text
large_stringlengths
148
17k
id
large_stringlengths
47
47
score
float64
2.69
5.31
tokens
int64
36
7.79k
format
large_stringclasses
13 values
topic
large_stringclasses
2 values
fr_ease
float64
20
157
But the similarities end there. Both of the newfound planets reside in tight orbits around their parent star that ought to drive their surface temperatures to life-unfriendly extremes. Torres and his colleagues estimate that Kepler 20 f, the cooler of the two, has a temperature in the neighborhood of 430 degrees Celsius—hot enough to melt lead. "These are definitely too hot to be habitable, at least too hot to support life as we know it," he says. In a separate study submitted to the Astrophysical Journal, the Kepler group reports finding three other small planets orbiting the same star, ranging from about two to three times the diameter of Earth. All five planets around Kepler 20 rank among the smallest-diameter planets discovered to date. (Astronomers have been able to measure the physical dimensions of only about 200 exoplanets to date; the diameters of another 500 or so planets are unknown.) The Kepler 20 system has a very different architecture than does our solar system. For starters, all five worlds orbit closer to their host star than Mercury, the innermost planet in our solar system, orbits the sun. And unlike our solar system, where the inner planets are terrestrial worlds and the outer planets are gas giants, the Kepler 20 system is not neatly divided. "This system has gas worlds and rocky worlds," Torres says. "But they're all mixed up; they're not separated like in our own solar system. This is a very interesting thing that we have never seen before."
<urn:uuid:3116dbe3-6f59-47c9-81a4-3700c188d074>
3.546875
301
Knowledge Article
Science & Tech.
47.915973
The excitement from Europe earlier this month was palpable. Experiments had hinted at the discovery of a new fundamental ingredient of nature—a particle called the Higgs boson. This wasn’t just any particle, but one that could potentially tell us that the theory physicists have been using to understand matter’s fundamental building blocks for the last half century is premised on a secure foundation. Even nonscientists—those for whom terms like “Higgs field,” “gigaelectronvolt,” and “hadron” are almost a foreign language—were thrilled, inspired by the notion that we are on the verge of unraveling mysteries previously beyond our grasp. “Hadron,” in fact, refers to particles that interact through one of the four forces of nature known as the strong nuclear force. The Higgs-boson experiments are taking place at the Large Hadron Collider, an enormous particle accelerator crossing the French-Swiss border. In the LHC’s underground labyrinth, scientists can observe the collision of protons—a type of hadron—that have been accelerated to nearly the speed of light. These protons collide a billion times a second in a tiny region smaller than a human hair. When they do, they can turn into energy, as predicted by Einstein’s theory, and that energy can then create new types of matter, never before seen. On the afternoon of Tuesday, Dec. 13, in Geneva, spokespeople from the two major LHC experiments, called ATLAS and CMS, announced the status of their respective searches for the Higgs boson. Named for the British physicist Peter Higgs, the particle—if it exists—would tell us that the Higgs mechanism, the half-century-old idea for understanding how elementary particles acquire their masses, is correct. Those masses are essential to much of the structure we see in the world. If electrons didn’t have mass, atoms wouldn’t form. And then neither would galaxies, planets, or life. There’s a lot more to all this structure than the Higgs mechanism alone, so the name “God particle,” coined by the Nobel Prize–winning physicist Leon Lederman and relished by the popular media, might be a bit misleading. Nonetheless, the Higgs mechanism is critical to today’s theory of the basic elements of matter. Higgs and his colleagues theorized that space itself contains a sort of charge. Elementary particles acquire mass through their interaction with the charge (you might think of this charge as a traffic camera that slows down traffic even without any actual policemen to stop the cars). Space isn’t filled with Higgs-boson particles—you need a collider such as the LHC to make those—but the Higgs boson is the telltale sign that there really is such a “charge” in space. But here’s the catch: the Higgs mechanism hasn’t yet been vindicated by experiments. The reason the news from Geneva was so momentous was that scientists at the LHC might have come one step closer to proving it. Such a discovery won’t turn our world around tomorrow. But basic science is like that. For all the deep and fundamental truths we learn about nature, it’s rarely clear right away what the implications will be. When electricity was discovered, no one knew the globe would fairly quickly be blanketed with lightbulbs. When quantum mechanics was discovered, no one anticipated semiconductors and the ensuing electronics revolution. It’s still unclear what a discovery of the Higgs boson will mean in 10 or 20 or 100 years’ time, but cultures where people learn more about their world, and science is valued, seem to fare well in the end. I listened to the Higgs announcements over a choppy Internet connection that I spliced with occasional glances at Twitter, where people who could actually hear what was going on gave a rolling status report of the talks. Although it was 5 a.m. for me in California, the early-morning wake-up was worth it. For me, a physicist whose work for the past quarter century has focused on the mysteries of matter, any clue about the Higgs boson would provide valuable and long-awaited insight. The first talk was by Fabiola Gianotti, the remarkable leader of the ATLAS experiment, who presented evidence of a Higgs boson decaying into photons and also into other particles. She kept advising caution, which she would belie by periodically breaking into a smile as she spoke. Listening to her, I felt the excitement, too. For a moment I even believed the Higgs boson might really have been found. But my hope might have been premature, as I learned in the CMS talk that followed. Alas, the CMS evidence for a particle was much weaker. Its researchers couldn’t rule out the Higgs boson. But they couldn’t say they’d seen it, either. The good news is that with four times the data coming next year (the LHC has improved remarkably with each year of running), even the most cautious and skeptical among us are confident we’ll know the answer—at least about the Higgs boson—by next year. And if the hints at discovery prove false, it won’t mean the whole story is wrong—it will more likely mean that a more subtle theory is responsible for the “charge” in space that gives particles mass. The great irony is that for physicists, not finding a Higgs boson would be spectacular, pointing to something potentially more interesting. Future investigations might demonstrate either that an exotic Higgs-boson-like particle has other ways to decay than those in the standard model or that the Higgs boson might be a more complex object made up of smaller ingredients, much as a proton is made up of smaller fundamental particles called quarks. Galileo first realized the value of experiments: artificial situations a scientist sets up to study some phenomenon. He said they went far beyond making new discoveries or proving an idea correct; just as important was ruling out ideas. I recently moderated a talk among four Nobel Prize winners at the Museum of the Rockies in Montana. A theorist on the panel thanked the experimenter to his right for finding the particle that verified his theory and earned him his Swedish prize. The experimenter’s response was that he shouldn’t thank him—he would have been just as happy to have disproved the theory. Knowing what is and isn’t realized in nature will guide us on our searches as we move forward, and will help us address still deeper questions about space and the matter of which the universe is composed.
<urn:uuid:d7211430-c180-426e-b12b-2bbe42a330cc>
3.140625
1,398
Nonfiction Writing
Science & Tech.
48.115585
It was the most average of hurricane seasons, and the most unpredictable of hurricane seasons. It started way early, with Subtropical Storm Andrea, which formed on May 9 (officially the season begins June 1). And now it is going to end way late, with Subtropical Storm Olga, currently in the Caribbean. [A subtropical storm, incidentally, is a hybrid between a fully tropical system and a fully extratropical or midlatitude one. The U.S. National Hurricane Center has been naming subtropical storms since 2002.] Olga is the first December named storm in the Atlantic since 2005's Hurricane Epsilon. As Jeff Masters points out, there have now been 17 named December Atlantic storms since record-keeping began. And Masters adds this tantalizing piece of information: "Seven of the 17 December storms have occurred since 1995." On a similar note, over at The New York Times, Andrew Revkin is also asking whether the 2007 season, with its abnormal length (if not its abnormal number of intense hurricanes), could be a hint that the climate's changing. Well, here's what we can safely say about this: A number of scientists do indeed expect lengthening of the average tropical cyclone season as a result of global warming. Simply put, the tropical oceans ought to warm up enough to sustain hurricanes earlier in the year, and also ought to remain warm enough to sustain them later into the year. This logic suggests that our traditional June/November Atlantic hurricane season bookends may indeed need to topple that is, provided that no countervailing changes occur as a result of global warming that have the effect of hemming the hurricane season back in again. But of course, there are a lot of complexities here. For example, you will note that our earliest and latest named storms of 2007, Andrea and Olga, were both subtropical in nature. And as I mentioned previously, the National Hurricane Center didn't even start naming these types of storms until 2002. So I can already hear the argument from skeptics: The season isn't really getting any longer, it's just that now we're paying more notice to subtropical storms.... Maybe that's right. I, however, remain convinced that global warming is already changing hurricanes in myriad ways but that due to the complexity of the science and the general unpredictability of weather, it is exceedingly hard to detect the effect definitively at this point. In any event, the 2007 Atlantic hurricane season continues to tantalize. In some sense, I'm going to be glad it's over (whenever it finally ends) just so it will stop thwarting, at every turn, my attempts to put it in a box and categorize it. Enter your city or zip code to get your local temperature and air quality and find local green food and recycling resources near you.
<urn:uuid:c5040760-d744-4f05-80f1-0ccc9110e1fa>
3.1875
583
Personal Blog
Science & Tech.
