}). The activation of the carboxylic acid group for the amide synthesis has been obtained using the mixed anhydride approach. In this regard, we used ethyl chloroformate in tetrahydrofuran (THF) under nitrogen atmosphere (N~2~) in the presence of triethylamine (Et~3~N) excess. Monitoring the reaction with thin layer chromatography (TLC) we detected the disappearance of the acidic intermediate, until the completion of anhydride formation. Then, ammonium chloride (NH~4~Cl) was added. The presence of the triethylamine excess involved the "de-blocking" of NH~3~ | {
"pile_set_name": "PubMed Central"
} |
Study rationale {#sec1}
===============
Infectious diseases, nutritional deficiencies and maternal and neonatal conditions are the dominant contributors to the overall burden of disease worldwide \[[@ref1]\]. However, the burden of non-communicable diseases (NCDs) such as diabetes, cardiovascular disease and cancer, has increased in the last decade. In 2012, an estimated 2.8 million deaths in sub-Saharan Africa (SSA) were attributable to NCDs; they are projected to be the most common cause of death in SSA by 2030 \[[@ref2], [@ref3]\]. The increasing prevalence of diabetes is a key component of the global rise in NCDs. The International Diabetes Federation currently estimates a 54% increase in global prevalence of diabetes, from 382 to 592 million by 2035 \[[@ref4]\]. SSA is projected to have a 109% increase in the prevalence of diabetes, from 19.8 million in 2013 to 41.5 million by 2035, representing the highest proportional increase of any region in the world.
The rise in diabetes prevalence is thought to be a consequence of rapid demographic and epidemiological transitions and urbanisation in the region \[[@ref4], [@ref5]\]. Within SSA, the prevalence of chronic diseases such as diabetes varies markedly among populations, suggesting that these disorders arise from complex interrelations between environmental and biological factors \[[@ref6]\]. Socioeconomic and demographic differences, diagnostic approaches, variation in lifestyle factors and genetic predisposition may explain some of these differences \[[@ref7]--[@ref9]\]. However, there is a lack of large-scale population-based studies that have assessed these systematically in SSA populations. Recent population-based diabetes studies have varied in size and scope (as shown in online Supplementary Table S1); many have only assessed a subset of potential risk factors, limiting comparative analyses. Relatively few have utilised validated survey designs, such as the WHO STEPwise approach to Surveillance (STEPS), to capture a broadened set of variables, as in the DDS. There is, therefore, a need for high-quality data to more reliably assess the burden of chronic diseases and the full spectrum of their risk factors, in order to determine the individual contribution and impact of these risk factors in SSA. In 2013, an estimated 9.3% of the population in South Africa had diabetes, which is one of the highest national prevalences of diabetes in SSA \[[@ref10]\]. Studies investigating the prevalence of diabetes in South Africa have reported differing prevalence between urban and rural areas and by ethnicity \[[@ref11]--[@ref14]\]. However, the only study population-based epidemiological study of diabetes in Durban was conducted in the early 1990s and found a prevalence of 5.3% \[[@ref15]\].
We therefore established the DDS as a population-based research framework to investigate a broad range of lifestyle, medical and genetic factors and their association with diabetes -- the primary research focus of the study -- together with other chronic diseases and traits including hypertension, dyslipidaemia, human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in an urban South African (black) population living in the eThekwini Municipality (also known as the city of Durban). The study provides a resource to examine a wide range of research questions in order to inform health policy and practice around the burden and aetiology of chronic diseases; this in turn will enable effective targeting of resources in South Africa and across the region. The DDS also provides a framework for future research including the possibility of interventional studies. The DDS is a collaborative initiative between the University of KwaZulu-Natal, the University of Cambridge, the University of Oxford and the Wellcome Trust Sanger Institute.
Study population {#sec2}
================
The study area is the eThekwini Municipality (city of Durban) in KwaZulu-Natal, South Africa as shown in [Fig. 1](#fig01){ref-type="fig"}. \[[@ref16]\] Based on the 2011 population census for South Africa, black Africans constitute 79.6% (41 000 938) of the total population of 50.8 million \[[@ref17]\]. KwaZulu-Natal is the second most densely populated province in South Africa, accounting for around one-fifth of the total population (10 267 300), of whom 86.8% are black African, 52.3% are female and 73.7% are aged 35 years or older \[[@ref18]\]. Fig. 1.Map of KwaZulu-Natal and eThekwini, South Africa. The map shows the municipal boundaries in KwaZulu-Natal, with the eThekwini Metropolitan Municipality highlighted in red. Adapted from Naudé *et al*. \[[@ref16]\].
The DDS sampling frame was developed independently by the Research and Policy Department of the eThekwini Municipality, and is divided into nine planning unit clusters (PUCs), representing nine townships (Umlazi, Inanda, KwaMashu, Ntuzuma, Mpumalanga Complex, Cato Manor, Clermont, Lamontville and Chesterville). Geographic information system mapping techniques were used to gather accurate geographical and boundary data on the selected PUC areas. The study region is predominantly urban with a total population of approximately 1 378 750 individuals, 61% of whom live in informal dwellings. In each PUC streets are randomly selected, with the number of streets selected being proportional to the size of the PUC population. Next, within each randomly selected street, households are nominated by systematic cluster sampling, with the number of formal or informal houses selected within each street proportional to the ratio of formal to informal housing in that PUC. Further, in each street the number of selected houses is oversampled, allowing for up to 20% non-participation without compromising overall study size. Within each nominated household, all family members who are of African descent, not pregnant and aged 18 years or older are eligible for recruitment into the study.
Before participant recruitment and data collection begin, PUC areas are sensitised to the study using flyers, neighbourhood-specific community activation events and reminders for local residents. These stages of community engagement and mobilisation are conducted with the support of the provincial department of health (KwaZulu-Natal), local health authorities and community leaders. Once the study rationale and procedures have been explained, all eligible individuals present at the time of mobilisation are invited to participate in the study. A non-responder is defined as an individual who has declined an invitation to participate; a non-response household is defined as a household who has been contacted on at least three occasions with all habitants absent on each occasion. Each non-response household is replaced by another house pre-selected from the same street as described above. Data and sample collection are undertaken at pre-arranged study appointments at a central community venue. All study appointments occur in the morning; this is essential as participants are required to fast overnight for a 75 g oral glucose tolerance test (OGTT).
Statistical power {#sec3}
=================
The DDS sample size -- based on population size, prevalence precision estimates and power for epidemiological and genetic association studies -- is 10 000 participants. Previous studies in SSA have estimated a diabetes prevalence of around 10% (which is consistent with preliminary findings from our study; data not shown). Based on this estimate, and taking into account design effects, our sample size is sufficient to estimate the population prevalence of diabetes with a 95% confidence interval (CI) of less than 1%. For logistic regression analyses that involve diabetes as an outcome, based on 1000 cases and 9000 controls, the study has more than 80% power to detect odds ratios (ORs) as low as 1.2 for exposure prevalences equal to 30%. For exposure prevalences greater than 30%, ORs less than 1.2 can be detected with the same power. Further, for exposure prevalences as low as 5% the study will have more than 80% power to detect ORs of at least 1.5. At this sample size we will also have the ability to examine genetic variants that explain 0.5 % of the variation in a relevant trait with more than 80% power using a genome-wide statistical threshold.
Data collection {#sec4}
===============
The DDS collects detailed questionnaire information on participant health, lifestyle and socioeconomic indices, as well as biophysical measurements, biochemical, haematological and serologic biomarkers for non-communicable and infectious diseases, and genetic information, as shown in [Table 1](#tab01){ref-type="table"}. The questionnaire used in this study is an adaptation of the standardised and validated WHO STEPS tool designed for the collection of disease risk factors \[[@ref19]\]. The questionnaire responses are collected on an electronic data capture system \[electronic questionnaire (EQ)\]. For increased accuracy and efficiency the EQ has built-in data checks, including double entry of numbers, plausibility of answers and appropriate numerical limitations, the detailed methods of which have been previously described \[[@ref20]\]. Biophysical measurements (height, weight, waist and hip circumferences and blood pressure) and samples of venous blood (baseline fasting sample, 30- and 120-min) and urine are collected in the same study appointment to maximise efficiency. Adhering to standardised protocols, trained study personnel perform all study procedures and sample collections. Study equipment is calibrated regularly. Blood and urine samples are stored in cold boxes maintained at 4--8 °C until transported to a laboratory within 6 h of collection. Full blood count, plasma glucose and HbA~1c~ analyses are undertaken on the day of sample collection, at a local private laboratory. All other samples are transported to the University of KwaZulu-Natal laboratory and processed for storage (including centrifugation, separation into serum and plasma, and DNA extraction). The processed samples are | {
"pile_set_name": "PubMed Central"
} |
Dear Editor:
Hailey-Hailey disease (HHD), also known as benign familial pemphigus, is a chronic recurrent bullous and vesicular dermatitis, presented histologically withsuprabasilar acantholysis[@B1]. Flexural sites, especially lateral side of neck, groin and axillae are affected. Patients are suffered by chronic erosions of the aforementioned sites, which is painful and commonly become infected secondarily[@B2]. Even many studied reported various medical treatments, such as topical and systemic corticosteroid, antifungals, and antibiotics, no radically curative therapy for HHD was found[@B3]. Good results for HHD have been obtained from such surgical interventions as excision, split-thickness skin graft, and dermabration[@B4]. However, there are few reports regarding the efficacy of cryotherapy for HHD. Here, we describe the successful treatment for recalcitrant HHD.
A 33-year-old man clinically presented with signs and symptoms of HHD in the area of bilateral crural folds. HHD was diagnosed with biopsy. His signs and symptoms had been presented for two years, despite multiple standard treatment and anecdotal therapies: numerous topical corticosteroids, tetracycline, cyclosporin, isotretinoin, prednisone, topical pimecrolimus cream, and tacrolimus ointment. Surgical, laser, or radiation therapy had never been tried.
As multiple therapies were either ineffective or associated with unacceptable side effects, cryotherapy and CO~2~ laser (UM-L30; Union Medical Co., Seoul, Korea) were initiated. The patient was started on cryotherapy (left side) and CO~2~ laser (right side) monthly for 3 months, after intense history taking and carefulphysical examination. We performed cryotherapy with two cycles using an open-spray technique at 10\~15 seconds and CO~2~ laser with (1.2 W in a continuous wave) one pass each session. Cryotherapy with the Cryosurg® spray gun (Coopersurgical, Trumbull, CT, USA) was done. The cryotherapy was perfomed perpendicular from the lesion at a 1\~2 cm distance. When the ice-ball had presented from the center to include the edge of the area with a 2 mm margin, cryotherapy was stopped. It was then allowed to melt. After each therapy, no extra dressing was done. Photographs of lesional skin were taken at baseline and week 12 ([Fig. 1](#F1){ref-type="fig"}, [2](#F2){ref-type="fig"}). The area receiving cryotherapy was disease free and asymptomatic 3 months later. The region subjected to CO~2~ laser treatment showed mild to moderate response, but less than the area receiving cryotherapy.
A variety of measures have been recommended for recalcitrant HHD. Cryotherapy has been advocated although freezing may induce lesions[@B5]. Necrosis, after the freezing and thawing of cells is the mechanism of cryotherapy. Re-epithelialize in treated areas occured. The HDD lesion was shown to have altered cellular connections within desmosomes and adherens junctions of the epidermis. The mechanism of cryotherapy for treatment of HHD may eliminate diseased epidermis and re-epithelialize normal epidermis.
Our patient presented with recalcitrant HHD. In management, we found, for the condition of patient\'s inguinal area, cryotherapy is more effective than was CO~2~ laser. Moreover, No short-term untoward side-effects was observed, such as hypopigmentation, after the use of cryotherapy as the treatment for HHD. During at least 3 months, patient went through relatively disease-free remission. These observations represent the successful use of cryotherapy for HHD.
This work was supported by the National Research Foundation of Korea (NRF), funded by the Ministry of Science, ICT & Future Planning (NRF-2014R1A1A3A040-49491), and the Hallym University Research Fund 2014 (HURF-2014-53, HURF-2014-58).
{#F1}
{#F2}
| {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-polymers-11-01937}
===============
The use of naturally renewable biopolymers (e.g., starch, cellulose, chitosan/chitin, caseinate, and pectins) as edible and biodegradable films and coatings constitute an actual and sustainable choice to prevent the post-harvest losses of very perishable fruits, such as blueberries.
The production of blueberries (family Ericaceae, genus *Vaccinium*) has been rapidly growing in the last years, reaching over 596,813 t worldwide in 2017, being led by the United States with 40% of total production and Canada with 27% \[[@B1-polymers-11-01937]\]. Highbush blueberries (*Vaccinium corymbosum*) are the most commercial blueberries. However, several other wild shrubs of the genus *Vaccinium* also produce commonly eaten blueberries, such as the European *Vaccinium myrtillus*.
*Vaccinium meridionale* Swartz (Andean blueberry) is one of the species of the genus *Vaccinium* that grows in the Andean region of South America at 2300--3300 m above sea level (m.a.s.l.) \[[@B2-polymers-11-01937]\]. The fruit is a berry, 5--10 mm in diameter, dark reddish, with a sour and tart character. In Colombia, Andean blueberry is sold at the local markets, and it is eaten fresh, dried, and cooked into sauces, jellies, and jams \[[@B3-polymers-11-01937]\]. *Vaccinium meridionale* Swartz is considered to be health-promoting food due to its high content of anthocyanins (\~329 ± 28 mg/100 g, mainly cyanidin 3-glucoside), and phenolic acids (\~ 758.6 ± 62.3 mg gallic acid equivalent/100 g, mainly chlorogenic acid) \[[@B3-polymers-11-01937]\]. Several studies have shown than Andean blueberry has antioxidant, anticarcinogenic, and anti-inflammatory properties \[[@B3-polymers-11-01937],[@B4-polymers-11-01937],[@B5-polymers-11-01937]\]. Therefore, *Vaccinium meridionale* Swartz has a high potential of use as an antioxidant additive or functional ingredient in food, pharmaceutics, and cosmetic applications \[[@B6-polymers-11-01937]\].
As for most blueberries fruit, Andean blueberries are perishable fruits, and, therefore, it is necessary to develop strategies to increase their storage life \[[@B7-polymers-11-01937]\]. It has been reported that the fruit decays quickly at ambient temperature after harvest, thus affecting its commercialization \[[@B8-polymers-11-01937]\]. Moreover, blueberry fruits are susceptible to bruising from mechanical impact, water loss, and microbial attack \[[@B9-polymers-11-01937],[@B10-polymers-11-01937]\].
Coatings are defined as mixtures of film-forming materials plus solvents and other additives (e.g., plasticizers), which, when applied to a surface and cured or dried, yield a solid protective, decorative and/or functional adherent thin layer \[[@B11-polymers-11-01937]\]. Moreover, coatings can be added of antioxidants, antimicrobial agents, oxygen scavengers, or moisture absorbing, among others, to obtain active coatings \[[@B12-polymers-11-01937],[@B13-polymers-11-01937]\]. Over the past years, the use of coatings has become more and more important in the food field. It has been reported that the application of coatings allows extending the shelf life of perishables and sensitive products such as fruits and vegetables because these materials act as an external protective layer slowing the respiration rate and reducing moisture and solute migration, gas exchange, oxidative reaction rates, as well as suppress physiological disorders of fresh-cut fruits \[[@B12-polymers-11-01937],[@B14-polymers-11-01937],[@B15-polymers-11-01937]\]. Several polymers from natural origin have been used for the fabrication of food edible coatings, including starch \[[@B16-polymers-11-01937]\], alginate \[[@B17-polymers-11-01937]\], chitosan \[[@B18-polymers-11-01937]\], pectin \[[@B17-polymers-11-01937]\] and cellulose derivatives \[[@B19-polymers-11-01937]\], among others. Between them, starches are well known for their good film-forming properties and functionalities \[[@B20-polymers-11-01937]\]. Moreover, it has been stated that because the edible films and coatings based on starches are reported to be transparent, odorless, tasteless, and colorless, they would not exhibit adverse effects on the sensory quality of a product \[[@B21-polymers-11-01937],[@B22-polymers-11-01937],[@B23-polymers-11-01937]\].
Despite that starches from diverse sources have been widely used as edible coating material and there is a tremendous amount of knowledge on composition, structure, properties, and modifications \[[@B24-polymers-11-01937],[@B25-polymers-11-01937],[@B26-polymers-11-01937]\], starches from Colombian native potatoes used in this research have not been studied until now. It is commonly hypothesized that starch granules architecture varies widely between different botanical sources, and so has a significant impact on its physicochemical properties \[[@B24-polymers-11-01937],[@B25-polymers-11-01937],[@B26-polymers-11-01937]\]
In the current work, starches were isolated from three different Colombian potatoes varieties (mora, pacha negra, and alcarrosa), and their physicochemical properties were investigated and compared. Edible coatings based on the different starches were applied on Andean blueberries, and the changes in fruit physicochemical parameters were monitored during 12 days of storage. As far as the authors are aware, this is the first time that starches isolated from Colombia native potatoes have been characterized in detail and applied as edible coatings on Andean blueberry.
2. Materials and Methods {#sec2-polymers-11-01937}
========================
2.1. Materials {#sec2dot1-polymers-11-01937}
--------------
Starches were isolated from three varieties of native potatoes (*Solanum tuberosum*), grown in Ventaquemada (Boyacá, Colombia) at 2630 (m.a.s.l.) ([Figure 1](#polymers-11-01937-f001){ref-type="fig"}).
Andean berries (*Vaccinium meridionale* Swartz) at maturity stage 4 (100% purple) and dry content (%) of 23.58 ± 1.90 were obtained from a local supermarket (Duitama, Colombia). The berries were examined previous to its use to separate fruits with physical, mechanical, or microbial damages. All chemicals used were of analytical grade. Dimethyl Sulfoxide was purchased from Sintorgan^®^ (Buenos Aires, Argentina). Urea was purchased from YPF (Buenos Aires, Argentina). Iodine and Potassium iodide were purchased from Anedra (Buenos Aires, Argentina). Ethanol 95.5% was purchased from Merck^®^ (Darmstadt, Germany). Glycerol was purchased from J. T. Baker (Phillipsburg, NJ, USA). Sodium hydroxide was purchased from Sigma Aldrich (St. Louis, MO, USA).
2.2. Isolation and Characterization of Starches {#sec2dot2-polymers-11-01937}
-----------------------------------------------
### 2.2.1. Starches Isolation and Yield {#sec2dot2dot1-polymers-11-01937}
Starches isolation was carried out from each potato cultivar according to the optimized protocol by Doporto, Dini, Mugridge, Viña, & García, 2012 \[[@B27-polymers-11-01937]\]. Briefly, potatoes were washed, sanitized (250 ppm of chlorine, 10 min), peeled and pulped with a grater. The grated potatoes were blended with water (2 L water/kg) and stored at 4 °C for 24 h. The blend was filtered using a cheesecloth, and the starch slurry was decanted at 4 °C. The supernatant was discarded, and the starch cake was recovered, dried at 40 °C for 14 h in a hot-air oven, and milled.
The starch yield was calculated as the percentage of dry weight (dehydrated at 40 °C) of isolated starch related to the fresh weight of the potato tuber.
### 2.2.2. Amylose Content {#sec2dot2dot2-polymers-11-01937}
Amylose content of starches was determined by the iodine binding method \[[@B28-polymers-11-01937]\]. An amount of each potato starch was weighted (*m~starch~*) and mixed with 10 mL of urea-DMSO solution (1:9 v/v). The blend was heated in an oven at 100 °C for 1 h and cooled to room temperature. Then, 0.5 mL of the prepared solution were weighed (*m~solution~*) and diluted in 5 mL of ethanol. The solution was centrifuged (5000 rpm, 30 min) and the supernatant was discarded. Urea-DMSO solution (1 mL), I~2~/IK solution | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The omohyoid muscle typically has an inferior belly originating from the superior border of the scapula, near the suprascapular notch, and occasionally, from the superior transverse scapular ligament \[[@B1]\]. This muscle then passes deep to the sternocleidomastoid where its superior belly passes almost vertically upward next to the lateral border of sternohyoid to attach to the inferior border of the body of the hyoid bone lateral to the insertion of sternohyoid \[[@B2]\]. Reported variants of the omohyoid muscle include absence of its superior belly, duplicated superior belly, coursing deep to the internal jugular vein, and existence as the variant cleido-hyoideus muscle \[[@B3]\].
As the omohyoid muscle is commonly used as a surgical landmark during neck dissections (e.g., identified as the surgical landmark for level III and IV lymph node metastases), knowledge of its variations is important to surgeons. Herein, we report an unusual variant of the omohyoid and sternohyoid muscles.
Case Report
===========
During the routine dissection of the neck in a fresh frozen cadaver head, fusion of the omohyoid and sternohyoid muscles into a single large sheet was found on the right side. The specimen was a Caucasian male cadaver whose age at death was 86 years old. The neck had been cut horizontally at the seventh cervical vertebra, so the inferior belly of the omohyoid muscle and attachment to the sternum of the sternohyoid muscle could not be observed. This large conjoined muscle was deep to the pretracheal fascia and ascended to attach onto the hyoid bone and thyroid cartilage ([Fig. 1A](#F1){ref-type="fig"}). Two white tendons were found at the inferolateral part of this muscle; the superior tendon represented the intermediate tendon of the omohyoid muscle and the inferior tendon and traveled anteriorly to cross the midline and attach onto the left sternohyoid muscle ([Fig. 1B](#F1){ref-type="fig"}). The muscle was innervated by branches of the cervical plexus and the ansa cervicalis was not observed. Deep to this abnormal muscle, the sternothyroid and thyrohyoid muscles were found and were normal in their morphology. The lateral edge of this fused infrahyoid muscle crossed the carotid sheath and its contents. On the left side, the infrahyoid muscles were normal, However, a slip from a left levator glandulae thyroidea muscle ascended and attached to the surface of the thyrohyoid muscle ([Fig. 2](#F2){ref-type="fig"}).
As a cadaveric examination, the present study did not require approval by an ethics committee at our institutions, and the work was performed in accordance with the requirements of the Declaration of Helsinki (64th WMA General Assembly, Fortaleza, Brazil, October 2013).
Discussion
==========
In some studies, a doubled or duplicated superior belly of the omohyoid muscle has been reported \[[@B4]\]. In these reports, the inferior head of the superior belly of the omohyoid muscle was described as it fused to the sternohyoid muscle. Wood \[[@B5]\] reported duplication and triplication of the superior belly of this muscle and insertion onto the thyroid cartilage. The region between the sternohyoid and omohyoid has been reported to be filled with muscle slips instead of fascia \[[@B6]\]. However, no reports have shown the massive fusion between the omohyoid and sternohyoid muscles like the present case.
Embryologically, Loth \[[@B7]\] considered the omohyoid muscle to be a remnant of the sternocleido-omohyoid muscle, which consists of two layers, a sternocleidohyoid portion and an omohyoid portion. Buntine \[[@B8]\] described this primitive sheet of the muscle as the episterno-cleido-hyoideus or sterno- omo-hyoid. Unfortunately, in the present case, the inferior part of the muscle could not be observed due to prior dissection. However, we speculate that this sheet might represent the sternocleido-omohyoid muscle, which had not undergone atrophy.
The omohyoid muscle is used as a landmark to identify levels III and IV lymph node metastases of head and neck cancers \[[@B9]\] with the lateral border of the sternohyoid muscle defined as the anterior boundary of levels III and IV. In terms of surgical neck dissection, fusion such as reported in our case might mislead the surgeon and confuse the level classification of metastasis and thus alter postoperative therapy and prognosis by altering the anatomical landmarks used to localize lymph nodes in the region \[[@B10]\].
The omohyoid muscle is an important landmark for head and neck cancer treatment. Therefore, surgeons should be aware of its variations such as the one described in the current report.
The authors wish to thank all those who donate their bodies and tissues for the advancement of education and research.
{#F1}
{#F2}
| {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Acrodysostosis (ACRDYS) is a rare skeletal dysplasia with skeletal abnormalities and multi-hormonal resistance similar to PHP1A, but caused by mutations downstream of the genes involved in PHP1A. Whereas PHP1A results from mutations of the gene encoding the Gα-stimulatory subunit (*GNAS*), ACRDYS is caused by mutations involving the genes for downstream effector proteins of *GNAS* in the cyclic AMP (cAMP)/ protein kinase A (PKA) pathway. In ACRDYS1, the protein kinase A regulatory subunit 1A (*PRKAR1A*) is mutated and in ACRDYS2 the gene coding for phosphodiestarase type 4D (*PDE4D*) is mutated. *PRKAR1A* encodes the cAMP-dependent regulatory subunit of protein kinase A. The mutated subunit impairs the protein kinase A response to cAMP accounting for the hormonal resistance and skeletal abnormalities in ACRDYS1. *PDE4D* is also involved in the cAMP signaling pathway, encoding a class-IV cAMP-specific phosphodiesterase, regulating cAMP concentrations and leading to ACRDYS2 \[[@CR1]\]. The two subtypes of ACRDYS are both characterized by similar skeletal features (short stature, facial dysostosis, and brachydactyly with cone-shaped epiphyses) and variable multi-hormone resistance. Patients with ACRDYS1 tend to have less facial dysostosis, and normal intelligence with multi-hormone resistance. Patients with ACRDYS2 tend to have more characteristic facial dysostosis and intellectual disabilities but have only subtle or absent hormonal resistance \[[@CR1]\].
The G-protein coupled hormones which are commonly affected in ACRDYS1 include parathyroid hormone (PTH), thyroid-stimulating hormone (TSH), growth hormone-releasing hormone (GHRH), luteinizing hormone (LH), and follicle-stimulating hormone (FSH). Accepted standard therapy involves thyroid hormone replacement and calcitriol to normalize thyroid and calcium metabolism. Growth hormone (GH) therapy is an accepted treatment for PHP1A patients with short stature and GH deficiency \[[@CR2]\] but efficacy of GH therapy is unknown in ACRDYS1. We report a case of ACRDYS1 in an 8-year-old female with severe short stature treated empirically with GH which was complicated by LCPD.
Case presentation {#Sec2}
=================
An 8-year-old female was referred to pediatric endocrinology for short stature. She was born at 38 weeks and small for gestational age (SGA) - birth weight of 4 pounds 8 oz (2.04 kg), and birth length of 16 in. (40.6 cm). Her father was from Mexico and her mother was from Puerto Rico and their heights are 5′9″ (175.3 cm) and 5′5″ (165.1 cm) respectively giving her a mid-parental height of 5′4.5″ (163.8 cm). She had normal development, without any significant medical problems.
Physical examination demonstrated severe short stature (height Z-score − 3.46), midface hypoplasia, and severe brachydactyly of her hands and feet. Laboratory analysis showed mildly elevated TSH with normal free thyroxine, mildly low calcium with elevated PTH and low normal IGF-1 level (Table [1](#Tab1){ref-type="table"}). Radiographs revealed severe brachymetatarsia, brachymetacarpia, and brachydactyly with cone-shaped epiphyses in the proximal phalanges (Fig. [1](#Fig1){ref-type="fig"}). Genetic testing revealed a mutation of the *PRKAR1A* gene, specifically R368X (CGA \> TGA). To address her TSH and PTH resistance, she was started on levothyroxine and calcitriol. We postulated that her severe short stature was from a combination of GHRH resistance and being born SGA. GH therapy was initiated at 0.35 mg/kg/week -- a mid-range dose for children with SGA. Three months later, her serum IGF-1 Z-score increased from − 1.2 to 2.1 at an effective GH dose of 0.33 mg/kg/week. Table 1Laboratory analysis upon initial presentation at age 8 yearsReference rangeResultsTSH0.6--5.5 μU/ml10.6Free T40.9--1.4 ng/dl1.0PTH11--74 pg/ml149Calcium8.9--10.4 mg/dl8.7Phosphorus3--6 mg/dl4.8IGF-176--424 ng/ml91 (z score − 1.2)IGF-BP31.6--6.5 mg/dl3.0Fig. 1Brachydactyly and cone shaped epiphyses seen in patient which is characteristic of ACRDYS
After 7 months, her annualized growth velocity had increased from 3 cm/year to 11 cm/year and she had grown 6.5 cm (Fig. [2](#Fig2){ref-type="fig"}). However, she also reported right knee pain for 1 week. Radiographs (Fig. [3](#Fig3){ref-type="fig"}) revealed flattening of the right femoral head consistent with LCPD. She was made non-weight bearing and GH therapy was discontinued. Fig. 2Linear Growth ChartFig. 3At onset of knee pain: Right capital femoral epiphyseal height loss was observed without evidence of slippage. No significant sclerosis
Six weeks later, radiographs (Fig. [4](#Fig4){ref-type="fig"}) revealed further collapse with involvement of the entire femoral head, and she was now using crutches/wheelchair. Her lesion stabilized after 8 months with conservative management. She remained off GH, had menarche at 11 years 8 months and reached skeletal maturity at 13 years old with final adult height at 4′2″ (128 cm); Z-score of − 5.5. She is ambulating independently with a leg length discrepancy \< 1 cm. She occasionally has right hip pain after walking for long periods and is being monitored closely for early hip arthritis. She has regular menses and continues on levothyroxine and calcitriol for TSH and PTH resistance respectively. Fig. 4Six weeks later: Increased flattening and sclerosis of right capital femoral epiphysis and mild increased fragmentation laterally
Discussion {#Sec3}
==========
Leg Calves Perthes Disease (LCPD), also called avascular necrosis of the femoral head epiphysis, is most commonly seen amongst children 4--8 years of age. LCPD is grouped together with slipped capital femoral epiphysis (SCFE) and scoliosis as possible adverse skeletal effects of the rapid growth caused by GH therapy in children with GH deficiency \[[@CR3]\]. The incidence rate for LCPD in idiopathic growth hormone deficient patients is reported to be 10 per 100,000 compared with 5--7 per 100,000 for the general population. Interestingly, the rate did not vary if the GH deficient children were on growth hormone therapy or not \[[@CR4]\]. LCPD is not known to be associated with ACRDYS, but LCPD was reported in a patient with PHP1A not on GH \[[@CR5]\]. Children with PHP1A treated with GH have not been reported to have an increased risk of LCPD. Proposed underlying risks of LCPD include glucocorticoid exposure, genetic mutations of COL2A1, coagulation abnormalities, traumatic injury to the blood supply, transient synovitis, second-hand smoke exposure, and venous congestion \[[@CR6]\]. Patients with underlying renal failure or kidney transplants who are on GH therapy are also reported to be at higher risk to develop LCPD \[[@CR4]\]. Similar to a previous case report of a pre-pubertal female with GH deficiency who developed LCPD \[[@CR7]\], we hypothesize that growth spurt due to GH treatment led to an insufficient blood supply to the epiphysis, resulting in LCPD in our patient. It is currently advised to stop GH treatment in cases of LCPD to decrease the severity of the disease and prevent contralateral disease \[[@CR7]\]. This is what we did and she did not develop contralateral disease. The 2018 consensus guidelines for PHP1A patients include a recommendation to screen all patients for GH deficiency \[[@CR8]\] and then to treat those who are deficient. Current standard starting dose of GH is 0.3 mg/kg/week divided daily and titrated utilizing the IGF-1 level and the linear growth velocity \[[@CR2]\]. For PHP1A children born small for gestational age (SGA), GH treatment can be considered, and typically higher doses are used than for GH deficiency \[[@CR2], [@CR8]\]. De Zegher et al. reported higher doses of GH at 0.46 mg/kg/week used in patients with SGA without skeletal dysplasia and GH was well tolerated \[[@CR9]\]. Our patient who was born SGA was started on higher GH dose of 0.35 mg/kg/week as compared to GH deficient PHP1A patients. It may be that this higher dose contributed to the development of LCPD.
Conclusion {#Sec4}
==========
GH is the standard of care for patients with PHP1A | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
In the gastrointestinal tract, interstitial cells of Cajal (ICC) function as pacemakers, neurotransmitter transducers, and mechanosensors that respond to physical and chemical signals, and thereby modulate smooth muscle contractility [@pone.0048897-Won1], [@pone.0048897-Choi1], [@pone.0048897-Ward1], [@pone.0048897-Nakayama1]. Alterations in ICC function have been linked to more than a dozen gastrointestinal diseases [@pone.0048897-Streutker1], [@pone.0048897-Mostafa1]. In the last decade, novel ICCs have also been identified in the urinary bladder in several species, including guinea pigs, rats, and humans [@pone.0048897-McCloskey1], [@pone.0048897-PiasecznaPiotrowska1], [@pone.0048897-Shafik1], [@pone.0048897-Kim1], [@pone.0048897-Okada1], [@pone.0048897-Johnston1]. Unlike ICC in gut, the function of ICC in bladder is poorly understood, but emerging data indicates that they too, are implicated in several bladder diseases. These disorders offer the chance to gain insights into ICC functioning. In megacystis-microcolon intestinal hypoperistalsis syndrome (MMIHS), a congenital lethal disease in newborns, patients are unable to void spontaneously and have a massively dilated bladder. It is thought that the lack of ICC in the MMIHS bladder is responsible for this lethal voiding dysfunction [@pone.0048897-PiasecznaPiotrowska1].
Proto-oncogene c-Kit (C-kit, tyrosine-protein kinase Kit, or CD117) is a receptor tyrosine kinase (RTK) expressed on the surface of hematopoietic as well as other cell types such as mast cells. Signaling through c-kit plays a role in cell survival, proliferation, and differentiation, and gain of function mutations in this protein are associated with multiple tumors [@pone.0048897-Papaspyrou1], [@pone.0048897-Corless1], [@pone.0048897-Arock1], [@pone.0048897-Rulina1]. In the digestive tract, c-kit is used as the "gold standard" for identification of ICC. C-kit has also been identified in urinary bladder in guinea pig, rat and human, and further functional characterization has suggested these c-kit-positive cells are like the ICC in gastrointestinal tract [@pone.0048897-Okada1], [@pone.0048897-McCloskey2], [@pone.0048897-Biers1], [@pone.0048897-Johnston2], [@pone.0048897-Vahabi1], [@pone.0048897-Wang1]. In the mouse urinary tract, there has been some confusion about the presence of c-kit in bladder ICC. Pezzone and co-authors reported c-kit positive cells in ureter, but not in bladder [@pone.0048897-Pezzone1]. Meanwhile, McCloskey *et al.* identified c-kit positive cells in both wild-type and *W/Wv* (c-kit mutant) mice [@pone.0048897-McCloskey3], while other investigators have failed to find c-kit in mouse bladder at all [@pone.0048897-Lagou1], [@pone.0048897-Koh1].
ICC are stellate-like cells with long dendrites or spikes. They have close contacts with nerve varicosities and smooth muscle cells and form gap junctions with each other, which provide a route for the diffusion of low molecular weight materials as an important intercellular signal communication pathway between these types of cells. Thus gap junctions have a crucial role in mediating the synchronized contraction of smooth muscle cells. Nemeth *et al.* reported that gap junction protein connexin 43 is present in ICC with convincing co-localization of c-kit. ICC could be seen to form a three-dimensional network in the normal colonic bowel wall and lack of connexin43 expression in the aganglionic bowel of Hirschsprung\'s disease (HD) may be partly responsible for the smooth muscle motility dysfunction in HD patients [@pone.0048897-Nemeth1]. It has remained unclear as to whether ICC in the urinary bladder also express connexin 43, or where connexin 43 is located. While dozens of studies indicate that connexin 43 plays a crucial role in modulating bladder overactivity, its precise localization is still the subject of debate and attributed mostly to bladder smooth muscle cells and/or myofibroblasts. We therefore sought to define more clearly the molecular signature of ICC and in doing so resolve some of these uncertainties [@pone.0048897-Hashitani1], [@pone.0048897-Haefliger1], [@pone.0048897-Sui1], [@pone.0048897-Neuhaus1], [@pone.0048897-Ikeda1], [@pone.0048897-Neuhaus2].
We recently identified a population of cells in mouse bladder that express ectonucleoside triphosphate diphosphohydrolase 2 (NTPDase2), an ectonucleotidase that degrades ATP/UTP to ADP/UDP and further to AMP/UMP [@pone.0048897-Yu1]. These NTPDase2-positive cells are a unique subset of cells in bladder that exhibit narrow elongated and branched cell processes and clearly wrap around smooth muscle cell bundles. They are also expressed in a sub-region of the lamina propria that is immediately adjacent to the bladder smooth muscle layer and seems to be a natural extension from between the smooth muscle spaces. Intriguingly our data indicated they were distinct from smooth muscle, fibroblasts, myofibroblasts and neurons, indicating they might be ICC [@pone.0048897-Yu1].
In this study we have used confocal immunofluorescent microscopy of multiple cellular markers to define the identity of these cells. Our data demonstrate that they are ICC by the usual accepted definitions and that ICC in mouse bladder can be clearly defined by the presence of c-Kit, NTPDase2, CD34, Ano1, connexin 43, vimentin, desmin, PDGF receptor and merlin/NF2. These data establish a molecular expression profile for ICC in mouse bladder, which can be used to assist in explorations of their functional roles in future.
Materials and Methods {#s2}
=====================
Materials {#s2a}
---------
Unless otherwise specified, all chemicals were obtained from Sigma (St. Louis, MO) and were of reagent grade or better.
Animals {#s2b}
-------
Mice used in this study were C57BL/6J mice (19--21 g) from Charles River Laboratories (Wilmington, MA). Mice were euthanized by inhalation of 100% CO2. After euthanasia and thoracotomy, the bladders were rapidly excised and processed as described below. All animal studies were carried out with the approval of the Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committee (Protocol **\#**051-2009).
Antibodies and labeled probes {#s2c}
-----------------------------
Affinity-purified polyclonal sheep anti-NTPDase2 antibody (AF5797) was purchased from R&D systems (Minneapolis, MN). Affinity-purified monoclonal rat anti-CD34 \[MEC14.7\] antibody (ab8158) and monoclonal rabbit anti-TMEM16A \[SP31\] antibody (ab64085) were purchased from Abcam (Cambridge, MA). Affinity-purified polyclonal rabbit anti-c-kit antibody (A0501), affinity-purified polyclonal rabbit anti-connexin 43 antibody (C0158), affinity-purified polyclonal rabbit anti-vimentin antibody (C0390), affinity-purified polyclonal rabbit anti-desmin antibody (C0171), affinity-purified polyclonal rabbit anti-PDGFβ antibody (B7194), affinity-purified polyclonal rabbit anti-merlin antibody (A8046) were purchased from Assay Biotechnology (Sunnyvale, CA). Affinity-purified polyclonal goat anti-mast cell tryptase (G-12) antibody (sc-32474) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Affinity-purified monoclonal mouse anti-αSMA antibody is a kind gift from the laboratory of Dr. Raghu Kalluri (Beth Israel Deaconess Medical Center). Secondary donkey anti-rabbit/sheep/goat/mouse antibodies conjugated to Alexa 488/546, and Topro-3 were purchased from Invitrogen-Molecular Probes (Carlsbad, CA).
Immunofluorescence analysis {#s2d}
---------------------------
Excised bladders were fixed in 4% (w/v) paraformaldehyde dissolved in 100 mM sodium cacodylate (pH 7.4) buffer for 2 h at room temperature. Alternatively, tissue was fixed in 4°C methanol for 10 min. Fixed tissue was cut into small pieces with a razor blade, cryoprotected with 30% sucrose solution (w/v), frozen, sectioned (5 µm), and incubated with primary antibodies (1∶50--1∶500 dilution) overnight at 4°C as described previously [@pone.0048897-Yu1]. After washing away unbound primary antibody, the sections were incubated with a mixture of Alexa 488-conjugated secondary antibody (diluted 1∶ | {
"pile_set_name": "PubMed Central"
} |
The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.
Introduction and background
===========================
Fulminant hepatic failure is defined as severe liver injury resulting in impaired synthetic capacity and encephalopathy in patients with previously normal liver function \[[@REF1]\]. It is typically characterized by increases in transaminases, which serves as the first clue to the clinician that acute liver injury is occurring. Depending on how elevated the patient's transaminases are, one can then narrow the list of differential diagnoses. Elevations in transaminases greater than ten times the upper limit of normal are suggestive of ischemic, toxic or viral liver injury \[[@REF2]\]. Of these, toxic (acetaminophen) and viral are the most common etiologies worldwide \[[@REF3]\]. Hepatitis A, B, C, D, and E are the most frequently encountered forms of viral hepatitis in the medical literature. Rarely will non-hepatitis viruses cause fulminant hepatic failure. The goal of this review article is to aid clinicians in the early identification of herpes simplex virus (HSV) hepatitis in order to initiate rapid treatment and ultimately prevent mortality.