47.134205
Last year around this time, DSN reported on a Corpus Christi Caller-Times story documenting that 135 sea turtle nests were located in 8,895 hours of surveys over 73,632 miles of Texas beaches. Of these, 128 nests were Kemp’s ridleys (Lepidochelys kempii), six nests were loggerhead sea turtles (Caretta caretta), and one nest was from a green sea turtle (Chelonia mydas). This was remarkable at the time because it was a record for Kemp’s ridley turtles, who were hard hit by shrimp trawlers, which ensnare and drown the turtles with their large, fast moving nets. Escape hatches, called Turtle Excluder Devices (TEDs), have been required on shrimp trawl nets since the late 1980s. The latest counts are in now for the 2008 nesting season from Donna Shaver, chief of sea turtle science and recovery at Padre Island National Seashore. She says… the future looks promising for Kemp’s ridleys… a record 195 Kemp’s ridley nests were found on the Texas coast this nesting season, which runs from April to mid-July. It’s the fifth consecutive record-breaking year. Four green turtle, four loggerhead and one leatherback nest were also discovered. The leatherback nesting site is the first on a Texas beach since the 1930s. None of the recovered leatherback eggs hatched, unfortunately. Leatherback turtles are critically endangered, predicted to go extinct by 2033 if the current rate of decline continues. The success of Texas turtle nesting populations is largely attributed to a captive rearing program which collects and incubates the eggs in their native sand, at the appropriate temperatures for each gender. One of the original Science papers documenting temperature dependent sex determination in sea turtles is abstracted here, if you’re interested in learning more. Why is captive rearing important in Texas? We like to drive our trucks on beaches here. It’s what we do. In Mexico they eat the eggs. Here, we just crush them, and never know it.
<urn:uuid:ad750e23-1ce8-4f8c-8f8a-54783f94ebe2>
3.265625
440
Personal Blog
Science & Tech.
49.57481
by Tanner Sorensen A big part of the development of Alchemy originated in Islam. The word alchemy came from the Arabic word al-kimia, which came from the Persian word kimia. Will Durrant quotes in his book The Story of Civilization IV: The Age of Faith, “Chemistry as a science was almost created by the Moslems; for in this field, where the Greeks (so far as we know) were confined to industrial experience and vague hypothesis, the Saracens introduced precise observation, controlled experiment, and careful records. They invented and named the alembic (al-anbiq), chemically analyzed innumerable substances, composed lapidaries, distinguished alkalis and acids, investigated their affinities, studied and manufactured hundreds of drugs. Alchemy, which the Moslems inherited from Egypt, contributed to chemistry by a thousand incidental discoveries, and by its method, which was the most scientific of all medieval operations.” There are many Islamic figures in chemistry, and they often aren’t as acknowledged as they should be. Early Islamic chemists such as Jabir ibn Hayyan, Al-Kindi and Al-Razi made important chemical breakthroughs such as perfumery; distillation apparatus; muriatic, nitric, acetic and sulfuric acids; purified distilled alcohol, soda and potash; and filtration. Jabir understood the importance of experimentation. Jabir created the alembic when he discovered how to complete the process of distillation. Jabir’s teacher, Ja’far al-Sadiq, refuted Aristotle’s theory of four elements by saying “I wonder how a man like Aristotle could say that in the world there are only four elements – Earth, Water, Fire, and Air. The Earth is not an element. It contains many elements. Each metal, which is in the earth, is an element.” Another influential Muslim chemist was al-Razi. Al-Razi was the first to distill petroleum, invent kerosene and lamps for it, invent soap bars and recipes for soap, make antiseptics, and developed many chemical processes like sublimation. In addition to all other contributions, Muslim alchemists developed theories on the possibility of the transmutation of metals, the philosopher’s stone, and creating artificial life in laboratories, as in later medieval European alchemy, though these theories were eventually discredited and rejected by practical Muslim chemists from the 9th century thereon. Therefore, medieval Arabic alchemy was the biggest contributor to Alchemy and Chemistry as we know it today.
<urn:uuid:cdd60d61-7352-4c72-bdd1-4f36f8e2c604>
3.234375
540
Personal Blog
Science & Tech.
21.033384
Wilhelm Conrad Röntgen (27 March 1845 – 10 February 1923) was a German physicist, who, on 8 November 1895, produced and detected electromagnetic radiation in a wavelength range today known as x-rays or Röntgen rays, an achievement that earned him the first Nobel Prize in Physics in 1901. |This scientist article is a stub. You can help Wikiquote by expanding it.| - I did not think; I investigated. - In a few minutes there was no doubt about it. Rays were coming from the tube which had a luminescent effect upon the paper. I tried it successfully at greater and greater distances, even at two metres. It seemed at first a new kind of invisible light. It was clearly something new, something unrecorded. - As quoted in "The New Marvel in Photography", by H. J .W. Dam, in McClure's magazine, Vol. 6, No. 5 (April 1896), p. 416 Quotes about Röntgen - Röntgen has familiarized us with an order of vibrations of extreme minuteness compared with the smallest waves with which we have hitherto been acquainted, and of dimensions comparable with the distances between the centers of the atoms of which the material universe is built up; and there is no reason to suppose that we have here reached the limit of frequency. - William Crookes, in his inaugural address as President of the British Association for the Advancement of Science, published in Nature No. 1506, Vol. 58 (8 September 1898), p. 438
<urn:uuid:196bc06e-373b-45fa-9eb6-1ec9f3a7336f>
3.53125
324
Knowledge Article
Science & Tech.
62.034732
The Box–Muller transform (by George Edward Pelham Box and Mervin Edgar Muller 1958) is a pseudo-random number sampling method for generating pairs of independent, standard, normally distributed (zero expectation, unit variance) random numbers, given a source of uniformly distributed random numbers. It is commonly expressed in two forms. The basic form as given by Box and Muller takes two samples from the uniform distribution on the interval (0, 1] and maps them to two standard, normally distributed samples. The polar form takes two samples from a different interval, [−1, +1], and maps them to two normally distributed samples without the use of sine or cosine functions. The Box–Muller transform was developed as a more computationally efficient alternative to the inverse transform sampling method. The Ziggurat algorithm gives an even more efficient method. Basic form The derivation is based on the fact that, in a two-dimensional Cartesian system where X and Y coordinates are described by two independent and normally distributed random variables, the random variables for R2 and Θ (shown above) in the corresponding polar coordinates are also independent and can be expressed as Because R2 is the square of the norm of the standard bivariate normal variable (X, Y), it has the chi-squared distribution with two degrees of freedom. In the special case of two degrees of freedom, the chi-squared distribution coincides with the exponential distribution, and the equation for R2 above is a simple way of generating the required exponential variate. Polar form The polar form was first proposed by J. Bell and then modified by R. Knop. While several different versions of the polar method have been described, the version of R. Knop will be described here because it is the most widely used, in part due to its inclusion in Numerical Recipes. Given u and v, independent and uniformly distributed in the closed interval [−1, +1], set s = R2 = u2 + v2. (Clearly .) If s = 0 or s ≥ 1, throw u and v away and try another pair (u, v). Because u and v are uniformly distributed and because only points within the unit circle have been admitted, the values of s will be uniformly distributed in the open interval (0, 1), too. The latter can be seen by calculating the cumulative distribution function for s in the interval (0, 1). This is the area of a circle with radius , divided by . From this we find the probability density function to have the constant value 1 on the interval (0, 1). Equally so, the angle θ divided by is uniformly distributed in the interval [0, 1) and independent of s. We now identify the value of s with that of U1 and with that of U2 in the basic form. As shown in the figure, the values of and in the basic form can be replaced with the ratios and , respectively. The advantage is that calculating the trigonometric functions directly can be avoided. This is helpful when trigonometric functions are more expensive to compute than the single division that replaces each one. Just as the basic form produces two standard normal deviates, so does this alternate calculation. Contrasting the two forms The polar method differs from the basic method in that it is a type of rejection sampling. It throws away some generated random numbers, but it is typically faster than the basic method because it is simpler to compute (provided that the random number generator is relatively fast) and is more numerically robust. It avoids the use of trigonometric functions, which are comparatively expensive in many computing environments. It throws away 1 − π/4 ≈ 21.46% of the total input uniformly distributed random number pairs generated, i.e. throws away 4/π − 1 ≈ 27.32% uniformly distributed random number pairs per Gaussian random number pair generated, requiring 4/π ≈ 1.2732 input random numbers per output random number. The basic form requires three multiplications, one logarithm, one square root, and one trigonometric function for each normal variate. On some processors, the cosine and sine of the same argument can be calculated in parallel using a single instruction. Notably for Intel-based machines, one can use the fsincos assembler instruction or the expi instruction (usually available from C as an intrinsic function), to calculate complex and just separate the real and imaginary parts. The polar form requires two multiplications, one logarithm, one square root, and one division for each normal variate. The effect is to replace one multiplication and one trigonometric function with a single division. See also - Inverse transform sampling - Marsaglia polar method, similar transform to Box-Muller, which uses Cartesian coordinates, instead of polar coordinates - Ziggurat algorithm, a very different way to generate normal random numbers - G. E. P. Box and Mervin E. Muller, A Note on the Generation of Random Normal Deviates, The Annals of Mathematical Statistics (1958), Vol. 29, No. 2 pp. 610–611 - Kloeden and Platen, Numerical Solutions of Stochastic Differential Equations, pp. 11–12 - Sheldon Ross, A First Course in Probability, (2002), pp. 279–81 - J. Bell: 'Algorithm 334: Normal random deviates', Communications of the ACM, vol. 11, No. 7. 1968 - R. Knopp: 'Remark on algorithm 334 [G5]: normal random deviates', Communications of the ACM, vol. 12, No. 5. 1969 - Everett F. Carter, Jr., The Generation and Application of Random Numbers, Forth Dimensions (1994), Vol. 16, No. 1 & 2. - Note that the evaluation of 2πU1 is counted as a single multiplication because the value of 2π can be computed in advance and used repeatedly.