Review
======
Epidemiology
HSV hepatitis in adults is a rare entity that was first reported in 1969 by Flewett et al. \[[@REF4]\]. Since its discovery, it is thought to comprise a mere 1% of all cases of acute liver failure (ALF), and only 2% of viral associated ALF \[[@REF5]\]. In the limited amount of cases that have been reported in the literature, it has occurred more frequently in patients that are in an immunocompromised state. These states include pregnancy, corticosteroid use, human immunodeficiency virus (HIV), and autoimmune disease \[[@REF6]\]. There also seems to be a female predilection of the disease. In 2007, Norvell et al. compiled 137 cases of HSV hepatitis that were available in the literature at the time. Their data demonstrated a female predominance of 62%. In the same study, 76% of inflicted patients were found to be either pregnant or immunosuppressed \[[@REF7]\]. It is important note however that HSV hepatitis is non-discriminating and may occur in male immunocompetent patients as well \[[@REF8]\].
Pathogenesis
There are multiple theories regarding the pathogenesis of HSV hepatitis. The first theory postulates that a large HSV inoculum at the time of initial infection overwhelms the hosts defense system, and results in visceral dissemination into the liver. The second theory suggests that visceral dissemination derives from herpetic lesions in the setting of impaired macrophages, cytotoxic T-lymphocytes, and delayed type hypersensitivity. The third theory suggests that an acute HSV infection, superimposed on a latent HSV reactivation, may be the culprit in the development of fulminant hepatitis. Finally, a fourth theory takes into consideration the heterogeneity of HSV. Studies have proven that certain strains of HSV are neurovirulent causing herpetic encephalitis. Similarly, there may be certain strains that are hepatovirulent and result in fulminant hepatic failure \[[@REF9], [@REF10]\].
Clinical manifestations
Identifying HSV hepatitis can be a precarious task. Clinically its presentation is indistinguishable from other etiologies of acute hepatitis. In addition, many of the cases reported in the literature have presented with an anicteric pattern \[[@REF11]\]. To further complicate matters, less than half of the reported cases present with mucocutaneous lesions suggestive of HSV \[[@REF12]\]. Leukopenia and thrombocytopenia have also been reported to be associated with HSV hepatitis \[[@REF13]\]. Other findings that are often seen in HSV hepatitis include fever, coagulopathy (resulting in life-threatening hemorrhage), and acute renal failure \[[@REF7]\]. Given the lack of objective physical findings, and absolute laboratory results, history gathering becomes essential.
Diagnosis
Diagnostic tools that can aid a physician in recognizing HSV hepatitis include HSV serology, HSV DNA by polymerase chain reaction (PCR), computed tomography (CT) scan and liver biopsy. Regarding laboratory studies, HSV DNA by PCR has been shown to be more discriminating than serologic testing for diagnosing or excluding HSV as a cause of ALF \[[@REF14]\]. CT scan findings are very non-specific, but may show hepatomegaly along with diffuse hypodense 1-4 mm lesions, which represent foci of acute hepatic necrosis. Ultrasound may also be useful in excluding other diagnoses that are suspected. This is especially true in pregnant patients where fatty liver disease of pregnancy is often the cause of acute liver failure \[[@REF15]\]. Despite the utility of these diagnostic modalities, liver biopsy remains the gold standard for diagnosing HSV hepatitis. Histologically, biopsy will show focal or confluent areas of acidophilic type necrosis, with little associated inflammation. In non-necrotic areas, Cowdry type A bodies surrounded by halos, may also be found \[[@REF16]\].
Treatment
Treatment of HSV hepatitis, and subsequent prognosis, is highly contingent on time. Rapidly progressive acute liver failure occurs in 74% of cases, with mortality rates reaching 90% \[[@REF17]\]. Studies have demonstrated better clinical outcomes in patients who were started on acyclovir early in their hospital course. One literature review in particular, concluded that patients who received early treatment were less likely to die, or require liver transplantation \[[@REF18]\]. It is important to note however that there have been cases of acyclovir resistant HSV hepatitis reported in the literature. Resistance of HSV to acyclovir is most often seen in immunocompromised patients and rates have been reported to range from 3.5% to 10% in this population \[[@REF19]\]. Acyclovir is a nucleoside analogue that is phosphorylated into its active form by thymidine kinase in HSV-infected cells. Acyclovir resistance results from mutations in the thymidine kinase gene that cause decreased production or complete absence of thymidine kinase \[[@REF20]\]. In cases of acyclovir resistant HSV hepatitis, Foscarnet or Cidofovir may be employed. These two agents inhibit the catalytic unit of viral DNA polymerase and do not require activation by thymidine kinase \[[@REF21]\]. Chaudhary et al. reported one case of HSV hepatitis that showed no improvement with acyclovir, but when foscarnet was added the patient's mental status improved and she was ultimately discharged home with no need for liver transplantation \[[@REF22]\]. Other important questions to consider with regards to treatment are the optimal route of administration (intravenous vs oral) and the subsequent duration of therapy. This is highlighted by a case reported by Czartoski et al. in which a patient diagnosed with HSV hepatitis initially showed improvement on intravenous acyclovir, but quickly decompensated when switched to oral valacyclovir \[[@REF23]\]. Despite completing 43 days of intravenous acyclovir prior to discontinuation, the patient ultimately expired. Once fulminant hepatic failure occurs the only option that remains is liver transplantation. In Norvell et al.'s literature review, seven patients with HSV hepatitis underwent orthotopic liver transplantation after developing fulminant hepatic failure. A mere three patients ultimately survived, expiring due to complications associated with liver transplantation \[[@REF7]\]. Despite a lack of evidence, there may be a role for plasmapheresis in HSV hepatitis. Holt et al. reported one such case in which a pregnant patient presented to their institution with acute liver failure. Given the patient\'s anemia, thrombocytopenia and transaminitis the presumptive diagnosis of HELLP (hemolysis, elevated liver enzymes, low platelet count) syndrome was made. This was followed by the rapid initiation of therapeutic plasma exchange (TPE). One day after the initiation of TPE the patient's transaminitis markedly improved (Alanine transaminase decreased by 5,131 IU/L; Aspartate transaminase decreased by 1,282 IU/L). The patient was later diagnosed with HSV hepatitis through liver biopsy and was started on acyclovir. She was ultimately discharged home with normal transaminase levels \[[@REF24]\].
Conclusions
===========
In conclusion, HSV hepatitis is a rare cause of rapidly progressive acute hepatitis that oftentimes results in fulminant hepatic failure. Due to its rarity, and lack of discernible clinical features, early recognition and history gathering become indispensable. Current guidelines do not recommend empiric treatment with acyclovir, but given its high mortality rate and complications associated with liver transplantation, one should consider empiric treatment in selected patient populations where there is a high index of clinical suspicion for HSV hepatitis. These would include immunocompromised patients or promiscuous patients with new sexual partners who present with acute liver failure. In these patients empiric treatment should be strongly considered along with early testing to rule out HSV hepatitis.
The authors have declared that no competing interests exist.
| {
"pile_set_name": "PubMed Central"
} |
A carpometacarpal joint (CMCJ) of the thumb is important for the function of the thumb and in the performance regarding strong pinch and grasp. The dislocation of the CMCJ in the thumb accounts for less than 1% of all hand injuries.[@B1] Mechanical instability for the CMCJ of the thumb is an important factor, which may lead to articular degeneration of the joint and thus interfere with the normal function of the hand. Recommended treatment for this injury has ranged from closed reduction with or without percutaneous K-wire fixation to reconstruction of the ligaments. We report a case of bilateral thumb CMCJ dislocations: a unique combination of injuries. It was successfully treated with closed reduction and percutaneous K-wires fixation on one side, and an open reduction and reconstruction of the ligament in the other side. Our patient was informed that the data concerning this case would be submitted for publication.
CASE REPORT
===========
A 50-year-old man was taken to the emergency room as a result of a motorbike accident. At the time of impact, he was firmly grasping the handlebars with both hands. A physical examination revealed severe tenderness and dorsal prominence at the CMCJ regarding both thumbs. There were no neurovascular injuries or skin lesions. The radiographs showed dorsal dislocation of the CMCJ for both thumbs with a tiny fracture fragment in the right hand ([Fig. 1](#F1){ref-type="fig"}). His accompanying injuries were a bilateral haemothorax, nasal bone fracture, and right distal tibia fracture. Under lidocain block, a closed reduction was performed by gentle longitudinal traction. After the reduction, 3-dimensional computed tomography showed that the dislocations of both CMCJs still remained.
Due to a bilateral haemothorax, surgery was performed 2 weeks after the injury. His right hand was treated with a closed reduction and percutaneous K-wires fixation under fluoroscopic guidance. However, his left hand was significantly unstable, so an open reduction with ligamentous reconstruction was performed ([Fig. 2](#F2){ref-type="fig"}). During the operation, the dorsal capsule and volar oblique ligament were ruptured, making it impossible to suture securely. Some small cartilage fragments and remnants of ligament interposed in the joint space were removed. Reconstruction of the volar oblique ligament was performed with the radial half of the flexor carpi radialis remaining in continuity at its insertion on the second metacarpal base. It was routed through a drill hole in the base of the metacarpal in the sagittal plane perpendicular to the thumb nail, using a 28-gauge stainless steel wire, passed deep to the abductor pollicis longus insertion, and then passed around the remaining flexor carpi radialis and secured over the dorsal capsule ([Fig. 3](#F3){ref-type="fig"}). Both thumbs were immobilized in a thumb spica cast for 6 weeks. Routine activities were recommended immediately upon removal of the cast. The K-wires were removed 7 weeks after surgery. At the 16-month follow-up, the patient complained of mild stiffness of the left thumb. However, there was no pain or chronic instability.
DISCUSSION
==========
A CMCJ of the thumb is a biconcave saddle joint: the trapezium is convex on anteroposterior views and concave on lateral views, whereas the thumb metacarpal is the opposite. This unique configuration provides a wide range of motion varying from abduction to opposition while the joint remains stable.[@B2] Furthermore, it is supported with a thickened joint capsule composed of sixteen ligaments, although stability is primarily provided by 4 main ligaments: the anterior oblique, the intermetacarpal, the dorsoradial, and the posterior oblique ligament.[@B3] Controversy concerning which ligaments are damaged in joint dislocation and which ligaments are the true key stabilizers for joint stability still exists. However, for years the volar oblique ligament has been believed to be the key stabilizer for CMCJ of the thumb. In this case, the dorsal capsule and volar oblique ligament were ruptured from the base of the first metacarpal bone.
This intrinsic joint stability makes a dislocation of the thumb CMCJ quite a rare injury. Mueller[@B1] reported that the CMCJ dislocation of the thumb accounts for less than 1% of all hand injuries. Bilateral CMCJ dislocation of the thumb was first described by Khan et al.[@B4] in 2003. In their report, both joints appeared stable after closed reduction and the patient was treated with a thumb spica cast for 6 weeks. At a 15-month follow-up, the functional result was good. We believe this is the second case described regarding a bilateral CMCJ dislocation of the thumb in the English literature.
Two mechanisms have been reported for a traumatic dislocation of the CMCJ of the thumb.[@B5]-[@B8] The first is a longitudinally directed force along the axis of the metacarpal with the joint in full flexion. The second is a force driven into the first web space of the thumb. This force separates the base of the first and second metacarpal joints and produces a CMCJ dislocation. It commonly occurs when motorcycle drivers grip the handlebars before an impact and the traumatic event of our case suggested that the injury was caused by the second mechanism.
There is some controversy regarding which treatments are optimal for acute thumb CMCJ dislocations. The treatments have ranged from a closed reduction and immobilization to a closed or open reduction and K-wire fixation with or without the reconstruction of the capsule and ligaments.[@B2] It is believed that the most important point in the management of acute CMCJ dislocations is to assess the stability of the joint after reduction.[@B9] If the first metacarpal bone was not well seated radiographically or was loose or sloppy clinically following the reduction, surgical reduction was indicated. Simonian and Trumble[@B10] advocated thumb spica casting if stable closed reduction was obtainable, but suggested early ligament reconstruction for an unstable thumb CMCJ. They reported that early reconstruction might decrease the incidence of recurrent instability and posttraumatic arthritis. Similarly, Shah and Patel[@B8] reported that open reduction and internal fixation alone were not adequate for an unstable thumb CMCJ dislocation and that the reconstruction of the capsular as well as ligamentous structures are needed. We performed a closed reduction and percutaneous K-wires fixation on the right hand. Although the extent of ligamentous injury was not determined, we believed that the volar oblique ligament was intact since the avulsion of the first metacarpal base was seen. On the other hand, an open reduction and reconstruction of the volar oblique ligament according to Eaton et al.[@B7] were performed on the left hand due to severe instability. This had the advantage of reconstructing the joint in two planes, reconstituting the volar oblique ligament and also creating a new ligament radially in a part of the joint capsule, which was weak and membranous. At the 16-month follow-up, the patient demonstrated a normal range of motion, strength and no joint instability. Overall, he was satisfied with the outcome. Although the follow-up period is short in order to allow a comment on the development of posttraumatic arthritic changes, this positive result would encourage us to adopt this technique in future cases.
No potential conflict of interest relevant to this article was reported.
{#F1}
{#F2}
{#F3}
| {
"pile_set_name": "PubMed Central"
} |
Familial glucocorticoid deficiency (FGD) is a rare autosomal recessive disorder in which cortisol and adrenal androgen secretions are deficient due to adrenal unresponsiveness to ACTH stimulation. The most significant phenotypic features are severe neonatal hypoglycemia, frequent childhood infection, and excessive generalized skin pigmentation related to elevated proopiomelanocortin (POMC) products ([@B1]). FGD can be caused by mutations in genes encoding the ACTH receptor \[melanocortin 2 receptor (*MC2R*)\] or its accessory protein (*MRAP*), and a similar clinical presentation has been observed in some patients with specific "mild" mutations in the steroidogenic acute regulatory protein ([@B2]--[@B4]). Most commonly, *MC2R* is mutated, and this is referred to as FGD type 1 (OMIM 202200).
MSH (melanotropin) and ACTH are products of the same gene, *POMC*, and they regulate pigmentation and adrenocortical function, respectively ([@B5]). Mutations in *POMC* result in a red hair phenotype with metabolic abnormalities, including adrenal insufficiency and obesity ([@B6]).
MC1R plays a central role in the regulation of skin pigmentation, is expressed in melanocytes, and binds α-MSH and ACTH with similar affinity. MC1R activation increases the ratio of black, strongly photoprotective eumelanins to reddish, poorly photoprotective pheomelanins ([@B7]). Several MC1R variants are associated with red hair/fair skin ([@B7]--[@B9]). Increased circulating ACTH acting through MC1R is believed to be the cause of the hyperpigmentation seen in primary adrenal failure. There are, however, a few reports of Addison\'s cases without hyperpigmentation ([@B10]--[@B21]). So far, no pathogenetic mechanism has been described to explain this phenomenon, although it has been noted that it is more frequently observed in fair-skinned individuals.
Here we report coexistent homozygous MC2R and MC1R mutations in the same individual, causing an unusual presentation of FGD without hyperpigmentation.
Patient and Methods
===================
The patient presented at 4 yr of age with hypoglycemia during a respiratory tract infection after prolonged fasting. She had three further hypoglycemic attacks in the following 2 yr during infections. At the age of 6, during evaluation of her fifth hypoglycemic attack, she was diagnosed with hypocortisolemia with elevated ACTH levels. A standard ACTH stimulation test revealed a subnormal response ([Table 1](#T1){ref-type="table"}). Absence of salt wasting with normal plasma renin activity and without elevation of adrenal glucocorticoid precursors was consistent with isolated glucocorticoid deficiency ([Table 1](#T1){ref-type="table"}).
######
Biochemical and hormonal values at baseline and after a standard dose (250 μg) ACTH test
Patient levels Reference ranges
---------------------------------------------------------- ------------------------------------------------------------------- -----------------------------------------------------------------------
ACTH \>1250 pg/ml (275 pmol/liter)[*^b^*](#TF1-2){ref-type="table-fn"} \<46 pg/ml (10.1 pmol/liter)[*^b^*](#TF1-2){ref-type="table-fn"}
Cortisol at diagnosis 2.56 μg/dl (71.1 nmol/liter)[*^a^*](#TF1-1){ref-type="table-fn"} 5--23 μg/dl (139--639 nmol/liter)[*^a^*](#TF1-1){ref-type="table-fn"}
Cortisol in standard dose ACTH stimulation test (250 μg) 4.9 μg/dl (136.1 nmol/liter)[*^b^*](#TF1-2){ref-type="table-fn"} 5--23 μg/dl (139--639 nmol/liter)[*^b^*](#TF1-2){ref-type="table-fn"}
6.6 μg/dl (183.3 nmol/liter)[*^c^*](#TF1-3){ref-type="table-fn"} \>20 μg/dl (\>550 nmol/liter)[*^c^*](#TF1-3){ref-type="table-fn"}
DHEAS \<15 μg/dl (0.39 μmol/liter) 2.3--15 μg/dl (0.06--0.39 μmol/liter)
Na and K 136 and 3.14 mEq/liter 134--145 and 3.5--5.3 mEq/liter
Aldosterone 50 pg/ml (138.8 pmol/liter) 10--180 pg/ml (27.7--500 pmol/liter)
Plasma renin activity 2.5 ng/ml · h (3.2 pmol/ml · h) 1--6.5 ng/ml · h (1.3--8.4 pmol/ml · h)
The patient was found to have hypocortisolemia at the time of hypoglycemia, but ACTH levels were not measured at this time because no hyperpigmentation was present. DHEAS, Dehydroepiandrosterone sulfate. Conversion factors: DHEAS, 1 μg/dl = 38.46 μmol/liter; cortisol, 1 μg/dl = 0.036 nmol/liter; aldosterone, 1 pg/ml = 0.36 pmol/liter; ACTH, 1 pg/ml = 4.54 pmol/liter; plasma renin activity, 1 ng/ml · h = 0.77 pmol/ml · h.
At the time of hypoglycemia (glucose, 25 mg/dl);
before, and
after ACTH stimulation test.
Her parents were consanguineous, and she had two unaffected sisters. Her physical examination was normal, except that her height and weight were above the 97th centile for height and weight of a sex- and age-matched reference population. It was noted that she had no hyperpigmentation, despite very high ACTH levels. Her eye color was bluish-gray, and skin and hair pigmentation was similar to unaffected family members. The family noted that her hair color was red during infancy and darkened as she got older. At follow-up, after replacement with hydrocortisone and reduction of serum ACTH levels, her hair had reverted to a reddish color ([Fig. 1](#F1){ref-type="fig"}).
{#F1}
Sequencing
----------
Genomic DNA was extracted from whole blood samples after individuals gave informed consent. The sequences of the coding exons of *MC1R* and *MC2R* and their intron/exon junctions were determined by PCR and automated sequencing.
Results
=======
Nucleotide sequence analysis of *MC2R* revealed a homozygous mutation NC_000018.9:g.13885083C\>A, c.455C\>A (p.T152K), a loss-of function mutation previously shown to be trafficking defective ([@B22]) ([Fig. 2](#F2){ref-type="fig"}). The parents and one unaffected sister were heterozygous for the mutation, and her other unaffected sister was wild-type. Hyperpigmentation is a classical clinical finding in FGD; to find the reason for this patient\'s lack of pigmentation, we sequenced *MC1R*. A homozygous NC_000016.9:g.89986144C\>T, c.478C\>T variation (p.R160W) was detected in *MC1R* in the proband. Her parents and sisters were heterozygous for the change ([Fig. 2](#F2){ref-type="fig"}). This change, SNP ID rs1805008, has been linked to a red hair phenotype ([@B8]).
{#F2}
Discussion
==========
Pigmentary skin changes are one of the most important clinical features and diagnostic clues in adrenal failure for clinicians. Here, we report a case of FGD without this clinical feature due to homozygous mutations in two unrelated genes, located on different chromosomes but belonging to the same family, the melanocortin receptors. The ligands of MC2R and MC1R are ACTH and α-MSH, respectively, both products of the same gene, *POMC*, which encodes a polypeptide hormone precursor that undergoes tissue-specific, posttranslational processing via cleavage by prohormone convertases. ACTH and | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Previous studies suggested that surgery using polypropylene mesh could offer a better anatomical cure of pelvic organ prolapse (POP) \[[@CR1]\]. A large UK-based surgical randomised controlled trial (RCT) (PROSPECT, PROlapse Surgery: Pragmatic Evaluation and randomised Controlled Trials) \[[@CR2]\] was conducted to compare outcomes of native tissue and mesh-augmented repairs. This study showed that the outcomes for both categories of repair are similar but mesh-augmented repairs have an additional 10% risk of mesh complications.
PROSPECT was a pragmatic RCT in which surgeons used the surgical techniques routinely used in their clinical practice. At the start of the study surgeons completed a questionnaire to document their surgical techniques for both native tissue and mesh/graft repairs \[[@CR3]\]. This demonstrated significant variation in the surgical technique used to perform an anterior repair. The limitations of the questionnaire study design, including the uncertainty about surgeon's terminology, gave cause for further evaluation. The current mesh pause adds additional importance to this study.
This prospective qualitative study, Variation in Surgical Technique (VaST), was proposed to gain greater insight into the surgical technique variations that exist and to understand why practice variation continues to exist despite the known importance of evidence-based medicine. The objective of this study was to describe and categorise surgical techniques used to perform native tissue anterior repairs so that future studies can assess the impact of surgical technique on the outcome of surgery.
Methods {#Sec2}
=======
This multi-centered UK-based prospective observational study used qualitative methodology to evaluate the surgical techniques used for native tissue anterior POP repairs. A purposive sample was drawn from a cohort of surgeons who had recruited to the large surgical prolapse study, PROSPECT \[[@CR2]\]. This sample was chosen to allow a future subgroup analysis of the influence of surgical technique on outcome. An additional sample of surgeons who had chosen not to participate in PROSPECT was included to ensure techniques were representative of common practice. Recruitment concluded following saturation of themes.
Data collection was performed at the individual surgeons' hospital site and the surgery was observed during routine theatre schedules. The same investigator performed all interviews and observations. Each surgeon was filmed performing a native tissue anterior repair. This was followed by a face-to-face semi-structured audio-recorded interview with the participating surgeon about their surgical technique. Additional field notes were taken.
All interviews were professionally transcribed in a verbatim manner and a subset sent to the surgeons to ensure accuracy. Thematic analysis \[[@CR4]\] using all data was performed and the six phases of analysis were followed. Stages 1--3 (familiarisation with data, generating initial codes and searching for themes) involved two of the investigators. A further investigator was involved in stages 4--6 (reviewing themes, defining and naming themes and producing a report) and in independently reviewing a subset of videos. The computer software (NVIVO) was used in the analysis of data to code and develop themes.
The first objective of VaST was to directly observe, describe and categorise techniques used to perform a native tissue anterior repair. Ethical approval was gained from the Sunderland Ethics Committee (REC no. 13/NE/0158, 29/05/13).
Results {#Sec3}
=======
Thirty surgeons were recruited to VaST; 2 surgeons were interviewed and 28 surgeons interviewed and filmed performing a native tissue anterior repair. These UK-based consultant surgeons worked in 1 of 21 centres (tertiary and district general hospitals) across England and Scotland. Table [1](#Tab1){ref-type="table"} summarises the background demographics of the surgeons and the procedures performed, both isolated anterior repairs and those with concomitant procedures.Table 1Demographics of surgeons and details of concomitant surgeryNumberType of surgeon PROSPECT22 Non-PROSPECT8Gender of surgeon Male20 Female10Type of consultant appointment General gynaecologist1 Gynaecologist with special interest14 Accredited subspecialist in Urogynaecology14 Urologist1Years since consultant appointmentMean 12 years (range 3--31)Procedures observed32 Anterior repair alone12 Anterior repair + sacrospinous fixation4 Anterior repair, posterior repair + sacrospinous fixation4 Anterior and posterior repair5 Anterior repair, posterior repair and vaginal hysterectomy6 Anterior repair, posterior repair and Manchester repair1
Current techniques used to perform native tissue anterior repairs {#Sec4}
=================================================================
Infiltration {#Sec5}
------------
At the start of the procedure most surgeons used infiltration in the anterior wall (*n* = 27/30). However, there was large variation in the volume used, from 3--80 ml (median 20 ml). The type of infiltration used included: local anaesthetic alone; local anaesthetic with saline; local anaesthetic with adrenaline; local anaesthetic with both adrenaline and saline; and finally adrenaline with saline. None used saline alone. The local anaesthetics used include lidocaine, bupivicaine and levobupivaciane.
Surgeons were asked where they injected the infiltration. Some of the surgeons stated that they placed the infiltration within a specific place in either a superficial or deep plane."Surgeon I: It's just underneath the vaginal skin. Obviously it is very difficult when you're infiltrating to judge whether you are underneath the fascia or not but I try to be superficial so that I get a layer between the fascia and the skin.""Surgeon L: That's an interesting one and we have been arguing for years as to exactly where you are but I think that I am sub-fascial."
Others were less certain of where the infiltration was placed and one surgeon described letting the infiltration, 'find the plane itself' (Surgeon AB). The surgeon's description of the depth of infiltration did not always match the investigators\' observations (Table [2](#Tab2){ref-type="table"}).Table 2Surgeons\' and investigators\' views of infiltration placementPlacement of infiltrationSurgeon\'s viewInvestigator\'s viewNone33Superficial108Deep125Uncertainty51Mixed011
Some surgeons used the presence or absence of blanching of the skin to inform whether the infiltration was in the place they wished it to be. Some took the presence of blanching to signify a superficial placement and others were unsure of what blanching signified."Surgeon Q: I\'m infiltrating it so that...the skin goes white. What layer that is, I have no idea, but essentially what I\'m trying to do, without any good evidence, is to make it go whiter.""Surgeon R: I inject local and adrenaline in the operation site underneath the fascial layer, so I don't want to see skin blanching."
Incision {#Sec6}
--------
Most surgeons used a longitudinal midline incision, performed with either a scalpel or scissors. One routinely used an elliptical incision (Surgeon Z) and one used a diathermy pen (Surgeon J).
When considering the caudal aspect of the incision, all surgeons expressed that they avoided the area overlying the urethra. The terminology to describe this landmark varied including 'bladder neck'; '2 cm', '3 cm' or '4 cm below the urethra'; 'just below the urethra'; 'urethro-vaginal sulcus'; 'where rugosity is lost' and 'at the extent of the bulge'.
When considering the cephalad extent of the incision most surgeons stated: the cervix or the vault. Other surgeons stated: 1 cm from the cervix/vault, as far as they could reach or to the extent of the prolapse. One surgeon failed to articulate an anatomical landmark and stated, 'It is related to experience' (Surgeon J).
Dissection {#Sec7}
----------
The depth of the dissection through the anterior vaginal wall varied. Some performed a superficial dissection aiming to leave the vaginal muscularis, often called fascia, on the bladder and others described a deep dissection aiming to leave the vaginal muscularis on the vaginal epithelium. Figure [1](#Fig1){ref-type="fig"} shows photographic illustrations of the different depths of dissection. Surgeon F described dissecting the vaginal muscularis from both the vaginal epithelium and the underlying bladder creating 'fascial flaps' (Fig. [1](#Fig1){ref-type="fig"}c). One surgeon described dissecting to the plane 'that seems right' but was unable to specify what this plane was.Fig. 1Photographic illustrations of the levels of dissection. **a** Superficial dissection. **b** Deep dissection. **c** Fascial flap dissection
The extent of lateral dissection was discussed with the surgeons. Some boney landmarks were described including the pubic arch (Surgeon P1), underneath the pubic rami (Surgeon P2, Surgeons E, F, O, S, AB) and behind the symphysis pubis. Others described muscular landmarks including the white line (arcus tendoneous fascia pelvis, ATFP) (Surgeon A), obturator internus (Surgeons J, Y) and pelvic side wall (Surgeon AA). A proportion of surgeons did not identify a landmark and explained the lateral extent of dissection as being something difficult to articulate or related to a surgeon\'s intuition."Surgeon M: I go as far as I think I need to go; that perhaps sounds rather vague and unacceptably vague but that's what I do."
Fascial repair methods {#Sec8} | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
Adipose tissue-derived mesenchymal stem cells (ASCs) with autologous fat improve the regenerative ability and retention of fat grafts and are increasingly being used for breast reconstruction of breast cancer patients following mastectomy \[[@B1]\]. However, increasing evidence has shown that ASCs may promote the growth and metastasis of breast cancer cells \[[@B2]--[@B5]\], and several studies have demonstrated that ASCs inhibit the growth of breast cancer \[[@B6], [@B7]\]. These contradictory observations may be due to different sources of ASCs, tumor models, and biomarkers for identifying ASCs. To enhance the safety of ASC application in breast reconstruction, it is very important to identify specific biomarkers to distinguish the breast cancer cell growth-promoting ASC subpopulation from other ASC subpopulations that do not enhance the growth and metastasis of breast cancer cells.
c-Kit is a protooncogene located at chromosome 4q12, and its encoding protein is a transmembrane receptor tyrosine kinase \[[@B8], [@B9]\]. c-Kit is expressed in many cells of the tumor microenvironment, including mesenchymal, mast, and progenitor cells. In breast cancer, the c-Kit/Kit ligand (KitL) signaling pathway promotes the proliferation, survival, and metastasis of tumor cells \[[@B10]\]. Moreover, the expression level of c-Kit is closely related to triple-negative breast cancer \[[@B11]\]. Recently, it was found that c-Kit^+^ ASCs display a higher differentiation potential in comparison to c-Kit^−^ ASCs \[[@B12], [@B13]\]. These facts suggest that c-Kit may be a potential biomarker that could distinguish the breast cancer cell growth-promoting ASC subpopulation from other ASC subpopulations.
The growth and metastasis of tumor cells is dependent on vessel formation in the tumor mass \[[@B14]\]. It has been shown that tumor cells recruit bone marrow-derived vascular endothelial progenitor cells (BM-EPCs) by increasing the expression of hypoxia-inducible factor-1*α* (HIF-1*α*) and vascular endothelial growth factor (VEGF), both of which play an important role in angiogenesis \[[@B15], [@B16]\]. The interaction of EPCs and tumor cells can enhance angiogenesis, which plays a crucial role in the growth and metastasis of tumor cells \[[@B17], [@B18]\]. ASCs have been demonstrated to promote angiogenesis by secreting growth factors within a variety of tumor types \[[@B19]--[@B22]\]. However, since the tumor microenvironment is very complex, whether ASCs differentiate into endothelial-like cells or recruit endothelial cells for vessel formation during tumor angiogenesis remains to be determined.
To explore the role and mechanism of c-Kit^+^ ASCs in breast cancer progression, in this study, we established a coculture model of ASCs and breast cancer cells. Furthermore, we analyzed the impact of c-Kit^+^ ASCs on tumor angiogenesis using breast cancer mouse models.
2. Materials and Methods {#sec2}
========================
2.1. Cell Culture {#sec2.1}
-----------------
4T1 breast cancer cells were purchased from the American Type Culture Collection (Manassas, VA, USA) and cultured in RIPM-1640 medium (Lonza, Walkersville, MD, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY, USA), 2 mM glutamine, 100 U/mL penicillin, and 100 *µ*g/mL streptomycin.
2.2. Animals {#sec2.2}
------------
Four-week-old female nude mice (Balb/c) were obtained from the SLAC Laboratory Animal Corporation (Shanghai, China) and were housed in a specific pathogen-free room. The Animal Committee of Harbin Medical University approved all the experimental protocols and animal handling procedures. All experimental procedures and postoperative animal care were conducted in accordance with the National Institute of Health\'s Guidelines for the Care and Use of Laboratory Animals.
2.3. Preparation of c-Kit^+^ ASCs {#sec2.3}
---------------------------------
Six-week-old Balb/c female mice were sacrificed by cervical dislocation, and inguinal fat tissues were dissected. After mincing the tissues into 2-3 mm pieces, they were digested with 200 U/mL collagenase II (Sigma, St. Louis, MO, USA) for 30 min, followed by centrifugation at 1200 rpm for 10 min. The pellets were sequentially filtered through 200 mesh filters and centrifuged at 12,000 rpm for 10 min. The pelleted cells were washed twice with phosphate-buffered saline (PBS) and resuspended in Dulbecco\'s modified Eagle medium (DMEM; Lonza) containing 10% FBS. The cells were grown at 37°C in a humidified atmosphere containing 5% CO~2~, and the medium was changed daily for 2-3 days. After 3 weeks of culture, c-Kit^+^/CD90^+^ cells were isolated by magnetic bead separation and further purified by fluorescence-activated cell sorting. The adipogenic differentiation potential of ASCs was routinely induced for 2 weeks using medium supplementation (1 : 1 DMEM/Hams F-12 containing 3% fetal calf serum, 100 nM insulin, 1 *μ*M dexamethasone, and 0.25 mM 3-isobutyl-1-methylxanthine) and determined using oil red O staining, following standard protocols.
2.4. Preparation of BM-EPCs {#sec2.4}
---------------------------
Bone marrow cells were isolated from the femurs of Balb/c female mice and diluted in Histopaque-1083 (Sigma) (7 : 4), immediately followed by centrifugation at 2400 rpm for 25 min at room temperature. The layer of bone marrow cells at the opaque interface was transferred to a tube containing PBS and centrifuged at 1500 rpm for 10 min at 4°C. EPCs from the mononuclear cells were isolated with CD34 and VEGFR2 magnetic bead separation (Miltenyi Biotech Inc., Auburn, CA, USA) and cultured in endothelial cell growth medium-2 (EGM-2; Lonza) at 37°C and 5% CO~2~ in a humidified incubator. Medium was changed daily for 2-3 days.
2.5. Immunofluorescence {#sec2.5}
-----------------------
The adherent cells were trypsinized and plated on EZ slides (Millipore, Billerica, MA, USA) for immunofluorescence assays. The cells were labeled with monoclonal rat anti-CD90 antibody (Abcam, Cambridge, MA, USA), followed by donkey anti-rat secondary antibody conjugated with Alexa Fluor 488 (Thermo Scientific, Waltham, MA, USA). For c-Kit staining, cells were incubated with polyclonal rabbit anti-c-Kit (Abcam) antibody, followed by incubation with goat anti-rabbit secondary antibody conjugated with Alexa Fluor 647 (Abcam). After incubation with 4′,6-diamidino-2-phenylindole (Thermo Scientific) for 1 min, the cells were observed under a fluorescence microscope (Olympus, Tokyo, Japan). The percentages of c-Kit^+^ and CD90^+^ cells during each isolation were analyzed using Image J software.
2.6. Direct Coculture of ASCs with 4T1 Cells {#sec2.6}
--------------------------------------------
c-Kit^+^ or c-Kit^−^ ASCs were cocultured with 4T1 cells at a ratio of 1 : 1. The cells were plated on gelatin-coated (1% in PBS) 24-well plates and cultured in DMEM at a density of 50,000/cm^2^. As controls, 4T1 cells or ASCs alone were cultured under the same conditions. The cells were incubated for 1--5 days at 37°C with humidified 5% CO~2~.
2.7. Indirect Coculture of ASCs with 4T1 Cells {#sec2.7}
----------------------------------------------
In a 24-well Transwell culture plate (Corning, NY, USA), 3 × 10^4^ 4T1 cells were plated in the bottom chamber and 3 × 10^4^ ASCs were plated in the upper chamber in DMEM. The chambers were incubated for 1--5 days in a 37°C incubator with humidified 5% CO~2~.
2.8. Tube Formation Assay {#sec2.8}
-------------------------
Matrigel (BD, Franklin Lakes, NJ, USA) was added to a 96-well plate, 50 *μ*L per well. After incubation at 37°C with 5% CO~2~ for 1 h, ASCs or EPCs (10^4^) in 100 *μ*L of culture medium were added. The cells were incubated for 18 h, and the area of tube formation was recorded using imaging software (Olympus, Tokyo, Japan).
2.9. Cell Viability Assay {#sec2.9}
-------------------------
Approximately 3 × 10^3^ 4T1 cells were cultured in culture supernatant from ASCs in 96-well plates. After 1--5 days, 10 *μ*L of cell counting kit-8 (CCK-8) solution was added per well, and the cells were further incubated at 37°C with 5% CO~2~ for 3 h. Then, the absorbance at 450 nm was recorded using a microplate reader.
2.10. Cell Proliferation {#sec2.10}
------------------------
DNA quantification was performed to assess cell proliferation using the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen, Carlsbad, CA, USA). After culturing for 1--5 | {
"pile_set_name": "PubMed Central"
} |
Data are owned by each centre that contributed to the ARPEC project. The ARPEC steering committee was in charge of approval of proposed analyses for abstracts and publications, delegating this to work package leads, if appropriate. The work package lead for ARPEC point prevalence surveys was Prof. Herman Goossens who together with the Project Co-ordinator Prof. Mike Sharland may be contacted at <arpec@sgul.ac.uk>.
Introduction {#sec007}
============
Antibiotics are among the most commonly used medications for hospitalized children \[[@pone.0199878.ref001]\]. On any day, 30% to 60% of children admitted to hospital around the world will receive at least one antibiotic, with many being prescribed multiple systemic antimicrobials \[[@pone.0199878.ref002],[@pone.0199878.ref003]\].
Antimicrobial stewardship interventions can improve antibiotic use in this vulnerable population and are usually implemented at a high level of aggregation, for example at hospital level \[[@pone.0199878.ref004],[@pone.0199878.ref005]\]. It is often desirable to compare the use of antibiotics, especially of last-resort agents, between hospitals or regions to identify outliers and therefore areas for intervention. However, merely comparing the overall volume of use or crude proportions for antibiotics of interest is unlikely to be useful because prescription patterns vary markedly, and this is partially due to differences in patient case-mix \[[@pone.0199878.ref006]--[@pone.0199878.ref011]\].
In many areas of infection control, regression models are used to adjust metrics for differences in patient case-mix \[[@pone.0199878.ref012]--[@pone.0199878.ref014]\]. However, these risk-adjustment models can easily become complex, may be based on specific data that are not widely available and/or comparable, and can require the adoption of extensive, costly data collection processes.
Another method is to apply a stratification system and examine exposure within groups of similar patients. An example of this method from another area of medical practice is the Robson classification, which stratifies pregnant women according to simple and widely available clinical characteristics that influence their a priori risk of having a Caesarean delivery \[[@pone.0199878.ref015]--[@pone.0199878.ref017]\].
We examined whether a risk-adjustment model could be developed from readily available variables that would facilitate the fair comparison of statistics from point prevalence surveys (PPS) on the prescribing of antibiotics to children with sepsis/bloodstream infections. We focused on three "pediatric conserve antibiotics" (pCAs) for severe Gram-negative and Gram-positive neonatal and pediatric infections. These antibiotics are part of the newly defined World Health Organization Watch group of antibiotics. This group has been identified to have a higher resistance potential, and should only be used for specific indications or in infections caused by bacteria suspected or proven to be resistant to less broad-spectrum options \[[@pone.0199878.ref018]\]. We evaluated whether available variables enabled the creation of: (i) a risk-adjustment model to fairly compare the prevalence rates across world regions, and (ii) a simple stratification system that identified patient groups who would be expected to have similar exposures due to their characteristics.
Materials and methods {#sec008}
=====================
Data collection {#sec009}
---------------
The study used data collected as part of the Antibiotic Resistance and Prescribing in European Children (ARPEC) project global PPS \[[@pone.0199878.ref003]\]. PPS are simple, standardized tools used widely internationally to collect data on antimicrobial use to facilitate monitoring within centers and countries \[[@pone.0199878.ref019]\]. Participating centers were asked to conduct a one-day cross-sectional survey of antimicrobial prescriptions for inpatients on neonatal and pediatric wards during three periods in 2011/2012 \[[@pone.0199878.ref002],[@pone.0199878.ref003]\]. During each PPS all neonatal and pediatric wards in participating institutions had to be surveyed once within the defined auditing period. All patients present in the wards at 8:00 am, and at least since midnight on the day of the survey, were recorded. For each patient treated with at least one antimicrobial, detailed data on the prescription as well as about the patient were collected according to a standardized protocol.
The ARPEC PPS were conducted in 226 participating centers located in 41 countries, which were grouped into continental regions (Africa, Asia, Australia, Europe--East, Europe--North, Europe--South, Europe-West, Latin/South America and North America) according to the UN geoscheme classification \[[@pone.0199878.ref002],[@pone.0199878.ref003]\].