<urn:uuid:10f4f6b8-e7e2-483a-bd7e-0a650e9d0346>
3.921875
1,259
Knowledge Article
Science & Tech.
47.131827
Serrasalmus nattereri (non Günther, 1864) The red-bellied piranha or red piranha (Pygocentrus nattereri) is a species of piranha native to South America, found in the Amazon River Basin, coastal rivers of northeastern Brazil, and the basins of the Paraguay and Paraná. The red-bellied piranha has a popular reputation as a ferocious predator, despite being primarily scavengers. As their name suggests, red-bellied piranhas have a reddish tinge to the belly when fully grown, although juveniles are a silver colour with darker spots. They grow to a maximum length of 33 centimetres (13 in) and a weight of 3.5 kilograms (7.7 lb). The way to distinguish males from females is that the female has a slightly deeper color of red on her belly. Their diet consists largely of fish, insects, worms, crustaceans, and the occasional larger animal. In contrast to their popular reputation of feeding on live animals, red-bellied piranhas usually feed on dead, dying, and injured vertebrates in the wild, but have been known to attack healthy animals. The fish usually feed in large schools around dusk and dawn. They locate their prey by scent or motion using a set of sensors down the sides of their bodies, the lateral line system. Red-bellied piranha usually spawn around April and May during the rainy season. The male will build a dug-out nest in rocks and vegetation, awaiting a female. Females can lay up to 1000 eggs which the male fertilizes. Males become extremely territorial during spawning, and will prevent other fish from approaching the nest. After the eggs hatch, both parents guard the broods. Red-bellied piranha in media Many myths surround this species. The 1978 film Piranha by Joe Dante shows these fish in a similar light to Jaws. Piranha was followed by a sequel, Piranha II: The Spawning, in 1981, and two remakes, one in 1995, and one in 2010. Films such as these, and stories of large schools of red-bellies attacking humans, fuels their exaggerated and erroneous reputation as being one of the most ferocious freshwater fish. In reality, they are generally timid scavengers, fulfilling a role similar to vultures on land. In the 2010 film Piranha 3D, Christopher Lloyd's character identifies a specimen of the fictional monstrous piranha, specifically as Pygocentrus nattereri, but erroneously refers to them as the first piranhas, when in reality, red-bellied piranha are most likely not the "original" species. In an aquarium Red-bellied piranhas are sometimes kept as aquarium fish. Their natural diet consists of live prey and dead animals and fish. Live feedings to captive piranhas can introduce diseases, and goldfish contain a growth-inhibiting hormone which in turn will affect piranhas. Red-bellied piranhas, particularly when juvenile, will sometimes bite one another in the aquarium, normally on the fins, in behaviour called 'fin nipping'. Fish that have had their fins nipped will grow them back surprisingly rapidly. - "Animal Diversity Web: Pygocentrus nattereri". Animal Diversity Web. University of Michigan. - "BBC Nature Red-bellied piranhas". BBC Nature Wildlife. BBC. Retrieved 10 December 2012. - "Red Bellied Piranha (Serrasalmus nattereri)". Marwell Animal Encyclopedia. Marshwell Wildlife. Retrieved 24 January 2013. |Wikimedia Commons has media related to: Pygocentrus nattereri|
<urn:uuid:a16038c2-4a1f-4480-b7bb-9fae57786d01>
3.328125
782
Knowledge Article
Science & Tech.
42.921366
What is a monsoon? Wind systems which change their directions seasonally, and originate from the temperature difference of the land and the sea, in a way that in the warm season they blow towards the land, in the cold season towards the sea. The monsoon name is typically used for the winds of the Indian Sea. How are monsoon winds formed? The monsoon wind system is a closed circulation, because their is a opposite current of air in upper layers compared to the bottom layer. The tropical monsoon The primary reason of the formation of monsoons, is the different warming-up of the seas and the land on the Earth's surface, and that the thermal and geographical Equator do not coincide and the thermal one is not parallel with the latitude circles. Above the continents, that warm up better, in the summer in the northern hemisphere it moves apart towards north, in the southern hemisphere moves apart towards south from the Equator. Because of the amplitude of the thermal Equator the trade wind crosses the geographical Equator, where because of the rotation of the Earth they change their direction. The south-east trade wind of the southern hemisphere in the summer of the northern hemisphere crosses the geographical Equator by following the thermal Equator, and continues its way as south-western monsoon. In the summer of the southern hemisphere the north-eastern trade wind of the northern hemisphere crosses the geographical Equator. Monsoons in temperate zones The monsoon wind systems of temperate zones are formed by the seasonally fluctuating and different warming-up and cooling-down of the land and the nearby ocean, and by the different air-pressure coming with this phenomena. In the winter land cools down more than ocean, therefore in the centre of the continents anticyclones form. In the winter these anticyclones result in current of air blowing from the land towards the sea close to the surface. In the summer the distribution of air-pressure is opposite, therefore in the centre of the continents, which warm up better, low-pressure anticyclonic areas form, which result in current of air blowing from the sea towards the centre of land close to the surface. The victims of the monsoon
<urn:uuid:700f5002-0880-4fc7-b527-c3c157dc62a9>
4.09375
461
Knowledge Article
Science & Tech.
37.129229
|[General Info] [Techniques] [Types] [Applications]| Nanoparticles can be formed in several different ways. One of the most common ways is attrition. Attrition is a process in which macro or micro scale particles are “ground up” in a ball mill and then air classified to recover oxide nanoparticles. Another common way to produce nanoparticles is pyrolysis. During pyrolysis (also called flame spray pyrolysis or chemical vapor condensation), an organic liquid or gas is forced through an orifice at high pressure and is then burned. Then, the ash that is left is air classified to produce oxide nanoparticles.
<urn:uuid:96a4d6c9-b316-40fa-aab7-463593530fe7>
3.671875
139
Knowledge Article
Science & Tech.
27.56375
The United States military is using technology to its advantage, and now, the latest breakthroughs in neuroscience might also provide the government with weaponry and gear that taps into the human brain. However, fiddling with such developments has the potential to do great harm. A recent article in U.S. News & World Report detailed advances in neuroscience that could possibly be used by the military: "tanks controlled from half a world away, memory erasures that could prevent PTSD, and 'brain fingerprinting' that could be used to extract secrets from enemies." Jonathan Moreno, a professor of bioethics at the University of Pennsylvania and the author of Mind Wars: Brain Science and the Military in the 21st Century, wrote an essay published in PLoS Biology about ethical questions of utilizing mind-altering developments in warfare. When Albert Einstein discovered his special theory of relativity he didn't know that one day that technology would be used to build nuclear weapons, he says. "Neuroscientists may not consider how their work contributes to warfare," added Moreno. Moreno and others are asking the government to consider the ethical boundaries of developing and utilizing such a technology to be used in warfare. The military has already invested in neuroscience technologies. In 2008, the military put $4 million towards the development of "thought helmets." Other emerging areas of neuroscience might also prove useful to the military include the ability to make soldiers that can eat grass, feel no fear and possess superhuman abilities to climb walls. It is no secret that the military likes utilizing technology to gain warfare advantages. This year alone, various branches of the Department of Defense have signed multi-million dollar contracts for the purchase of robots for use in tactical operations. Most of the robots are small in size, but most recently DARPA imagined humanoid-sized robots. Do you think developments in neuroscience should be used by the military? Tell us in the comments.
<urn:uuid:08188c26-43df-4844-a5cb-6f0c6d6701e9>
3
385
Comment Section
Science & Tech.
31.283619
in Tetrahedral ABCD : E,F and G are to order Middle of sides AB , BC, AD . also GE is Perpendicular to AB and GF is Perpendicular to BC . if angle of ABC is 96 degree . calculate angle of ACD? The line EG is the perpendicular bisector of the segment [AB] and so |AG|=|BG|. Likewise, the line FG is the perpendicular bisector of the segment [BC] and so |BG|=|CG|. G is the midpoint of the segment [AD] and so |AG|=|DG|. Thus the points A,B,C,D all lie on a circle with centre G. The angle $\angle ACD$ stands on the diameter $[AD]$, and so is a right angle.
<urn:uuid:2987e8d1-59ce-4360-a46b-225d70c142b7>
2.921875
170
Q&A Forum
Science & Tech.
84.677103
Gravity and Newton's Third Law Name: James T. If every action has an equal and opposite reaction, then I think the pull of gravity can be reversed somehow. anyone agree? The equal and opposite reaction that applies to the force of the earth's gravity pulling you down is the force of your gravity pulling the earth up. Let's say that someone weighs 130 lbs. They are pushing down on the earth with 130 lbs but the earth is pushing back with 130 lbs (equal and opposite Click here to return to the Physics Archives Update: June 2012
<urn:uuid:598cc572-af49-42af-939b-2d6e538e60d5>
2.796875
119
Knowledge Article
Science & Tech.