The PPS methodology and data collection approaches have previously been described in detail \[[@pone.0199878.ref002],[@pone.0199878.ref003]\]. During data collection no unique identifiers, such as hospital numbers or dates of birth, were recorded. As the PPS was therefore a completely anonymized audit of antimicrobial prescribing to inpatient neonates and children, formal ethical review was not a requirement. Individual participating centres were asked to ascertain any local requirements for ethical review. By entering data, centres confirmed that they had taken the required steps according to their local and national regulatory and legal requirements.
Study population and definition of patient and treatment characteristics {#sec010}
------------------------------------------------------------------------
The study used the records of surveyed patients who were prescribed systemic antibiotics (J01) \[[@pone.0199878.ref020]\] for the most common indication of suspected or definitive sepsis/bloodstream infection \[[@pone.0199878.ref003]\], excluding febrile neutropenia and catheter-related bloodstream infection. A single key infection syndrome was selected as different factors may drive prescribing of antibiotics depending on the type of infection being treated. Relevant prescriptions were identified from the PPS information on "reason for prescription".
In terms of antibiotic use, we focused on carbapenems (J01DH), glycopeptides (J01XA) and linezolid (J01XX08). Prescribing of these antibiotics may reflect actual or feared infection caused by resistant organisms, such as extended-spectrum beta-lactamase producing Gram-negative bacteria or methicillin-resistant *Staphylococcus aureus*. The World Health Organization confirms these antibiotics, among others, as key targets for national antibiotic stewardship \[[@pone.0199878.ref018]\]. Our study is limited to the indicated groups and follows the same approach as a recent study evaluating the impact of antimicrobial stewardship on antibiotic prescribing in US children's hospital \[[@pone.0199878.ref021]\]. Exposure to pCAs was defined at the patient level, with a patient classified as exposed if one or more of the antibiotics listed above was prescribed.
At the patient level, the ARPEC dataset included information on a patient's age, whether they had any chronic conditions, and the type of ward the patient was on. Data were also collected on the type of prescription (empiric or targeted). Neither the microbiological results for individual patients nor hospital antibiograms were available. Finally, timing of prescription was available as having been issued \>48 hours after hospitalization (hospital-acquired) or ≤48 hours after hospitalization (community-acquired). Any prescription for sepsis/bloodstream infection in the first three days of life was considered neonatal early onset sepsis. Wards were classified as either a neonatal intensive care unit (NICU, all care levels), pediatric intensive care unit (PICU) or other pediatric wards. Patients with any recorded underlying disease from a predefined list including surgical malformations, chronic neurological, gastrointestinal, endocrine, lung and renal disease as well as congenital heart disease, oncologic/hematologic diseases, genetic or metabolic disorders, rheumatological or autoimmune disease and chronic infections were labeled as having underlying disease ([S1 File](#pone.0199878.s001){ref-type="supplementary-material"}). Patients receiving any targeted prescriptions for a sepsis/bloodstream infection (according to the ARPEC protocol based on pathogen identification and/or antimicrobial susceptibility testing) were defined as receiving targeted treatment, even when additional prescriptions were empiric. All other patients were labeled as receiving empiric treatment.
Statistical analysis {#sec011}
--------------------
Logistic regression was used to assess the association between pCA exposure and the individual patient and treatment characteristics. Age was dichotomized into neonates aged 3 days or younger versus infants aged 4 days or older and children (reflecting clinical differences between early-onset and late-onset sepsis among neonates).
We then developed a risk model using multivariable logistic regression.
The model was developed by sequentially adding each available patient variable, starting with the variable that had the strongest univariate association and ending with the weakest. A Wald test was used to assess the contribution of an added variable to the model and a p value of 0.05 was used as the threshold for inclusion. Following this, interactions between included variables were explored. The performance of the model was assessed in terms of its calibration and discrimination. Calibration describes the level of agreement between the predicted and observed risks, and was evaluated using the Hosmer-Lemeshow test. Discrimination indicates the ability of a model to distinguish patients with a lower and higher risk of pCA prescription. We evaluated this by using the c-statistic (equivalent to the Area under the ROC curve).
The regression model was used to calculate risk-adjusted regional pCA exposure rates. These were derived using indirect standardization, which involved multiplying the ratio of observed/expected exposure rates by the mean exposure rate in the whole cohort \[[@pone.0199878.ref009]\]. Approximate 95% confidence intervals were derived for proportions and indirectly standardized rates using the Wilson Score and Byar's Method, respectively.
As a sensitivity analysis, we repeated the above process using a multilevel logistic model, | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S0001}
============
Conjunctivitis is a collective term for a diverse group of diseases that are characterized by inflammation of the conjunctiva.[@CIT0001] The most common cause of infectious conjunctivitis is viral infection (\~80% of cases), followed by bacterial.[@CIT0001],[@CIT0002] The noninfectious forms are allergic, mechanical/irritative/toxic, immune-mediated, and neoplastic.[@CIT0001] Of noninfectious conjunctivitis, the allergic form is the most common, affecting approximately 40% of the US population.[@CIT0002] Conjunctivitis can also be classified as acute, chronic, or recurrent,[@CIT0001],[@CIT0002] according to the mode of onset and severity of the clinical response.[@CIT0002] Most cases of viral and bacterial conjunctivitis are considered acute and, less frequently, as hyperacute. The mechanical/irritative/toxic, immune-mediated, and neoplastic forms are typically associated with chronic inflammation,[@CIT0001] and the toxic form can have an acute onset. Allergic conjunctivitis can be chronic, with possible onset in childhood, and present with acute exacerbations related to seasonal factors or contact lens use, for example.[@CIT0001]
Conjunctivitis is a highly common presentation in the primary care setting. It is responsible for \~2% of all medical consultations in the United States[@CIT0003] and countless self-referrals to community pharmacies.[@CIT0004] It is difficult to accurately capture the true epidemiology of conjunctivitis because of the high numbers of patients who may self-medicate or delay or decline to seek medical care, and because of inaccurate diagnosis in the primary medical care setting. Approximately 70% of all patients with acute red eye present to primary care and urgent care,[@CIT0005] posing a large economic and social burden.[@CIT0006]--[@CIT0008] The pharmacoeconomic impact of infectious conjunctivitis is noteworthy and includes the cost of repeat diagnoses, referrals, insurance copays, patient medications, and lost productivity associated with absence from work or school. In the United States, acute conjunctivitis affects an estimated 6 million people per year,[@CIT0002] and bacterial conjunctivitis treatment alone costs the United States \$377--857 million annually. To the best of our knowledge, no health-related quality-of-life studies of patients with acute infectious conjunctivitis have been published.
The purpose of this narrative review is to provide practical guidance on the differentiation of acute infectious conjunctivitis in the primary care setting and to highlight disconnects between diagnosis and treatment.
Challenges of Acute Infectious Conjunctivitis Management and Diagnosis {#S0001-S2001}
----------------------------------------------------------------------
Eye care professionals tend to evaluate acute infectious conjunctivitis cases at secondary care visits. Patients with infectious conjunctivitis are suboptimally managed in primary care due to an underappreciation of the prevalence of viral conjunctivitis, as well as frequent antibiotic prescriptions (\~80%) for infectious conjunctivitis,[@CIT0009] despite guidelines that discourage antibiotic use for minor self-limiting illnesses.[@CIT0010] Antibiotic prescription is a measure of presumed diagnosis of bacterial conjunctivitis, but the rate of clinical accuracy in diagnosing viral conjunctivitis may be \<50%.[@CIT0009],[@CIT0011] Observational evidence indicates that laboratory confirmation isolates bacterial pathogens in just 30--50% of suspected cases.[@CIT0009],[@CIT0011]
Misdiagnoses expose patients to unnecessary and ineffective antibiotic treatment. In the Antibiotic Resistance Monitoring in Ocular Microorganisms (ARMOR) surveillance study of 3237 ocular isolates collected from patients with bacterial eye infections (from 72 US centers from 2009 to 2013), nearly one-half had methicillin-resistant staphylococci.[@CIT0012] Although the contribution of topical antibiotics to antibiotic resistance is not easily confirmed,[@CIT0011] current resistance trends should be considered before treating common eye infections with antibiotics.[@CIT0013] Furthermore, prescribing antibiotics in cases of unconfirmed bacterial infection is not compliant with Antibiotic Stewardship initiatives, which are part of primary care and pediatric practice protocols.[@CIT0014] In addition to the risk of antibiotic resistance, misdiagnosis can result in recurrent cases of infectious conjunctivitis, particularly among pediatric patients, or in cases that progress to serious ocular and extra-ocular complications.
There are several challenges to accurately diagnosing acute infectious conjunctivitis. First, clinical ambiguity exists between the acute viral and bacterial as well as the allergic forms, which can confound diagnosis.[@CIT0011] Discrimination between viral or bacterial origins of infectious conjunctivitis based on historical, nonspecific, clinical signs and symptoms, such as type of discharge, is difficult and not supported by evidence-based diagnostic criteria.[@CIT0011],[@CIT0015] Routine bacteriologic examinations are neither typically performed nor practical in the management of clinically suspected acute bacterial conjunctivitis,[@CIT0015] except in neonates.[@CIT0001] Culturing should also be considered for immunocompromised patients or for patients with hyperacute cases of infectious conjunctivitis. The misdiagnosis of infectious conjunctivitis is compounded by the view that all cases should be treated with topical ophthalmic antibiotics, even though most are self-limiting.[@CIT0016],[@CIT0017] Social factors, such as school policies or pressure to reduce absence from work, may also influence general practitioners to prescribe topical antibiotics.[@CIT0011] Lastly, the level at which patients enter the health care system can impact the accuracy of the diagnosis.
Guidelines and criteria for diagnosing and treating acute infectious conjunctivitis based on natural history and etiology are available.[@CIT0001] However, greater awareness of and adherence to differential diagnosis should be kept in mind to improve outcomes in patients presenting with suspected acute infectious conjunctivitis.[@CIT0017]
Epidemiology and Clinical Presentation {#S0001-S2002}
--------------------------------------
Discriminating features of viral, bacterial, and allergic acute conjunctivitis are summarized in [Table 1](#T0001){ref-type="table"}.[@CIT0001],[@CIT0002],[@CIT0018]Table 1Discriminating Clinical Features of Suspected Acute ConjunctivitisTypeConjunctivalItchingDischargeLymphadenopathyAssociated Fever and Sore ThroatViralFollicularMinimalWateryCommon (\~50%)Common Adenoviral HSV VZVBacterialPapillaryMinimalPurulentUncommonOccasionally NongonococcalMucopurulent GonococcalHyperpurulentChlamydialFollicularMinimalMucopurulentCommonNoAllergicPapillary with chemosisSevereWateryNoneNoMucoid[^1][^2]
### Viral Conjunctivitis {#S0001-S2002-S3001}
Adenoviruses are the cause of most (65--90%) cases of viral conjunctivitis, while the herpes simplex virus (HSV) is the cause of 1.3--4.8% of all cases of acute conjunctivitis.[@CIT0002] Other viruses that are associated with conjunctivitis include varicella (herpes) zoster virus (VZV) and *Molluscum contagiosum*.[@CIT0001]
Adenoviruses are nonenveloped viruses that are relatively resistant to disinfection.[@CIT0019] Adenoviral conjunctivitis is highly contagious, due in part to the capacity of the virus to survive in a desiccated state at room temperature for several weeks.[@CIT0020] Transmission risk is 10--50%, and the infection may spread via personal contact or indirectly through shared items.[@CIT0002] Adenoviral conjunctivitis is self-limiting, with improvement of signs and symptoms within 5--14 days.[@CIT0001] Often, the condition presents as unilateral in early phases and eventually spreads to both eyes.
Adenovirus serotypes are associated with different types of ocular infection,[@CIT0021] including pharyngoconjunctival fever and epidemic keratoconjunctivitis (EKC; patient photos shown in [Figure 1](#F0001){ref-type="fig"}). Pharyngoconjunctivitis typically manifests bilaterally with fever and enlargement of the periauricular lymph nodes.[@CIT0002] EKC is more severe because of the adverse effect it can have on visual acuity; it is characterized by watery discharge, swelling, and redness, and involvement of lymph nodes on both sides of the neck.[@CIT0002],[@CIT0021] EKC is highly contagious, and asymptomatic patients who have contracted the disease may unknowingly spread the virus.[@CIT0021]Figure 1Case photographs of adenoviral conjunctivitis. (**A**) gross examination of acute adenoviral conjunctivitis; (**B**) bilateral AdenoPlus-positive EKC; (**C**) high magnification of the conjunctiva of positive EKC. Photos provided by Scott Hauswirth and Elizabeth Yeu. The patients have given permission for publication of these photos.**Abbreviation:** EKC, epidemic keratoconjunctivitis.
A complication of EKC is the formation of pseudomembranes on the palpebral conjunctiva in the early and later stages of the condition.[@CIT0021],[@CIT0022] Manual removal of these membranes causes minor bleeding but no damage to the underlying epithelium, and may prevent symblepharon formation in cases with severe inflammation.[@CIT0022] Multifocal subepithelial infiltrates may develop in the cornea within 7--10 days after the onset of clinical signs of infection.[@CIT0023] These can persist for weeks or even years in some cases.[@CIT0022] If left untreated, subepithelial infiltrates can cause scarring in the cornea, leading to irregular astigmatism and loss of visual acuity.[@CIT0024] Topical corticosteroids or steroid-sparing agents such as cyclosporine eye drops can be used to reduce the risk of scar | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION
============
Nowadays, the internet is an essential part of everyday life, as it enables the fluidity necessary for the circulation of information and global communication.[@B1] ^,^ [@B2] Although there are benefits to this, a new pathology called internet addiction has occurred.[@B1] ^,^ [@B3] ^,^ [@B4] As such, a fine line separates essential access to work, the teaching-learning process, social communication, and information searching with the compulsive and pathological use of the internet. Therefore, internet dependency is a new and growing problem in public health, requiring greater understanding by the scientific community in order to propose community interventions.
Several factors are associated with internet addiction, such as sociodemographic aspects related to internet use and psychosocial habits[@B5] ^,^ [@B6] ^,^ [@B7]. Some studies have reported that types of leisure activities done in one's free time, in addition to the multiple activities performed online, are predisposing factors for internet dependence.[@B8] ^,^ [@B9] Specifically, systematic reviews have indicated several adverse effects of internet addiction on mental health, such as attention deficit hyperactivity disorder, depression, hostility and low self-esteem.[@B1] ^,^ [@B5] ^,^ [@B6] ^.^ [@B7]
Data from the Brazilian National Household Sample Survey indicate that, in Brazil, 49.4% of people are connected to the internet, and this is mostly concentrated in the 15-17-year-old age group.[@B10] Thus, the aim of this study was to investigate the prevalence of internet addiction and associated factors in high school students in the municipality of Rio Branco, in the Brazilian state of Acre.
METHOD
======
This is a population-based, cross-sectional study with high school students in the municipality of Rio Branco, conducted in the months of May and June 2015. The study population consisted of 20,476 students enrolled in 37 high schools in the urban area of Rio Branco. To determine sample size, an expected prevalence for internet dependency of 12% was considered, as observed in high school students in China.[@B8] Precision was set for a sampling error of 0.03 and a level of confidence of 95% was set. With these criteria, the study required a sample of 1,182 students. To protect the investigation from the effects of non-response, 18% was added to the sample size, taking into account operational restrictions, such as the number of researchers and the time available for data collection. The final sample size was estimated at 1,391 students.
The selection of students took place in three stages. First, five schools were selected by simple random sampling. Three schools were public and two were private. This number of schools was based on operational restrictions for data collection. In the second stage, classrooms from each school were chosen by allocation proportional to size, and students were chosen by classroom in the third stage. As inclusion criteria, students aged between 14 and 18 years and 11 months, who were regularly enrolled in a high school institution in the city of Rio Branco were considered. The exclusion criteria were pathologies that would make it impossible for students to participate in data collection without assistance, given the importance of privacy in answering the questions. The study was approved by the Research Ethics Committee of the Universidade Federal do Acre under protocol number 39594914.8.0000.5010. Before beginning data collection, the parents and adolescents signed a free and informed consent form.
A structured and self-answered questionnaire was applied to students with questions regarding demographic (gender and age), social and family (marital status, being an only child, number of true friends and number of teenagers at home), leisure activities (physical activity; going to the movies and theater, going out to dance at nightclubs and shows; and reading newspapers, magazines or books), parental control and computer usage time.
To obtain information on physical activity, the self-administered physical activity checklist was applied, and then validated by Farias Junior et al.[@B11] Using this instrument, the types of physical activity and the number of minutes engaging in physical activity per week were verified. This variable was categorized into: equal to or greater than 300 minutes, between 150 and 299 minutes, from 1 and 149 minutes, and does not practice physical activity.
According to the protocol suggested by Petroski,[@B12] body weight was measured using a digital portable scale with a maximum capacity of 150 kg and a sensitivity of 50 g, while height was measured using a portable stadiometer with a maximum extension of 2 subdivided into 0.1 cm. The variable body mass index (BMI) was used as recommended by the World Health Organization,[@B13] with excess weight (sum of overweight and obese individuals) determined using BMI values for age equal to or greater than 1 Z score.
The test for internet addiction was verified by the internet addiction test (IAT),[@B14] which was validated and adapted into the Portuguese language.[@B2] ^,^ [@B15] The test consists of 20 questions on a Likert scale ranging from 1 (rarely) to 5 (always), for the individuals to fill out themselves. Individuals with a score equal to or greater than 70 points were considered to be internet dependent.
Statistical analysis of the data was performed using the Stata program, version 10 (Stata Corp. College Station, TX, United States). The associated factors were identified in two stages. First, the independent variables that showed associations with internet dependence with p≤0.20 by the Wald test in simple logistic regression were selected to compose the final multiple model. Subsequently, using multiple logistic regression, using the step-by-step procedure with retrograde elimination, variables with p≤0.05 were selected to compose the final multiple model. The variables with a -value between 0.05 and 0.10 remained in the model as adjustment variables.
RESULTS
=======
Of the 1,391 adolescents contacted, there were four losses due to refusal to participate in the study. Thus, 1,387 adolescents were considered in the analysis, of which 76.8% were from public schools and 23.2% were from private schools. Of these, 53.1% were female, 44.5% were between 14 and 15 years old, and 55.5% were between 16 and 18 years old.
The overall prevalence of internet addiction was 10.6%. Male students showed a lower prevalence (6.9%) of internet dependence in contrast to female students (13.9%). However, no statistical difference was identified between the ages for internet dependence.
The variables sex, true friends, use of a computer in the bedroom, times using a computer in the middle of the week and on the weekend, going to the movies or theater, going out to dance in nightclubs or *shows*, reading the newspaper, magazines or books, and practicing physical activity were candidates for the final multiple model ([Tables 1](#t1){ref-type="table"} and [2](#t2){ref-type="table"}).
Table 1Prevalence (%) and Odds Ratio of internet dependence according to demographic, social and family variables and body mass index in high school adolescents, Rio Branco, Acre, Brazil.n\*%ORp-valueSexMale6506.91Female73713.92.18\<0.001Age14-15 years61611.2116-18 years77110.20.900.567Only childNo1,19910.51Yes16911.21.070.772True friends6 or more friends4118.511 to 5 friends78111.91.450.073No Friends7712.91.600.217Another teenager at homeYes84410.01No51511.41.150.421BMIEutrophic1,04610.51Overweight30411.51.100.621[^2][^3]
Table 2Prevalence (%) and Odds Ratio of internet dependence according to variables of leisure activities, parental control and time spent using computers in high school adolescents, Rio Branco, Acre, Brazil.n\*%ORp-valueUsing a computer in their roomNo1,0419.11Yes33115.71.850.001Parental control over computer useYes5229.91No85211.01.120.532Computer time during the weekUp to two hours a day1,3299.81More than two hours a day5829.33.79\<0.001Computer time during the weekendUp to two hours a day1,0778.41More than two hours a day31018.32.44\<0.001Going to the movies or theaterRarely or never54911.11Monthly6198.50.740.144Weekly20615.01.410.142Going out to dance at nightclubs or showsRarely or never9748.21Monthly24712.91.660.022Weekly13822.43.23\<0.001Reading newspapers, magazines or booksRarely or never41912.61Monthly31411.40.890.627Weekly6418.70.660.041Physical activity\> 300 minutes5917.91150 to 299 minutes1888.51.070.8071 to 149 minutes19710.61.380.243Does not practice physical activity32317.02.37\<0.001[^4][^5]
In the analysis of factors associated with internet dependence ([Table 3](#t3){ref-type="table"}), girls were 1.84 times more likely to be dependent on the internet than boys. Adolescents who spent more than two hours on the computer on weekdays and on the weekend showed associations | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1-ijerph-14-00012}
===============
Worldwide, *Legionella* is an opportunistic pathogen of public health concern \[[@B1-ijerph-14-00012],[@B2-ijerph-14-00012]\]. It is the causative agent of Legionellosis which includes Legionnaires' disease, an atypical pneumonia, and Pontiac fever, an acute febrile illness \[[@B3-ijerph-14-00012],[@B4-ijerph-14-00012]\]. As such, it is responsible for both nosocomial and community-acquired infections \[[@B5-ijerph-14-00012]\]. One of the primary sources of Legionellosis has been identified as potable water systems \[[@B6-ijerph-14-00012],[@B7-ijerph-14-00012],[@B8-ijerph-14-00012]\]. In the U.S. from 2009--2010, 58% of all drinking water-related outbreaks were caused by *Legionella* \[[@B9-ijerph-14-00012]\].
Across Europe, in 2010, there were 6305 notified cases of Legionnaires' disease reported to the European Legionnaires' Disease Surveillance Network (ELDSNet) \[[@B1-ijerph-14-00012]\]. In the U.S. there has been a significant increase in the incidence of Legionellosis from 0.39 cases per 100,000 in 2000 to 1.36 per 100,000 in 2011 (which equates to a total of 4202 cases) \[[@B10-ijerph-14-00012]\], although estimates state that that this could actually be as high as 50,000 cases, with many going undiagnosed \[[@B8-ijerph-14-00012]\]. It has also been reported that the annual health care cost of *Legionella* infection in the U.S. is over \$430 million \[[@B11-ijerph-14-00012]\].
Opportunistic pathogens are likely to become increasingly significant to public health as a consequence of the global aging population \[[@B12-ijerph-14-00012]\]. It is estimated that in the next five years, there will be more people over the age of 65 than there will be under the age of five \[[@B13-ijerph-14-00012]\]. This will mean that a greater percentage of the population will be considered high risk \[[@B14-ijerph-14-00012]\]. Consequently, opportunistic pathogens linked to potable water distribution systems have been identified as an emerging waterborne disease problem of public health significance \[[@B15-ijerph-14-00012]\]. This identifies the need to discuss and evaluate the guidelines for the control of *Legionella* in water distribution systems \[[@B8-ijerph-14-00012]\].
Historically, an issue that has been subject to some debate is the role of routine testing of water systems for the monitoring of *Legionella* \[[@B14-ijerph-14-00012]\]. The lack of correlation between test results and human health risk has been previously acknowledged \[[@B7-ijerph-14-00012],[@B16-ijerph-14-00012]\]. Additionally, it has been identified that there is the potential for overreliance on test results at the detriment of risk management strategies \[[@B14-ijerph-14-00012]\]. This commentary will explore current literature to present the argument that routine testing of water systems for *Legionella* should be removed from all guidelines. Instead, the presence of the pathogen should be assumed and appropriate control strategies should be identified and managed accordingly.
2. The Presence of *Legionella* in Potable Water Sources {#sec2-ijerph-14-00012}
========================================================
There have been numerous studies which have linked potable water to outbreaks of Legionellosis \[[@B6-ijerph-14-00012],[@B14-ijerph-14-00012],[@B17-ijerph-14-00012],[@B18-ijerph-14-00012],[@B19-ijerph-14-00012],[@B20-ijerph-14-00012],[@B21-ijerph-14-00012],[@B22-ijerph-14-00012],[@B23-ijerph-14-00012]\]. However, there have also been numerous studies which have detected the pathogen from potable water not associated with a specific outbreak; this includes studies from the U.S. \[[@B24-ijerph-14-00012],[@B25-ijerph-14-00012]\], The Netherlands \[[@B26-ijerph-14-00012],[@B27-ijerph-14-00012],[@B28-ijerph-14-00012]\], Germany \[[@B29-ijerph-14-00012],[@B30-ijerph-14-00012]\], Sweden \[[@B31-ijerph-14-00012]\], Israel \[[@B32-ijerph-14-00012]\], Australia \[[@B33-ijerph-14-00012]\], Latvia \[[@B34-ijerph-14-00012]\], Italy \[[@B35-ijerph-14-00012]\], Spain \[[@B36-ijerph-14-00012]\], UK \[[@B37-ijerph-14-00012]\], Croatia \[[@B38-ijerph-14-00012]\], France \[[@B39-ijerph-14-00012]\], Iran \[[@B40-ijerph-14-00012]\] and China \[[@B41-ijerph-14-00012]\]. A recent study by Donohue \[[@B42-ijerph-14-00012]\] collected 272 water samples from public and private cold water taps across the U.S. and found that 47% were positive for *L. pneumophila* Sg1 using qPCR. Another study in Australia used qPCR to consistently detect *Legionella* from two different potable water distribution pipelines sampled four times over the year \[[@B33-ijerph-14-00012]\]. The evidence presented in these studies suggests that *Legionella* is ubiquitous in potable water distribution systems \[[@B28-ijerph-14-00012],[@B43-ijerph-14-00012]\].
3. Interpreting *Legionella* Test Results {#sec3-ijerph-14-00012}
=========================================
Currently, there are numerous *Legionella* qMRA models but there is no consensus with regards to the concentration that will cause Legionellosis \[[@B44-ijerph-14-00012],[@B45-ijerph-14-00012],[@B46-ijerph-14-00012],[@B47-ijerph-14-00012],[@B48-ijerph-14-00012]\]. Infectious doses are based on animal models or back-calculated from exposure estimates during outbreaks \[[@B44-ijerph-14-00012],[@B49-ijerph-14-00012],[@B50-ijerph-14-00012],[@B51-ijerph-14-00012]\]. Attempts to calculate infectious doses are further complicated by variations in *Legionella* virulence based on strain type, life cycle and environmental conditions \[[@B52-ijerph-14-00012],[@B53-ijerph-14-00012],[@B54-ijerph-14-00012],[@B55-ijerph-14-00012]\], as well as the disparity of illness as a consequence of exposure to *Legionella* \[[@B45-ijerph-14-00012]\]. This includes the differences between infectious mechanisms and outcomes of Legionnaires' disease compared to Pontiac fever \[[@B14-ijerph-14-00012],[@B56-ijerph-14-00012],[@B57-ijerph-14-00012]\]. Also, there is potential for exposure to *Legionella* to cause no illness but instead an asymptomatic increase in *Legionella* antibodies \[[@B58-ijerph-14-00012]\].
4. Limitations with the Standard Method for *Legionella* Detection {#sec4-ijerph-14-00012}
==================================================================
The International Standard ISO 11731 describes the standard culture method for the isolation and enumeration of Legionella from environmental samples \[[@B59-ijerph-14-00012],[@B60-ijerph-14-00012]\]. However, this standard culture method is time-consuming and fraught with limitations \[[@B61-ijerph-14-00012],[@B62-ijerph-14-00012],[@B63-ijerph-14-00012],[@B64-ijerph-14-00012]\]. The main limitation is that the culture cannot detect viable but non-culturable (VBNC) *Legionella* which has been shown to be induced by numerous factors commonly found in potable water systems \[[@B45-ijerph-14-00012],[@B56-ijerph-14-00012]\]. This includes the presence of disinfection chemicals, low nutrients, high temperatures and low oxygen \[[@B65-ijerph-14-00012],[@B66-ijerph-14-00012],[@B67-ijerph-14-00012],[@B68-ijerph-14-00012]\]. Additionally, a study by Borges et al. \[[@B63-ijerph-14-00012]\] utilized the standard detection method and identified the occurrence of false positives as a consequence of the misidentification of *Chitinophagaceae*. However, despite the occurrence of false positives, Borges et al. \[[@B63-ijerph-14-00012]\] concluded that, overall, the culture method underestimated *Legionella* populations. This is supported by a desktop study that collated all published data testing environmental samples for *Legionella* concurrently using culture and qPCR and found that 72% of samples were positive using PCR compared to 34% using culture \[[@B62-ijerph-14-00012]\], although it is important to note that qPCR overestimates as it detects both live and killed *Legionella* and the actual | {
"pile_set_name": "PubMed Central"
} |
Correction to: Protein Cell 10.1007/s13238-019-00668-8 {#Sec1}
======================================================
In the original publication the bands in Fig. 1J and Fig. 2B were not visible. The correct versions of Fig. [1](#Fig1){ref-type="fig"}J and Fig. [2](#Fig2){ref-type="fig"}B are provided in this correction.Figure 1EGFR activation promotes TLR4 phosphorylation and cell surface expression of TLR4 in response to LPS. (A and B) BMDM were treated with LPS (1 μg/mL) for 6, 12, or 24 h in the presence or absence of pretreatment of PD or TAPI-1. (A) Flow cytometry analysis of cell surface TLR4 intensity in BMDM. (B) Flow cytometry analysis of cell surface TLR4 intensity in BMDM. (C and D) WT (C57BL/6) mice were treated with LPS (10 mg/kg, i.p.). In some groups, mice were pretreated with erlotinib (100 mg/kg, gavage administration) at 30 min prior to LPS i.p. Peritoneal lavage fluids were collected at 24 h after LPS treatment and peritoneal macrophages were identified with F4/80. TLR4 intensity on the surface of peritoneal macrophage was analyzed by flow cytometry. (E and F) BMDM isolated from WT and *EGFR*^−/−^ mice were treated with LPS (1 μg/mL) *in vitro* for 1 h followed by flow cytometry analysis of cell surface TLR4 intensity. (G and H) WT (C57BL/6) and *EGFR*^−/−^ mice were treated with LPS (10 mg/kg, i.p.) for 24 h. Peritoneal lavage fluids were collected, and peritoneal macrophages were identified with F4/80. TLR4 intensity on the surface of peritoneal macrophage was analyzed by flow cytometry. (I) Western blot analysis of phosphor-TLR4 in BMDM treated with LPS (1 μg/mL) for 30 min with or without PD168393 (PD, 10 μmol/L) pretreatment for 30 min. (J) Western blot analysis of phosphor-TLR4 in *EGFR*^−/−^ BMDM treated with LPS (1 μg/mL) for 30 min. (K--N) HEK293 cells were transfected with *TLR4*, *MD2*, *CD14*, *EGFR*, or *TLR4* mutant for 48 h, with treatment of LPS (1 μg/mL) for 30 min or 24 h. (K) Diagram of the TLR4 phosphorylation site mutated plasmid. (L) Western blot analysis of the phosphor-TLR4 and phosphor-EGFR in transfected HEK293 treated with LPS for 30 min. (M and N) Flow cytometry analysis of cell surface TLR4 intensity in transfected HEK293 treated with LPS for 24 h. (O and P) BMDM were treated with LPS (1 μg/mL) for 30 min with or without PD168393 (PD) pretreatment for 30 min. (O) Immune-staining of TLR4 and EGFR in BMDM. (P) Co-immunoprecipitation of TLR4 with EGFR in BMDM. (Q) Immune-staining of TLR4 and GM130 in BMDM treated with LPS (1 μg/mL) for 24 h with or without PD168393 pretreatment for 30 min. (R) Immune-staining of TLR4 and GM130 in *EGFR*^−/−^ BMDM treated with LPS (1 μg/mL) for 24 h. All images and flow cytometric plots are the representatives from at least 4 experiments. The graphs depict mean ± SD of four to six experiments or mice. \**P* \< 0.05 as compared with control group; †*P* \< 0.05 as compared with the time-matched LPS alone groupFigure 2Rab5a-mediated concurrent internalization of TLR4 and EGFR results increased cell surface expression of the receptors. (A and B) BMDM were treated with LPS for 6, 12, or 24 h in the presence or absence of pretreatment of PD168393 (PD) for 30 min. (A) Real time PCR analysis of Rab5a expression. (B) Western blot analysis of Rab5a expression. (C and D) BMDM transfected with si-NC and si-Rab5a for 48 h were treated with LPS (1 μg/mL) for 24 h. Flow cytometry analysis of cell surface TLR4. (E--H) BMDM were treated with LPS (1 µg/mL) for 1 h or 24 h, with or without clathrin inhibitor chlorpromazine (CPZ 12.5 μmol/L) or PD168393 (PD 10 μmol/L) pretreatment for 30 min. Flow cytometry analysis of cell surface TLR4 at 24 h or after LPS. (I and J) BMDM cells transfected with si-NC or si-Rab5a for 48 h followed by LPS treatment (1 μg/mL) for 1 h. Flow cytometry analysis of cell surface TLR4. (K and L) WT and *Rab5a*^−/−^ BMDM were treated with LPS (1 μg/mL) for 1 h or 24 h. Flow cytometry analysis of cell surface TLR4 at 1 h or 24 h after LPS. (M--O) BMDM were treated with LPS (1 μg/mL) for 1 h with or without PD168393 (PD) pretreatment for 30 min. (M) Immune-staining of TLR4 and EEA1 in BMDM. (N) Immune-staining of TLR4 with Rab5a. (O) Co-immunoprecipitation between TLR4 and Rab5a in BMDM. All flow cytometric plots are the representative from at least 4 experiments. The graphs depict mean ± SD of four to six experiments or mice. \**P* \< 0.05 as compared with control group; †*P* \< 0.05 as compared with the time-matched LPS alone group
| {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Atypical antipsychotics (AAPs) are an effective treatment for many types of mental illnesses. According to treatment guidelines, antipsychotics are recommended for schizophrenia treatment \[[@CR1]--[@CR3]\], for the treatment of bipolar disorders \[[@CR4], [@CR5]\], and in some cases, as adjunct therapy for major depressive disorder (MDD) \[[@CR6], [@CR7]\]. Although effective, AAPs are often associated with treatment-emergent adverse events (TEAEs), which can be highly burdensome and can affect quality of life and medication adherence \[[@CR8]--[@CR10]\]. Accordingly, treatment guidelines recommend that physicians modify treatment regimens based on patients' response and ability to tolerate side effects \[[@CR1]--[@CR7]\]. This report focused on schizophrenia and MDD as two groups that could be anticipated to experience the effects of the medication very differently, as it was important to study the scope of how patients experience TEAEs. In recent decades, AAPs have been introduced for the treatment of schizophrenia and MDD, with both improved treatment efficacy and reduced neurological side effect burden compared with older, first generation antipsychotics \[[@CR11], [@CR12]\]. Schizophrenia affected an estimated 1.1% of adults (2.6 million) in the United States in 2013, and onset in early adulthood is common, often leading to chronic lifelong disability \[[@CR13], [@CR14]\]. MDD is even more prevalent in the United States, with an estimated 6.7% (15.7 million) adults having experienced an MDD episode in 2013, and more than 10 million who received treatment for depression \[[@CR15]\]. However, despite the improved efficacy and tolerability profiles of AAPs, the risk of TEAEs still associated with these agents often includes weight gain and metabolic syndrome, extrapyramidal symptoms (EPS), sexual dysfunction, and sedation and somnolence, depending on the specific agent \[[@CR9], [@CR16], [@CR17]\]. A multiple treatment meta-analysis of schizophrenia trials has shown that although antipsychotics had small but robust differences in efficacy, they differed substantially in side effects \[[@CR12]\].
Perspectives on the importance of TEAEs differ across patients and between patients and physicians. That is, how patients are affected by TEAEs is specific to each individual and may also be seen differently by physicians. These differences in perspectives and preferences must be taken into account within the therapeutic alliance, as they may impact treatment decisions when considering the overall benefit-risk profile. In fact, increasing importance is being placed on bringing the patients' perspectives to the evaluation of the overall benefit-risk profile for treatment \[[@CR18]\]. In a study reviewing adverse events of antipsychotics as outcome measures, it was concluded that a patient's subjective experience of medication should be given more consideration \[[@CR19]\]. Although TEAEs are an important consideration for treatment, they are hard to quantify. The patient's perspective may assist in this and has been used in other disease fields. For example, in rheumatology, a tolerability index that has been used in clinical trials incorporates a patient-based method of assessing TEAEs \[[@CR20]\]. In cancer clinical trials, a recommended core set of patient-reported symptoms for measuring side effects has been established to promote consistent assessment of treatment-related symptoms \[[@CR21]\]. There are a number of neuroleptic side-effect assessment scales available \[[@CR22], [@CR23]\], and among the most complete are the 48-item Udvalg for Kliniske Undersogelser (UKU) rating scale \[[@CR24]\] and the Liverpool University Neuroleptic Side-Effect Rating Scale (LUNSERS) \[[@CR25]\]. However, these scales do not fully account for the patient's subjective experience or preference. Although considered important, the differences in patient and physician perspective in schizophrenia and MDD appear to be lacking in the literature.
The current study investigates TEAEs of AAPs from both patient and physician perspectives. The goal of the study was to provide better understanding of the occurrence and burden of TEAEs associated with AAP medications, as reported by patients and physicians. The initial feedback gained in this study will be used for a future project to generate an algorithm for a tolerability index score that will quantify the burden of AAP TEAEs and fully accommodate patient preference through a discrete choice experiment. The development of this index measure to assess the burden of TEAEs could help facilitate the prescribing of AAP medications to individuals with MDD and schizophrenia. A first step to establishing this potential tolerability index algorithm would be to evaluate which TEAEs are most bothersome to patients. Although the long-term goal is to allow the approach towards assessing TEAEs to be transnational, the patient selection was based in the US, partly due to the push by the FDA to include patients' perspectives in the overall benefit-risk profile for treatment \[[@CR18]\].
Methods {#Sec2}
=======
Study design {#Sec3}
------------
To gain insight into the occurrence and burden of TEAEs associated with AAPs, focus groups with patients with MDD and interviews with patients with schizophrenia were conducted at two qualitative research facilities: one in Raleigh, North Carolina, USA, and one in St. Louis, Missouri, USA. Although focus groups are more efficient in terms of the time required for data collection and appropriate for data collection in the MDD patient population, previous studies have demonstrated that individual interviews are more successful in obtaining adequate feedback from individuals with schizophrenia, as these patients are generally more comfortable discussing their symptoms and experiences on an individual basis \[[@CR26]\]. A physician focus group was also conducted with psychiatrists at the North Carolina location to obtain their perspectives on the occurrence and importance of TEAEs in these patient populations. This study fully adhered to COREQ guidelines and methodology. Medical recruiters at each facility screened all participants following a study review by an institutional review board (RTI IRB Approval 2/18/15; \# 13733); informed, written consent was obtained prior to initiation of the study. Patients and physicians were provided an honorarium in appreciation for their time.
Physician and patient recruitment {#Sec4}
---------------------------------
Patients were selected from the individual site databases of general community residents who had previously agreed to be contacted for potential research opportunities. Patients were identified and screened, based on their own reports, to meet the inclusion criteria of being an English-speaking adult with a clinician-administered diagnosis of MDD or schizophrenia, taking one or more AAPs within the past year, and reporting one or more TEAEs associated with an AAP. The AAPs included were: aripiprazole, asenapine, clozapine, iloperidone, lurasidone, olanzapine, paliperidone, quetiapine, risperidone, or ziprasidone. Physicians interested in participating in the study were identified from the North Carolina site database. Each physician was selected by meeting the criteria of being a practicing psychiatrist providing direct care of adult patients with MDD and/or schizophrenia and regular treatment of these patients with AAP medication (e.g., 10% or more of patients with MDD requiring adjunctive therapy).
Procedures {#Sec5}
----------
In this study, a TEAE was defined as "any untoward or undesirable medical occurrence in a patient that was linked in time with the use of a pharmaceutical/medicinal product and that may or may not be considered to be related to that product." Adverse drug events were not actively solicited, ascertained, or evaluated in the study; however, because this project was conducted by Lundbeck, if a potential TEAE associated with a Lundbeck product became evident through the conduct of this qualitative research, a TEAE report was submitted to Lundbeck US Pharmacovigilance.