66.403
Mission Type: Rover Launch Vehicle: Proton booster plus upper stage and escape stages; 8K82K + Blok D (Proton-K no. 251-01) Launch Site: Tyuratam (Baikonur Cosmodrome), USSR; NIIP-5 / launch site 81L Spacecraft Mass: Spacecraft: 5700 kg; Rover: 756 kg Spacecraft Instruments: 1) imaging system (two low-resolution TVs and four high-resolution photometers); 2) x-ray spectrometer; 3) penetrometer; 4) laser reflector; 5) radiation detectors; 6) x-ray telescope; and 7) odometer/speedometer Spacecraft Dimensions: Descent vehicle: about 4 meters maximum distance between the landing legs Rover: 1.35 m high and 2.15 m across the top of the pressurized container, with a wheelbase of 1.6 m. Spacecraft Power: Solar cells and chemical batteries Deep Space Chronicle: A Chronology of Deep Space and Planetary Probes 1958-2000, Monographs in Aerospace History No. 24, by Asif A. Siddiqi National Space Science Data Center, http://nssdc.gsfc.nasa.gov/ Solar System Log by Andrew Wilson, published 1987 by Jane's Publishing Co. Ltd. Luna 17 continued the spate of successes in Soviet lunar exploration begun by Luna 16 and Zond 8. Luna 17 carried Lunokhod 1, the first in a series of robot lunar roving vehicles whose conception had begun in the early 1960s, originally as part of the piloted lunar landing operations. This was the second attempt to land such a vehicle on the Moon after a failure in February 1969. The descent stage was equipped with two landing ramps (in case one was blocked by a boulder) to enable the rover to disembark onto the Moon's surface. The 756-kilogram rover stood about 1.35 meters high and was 2.15 meters across. Each of its eight wheels could be controlled independently for two forward and two reverse speeds. Its top speed was about 100 meters per hour, with commands issued by a five-man team of "drivers" on Earth who had to deal with the 5-second delay. The set of scientific instruments was powered by solar cells (installed on the inside of the hinged top lid of the rover) and chemical batteries. After two midcourse corrections en route to the Moon, Luna 17 entered lunar orbit and then landed on the lunar surface at 03:46:50 UT on 17 November 1970 at 38°17' north latitude and 35°deg; west longitude, about 2,500 kilometers from the Luna 16 site in the Sea of Rains. The Lunokhod 1 rover rolled over one of the ramps and onto the lunar surface at 06:28 UT. The rover had an expected lifetime of three lunar days but operated for eleven. During its 322 Earth days of operation, the rover traveled 10.54 kilometers and returned more than 20,000 TV images and 206 high-resolution panoramas. In addition, Lunokhod 1 performed 25 soil analyses with its RIFMA X-ray fluorescence spectrometer and used its penetrometer at some 500 different locations. Controllers finished the last communications session with Lunokhod 1 at 13:05 UT on 14 September 1971. Attempts to reestablish contact were finally discontinued on 4 October.
<urn:uuid:5c08d7fb-5aab-4e10-85e6-261b2532a404>
3.375
709
Knowledge Article
Science & Tech.
59.142411
Some of you may have noticed the orange substance in Knob Creek in Black hills. The Tennessee Department of Environment and Conservation and the county’s environmental engineer have both examined the substance and have found it HARMLESS. Campbell Ridley met Mike Sweeney, the director of solid works, at the park Tuesday and the county had their environmental engineer at the park at 7 a.m. Wednesday morning. I met Mike and TDEC this morning. TDEC said that the substance in the creek is a product of low oxygen in the groundwater and iron rich soil. This substance is naturally occurring and has nothing to do with the landfill. From the TDEC bioloigist: The orange deposits that you have seen in Knob Creek at Chickasaw Trace are from naturally occurring "iron bacteria". These bacteria break down iron in the water and soil to form iron oxides, which is orange. An oily appearing sheen is usually associated with these deposits as well. The orange deposits and oily sheen are not harmful to aquatic life or to humans. They occur very commonly in streams and springs around Middle Tennessee. I have included a link to a fact sheet that I found on the internet that is very informative about this subject. I hope this helps. Water Pollution Control Columbia Environmental Field Office
<urn:uuid:89a53c24-69b4-447d-b814-8aba7007906b>
2.875
267
Comment Section
Science & Tech.
49.28197
Different modes of oscillation for a pendulum The period of a simple pendulum is not a trivial thing, and it depends on the initial conditions. Shown here are ten different modes of oscillation for the same pendulum. The only difference is the total amount of mechanical energy in the system. As a result, each one has a completely different period of oscillation, unlike what the small-angle approximation (as taught in high-school) would suggest. They can’t be in sync. You may see some really interesting patterns based on the delay between them in your browser. The red graph above each pendulum represents the phase portrait for the respective mode of oscillation, with the current state marked as a blue dot. The horizontal axis represents angle (hence why it wraps around the sides) while the vertical axis represents angular velocity. Pendulums are very interesting dynamical systems, as they are relatively simple to understand but can produce surprisingly complex results in certain cases, such as the chaotic behavior of double pendulums and the odd behavior displayed by coupled pendulums.
<urn:uuid:e9733165-66eb-4534-a5e9-d200891196a7>
3.53125
225
Personal Blog
Science & Tech.
32.099174
Click below for information about acid rain All about Acid Rain This site is an excellent acid rain resource containing articles, links and information covering all aspects of acid rain. Environmental Effects of Acid Rain: by the EPA Here is a highly informative page that explains how acid rain is formed, includes a model, explains where it comes from, and describes its effects on the world, i.e. forest degradation, visibility, health risks, etc. Causes, Effects and Solutions of This page includes an explanation, the science and links concerning the cause and effects of acid The EPA Acid Rain This page describes the EPA’s Acid Rain Program to reduce electric utilities’ emissions of pollutants that cause acid rain. One can also access articles, reports, and papers about acid rain from Benefits of Natural Gas: by American Gas Take a look at this page for information about the benefits of using natural gas over electricity (less sulfur dioxide emitted into the environment). It also provides information on how electric utility power plants may react to EPA
<urn:uuid:6c7ad8da-67c2-4905-bbd9-1e905382a8be>
2.875
237
Content Listing
Science & Tech.
20.840076
Wind Energy Technologies Wind energy technologies use the energy in wind for practical purposes such as generating electricity, charging batteries, pumping water, and grinding grain. Most wind energy technologies can be used as stand-alone applications, connected to a utility power grid, or even combined with a photovoltaic system. For utility-scale sources of wind energy, a large number of turbines are usually built close together to form a wind farm that provides grid power. Several electricity providers use wind farms to supply power to their customers. Stand-alone turbines are typically used for water pumping or communications. However, homeowners and farmers in windy areas can also use small wind systems to generate electricity. Learn more about small wind electric systems from Energy Saver. Or learn more about: Or read about EERE's wind energy technologies research.
<urn:uuid:0e278f26-3bdc-4977-b2bc-7891ee830886>
3.40625
167
Knowledge Article
Science & Tech.
20.870643
Indonesian peatlands seen playing key climate role YOGYAKARTA, Indonesia (Reuters) - To the average person, they are just ordinary swamps or bogs. But peatlands across the world are more than just simple marsh land: they are one of the largest carbon stores on earth and play a significant role in the regulation of greenhouse gas emissions and global climate change. Not for long, perhaps. In recent years, experts say peat bogs have been stoking global warming through increasing greenhouse gas emissions because of massive deforestation and conversion into agricultural land and palm oil plantations, especially in Southeast Asia which accounts for a huge chunk of the world's marshes. "When you clear land, the easiest way is by burning. But that emits sequestered carbon into the atmosphere," Bostang Radjagukguk, an Indonesian peat expert, told Reuters at a conference on peatlands in the historic city of Yogyakarta. "In Indonesia, some 5 percent of 20 million hectares (49 million acres) of peatland has already been converted into agricultural land." Peat is created by dead plant matter compressed over time in wet conditions preventing decay. Peat can hold about 30 times as much carbon as in forests above ground. The world's peatlands -- a rich and fragile ecosystem formed over thousands of years -- are estimated to contain 2 trillion tonnes of sequestered carbon. When drained, peat starts to decompose on contact with air and carbon is released, often aggravated by fires that can rage for months and add to a choking smog or haze that is an annual health menace to millions of people in the region. Dutch research institute Wetlands International estimates peatlands in Southeast Asia store at least 42 billion tonnes of soil carbon or peat carbon. Wetlands senior program manager Marcel Silvius estimates about 13 million of 27.1 million hectares of Southeast Asia peatlands have been drained causing severe peat soil degradation. Although degraded peatlands in Southeast Asia cover less than 0.1 percent of the global land surface, they are responsible for about 2 billion tonnes of carbon dioxide a year, or close to 8 percent of global carbon dioxide emissions. "By 2025, peatland emissions will decrease because easily degradable peatlands would have disappeared altogether," Silvius told Reuters. "In Indonesia alone, 3 million hectares of shallow peatland have already disappeared." As concerns about global warming increase, environmentalists say the problem is more acute in Indonesia where emissions from peat, when drained or burnt, account for some 85 percent of total emissions from Southeast Asia. Indonesia is home to 60 percent of the world's threatened peatlands, but its marshes are being destroyed at an unprecedented pace because of massive conversion into pulp wood and palm oil plantations to feed global demand for biofuel. "Palm oil production on peatlands requires drainage, leading to substantial emissions of carbon dioxide. This renders it unsuitable as a biofuel, as biofuels should by international standards at least be carbon neutral," said Silvius. MEGA RICE PROJECT Indonesia has also lost a huge chunk of peat under a project to convert about 1 million hectares of peat swamp forests into rice fields in the mid 90s, dubbed the Mega Rice Project. The project deforested and drained massive amounts of peatland in Central Kalimantan, only to find the acidic soil underneath was unsuitable for rice farming. Today, it's a giant wasteland, a spread of dry black peat releasing enormous amounts of carbon dioxide into the air. The highly combustible material lights up in the dry season, choking the area in thick haze for a couple of months a year. "It releases carbon-dioxide, methane and a cocktail of other gases, some of them toxic," Professor Jack Rieley, a peat expert at the University of Nottingham, told Reuters. Now, as the world battles global warming, Indonesia's peatlands are being seen as a hot investment ticket, as keeping its vast peatlands intact could be a huge opportunity for companies seeking to trade off business-related carbon emissions for emissions reductions achieved elsewhere. Indonesia is pushing to make emission cuts from preserving peatlands eligible for trade in a new deal on fighting global warming at U.N.-led climate talks in Bali in December. (Additional reporting by Adhityani Arga)
<urn:uuid:f186cd46-126a-4b8a-93f8-b7261cfdd7b4>
3.796875
926
Truncated
Science & Tech.
35.319993
Humphrey the Lost Whale Summary: This is a true story of Humphrey, the humpback whale, who was stranded in San Francisco Bay. Through the efforts of many, he was finally rescued and allowed to return to the open sea. Learn all about these interesting creatures by visiting Whale Characteristics, Humpback Whale Facts, and Two Groups of Whales. When you have finished studying the whale sites, test your understanding with the Whale Quiz.
<urn:uuid:43aaa280-0d91-4e50-9a49-08b8c26f8030>
2.6875
94
Knowledge Article
Science & Tech.
48.74
Species of Concern Cerulean Warbler (Dendroica cerula) Fact Sheet by Stuart Tingley cerulean warbler is a small migratory songbird that breeds in the forests of the central and eastern United States. What is a Cerulean Warbler? Named for the male’s unique blue color, the cerulean warbler is a small, migratory bird that weighs about 0.3 oz. The brightly colored male looks quite different from the female. It is bright cerulean blue above and white below, with white wing bars, white tail spots, a narrow black necklace and black streaks along the sides and back. The female is dull turquoise above and yellowish-white below, with a pale blue crown and a white or yellowish line over the eye. The female also has white wing bars and white tail spots but does not have a breast band or distinctive streaking. Young birds are similar to adult females, but are greener in color. The cerulean warbler’s summer range extends eastward from the Great Plains in eastern North and South Dakota, Nebraska, Kansas, and Oklahoma; south to Arkansas, Mississippi, Tennessee, northern Alabama and Georgia, and South Carolina; north to Massachusetts, southern Quebec, southeastern Ontario, Michigan, Wisconsin, and central Minnesota. Within this range their core breeding area is in eastern Tennessee, eastern Kentucky, southern and western West Virginia, southeastern Ohio, and southwestern Pennsylvania. During migration, cerulean warblers pass through the southern United States, flying across the Gulf of Mexico to the highlands of Central America and on to South America. They winter in broad-leaved evergreen forests within a narrow band of middle elevations (1,600 to 6,000 ft.) in the Andes Mountains of northern South America from Columbia to Peru and Venezuela. Cerulean warblers nest and raise their young in large tracts of deciduous hardwood forests that have tall, large-diameter trees and diverse vertical structure in the forest canopy. Gaps in the forest canopy or small forest openings appear to be important. Cerulean warblers nest in uplands, wet bottomlands, moist slopes, and mountains from less than 100 feet to more than 3,500 feet in elevation. Migratory and winter season habitats are not well known. This species may prefer primary forests with older-growth conditions, but has been found in second-growth forests and shade-grown coffee plantations. Similar to breeding habitat, multiple layers of vegetation in the forest canopy appear to be important. Cerulean warblers eat mostly insects, including bees, wasps, caterpillars, and weevils. They search for and take insects from the base of leaves and the foliage of many different tree species. During winter, ceruleans also feed on nectar. Cerulean warblers are considered area-sensitive because they prefer breeding in large forest tracts. They will breed in smaller forested stands in areas where the larger landscape is well-forested. During the breeding season, males sing high in mature trees. Females build open-cup nests on the middle and upper branches of deciduous forest trees, 30 to 60 feet above the ground. Nests are often located over an open space but are concealed from above by clumps of leaves from other branches or vines. Three to four eggs are laid in May or June and the female incubates for 11 to 13 days. After hatching, both parents feed the young for 9 to 11 days before fledging. Only one brood of young is raised annually, but the pair may renest if their first nest is destroyed. Why is There Concern About the Cerulean Warbler? Data from the Breeding Bird Survey indicate that the cerulean warbler has steadily declined at a rate of about 3 percent per year since 1966, when the survey first began. Based on an estimated 560,000 ceruleans in 1995, that rate of decline would result in a 2006 population of about 400,000. Habitat Loss on the Breeding Grounds Within its breeding range, over 50 percent of the historical forests have been cleared and replaced with farms, cities and suburbs. Many forests that remain do not have suitable habitat for cerulean warblers. For example, some forest management practices remove the largest trees, eliminating the structurally diverse canopy that ceruleans need. In many areas where forest acreage is increasing, that increase is due to second-growth stands of similar-sized and relatively young trees. Those stands lack the structural complexity preferred by this species. Small wooded tracts within a mostly cleared landscape are unsuitable cerulean habitat because they have high rates of nest parasitism and predation. Habitat Loss on the Wintering Grounds Over 60 percent of the cerulean’s wintering habitat has been converted from native tropical forest to pastures and farms. The rate of clearing is declining because much of what remains is on steep slopes. Ceruleans do use shade-grown coffee plantations but some of those plantations are being converted to sun-grown coffee, which ceruleans do not use. Habitat Loss on the Migratory/Stopover Grounds During migration ceruleans use coastal woodlots and forests along the Gulf Coast of North and Central America. Those wooded areas are being cleared as coastal development expands. What is Being Done to Conserve Cerulean Warblers? USFWS Migratory Birds – Cerulean Warbler Focal Species Strategy The Service is preparing a Cerulean Warbler Focal Species Strategy by compiling management and conservation documents into an action plan that will include monitoring, research, assessment, habitat management and public awareness to accomplish: 1) improved population status; 2) a clear statement of the responsibilities for actions; 3) a focus of Service resources on implementing those actions; and 4) communications to solicit support and cooperation for partners inside and outside the Service. Cerulean Warbler Technical Group The Cerulean Warbler Technical Group (CWTG) was formed in 2001 to develop a broad-based, scientific and technically sound approach to cerulean warbler conservation. Composed of private, state, and federal natural resource managers and species experts, the CWTG is developing strategies to meet monitoring, research, and conservation needs. The CWTG partnered with major forest-products companies in the mid-Appalachians to evaluate cerulean warbler status on up to 250,000 acres of previously unsurveyed habitat. During the nesting seasons of 2003 - 2005, hundreds of points on private lands were surveyed. The data are being used to test and refine predictive models on the spatial distribution, abundance, and habitat associations of cerulean warblers in their core breeding range. Trial timber harvest techniques to benefit cerulean warblers are being evaluated on several national forests in the Southeast. We believe these techniques have the potential to create and restore habitat much faster than natural succession would allow. The Non-Breeding Season Group of the CWTG compiled a database of documented observations of cerulean warblers, assessed non-breeding threats and conservation needs, identified opportunities for improving awareness of migratory bird issues, and (via the USDA Forest Service and The Nature Conservancy) provided funding for South American biologists to conduct new research on cerulean warblers in winter from 2003-2004 through 2005-2006. A number of independent studies throughout the cerulean’s breeding range provided information about the species ecology and population status. The CWTG has proposed a large-scale, coordinated breeding season effort to replicate some of the previous work and to address information gaps. Fact Sheet Created December 2006 Back - Cerulean Warbler
<urn:uuid:510bda89-3bfe-4f76-8862-a27b25ff756f>
3.78125
1,606
Knowledge Article
Science & Tech.
35.408805
Youíve been living off bread and water for a year. Suddenly, a table of your favorite food is dropped into your living space. Youíre probably going to "attack" the food and eat all that you can, as fast as you can. All your friends, seeing that pile of food that just appeared, will join in and eat to their hearts desire. Seed is a table of food for microorganisms When we plant a seed in the ground, microorganisms see it as a food source. Most microorganisms in the soil wonít hurt the seed or plant, some microorganisms can actually be beneficial to the plant, and some can hurt the plant by causing diseases and economic damage to plant stands and the plant in general. The microorganisms that cause plant diseases are the "Tiny Predators: Enemies of Germination". Different Kinds of "Tiny Predators" Disease causing microorganisms can be present on the seed or in the soil. Here is a general view of three types of disease causing organisms. A virus basically is a piece of DNA with a protein coat. They are the smallest and generally the most difficult disease-causing microorganism to control. Virusís can be seed borne, but usually are not the cause of plant stand problems. They are more likely to cause problems as the plant grows. Bacterial disease causing microorganisms can be present on the seed or in the soil. There are more options for soil and seed borne bacterial control, but control measures are limited. Bleach or hot water seed treatments can kill seed borne bacteria without harming the seed, and if the chemical label permits, antibiotics such streptomycin can be applied to the seed as a preventative measure. Fungi are the most likely microorganism to cause seed germination and plant stand problems. There are many seed treatment chemicals in the market place that can help to control plant diseases caused by fungi. Some very specifically, control a certain type of fungi that may cause a certain disease, and some help to control several types fungi. Some only control the fungi if it comes in contact with the chemical, and some are systemic and travel inside the plant controlling the disease in all parts of the seed and plant. In solving plant stand problems caused by fungi or any of these "Tiny Predatorís", it is always best to identify specifically what is causing the plant stand problem, and select the control options or chemicals that best solves the problem.