Semi-structured interview guides were utilized to provide structure to the MDD focus groups (lasting approximately 1.5 h each), the schizophrenia individual interviews (lasting 45 min each), and the psychiatrist focus group (lasting approximately 1.5 h). All focus groups and interviews were conducted by two PhD-level psychologists. General discussion was followed by targeted questions along with handouts for each participant to provide individualized feedback. The following information was obtained at the group or individual patient level: 1) exhaustive lists of TEAEs experienced, 2) frequency of each TEAE, and 3) bother ranking for the most bothersome TEAEs ("1" for most bothersome TEAE, "2" for the next most bothersome, and so on; up to a number that seemed meaningful to the patient). At the physician level, collected information included: 1) an exhaustive list of TEAEs observed or reported by their patients; 2) the most and least frequently occurring TEAEs; 3) clinically important TEAEs (ranked as 1 for most clinically important); and 4) level of patient-perceived bother for each clinically important TEAE (0 = no bother to 10 = extremely bothered). Physicians were not asked to distinguish between adverse event profiles for patients with MDD and schizophrenia.
Analysis {#Sec6}
--------
To ensure consistency in organizing and coding TEAEs across patients and physicians, a codebook was developed and applied, providing consensus in TEAE coding decisions by each of the two focus group and interview moderators.
In order to organize the rankings and rating scores in a more meaningful manner, a "top 3 box" approach was taken (i.e., collapsing the proportion of participants reporting in the top 3 responses). For example, bother and clinical importance rankings of 1, 2, and 3 were collapsed into the "most" bothersome or "most" clinically-important TEAEs, and ratings of 8, 9, and 10, among physicians in rating patient burden were collapsed into the "most" | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#sec1-1}
============
According to the global burden of disease study, COPD will be the fifth leading cause of disability and the third leading cause of death in the world in the first half of the twenty-first century. For developing countries, COPD is expected to be the fourth leading cause of disability for males and the third for females in 2020.\[[@ref1]\]
Chronic obstructive pulmonary disease (COPD) has been defined by the global initiative for obstructive lung disease (GOLD) as a disease state characterized by airflow limitation that is not fully reversible.\[[@ref2]\]
Dyspnoea, the hallmark symptom of COPD, is the reason for which most patients seek medical attention and is a major cause of disability and anxiety associated with the disease. Chronic cough, often the first symptom of COPD, to develop.\[[@ref3]\]
The diffusing capacity of lung for carbon monoxide (DLCO) is a measure of the ability of gas to transfer from the alveoli across the alveolar epithelium and the capillary endothelium to the RBCs. Gas exchange is impaired by parenchyma destruction, which disrupts the local matching of ventilation and perfusion.\[[@ref4]\] The imbalance of ventilation perfusion may lead to alteration of transfer factor. It is usually due to a change in either or both the volume of blood in the alveolar capillaries and the diffusion capacity of alveolar capillary membrane. In chronic lung disease, diffusion capacity is impaired when there is a reduction in the effective surface area for gas exchange in lung, in disease of lung parenchyma in which there is loss of lung tissue or part of the lung, not ventilated.\[[@ref5]\]
A comprehensive yoga program can have a salutary effect on general health and respiratory health and thereby help increase a person\'s ability to perform activities of daily living. COPD is known to increase the level of stress, emotional vulnerability, physical inactivity and muscle wasting. This yogic regimen may change the milieu at the bronchioles and the alveoli particularly at the alveolo-capillary membrane to facilitate diffusion and transport. Hence transfer factor of the lung for carbon monoxide (TLCO) has been included in this proposed study.
We have not come across any study regarding the effect of yogic exercises on transfer factor of lung for carbon monoxide; it was therefore decided to scientifically study the effects of yogic exercises in a group of COPD patients by measuring pulmonary function tests along with diffusion capacity.
MATERIALS AND METHODS {#sec1-2}
=====================
The study was conducted in University College of Medical Sciences (UCMS), Delhi on 60 diagnosed patients of mild (*n*=30) and moderate (*n*=30) COPD patients in the age group of 30-60 years, of either sex, having disease duration of more than one year. The patients were recruited from the medicine outpatient department (OPD) of Guru Teg Bahadur (GTB) hospital, Delhi. The diagnosis was based on three most common symptoms, namely, cough, sputum production and exertional dyspnoea.
Inclusion criteria for COPD patients of mild and moderate severity, according to GOLD guidelines: Mild ratio of forced expiratory volume in first second to forced vital capacity (FEV~1~/FVC)\<70% and FEV~1~\>80% predicted, moderate- FEV~1~/FVC\<70% and FEV~1~=50-80% predicted. All patients remained on their prescribed medical treatment during the study. They were on regular conventional treatment with daily inhaled bronchodilator β~2~ agonist; salbutamol 100-200 μg at the interval of 6 h and inhaled anticholinergic; ipratropium bromide 40-80 μg at the interval of 6-8 h.
Subjects with a history of an exacerbation or respiratory tract infections, tuberculosis, current smokers, pregnant or lactating women, diabetes or any other disorder were excluded. The medication for COPD was kept the same throughout the study period for both control and the yoga group. The study was explained to the patients and their signed informed consent was taken. Ethical clearance was also obtained from UCMS ethical committee.
Selected patients were randomized into two groups:
**Group 1 control group** (*n*=30): This group was further subdivided according to severity:
Group 1a Mild COPD: This group was taking conventional treatment with inhaled bronchodilator β~2~ agonist, salbutamol 100-200 μg at an interval of 6 h.
Group 1b Moderate COPD: This group was taking conventional treatment with inhaled bronchodilator β~2~ agonist, salbutamol 100-200 μg at an interval of 6 h and inhaled anticholinergic, ipratropium bromide 40-80 μg at an interval of 6 h.
**Group 2 Yoga group** (*n*=30): These patients were taught pranayama and asanas and were asked to continue the same medication as group 3. This group was further subdivided according to severity.
Group 2a Mild COPD
Group 2b Moderate COPD
The training in yoga: The yoga practice given to COPD patients (for 2 months) included pranayama and asanas. Before putting the patients on yoga regimen, they were clinically examined to rule out any physical ailments. Patients were asked to perform yoga exercises for 40-50 min everyday for 2 months under the supervision and guidance of a yoga instructor. Yoga includes pranayama (30-35 min), asanas (10 min), meditation (10 min) and life style changes.
Pranayama (breathing exercises):\[[@ref6]\]
Bhastrika: 5 minAnulom vilom: 15 minKapalbhati: 10 minBhramari: 5 times
Asanas (postures):
Surya NamaskarTadasanaSukhasanaPaschimotanasanaShavasana: 10-20 min
Both the control group and yoga group were matched for age, sex and duration of asthma and COPD. All subjects underwent complete physical examination and clinical assessment. Routine laboratory tests (complete hemogram) were done at the time of commencement of the study. Patients were tested, instructed and followed up in cardiopulmonary laboratory of the Physiology department. Yoga group were explained about yoga and their lifestyle modifications. They were advised about the diet, in which more fruits and vegetables were included. They were instructed to avoid alcohol and smoking and to keep regular working and sleeping hours. Proper yoga training was given by yoga experts. Subsequently they performed yoga in the yoga clinic for 21 days for an average of 45 min daily. Thereafter, they were asked to practice yoga for 45 min daily at home. The subjects were followed in the cardiopulmonary laboratory, after each week, for an evaluation and compliance to see whether they were doing the yogic exercises properly. Subjects maintained daily records of their breathing exercises, asthma symptom severity during the day and night, plus activity limitations due to asthma. They were asked to note down if there was any change in the dose of their medications.
The control groups were also asked to maintain records of all events related to disease and medication use. Both the groups were regularly attended by their treating physicians during study evaluation visits. Both the groups filled the daily diary and brought it at each visit. During the follow up period, telephonic support was provided for motivating participants to improve their compliance. All the subjects were evaluated three times, first at the time of recruitment, then after one month and two months. Simultaneously they underwent either conventional treatment or conventional treatment with yogic intervention. The recorded parameters were compared, statistically analyzed and then concluded. All of the patients received the same yoga training.
Parameters {#sec2-1}
----------
Standing height and weight of the patients were measured and body mass index (BMI) was calculated. Diffusion capacity was assessed prior to yoga training, at the end of 1 month and after 2 months of yoga therapy. It was carried out on each stable subject using computerized medisoft instrument (HYP'AIR compact-manufacturer- PK MORGON). The patients were acclimatized to the laboratory for 10 min. The level of the mouth piece was adjusted so that the patient was comfortable. Adequate demonstration was given till the subject had comprehended the instructions. Diffusion capacity was carried out in the morning between 9:30 am and 11 am.
To make the measurement of transfer factor, the subject was seated upright in front of the apparatus; this is set so that the subject breathes air through the mouth piece. A nose clip was worn. After a few normal breaths, the subject breathed out to residual volume. Then immediately, the subjectrapidly inhaled the test gas to total lung capacity, held the breath for approximately 9-11 s and finally breathed out at a moderately fast rate. After exhalation, a sample of alveolar gas was collected for analysis.
By the method of Jones and Meade, the effective duration of breath holding is taken to include two- thirds of time of inspiration and the time of expiration up to half way through the period of sample collection.\[[@ref7][@ref8]\]
A total of 3 tests were performed and the best of the three fulfilling the criteria of reproducibility and vitality were considered for analysis.
The control group was told to continue the medicines, with no dietary restrictions or daily activities. They were also assessed for diffusion capacity at the time of recruitment, at the end of 1 month and after 2 months.
Data were collected, tabulated and analyzed using repeated measures of analysis of variance (ANOVA), followed by Tukey test with *P*\<0.05 as statistically significant. Results are expressed as mean±standard deviation ( | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Although the US has achieved substantial gains in improving the health of women and children, and infant mortality has reached record low levels, the US presently ranks 27th among established market economies in infant mortality \[[@CR1]\]. Four recurring causes account for more than half of all infant deaths: birth defects, disorders related to short gestation and preterm birth, maternal complications of pregnancy (including complications of the placenta, cord and membranes), and sudden infant death syndrome \[[@CR2]\]. In recent years some causes of infant mortality have increased, particularly in the percentage of births that were preterm and of low birth weight \[[@CR3]\]. In 2002, congenital anomalies, low birth weight, preterm delivery, and maternal complications of pregnancy accounted for 14,263 (50.9%) of the 28,034 infant deaths \[[@CR2]\].
Relatively little is known about the risk factors underlying the continued increase in these adverse outcomes. Adequate prenatal care has long been considered as an opportunity to reduce such risks. However, despite increases in access to and utilization of early prenatal care, interventions and efforts directed at addressing such risk factors fall short of their goal. Indeed, the effects of such efforts may have reached their peak, and new approaches may be necessary. Reviews on selected risk factors indicate that a large proportion of women enter pregnancy with pre-existing risks for adverse pregnancy outcomes. Although some women tend to take action to reduce their risk as soon as they learn that they are pregnant, the extent of pregnancy related change in risk factors varies considerably and often does not occur early in pregnancy when teratogenic effects are more pronounced. Moreover, post-pregnancy relapse is high \[[@CR4]\]. For example in the period 1996--1998 the reported reduction in the use of alcohol, tobacco and illicit drugs in the first trimester was 46, 28, and 28% respectively \[[@CR4]\]. Such information is important to the emerging emphasis on preconception care as a complementary approach to reduce risks to pregnancy. This paper provides nationally-representative estimates on risks during the preconception period and describes the apparent reductions in risk achieved during pregnancy for all known risk factors for which data are available.
Data {#Sec2}
====
The estimates presented herein are based on data from the 2004 Behavioral Risk Factor Surveillance System (BRFSS) \[[@CR5]\]. However, because not all risk indicators that were considered were included in the 2004 BRFSS, 2002 data were used for a small number of risk indicators for which the 2002 BRFSS provided the most recently available data. The BRFSS is an ongoing annual telephone survey of the non-institutionalized adult civilian population aged 18 years and older conducted in each state. The survey obtains information on a wide range of modifiable risk behaviors. In 2004 the median response rate for the BRFSS state surveys was 52.7 percent. This rate represents an estimate of the percentage of eligible respondents that completed telephone interviews, and is computed based on procedures recommended by the Council of American Survey Research Organizations (http://www.casro.org/resprates.cfm.) In comparison with other national surveys, BRFSS data appear to be of good quality \[[@CR5]\]. Additional technical information is available online at http://www.cdc.gov/brfss/.
The survey includes core modules asked in all states, rotating modules asked every second year in all states, and optional modules that are included only in some states. Being a general survey, the BRFSS lacks information on some factors of interest to the present topic, for example month of pregnancy for pregnant women, or information on prenatal care. Further, the BRFSS is not designed specifically to study all known risk behaviors at preconception or pregnancy. In addition, as an interview survey, the survey relies on self-reported data which contain an unknown level of reporting error.
Identification of women in the preconception group in the BRFSS is made possible by questions introduced in the "family planning section" of the questionnaire. The availability of these questions makes it possible to compare risk behaviors among women about to become pregnant with those who are already pregnant on a large and nationally-representative sample of women. Women in the preconception period were identified as those who reported that they wanted a baby in the next 12 months, were not using contraception, were not sterile and were not already pregnant. Women who were pregnant were identified based on the response to the question "To your knowledge are you now pregnant?" Age of gestation was not assessed in this survey. Data were aggregated across states to make national estimates. For 2004 this resulted in a total national U.S. sample of 70,917 women aged 18 to 44 years, of whom 2308 (3.4%) were classified into the preconception period, and 2998 (4.7%) reported that they were pregnant at the time of their interview. The corresponding number of women in the 2002 are 61,284 women 18--44, with 2204 (3.7%) in the preconception period, and 2556 (4.6%) pregnant women. The analysis on folic acid and vitamins are based on surveys in 12 states in 2004. The results for these items are generalizable to the populations of these 12 states (shown in Table [2](#Tab2){ref-type="table"}) but not to the entire United States population. Table 1Comparison of age and race/ethnicity, 2004 Women in preconception and pregnant (BRFSS) and Births (Vital Statistics data)BRFSSPreconception womenPregnant womenVital statisticsPercentCIPercentCIbirths PercentAge group 18--192.00.97.52.27.1 20--2416.33.326.53.026.1 25--2923.43.126.52.727.9 30--3428.43.126.22.824.4 35--3918.52.510.21.512.0 40--4411.42.23.10.92.6100.0100.0Race/ethnicity NH White64.93.960.13.456.8 NH Black11.92.511.51.913.6 Hispanic16.03.523.03.422.5 Others7.22.15.51.67.2100.0100.0100.0*Note.* For BRFSS estimates, 95% confidence interval = Percent +/− CI. Vital statistics data: Hamilton BE, Martin JA, Ventura SJ, Sutton PD, Menacker F. Births: Preliminary data for 2004. National vital statistics reports; vol 54 no 8. Hyattsville, Maryland: National Center for Health Statistics. 2005.Table 2Health risk indicators by pregnancy status Women 18--44, 2004 and 2002 BRFSSPreconception womenPregnant womenPercentCIPercentCI2004 data--nationwide^*a*^ General Health Poor/fair general health status8.32.16.41.7 14+ days in past month mental health not good^\*^12.82.49.61.9 No health plan^\*^18.83.511.92.3 No dental visit past year28.33.230.23.1 Told had diabetes^\*^2.00.90.70.4 HIV Don't know about prevention of MTC HIV transmission38.23.534.13.0 Never tested for HIV^\*^34.93.424.43.0 1 or more HIV risk category^\*^4.31.46.91.8 Alcohol/smoking Any alcohol in past month^\*^53.93.710.71.8 Average 1 or more drink per day, past month^\*^6.02.00.80.5 Binging: Any occasions of 5+ drinks in past month^\*^10.72.11.90.9 Frequent drinking: binging or 1 or more drinks per day^\*^12.92.52.20.9 Current smoker^\*^19.42.78.41.5 Obesity Overweight, body mass index (BMI) \>2546.03.6NA Obese, BMI \>3022.43.1NA2004 data, 12 states only^*b,c*^ Folic acid Don't know about folic acid for birth defects prevention46.16.938.45.6 Don't take vitamins of any kind^\*^36.97.110.23.6 Don't take folic acid or multivitamin^\*^38.47.017.54.5 Don't take folic acid or multivitamin *daily*^\*^44.86.919.94.7Nutrition (2002 BRFSS)^d^ Fewer than 5 servings/fruit and vegetables^\*^74.93.164.73.5 Fewer than 1 servings/fruit and vegetables3.31.12.91.3*Note.* 95% confidence interval = Percent +/− CI.^*a*^Unweighted number of observations: Preconception women (2308), Pregnant Women (2998).^*b*^Unweighted number of observations: Preconception women (607), Pregnant Women (756).^*c*^States: AZ, CO, FL, KY, MN, MT, NC, ND, NE, TX, VA, WI.^*d*^Unweighted number of observations: Preconception women (2204), Pregnant Women (2556).^\*^*p* \< .05, preconception vs. pregnant women.^\*\*^HIV risk: Any statement is true: in past year illegal drug injection, treated for STD, exchange for | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
Over the past few decades, studies have found that regulated intramembrane proteolysis (RIP) plays an important role in various kinds of cellular processes, including cell signaling, gene transcription and apoptosis [@pone.0037452-Brown1], [@pone.0037452-Wolfe1]. Regulated intramembrane proteolysis is a process through which proteases cleave substrates within their transmembrane regions. Three major intramembrane protease families have been identified, including the metalloprotease-type S2P family, the γ-secretase and signal peptide peptidase family and the rhomboid proteases.
Rhomboid proteins are a family of widely conserved intramembrane serine proteases found from bacteria to humans [@pone.0037452-Urban1]. In Drosophila, they cleave the epidermal growth factor-like ligands to regulate the EGFR signaling pathway, playing important roles in signal transduction pathways and organism development [@pone.0037452-Lee1], [@pone.0037452-Urban2]. The mitochondrial rhomboid protease PARL has been found to regulate mitochondrial membrane remodeling and apoptosis [@pone.0037452-McQuibban1], [@pone.0037452-Cipolat1]. Rhomboid proteases are also involved in para-invasion and replication [@pone.0037452-Brossier1]. Although significant progress has been made since their discovery approximately ten years ago, the biological functions of most rhomboid proteases remain unclear. Few substrates have been identified for the rhomboid proteases, and the identification of these substrates will play a key role in understanding the function of this intriguing family of intramembrane proteases. Thus, finding novel substrates is an urgent need for the investigation of rhomboid proteases. Furthermore, only single transmembrane proteins have been identified as substrates of rhomboid proteases [@pone.0037452-Strisovsky1], [@pone.0037452-Jin1], [@pone.0037452-Adrain1]. However, because so many transmembrane proteins are multi-pass membrane proteins, there is a question regarding whether any multi-pass transmembrane proteins are substrates for rhomboid proteases.
TSAP6/STEAP3 was initially identified as a p53-inducible gene implicated in apoptosis and cell cycle regulation [@pone.0037452-Passer1], [@pone.0037452-Amson1]. TSAP6 is a member of the six-transmembrane epithelial antigen of the prostate (STEAP) family and facilitates ferrireductase iron uptake in erythroid cells [@pone.0037452-Ohgami1], [@pone.0037452-SanchezPulido1]. However, the most intriguing finding is that TSAP6 plays a role in the regulation of nonclassical exosomal secretion, which may have a broad biological significance [@pone.0037452-Amzallag1], [@pone.0037452-Lespagnol1].
Exosomes, which are 30--100 nm in diameter, are derived from the internal vesicles of multivesicular bodies. They are secreted by various types of cells through a nonclassical secretion pathway [@pone.0037452-Nickel1], [@pone.0037452-Keller1]. Recent studies have highlighted the role of exosomes in various kinds of cellular processes, including cell maturation and differentiation, cancer progression and immune regulation [@pone.0037452-Li1], [@pone.0037452-Camussi1]. The function of the exosome is diverse and complicated and is related to its origin, its numerous components, and its targeted cells [@pone.0037452-Hwang1], [@pone.0037452-Zitvogel1], [@pone.0037452-Huber1], [@pone.0037452-Szajnik1]. However, the mechanism by which exosome secretion is regulated is still unclear. Exosomes originate from intracellular membrane vesicles, such as endosomes, lysosomes, and the plasma membrane, and they are secreted through fusion with the plasma membrane [@pone.0037452-Heijnen1], [@pone.0037452-Cocucci1]. Studies have found that various kinds of factors and proteins can influence exosome secretion, including calcium, DGKα, Rab family proteins and p53 [@pone.0037452-Savina1], [@pone.0037452-Alonso1], [@pone.0037452-Yu1], [@pone.0037452-Ostrowski1]. Interestingly, p53 has been found to promote exosome secretion through up-regulating TSAP6 transcription [@pone.0037452-Amzallag1].
We investigated the function of the mammalian rhomboid protein RHBDD1 and found that it could promote the proteolytic cleavage and subsequent proteasomal degradation of the pro-apoptotic Bcl-2 family member Bik [@pone.0037452-Wang1]. We also found RHBDD1 to be implicated in the regulation of spermatogenesis [@pone.0037452-Wang2]. Bik was found to interact with RHBDD1 using a yeast two-hybrid screen with RHBDD1 as bait. In addition to Bik, the multi-transmembrane protein TSAP6 was also identified in the screen. In this study, we investigated whether TSAP6 was a novel substrate of RHBDD1. We found that RHBDD1 induced the cleavage of multi-transmembrane protein TSAP6. The major cleavage site was mapped through mass spectrometry and mutagenesis experiments. We also show that the level of TSAP6-mediated exosomal secretion was elevated when RHBDD1 was mutated. Our findings may help clarify the mechanism by which rhomboid proteases are involved in the cellular secretion pathway in mammals.
Results {#s2}
=======
RHBDD1 overexpression induces the cleavage of TSAP6 {#s2a}
---------------------------------------------------
Because RHBDD1 is a serine-type intramembrane protease, we hypothesize that transmembranal TSAP6 may be a substrate of RHBDD1. We co-transfected a Flag-tagged TSAP6 construct with RHBDD1 or with its catalytically inactive form, RHBDD1^S144A^ [@pone.0037452-Wang1]. When transfected alone, Flag-tagged TSAP6 appeared to be an approximately 55--70 kDa doublet on the immunoblot ([Fig. 1A](#pone-0037452-g001){ref-type="fig"}), probably as a result of posttranscriptional glycosylation, as previously reported [@pone.0037452-Lespagnol1]. However, the pattern of the bands of TSAP6 was different when it was cotransfected with RHBDD1. The intensity of the 55--70 kDa TSAP6 doublet decreased dramatically, and a lower band (approximately 38 kDa) appeared ([Fig. 1A](#pone-0037452-g001){ref-type="fig"}). However, RHBDD1^S144A^ did not show this effect, indicating that the catalytic activity of RHBDD1 is essential for the cleavage of TSAP6. In addition to the 38-kDa cleavage band, two weaker cleavage bands were detected when the blot was exposed for a longer period of time ([Fig. 1A](#pone-0037452-g001){ref-type="fig"}). The two weaker cleavage bands were visible in most cases during our investigation of the cleavage when exposed for longer periods. To determine whether RHBDD1 overexpression was responsible for the cleavage of TSAP6, the effect of the level of RHBDD1 on cleavage was investigated. The proteolytic cleavage of TSAP6 increased gradually when the expression of RHBDD1 was increased ([Fig. 1B](#pone-0037452-g001){ref-type="fig"}). Different parts of RHBDD1 were tested for their ability to induce the cleavage of TSAP6. RHBDD1 is mainly composed of an N-terminal rhomboid domain and a C-terminal domain ([Fig. 1C](#pone-0037452-g001){ref-type="fig"}). The N-terminal region (1--214 aa, mainly composed of the 59--214 aa rhomboid domain) of RHBDD1 was sufficient for the proteolysis of TSAP6, but its activity was much weaker than full-length RHBDD1 ([Fig. 1D](#pone-0037452-g001){ref-type="fig"}).
![RHBDD1 overexpression induces the cleavage of TSAP6.\
A. RHBDD1 mediated proteolytic processing of TSAP6 in an enzymatic activity-dependent manner. Upon co-expression of TSAP6-Flag and RHBDD1-HA or RHBDD1^S144A^-HA in HEK-293T cells, the cleaved fragments were observed only with RHBDD1 overexpression. Note that three cleaved fragments (black arrowheads) were detected when the blot was exposed for a longer period of time. B. Dose dependency of RHBDD1-induced cleavage of TSAP6. The lysates of HEK-293T cells transfected with the indicated amounts of RHBDD1-HA and TSAP6-Flag constructs were blotted using anti-Flag and anti-HA antibodies. The cleaved fragments are indicated with black arrowheads. C. RHBDD1 and its truncated forms. D. Determination of the cleaving ability of different regions of RHBDD1 on TSAP6. The lysates of 293T cells transfected with TSAP6 and empty vector or RHBDD1-HA, RHBDD1C-HA, RHBDD1N-HA, and RHBDD1^S144A^-HA (here designated as S144A) were seperated with 10% SDS-PAGE and blotted with the indicated antibodies. E. RHBDL2 was not found to cleave TSAP6. F. RH | {
"pile_set_name": "PubMed Central"
} |
Introduction {#s1}
============
In recent decades, breast cancer cases have increased worldwide [@pone.0053902-Pedraza1] and today are the main cause of cancer mortality and morbidity in women [@pone.0053902-Hortobagyi1]. Breast cancer is caused by environmental and genetic factors [@pone.0053902-Song1]. Two main genes, *BRCA1* and *BRCA2*, are associated with hereditary breast cancer. Sporadic cases of breast cancer, however, may be related to variants in low-penetrance genes such as polymorphisms [@pone.0053902-Martin1], [@pone.0053902-Rodrigues1].
Lifetime exposure to estrogen is another factor that plays an important role in breast cancer. It is known that this hormone is involved both in the development of the mammary gland, as well as in the pathogenesis and progression of breast cancer [@pone.0053902-Germain1]. Based on this, the study of genes related to biosynthesis and the metabolism of estrogen is one way to identify possible candidate genes for breast cancer risk [@pone.0053902-Dumas1]. One of them is the *CYP19* (P450arom) gene. The human *CYP19* gene is located in the chromosome 15q21.2 region and is comprised of a 30 kb coding region [@pone.0053902-Bulun1]. This gene encodes for aromatase, an enzyme whose function is to catalyze the conversion of androgens into estrogens, a reaction known as aromatization. In premenopausal women, the main source of estrogens is the ovaries. Meanwhile, in postmenopausal women, aromatization takes place elsewhere such as in adipose tissue, skin, muscle, and liver cells.
There have been several epidemiological studies of polymorphisms on the *CYP19* gene with the aim of finding associations between genetic variations and breast cancer risk. Some have found an association with an increased risk of breast cancer, such as that of a tetra-nucleotide repeat polymorphism in the intron 4 (TTTA)n [@pone.0053902-Fasching1]. Still, other polymorphisms studied have not shown a clear association with breast cancer risk, thus generating a situation of inconsistent results. This is the case of a C/T single nucleotide polymorphism (SNP) located in the 3′ untranslated region (3′-UTR) of the *CYP19* gene (rs10046). Some studies have linked this polymorphism with breast cancer risk [@pone.0053902-Kristensen1], however, others show different results [@pone.0053902-Haiman1], [@pone.0053902-Ralph1], [@pone.0053902-Zhang1]. This discrepancy in results led us to conduct a case-control study of this SNP in a population in Valencia (Spain). Additionally, we performed a meta-analysis of this polymorphism for the first time. It is a powerful tool for overcoming the problems of the small sample size and inadequate statistical power of genetic studies. This approach gives more reliable results than a single case--control study can. The aim was to collect all results published to date about this polymorphism and to obtain conclusive results about their relevance in susceptibility to breast cancer.
Materials and Methods {#s2}
=====================
Case-control Study {#s2a}
------------------
### Study population {#s2a1}
Association analysis between the rs10046 polymorphism (*CYP19*) and breast cancer disease was performed in a case-control study. The study was performed in a Caucasian Spanish population composed of 522 breast cancer patients and 1221 controls recruited at the Clinic Hospital of Valencia (Spain) with a mean age at diagnosis of 51 years (range 21--89) and 51 years (range 18--86), respectively. The controls were women without malignant pathology recruited at the blood donor bank and women with non-malignant pathology from the menopausal unit of the same hospital. The recruitment of the cases and controls was performed in the same interval of time ±0.5 years. The research protocols were approved by the ethics committee of the Institute of Health Research INCLIVA before the study began. All the participants in the study gave their written informed consent to participate in the study.
### Genotyping {#s2a2}
Genomic DNA was extracted from blood samples using the DNeasy tissue kit from Qiagen (Izasa, Madrid, Spain) or DNA Isolation Kit by MOBIO (Carlsbad, CA, USA) using minor modifications to the manufacturer protocol. A final elution volume of 100 µl was established. DNA quantity was measured by absorbance at 260 nm using a NanoDrop spectrophotometer, and DNA purity was evaluated by measurement of the 260/280 absorbance ratio. DNA samples were stored at −20°C. Genotyping analysis was performed by real-time PCR (5 ng/ul DNA), using the TaqMan SNP Genotyping Assays C\_\_\_8234731_30 (Applied Biosystems) according to the manufacturer instructions. Thermal cycling and detection was performed on the ABI Prism 7900 using the Sequence Detection Software (Applied Biosystems). The results were analyzed using the allelic discrimination assay program of Sequence Detection Software version 2.4 (Applied Biosystems).
### Statistical analysis {#s2a3}
The SNPs genotype analysis of our study population was done with the SNPstats software [@pone.0053902-Sole1] (allele and genotype distributions, association test, Hardy-Weinberg Equilibrium (HWE)). SNPstats association was based on binary logistic regression according to the response variable providing odds ratios (ORs), the confidence interval (CI), and the p-values for multiple inheritance models (dominant, recessive, over-dominant co-dominant, and log-additive). The lowest Akaike's Information Criterion and Bayesian Information Criterion value indicate the best inheritance genetic model for each specific polymorphism.
Meta-analysis {#s2b}
-------------
### Literature search strategy for identification of the studies {#s2b1}
We did a literature search in PubMed, Scopus and EBSCO data bases using the terms "breast cancer and rs10046", along with additional terms such as "polymorphisms, SNPs and CYP19", and all possible combinations. The studies for the meta-analysis were selected when they satisfied the following criteria: studies published by March 2012, case-control studies in humans, studies with genotype frequencies or OR data, information about HWE and information about procedure (adjusted or not, subgroups, etc.). In order to search more deeply, we reviewed the references of the selected articles to retrieve data that we could have ignored in the initial search.
### Data extraction {#s2b2}
Information was extracted from the articles by two of the authors following the criteria listed above (B.P. and P.E.). Disagreement was discussed and resolved between the two authors. In the event that a study presented subpopulations, these were taken to be different studies. The same was done for studies composed of a first set and a second independent validation set.
### Statistical analysis {#s2b3}
Raw data from comparable studies were analyzed jointly using likelihood methods. The estimate of association with breast cancer risk was evaluated using the fixed effect method [@pone.0053902-Mantel1] which calculates the ORs and the corresponding 95% CIs for individual studies and the global association. When the test was heterogeneous, the random-effects method [@pone.0053902-DerSimonian1] was applied. If heterogeneity was not corrected, we performed an influence analysis to determine the study responsible for that variability. Recessive, dominant, co-dominant, additive and over-dominant models were computed.
The analysis of heterogeneity between studies was performed by the Q statistic, with p-values \<0.1 indicating significant heterogeneity [@pone.0053902-Lau1]. We also used the I^2^ statistic to quantify heterogeneity; values of 25% correspond to low heterogeneity, 50% to moderate heterogeneity and 75% to high heterogeneity [@pone.0053902-Higgins1]. The meta-regression was performed with the SPSS package (Statistical Package for the Social Sciences, version 19.0), and a variable was considered a source of heterogeneity when the p-value was significant in the ANOVA analysis. Publication bias was assessed by funnel plots of effect sizes versus standard errors to identify significant asymmetry. Additionally, Egger's linear regression test [@pone.0053902-Egger1] and Begg's test [@pone.0053902-Begg1] were performed to evaluate the potential bias. The Gleser-Olkin method [@pone.0053902-Gleser1] was used to estimate the number of unpublished studies. Accumulative meta-analysis [@pone.0053902-Jeng1] was assessed by year of publication to evaluate the possible publication bias by time. Statistical analysis of association was done with SPSS, version 19.0.
Results {#s3}
=======
rs10046 Genotype in a Spanish Population {#s3a}
----------------------------------------
The distribution of the genotype frequencies in this polymorphism within the control group is in agreement with that expected under HWE with a p-value of \<0.05. We also observed that the frequencies in this study were similar to those previously reported in the European population described by HapMap (<http://hapmap.ncbi.nlm.nih.gov/>).
Our results show an association between the rs10046 polymorphism on the *CYP19* gene and breast cancer risk. The carriers of at least one C allele (dominant model) have 1.29 times increased risk of developing breast cancer (95% | {
"pile_set_name": "PubMed Central"
} |
Introduction
============
The three-year mandate of the European Union Committee of Experts on Rare Diseases \[[@B1]\] drew to a close in July 2013 with an impressive record. These results were achieved thanks to the unique nature of the forum it provided for the discussion of key topics for the rare disease community, bringing together representatives from all 28 European Member States, experts, patient representatives and members of the Industry, as well as the European Commission \[Figure [1](#F1){ref-type="fig"}\]. The enthusiastic participation of the 51 members of the EUCERD allowed the EUCERD to foster exchanges of relevant experience, policies and practices in the field of rare diseases, and help the European Commission and the Member States prepare and implement activities in the in the field of rare diseases.
{#F1}
Established via the European Commission Decision of 30 November 2009 (2009/872/EC) \[[@B2]\], the EUCERD responded quickly to the evolving needs of the rare disease community \[Figure [2](#F2){ref-type="fig"}\] following the *Commission Communication Rare Diseases: Europe's Challenge* (2008) \[[@B3]\] and the *Council Recommendation on an Action in the Field of Rare Diseases* (2009) \[[@B4]\]. These texts defined a European policy in the field and notably encouraged Member States to elaborate national plans/strategies for rare diseases by the end of 2013 to *"\[guide\] and \[structure\] relevant actions in the field of rare diseases within the framework of their health and social systems"*. Although other non-European countries and world regions have policies in place relative to orphan medicinal products, Europe is the only region with a public health policy in the field of rare diseases.
{#F2}
The EUCERD selected from the key areas cited by the Commission Communication and Council Recommendation a number of topics which had to be tackled immediately in order to clarify concepts and guide the reflection underway at national level. Most of these selected topics had already been tackled by the European Commission's Rare Diseases Task Force (RDTF), the EUCERD's predecessor, and there was sufficient consensus to elaborate sets of recommendations for the European Commission and Member States. Supported via two consecutive Joint Actions between Member States (N°2008 22 91 and N°2011 22 01), the EUCERD thus organised a number of expert workshops over the years to elaborate the recommendations in areas concerning the organisation of expert services (centres of expertise and European Reference Networks), data collection, and access to medicines. For each topic the process started with the identification of the scope of the issue and a fact-finding mission concerning the state of the art of the topic. This information was used to produce a preliminary report, or a draft recommendation, which provided material in turn for an expert workshop to discuss and elaborate a recommendation which was then submitted for discussion and adoption by the EUCERD \[Figure [3](#F3){ref-type="fig"}\]. The Recommendations have been disseminated by the members of the Committee and through OrphaNews Europe \[[@B5]\], the newsletter of the committee with 14 000 registered readers.
{#F3}
Centres of expertise : the key stone of national plans and strategies for rare diseases and a step towards European networks
----------------------------------------------------------------------------------------------------------------------------
The first area of the *Council Recommendation* to be dealt with by the Committee concerned the centres of expertise for rare diseases and European Reference Networks for rare diseases. The identification, and creation, of centres of expertise for rare disease is a key element of the *Council Recommendation* and central to national rare disease plans/strategies. There are around 6 000 rare diseases and most are unknown to healthcare professionals so rare diseases patients suffer from not knowing where to consult. To overcome this, some Member States have established centres specialised in some rare diseases/groups of rare diseases which have proven to be very efficient in providing quality of care for patients. The networking of these centres could lead to the gathering of the scarce expertise concerning these diseases at European level, in order to ensure equal access to accurate information, appropriate and timely diagnosis and high quality care for rare disease patients.
This area had been previously identified by the former RDTF as a priority topic with a dedicated working group, as networks of centres of expertise had been defined by the High Level Working Group on European Centres of Expertise as an area of European added-value with consensus on the benefits of a cross-border approach \[[@B6]\]. Indeed, the RDTF had previously established a list of criteria for designation of centres of expertise which served as the starting point for the EUCERD's reflection on this subject. Currently, the organisation of centres of expertise varies greatly from country to country: few countries currently have a designation process in place, and the designation criteria vary across these countries, and sometimes even from region to region. By revisiting the work of the RDTF, the EUCERD was able to draft and adopt recommendations relevant to the current situation concerning the definition of the missions, scope and criteria for designation and evaluation of centres of expertise. The EUCERD's *Quality Criteria for Centres of Expertise for Rare Diseases in Member States* (2011) \[[@B7]\] have been very well received in the EU Member States and are being actively used as a starting point in the elaboration of the actions concerning the organisation of care in their national plans/strategies. Member States have appreciated the clarification of concepts provided by the Recommendations which can be tailored to the countries' specificities. It is hoped that the use of these Recommendations will help to harmonise the criteria for designation of centres from country to country, in preparation for the establishment of the future European Reference Networks for rare diseases, for which centres of expertise are the building blocks \[Table [1](#T1){ref-type="table"}\].
######
Key facts and state of play in European countries in December 2013: Centres of expertise for rare diseases (CE RD)^1^
--- ------------------------------------------------------------------------------------------------------------------------------------------------------------------
• 1 European country with designated CE RD in the scope of a national plan for rare diseases
• 5 European countries with officially designated CE RD
• 15 European countries with non-designated CE RD acknowledged by health authorities to varying degrees
• 9 European countries with CE RD recognised by reputation only
• 16 European countries with plans to designate CE RD in their national plans/strategies for RD
• *EUCERD Recommendations on quality criteria for centres of expertise for rare diseases in Member States* adopted on 24 October 2011
• Consensus on 45 recommendations covering the mission and scope, criteria for designation, process of designation and evaluation, and European dimension of CE RD
^1^Data as of December 2013, reproduced from S. Aymé, C. Rodwell (eds.), **2014 Report on the State of the Art of Rare Disease Activities in Europe,** to be published in July 2014.
European Reference Networks for rare diseases: the European dimension of health care pathways
---------------------------------------------------------------------------------------------
Collaboration of centres of expertise through European Reference Networks (ERNs) is highlighted in the *Council Recommendation*, whilst the creation of such European structures is a key element of the *Directive on the application of patients' rights in cross-border healthcare (2011/24/EU)* (9 March 2011) \[[@B8]\], which specifically cites rare diseases as an area of interest for ERNs. The concept of ERNs for rare diseases had been developed over a number of years before the creation of the EUCERD by a dedicated RDTF working group mandated by the HLG. This working group ascertained that the treatment of rare diseases demands multidisciplinary care which is sometimes not available at local or national level and worked on establishing a set of recommendations concerning ERNs \[[@B9]\]. The EUCERD decided, once the concept of centres of expertise was well established, to take stock of this work in the context of the Directive in order to establish a recommendation for both the European Commission and the Member States. The *Recommendations on European Reference Networks for Rare Diseases* (2013) \[[@B10]\] highlights the specificities of rare diseases to be taken into account when considering the scope, mission, governance, designation and evaluation of such ERNs in the future activities planned around the Cross-Border Healthcare Directive. The reflections during the elaboration of the document have helped develop the concept of ERNs in the field of rare diseases. The adopted EUCERD Recommendations have provided guidance to Member States in process of elaborating the healthcare pathways at both the national and European levels in the scope of their national plans/strategies for rare diseases to ensure that this future possibility is envisaged from their inception. The Recommendations have also now fed into the process underway at the European Commission to prepare the legal framework for the implementation of the future ERNs, of which a number, it is hoped, will be dedicated to rare diseases. Stakeholders are now waiting for confirmation of how the sustainability and designation of these ERNs will be organised at European level. This question has been partially answered by the mention of support for projects concerning the modelling and validation of system methodologies for European Reference Networks in the Horizon 2020 call \[[@B11]\] \[Table [2](#T2){ref-type="table"}\].
######
Key facts : European Reference Networks (ERNs) for rare diseases
--- ----------------------------------------------------------------------------------------------------------------------------------------------------------------
• Rare diseases | {
"pile_set_name": "PubMed Central"
} |
Specifications tableSubject area*Ecology, Conservation Biology*More specific subject area*Urban ecology*Type of data*Tables, graphs*How data was acquired*Floristic inventories and vegetation relevés*Data format*Raw and aggregated*Experimental factors*A stratified sampling design with two types of gardens, and two crossed (independent) gradients: an urban intensity and a garden management intensity/habitat spatial heterogeneity gradient.*Experimental features*Gardens were chosen following a stratified sampling design, based on the urban habitat mapping key of the city of Zurich. The (independent) strata included i) garden type (domestic vs. allotment); ii) a garden spatial heterogeneity/management intensity gradient, ranging from extensively managed gardens with a high vertical vegetation structure and a high proportion of native plant species, to intensively managed gardens with a low vertical vegetation structure and a high proportion of alien plant species; and iii) an urban intensity gradient, which ranged from densely to less densely built-up areas of the city.*Data source location*City of Zurich, Switzerland; 47°22′N, 8°33′E*Data accessibility<https://doi.org/10.17632/452pj39jm2.2>Related research article*Young, C., Frey, D., Moretti, M., & Bauer, N. (2019). Research Note: Garden-owner reported habitat heterogeneity predicts plant species richness in urban gardens. Landscape and Urban Planning, 185, 222--227.*<https://doi.org/10.1016/j.landurbplan.2019.01.013>*.*[@bib1]**Value of the Data**•The data is comprehensive as it describes all vascular plants growing on entirely sampled garden lots with a high taxonomic resolution, and plants growing on standardized sampling plots.•The data can contribute to comparative studies of community assembly rules of spontaneously versus human assembled urban plant communities.•The data can contribute to comparative studies of garden floras to understand mechanisms of plant introductions and invasions.•The data can be used to investigate the effects of garden plants on diversity patterns of species of other trophic levels (e.g. herbivors, pollinators), for which data exists from the same gardens•The data can be used to investigate above-below ground interactions, as biotic and abiotic soil data exists in the same gardens.
1. Data {#sec1}
=======
This article presents data of a survey of vascular plants in 85 urban gardens in the city of Zurich, Switzerland. Two garden types were investigated: allotment (*N* = 42) and domestic gardens (*N* = 43). In each garden, we applied two sampling methods: a floristic inventory of entire garden lots (mean area ±SD: 312 ± 155 m^2^) and sampling on plots of a standardized size (2 × 10 m^2^). The two plots were centred within the two main land-use types found in each garden: lawn, meadow, vegetable bed, flower bed or berry patch. We give the origin status for each of the 1081 taxa found, i.e., whether a taxon is considered native or alien to Switzerland ([Appendix](#appsec1){ref-type="sec"}). Similarly, for each taxon and garden, we estimate the origin of each plant or garden population by classifying each taxon as either cultivated or spontaneously growing ([Appendix](#appsec1){ref-type="sec"}). Species richness (i.e. number of taxa) of all (*S*~total~), native (*S*~native~), cultivated (*S*~cultivated~) and spontaneous (*S*~*s*pontaneous~) plants was computed for each garden and overall ([Table 1](#tbl1){ref-type="table"}). In addition, species richness levels of gardens and land-use types were visualized, and results of the two sampling methods were compared ([Fig. 1](#fig1){ref-type="fig"}, [Fig. 2](#fig2){ref-type="fig"}). For each garden, additional environmental data is given, such as garden type, area, and urbanization intensity, which was calculated as the landscape proportion of impervious (i.e. built and paved) surface within a 500-m radius ([Table 1](#tbl1){ref-type="table"}). The data is part of an inter- and transdisciplinary investigation of biodiversity, soil quality, ecosystem services and social value of urban gardens in Switzerland ([www.bettergardens.ch](http://www.bettergardens.ch){#intref0020}). The data can be linked to biotic and abiotic soil data [@bib2], [@bib3], [@bib4], to data of soil surface dwelling and flying arthropods, which were sampled in the same gardens and during the same period, and to arthropod and bird predation data [@bib5], [@bib6]. The raw data are available from Mendeley Data <https://doi.org/10.17632/452pj39jm2.2> [@bib7].Table 1Species richness (i.e. number of taxa) of all (*S*~total~), native (*S*~native~), cultivated (*S*~cultivated~) and spontaneous (*S*~*s*pontaneous~) vascular plants in 85 urban gardens in the City of Zurich, Switzerland. The data are based on a complete floristic inventory of garden lots. For each garden, garden type, area and landscape proportion of sealed surface within a 500-m radius is given. Sealed surface was defined as built and paved land-cover. Note that plants can belong to more than one category (i.e., native, cultivated, spontaneous), since a plant can occur spontaneously in one garden while it is cultivated in another, and both cultivated and spontaneous plants can be native.Table 1Garden IdGarden typeGarden area (m2)Landscape proportion of sealed surface (500-m scale)*S*~total~*S*~native~*S*~cultivated~*S*~spontaneous~1allotment210.30.190171103114572home285.10.39314878109393allotment183.90.6301155278374home399.50.2331458189565home666.80.27216587108576allotment169.50.3901266887397home238.10.671695322478home473.50.428794051289allotment198.80.2009761435410allotment246.10.536179991136611home659.20.4348950543512home476.20.42913065884213allotment197.00.4329156533814allotment172.60.21811361694415allotment256.10.2857843473116allotment307.50.24312059863417home346.90.2107137422918allotment179.60.21010960674219home510.40.81211469753920allotment496.00.20813991786121allotment223.90.273155841282722home170.20.7266452174723allotment212.50.20711355724124allotment205.30.29014883876125home695.70.29513275854726home400.10.55912071675327home135.90.81111770754228home407.50.61311060753529allotment734.50.36211477585630home273.60.7161851241454031allotment167.90.21110451693532home229.70.2849543732233allotment198.70.24811558694634allotment173.10.5396338273635home249.90.7249247563636home255.90.3739652643237home291.00.58213282953738allotment501.20.1599957534639home791.50.1919173236840home294.20.53410558713441home444.20.43013168894242home486.10.2482051691535243home107.40.6165339223144home497.20.51711862774145home355.50.574178951195946allotment212.50.19511346823147home286.80.472186971384848home422.20.72110254673549allotment169.10.32012553883750home150.90.6139237741851allotment184.50.360122491002252home366.70.4971741071383653allotment410.30.81812580715454allotment179.60.1877552314455allotment240.40.11112470715356home438.90.2491711231224957home121.70.8149850722658home551.40.383143102895459home455.30.4417545433260allotment220.20.1299960574261allotment150.40.1098848513762home291.70.66310355604363allotment370.90.83413067864464allotment201.60.548155751124365home479.60.21512168932866allotment232.40.42312350903367allotment507.40.27917687 | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1-1}
============
The dexamethasone implant (OZURDEX; Allergan Inc., Irvine, CA, USA) is a biodegradable, sustained-release device injected transconjunctivally into the vitreous cavity, containing 0.35 or 0.7 mg of dexamethasone. The implant has been approved by the Food and Drug Administration for use in noninfectious intermediate and posterior uveitis. \[[@ref1]\] The occurrence of raised intraocular pressure (IOP) as a side effect of the drug is around 27% and is usually transient and can most often be controlled medically. \[[@ref2]\] We report a case of uncontrolled ocular hypertension after OZURDEX implant insertion for posterior uveitis in a young patient which necessitated implant removal along with trabeculectomy.
Case Report {#sec1-2}
===========
A 32-year-old gentleman, diagnosed with chorioretinitis in the left eye probably due to tuberculosis, was treated elsewhere with intravitreal OZURDEX for control of inflammation 72 days prior. Thereafter, he presented to our hospital with secondary rise in IOP. On examination, his unaided visual acuity for distance was 6/6, N6 for near vision in both eyes. His anterior chamber in both eyes was quiet with a clear lens. His IOP was 14 and 42 mmHg in the right and left eye, respectively. Gonioscopy revealed open angles up to scleral spur in all quadrants in both eyes. Fundus examination of his right eye was within normal limits; in his left eye, anterior vitreous face was quiet, optic disc (vertical cup: disc ratio 0.3) and macula were normal, an isolated chorioretinal patch was seen in the inferotemporal quadrant, and the OZURDEX implant cylinder was seen floating freely in the vitreous cavity \[[Figure 1](#F1){ref-type="fig"}\]. On Optical coherence tomogramphy (OCT) macula, his foveal contour in both eyes was normal. The patient was on maximal medical therapy including oral carbonic anhydrase inhibitors, despite which his IOP was uncontrolled. Therefore, we decided to perform a 25-gauge pars plana removal of the implant along with trabeculectomy with mitomycin C \[[Figure 2](#F2){ref-type="fig"}\]. The postoperative period was uneventful with a minimal manipulation of the bleb by the removal of releasable suture on day 5 when the IOP was 18 mmHg, and the IOP then stabilized at 14 mmHg. When the patient came back for a follow-up after 6 weeks, he had a quiet anterior chamber and vitreous cavity and his IOP of 6 mmHg \[[Figure 3](#F3){ref-type="fig"}\].
{#F1}
{#F2}
{#F3}
Discussion {#sec1-3}
==========
Ocular hypertension following the use of dexamethasone implant (OZURDEX) is reported to be relatively less frequent when compared to other forms of intraocular steroids.\[[@ref3]\] The IOP usually reaches its peak at around 60 days after the implant insertion.\[[@ref4]\]
Uveitic eyes are more prone to have a steroid response due to the already compromised trabecular meshwork.\[[@ref5]\] Although OZURDEX is considered to have a better safety profile, the SAFEODEX study identified six independent risk factors for secondary ocular hypertension after OZURDEX injection, including younger age \<60 years (odds ratio \[OR\] = 2.94, *P* \< 0.001), eyes with uveitis (OR = 3.26, *P* = 0.017), and preexisting glaucoma (OR = 3.7, *P* = 0.017).\[[@ref6]\]
Lowder *et al.*\[[@ref1]\] reported that using 0.35 mg DEX implant, 0.7 mg DEX implant, and sham in patients with noninfectious intermediate or posterior uveitis only \<5% had IOP \>35 mmHg and \<10% had IOP \>25 mmHg in all treatment arms. The majority of the study patients needed only a single IOP-lowering medication for IOP control and none required surgical intervention throughout the follow-up period of 26 weeks. However, our patient required a trabeculectomy and a pars plana vitrectomy was also done simultaneously to remove the residual OZURDEX, for a more effective control of IOP.
OZURDEX implant removal for anterior migration in aphakic eyes has been reported in the past, especially in eyes with absent capsular support and prior vitrectomy, but there are not many instances of performing pars plana OZURDEX implant removal for uncontrolled glaucoma.\[[@ref7]\] One similar case report from India describes the removal of OZURDEX implant in a child with uveitis after developing intractable glaucoma. Although later, the child still needed trabeculectomy for control of glaucoma despite the removal of the implant.\[[@ref8]\] This can probably be explained by the resultant damage to the trabecular meshwork by the steroid.
The effect of the OZURDEX implant usually lasts for as long as 6 months, and a sizable portion of the implant was still present in the vitreous cavity 2½ months after the insertion; hence, we decided to go ahead and remove the implant.\[[@ref9]\] Trabeculectomy was combined owing to the persistently high IOP for a duration \>2 months, the possible permanent damage to the trabecular meshwork, the need for maximum IOP-lowering medications, and the chances of recurrence of inflammation.
There are few studies done on the effects of OZURDEX in the younger age group in which population uveitis often occurs. Young people, especially in the age group of \<6 years, respond more dramatically to steroids.\[[@ref10]\] Further studies are required to evaluate the safety of OZURDEX on young eyes with uveitis and to set guidelines for follow-up. This case report throws light on the possible vision-threatening complication of OZURDEX in a young patient that was managed efficiently by removal of implant along with trabeculectomy.
Conclusions {#sec1-4}
===========
Steroids must be used with caution especially in young patients, patients with uveitic eyes, steroid responders, and patients with preexisting glaucoma. Young patients with uveitis receiving implant must be evaluated periodically, and prompt treatment must be initiated for raised IOP to prevent permanent optic nerve damage.
Declaration of patient consent {#sec2-1}
------------------------------
The authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/ have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Financial support and sponsorship {#sec2-2}
---------------------------------
Nil.
Conflicts of interest {#sec2-3}
---------------------
There are no conflicts of interest.
| {
"pile_set_name": "PubMed Central"
} |
Human movement, cognition, and learning are inextricably bound. Starting in early life, children act upon and understand the environment using mainly sensorimotor actions ([@B160]). Broad changes in perception, cognition, and behaviour appear with the development of a child's sensorimotor repertoire ([@B131]). Different types of motor experiences are prevalent throughout the development from childhood into adulthood, such as reaching and grasping movements ([@B38]), gross motor patterns of varying complexity mastered in the context of physical activity and sport ([@B36]), and gesturing ([@B70]). All these forms of human movements have been shown to affect cognition and learning.
In searching for underlying mechanisms explaining the connexion between physical activity, cognition, and learning, two main explanations deriving from two completely different lines of research can be found in the literature: physiological and cognitive. On the one hand, exercise and cognition research has predominantly referred to the physiological changes induced by single bouts (e.g., enhanced catecholamine levels) or multiple bouts of physical activity (e.g., changed brain structures) as an explanation for the inter-relatedness of physical activity and cognitive functioning (e.g., [@B54]; [@B46]). On the other hand, embodied cognition research has mainly focused on cognitive explanations, discussing them in the context of more subtle movements, such as gestures, and more recently whole-body movements (e.g., [@B101]), influencing cognitive processes and learning (e.g., [@B70]).
The main goal of this narrative review is to describe both research traditions (i.e., exercise and cognition research and embodied cognition research), and to review the literature to determine whether combining these two approaches may provide a synergistic benefit for both research and educational practice. The included literature will be described in terms of whether the movements are relevant and/or integrated with the cognitive/learning task. In doing so, one can identify that the first research tradition focuses on physiological explanations for the general health and cognitive benefits of gross motor movements in the form of physical activity or exercise, but without considering the relevance of the movements for the learning task. Typically, gross movements are not integrated (i.e., no temporal connexion of the movements with the learning task) with academic lessons, and are not meaningful or congruent with the task. The second research tradition focuses on cognitive explanations of subtle/fine or whole-body movements that are relevant to the learning task. Researchers in this tradition, however, do not consider the physiological benefits of physical activity or exercise.
In describing the two lines of research, the concepts of physical activity, exercise, and physical fitness are based on the definitions provided by the [@B23]:
1. Physical activity: "any bodily movement produced by the contraction of skeletal muscle that increases energy expenditure above a basal level."
2. Exercise: "a subcategory of physical activity that is planned, structured, repetitive, and purposive in the sense that the improvement or maintenance of one or more components of physical fitness is the objective. Exercise and exercise training are frequently used interchangeably and generally refer to physical activity performed during leisure time with the primary purpose of improving or maintaining physical fitness, physical performance, or health."
3. Physical fitness: "the ability to carry out daily tasks with vigour and alertness, without undue fatigue, and with ample energy to enjoy leisure-time pursuits and respond to emergencies. Physical fitness includes a number of components consisting of cardiorespiratory endurance (aerobic power), skeletal muscle endurance, skeletal muscle strength, skeletal muscle power, flexibility, balance, speed of movement, reaction time, and body composition" ([@B23]).
Acknowledging the aforementioned definitions, the terms "physical activity" and "movement" can be used interchangeably. However, we will use the term "physical activity" to label those activities which have been investigated in the exercise and cognition research tradition: mainly gross motor movements, which largely increase energy expenditure above a basal level. The term "movement," on the other hand, will be used to describe activities which have been investigated in the embodied cognition research tradition: mainly fine motor movements, such as gestures, which only marginally increase energy expenditure.
Finally, we propose the third approach, which combines both traditional approaches by looking at integrated, task-relevant physical activities. Blending the physiological and cognitive research traditions to improve both cognition and learning can potentially provide the field of education with valuable insights that can be used to formulate more concrete guidelines for the effective integration of movements in learning environments.
Exercise and Cognition Research
===============================
The exercise and cognition research tradition has its roots in ageing research ([@B31]; [@B59]). Interested in understanding how physical exercise could reduce the age-related decline in cognitive functioning, exercise scientists adopting a more medical perspective have tried to find the right dose of exercise to reach the largest cognitive benefits (e.g., [@B26]). Only in the last decades, there has been a shift toward the younger population, and concomitantly, interest in the effects of physical activity on children's and adolescents' cognition and brain development ([@B90]; [@B128]). The historical foundation in ageing research coupled with the medical perspective may explain why this line of research is focusing on cognitive functioning as the main outcome variable, rather than on learning, and why the given explanations are so physiological in nature.
Physiological Explanations for the Effects of Physical Activity on Cognition
----------------------------------------------------------------------------
The positive effects of physical activity are widespread across various domains of human life. The benefits of physical activity have been expanded beyond cardiovascular health and obesity prevention, and include improved cognitive functioning, as well as brain structure and activity ([@B90]). Several findings indicated that improving cardiovascular fitness through regular exercise induced morphological changes to the brain and enhanced cognitive functioning in ageing humans ([@B92]; [@B32]). Especially, executive functions (EF) appeared to be more susceptible than other cognitive processes to aerobic exercise ([@B31]). EF is the part of cognition that encompasses effortful and goal-oriented functions, including inhibition, working memory, and cognitive flexibility ([@B8]; [@B118]). These foundational components, form the basis for higher order EFs, such as reasoning, problem solving, and planning ([@B33]; [@B105]). The working memory system is especially influential for memory, perception, and attention ([@B7]). It is comprised of the central executive and two peripheral systems, the visuospatial sketch pad and phonological loop. The central executive is responsible for the attentional control of behaviour, such as processing, storage, and coordination of information coming from the peripheral systems. The phonological loop holds acoustic or speech-based information, and is important for speech perception and production, whereas the visuospatial sketch pad is linked with visual perception and action.
Findings in older adults resulted in the EF hypothesis, proposing that exercise affect EF's by inducing vascularisation, neurogenesis, and by altering synaptic processes in neural networks supporting EF, therefore influencing higher order thinking processes ([@B137]; [@B90]; [@B173]). Children's cognitive and neural development, and in particular EF and the supporting brain structures, may also be ameliorated by physical exercise ([@B41]; [@B78]; [@B44]). Higher fitness levels correlate to greater school performance due to physiological alterations in the brain structure, e.g., larger hippocampal volume, neurogenesis, synaptic plasticity, oxygenation, and brain circuit of hormones and neurotransmitters among higher fit preadolescent children of 7--10 years old ([@B24]; [@B90]; [@B25]). Although 95% of the brain size is reached by age 6, grey matter volume in the frontal, parietal, and temporal lobes peak during 10--12 and 16--17 years, respectively ([@B64]; [@B97]; [@B90]). Adolescents experience functional changes in EF, where increased activity has been observed in the prefrontal regions during the performance of social cognitive tasks ([@B15]).
Developmental neuroimaging studies have shown a gradually maturing sensorimotor system before the emergence of higher order EF, while neuroscientists have linked developmental changes in the brain with behavioural performance measures (e.g., memory function, task performance; [@B20]). Specifically, regions responsible for primary functions such as motor and sensory systems mature earlier than regions related to higher order association. Because the latter regions integrate these primary functions, the consensus is that EF is crucial for mental and physical health, academic success, cognitive, social, and psychological development ([@B42]). It is considered even "more important for school readiness than intelligence quotient" ([@B18]; [@B44], p. 959), and positively affects math and reading performance throughout education ([@B14]). EF is subsequently correlated with on-task behaviour, aiding self-regulation, behavioural inhibition, and the ability to focus on classroom material despite internal or external distractions, which is essential for successful learning. Children show increased on-task behaviour after physical activity programmes at school ([@B140]), confirming that physical activity can positively affect classroom behaviour.
Until now, several meta-reviews in children report a favourable relationship between physical activity and aerobic fitness on the one hand, and cognition and brain function on the other hand. In 1997, Etnier and colleagues examined 200 studies, in which 134 were included. They indicated that acute exercise has a significant small positive effect (Hedge's *g* = 0.36) on cognitive performance with children (6--13 years). Also, later in their meta-analysis with the same age group, [@B155], after having examined 118 studies and analyzed 44 studies, reported a similar overall effect size (Hedge's *g* = 0.32). More recently, [@B46] systematically reviewed the relationship between physical activity, fitness, cognition, and academic achievement and concluded that most research findings support the view that physical fitness, single bouts of exercise, and participation in physical activity programmes are beneficial for children's cognitive | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Physical exercises are prescribed in some institutions for patients that wear braces for adolescent idiopathic scoliosis \[[@B1]-[@B3]\], but there is no scientific evidence for this practice \[[@B4],[@B5]\].
The possible useful effects of an exercise regimen for a patient with adolescent idiopathic scoliosis wearing a corrective brace have been divided theoretically into the two categories of general and specific effects \[[@B6],[@B3],[@B11]\]. The former includes all beneficial modifications (obtained through the activation of muscles, the stimulation of ventilatory exchanges and psychological help) that physical activity provides the patient, while reducing the impairments and disabilities induced by wearing the orthosis.
Let us look at these singly:
1\. Activation of muscles
In braced patients, it is normally thought that the supporting action of trunk muscles is reduced \[[@B9],[@B10],[@B12]-[@B15]\]. Exercises are proposed to:
a\. avoid this effect, that could be more pronounced in adolescent patients using braces all day long;
b\. have the effect of stabilizing the spine when the brace is removed.
2\. Stimulation of ventilatory exchanges
Vital capacity and VO2 max are often reduced in patients whose scoliotic curvatures exceed 30 degrees Cobb \[[@B16],[@B17]\]. The VO2 max is usually reduced beyond a level that might be explained by a decrease in vital capacity alone. The reduction has been attributed to lack of physical exercise \[[@B18],[@B19]\]. Exercises are proposed to:
a\. increase vital capacity;
b\. train the patient so that both the cardiovascular and the musculoskeletal systems have an increased capacity to use oxygen;
c\. improve respiratory ability from a neuromuscular standpoint.
3\. Psychological help
Braces may induce a \"negative body image\" \[[@B20]\] in a growing child, that could, in turn, lead to an immature personality in adulthood. Exercises are proposed to reduce the psychological disability induced by the brace (which is not as great as that induced by the impairment itself), which may include a feeling of inferiority of the patient with respect to his/her friends.
Conversely, the category of specific effects relates to the pressure that braces exert on the spine through the soft tissues. Specific exercises have been proposed by Stagnara \[[@B3],[@B2]\] and many others \[[@B6],[@B7],[@B13],[@B10],[@B12],[@B13],[@B15],[@B21],[@B22]\] with the rationale of increasing the corrective forces applied by the brace -- somehow using movements as \"dynamic tools\" to amplify the corrective \"static\" forces applied by the orthosis.
Obviously such movements are instantaneous, but the immobilization of the ribs and spine that they induce (the former having modelling, and the latter, derotatory and deflective effects), could, in time and with repetition, play a major role in bringing about a positive effect of the brace \[[@B3],[@B2]\].
Moreover, it is necessary to consider the following assumptions:
1\. According to many etiological theories, the central nervous system could play an important role in the origin of the deformity \[[@B23],[@B24]\];
2\. It has been supposed that the soft tissues are not able to withstand passively the forces that should be applied by a brace in order to correct a scoliosis \[[@B25]\];
3\. The brace corrective effect with respect to Cobb angle reduction is strongly correlated with the pressure exerted by the pads \[[@B26]\];
4\. The strap tension should be set as high as possible for right thoracic curvatures \[[@B27]\];
5\. Muscular contraction has been supposed to play a major role in the effect of braces \[[@B25],[@B28]\]. Esthesio- and proprioceptive stimuli have also been considered important in bringing about a rearrangement of the postural system \[[@B1],[@B23]\];
6\. The electronic pressure sensor may be the best way to quantify the effectiveness of brace pad placement \[[@B29]\].
On the basis of these hypotheses, the forces applied during specific exercises and physical activities are important not only from a biomechanical standpoint, but also from a neurological perspective that aims to help the patient to develop a new spinal behavior. Thus, exercises that dually act on the spine -- both to increase the forces of the brace and to drive vertebrae in the direction of the correction by means of the \"escape from the pad\" movement \[[@B3],[@B30]\] -- could be extremely useful.
Focusing on the specific effect of physical activity, the aims of our study were:
1\. to ascertain the presence of muscle action and, if present, determine its importance;
2\. to evaluate the theoretical possibility of developing a best \"corrective exercise\" in a fiberglass brace (in terms of forces exerted during the movement); and
3\. to compare the exercises most commonly prescribed to achieve specific effects, such as kyphotization, rotation \[[@B9],[@B10],[@B3]\] and \"escape from the pad\" \[[@B3],[@B30]\].
Materials and methods
=====================
Subjects
--------
We examined 17 patients consecutively admitted to Don Gnocchi Foundation Orthopaedic Department to undergo treatment for idiopathic scoliosis. This treatment was based on two or three (depending on the degrees Cobb of the curvature) fiberglass non-removable braces (modified Risser type) \[[@B1]\]. The inclusion criteria were:
1\. a diagnosis of adolescent idiopathic scoliosis;
2\. the presence of a right thoracic or thoracolumbar curvature;
3\. no significant pain during movements in brace;
4\. second or third Risser fiberglass brace (so that, before the start of our evaluation, the patients involved in the study were accustomed to movements inside the brace); and
5\. good execution of the proposed movements, as judged by a single, well-qualified physical therapist (MR).
Fourteen female and three male patients were included in the study. Age ranged from 12 to 17 years; curvatures from 36 to 52 degrees Cobb; 13 of 17 patients had double major curvatures and all patients had classic idiopathic right thoracic, left lumbar curvature patterns.
Instrument
----------
A pressure distribution measurement system (F-Scan System™- Tekscan, Inc. Boston, MA 02210 USA) was utilized which detects pressure by means of a sensor and handles data through a dedicated personal computer and software. The sensor is a rectangular plastic sheet 7.62 cm wide, 20.32 cm long and 0.1016 mm thick. It is a resistive-based device made up of a conductive paste interposed between two insulating sheets. The paste is applied so as to form a 6 × 16 cell grid on one side and a 6 × 4 cell grid on the other. The cells are connected to one another by conductive wires which guide the variation of resistance from the pressure applied to the device for measurement. The sensor is connected to a personal computer by an A/D unit able to control the scanning process. Important characteristics of the software include its ease of use and the capability of viewing the acquisition process in real time.
The repeatability of the F-Scan system has been verified in other applications \[[@B31],[@B32]\]. We have already studied the capacity of the system to evaluate the forces applied by Fiberglass orthoses, and revealed how certain parameters influence data acquisition \[[@B32]\]. The most important of these are:
1\. the size of the forces to be measured;
2\. the temperature during measurements;
3\. the time taken to perform measurements;
4\. the interval between two consecutive measurements; and
5\. sensor wear and tear.
The foregoing perturbations can be limited by calibrating the sensor carefully before the start of data acquisition. For comparison with the data obtained *in vivo*, a measurement is required that must be calculated when all the parameters are known and controlled \[[@B32]\].
Brace
-----
The Risser cast has a long tradition in scoliosis treatment \[[@B33],[@B34]\] and is still used in some scoliosis centers around the world\[[@B1]\]. The brace utilized in this study was modified by using a different material (fiberglass) to avoid the last (third) phase of manufacturing \[[@B1],[@B35]\]. The patient lays supine on a modified Risser bed, in traction. The following corrective actions are performed on the patient\'s trunk:
• passive deflection;
• derotation with a tissue band; and
• direct push on the rib hump by two pads that exert a strong pressure through a screw mechanism.
The brace is modelled directly on the patient\'s trunk with fiberglass bands. Two windows are cut to allow for expansion of the concave aspect of the scoliotic deformity once the material hardens.
Movements evaluated
-------------------
We evaluated those movements which can be performed in a seated position and which were thought to be capable of varying the corrective forces exerted on the scoliotic curvatures and rib humps by the brace \[[@B9],[@B10],[@B3]\]. The movements could either enhance or reduce the pressure of the pad. The following movements were tested:
1\. kyphotization: a generalized flexion of the whole dorsal spine;
2\. rotation against the pad of the brace: a movement of the apical aspect of the curvature against the pad of the brace;
3\. \"escape from the pad\" movement \[[@B3],[@B30]\]: a movement of the apical aspect of the curvature in the same direction as that of the passive corrective | {
"pile_set_name": "PubMed Central"
} |
Background
==========
Human parvovirus B19 is considered an important trigger of aplastic crisis in patients with chronic congenital hemolytic disorders.
Case report
===========
We describe the case of a young adult known with hereditary microspherocytosis who presented with fever, marked agitation and confusion and a slight left hemiparesis. The cerebral imaging revealed multiple giant cystic Virchow-Robin spaces, but no other abnormalities. The complete blood counts showed pancytopenia and the peripheral blood smear revealed reticulocytopenia, confirming the diagnosis of aplastic crisis. Human parvovirus B19 infection was proven by the detection of serum DNA using PCR technique. After the initiation of packed red cells transfusion a favorable outcome was seen and his neurologic symptoms fully remitted.
Conclusion
==========
Direct invasion of human parvovirus B19 may induce both aplastic crisis and acute encephalopathy in patients with hereditary spherocytosis. Human parvovirus B19 may induce aplastic crisis but also acute encephalopathy through direct invasion, although in our case the transient neurological symptoms were rather an effect of hypoxia.
| {
"pile_set_name": "PubMed Central"
} |
Abbreviations used in this paper: α1-AT, α1-antitrypsin; COPII, coat protein II; ERGIC, ER Golgi intermediate compartment; MCFD2, multiple coagulation factor deficiency protein 2; MEF, mouse embryonic fibroblast; PCA, protein fragment complementation assay.
Introduction
============
The lumen of the ER provides a unique oxidizing environment for protein folding and modification. One third of all newly synthesized proteins are translocated into the ER and processed by multiple ER resident enzymes. An elaborate quality-control system monitors the conformational state of the nascent proteins and retains them in the ER during the folding process ([@bib10]). Upon correct folding, proteins are exported from the ER in coat protein II (COPII) vesicles ([@bib13]). Although transmembrane proteins can directly interact with the cytosolic COPII coat ([@bib6]), some soluble luminal proteins require cargo receptors for their selective recruitment into COPII vesicles ([@bib7]; [@bib5]). The best characterized mammalian cargo receptor is the oligomeric type I membrane lectin ERGIC-53 ([@bib27]). ERGIC-53 cycles between the ER and ER Golgi intermediate compartment (ERGIC), captures soluble glycoproteins in the lumen of the ER, and binds COPII by means of a dihydrophobic ER export motif in its cytosolic tail ([@bib12]; [@bib3]). As a cargo receptor, ERGIC-53 mediates ER export of coagulation factors V and VIII and cathepsin C and Z ([@bib17]; [@bib30]; [@bib2]). Furthermore, ERGIC-53 was recently shown to assist the assembly of IgM polymers in the ER ([@bib1]). With only few ERGIC-53 cargo proteins identified, however, it is not known whether receptor-mediated ER export is the predominant mechanism for the transport of soluble proteins. A major problem in identifying cargo--receptor complexes is their transient nature in a unique ionic and oxidizing environment. Further, existing proteomic techniques for identifying protein--protein interactions (e.g., affinity purification/mass spectrometry or the yeast two-hybrid system) are not easily applicable or are not appropriate to the study of membrane proteins. However, protein fragment complementation assays (PCAs) do allow for detection of both transient and dynamic protein--protein interactions in intact living cells, including those for membrane proteins ([@bib24]; [@bib15]). A PCA based on a YFP variant (citrine) has been demonstrated to be applicable to protein--protein interactions inside the lumen of the secretory pathway ([@bib19]). In the YFP PCA, nonfluorescent N- and C-terminal fragments of YFP (YFP1 and YFP2) are individually fused to the coding sequences of two separate proteins and expressed in mammalian cells. If the two fusion proteins interact, the fragments of YFP are brought into proximity, permitting folding and reconstitution of fluorescent YFP in vivo. Using this specific and sensitive assay, we have demonstrated that the oligomerization of ERGIC-53 and its interactions with multiple coagulation factor deficiency protein 2 (MCFD2) and cathepsin C and Z were readily visible in living cells. Here, we describe a YFP PCA--based cDNA library screening strategy for the identification of novel ERGIC-53 cargo proteins. The screening of a human adult liver cDNA library identified α1-antitrypsin (α1-AT) as novel interaction partner of ERGIC-53 and our validation studies establish ERGIC-53 as a transport receptor of α1-AT.
Results and discussion
======================
Based on a general PCA cDNA library screening strategy ([@bib22],[@bib23]), we developed a screening approach designed to identify proteins that bind to cargo receptors in the ER lumen. ERGIC-53 was used as bait and was N-terminally tagged with YFP2, which localizes YFP2 to the luminal side of the membrane and allows screening for protein--protein interactions inside the lumen of the ER. Prey proteins were C-terminally tagged with YFP1 and expressed from a cDNA-YFP1 fusion library ([Fig. 1](#fig1){ref-type="fig"}).Figure 1.**Strategy of the ERGIC-53 cargo hunt based on YFP PCA.** (A) Schematic representation of the YFP PCA approach to screen for ERGIC-53 cargo proteins in the lumen of the secretory pathway. YFP PCA is based on the reconstitution of functional YFP from two nonfluorescent fragments that are brought into close proximity by two interacting proteins. YFP2 was fused to the ERGIC-53 bait protein, whereas YFP1 was fused to a human liver cDNA library to express YFP1-tagged prey proteins. (B) The YFP2--ERGIC-53 bait protein was expressed from the kanamycin-resistant pCMV vector, whereas the cDNA-YFP1 library was constructed in the ampicillin-resistant pcDNA3 vector. (C) Flow chart of the screening strategy. This fusion orientation assures that library-encoded secretory and membrane proteins reach the lumen of the ER because N-terminal signal sequences are not perturbed. However, we do not expect to identify known ERGIC-53 interaction partners with this cDNA-YFP1 library because of specific characteristics of these proteins or because of the specific orientation of the prey YFP1 toward cytosol. For example, C-terminal tagging cathepsin Z and C impedes the interaction with ERGIC-53 ([@bib19]), whereas MCFD2-YFP1 is unlikely to be identified because its interaction with ERGIC-53 strictly depends on the full-length MCFD2 protein ([@bib21]). Further, the interaction of ERGIC-53 with itself cannot be detected because the oligomerization of ERGIC-53 requires its transmembrane domain ([@bib18]), which localizes the YFP1 of all oligomerization-competent YFP1--ERGIC-53 prey proteins to the cytosol. This compartment-specific topological requirement is a unique feature of the PCA approach, providing information about the orientation of membrane-associated prey proteins. Our C-terminal tagging strategy requires that library inserts lack their stop codon to avoid termination of translation in front of the YFP1 sequence. To this end, we used cDNAs generated by randomly primed reverse transcription of mRNA, which enriches the 5′ ends. cDNA inserts were subcloned from a human adult liver cDNA library into mammalian pcDNA3 expression vectors containing YFP1 in all three reading frames. The resulting cDNA-YFP1 library contained ∼10^6^ clones and inserts ranged from ∼1 to ∼2.5 kb in size. As expected for a library generated from a secretory tissue like liver, cDNAs encoding secretory proteins were well represented (Fig. S1, available at <http://www.jcb.org/cgi/content/full/jcb.200709100/DC1>).
The YFP PCA--based cDNA library screen was performed in COS-1 cells, which express the large T antigen and replicate plasmids containing the SV40 eukaryotic origin of replication. Because of this feature, cDNA-YFP1 library plasmids will be replicated upon transfection, which ensures sufficient expression of individual prey proteins and simplifies recovery and analysis of positive clones. Coexpression of YFP2--ERGIC-53 and the cDNA-YFP1 library resulted in the detection of 1.63% yellow fluorescent COS-1 cells, and YFP PCA can fully account for the detected signal because few positive cells were obtained upon expression of YFP2--ERGIC-53 or the cDNA-YFP1 library alone ([Fig. 2 A](#fig2){ref-type="fig"}).Figure 2.**Screening of the cDNA-YFP1 library for ERGIC-53 interaction partners.** (A) COS-1 cells were transfected with the indicated bait and prey constructs and analyzed by FACS as described in Materials and methods. Coexpression of YFP2--ERGIC-53 and the cDNA-YFP1 library resulted in the specific detection of 1.63% YFP positive (YFP^+^) cells. In a nonsaturating screen, ∼500 fluorescent cells were collected by FACS and total DNA was extracted and transformed into bacteria, which resulted in the recovery of several hundred prey clones. (B) 48 prey clones were randomly selected and plasmids were isolated and individually assayed by YFP PCA with YFP2--ERGIC-53 in COS-1 cells. Fluorometric analysis revealed that prey plasmids 17, 32, 33, and 44 (indicted by red boxes) were positive and reconstitute fluorescent YFP when expressed with YFP2--ERGIC-53. Bars represent fluorometric values of a single screening experiment. The threshold for a positive hit was set to 250 arbitrary fluorescence units, which corresponds to a ∼1.5-fold induction in YFP fluorescence in comparison to untransfected cells. (C) Sequence analyses identified α1-AT as a cDNA insert in all four positive prey plasmids. In the screen, YFP2--ERGIC-53 and the cDNA-YFP1 library were transfected at a ratio of 10:1 to reduce the number of library plasmids transfected per cell. This lowered the percentage of positive cells to 0.12% (unpublished data). Several hundred YFP-positive cells were collected by FACS and prey clones were recovered, 48 of which were individually reanalyzed by YFP PCA in COS-1 cells. Coexpression with YFP2--ERGIC-53 resulted in positive YFP signals for prey plasmids numbered 17, 32, 33, and 44 ([Fig. 2 B](#fig2){ref-type="fig"}). The recovery of only 4 positives out of 48 reanalyzed prey plasmids is not because of the unspecificity of our assay but rather the uptake of several prey plasmids per transfected cell. A YFP-positive cell contains the positive prey plasmid as well | {
"pile_set_name": "PubMed Central"
} |
1. Introduction {#sec1}
===============
*Orostachys japonicus* (*O. japonicus*) is traditionally used as an inflammatory agent, antifebrile, homeostatic agent, and antidote and anticancer agent \[[@B1]\]. The methanol extract of*Orostachys japonicus*is thought to contain several different classes of phytochemicals, including triterpenes, sterols, and flavonoids \[[@B2]\]. Inflammation is caused by a variety of factors, including physical and chemical agents, the immune response, and tissue necrosis \[[@B3]\]. However, further studies on*O. japonicus* are required due to the lack of information on signaling pathways and physiological activity.
Immune cells can recognize pathogen-associated molecules, such as the lipopolysaccharide (LPS) of Gram-negative bacteria, the peptidoglycan (PGN) of Gram-positive bacteria, and mannans of yeast cells through toll-like receptors (TLRs) expressed on the cell surface \[[@B4]\]. Humans have various pathogen-recognition receptors including TLRs, nucleotide-binding oligomerization domain- (NOD-) like receptors (NLRs), and retinoic acid-inducible gene-1- (RIG-1-) like receptors \[[@B5]--[@B7]\]. These receptors transduce signals to activate nuclear factor-*κ*B (NF-*κ*B), which subsequently drives the induction of several proinflammatory cytokines and chemokines \[[@B8]--[@B10]\]. TLRs are an integral component of the inflammation process. TLR2 and TLR4, along with their ligands, are best characterized in terms of innate responses to bacteria, including*Chlamydia*. TLR2 is involved in the recognition of a broad range of microbial products, and TLR4 is the signal-transducing receptor for LPS \[[@B11]\]. NOD1 and NOD2 are involved primarily in mediating antibacterial defenses \[[@B12]\]. NOD1 recognizes mainly Gram-negative bacteria, whereas NOD2 recognizes most Gram-positive and Gram-negative bacteria \[[@B13]\].
Inducible nitric oxide synthase (iNOS) is expressed widely in various cell types and is highly expressed in LPS-activated macrophages \[[@B14]\]. Expression of the iNOS gene in macrophages is regulated mainly at the transcriptional level. NF-*κ*B is a pivotal regulator of important immunoregulatory genes involved in immune and inflammatory responses, including iNOS \[[@B15]\]. Cyclooxygenase-2 (COX-2) is expressed in the presence of many proinflammatory mediators, including LPS, interlukin-1*β* (IL-1*β*), and tumor necrosis factor-*α* (TNF-*α*), through which high concentrations of prostaglandin E~2~ (PGE~2~) are produced \[[@B16]\]. iNOS and COX-2 expression are regulated by NF-*κ*B. NF-*κ*B is a transcription factor that regulates several genes, including iNOS, COX-2, IL-1*β*, IL-6, and TNF-*α*, which are important for immunity and LPS-induced inflammation \[[@B17]\]. NF-*κ*B is activated by phosphorylation of inhibitory *κ*B*α* (I*κ*B*α*) through activation of mitogen-activated protein kinases (MAPKs), such as c-Jun N-terminal kinase (JNK), p38, and extracellular signal-regulated kinase (ERK)1/2 \[[@B18], [@B19]\]. In the present study, we investigated the effects of*O. japonicus* on the expression of genes encoding pathogen-recognition receptors (TLR2, TLR4, NOD1, and NOD2) and proinflammatory factors (iNOS, COX-2, and cytokines) in LPS-stimulated PMA-differentiated THP-1 cells, as well as the NF-*κ*B and MAPK pathways.