<urn:uuid:c81a8c32-75ef-4ece-a1b1-d85bc3010523>
3.125
553
Knowledge Article
Science & Tech.
49.219096
Chondracanthus Distribution and Ecology Wait! I want to jump straight to C. exasperatus' Ecology no problem... This map shows the distribution of the Gigartinaceae by genus. While it did not reproduce extremely well, the X's (Chondracanthus) can fairly easily be distinguished, indicating its worldwide distribution (Hommersand et. al., 1993). Chondracanthus exasperatus: Worldwide Distribution The range of C. exasperatus extends from Vancouver, British Columbia to Maria, Baja California. Three varieties of this species have been identified over this range. In the northern reaches of its range, specimens have extremely irregular edges. Central californian specimens have very thick blades and are often found in close proximity, even overlapping with other specimens, as opposed to southern specimens which are more widely spaced. Other varieties of C. exasperatus C. exasperatus: Vertical Distribution: C. exasperatus is found on rocks in the lower intertidal and subtidal zones. Typical depth ranges from 5-10m. Light availability: Because C. exasperatus is commonly found at these lower depths, it is exposed to lower light intensities than many intertidal algae. Furthermore, it is often associated with kelp forests, which block much of the available light. C. exasperatus is able to continue active photosynthesis in this low light, sheltered environment because its accessory pigments are specialized to absorb this filtered light. Mumford and Waaland have found that maximum growth rate occurs at 3m below the M.L.L.W. (mean low low water) and the maximum growth season is between March and September (Mumford and Waaland, 1980). Space availability: The limiting factor to C. exasperatus abundance is usually the amount and distribution of suitable substrate. Algae associated with the vertical range of C. exasperatus: General algal community known as the kelp forest community. This community is divided into four levels, the canopy species (ie. giant kelp, bull kelp), the understory species (such as the lesser kelps), the turf species (including many reds such as sea grapes), and the crust species (such as coralline algaes). C. exasperatus is a turf species. Basic kelp forest ecology makes certain predictions for the competitive ability and resistance to damage by storms of turf species. Briefly, competitive ability (mostly for light) is hierarchical, moving up from the crust species to the canopy species, as explained earlier in the light availability section. There is an opposite hierarchy for resistance to damage from storms, turf and crust species being more resistant than understory and canopy species (Watanabe, 1998). Animals associated with the vertical range of C. exasperatus:
<urn:uuid:ed5be024-2f4d-4043-ad47-1885dc3728a6>
3.53125
583
Knowledge Article
Science & Tech.
32.437195
Observing Noctilucent Clouds by Dr. Colin Steel What are Noctilucent Clouds ? The terms nocti and lucent are derived from the Latin where they (very loosely) translate to night and luminous. Thus NLC are clouds which shine at night. Their actual composition is not known but there are several theories concerning their origin. Why should astronomers be interested in clouds ? There is a fundamental difference between NLC and any other type of clouds. Most clouds exist within about 10 km of the Earth's surface; however, NLC exist at a height of 82 km. They are thus not part of the normal weather system but appear to be more connected with astronomical phenomena. How long have they been known ? NLC were observed in the year 1884 but there has been a steady rise in their frequency ever since the mid nineteen sixties. What do they look like ? NLC look fundamentally unlike the familiar tropospheric type clouds which appear dark at night. NLC shine because they are high enough up to be illuminated. They appear pearly white in colour and often appear very delicate in texture. When can they be seen ? The normal noctilucent cloud season lasts during June and July. However, NLC displays in late May and early August cannot be ruled out. For the southerm hemisphere, the season is displaced by six months. And from where ? The normal latitude zone for observing NLC displays from is latitude 50 to 65 with 55 to 60 being particularly favoured. Thus the British Isles are a location from which to see NLC with Scotland being most favoured. North of about latitude 60, it does not get sufficuently dark during the middle of the season. NLC displays can also be seen from the corresponding southern latitudes (although there is not much land there) with the season being December and January rather than June and July. How can they be observed ? They can be observed in several different ways. High-power telescopes are of limited use, but visual and photographic observations are very useful. I wish to observe them visually. How do I do this ? The best way to observe visually is to make drawings at intervals e.g. every fifteen minutes. On the drawing, the extent of the display in azimuth and altitude should be noted e.g. azimuth 330 to 025, altitude 2 to 20. The brightness of the display (and its various parts) should be noted on a scale 1 (faintest) to 4 (brightest) as should the type of NLC (A = featureless, B = linear, C = cross-hatched, D = 'whorly'). Any other features worthy of note should be added. I want to photograph them. How do I do this ? This is relatively straightforward. What you need is a camera where the exposure can be controlled and a relatively stable platform. A wide-angle lens is optional but it does help in that normally a display can be photographed in one frame. Typical details are 200 ASA film, f/2, 10 second exposure. With a faster/slower film, the exposure can be decreased/increased. When should I take the photographs ? If you are interested in 'pretty pictures', the photographs may be taken at any time. However, with a very little discipline, photographs may be obtained that are no less 'pretty' but that are also scientifically, very useful. If picutres are taken within a second or so of each quarter-hour e.g. on the hour, quarter-past, half-past and quarter-to, and another observer, elsewhere, has done the same then triangulation can be carried out. What can be learned from triangulation ? From a single photograph of an NLC display, only the direction from the observer to the clouds can be inferred. However, from two such photographs, the exact position of the NLC display in three-dimensional space can be worked out. Thus it can be inferred which point on the Earth's surface they are above and the height can also be found out. Why is the height of NLC so important ? It is thought that noctilucent clouds exist at a temparature minumum in the Earth's atmosphere. If the noctilucent cloud height were to change, it would indicate a change in the temperature structure of the atmosphere. Thus, the height of NLC could be a possible tracer of global warming and other effects. Who should I send my reports to ? In the UK, NLC are dealt with by the aurora section of the British Astronomical Association and in particular by the deputy director, Dr. David Gavine, 29 Coillesdene Crescent, Joppa, Edinburgh, EH15 2JJ. Other NLC Web Sites Back to the M.A.S. Home Page Maintained by Michael Oates 19 January, 2005
<urn:uuid:3021590e-d56d-4dc8-82c9-4063fb101351>
3.96875
1,031
Knowledge Article
Science & Tech.
60.080841
With this eyepiece the plane-polarization in a beam of light is compensated by means of a thin, plane-parallel plate of celluloid tilted at the proper angle. To ascertain if the compensation is complete a detector consisting of a quartz plate and a second tiltable plate of celluloid is used in combination with a Savart plate and a nicol or Wollaston prism. The biquartz plate consists of two plates of quartz cut normal to the optic axis, the one of dextrogyre and the second of laevogyre quartz, mounted side by side with polished junction faces. The thickness of the quartz plates is such (1.76 mm) that for mercury green light of wavelength 5461A the rotation is ±45°. An incident plane-polarized beam is divided into two beams by the biquartz plate; the plane of vibration of the beam emerging from the first half of the plate is normal to that of the second beam. The tiltable plate of the detector is mounted above the biquartz plate and has its axis of rotation in the plane of vibration of the wave emerging from one of the biquartz plate halves. By means of this second plate a small amount of polarization can be added to, or subtracted from the polarization in the transmitted beams. The Savart plate and analyzing prism serve to detect the presence of plane-polarized light in the beam. With the aid of this eyepiece the amount of plane-polarization can be determined, for low percentages, to one-fifth of one percent. The eyepiece has been used chiefly in the measurement of the percentage plane-polarization in light reflected by different parts of the moon’s surface and by terrestrial materials; also for the measurement of sky polarization and in metallographic work. F. E. WRIGHT, "An Eyepiece for Measuring the Percentage Plane-Polarization in a Beam of Light," J. Opt. Soc. Am. 24, 206-214 (1934)
<urn:uuid:0b6291b3-81f0-40f6-b9f3-cb227d21a8ab>
2.84375
419
Academic Writing
Science & Tech.