2. Materials and Methods {#sec2}
========================
2.1. Extraction of*O. japonicus* {#sec2.1}
--------------------------------
*O. japonicus* (20 g) was extracted by overnight incubation at 60°C in 500 mL of 80% methanol. The solution was filtered through Whatman No. 1 filter paper and concentrated using a rotary evaporator (Buchi, Flawil, Switzerland). The concentrated extract was freeze-dried (EYELA, Tokyo, Japan) and stored at 4°C in a vacuum container until use.
2.2. Cell Culture {#sec2.2}
-----------------
Human monocytic leukemia THP-1 cells were supplied by the Korean Cell Line Bank. Cells were cultured in RPMI 1640 medium (GIBCO, Grand Island, NY, USA) containing 10% fetal bovine serum and antibiotics. Cells were incubated at 37°C in a humidified atmosphere of 5% CO~2~ in 95% air. THP-1 cells were treated with 100 nM of phorbol myristate acetate (PMA, Sigma-Aldrich Co., St. Louis, MO, USA) for 72 h to induce differentiation into macrophages. After differentiation, nonattached cells were removed by aspiration and adherent macrophages were washed with RPMI 1640 medium three times and then incubated in cell culture medium at 37°C.
2.3. Cell Viability {#sec2.3}
-------------------
Cell proliferation was measured with CellTiter 96 Aqueous One Solution (Promega, Madison, WI, USA). Cells were seeded at 1 × 10^4^ per well in 96-well plates and incubated with different concentrations of*O. japonicus* at 37°C for 24 h, respectively. Cell viability was determined using a colorimetric assay with PMS/MTS solution. The absorbance was determined at 490 nm with background subtraction at 650 nm.
2.4. Treatment with*O. japonicus* {#sec2.4}
---------------------------------
THP-1 cells were pretreated for 2 h in serum-free medium with*O. japonicus* (0--25 *μ*g/mL) and then incubated with LPS (1 *μ*g/mL) for 4 h (for mRNA expression) and 20 h (for protein expression). At each time point, total RNA and protein were isolated from the cultured THP-1 cells.
2.5. RNA Extraction and Real-Time PCR {#sec2.5}
-------------------------------------
Total RNA was purified from cultured cells using the TRIzol reagent following the manufacturer\'s protocol (Invitrogen, Carlsbad, CA, USA). First-strand cDNA synthesis was performed with 1 *μ*g of total RNA and it was transcribed to cDNA using a reverse transcription system with random hexamers (Promega) according to the manufacturer\'s protocol. The sequences for gene-specific primers were as follows: TLR2, 5′-TCTCCCATTTCCGTCTTTTT-3′ and 5′-GGTCTTGGTGTTCATTATCTTC-3′ (125 bp); TLR4, 5′-GAAGCTGGTGGCTGTGGA-3′ and 5′-TGATGTAGAACCCGCAAG-3′ (213 bp); NOD1, 5′-GTCACTGAGGTCCATCTGAAC-3′ and 5′-CATCCACTCCTGGAAGAACCT-3′ (363 bp); NOD2, 5′-CATGTGCTGCTACGTGTTCTC-3′ and 5′-CCTGCCACAATTGAAGAGGTG-3′ (226 bp); iNOS, 5′-TGGATGCAACCCCATTGTC-3′ and 5′-CCCGCTGCCCCAGTTT-3′ (59 bp); COX-2, 5′-CAAATCCTTGCTGTTCCCACCCAT-3′ and 5′-GTGCACTGTGTTTGGAGTGGGTTT-3′ (173 bp); IL-1*β*, 5′-TGATGGCTTATTACAGTGGCAATG-3′ and 5′-GTAGTGGTGGTCGGAGATTCG-3′ (140 bp); IL-6, 5′-GTGTTGCCTGCTGCCTTC-3′ and 5′-AGTGCCTCTTTGCTGCTTTC-3′ (194 bp); IL-8, 5′-GACATACTCCAAACCTTTCCAC-3′ and 5′-CTTCTCCACAACCCTCTGC-3′ (160 bp); TNF-*α*, 5′-ATCTTCTCGAACCCCGAGTG-3′ and 5′-GGGTTTGCTACAACATGGGC-3′ (51 bp); *β*-actin, 5′-GCGAGAAGATGACCCAGATC-3′ and 5′-GGATAGCACAGCCTGGATAG-3′ (77 bp). Real-time PCR was performed on the StepOneplus real-time PCR system with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster, CA, USA). PCR was performed with 1 *μ*L of cDNA in 20 *μ*L reaction mixtures that consisted of 10 *μ*L Power SYBR Green PCR Master Mix, 2 *μ*L primers, and 7 *μ*L PCR-grade water. The reactions were performed with a denaturation step at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The crossing point of target genes with *β*-actin was calculated using the formula 2^−(target gene−*β*-actin)^, and the relative amounts were quantified. | {
"pile_set_name": "PubMed Central"
} |
Introduction {#sec1-2331216515569792}
============
Cochlear implants (CIs) are neural prostheses for individuals who have severe or profound hearing loss. These devices consist of an array of electrodes that are inserted into the inner ear to stimulate the auditory nerve. The auditory nerve has a tonotopic organization, such that the frequency information carried by the nerve fibers changes systematically and in a topographic manner, with high frequencies represented by neurons that synapse near the basal end of the spiral cochlea and low frequencies represented by neurons that synapse closer to the apex. As such, different electrodes along the array are intended to activate specific populations of auditory nerve cells. By presenting each electrode with information from a limited frequency range, the prosthesis ideally recreates a tonotopic representation of sound in the implanted ear.
To adjust the dynamic range of the electrical current delivered to each electrode to the dynamic range of the acoustic input, audiologists have typically used psychophysical measures of the lowest detectable current level, called threshold, and the current level that is most comfortable for listening, called most comfortable level (MCL). Recently, however, some manufacturers have moved away from recommending threshold measurements, in part because the measurement procedure is considered too time consuming, and because thresholds are often quite uniform across the electrode array.
One reason for the relatively uniform absolute thresholds across the electrode array is the broad electrical field produced by the monopolar (MP) stimulation used in most commercially available implant systems. The broad stimulation fields produce uniform thresholds but also lead to poor tonotopic representation (e.g., [@bibr5-2331216515569792]). The poor tonotopic representation is thought to underlie at least some of the difficulties faced by CI users in understanding speech, especially in noisy environments (e.g., [@bibr7-2331216515569792]; [@bibr12-2331216515569792]; [@bibr15-2331216515569792]).
In contrast to the single active electrode utilized for MP stimulation, focused stimulation can be achieved with CIs by manipulating the spatial arrangement of current delivery across the electrode array. Several such electrode configurations have been proposed over the past 20 years, including bipolar (BP), tripolar (TP), and partial tripolar (pTP), as well as the quadrupolar (QP) configuration employed in this study ([@bibr8-2331216515569792]; [@bibr18-2331216515569792]). These configurations have been shown to produce narrower excitation patterns than MP stimulation, both physiologically ([@bibr5-2331216515569792]; [@bibr9-2331216515569792]; [@bibr21-2331216515569792]) and psychophysically ([@bibr4-2331216515569792]; [@bibr10-2331216515569792]; [@bibr13-2331216515569792]; [@bibr14-2331216515569792]). Although early studies failed to find clear perceptual benefits of focused stimulation ([@bibr16-2331216515569792]; [@bibr24-2331216515569792]; [@bibr26-2331216515569792]), at least one recent study has shown improved understanding of speech in noise using pTP stimulation when compared with MP stimulation ([@bibr22-2331216515569792]). Because focused stimulation produces narrower excitation patterns, it also commonly leads to more variable thresholds between electrodes. This is presumably because the density of surviving neurons and the distances between electrodes and those neurons are typically not uniform along the cochlear array ([@bibr3-2331216515569792]; [@bibr13-2331216515569792]; Teymouri et al., 2011). Therefore, if the use of focused stimulation techniques becomes more commonplace, threshold measurements may be reinstituted as a necessary step in fitting CIs in the clinic.
In acoustic hearing, fast methods for measuring thresholds and psychophysical tuning curves have been developed and validated for similar purposes. These methods are based on a variant of the Bekesy tracking technique (e.g., [@bibr25-2331216515569792]), in which a listener adaptively adjusts the level of a tone, which glides slowly upward or downward in frequency, in order to maintain a threshold level of perception ([@bibr19-2331216515569792]; [@bibr20-2331216515569792]). With these variants, the listener presses a button to indicate a tone is audible while the frequency of the tone is gliding. The level of the sound increases when the button is released and decreases when it is pressed. At face value, these methods appear difficult to implement in CIs because of the discrete nature of electrodes that represent sound frequency. However, technology in a subset of currently available CIs allows for quasi-continuous sweeps by using current steering---the stimulation of two neighboring electrodes simultaneously with a variable ratio of current between them, allowing for pitch percepts that are intermediate to those produced by the stimulation of the electrodes individually.
This study used virtual current sweeps to implement a procedure based on the Bekesy tracking method, thereby providing a rapid and clinically feasible measure of threshold across the electrode array. Thresholds obtained with this new method were compared with thresholds obtained using a traditional adaptive forced-choice procedure. The test--retest reliability of the two procedures was assessed, along with the respective test times. All procedures were performed with both a broad MP and focused QP electrode configuration.
Methods {#sec2-2331216515569792}
=======
Subjects {#sec3-2331216515569792}
--------
Fifteen postlingually deafened adults participated; all were implanted with the Advanced Bionics (Valencia, CA) HiRes90K CI. One subject was bilaterally implanted (S23, left ear and S36, right ear) to give a total of 16 ears tested. Details are shown in [Table 1](#table1-2331216515569792){ref-type="table"}. Ten of the subjects were tested at the University of Washington in Seattle (subject identifiers with an "S") while the remaining five subjects were tested at the University of Minnesota in Minneapolis (subject identifiers with a "D"). The respective Human Subjects Review Boards approved all procedures, and all subjects provided written informed consent. Table 1.Subject Demographics.Subject codeGenderAge at start of experiment (Years)CI use prior to experiment (Years)EtiologyDuration bilateral severe-profound hearing loss prior to implant (Years)D24M64.36.9Unknown progressive27D26F55.05.5Unknown11D28F65.611.6Familial progressive SNHL7D33M74.71.3Noise exposure; Trauma\<1D38F32.61.3Sudden SNHL\<1S22F73.66.9Unknown progressive11.7S23M69.07.0Unknown progressive, sudden loss 10 years ago7.9S28F74.75.0Autoimmune disease18.7S29M82.05.0Unknown progressive34.0S30F49.010.0Unknown progressive16.0S36^[a](#table-fn1-2331216515569792){ref-type="table-fn"}^M69.14.5Unknown progressive, sudden loss 8 years ago3.5S38M48.83.6Otosclerosis18.3S40M51.71.3Enlarged vestibular aqueduct46.4S41M48.65.6Maternal rubella1.2S42M63.812.6Sudden loss33.5S43M68.40.6Unknown progressive17.9[^1]
Stimuli {#sec4-2331216515569792}
-------
Biphasic, charge-balanced, cathodic-phase-first pulse trains were used. Phase durations were 97 µs and the pulse rate was 997.9 pulses per second. Each pulse train was 200.4 ms in duration and was presented either in MP or QP configuration (see [Figure 1](#fig1-2331216515569792){ref-type="fig"}). All stimuli were presented and controlled using research hardware and software ("BEDCS") provided by the Advanced Bionics Corporation (version 1.18). Programs were written using the MATLAB programming environment, which controlled low-level BEDCS routines. Identical software and hardware were used at both testing sites (Minneapolis and Seattle). Figure 1.Schematic of steered QP (left) and MP (right) electrode configurations. QP consists of four adjacent electrodes; two active electrodes and two flanking return electrodes that share a fraction of the return current. The remaining current is delivered to an extracochlear ground electrode. Alpha represents the ratio of current for the two active electrodes. An alpha of 0 (a) indicates all stimulating current is delivered to the more apical electrode (panel a), while an alpha of 1 (c) indicates all current is directed to the basal electrode (panel c). Alpha equal to .5 (b) indicates half of the stimulating current is applied to each of the two active electrodes (panel b). In the MP configurations (right), all of the return current is delivered to the extracochlear ground electrode. Alpha nomenclature is the same for both configurations, and electrodes more apical are to the right.
The stimulation procedures for current focusing and steering with the QP configuration are illustrated in [Figure 1](#fig1-2331216515569792){ref-type="fig"}. The QP configuration consists of two active electrodes and two adjacent flanking electrodes. With full QP, two flanking electrodes carry all of the return current evenly, which theoretically produces the most restricted current spread. With partial QP (left column of [Figure 1](# | {
"pile_set_name": "PubMed Central"
} |
Sevoflurane is a volatile anesthetic with a low blood--gas partition coefficient and produces a rapid induction and recovery of anesthesia \[[@r16]\]. During last decade, clinical use of sevoflurane has been spreading in veterinary practice. Sevoflurane is minimally metabolized and easily cleared in animals, however, it should be remembered that sevoflurane has a dose-dependent depressant effect on cardiorespiratory function in dogs \[[@r22]\]. Because of these side effects, sevoflurane must be carefully titrated, and vigilant monitoring should be employed to avoid excessive anesthetic depth. The term of balanced anesthesia usually refers to the use of different drugs in combination to provide hypnosis, analgesia and muscle relaxation \[[@r25]\]. Administration of analgesic drugs as a part of the balanced anesthesia is sparing with requirements of anesthetic drugs, including sevoflurane, thereby reducing their depressant effects on the cardiovascular system and improving the quality of anesthesia \[[@r24]\].
Minimum alveolar concentration (MAC) is defined as the partial pressure of a gas that produces immobility in 50% of individuals exposed to a supramaximal noxious stimulation \[[@r12]\]. The MAC is the standard measure to evaluate inhaled anesthetic potency \[[@r27]\]. Lidocaine is a sodium channel blocker, and its intravenous infusion can be spared with anesthetic requirements in dogs undergoing surgery \[[@r9], [@r19], [@r31]\]. It is also reported that the intravenous infusion of lidocaine decreases the MAC of isoflurane \[[@r21], [@r36]\] and sevoflurane \[[@r7], [@r11], [@r20]\] in a dose-dependent manner in dogs. Studies in humans and in dogs suggest that low doses of alpha~2~-adrenergic agonists may produce the sparing effects of anesthetic requirements and analgesia with minimal impact on cardiovascular function \[[@r1],[@r2],[@r3], [@r24]\]. In dogs, dexmedetomidine has been shown to reduce the anesthetic requirement for induction and maintenance of general anesthesia \[[@r2], [@r8], [@r24], [@r34]\]. Therefore, it is expected that the balanced anesthesia using a combination of lidocaine and dexmedetomidine infusion may decrease sevoflurane requirement and therefore may reduce the incidence of its side effects.
The aim of the present study was to evaluate the effects of constant rate infusion (CRI) of a combination of lidocaine and dexmedetomidine on the MAC of sevoflurane in dogs. The authors suggest the hypothesis that the combination of lidocaine with dexmedetomidine significantly reduces the MAC of sevoflurane in dogs.
MATERIALS AND METHODS {#s1}
=====================
*Animals and experimental protocol*: Seven adult mixed-breed neutered dogs, age 1--2 years, three males and four females and body weight (mean ± SD) 18.1 ± 9 kg, were included in a prospective randomized cross-over experiment with a 2-week washout period between treatments. Dogs were considered to be healthy on the basis of medical history, physical examination, complete blood count (CBC) and serum biochemical analysis. Food but not water was withheld 8 hr prior to each anesthetic procedure. This study was planned as a randomized crossover trial. Each dog was anesthetized three times and received one of the following three treatments: 1) an intravenous (IV) loading dose (LD) of 2 mg/kg lidocaine (Lidocaína 2% Inyectable: Pisa, México) followed by lidocaine 6 m*g*/kg/hr CRI (LIDO), 2) LD of 2 *µ*g/kg IV dexmedetomidine (Dexdomitor, Orion Corporation, Espoo, Finland, 0.5 mg/m*l*) followed by dexmedetomidine 2 *µ*g/kg/hr CRI (DEX) and 3) LDs of lidocaine 2 mg/kg IV and dexmedetomidine 2 *µ*g/kg IV followed by lidocaine 6 mg/kg/hr and dexmedetomidine 2 *µ*g/kg/hr CRI (LIDO--DEX). Loading doses were diluted up to a final volume of 3 m*l* with sterile water and administered IV over 1 min. Treatments were diluted up to 60 m*l* with saline 0.9% and delivered as a CRI accordingly. All CRIs were started immediately after bolus administration using a syringe infusion device (Colleague, Baxter Healthcare Corporation Medication Delivery, Deerfield, IL, U.S.A.). The sevoflurane MAC was determined before (SEV-MAC~BASAL~) and during one of the three CRI treatments (SEV-MAC~LID~, SEV-MAC~DEX~ and SEV-MAC~LID-DEX~) in each dog. This study was approved by the animal research ethics committee of the Universidad Autonoma de Mexico with protocol number 2267/2010.
*Anesthetic procedure and instrumentation*: A 20-gauge catheter was aseptically placed into the cephalic vein. Anesthesia was induced with an intravenous administration of propofol (Fresofol 1%, Fresenius Kabi, Pimble, Australia) at a dose of 6 mg/kg. Orotracheal intubation was performed in all dogs with an appropriately sized, cuffed endotracheal tube that was attached to a circle anesthetic rebreathing system (Fabius Dragër Medical GmbH 23542, Lübeck, Germany). Anesthesia was maintained with sevoflurane (Sevorane Abbott Laboratories, Bogota, Colombia) vaporized in 100% oxygen with a flow rate of 2 l/min (Dragër medical, AG&CO, KGaA, Lubeck, Germany, Dragër Vapor 2000). All dogs were administered lactate Ringer's solution at a flow rate of 3 m*l*/kg/hr through the catheter by the use of an infusion pump (Colleague, Baxter Healthcare Corporation Medication Delivery) and mechanically ventilated with intermittent positive-pressure ventilation (IPPV) (Fabius Dragër Medical GmbH Lübeck) to maintain eucapnia (35--40 mmHg of end-tidal CO~2~) during the anesthesia. End-tidal concentration of sevoflurane SEVO (ET~SEV~) and ETCO~2~ was continuously monitored by a side-stream infrared gas analyzer (Dräger Vamos, Dräger Medical GmbH). Dogs were placed in lateral recumbency, and a 22-gauge catheter was aseptically placed in the dorsal metatarsal artery and attached to an electrical transducer (DTX Plus DT-4812, Becton Dickinson Critical Care Systems Pte Ltd., Singapore) connected to a multi-parameter monitor (WL Surgivet V9212SR 2009-01, Smith Medical PM Inc., Waukesha, WI, U.S.A.). Systolic, diastolic and mean arterial blood pressures (SAP, DAP and MAP, respectively) were continuously monitored via a blood-pressure transducer system connected to the dorsal pedal artery (DTX plus^®^ DT 4812, Becton Dickinson Critical Care Systems Pte Singapore Ltd.). The zero reference point of the pressure transducer was set at the level of the heart. Heart rate and rhythm (EGG lead II) and pulse oximetry were also continuously monitored by placing the electrodes at the level of the elbows and left patella and an infrared sensor attached to the dog's tongue, respectively (WL Surgivet V9212SR 2009-01, Smith Medical PM Inc.). A circulating warm-water blanket was used to maintain the esophageal temperature between 37.5 and 38.5°C.
*MAC determination*: Following the propofol induction, the dogs had been anesthetized for at least 90 min as an initial equilibration period at an ET~SEV~ of 2.7% to minimize the effects of propofol. The determination of SEV-MAC~BASAL~ for each dog was started after the initial equilibration period. Once the SEV-MAC~BASAL~ was determined, dogs were received the CRI treatment of lidocaine, dexmedetomidine or combination. The SEV-MAC~LID~, SEV-MAC~DEX~ and SEV-MAC~LID-DEX~ were determined after 45 min equilibration period of the CRI treatments \[[@r15], [@r36]\]. Cardiovascular parameters and other variables were recorded immediately before the determination of minimum alveolar concentration (MAC) of sevoflurane.
MAC was determined by use of a previously described technique. Noxious stimulation was applied by clamping a paw of the third or fourth digits. The clamping technique was performed with 24-cm sponge forceps (with protective plastic tubing on each jaw) clamped to the first notch until gross purposeful movement was detected or a period of 60 sec elapsed \[[@r35]\]. A negative response included the lack of movement of head and limbs, muscle rigidity, shivering, tail movement, couching, swallowing or an increase in spontaneous respiratory efforts during controlled ventilation. When a positive response was elicited, the ET~SEV~ was increased by 0.1% and maintained at this concentration for at least 20 min, and the noxious stimulus procedure was repeated. When a negative response was detected, the ET~SEV~ was decreased by 0.1% and maintained at this concentration for at least 20 min, and the noxious stimulus procedure was repeated. The procedure was continued until purposeful movement ceased (increase in anesthetic concentration) or returned (decrease in anesthetic concentration). The sevoflurane MAC was calculated as a mean value between the highest | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Clear cell sarcoma of soft tissue (CCSST) is a malignant mesenchymal tumor that mostly affects young adults and tends to affect the lower extremities, close to the tendon and aponeuroses \[[@CR1]\]. Histologically, CCSSTs have epithelioid tumor nests accompanied by some spindling areas, and wreath-like multinucleated giant cells. CCSSTs present with a melanocytic differentiation and often express melanocytic markers including S-100 protein, melanoma antigen (Melan-A), human melanoma black 45 (HMB45), microphthalmia-associated transcription factor (MITF), and SRY-Box 10 (SOX-10) on immunohistochemistry (IHC). Ultrastructurally, CCSST has premelanosomes in the cytoplasm of tumor cells and shares some characteristic features with malignant melanomas (MMs). MMs genetically have BRAF mutations, although CCSST lacks this mutation. Clear cell sarcoma-like gastrointestinal tumor (CCSLGT) is also a malignant mesenchymal tumor that shares some pathological features with CCSST and arises from the gastrointestinal tract, such as the small and large intestine, and stomach. CCSLGT was originally reported to be an "osteoclast-rich tumor of the gastrointestinal tract with features resembling clear cell sarcoma of the soft parts" \[[@CR2]\] and the first case of CCSLGT was reported by Alpers et al. \[[@CR3]\] as a "malignant neuroendocrine tumor of the jejunum with osteoclast-like giant cells" in 1985. Subsequently, the term CCSLGT was first used by Kosemehmetoglu et al. \[[@CR4]\] in their review, which included 13 CCSLGT cases. However, some authors have proposed using the term "malignant gastrointestinal neuroectodermal tumor," because CCSLGTs lack melanocytic differentiation on IHC and ultrastructural examination and appear to have poorer prognosis \[[@CR5]\]. Although CCSLGT has a similar histology to CCSST in some respects, such as a clear cytoplasm and epithelioid cells, there are some differing characteristics. CCSLGT has a pseudo-papillary growth pattern and many osteoclast-type giant cells, and the tumor cells tend to be positive for S-100 protein but show less expression of melanocytic markers on IHC \[[@CR6]\]. Genetically, CCSST and CCSLGT usually have characteristic chimeric fusions of Ewing sarcoma breakpoint region 1 (*EWSR1*) with cAMP response element-binding protein (*CREB*) gene family members, *EWSR1-*activating transcription factor 1 (*ATF1*) and *EWSR1-CREB1*, which were derived from each translocation of t(12;22)(q13;q12) and t(2;22)(q34;q12), respectively \[[@CR7]--[@CR10]\]. *EWSR1-ATF1* fusion is much more frequent than *EWSR1-CREB1* fusion, but *EWSR1-CREB1* fusion of CCSLGT is comparatively often observed.
In this study, we used fluorescence *in situ* hybridization (FISH) and reverse transcription polymerase chain reaction (RT-PCR) to perform genetic analyses of 22 cases of CCSSTs and CCSLGTs, and compared their different chimeric fusion types.
Methods {#Sec2}
=======
Case selection {#Sec3}
--------------
The study protocol for the collection of tumor samples and clinical information were approved by the Institutional Review Board of Sapporo Medical University Hospital (Sapporo, Japan; No. 292--3012). We selected 22 cases of clear cell sarcoma (CCS) including 16 CCSST and 6 CCSLGT cases from the clinicopathological archive at the Department of Surgical Pathology, Sapporo Medical University Hospital. We reviewed all hematoxylin and eosin-stained sections and confirmed that each case fulfilled the histologic criteria of CCSST and CCSLGT.
Immunohistochemistry {#Sec4}
--------------------
We evaluated previously reported IHC findings of melanocytic markers, including S-100 protein, Melan-A, HMB45, and SOX-10, and assessed their positivity. We also performed additional IHC using representative sections from formalin-fixed and paraffin-embedded tissues in some cases. These tissues were sliced into 3-mm-thick sections and examined with an automated IHC system at Sapporo Medical University Hospital. All slides were loaded into a PT Link module (Agilent Technologies, Santa Clara, CA) and subjected to a heat-induced antigen-retrieval protocol with EnVision FLEX Target Retrieval Solution (Agilent Technologies) before being transferred to the Autostainer Link 48 instrument (Agilent Technologies) and Dako Omnis (Agilent Technologies). We used antibodies against the following antigens: S-100 protein (polyclonal; Agilent Technologies), Melan-A (A103; Agilent Technologies), HMB45 (HMB45; Agilent Technologies), and SOX-10 (N-20; Santa Cruz Biotechnology, Santa Cruz, CA).
Fluorescence *in situ* hybridization {#Sec5}
------------------------------------
We performed FISH using the specimens obtained from tumor materials and 4 μm slices on glass slides. First, we selected an area showing representative histology and marked a 5-mm-diameter circle with a marker on the glass slides for FISH analyses. We performed FISH using dual color break apart probe for EWSR1 (Abbott, Abbott Park, IL), ATF1 (Empire Genomics, Buffalo, NY), CREB1 (Empire Genomics), and CREM (Empire Genomics). FISH was conducted as previously described \[[@CR11]\], with the following modifications: baking (1 h at 60 °C), deparaffinization, target gene activation (20 min with 0.2 M HCl followed by 30 min with pretreatment solution at 80 °C), enzyme treatment (60 min with protease solution at 37 °C), re-fixation (10 min in 10% formalin neutral buffer solution), denaturation (5 min with denaturation solution at 72 °C), washing and dehydration (1 min each in 70%, 85%, and 100% ethanol), hybridization with 10 mL DNA probe solution (5 min at 90 °C followed by 48 h at 37 °C), and washing with post-hybridization wash buffer (2 min at 72 °C). As a counterstain, 10 μL 4,6-diamidino-2-phenylindole was added. Slides were coverslipped for viewing under a fluorescence microscope.
To detect the presence of *EWSR1*, *ATF1, CREB1*, and *CREM* rearrangements, we counted 50 nuclei in tumor cells that showed a pair of fused and split signals, and calculated the percentage of split signals. The signals were considered split when the distance between the red and green signals was at least twice the estimated signal diameter. We did not evaluate any truncated and overlapping cells in FISH analysis. We considered the specimen to be "split positive" if split signals were observed in more than 10% of tumor cells \[[@CR12]\].
Reverse transcription-polymerase chain reaction {#Sec6}
-----------------------------------------------
We detected chimeric fusions by RT-PCR using fresh tumor samples in several available cases. RT-PCR analysis was performed for *EWSR1-ATF1* and *EWSR1-CREB1* fusions. For RT-PCR detection of the *EWSR1-ATF1* and *EWSR1-CREB1* fusions, we used the forward primer EWSex7-F1 with either the CREB1ex7-RevA primer (binds both *CREB1* and *ATF1*; sequence: TCCATCAGTGGTCTGTGCATACTG) or the CREB1ex7-RevC primer (specific for *CREB1*; sequence: GTACCCCATCGGTACCATTGT) \[[@CR1], [@CR7], [@CR13]\].
Results {#Sec7}
=======
Clinical findings {#Sec8}
-----------------
This study involved 8 male and 14 female patients with a mean age of 40 years (range, 8--78 years). Mean tumor size was 4.6 cm (range, 2--10). The anatomical locations were deep soft tissue of the upper (*n* = 6) and lower (*n* = 8) extremities, esophagus (*n* = 1), small intestine (*n* = 5), abdominal wall (n = 1), and skin (n = 1). The primary site in Case 13 was the upper extremity, but a specimen was not available, so we used lymph node specimens of metastatic lesions. Mean follow-up duration was 38 months (range, 3--249 months; Table [1](#Tab1){ref-type="table"}).Table 1Summary of clinical, immunohistochemical, and genetic findings of CCSST and CCSLGT casesNo.Age (years) /SexLocationTumor size (cm)Outcome (months)ImmunohistochemistryFluorescence in situ hybridization (%)Expected fusion genes by FISHRT-PCR findingsS-100 proteinMelan-A and/or HMB45SOX-10EWSR1ATF1CREB1CREM129/FLeg5DOD (73)++NP72482NP*EWSR1-ATF1*NP241/MLeg4DOD (62)++NP68NDNDNP*EWSR1*- (unknown | {
"pile_set_name": "PubMed Central"
} |
{
"pile_set_name": "PubMed Central"
} | |
T. W. Ford, P. A. Kirkwood. Sympathetic discharges in intercostal and abdominal nerves. Physiol Rep, 6 (11), 2018, e13740, <https://doi.org/10.14814/phy2.13740>
**Funding Information**
This experimental work was supported by the Jeanne Anderson Fund (Institute of Neurology), the Wellcome Trust (038027/Z/93/Z/1.5), the Canadian MRC and the International Spinal Research Trust (STR 032).
Introduction {#phy213740-sec-0001}
============
It is well recognized that the naturally occurring efferent discharges of intercostal nerves in an anesthetized or decerebrate animal may include discharges of both alpha and gamma motoneurones (Eklund et al. [1964](#phy213740-bib-0008){ref-type="ref"}; Sears [1964b](#phy213740-bib-0027){ref-type="ref"}; De Troyer et al. [2005](#phy213740-bib-0006){ref-type="ref"}). However, there is a third category of efferent discharges usually present in muscle nerves, those arising from the sympathetic innervation. To our knowledge, the discharges of these efferents have not been described for the intercostal nerves. Furthermore, there are few descriptions of muscle nerve sympathetic discharges recorded during ongoing somatic motoneurone activity (for refs see Boulton et al. ([2016](#phy213740-bib-0004){ref-type="ref"})). The intercostal nerves provide a unique set of nerve branches for investigation of sympathetic activity under such conditions. These branches, in a range of sizes, innervate various intercostal and abdominal muscles with different patterns of respiratory drive.
The nature of the intercostal nerve sympathetic discharges became a matter of interest for us during current work, in which we are reanalyzing cross‐correlation measurements of connections from expiratory bulbospinal neurones to thoracic motoneurones following spinal cord lesions (Ford and Kirkwood [1995](#phy213740-bib-0010){ref-type="ref"}), with a view to separately identifying connections to gamma and alpha motoneurones on the basis of efferent spike size. Separation of gamma from alpha discharges (i.e., the choice of the upper border of spike sizes for the gamma population) may be made by reference to the criteria used by Sears ([1964b](#phy213740-bib-0027){ref-type="ref"}), but the lower size limit for the gamma population seems to be more of a problem. Inspection of recordings of the discharges at high gain revealed a dense population of very small spikes, down to the limit of discrimination from noise. It seemed likely that these discharges were those of postganglionic sympathetic efferents, but since our investigations were being made post hoc, from existing recordings, there was no possibility of identifying them by any experimental procedure. We have therefore looked for their cardiac modulation. This is a well‐known property, indeed often an identifying criterion, in other studies of muscle nerve sympathetic outflow (e.g., Boulton et al. [2014](#phy213740-bib-0003){ref-type="ref"}). We find that such a modulation was indeed present for these spikes for all the categories of nerves, though of a relatively modest strength. A particularly interesting feature of the presumed sympathetic discharges thus identified was that their amplitudes for the largest nerves were found to approach those of the gamma spikes.
Material and Methods {#phy213740-sec-0002}
====================
The recordings examined came from experiments for which the main results have already been reported and were conducted according to UK legislation \[Animals (Scientific Procedures) Act 1986\] under Project and Personal Licences issued by the UK Home Office. The data came from 17 cats of either sex, weighing 2.5--3.7 kg. Twelve of these (vagotomized) came from the experiments reported by Saywell et al. ([2007](#phy213740-bib-0024){ref-type="ref"}, [2011](#phy213740-bib-0025){ref-type="ref"}) and the other 5 (vagus nerves intact) from those reported by Road et al. ([2013](#phy213740-bib-0022){ref-type="ref"}). The animals were anesthetized with sodium pentobarbitone (initial dose 37.5 mg kg^--1^ I.P., then I.V. as required). Neuromuscular blockade was achieved by using gallamine triethiodide (subsequent to surgery, I.V., repeated doses 24 mg as required) and the animals were artificially ventilated via a tracheal cannula with oxygen‐enriched air, to bring the end‐tidal CO~2~ fraction initially to about 4%. CO~2~ was then added to the gas mixture to raise the end‐tidal level sufficient to give a brisk respiratory discharge in the mid‐thoracic intercostal nerves (typically 6--7%). During neuromuscular blockade, anesthesia was assessed by continuous observations of the patterns of the respiratory discharges and blood pressure together with responses, if any, of both of these to a noxious pinch of the forepaw. Only minimal, transient responses were allowed before supplements (5 mg kg^--1^) of pentobarbitone were administered. The animal was supported by vertebral clamps, a clamp on the iliac crest and a plate screwed to the skull. Rectal temperature was maintained between 37°C and 38°C by a thermostatically controlled heating blanket. Mean blood pressures, measured via a femoral arterial catheter, were above 80 mmHg throughout.
Nerve recordings {#phy213740-sec-0003}
----------------
These were originally made either during spike‐triggered averaging measurements or for cross‐correlation measurements to investigate the connections from expiratory bulbospinal neurones to motoneurones or to spinal interneurones. The recordings were made from the cut central ends of selected nerves via pairs of platinum wire electrodes and with conventional amplification (filter settings 300 Hz to 3 kHz). Thoracic nerves were maintained in a single paraffin oil pool constructed from skin flaps and the lumbar nerves were recorded under petroleum jelly, most often with a piece of thin plastic film separating the electrodes from underlying muscle. These recordings were stored on magnetic tape and subsequently acquired for computer analysis via a 1401 interface and Spike2 software (Cambridge Electronic Design, Cambridge, UK). Sampling rates were around 8--10 kHz, varying according to the number of channels sampled.
In the first group of 12 cats, the recordings examined consisted of one external intercostal nerve in either T5 or T6, from one experimental run in each cat, each run being a period (no stimuli being delivered) used for intracellular recording from a motoneurone or an interneurone (1--23 min). To investigate cardiac modulation, an ECG signal was obtained from a cord dorsum recording, originally used for monitoring afferent nerve volleys during the initial testing of the motoneurones or interneurones (Saywell et al. [2011](#phy213740-bib-0025){ref-type="ref"}; Ford et al. [2014](#phy213740-bib-0012){ref-type="ref"}).
In the second group of five cats, longer runs of data (52--100 min) originally obtained for cross‐correlation measurements, were available (one run from each cat). Recordings from one external intercostal nerve (T5 or T6) and 3--6 internal intercostal nerves or nerve branches (T8--T11) from the left side of each cat were included. These branches included the following nerves on the left side of T8 and/or T9 (four cats): (1) one of the filaments of the internal intercostal nerve, which are the naturally occurring branches that leave the nerve at intervals to innervate the internal intercostal muscle layer (Sears [1964a](#phy213740-bib-0026){ref-type="ref"}); (2) the lateral branch of the internal intercostal nerve, which innervates external abdominal oblique; (3) the distal remainder of the internal intercostal nerve, which innervates the more distal part of the internal and parasternal intercostal muscles, transversus abdominis, and rectus abdominis (see Meehan et al. [2004](#phy213740-bib-0018){ref-type="ref"} for refs). In the fifth cat, the whole internal intercostal nerves of T9 and of T11 were included, together with those of T9, T10 and T11 on the right side. In addition, in two of the animals, recordings from branches of the L1 ventral ramus were also available, including (in both animals) a branch innervating internal abdominal oblique and a distal remainder (for more details see Road et al. [2013](#phy213740-bib-0022){ref-type="ref"}). In only one of this group of five animals was there a cord dorsum recording that could be used to provide an ECG signal, but in the other four an ECG signal could be derived from one of the nerve recordings, in each case a nerve with a relatively modest efferent discharge.
Analysis {#phy213740-sec-0004}
--------
This consisted firstly of visual inspection of the efferent discharge signals, concentrating on the smallest spikes viewed at high gain, secondly of the construction of cross‐correlation histograms between efferent spikes in different spike‐amplitude ranges, with *R*‐wave | {
"pile_set_name": "PubMed Central"
} |
A hallmark of tumor cells is their ability to grow anchorage independent. Proliferation and survival of tumor cells, determining progression of solid tumors, are independent of signals elicited by interactions with the surrounding extracellular matrix (ECM^1^; [@B17]). In contrast, normal diploid cells require anchorage to the ECM for proliferation as well as survival ([@B9]). Several lines of direct evidence show that integrins transduce these signals ([@B42]).
Integrins are the most important family of cell surface receptors that mediate cell--matrix interactions ([@B26]). They are heterodimers of noncovalently linked α and β subunits. So far 15 different α subunits and 8 different β subunits are known. The β1 subunit can associate with at least 10 different α subunits forming the largest subfamily of integrins. Members of the β1 integrin subfamily primarily bind to components of the ECM such as fibronectin, collagens, and laminins, but some of them also participate in direct cell--cell adhesion ([@B26]; [@B22]). The cytoplasmic domain of β1 integrin can directly interact with cytoskeletal proteins such as talin and α-actinin and with signal transducing proteins such as focal adhesion kinase (FAK; [@B37]) and integrin-linked kinase ([@B23]).
Integrin engagement and clustering regulate shape, motility, survival, and proliferation of cells. These events are executed by integrin-mediated cascades of intracellular signals that include tyrosine phosphorylation of FAK ([@B21]), increases in intracellular Ca^2+^ levels ([@B38]), intracellular pH ([@B39], [@B40]), inositol lipid synthesis ([@B30]), and expression of cyclins ([@B20]). Furthermore, it has been demonstrated that integrins can also mediate the activation of protein kinase C ([@B45]), mitogen-activated protein kinase ([@B32]) and NF-κB ([@B46]). In addition to these adhesion-mediated signaling pathways, many cells depend on growth factor--mediated signals for appropriate cell cycle progression and proliferation.
In the present study we have used β1 integrin--deficient embryonic stem (ES) cells (Fässler al., 1995) to induce teratomas in syngeneic mice. ES cells as well as pre- or early postimplantation embryos of most mouse strains develop into tumors when transplanted into an ectopic location of syngeneic animals ([@B8]; [@B7]). These tumors are composed of various differentiated somatic tissues and are called teratomas. We show that β1-null ES cells give rise to either very small or no teratomas. The most prominent changes that are associated with the impaired growth in β1-null teratomas are abnormal depositon of ECM proteins and various defects in basement membranes. Furthermore, β1-null teratomas showed an inefficient angiogenesis. A number of studies have demonstrated convincingly that tumor growth is dependent on angiogenesis ([@B16]). Tumor angiogenesis is regulated by factors produced by tumor cells as well as by cell adhesion molecules expressed on endothelial cells. Systemic or local administration of antibodies or cyclic RGD peptides blocking αvβ3 integrin function inhibits tumor angiogenesis and as a consequence promotes tumor regression ([@B4]). This anti-angiogenic effect of the αvβ3 antagonists results from the activation of apoptosis of newly sprouting blood vessels ([@B5]). We now show that β1 integrin plays an essential role during angiogenesis in teratomas. In normal teratomas both host- and ES cell--derived endothelial cells contribute to angiogenesis. In contrast, in β1-null teratomas, all vascular cells are exclusively derived from the host. Furthermore, we report that vascular endothelial growth factor (VEGF) treatment--induced proliferation of endothelial cells and extensive branching of blood vessels in normal but not in β1-null embryoid bodies.
MATERIALS AND METHODS
=====================
Cells and Cell Culture
----------------------
The following ES cells were used to induce teratomas: wild-type ES cell line D3 (+/+; [@B11]); G119 (+/−), which is heterozygous for the β1 integrin gene mutation; G101 (+/+), which is wild-type for β1 integrin gene but mock transfected; and G201 (−/−) which is β1 integrin deficient ([@B14]). In the cell clones G119 and G201, a fusion DNA of β-galactosidase and neomycin is inserted in frame with the ATG of the β1 integrin gene ([@B14]). The cell clone G101 contains a randomly integrated β-galactosidase gene that is ubiquitously expressed.
ES cells were cultured in the absence of a fibroblast feeder layer in DME, supplemented with 20% heat-inactivated FCS (GIBCO BRL, Gaithersburg, MD), 0.1 mM β-mercaptoethanol (Sigma Chemical Co., St. Louis, MO), 1× non-essential amino acids (GIBCO BRL), and 1,000 U/ml recombinant leukemia inhibiting factor (GIBCO BRL).
For differentiation, ES cells were cultured in hanging drops as described previously ([@B15]). Briefly, 600 cells were cultured in 20 μl of DME, supplemented with 20% FCS hanging from the lid of the culture dish for 5 d, which allows the formation of cell aggregates (embryoid bodies). Subsequently, the aggregates were plated on Tissue Tek chambers (Nunc, Wiesbaden, Germany) and incubated for 7, 15, or 20 d, respectively, fixed in 4% paraformaldehyde and immunostained for von Willebrand Factor (Behringwerke Ag, Marburg Lahn, Germany) and platelet endothelial cell adhesion molecule (PECAM) ([@B43]).
Alternatively, after outgrowth of cell aggregates for 20 d, cells were trypsinized and cultured on gelatin-coated glass cover slips for 24 h, fixed, and stained for von Willebrand Factor (vWF) or PECAM. Positive cells were counted using an Axiophot fluorescence microscope (Carl Zeiss, Oberkochen, Germany).
For VEGF treatment, ES cells were cultured in hanging drops for 2 d, in bacteriological dishes for 3 d, and then plated on gelatinized glass cover slips for another 12 d. The culture medium was DME, containing 20% FCS with either 10 or 20 ng/ml VEGF (R&D Sytems, Wiesbaden, Germany).
Antibodies
----------
The following primary antibodies were used: rabbit anti--rat β1 integrin; hamster anti--mouse β3 integrin; hamster anti--mouse αv integrin (both from PharMingen, San Diego, CA); hen anti--human FN ([@B28]); rabbit anti--mouse FN (GIBCO BRL); goat anti-collagen type I; goat anti-collagen type III (both from Southern Biotechnology Associates Inc., Birmingham, AL); rat anti--mouse nidogen ([@B12]); rat anti--mouse PECAM-1 ([@B43]); and rabbit anti-- mouse vWF (Behringwerke).
The following secondary antibodies were used: goat anti--rabbit FITC; goat anti--rabbit Cy3; rabbit anti--hamster FITC; goat anti--chicken FITC; donkey anti--goat Cy3; goat anti--rat Cy3 (Jackson Immunoresearch Lab. Inc., West Grove, PA), rabbit anti-digoxygenin FITC (Boehringer Mannheim, Mannheim, Germany), biotinylated goat anti--rabbit Ig (Vector Laboratories, Inc., Burlingame, CA), biotinylated goat anti--rat Ig (Amersham Intl., Little Chalfont, UK), and streptavidin-horseradish peroxidase conjugate (Amersham Intl.).
Teratoma Induction
------------------
10^7^ ES cells were trypsinized, washed twice, suspended in 100 μl PBS, and then injected subcutaneously on the back of syngeneic 129/SV male mice. After 21 or 28 d, tumors were surgically removed and frozen in ice-cold isopentan. To analyze cell proliferation, 25 mg per 100 g body weight of the thymidine analogue bromodeoxyuridine (BrdU) was injected intraperitoneally 2.5 h before the excision of the tumors.
Microscopical Analysis of Embryoid Bodies and Tumor Tissue
----------------------------------------------------------
### Light microscopy.
For light microscopical examination, small pieces of teratomas and 20-μm-thick immunostained cryosections were dehydrated conventionally in a graded ethanol series, and finally infiltrated with and embedded in araldite (Serva, Heidelberg, Germany). Semithin sections of 1--2 μm were analyzed using a Zeiss Axiophot microscope (Carl Zeiss), with or without methylene blue staining.
### Histochemistry.
Teratomas were surgically removed, frozen in ice-cold isopentan, and stored at −80°C. Tissue specimens were cut into 10-μm-thick sections and collected on glass slides (Shandon, Frankfurt, Germany). Hematoxylin/Eosin and lacZ staining followed published protocols ([@B14]). Stained sections were analyzed using a Zeiss Axiophot microscope.
### Cell proliferation.
Incorporation of intraperitoneally injected BrdU into the DNA of replicating teratoma cells was analyzed using anti-BrdU monoclonal antibodies, following the protocol supplied by the manufacturer (Boehringer Mannheim).
Similarly, proliferation of cells in embryoid bodies was assayed after addition of BrdU to the culture medium and incubation for another 2 h. Embryoid bodies were fixed as described above, and then processed following the manufacturer\'s protocol. For development of the immunostaining 3,3-di | {
"pile_set_name": "PubMed Central"
} |
Introduction {#section1-1176934319838818}
============
Lily is a perennial bulbous flower in the monocotyledon subclass, *Liliaceae* family and *Lilium* genus, with an extremely high ornamental value. China is a large producer of lily cut flowers. As the planting of lily continues and the planting area of lily expands, lily diseases are becoming more serious. Lily basal rot (also known as root rot or stem rot) has become one of the most important diseases endangering lily. It is a soil-borne disease that mainly harms the underground part of the plant, resulting in wilting, yellowing, and rotting of the bulbs. This disease seriously affecting the yield and quality of lily and resulting in huge economic losses.^[@bibr1-1176934319838818]^ *Fusarium oxysporum* f. sp. *lilii* is the main pathogen that causes lily basal rot.^[@bibr2-1176934319838818]^ *F. oxysporum* can survive for a long time as mycelium in the bulbs or as mycelium, chlamydospore, or sclerotium with diseased residue in the soil. At present, chemical control methods are the main measures to prevent and control lily basal rot. However, due to the soil-borne nature and the development of pathogenic resistance of this disease, chemical control methods have shown dwindling effects.^[@bibr3-1176934319838818]^ At the same time, long-term, large-scale, and repeated use of chemical pesticides causes environmental pollution. Therefore, selective breeding of resistant varieties is the preferred choice to control lily basal rot.
The germplasm resources of *Lilium* species highly resistant to *F. oxysporum* have an important role in cultivating lily varieties against this disease. To date, no wild *Lilium* species or cultivars showing complete resistance to lily basal rot have been found, but several wild *Lilium* species and cultivars are highly resistant to it.^[@bibr4-1176934319838818]^ Among lily cultivars, Asian lily hybrid is highly resistant and Oriental lily is the least resistant.^[@bibr4-1176934319838818]^ The lily germplasm resources in China are abundant. Some wild species with strong disease resistance, such as *Lilium henryi, Lilium pumilum*, and *Lilium regale*, have been widely used in disease resistance breeding.^[@bibr4-1176934319838818]^
Although the germplasm resources of *Lilium* species resistant to *F. oxysporum* have been used in disease-resistant breeding, the molecular mechanism of disease resistance is rarely reported. In 2013, a cDNA library of the root of *F. oxysporum*--infested *Lilium regale* was constructed by suppression subtractive hybridization and 180 sequences homologous to known proteins in the model plant by sequencing analysis, most of which belonged to pathogenesis-related (PR) 3, PR10, glutathione S-transferase, cytochrome P450, antioxidant enzymes, and peroxidases, were obtained.^[@bibr5-1176934319838818]^ In 2012, *Lilium leichtlinii* var. *maximowiczii* Baker was used to construct suppression subtractive hybridization library of lily after induced by *F. oxysporum*. They identified 6 types of disease-resistant expressed sequence tags (ESTs), including serine/threonine protein kinase, glutathione S-transferase, peroxidase, and cyclophilin homologs.^[@bibr6-1176934319838818]^ The above 2 studies identified some genes of lily in response to *F. oxysporum* infection, but the mechanism of this resistance has not been investigated in depth. Some studies have used the molecular marker system to construct the genetic map of Asian lily backcross populations. To date, a total of 10 potential quantitative trait loci (QTLs) for *F. oxysporum* resistance have been mapped.^[@bibr7-1176934319838818]^,^[@bibr8-1176934319838818]^ However, none of these studies identified the specific genes involved in *F. oxysporum* resistance. Therefore, the molecular mechanism of resistance to *F. oxysporum* in lily needs to be further studied.
In this study, *L. pumilum* that was highly resistant to *F. oxysporum* was used as the experimental material. High-throughput transcriptome sequencing technology combined with bioinformatics method was applied to identify genes related to *F. oxysporum* resistance in *L. pumilum*, understand the function of these genes, and fully integrate the regulatory network, thereby clarifying the molecular mechanism of lily resistance-associated genes in response to pathogen invasion. Our findings will lay a theoretical foundation for the cloning of disease-resistance-associated genes and for disease-resistance breeding.
Materials and Methods {#section2-1176934319838818}
=====================
The tissue culture seedlings of wild *L. pumilum* with the same genetic background were used in the experiment. The pathogen *F. oxysporum* was isolated from the plants with the symptom of lily basal rot in the Greenhouse of Beijing University of Agriculture. *L. pumilum* and *F. oxysporum* were stored in the Lily Breeding Laboratory, College of Landscape Architecture, Beijing University of Agriculture.
*F. oxysporum* was inoculated on *potato dextrose agar* (PDA) medium and cultured at 27°C for 7 days. The spores were washed with sterile water and adjusted to 1 × 10^6^ spores/mL for the subsequent inoculation. The tissue culture seedlings of *L. pumilum* grew at 25°C under a 16/8 h light/dark period. The tissue culture seedlings of *L. pumilum* with a bulb diameter 1 to 1.5 cm and strong root tissue were selected for *F. oxysporum* inoculation. For each treatment, 3 bottles with 3 plant tissue culture seedlings in each bottle were used for inoculation, and each seedling was inoculated with 600 µL of spore suspension. *L. pumilum* tissue culture seedlings were inoculated with sterile water at the same time as the control group. The roots of the tissue culture seedlings in the treatment group and the control group were collected at 6, 12, or 24 h after inoculation and immediately frozen in liquid nitrogen. The samples were stored at −80°C for later use. The 3 time-point samples for *F. oxysporum* inoculation were named F6h, F12h, and F24h, respectively, and the corresponding samples for the control group were named M6h, M12h, and M24h.
The total RNA of the samples was extracted using the RNAprep Pure Plant Kit (TIANGEN Ltd; Beijing, China). After the obtained sample was tested, the eukaryotic mRNA was enriched using magnetic beads with Oligo (dT). Subsequently, fragmentation buffer was added to break the mRNA into short fragments. The mRNA was used as the template to synthesize a single strand of cDNA, followed by the addition of buffer, dNTPs, DNA polymerase I, and RNase H to synthesize the double-stranded cDNA, which was purified with AMPure XP beads. The purified double-stranded cDNA was first subjected to end repair by adding poly-A tails and linking to the sequencing adaptor, and then AMPure XP beads were used for the selection based on fragment size. Finally, polymerase chain reaction (PCR) amplification was performed, and the PCR product was purified with AMPure XP beads to obtain the final library. After the library was constructed, Qubit 2.0 was used for the preliminary quantification, and the library was diluted to 1.5 ng/µL. The insert size of the library was detected using an Agilent 2100 Bioanalyzer. When the expected insert size was detected, the effective concentration of the library was accurately quantified (effective concentration of the library \>2 nM) to ensure the quality of the library.
The constructed cDNA library was sequenced by Illumina HiSeq 2500 sequencing platform (Illumina, Inc, San Diego, CA, USA) from Novogene. The raw reads from sequencing were filtered. Clean reads were collected after removing reads with the adaptor and those of low quality. The clean reads were spliced by Trinity.^[@bibr9-1176934319838818]^ The resulting transcript sequence was used as a reference for the subsequent analysis. The longest transcript in each gene was used as a Unigene. Functional annotation was carried out for the obtained Unigenes with 7 major databases: National Center for Biotechnology Information (NCBI), non-redundant protein (Nr), NCBI nucleotide sequences (Nt), Protein family (Pfam), euKaryotic Ortholog Groups (KOG), Swiss-Prot, Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Ontology (GO).
Using Bowtie2 software, the clean reads were aligned to the assembled Unigene library, and the results were statistically analyzed using RNA-Seq by Expectation Maximization (RSEM) software to further obtain the number of read counts for each gene sample corresponding to each gene.^[@bibr10-1176934319838818]^,^[@bibr11-1176934319838818]^ The expression of the Unigene was calculated using the fragments per kb per million fragments (FPKM) method.^[@bibr12-1176934319838818]^ The read- | {
"pile_set_name": "PubMed Central"
} |
**A Primer of Ecology with R**
M. Henry H. Stevens
New York:Springer, 2009. 388 pp. ISBN: 978-0-387-89881-0, \$64.95
**Acute Exposure Guideline Levels for Selected Airborne Chemicals: Vol. 8**
Committee on Acute Exposure Guideline Levels; Committee on Toxicology; National Research Council
Washington, DC:National Academies Press, 2009. 434 pp. ISBN: 978-0-309-14515-2, \$84.50
**Carbon Sinks And Climate Change Forests in the Fight Against Global Warming**
Colin A.G. Hunt
Northhampon, MA:Edward Elgar Publishing, 2009. 256 pp. ISBN: 978-1-84720-977-1, \$110
**Contemporary Issues In International Environmental Law**
Malgosia Fitzmaurice
Northhampon, MA:Edward Elgar Publishing, 2009. 256 pp. ISBN: 978-1-84542-283-7, \$99
**Ecological Economics, 2nd ed.: Principles and Applications**
Herman Daly, Joshua Farley
Washington, DC:Island Press, 2009. 488 pp. ISBN: 978-1-59726-681-9, \$75
**Environmental Law Handbook, 20th ed.**
Daniel M. Steinway, et al.
Cincinnati, OH:ACGIH, 2009. 975 pp. ISBN: 978-1-60590-278-4, \$99
**Global Sources of Local Pollution: An Assessment of Long-Range Transport of Key Air Pollutants to and from the United States**
Committee on the Significance of International Transport of Air Pollutants; National Research Council
Washington, DC:National Academies Press, 2009. 250 pp. ISBN: 978-0-309-14398-1, \$42
**Governing The Environment: Salient Institutional Issues**
Albert Breton, Giorgio Brosio, Silvana Dalmazzone, Giovanna Garrone, eds.
Northhampon, MA:Edward Elgar Publishing, 2009. 978 pp. ISBN: 978-1-84720-397-7, \$140
**Inorganic Chromium (III) Compounds**
World Health Organization
Geneva:WHO Press, 2009. 102 pp. ISBN: 978-9-2415-3076-7, \$20
**International Handbook On The Economics of Energy**
Joanne Evans, Lester C. Hunt, eds.
Northhampon, MA:Edward Elgar Publishing, 2009. 848 pp. ISBN: 978-1-84720-352, \$330
**Night Noise Guidelines for Europe**
WHO Regional Office for Europe
Geneva:WHO Press, 2009. 180 pp. ISBN: 978-9-2890-4173-7, \$40
**Our Choice: A Plan to Solve the Climate Crisis**
Al Gore
London:Bloomsbury Publishing, 2009. 416 pp. ISBN: 978-0-7475-9098-9, \$20.90
**Technonatures: Environments, Technologies, Spaces, and Places in the 21st Century**
Damian F. White, Chris Wilbert, eds.
Waterloo, ON:Wilfrid Laurier University Press, 2009. 282 pp. ISBN: 978-1-55458-150-4, \$38.95
| {
"pile_set_name": "PubMed Central"
} |
All protein array data files are available from the Array Express database (accession number E-MTAB-7622).
Introduction {#sec001}
============
The absence of Reelin--a glycoprotein crucial for physiological retinogenesis--has been recently associated with changes in both Nerve Growth Factor (NGF) protein and mRNA in the retina \[[@pone.0212732.ref001]--[@pone.0212732.ref003]\]. NGF and Reelin have been reported to take actively part in neurogenesis and retinogenesis \[[@pone.0212732.ref004]--[@pone.0212732.ref006]\]. NGF has been hypothesized to interact with Reelin by modulating neuronal migration, neurodevelopment and other physiological processes in the central nervous system and retina \[[@pone.0212732.ref001],[@pone.0212732.ref002],[@pone.0212732.ref007]\]. NGF activities encompass cell proliferation, cytoskeletal reorganization, migration, differentiation, survival and/or apoptosis \[[@pone.0212732.ref004],[@pone.0212732.ref008]\]. In the retina, NGF modulates retinal cell development, differentiation and functional activity, and promotes survival/recovery of Retinal Ganglion Cells (RGCs), photoreceptors and optic axons after experimental injuries as well as normal functional and anatomical development of visual acuity and binocularity \[[@pone.0212732.ref004],[@pone.0212732.ref008]--[@pone.0212732.ref010]\].
The neurodegenerative process occurring in *Reeler* retina evolves through a series of changes at different cell types (neural, vascular and glial cells) and comprises several overlapping/interrelated molecular pathways \[[@pone.0212732.ref005]\]. Glial cell activation (astrocytes, Müller cells and resident microglia) represents a crucial step for protecting neurones from degeneration \[[@pone.0212732.ref007]\]. Müller cells work in concert with other glial cells and neurones to guarantee optimal development of retinal structure \[[@pone.0212732.ref009]--[@pone.0212732.ref012]\]. An open question regards the glia cell activation upon Reelin deficiency and the possibility for NGF to maintain retinal homeostasis via glial cell activation, as observed in other neuronal degenerating tissues \[[@pone.0212732.ref013],[@pone.0212732.ref014]\].
Therefore, the aim of this study was to look for some proinflammatory/profibrogenic mediator changes in the vitreous and retina as well as glial cell activation in the retina of *Reeler* mice.
Materials and methods {#sec002}
=====================
Animals and ethical approval {#sec003}
----------------------------
Eighteen (18) animals were used for the study, including 9 *Reeler* (RELN^-/-^; 9--11 gr body-weight) and 9 WT (RELN^+/+^; B6C3Fe; 12--14 gr body-weight) mice (Charles River, Calco, Como). Experimental procedures were approved by the Ethical Committee of Tor Vergata University (Rome, Italy), according with ethical standards stated in the Declaration of Helsinki and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. All the steps in the procedure were in compliance with the directive 2010/63/EU guidelines, under the authorization provided by the Italian Ministry of Health. All efforts were made to minimize suffering.
All analytic and molecular grade reagents were purchased from Carlo Erba (Milan, Italy), Euroclone (Milan, Italy) and Sigma (Milan, Italy), otherwise specified in the text. Daily produced MilliQ RNAse-free water was provided for biochemical and molecular purposes (Direct Q5; Millipore Corp., Billerica, MA).
Experimental procedure: Vitreous and retina {#sec004}
-------------------------------------------
At postnatal day (p) p14, p21 and p28, mice were anaesthetized by intraperitoneal injection of 2 mg/mL ketamine (0.2 mL/10 gr body-weight; Ketavet, Gellini Pharmaceutics, Italy) and 0.23 mg/mL medetomidine (0.24 mL/10 gr body-weight; Domitor, Orion Corp., Espoo, Finland) mixture. Sampling was carried out under a dissecting microscope (SMZ645; Nikon, Tokyo, Japan) equipped with cold-light optic fibers (PL2000 photonic; Axon, Vienna, Austria), as previously reported with slight modifications \[[@pone.0212732.ref002]\]. A corneal incision was produced and lens, retina and vitreous were collected in a microvial with separating membrane. Centrifugation (13.000rpm/15min) was performed to detach vitreous from retina and lens. Vitreous (left/right eyes) and retina (right eye) were appropriately stored for biochemical and molecular studies. Other retinas (left eye) were used for immunofluorescent analysis.
Vitreous and retina (n = 3/time-point; *Reeler* and WT mice) were diluted / extracted in modified RIPA Buffer (50mM Tris-HCl, 150mM NaCl, 1% Triton-X100, 5mM EDTA, 100mM NaF and 1mM PMSF; pH 7.5) and finally sonicated (VibraCell Sonics, Inc., Newtown, USA), according to a standard procedure \[[@pone.0212732.ref002]\]. Total proteins were quantified with Nanodrop Spectrophotometer (A1000, Celbio, Milan, Italy).
Protein array {#sec005}
-------------
A customised chip-based array was used to quantify inflammatory/profibrogenic factors in vitreous and retinal lysates, between a list of potential candidates (G-series arrays; Ray Biotech, Norcross, CA). Each glass-slide comprised 14 identical sub-arrays containing 50 factors (antibody spots in duplicate) retrospectively selected by literature search \[[@pone.0212732.ref015]--[@pone.0212732.ref018]\]. *Reeler* and WT samples were processed simultaneously. Briefly, normalized protein extracts (50μg total protein; 70μL per well) were diluted in appropriate buffer and hybridized in sub-arrays. Washing, detection and labelling steps were performed according to the manufacturer's recommendation. Spin-dried slides were scanned in a GenePix 4100A Microarray platform (Molecular Devices LLC, Sunnyvale, Silicon-Valley, CA). Capturing conditions and image digital acquisitions were done as previously reported \[[@pone.0212732.ref019]\]. Images were uniformly adjusted for size, brightness, contrast and chip-to-chip comparisons by the software and provided as 8-bit Tiff format (Axon GenePix Pro 6.0.1.25 software; Molecular Devices). Inter-assay normalization was guaranteed by the presence of multiple internal controls for each sub-array. The sensitivity range was 3.8--56 pg/mL, as provided by the manufacturer. Microarray data are available in the ArrayExpress database (<http://www.ebi.ac.uk/arrayexpress>) under accession number E-MTAB-7622.
NGF ELISA {#sec006}
---------
Samples were further diluted 1:2 in assay diluent (10mM PB, 150mM NaCl, 0.5% BSA, 0.1% Triton X100 and 1x protease inhibitor cocktail (Pierce---Thermo Fisher Scientific Inc.; Waltham, MA USA); Ph 7.5). Briefly, 96-well Maxisorp enzyme-linked immunoassay plates (Nunc, Roskilde, Denmark) were precoated with monoclonal anti-βNGF antibodies (0.4 μg/mL; MAB256; R&D Systems Inc, Minneapolis, Minnesota, USA). Standards (0.15 pg/mL to 1 ng/mL βNGF; Alomone Labs, Jerusalem, Israel) and samples were incubated at 4°C for 18 hours. ELISA was developed by using polyclonal biotinylated anti-NGF antibodies (0.15 μg/mL, BAF256; R&D), horseradish peroxidase streptavidin (1:300; DY998, R&D) and the ready-to-use TMB substrate (eBioscience, San Diego, CA, USA). Under these conditions, no cross reactivity with Brain Derived Neutrophic Factor (BDNF) or Neutrophins 3/4/5 was observed. The colorimetric signals (Optic Density, OD; λ450-570nm) were quantified using the Sunrise plate reader (Tecan Group Ltd., Männedorf, Switzerland) and the related mean values (pg/mL) were produced according to 3^rd^ grade polynomial standard curve and normalized to total protein content (A280; Nanodrop).
Total RNA extraction, cDNA synthesis and real-time PCR analysis {#sec007}
---------------------------------------------------------------
Total RNA was extracted from retinas according to the TRIfast procedure (EuroClone) and rehydrated in 10μL fresh RNAse free MilliQ water, before treating with RNase-Free DNaseI (2U/μL; AM-1907; Turbo DNA free kit; Ambion Ltd., Huntingdon, Cambridgeshire, UK). Quantity and purity (\>1.8; A280 program, Nanodrop) as well as sign of RNA degradation (1% agarose gel analysis) were checked. cDNAs were generated from normalised templates (1μg RNA) (ImProm-II Reverse Transcription System; Promega Corp., Madison, USA) in a One Cycler programmable thermocycler (PeqLab Biotech, Erlangen, Germany) and amplified using the SYBR Green PCR core reagent kit (Applied Biosystems, Foster City | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
The number of total hip arthroplasties (THA) carried out in Germany has increased in recent years up to 160,000 annually \[[@CR1]\]. The main reasons for this are the aging of the population and technical improvements in orthopedic surgery. The current rate of prosthetic joint infection (PJI) in Europe and the United States is around 0.6--1.0% for THA \[[@CR1]--[@CR3]\]. This indicates that not only the number of THA increasing, but also the absolute numbers of infections.
Treatment for PJI depends on the duration of symptoms. Early or hematogenous infections, with symptoms for less than 4 weeks, can be treated with local debridement and retention of the implant. In patients with late infections, one-stage or two-stage procedures are necessary \[[@CR4]\].
As success rates are above 90%, two-stage revision is the first choice for patients with late PJI in Germany \[[@CR5], [@CR6]\]. Either cemented or cementless revision systems can be used \[[@CR5]--[@CR9]\]. Cemented fixation was used for reimplantation in the past, because it allows antibiotics to be used in the cement to reduce the risk of recurrent infection \[[@CR7], [@CR8]\]. However, following good results with cementless fixation in aseptic surgery \[[@CR10], [@CR11]\], there have been increasing numbers of publications describing successful cementless fixation in two-stage revision procedures \[[@CR3], [@CR5], [@CR12]--[@CR17]\].
The aim of the present study was to evaluate clinical and functional outcomes with the Modular Universal Tumor And Revision System (MUTARS) RS stem, which has been used in our department for more than 10 years, in patients undergoing two-stage revisions.
Methods {#Sec2}
=======
Patients {#Sec3}
--------
The functional and clinical outcomes for 43 patients who had undergone two-stage revision procedures for PJI were analyzed in a retrospective study. The patients had been treated between 2000 and 2012 in a university orthopedic department. We had an ethics approval of the local ethic committee of the University of Münster (2014-324-f-N). Every patient were informed about the study and agreed to publish their data. A consent statement was signed.
They included 21 men and 22 women, with an average age of 66 years (range 40--84 years). The minimum follow-up period was 24 months. Shorter follow-up periods were only observed when there were complications such as loosening or recurrent infection. The mean follow-up period was 3.86 years (range 7 months to 11.6 years). The indication for THA was primary osteoarthritis (OA) in 31 cases, femoral neck fracture in six cases, secondary OA after acetabular fracture in four cases, rheumatoid arthritis in one case, and necrosis of the femoral head in one case. The last operation for the explantation of the prosthesis was in mean 43,5 months (1 months -- 24 years).
Clinical and functional follow-up {#Sec4}
---------------------------------
All of the patients received radiographic and clinical follow-up examinations. In case of death (n = 2), the last clinical and radiographic examination was evaluated, and inquiries were also made of the patient's relatives. The Della Valle--Paprosky classification was used to classify femoral bone defects \[[@CR18]\]. The functional outcome was evaluated at the outpatient examinations using the Harris Hip Score \[[@CR19]\].
End points and definitions {#Sec5}
--------------------------
The inclusion criterion for the patients was a minimum follow-up period of 24 months, or less in case of early loosening of the stem or infection. PJI was diagnosed if at least one diagnostic method was positive in accordance with the Centers for Disease Control criteria \[[@CR20]\]. The primary end points of the study were successful treatment for infection or reinfection with loosening of the prosthesis. Clinical cure, with no clinical signs of inflammation and negative C-reactive protein findings, was assessed by the treating clinician at the date of the last available follow-up. Aseptic loosening of the stem was a secondary end point.
Surgical treatment {#Sec6}
------------------
If at least one Centers for Disease Control criterion \[[@CR20]\] was positive, a two-stage revision was performed (Figure [1](#Fig1){ref-type="fig"}). All of the patients were treated with an antibiotic-loaded polymethylmethacrylate (PMMA) spacer. We collected at least three biopsies for microbiological examination. The composition of the antibiotics in the spacer was adapted to the bacterial resistance (Table [1](#Tab1){ref-type="table"}). Between 2000 and 2004, seven patients were treated with a short period of parenteral antibiotic therapy for a mean of 20 days (range 17--26 days) between both operations. Since 2005, all patients have been treated with parenteral antibiotic therapy for at least 2 weeks, followed by oral antibiotic therapy for at least 4 weeks. If the bacteria involved were not identified, calculated antibiosis with a cephalosporin and clindamycin was administered. In other cases, specific antibiotic therapy was used.Figure 1**Two-stage procedure in a 74-year-old-woman. a**: Septic loosening of the hip. **b**: Explantation of the hip prosthesis and spacer implantation. **c**: Reimplantation of a hip prosthesis with the MUTARS RS stem and a cementless cup.
######
**Antibiotic combinations in antibiotic-loaded polymethylmethacrylate (PMMA) spacers**
Antibiotic combination Patients (n)
--------------------------------------- --------------
Gentamicin 11
Gentamicin/vancomycin 4
Gentamicin/vancomycin/clindamycin 16
Gentamicin/clindamycin 11
Gentamicin/clindamycin/flucloxacillin 2
Before replantation we paused the antibiotic therapy for at least two weeks. If the C-reactive protein was less than 2 mg/dl we do the reimplantation. The MUTARS RS stem (Implantcast Ltd., Buxtehude, Germany) was used for reimplantation. It is a modular revision stem with a hexagonal stem design \[[@CR21]\] and has included a hydroxyapatite layer since 2006. For acetabular reconstruction we used in three cases a cemented dual mobility cup, in eight cases a cemented polyethylene, in 22 cases a cementless cup and in 10 cases a reconstruction with an antiprotrusio cage. In three cases we used the cage in combination with spongiosa chips of an allograft. After reimplantation, 2 weeks of the parenteral antibiotic therapy was administered, followed by 4 weeks of oral antibiotic therapy.
Statistical analysis {#Sec7}
--------------------
Statistical analysis was performed with IBM SPSS Statistics for Windows, version 21.0 (IBM Corporation, Armonk, New York, USA).
Results {#Sec8}
=======
Diagnosis of the periprosthetic infection {#Sec9}
-----------------------------------------
The leading indication for explantation was bacteria in the aspiration fluid in 18 cases, fistula in 12 cases, purulent synovial fluid in eight cases, elevated leukocyte counts (\>4500) in the aspiration fluid in combination with elevatd C-reactive protein in four cases, and positive leukocyte scintigraphy in combination with elevated C-reactive protein in one case. Microorganisms were identified in 88.3% of cases (Table [2](#Tab2){ref-type="table"}). *Staphylococcus aureus* was present in most cases.Table 2**Microorganisms identified in soft-tissue samples**MicroorganismPatients (n)*Staphylococcus aureus*13\**Staphylococcus epidermidis*12*Enterococcus faecalis*3*Streptococcus gallolyticus*2*Corynebacterium*2*Escherichia coli*2*Staphylococcus haemolyticus*2*Enterobacter cloacae*1*Neisseria* species1*Micrococcus luteus*1*Serratia marcescens*1*Staphylococcus capitis*1*Staphylococcus cohnii* species1*Staphylococcus hominis*1*Staphylococcus warneri*1*Streptococcus agalactiae*1*Streptococcus bovis*1*Streptococcus pluranimalium*1*Peptococcus* species1*Propionibacterium* species1*Pseudomonas aeruginosa*1Sterile7Patients with two species6Patients with eight species1\*Two were methicillin-resistant.
Infection therapy {#Sec10}
-----------------
A spacer exchange and repeated complete PJI management were necessary in four cases. The cause of persisting infection was a nonsensitive spacer in a patient with methicillin-resistant *S. aureus* (MRSA) in one case, persistent fistula in two cases, and persistently high C-reactive protein levels in one case. The mean C-reactive protein level was 0.8 mg/dL (0.5--2.0 mg/dL) at the time of reimplantation.
The success rate with infection control for PJI was 93%. Reinfection occurred in four cases (7%) (Table [3](#Tab3){ref-type="table"}). Another two-stage revision with a cemented prosthesis was carried out in two cases, and resection arthroplasty was performed in two patients. Two patients with reinfection had MRSA infections. The risk of reinfection after MRSA infection was 20.5 times greater | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Treatment of horses for infection of a limb with *Pythium insidiosum* is challenging, and its effectiveness appears to depend on such factors as size and site of the lesion, duration of infection, immunocompetence, and the type of treatment. Systemically administered antifungal drugs, such as potassium or sodium iodide, ketoconazole, miconazole, fluconazole, itraconazole, and amphotericin B, have been administered with or without the surgical excision of the lesion to improve outcomes \[[@CR1]--[@CR3]\]. However, these drugs are considered hazardous and are expensive when administered systemically to horses, and because *Pythium insidiosum* is not a true fungus, this protistal organism has increased resistance to most available antifungal agents \[[@CR3], [@CR4]\]. Dória et al. \[[@CR5]\] reported that intravenous regional limb perfusion (IRLP) with amphotericin B is effective for treating horses with a cutaneous lesion of pythiosis of a limb, resolving the infection with manageable complications, such as oedema of the limb, signs of pain during palpation of the limb, and inflammation at the site of venipuncture for IRLP. Their study demonstrated that 92 % of the horses (*n =* 11) affected by *Pythium insidiosum* and presenting with exuberant granulation tissue in the distal aspect of a thoracic or pelvic limb that were treated with intravenous regional perfusion with amphotericin B had complete resolution of their lesions 35 days after one treatment or 60 days after two treatments. Dória et al. \[[@CR5]\] considered the intravenous regional perfusion of amphotericin B to be an effective adjunct therapy to surgical excision and thermocauterization in treating horses for pythiosis of the distal portion of the limb.
We hypothesized that better results with fewer complications might be achieved if dimethylsulfoxide (DMSO) is added to the perfusate when amphotericin B is administered by IRLP as a treatment for pythiosis of a limb. We reasoned that adding DMSO to the perfusate would achieve a higher concentration of amphotericin B within the infected tissues, and because DMSO has been shown to be an effective anti-inflammatory agent, its addition to the perfusate would reduce inflammation at the site of intravenous administration. It may also possess some inhibitory effects on the growth of a variety of fungi as a result of its effect on the immune response and as a result of reducing endotoxin-induced tissue damage. Studies have shown that intravenous administration of DMSO results in vascular dilation and increased flow of blood through experimentally created cutaneous flaps \[[@CR6]--[@CR9]\]. Such properties associated with its ability to penetrate biological membranes provide a rationale for its use in conjunction with an antifungal drug for regional limb perfusion \[[@CR10]\].
Thus, we evaluated the effects of administering amphotericin B in a 10 % solution of DMSO by IRLP as an adjunct therapy to surgical excision, hoping to diminish the detrimental vascular effects associated with administration of amphotericin B, to treat horses for pythiosis of a limb.
Methods {#Sec2}
=======
This study was approved by the University of Cuiabá Animal Care and Ethics Committee, under protocol number 2009--228. Fifteen horses (8 males and 7 females, age 4 months to 15 years, weighing 100--420 kg) diagnosed with pythiosis were studied. This research was carried out on horse farms located in Tocantins state (*n* = 1), São Paulo state (*n =* 2) and Mato Grosso state (*n =* 12), Brazil. The presumptive diagnoses were made on the basis of historical data, the gross appearance of the granulomatous lesion, and the histological appearance of the lesion. Lesions were located distal to the cubital joint (elbow) or the femorotibial joint (stifle). In preparation for the treatment, feed was withheld for 12 h before treatment was administered. A catheter was placed into a jugular vein, and the horses were tranquillized with acepromazine (0.1 mg/kg) and then anesthetized with guaiacol glycerol ether (100 mg/kg), ketamine (2 mg/kg), and midazolam (0.1 mg/kg). Horses were positioned in lateral recumbency with the lesion uppermost. The site of the lesion was prepared for surgery by scrubbing the site with soap and applying dilute povidone-iodine solution and 70 % isopropyl alcohol. An Esmarch tourniquet was applied proximal to the lesion to prevent hemorrhaging, making it possible to surgically remove the exuberant granulation tissue and kunkers safely avoiding exposing the bone or entering a synovial structure. Tissues (1 cm^3^) were collected and fixed in 10 % formalin for histological (hematoxylin and eosin; Grocott's methenamine silver) and immunohistochemical (the labeled streptavidin biotin method) analyses, performed as previously reported \[[@CR11]--[@CR13]\]. After surgery, the Esmarch tourniquet was partially released to identify bleeding vessels for cauterization with electric thermocautery, and the site of the lesion was bandaged. The Esmarch tourniquet was repositioned and retightened, and a superficial vein (the cephalic, palmar digital, saphenous, plantar digital, or dorsal digital vein) next to the lesion and distal to the tourniquet was catheterized using a 20-, 22-, or 24-ga catheter for administration of the drugs. The catheterized vein was injected with 60 mL of a solution containing 50 mg (10 mL) of amphotericin B[1](#Fn1){ref-type="fn"}, 6 mL of medical grade DMSO[2](#Fn2){ref-type="fn"} and 44 mL of lactated Ringer's solution. The injection was delivered using finger pressure over 5 min using a 60-mL syringe connected to an extension line. The catheter was removed after the administration, and firm pressure was applied manually to the site of venipuncture. The tourniquet was released 45 min after the administration of the solution of amphotericin B and DMSO.
Lesions were evaluated before treatment (Day 0) and then weekly (1 to 9 weeks) after the administration of the solution of amphotericin B and DMSO until the lesions were completely healed. At the same time points, blood samples were collected for haematological and biochemical analyses using standard techniques \[[@CR14]\].
The lesion's size (length and width) was determined at day 0 using a ruler. The lesions were assessed qualitatively, and the response to therapy was determined by clinical observation (i.e., gross appearance of the lesion). The appearance of the lesion was compared to the photographic appearance of the lesion at the times of previous evaluations. A wound was considered completely healed when it was completely covered with epithelium. The affected limb was evaluated for regional swelling, sensitivity to palpation, and signs of inflammation at the site of venipuncture.
The data were analyzed with the Statistical Analysis System (SAS.2011). Normality of the data distribution was evaluated by the Shapiro-Wilk test. A one-way analysis of variance with repeated measures, followed by a Tukey test, was used for the comparisons of the weekly data. The differences were considered to be statistically significant when *P* ≤ 0.05.
Results {#Sec3}
=======
The pythiosis lesions were located in different regions, including the radius (20 %), carpus (6.66 %), metacarpus (6.66 %), tibia (6.66 %), tarsus (6.66 %), metatarsus (6.66 %), fetlock and pastern (46.7 %). At day 0, all of the horses had large lesions ranging from 12 to 50 cm in length (mean length 27 cm) and 15 to 40 cm in width (mean width 25 cm) and surrounded 90° (4 horses), 180° (7 horses) or 360° (4 horses) of the affected areas. The lapse of time between emergence of the lesion and the beginning of treatment with amphotericin B and DMSO ranged from two to five months (average, three months).
Before treatment (D0), the affected limb was swollen, and the lesion was filled with exuberant, ulcerated granulation tissue and surrounded by oedematous tissue. The surface of the granulation tissue was nodular and covered with a mucosanguineous viscous exudate. The tissue sections had sinuses containing kunkers, usually surrounded by seropurulent discharge. The horses showed signs of intense pruritus that was characterized by self-mutilation.
The histopathological diagnosis was pyogranulomatous dermatitis associated with the pseudo hyphae characteristic of *Pythium insidiosum* (subcutaneous pythiosis), confirmed by the immunohistochemistry analysis. Surgical excision of the exuberant granulation tissue and IRLP administration of amphotericin B and DMSO resulted in complete resolution of the lesions. All 15 lesions regressed after a single administration of a solution containing amphotericin B and DMSO. By one week after a single treatment, exudate, sinuses, and kunkers had disappeared from the lesions, and the granulation tissue had regressed and turned from white to pink-yellow. In subsequent weeks, the granulation tissue became pink and flat, and a margin of epithelialization could be seen moving centripetally. Epithelialization was complete by 6 weeks in 5 horses, 4 of which had lesions surrounding 90° of the affected area and 1 | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
Physical inactivity has been recognized as a major modifiable risk factor for non-communicable diseases (NCDs) since the 1950s \[[@CR1]\]. Recent reports have equated the impact of physical activity (PA) to that of smoking with respect to the worldwide burden of NCDs \[[@CR2]\]. Physical activity is a challenging variable to measure, on account of the inherent complexity and diversity of human behavior. Traditionally, tools for measuring physical activity have been divided into subjective and objective methods. While the use of objective methods generally provides more accurate estimates of physical activity, these methods are cumbersome and impractical for use outside the setting of specialized research units. Subjective (self-reported) methods involving the use of physical activity questionnaires (PAQs) have therefore become the preferred method of assessing physical activity in epidemiological studies.