49.617664
At the heart of M87, the Virgo A galaxy, is one of the biggest black holes ever seen — about 6 billion times more massive than the sun. Scientists working with the Chandra X-ray telescope and the Very Large Array have compiled this nice new image of its insatiable appetite in action. The ESO's Very Large Telescope, with help from NASA's Chandra X-ray Observatory, has found the most powerful pair of jets ever witnessed ejecting from a small, stellar-sized black hole. But while the black hole (by black hole standards, anyhow) is small enough to be classified a microquasar, the jets are anything but tiny, sufficiently powerful to spawn a giant, fiery gas bubble 1,000 light years across. If there’s one thing that’s true about all science – and especially science of the cosmos – it’s that the body of knowledge we consider to be fact is extremely fluid. A prescient reminder of this came late last week via a paper published in the journal Nature, which found that contrary to popular theory, there is indeed more than one way for a white dwarf to die. We know that super-massive black holes can devour stars, and we know that stellar-mass black holes born of collapsing stars often anchor at the center of galaxies, but the elusive middleweight black hole is more theory than knowledge. While scientists have long thought they are hiding out there, hard evidence of their existence has been hard to come by. Celebrating the four centuries of astronomical advancement since Galileo took his first telescopic view of the heavens, NASA today unveiled this unique view of the heart of our galaxy as captured by the Hubble Space Telescope, the Spitzer Space Telescope and the Chandra X-Ray Observatory. The 6-foot-by-3-foot prints were unveiled at more than 150 planetariums, museums, libraries, and centers of learning across the land, and man, is it ever a view. NASA today released a new, panoramic mosaic of the Milky Way, and frankly, it rivals anything snapped during the Hubble's early days. Taken by the Chandra X-ray space telescope, the picture shows the massive energy released by neutron stars and black holes more vividly than any previous picture. Scientists say black holes may pepper the universe with the stuff of stars. By Andrew Fazekas Posted 07.02.2003 at 1:12 pm 0 Comments "We are all made of star stuff," said Carl Sagan, describing how dead stars birthed the building blocks of life. Astronomers have theorized that titanic star explosions create carbon, oxygen and other elements, then eject them into nearby interstellar space. Now researchers say a newly observed dispersal mechanism likened to a galactic sprinkler system may be strong enough to hurl the "star stuff" far beyond local galaxies, seeding the universe with the ingredients of life. Five amazing, clean technologies that will set us free, in this month's energy-focused issue. Also: how to build a better bomb detector, the robotic toys that are raising your children, a human catapult, the world's smallest arcade, and much more.
<urn:uuid:72ca6746-6681-4619-a1c7-2f1f582f205a>
3.46875
650
Content Listing
Science & Tech.
43.282807
Jython is an implementation of the Python programming language written in Java. Jython programs can use any Java class, and includes almost all modules in standard Python. Jython is able to compile Python source code down to Java bytecodes which can then run directly on a JVM; it also includes a set of libraries which are used by the compiled Java bytecodes and extra support to make it easy to use Java packages from within Jython. This requires: jdk Maintained by: Benjamin Trigona-Harany (the SlackBuild does not include the source)
<urn:uuid:3c1823d8-cff9-4e9a-8c6d-64b2754f92d8>
2.703125
125
Knowledge Article
Software Dev.
24.510403
|Home | X-Objects | Stars | Habitability | Life || Located around 10,000 light-years away, Rho Cassiopeiae is a yellow hypergiant that recently has been ejecting about 5.4 percent of a Solar-mass annually and may be close to exploding as a supernova (more from CfA and Lobel et al, 2003). Rho Cassiopeiae (Rho Cas) belongs to an unusual class of which are much brighter and many times more massive than Sol. Despite being located some 10,000 light-years (ly) away, the star is visible to the naked eye because it is over 500,000 times more luminous than Sol. Like all extremely massive stars, however, hypergiants are very short-lived with a total life of only a few million years. Rho Cas is a yellow hypergiant, which are particularly rare objects as only seven (including have been found in the Milky Way. With surface temperatures between 3,500 and 7,000 °K, yellow hypergiants appear to be stars that are at a very evolved stage of their life and may be close to exploding as supernovae. Rho Cassiopeiae (Rho Cas) belongs to an unusual class of stars called hypergiants, which are much brighter and many times more massive than Sol. Despite being located some 10,000 light-years (ly) away, the star is visible to the naked eye because it is over 500,000 times more luminous than Sol. Like all extremely massive stars, however, hypergiants are very short-lived with a total life of only a few million years. Rho Cas is a yellow hypergiant, which are particularly rare objects as only seven (including HR 8752 and IRC+10420) have been found in the Milky Way. With surface temperatures between 3,500 and 7,000 °K, yellow hypergiants appear to be stars that are at a very evolved stage of their life and may be close to exploding as supernovae. In theory, hydrogen-fusing dwarf stars of 10 to around 60 Solar-masses first evolve as spectral type O to become blue supergiants and then progress to become red supergiants (type M). Stars with 30 to 60 Solar-masses then "loop back" from swollen and cooler, red supergiant phase back into much hotter but smaller blue supergiants (Stothers and Chin, 2001); in contrast, those starting with more 60 Solar-masses remain as blue supergiants. Rho Cas appears to be changing back from being a red supergiant, when it may have been five times larger (James Kaler, 2002; Israelian et al, 1999; and Cornelius de Jager, 1997). In which case, Rho Cas may be "bouncing against" the Yellow Evolutionary Void where such stars become unstable -- as evidenced by its high, if irregular, variability -- and soon explode as a Type-II supernova (like Supernova 1987 A). Some astronomers believe that Rho Cas may soon run out of core nuclear fuel and become a supernova. See a discussion of "the Burning of Elements Heavier than Helium" and "Supernova Explosions" as part of stellar evolution and death. Based on estimates of interstellar absorption and absolute visual magnitude, Rho Cassiopeiae may be located around 10,100 +/- 1,600 ly from Sol (Lobel el al, 2003). It lies in the southwestern part (23:54:23.0+57:29:57.8, ICRS 2000.0) of Constellation Cassiopeia, the Lady of the Chair -- southwest of Caph (Beta Cassiopeiae), south of Tau Cassiopeiae, north of Sigma Cassiopeiae, northwest of Schedar (Alpha Cassiopeiae), and east of M52, the Bubble Nebula, and Delta Cephei. It is located in the Cassiopeia OB5 Association (James Kaler, 2001). The star is a slowly pulsating, post-main sequence yellow hypergiant of spectral and luminosity type F8-G2 Ia0pe, with an atmospheric abundance of Nitrogen and Sodium and strong emission lines of Iron (Fe I), Nickel (Ni I), and Calcium (Ca I). It may have around 40 Solar-masses (James Kaler, 2002). According to Robert Burnham, Jr. (1931-93), the star ranges in brightness from a normal range of magnitude of 4.4 to about 5.1 but dimmed to 6th magnitude on 1946. Although no real periodicity has been evident, the interval between some peaks has been around 100 days. When near maximum, its spectral type has been classified as F8, but the light is redder than normal for a F-type star. When varying in brightness, its spectral type has fluctuated between F8 and K5, and reached M5 in June 1946, mostly through atmospheric cooling rather than dimming (James Kaler, 2002). While its spectrum appears to be that of a supergiant, its luminosity is around 100 times greater. Instituto de Astrofísica de Canarias During its 2000-2001 eruption, Rho Cas ejected about 10 percent of a Solar- mass, dimmed by more than a full magnitude, and changed its spectral type from late F to early M (more from ING and Lobel et al, 2003). Neither a cool red or a hot blue like most hypergiants, Rho Cassiopeiae is particularly unusual. With a surface temperature of around 7,300 °K, it radiates substantially in visible light. The star has an absolute bolometric magnitude of -9.6, radiating with a luminosity of about 550,000 times that of Sol. It appears to have a diameter between 400 and 500 times Sol's, where at 450 times the Solar diameter it would extend 4.3 AU or about 40 percent more than the orbit of Mars (James Kaler, 2002; and Alex Lobel, 2001). The star is emitting a 10-km-per-second stellar wind that is ejecting around 5.4 percent of a Solar-mass of its gas and dust annually (Lobel et al, 2003). It is classified as a variable star (Percy et al, 2000). Useful catalogue numbers and designations for this star include: Rho Cas, 7 Cas, HR 9045, HIP 117863, HD 224014, BD+56 3111, SAO 35879, FK5 899, and SV* HV 194. et al, 2003, Larger image from animation. After the star dimmed, dark bands in its spectrum appeared indicating that molecules such as Titanium Oxide formed as its outer atmosphere cooled (more). During the recent 2000-2001 eruption, Rho Cas brightened briefly, then dimmed for a period of months. Astronomers believe that the initial brightening occurred because gases fell in towards the star and were compressed and heated. Subsequently, some of that material was blasted outward in a powerful, circumstellar shock wave, which dimmed the star by a factor of six (from 4th to 6th magnitude) and altered its spectral type from F to M, indicating a drop in surface temperature from 12,000 °F (7,000 °K) to 5,000 °F (3,000 °K). As when Rho Cas dimmed around 1945-46 and 1985-86, dark bands appeared in the optical spectrum of Rho Cas, indicating that molecules not normally present (particularly that of titanium oxide) were able to form in the star's cooler outer atmosphere (Lobel et al, 2003). Rho Cass ejected unusually high amounts of mass in 1893 and around 1945-47 that appeared to be associated with a decrease in surface temperature and the formation of a dense envelope, which suggest that the star has a major eruption about once every 50 years and that the current eruption is leading to such an extreme event. Since its eruption in 2000, the star's atmosphere has been pulsating in a strange manner. Its outer layer now seems to be collapsing again, as occurred prior to the last outburst. As a result, astronomers believe that an even larger eruption may be imminent (AAS, 2003). See astronomer Alex Lobel's web page which has more images, animations, a presentation slideshow, a paper and other references, and a press release on Rho Cassiopeiae. Try also Professor Jim Kaler's Stars site for other information about Rho Cassiopeiae at the University of Illinois' Department of Astronomy. Up-to-date technical summaries on this star are available at: NASA's ADS Abstract Service for the Astrophysics Data System; and the SIMBAD Astronomical Database mirrored from CDS, which may require an account to access. With its stars shaped in a "W," the northern Constellation Cassiopeia was named by the Ancient Greeks for the mother of Andromeda who claimed to be more beautiful than the daughters of Nereus, a god of the sea. Cassiopeia's vanity so angered the sea god Poseidon that he had Andromeda chained to a rock of the coast as a sacrifice for Cetus (the monstrous whale) until Perseus rescued her. For more information on stars and other objects in this Constellation and a photograph, go to Christine Kronberg's Cassiopeia. For an illustration, see David Haworth's Cassiopeia. For more information about stars including spectral and luminosity class codes, go to ChView's webpage on The Stars of the Milky Way. © 2003 Sol Company. All Rights Reserved.