A number of PAQs have been described in the literature, most of which have been designed for use, and validated in, developed countries. Several factors mitigate against the use of these questionnaires in low and middle income countries like India. A major drawback of these PAQs in the Indian context, is the importance given to leisure time physical activity (LTPA). While LTPA contributes significantly to total physical activity in Western populations, studies from India show that less than 10% of the population performs any LTPA at all \[[@CR3]\]. Also, the use of many of these PAQs demands a certain level of literacy in the respondents, which may not be the case in developing countries like India.
In recent years, international questionnaires such as the Global Physical Activity Questionnaire (GPAQ) \[[@CR4]\] and International Physical Activity Questionnaire (IPAQ) \[[@CR5]\] have been validated in several populations, including those of developing nations. Many of these questionnaires, though valid and reliable, do not permit collection of information on region-specific and culturally relevant activities across different domains. These questionnaires assess physical activity over the week prior to administration and may not be suited for use in individuals with varied educational levels as seen in India, as they require the respondent to self-rate their own level of activity intensity, which has been shown to be difficult in the Indian setting.
The Indian Migration Study (IMS) questionnaire \[[@CR6]\] was developed as an alternative to the international questionnaires for use in India. While the IMS questionnaire is reliable, valid and culturally relevant, it only collects information pertaining to the month immediately preceding its administration. Also, the IMS questionnaire does not address the aspect of seasonality of occupations and variations in physical activity in individuals holding multiple jobs at the same time.
Therefore, we attempted to develop a PAQ for use in India, that would measure habitual, culturally relevant activities in various domains (occupational, transport, recreational, activities of daily living and weekend activities) over a year and which would be valid for use in adults of different age groups with varying levels of activity in urban as well as rural settings. The present paper aims to assess the reliability and validity of this new PAQ- termed the Madras Diabetes Research Foundation- Physical Activity Questionnaire (MPAQ).
Methodology {#Sec2}
===========
The MPAQ was developed (Additional file [1](#MOESM1){ref-type="media"}) after reviewing various published validated physical activity questionnaires both in India and abroad. In addition, 24 hour physical activity recalls encompassing a weekday and weekend were collected from 50 volunteers across all ages and occupations. From these 24 hr recalls, the various activities reported across all domains were listed in the MPAQ and similar activities were grouped together and further truncated based on the average energy cost, as the Physical Activity Ratio (PAR) provided by the WHO/FAO 2001 \[[@CR7]\]. The MPAQ was designed to capture frequency and duration of habitual obligatory and discretional activities by means of a mix of open and closed-ended questions arranged in four domains viz. work-related activity (work domain), activities of daily living \[general activity domain which includes sleep (daytime napping and sleep at night), personal care and domestic chores\], transport-related activities (transport domain) and recreational activities (recreational domain). In all domains, options are provided to capture both seasonal and non-seasonal activities. The questionnaire captures details of up to two jobs and elicits information on time spent sitting, standing, walking and climbing stairs in each of these jobs, providing insight into the nature of the job and intensity of work activity.
In the recreational domain, the questionnaire elicits information on sedentary behavior (including TV viewing, chatting with friends, listening to music etc.) as well as light, moderate and vigorous activities on a daily, weekly or monthly basis. In addition, there is provision for recording the extra activities or extra hours of sedentary behavior that happen during the weekend. The questionnaire enables calculation of physical activity for an "average" day by summing up activities in various domains for a 24-hour period. Similarly, weekly and monthly calculations can also be done and information aggregated to compute activity for a year.
Total energy expenditure can be estimated through factorial calculations recommended by a joint FAO/WHO/UNU expert consultation \[[@CR7]\]. The factorial calculations are based on the time spent on various activities in the multiple domains and the energy cost of these activities. Energy cost is reported as a multiple of Basal Metabolic Rate (BMR) and called Physical Activity Ratio (PAR). Total time spent on habitual activities is multiplied by PAR to derive the total energy expenditure (TEE) of 24 hours. The physical activity level (PAL) can then be calculated as TEE/BMR for 24 hours. Based on the PAL values \[[@CR7]\], individuals can be divided into three categories: Sedentary (1.40 -- 1.69), moderately active (1.70-1.99) and vigorously active (2.00-2.40) \[[@CR7]\].
Written informed consent was obtained from each participant before start of the reliability and validity studies. Institutional Ethics Committee approval was obtained from the Ethics Committee at MDRF.
Reliability study {#Sec3}
-----------------
The MPAQ was administered by trained interviewers to individuals of either gender aged 20 years and above from 10 states in India namely Tamilnadu, Gujarat, Maharashtra, Jharkhand, Haryana, Bihar, Chandigarh, Assam, Tripura and Arunachal Pradesh. The states were so chosen as to be representative of the country in terms of geography, socioeconomic status, variability of occupations and climatic conditions. From one district in each state, two census enumeration blocks (CEBs) in urban areas and three villages in rural areas were randomly selected (Figure [1](#Fig1){ref-type="fig"}). In each CEB or village, 10 households were randomly selected and in each household, one individual was selected to participate in the study. Thus, 50 individuals were selected from each state, and 500 for the entire study. In addition, five individuals from each state were recruited to allow for non-response over time. Hence a total of 550 individuals were initially invited for the study, of whom 543 individuals participated and had all required information at baseline. The participants were sampled so as to obtain individuals across all age categories and both genders with varying literacy levels and engaged in a wide range of occupations so as to test the ability of the MPAQ to measure physical activity of individuals from all walks of life.Figure 1Selection of study subjects.
Demographic details and information on smoking and alcohol use were obtained from all participants as well as height, weight, waist and blood pressure (BP) measurements, assessed using standardized techniques. Weight (in kilograms-kg) was measured with the subjects wearing light clothing after having removed shoes and heavy jewelry. Height was measured to the nearest centimeter (cm) using a stadiometer with the subjects standing erect without shoes. Body mass index (BMI) was calculated as the weight (kg) divided by the height (in meters squared). Waist circumference was measured using a non-stretchable tape, as the mean of two measurements of the smallest horizontal girth between the costal margins and the iliac crests at minimal respiration. BP was recorded in the sitting position in the right arm using an electronic instrument (Model: HEM- 7101, Omron Corporation, Tokyo, Japan). Two readings were taken 5 minutes apart and the mean of 2 readings was taken as the blood pressure.
The baseline administration of MPAQ was performed from May to August 2011 in all the states. This was followed by a repeat administration within a month for assessing reliability. The interval of one month was chosen based on a previously published study from India \[[@CR6]\], and was deemed most appropriate to eliminate recall of previous responses by the participants as well as any possibility of physical activity patterns having significantly altered in the interim.
Validity studies {#Sec4}
----------------
For assessing relative validity, the MPAQ and the GPAQ were administered in a randomized order by trained interviewers to all selected participants across the 10 states one day apart so as to avoid questionnaire fatigue. The GPAQ was chosen because it is a widely used global PAQ which has been validated in India \[[@CR8]\]. The test questionnaire took on an average, 10 minutes (±5) to administer. Subject acceptability and co-operation were good with both questionnaires but the subject understanding was better with the test questionnaire.
Construct validity indicates the consistency or the relationship between the activity instrument (MPAQ) and the physiological variable such as BMI. This was tested by plotting time spent in sitting and moderate and vigorous physical activity (MVPA) (measured as minutes/day) against BMI and waist circumference measured at baseline.
For assessing criterion validity, 107 individuals of either gender aged 20 years and above were recruited from Chennai city | {
"pile_set_name": "PubMed Central"
} |
Learning pointsAs the number of transcatheter aortic valve implantation (TAVI) has increased in the last decade, a unique set of post-intervention events and complications have been identified.This is the first clinical case report to describe the occurrence of acute necrotizing oesophagitis (ANE) as a possible complication of TAVI.Transcatheter aortic valve implantation patients are prone to ANE due to their advanced age and frailty, comorbidities, ischaemic insult, and anti-platelet therapy.Acute necrotizing oesophagitis is a rare entity with high rate of acute and long-term complications and successful management requires early detection and multidisciplinary care.
Introduction
============
Transcatheter aortic valve implantation (TAVI) has revolutionized the management of aortic stenosis in the last decade.[@ytz069-B1] However, as the number of TAVI has increased, a unique set of post-intervention events and complications have been identified. Bradyarrhythmias, vascular access complications, acute cerebral vascular accidents, acute renal failure, cardiac tamponade, aortic root rupture, and aortic regurgitation are some of the most common described complications.[@ytz069-B2] Their recognition is critical to improve patients' outcomes, often involving a multidisciplinary team. In the present article, we report the occurrence of acute necrotizing oesophagitis (ANE), an undescribed complication possibly associated with TAVI.
Timeline
========
Time Description of relevant clinical information Intervention required
----------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------
December 2016 Evaluation in outpatient clinic: complains of fatigue on moderate exertion in the last 4 months. Performing of diagnostic tests in ambulatory.
January 2017 Severe aortic valve stenosis diagnosis (mean gradient of 52 mmHg and valve area of 0.87 cm^2^). Discussion in Heart Team.
March 2017 Accepted to transcatheter aortic valve implantation (TAVI). TAVI scheduling.
Day 0 TAVI procedure, transfemoral approach, without acute complications. Admission to intensive care unit.
Dual antiplatelet therapy (DAPT) initiation.
Day 1 Favourable evolution (without access complications or rhythm disturbances and with haemodynamic stability).
Day 2 Acute abundant haematemesis, haemodynamic instability, and haemoglobin drop. Endoscopy showed lesions compatible with acute necrotizing oesophagitis diagnosis.
Fluid therapy and replacement of blood products.
Proton-pump inhibitor (IBP) therapy, domperidone and sucralfat.
DAPT suspended.
Day 3 Haematemesis in small quantity. Therapeutic maintenance.
Day 4 Favourable evolution, with haemodynamic stabilization and without haematemesis. Therapeutic maintenance.
Day 5 Endoscopy showing resolution of the previously described lesions. Oral diet was progressively initiated.
Day 6 IBP was switched to oral formulation.
Day 7 DAPT was re-instituted.
Day 8 Patient was discharged clinically well and without any symptoms.
August 2017 Follow-up in outpatient clinic, without symptoms or complications.
Case presentation
=================
We present the case of an 86-year-old woman with a past medical history of endometrial cancer, treated by hysterectomy, oophorectomy and radiotherapy, and with consequent radiation cystitis; she also had dyslipidaemia and osteoporosis, associated with thoracic kyphosis, chronic back pain and mobility impairment (need of walking stick support, help with daily activities and house-keeping). The patient presented with fatigue on moderate exertion with progressive aggravation in the last 4 months. On cardiac auscultation, a mid-systolic murmur was audible along the upper right sternal border. The electrocardiogram revealed sinus rhythm with left axis deviation and repolarization abnormalities (*Figure*[*1*](#ytz069-F1){ref-type="fig"}). Transthoracic echocardiography (TTE) revealed: left ventricular (LV) concentric hypertrophy (LV mass index of 123 g/m^2^; relative wall thickness of 0.49); non-dilated LV (end-diastolic volume of 45 mL/m^2^), normal ejection fraction (57%), and diastolic dysfunction (*e*/*a* ratio of 0.5; *e*/*e*′ of 13; left atrium volume index of 44 mL/m^2^; and tricuspid regurgitation velocity of 2.9 m/s); ascending aorta dilatation (49 mm); tricuspid aortic valve, severely calcified, with severe stenosis (sAS)---mean gradient of 52 mmHg and valve area of 0.87 cm^2^. Blood tests showed N-terminal prohormone of brain natriuretic peptide of 1302 pg/mL (0--300 pg/mL), without other significant abnormalities (Table [1](#ytz069-T1){ref-type="table"}). Coronary angiography was normal. Due to symptomatic sAS, the case was discussed in Heart Team, in order to decide the best approach to aortic valve replacement. Considering the advanced age, moderate frailty (Clinical Frailty Scale assessment of 6,[@ytz069-B5] normal body mass index of 22 kg/m^2^), restricted mobility, and intermediate surgical risk \[Society of Thoracic Surgeons (STS) score: 4.2% risk of mortality\], TAVI was considered the best option. Pre-TAVI computed tomography angiography was performed to determine the best vascular access and the appropriate dimensions of the aortic valve prosthesis. It confirmed dilatation of the ascending aorta (50 mm) and diffuse atherosclerotic disease, without any obstructive lesions. Elective transfemoral TAVI was scheduled.
{#ytz069-F1}
######
Blood tests results
Parameters (unit) Pré-TAVI First day Post-TAVI Second day Post-TAVI Fourth day Post-TAVI At discharge Normal range
---------------------------------- ---------- --------------------- ---------------------- ---------------------- -------------- --------------
Haemoglobin (g/dL) 12.7 11.4 9.6 9.9 10.4 12--15.3
Leucocytes (×10^9^/L) 4.0 6.5 3.04 3.0 3.0 4.0--11.0
Platelets (×10^9^/L) 181 115 119 146 170 150--450
Partial thromboplastin time (s) 27.3 31.0
Prothrombin time (s) 11.3 11.6
Urea (mg/dL) 52 48 36 22 21 16--49
Creatinine (mg/dL) 0.99 0.9 0.89 0.75 0.83 0.51--0.95
Sodium (mmol/L) 139 140 143 139 139 135--145
Potassium (mmol/L) 4.8 4.1 3.9 3.8 4.2 3.5--5.1
C-reactive protein (mg/dL) 0.09 7.49 7.55 2.4 1.51 \<0.5
Aspartate aminotransferase (U/L) 18 16 13 15 0--32
Alanine aminotransferase (U/L) 6 6 5 5 0--33
Gamma glutamyl transferase (U/L) 12 9 9 0--40
Alkaline phosphatase (U/L) 99 63 65 35--105
Bilirubin (mg/dL) 0.32 0.32 \<1.2
NTproBNP (pg/mL) 1302 580 \<300
The procedure was performed under general anaesthesia and guided by transoesophageal echocardiogram (TOE), via the right femoral route. Balloon valvuloplasty (20 × 40 mm balloon) was performed prior to aortic valve prosthesis implantation (Edwards Sapiens 3™, 23 mm, through a NovaFlex™ delivery system). Valvuloplasty and prosthesis deployment were accomplished during a burst of rapid ventricular pacing, using a temporary pacemaker, with 30--40 s of intentional low cardiac output state---systolic blood pressure (SBP) of 40--50 mmHg. After valve deployment, the patient presented a short period of hypotension (SBP 60--70 mmHg and diastolic blood pressure ±20 mmHg; heart rate ±100 b.p.m.), with spontaneous recovery in less than 3 min. The final result was satisfactory, with | {
"pile_set_name": "PubMed Central"
} |
Introduction {#S0001}
============
Infections owing to soil-transmitted helminths and foodborne trematodes are serious public health problems in Laos.[@CIT0001]--[@CIT0003] Previous studies have reported a high prevalence of intestinal parasitic infections among school-aged children and young people in Laos. For example, the reported prevalence of intestinal helminths among children aged 6--11 years is 70.3%, and this is 71.2% among young people aged 12--19 years in northern Laos.[@CIT0004] Among children under 15 years of age in Bolikhamxay Province, this prevalence is 56.7%.[@CIT0005] Recent studies show that the main parasitic infections among the general population are hookworm and *Opisthorchis viverrini* infections.[@CIT0002],[@CIT0006],[@CIT0007] This tendency has also been observed among children and young people, with 80.0% of the children aged 6--15 years infected by hookworm and 64.6% by *O. viverrini* in Champasack Province,[@CIT0008] and 87.0% infected by hookworm and *O. viverrini* in Saravane Province.[@CIT0002] The impact of helminth infections is significant predictors of malnutrition, iron deficiency anemia, and poor academic performance among schoolchildren.[@CIT0009]--[@CIT0012] Additionally, *O. viverrini* infection is associated with cholangiocarcinoma and bile duct cancer.[@CIT0013],[@CIT0014]
Therefore, a successful parasite control program for students at school is necessary to improve their health status, increase their chances of optimal growth and learning,[@CIT0015] and avoid future early death. According to the National School Health Policy formulated by the Ministry of Education (MoE) and Ministry of Health (MoH) in Laos, the school health program consists of five components: personal health and life skills, healthy school environment, health and nutrition services, control and prevention of common diseases, and school and community partnership.[@CIT0016] Therefore, helminths control is also included in the program and has been implemented as the school deworming campaign for all primary school-aged children since 2005.[@CIT0017] This campaign has covered 93% of the country.[@CIT0018] The school-based program is expected to provide schoolchildren with proper knowledge, attitudes, and practices for maintaining better health status throughout their entire life. However, the influence of this program during primary school and the factors related to parasitic infection among secondary school students has not been sufficiently investigated.
In the present study, we sought to identify factors, including primary school health programs, related to infection with hookworm and *O. viverrini* among secondary school students in a large city of Laos.
Material and methods {#S0002}
====================
Study area {#S0002-S2001}
----------
The study was conducted in Vientiane, the largest city in Laos. Vientiane is located on the banks of the Mekong River near the border with Thailand, at elevation 174 m above sea level. Vientiane has a tropical monsoon climate, with the rainy season occurring between May and October.[@CIT0019] Vientiane has nine districts. The study site was a secondary school in Sikottabong District, which is located at about 9 km from the center of the city and urban area. The students of the target school were mainly from nine villages located in the vicinity of the school. The total number of students at the school was around 230. The gross enrollment rate in secondary schools in Laos is 66.5%.[@CIT0020]
Study population and sample size {#S0002-S2002}
--------------------------------
As of the 2015 census, Vientiane city had a population of 820,000, with 8.9% of the population aged 10--14 years.[@CIT0019] We selected one secondary school located in an area where we have implemented a school health program since 2002.
The sample size was determined using the A-priori Sample Size Calculator for Multiple Regression (available from <http://www.danielsoper.com/statcalc>) with a 0.15 anticipated effect size, 80% statistical power, 15 predictors, and 0.05 probability level. The calculated minimum sample size was 139.
Study design {#S0002-S2003}
------------
We conducted a cross-sectional survey in September 2013. First, schoolteachers and students were informed about the study objectives and procedures. A total of 197 students agreed to voluntarily participate and signed consent forms. Students in first grade were not included because they were in the process of admission during the study period.
Questionnaire survey {#S0002-S2004}
--------------------
The questionnaire included sociodemographic characteristics, perception of the primary school health program, and status of water and sanitation in the student's home. This questionnaire was translated into the Lao language, and any discrepancies in terms of wording were settled through discussions with Laotian senior researchers from the Lao Tropical and Public Health Institute. Finally, the translated questionnaires were pre-tested. To collect data, first, a Laotian researcher explained the questionnaire to the students and instructed them on how to complete the questionnaire. The students then completed the self-administered questionnaires in the Lao language.
Sample collection and stool examination {#S0002-S2005}
---------------------------------------
All students participated were provided with a stool container labeled with an identification number on the day before the survey. Students were requested to provide their own fresh stool sample on the sample collection day. The research team visited classrooms at the target school between 8:00 a.m. and 9:00 a.m. to collect the stool samples together with the completed questionnaire. All collected samples were kept in a cool box and were transferred by car to the laboratory of the Lao Tropical and Public Health Institute within an hour after collection. For each stool sample, two Kato--Katz thick-smear slides were prepared, using standard 41.7 mg templates. After a clearing time of 30 mins, the slides were examined under a light microscope (100× magnification). All samples were examined on the day of collection.
Data analysis {#S0002-S2006}
-------------
In total, 178 participants submitted a stool sample, and samples were analyzed for the prevalence of helminths among study participants. Among 178 students, 164 completed the questionnaire. The data from these 164 participants were used to analyze associations among sociodemographic characteristics, primary school health program score, status of hygiene and sanitation in the student's home, and parasitic infection. The items addressing the perception of the school health program were from a previous study on school health program evaluation in Laos.[@CIT0021] Response options to the survey questions were "yes" or "no", and "yes" responses were summed to obtain the overall primary school health program score ([Table 1](#T0001){ref-type="table"}). The intensity of helminth infections was expressed in fecal eggs per gram (EPG). According to the previous studies,[@CIT0002],[@CIT0006],[@CIT0022] for hookworm and *O. viverrini* infections, the following light-, moderate-, and high-intensity groups were established based on the EPG counts: hookworm; 1--1,999 EPG, 2000--3,999 EPG, and ≥4,000 EPG and *O. viverrini* and *T. trichiura*: 1--999 EPG, 1,000--9,999 EPG, and ≥10,000 EPG.Table 1Questionnaire items for primary school health program scoreItems%There was water available in primary school70.6There was boiled or bottled water for students to drink87.1There was a latrine in primary school93.3The latrine was always kept tidy78.5The primary school had a good fence to prevent animals from entering the schoolyard91.4Health personnel visited the primary school to check students' health condition87.1Primary school teachers instructed students to wash hands before eating98.2Primary school teachers instructed students to wash hands after using the latrine95.1Primary school teachers instructed students to wash hands after returning from outside69.9Primary school teachers instructed students on how to clip fingernails97.5Primary school teachers instructed students on how to keep eyes and ears clean88.3Mean (SD)Total score (range: 5--11)9.57 (1.33)[^1]
Data analysis was performed using IBM SPSS, version 22.0 (IBM Corp., Armonk, NY, USA). The association among parasite infections (hookworm and *O. viverrini*), sociodemographic characteristics, and the school health program available during primary school were assessed in a univariate logistic regression analysis. Predictors with *p*\<0.25 were retained in a multivariate logistic regression model. Odds ratios (ORs) and 95% confidence intervals (CIs) were reported. The significance level was set at *p*\<0.05.
Ethics approval and consent to participate {#S0002-S2007}
------------------------------------------
Ethical approval was obtained from the Tenri Health Care University Ethics Committee (Project no. 27) and the National Ethics Committee on Health Research, MoH, Lao PDR (Ethical Clearance No. 045/2013 NECHR). Permission for the survey was obtained from the MoH, as well as the school committee and director. Meetings were held with students' parents or guardians in which they were given a detailed explanation of the study aims, procedures, potential risks, and benefits. Written informed consent was obtained from the parents or guardians of participants. In cases where a parent or guardian was illiterate, students signed the consent form, witnessed by a parent or guardian." Participants were free to | {
"pile_set_name": "PubMed Central"
} |
Background {#Sec1}
==========
Adverse food reactions (AFRs) are defined as abnormal responses to an ingested food or food additive \[[@CR1], [@CR2]\]. When an AFR is suspected, its diagnosis should always be based on a complete and accurate dietary history, clinical signs and, in particular, on the results of a dietary elimination test, i.e., an "elimination and re-introduction diet" \[[@CR3]\]. Indeed the gold standard method to diagnose an AFR consists of feeding the animal a limited-antigen diet until the abatement of clinical signs (elimination diet) and then reintroducing the diet previously fed to demonstrate the recurrence of symptoms (provocation diet) \[[@CR3]\]. Other tests, such as skin testing, skin patch testing, serologic tests measuring food allergen-specific serum IgE, and gastric biopsy tests have already been shown to have low sensitivity and specificity \[[@CR3]--[@CR5]\]. The elimination diet should contain protein and carbohydrate sources that the animal has never eaten before the trial and should be administered for a period of at least 8--10 weeks \[[@CR6]\]. Clinical signs of gastrointestinal disease usually improve within 2 weeks, whereas cutaneous clinical signs may take up to 8 to 12 weeks to respond to dietary change. For the elimination diet, veterinarians can use either commercial veterinary prescription diets, such as limited-antigen diets or hydrolyzed diets, or home-cooked diets \[[@CR6]\]. Commercially available limited-antigen diets typically include proteins from venison, quail, rabbit and duck and are generally combined with alternative carbohydrate sources, such as green peas, rice and potatoes. A hydrolyzed diet can provide an alternative to the novel protein diet; they contain small peptides of molecular weights below 3 kDa, which are easily digestible and associated with low antigenic stimulation \[[@CR7]\], but their efficacy has not always been confirmed \[[@CR6], [@CR8]--[@CR12]\]. In the case of no evident improvement in clinical signs during a dietary trial, AFR cannot be excluded, because residual allergenic fragments may remain in the hydrolyzed diet and contamination may have occurred during the production process of limited-antigen diets \[[@CR13]\]. In each of these cases, the correct diagnosis of AFR would be compromised. Many studies have already demonstrated the presence of undeclared ingredients in limited-antigen dry diets, dry and wet physiological foods, vegetarian and vegan diets, supplements and treats for pets, such as microscopic bone fragments, proteins, detected by enzyme-linked immunosorbent assay (ELISA), and deoxyribonucleic acid (DNA), detected by polymerase chain reaction (PCR), reverse transcription PCR, multiplex PCR or PCR-restriction fragment length polymorphism \[[@CR14]--[@CR24]\]. Considering that the production technologies involved in dry and wet pet food manufacturing are distinct, the aim of the present study was to investigate whether the high rate of contamination found in commercial limited-antigen dry diets \[[@CR13]\] is also applicable to the antigen-limited wet diets often used in dietary elimination trials for the diagnosis and therapy of AFR in pets.
Methods {#Sec2}
=======
Samples {#Sec3}
-------
Eleven canine and feline antigen-limited wet diets (10 novel protein diets and 1 hydrolyzed diet) produced by 5 different pet food manufacturers (2 Italian and 3 international) were obtained from veterinary clinics. All of the products used in this study were declared as dietetic complete pet food, specifically intended for particular animal nutritional purpose of reduction of ingredients and nutrient intolerances, according to the European law 2008/38/EC \[[@CR25]\]. For each sample, the product's label was carefully studied to identify all protein sources of animal origin and of vegetal origin in the case that the product was declared to be vegetarian. The product's brand, description, therapeutic indications, animal species, feed material declaration, additives lists, analytical constituents, instruction for proper use, net weight, lot number, expiry date, and the name and address of the business operator responsible for its labelling were recorded.
Each pet food product was randomly assigned a unique three-digit sample identification number. Samples were then submitted to the polymerase chain reaction (PCR) to identify DNA belonging to 3 zoological classes (mammalian, avian and fish). Based on these results, PCR analyses for specific animal species (quail, rabbit, duck, horse, deer, turkey, chicken, domestic ruminant, tuna and swine) were performed according to the zoological classes testing positive. The limited-antigen diet composed of vegetal protein only was also tested using PCR to identify vegetal protein origin.
DNA extraction {#Sec4}
--------------
To extract DNA from pet food samples, the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) was used following the manufacturer's instructions. Negative controls (water) were included in each extraction. DNA concentration was determined by spectrophotometry (Nanodrop ND1000; NanoDrop Technologies Inc., Wilmington, DE, USA).
Species identification protocol {#Sec5}
-------------------------------
Previously published PCR primers (Table [1](#Tab1){ref-type="table"}) designed to recognise species-specific regions of mitochondrial DNA were used to test for the presence of quail, rabbit, duck, horse, turkey, chicken, ruminant and swine products. Deer and tuna were identified using minisequencinq protocols (Table [1](#Tab1){ref-type="table"})**.** For horse, a specific real time PCR assay was run in a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The PCR amplifications were performed in an ABI 2720 thermocycler (Applied Biosystems, Foster City, CA,USA). Minisequencing was performed on an ABI 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). All amplification protocols were performed following the published protocols (Table [1](#Tab1){ref-type="table"}).Table 1Primers used for the detection of species specific and zoological class DNAPrimerPCR product (bp)ReferencesDetection of species-specific DNA Chicken95Martín et al., 2007 \[[@CR32]\] Deer232La Neve et al., 2008 \[[@CR33]\] Duck64Martín et al., 2007 \[[@CR32]\] Horse147Kesmen et al., 2009 \[[@CR34]\] Quail129Rojas et al., 2010 \[[@CR35]\] Rabbit160Walker et al., 2004 \[[@CR36]\] Domestic Ruminant104Dalmasso et al., 2004 \[[@CR15]\] Swine108Meyer et al., 1995 \[[@CR37]\] Tuna132Bottero et al., 2007 \[[@CR38]\] Turkey122Martín et al., 2007 \[[@CR32]\]Detection of zoological class DNA MAMMALIAN117Chiappini et al., 2005 \[[@CR39]\] FISH224Dalmasso et al., 2004 \[[@CR15]\] POULTRY183Dalmasso et al., 2004 \[[@CR15]\] VEGETABLE132Little DP, 2014 \[[@CR39]\]
Results {#Sec6}
=======
Eleven canine and feline antigen-limited wet diets were collected and submitted to PCR to test for the presence of DNA from 3 different zoological classes (mammalian, avian and fish), and subsequently for DNA from specific animal species as well as for DNA of vegetal origin. Table [2](#Tab2){ref-type="table"} shows the animal protein sources as listed on the product labels and the results obtained by species-specific PCR. Discrepancies between the results expected and those obtained from PCR were observed in 6 out of the 11 sampled diets. Of the 6 showing discrepancies, 5 were contaminated with protein from additional animal species and 1 was wholly composed of animal protein sources completely unrelated to those declared on the label. Of these 5 contaminated with additional animal species, 2 contained DNA belonging to 2 different zoological classes, i.e., inter-zoological class contaminations: Sample n.6 declared rabbit as its unique animal protein source on the label, but PCR detected DNA belonging to 2 different zoological classes: 2 avian (turkey and chicken) and 1 mammalian (rabbit). Sample n.11 declared duck as its unique animal protein source on the label, but PCR again detected DNA belonging to 2 different zoological classes: 3 avian (duck, chicken, and turkey) and 1 mammalian (pork).. In the remaining 3 samples contaminated with additional animal species, the contaminating species belonged to the same zoological class. Sample n.1 declared turkey as its unique animal protein source on the label, whereas PCR analysis detected DNA from turkey and chicken. Sample n.3 declared deer as its unique animal protein source on the label, but PCR analysis detected DNA from another domestic ruminant in addition to deer. Sample n.8 declared quail as its unique animal protein source on the label, but PCR analysis confirmed the presence of another avian species (not covered by the species-specific PCR primers listed in Table [1](#Tab1){ref-type="table"}) in addition to quail. Finally, the label for sample n.7 indicated duck as its unique animal protein source, but PCR analysis was only able to detect DNA from turkey, chicken and horse, (and thus a case of inter zoological class contamination); no traces of duck DNA were found. In the remaining 5 sample diets, PCR analysis confirmed the animal protein species sources declared on the label.Table 2List of declared animal protein sources and PCR results expressed as zoological class and species in 11 antigen-limited wet dietsSamplesDeclared animal protein source- Zoological classDeclared animal protein source-speciesDeclared fat sourcePCR analysis results- Zoological class | {
"pile_set_name": "PubMed Central"
} |
Introduction {#Sec1}
============
In recent years, inequalities with power-exponential functions have been intensively studied \[[@CR1]--[@CR7]\]. They have many important applications. For example, they can be found in mathematical analysis and in other theories like mathematical physics, mathematical biology, ordinary differential equations, probability theory and statistics, chemistry, economics. For more details, a literature review and the history of inequalities with power-exponential functions, see \[[@CR2]\]. Cîrtoaje, in \[[@CR1]\], has introduced the following interesting conjecture on the inequalities with power-exponential functions. The inequality is similar to the reverse arithmetic-geometric mean inequality where its terms were rearranged.
Conjecture 1 {#FPar1}
------------
*If* $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$a,b \in(0,1]$\end{document}$ *and* $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$r \in(0,e]$\end{document}$, *then* $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ 2\sqrt{a^{ra}b^{rb}}\geq a^{rb}+b^{ra}. $$\end{document}$$
The conjecture was proved by Matejíčka \[[@CR3]\]. Matejíčka also proved ([1](#Equ1){ref-type=""}) under other conditions in \[[@CR4], [@CR5]\]. For example, he showed that ([1](#Equ1){ref-type=""}) is also valid for $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$a,b,r \in (0,e]$\end{document}$. In \[[@CR5]\], one interesting property of the generalized Cîrtoaje's inequality (CI) was found. In \[[@CR6]\], a classification of sets of solutions of (CI) $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ n\sqrt[n]{\prod_{i=1}^{n}x_{i}^{rx_{i}}} \geq x_{n}^{rx_{1}}+ \sum_{i=1}^{n-1}x_{i}^{rx_{i+1}} $$\end{document}$$ was made.
Methods {#Sec2}
=======
In this paper, methods of mathematical and numerical analysis are used. We make a classification of sets of solutions of the other generalization of (CI).
Let *φ*, *ψ* be functions from $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$\{1,\ldots,n\}$\end{document}$ to $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$\{1,\ldots,n\}$\end{document}$, where $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$n\in N$\end{document}$. Put $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ F(r)=\ln n+\frac{r}{n} \Biggl(\sum_{i=1}^{n}x_{\varphi (i)} \ln x_{i} \Biggr)-\ln \Biggl(\sum_{i=1}^{n}e^{rx_{\psi(i)}\ln x_{i}} \Biggr). $$\end{document}$$ The function $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$F(r)$\end{document}$ is defined on $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$R^{n}_{+}$\end{document}$ where $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$n\in\mathbf{N}$\end{document}$, $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$r\geq0$\end{document}$, $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$R^{n}_{+}=\{(x_{1},\ldots,x_{n}), x_{i}>0, i=1,\ldots,n\}$\end{document}$. We note that $\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$F(r)\geq0$\end{document}$ is equivalent to the following generalization of Cîrtoaje's inequality (I): $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ n\sqrt[n]{\prod_{i=1}^{n}x_{i}^{rx_{\varphi(i)}}} \geq \sum_{i=1}^{n}x_{i}^{rx_{\psi(i)}}. $$\end{document}$$ The reverse inequality to (I) $$\documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym}
\usepackage{amsfonts}
\usepackage{amssymb}
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ n\sqrt[n]{\prod_{i=1}^{n}x_{i}^{rx_{\varphi(i)}}}< \sum_{i=1}^{n}x_{i}^{rx_{\psi(i)}} $$\end{document}$$ we | {
"pile_set_name": "PubMed Central"
} |
INTRODUCTION {#s1}
============
Natural Killer (NK) cell neoplasms are a rare and heterogeneous group of disorders characterized by excessive proliferation of cytotoxic CD3^−^ CD16/56^+^ NK cells. This group comprises two subtypes: aggressive NK leukemia (ANKL) and chronic lymphoproliferative disorder (CLPD) \[[@R1], [@R2]\]. ANKL is an Epstein Barr virus (EBV)-associated tumor most prevalent among Asian young adults (median age of 42 years). It has a fulminant clinical course, frequently resulting in death within two months. In contrast, CLPD has no demonstrable association with EBV and tends to occur in older adults (median age of 60 years). The clinical course is typically indolent, similarly to T-cell large granular lymphocytes leukemia (T-LGLL) \[[@R3]--[@R5]\].
Since no standard therapies for aggressive NK cell neoplasms have been established so far and the overall outcomes are dismal, new therapeutic options are needed.
Fyn, a tyrosine-specific phospho-transferase, is a member of Src family kinases which includes c-Src, Yes, Lck, Lyn, Hck, Fgr and Blk \[[@R6]--[@R8]\]. It phosphorylates a variety of target proteins involved in different signaling pathways \[[@R6]\]. Moreover, it regulates several biological functions, including growth factor and cytokine receptor signaling, cell-cell adhesion, integrin-mediated signaling, ion channel function, platelet activation, T and B-cell receptor signaling, axon guidance, mitosis, differentiation of NK cells \[[@R9]--[@R11]\].
In the last decade, the implication of Fyn in cancer biology and in hematologic malignancies has become more apparent. In chronic myeloid leukemia (CML) Fyn is up-regulated and its activation seems to be important in imatinib resistance \[[@R12], [@R13]\]. It is notably involved in the pathogenesis of peripheral T cell lymphomas \[[@R14]\] and in acute myeloid leukemia its higher expression, combined to FLT3-Internal Tandem Duplication (ITD), is correlated with poor prognosis \[[@R15]\].
The tissue-specific pattern of Fyn mRNA indicates that it is more expressed in normal NK and T cells respect to other human tissues \[[@R16]\].
Tintori *et al.,* by a structure-based drug design protocol and following hit-to-lead optimization, found 4c pyrazolo\[3,4-*d*\]pyrimidine compound driving inhibition of Fyn phosphorylation with a nanomolar range in an enzymatic cell-free assay. Moreover, the compound showed anti-proliferative activities against different cancer cell lines \[[@R17]\].
Therefore, in the present study we investigated the expression of Fyn in NK leukemic cells and the effect of 4c pyrazolo\[3,4-*d*\]pyrimidine compound in NK cell lines and in primary cells from chronic leukemic neoplasms.
RESULTS {#s2}
=======
Fyn is highly expressed in NK leukemic cells {#s2_1}
--------------------------------------------
In order to quantify the presence of Fyn in NK leukemic cells, we firstly assessed its mRNA expression levels in peripheral blood mononuclear cells (PBMCs) from 10 healthy donors (HDs) and 8 CLPD patients by quantitative Real Time-Polymerase Chain Reaction (qRT-PCR). *Fyn* level was significantly up-regulated in PBMCs from CLPD patients compared to HDs (*p* \< 0.001; Figure [1A](#F1){ref-type="fig"}). We also analyzed Fyn protein level by western blotting (WB) in PBMCs of 3 HDs, 3 CLPD patients and in two NK cell lines, KHYG1 and NK92. We observed a high level of Fyn protein in PBMCs from chronic patients and in NK leukemic cell lines respect to PBMCs from HDs (Figure [1B](#F1){ref-type="fig"}).
{#F1}
4c pyrazolo\[3,4-*d*\]pyrimidine compound reduced cell viability, induced apoptosis and cell cycle arrest in NK leukemic cells {#s2_2}
------------------------------------------------------------------------------------------------------------------------------
We treated two cell lines (KHYG1 and NK92), 3 PBMCs from HDs and NK cells isolated from 3 HDs with 4c pyrazolo\[3,4-*d*\]pyrimidine compound or with dimethyl sulfoxide (DMSO) vehicle control at different concentrations (2--10 μM) for 24, 48 and 72 hours, cultured with IL2. After 4c treatment, we performed viability test which showed that 4c compound reduced viability of both cell lines in a dose-dependent manner. The effect was observed at 24 hours and remained constant in the other time points (Figure [2A](#F2){ref-type="fig"}). Importantly, both cell lines needed a significantly lower drug concentration (*p* \< 0.01) to reach 50% reduction of viability (EC~50~) (Table [1](#T1){ref-type="table"}). Interestingly, 4c compound had negligible effect in PBMCs and in purified NK cells from HDs (Figure [2A](#F2){ref-type="fig"}). Same results were obtained in primary NK cells from HDs treated with 4c compound and cultured without IL2 ([Supplementary Figure S1](#SD1){ref-type="supplementary-material"}).
{#F2}
###### EC~50~ obtained in two cell lines and PBMCs and in purified NK cells from HD samples after 4c compound treatment (*P* value is \< 0.01 for both cell lines vs HDs) (n.c.: not calculable)
EC~50~ (μM)
------------- -------------
KHYG1 5.4
NK92 10.6
HDs 59
HD-NK cells n.c.
To further investigate cell death mechanism induced after treatment, we performed apoptosis and cell cycle analysis on KHYG1 cell line by cytometric analysis of Annexin V/propidium iodide (PI) and PI, respectively. After treatment with 4c compound at 4 μM for 24 hours, we observed a significant increase of apoptotic cells (*p* \< 0.001) and cell cycle arrest in G2/M phase in treated KHYG1 respect to their control (Figure [2B--2C](#F2){ref-type="fig"}).
Fyn phosphorylation is reduced after 4c compound treatment and it decreased Akt and P70 S6 kinase activation {#s2_3}
------------------------------------------------------------------------------------------------------------
To verify Fyn inhibition we performed its immunoprecipitation in KHYG1 cell line treated with 4c compound or with DMSO vehicle control and we detected its phosphorylation. We observed that Fyn phosphorylation significantly decreased after treatment (*p* \< 0.01; Figure [3A](#F3){ref-type="fig"}).
{#F3}
We also explored, by WB, the activation of two protein involved in Fyn pathway, Akt and P70 S6 kinase. Our data showed that there was a decrease of phosphorylation of Akt and P70 S6 kinase after treatment with 4c compound (*p* \< 0.05; Figure [3B](#F3){ref-type="fig"}).
Gene expression and protein profile of treated NK leukemic cells showed the activation of apoptotic pathways {#s2_4}
------------------------------------------------------------------------------------------------------------ | {
"pile_set_name": "PubMed Central"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.