<urn:uuid:6a80a97f-d37f-454b-a810-942c844a6e4a>
3.59375
2,071
Knowledge Article
Science & Tech.
53.180187
During his Nobel Lecture at Stockholm University in Sweden, Alan Heeger pulled out a personal digital assistant and held it up so the crowd could marvel at its brilliant display screen. Heeger shared the 2000 Nobel Prize in chemistry for the materials that made this screen possible: electrically conductive plastics. What he didn’t hold up, though, was an application of those same new materials that could have a far greater impact. Instead of conducting electricity and emitting light, as they do in flat-panel displays, these same plastics can be made to run the reverse process, absorbing light and producing electricity. If they work, they could fulfill the dream of many energy researchers: inexpensive solar cells. Such materials could change the face of solar power because plastic is cheap, and cheap would be a rather novel and welcome way to describe solar technology. The advantages of solar power are obvious: every minute, the sun pounds the surface of the earth with more energy than the entire world consumes in a year-a potential source of virtually unlimited, clean and free electricity. But until recently the high cost of the materials used in solar cells has relegated the technology to powering satellites, high-tech backwoods cabins and communications towers beyond the reach of power lines. Solar cells made from materials like electrically conductive plastics could finally make solar power affordable for far broader uses. Moreover, says Heeger, the chemistry behind these plastics is rather simple, so they could be fairly easy-and cheap-to manufacture. Conventional solar cells cost so much because most are made from the same relatively expensive silicon semiconductors used in computer microchips. Recently, manufacturers have found ways of making solar cells using ultrathin films of silicon; consequently, solar power is getting cheaper and consumption is increasing. More than 200,000 homes in the United States now derive at least some of their power from solar cells; the technology is already paying its way in places like California, where energy is expensive and governments are willing to subsidize solar power to make it competitive with fossil fuels. But switching to thin-film silicon may not bring about the drastic cost reductions solar cells need to effectively compete with coal-, oil- and natural-gas-generated electricity across the globe. Despite nearly quadrupling in sales over the last five years, solar still accounts for only .04 percent of worldwide power generation. What is needed to accelerate the penetration of solar power is even cheaper materials. And an increasing number of companies are looking to electrically conductive plastics and other novel organic materials as the solution. Researchers developing these new-age materials for solar cells are sensitive to failed promises about solar power and caution that organic solar cells could be a decade or more from the market. At the same time, they are clearly excited about recent advances in the materials which, if sustained, could deliver the performance and affordability that will render solar power ubiquitous. “If the performance of organic solar cells was as good as conventional ones, it would be pretty darn interesting,” says Princeton University electronics expert Steven Forrest. “That could be a huge market.”
<urn:uuid:b1bc8a7c-745f-4c34-af2a-4626fb6d1651>
4
626
Truncated
Science & Tech.
24.423571
The Space Technology Research Vehicles (STRV 1A and 1B) were designed with the principal aim of providing the technology community with affordable access to earth orbit to allow an in-orbit evaluation of new technologies. The spacecraft were designed, built, and tested at the UK Defence Research Agency (DRA) at Farnborough (with assistance as required from subcontractors) and were operated (1994-1996) from a ground station facility at DRA Lasham in Southern England. The short duration time scale of the project (from design phase to operations in 3 years) has guaranteed the return of experimental data in a meaningful time frame. The STRV 1A and 1B satellites were almost entirely experimental, with the majority of the platform systems incorporating new features or techniques. Despite a maximum mass of 55 kg each, a total of fourteen different experiments were incorporated in the design of the two vehicles. The majority of the technologies flown were associated with ongoing research programmes within the Space Deparment of the DRA. These programmes were both intramural and in conjuction with UK industries and universities. In addition, there was a major international collaborative aspect to the project. The Ballistic Missile Defence Organization (BMDO) Materials and Structures Programme sponsored four experiments that were built at the Jet Propulsion Laboratory (JPL) and were flown aboard the STRV-1B. The BMDO also negotiated antennas to supplement the DRA ground station. The European Space Agency (ESA-ESTEC) also submitted experiments and solar panels for STRV 1A and provided the programme with design effort and radiation facility time. The United States Air Force Phillips Laboratory, Albuquerque, provided solar panels on STRV 1B, together with experimental cells as part of one of the experiments. The limitation on mass was a consequence of the choice of launch: the Ariane Structure for Auxiliary Payloads (ASAP). Although this structure has now flown several times into low earth, polar orbit, the STRV 1A/1B launch on 17th June 1994 was the first occasion that the Ariane-4 launched auxiliary payloads into Geostationary Transfer Orbit (GTO). - Mission operations beginning in September 1996 LASP did not provide any instruments for the STRV mission. Launch date: June 17, 1994 Launch location: Europe’s Spaceport, Kourou, French Guiana Launch vehicle: Ariane-44LP Mission target: Earth orbit Mission duration: 1 year Other key dates: - LASP assumed mission operations: September 1996 - End of mission operations: September 1998 Other organizations involved: - NASA’s Jet Propulsion Laboratory (JPL) - UK Defence Research Agency - European Space Agency
<urn:uuid:f25c41bb-c292-4d34-a420-85af2f83972f>
3.421875
559
Knowledge Article
Science & Tech.
21.034106
Let us quickly study two very simple cases of free-body diagrams to make the principles a little clearer. A ball is at rest on a table, as shown below below. Two forces act on the ball, gravity (red arrow) and the supporting normal force from the table (blue arrow). They have the same length, but opposite direction and thus add up to zero. The two forces are balanced. The free-body diagram on the right shows this. The same ball is on the same table, but now a string is attached to it. The string runs over a pulley and is connected to a weight that can drop. This situation is more complicated than the one above, but we can also draw the corresponding free-body diagram, see the right drawing below. Now the free-body diagram shows that the forces are unbalanced and there is a resulting force acting on the ball which will make it move. You can, of course, also draw a free-body diagram of the weight that hangs down from the string. This diagram will have two arrows, one pointing straight down and one pointing straight up. The up arrow would be again the string force, and the down arrow that of gravity. Together with Newton's second law (which we will discuss soon), these two free-body diagrams would enable us to solve the entire problem. © MultiMedia Physics, 1999
<urn:uuid:add41bea-2187-4cec-ab31-c220e455b065>
4.5
280
Tutorial
Science & Tech.
64.975847
Your confusion arises from the fact that you are using the same letter in both equations. It would be better to say that invertibility is the property that for every $m$ there is a solution to the equation $m*x = e$, and a solution to the equation $y*m=e$. You can then prove that the solutions will in fact be the same, since $$y = y*e = y*(m*x) = (y*m)*x = e*x = x.$$ Moreover, while it is true that the two equations together imply that $mx=xm$, this is not equivalent to commutativity. To be clear, commutativity would be For all $a$ and all $b$, $ab=ba$. Here you have only If $x$ is the solution to $mx=e$, then $mx=xm$. That is, you are only guaranteed that a particular element commutes with each $m$, not that every element commutes with every element. Consider the usual "axioms" of a group. the ingredients are a set $S$, and a function $\cdot\colon S\times S\to S$, which we write using infix notation (so we write $a\cdot b$ or $ab$ instead of $\cdot(a,b)$). Then we require: - Associativity. $\cdot$ is associative: $a(bc) = (ab)c$ for all $a,b,c\in S$. - Existence of neutral element. There exists an element $e\in S$ such that for all $a\in S$, $ae=ea=a$. - Existence of inverses. For each $a\in S$ there exists $b\in S$ such that $ab=ba=e$, where $e$ is a neutral element as in 2. If we relax the requirements that all three conditions get satisfied, we get more general structures (but the more general the structure, the less we can say about them). - If you drop all three conditions, you get a magma. - If you drop the second and third condition but keep the first, requiring only that the operation be associative, you get a semigroup. - If you drop the third condition but keep the first and second, requiring that the operation be associative and that there be a neutral element, you get a monoid. - If you keep all three conditions, you get a group. There are other things you can do; it does not make sense to drop the second and keep the third condition. If you drop the first (associativity), then can relax the conditions a bit and ask that all equations of the form $ax=b$ and $ya=b$ have solutions, but not requiring that the operation be associative. That gives you a quasigroup. If you require that all such equations have solutions and that there be an identity, you get a loop. This is equivalent to asking that conditions 2 and 3 be satisfied, but not condition 1. Within each category you can put other conditions. There are "cancellation semigroups", which are semigroups in which $ax=ay$ implies $x=y$. There are "inverse semigroups" which, perhaps confusingly, does not mean that condition 3 is satisfied (makes no sense if we don't have condition 2), but rather that for every $a$ there exists a $b$ such that $aba=a$ and $bab=b$. And so on and so forth. Lots of different wrinkles to be seen in there.
<urn:uuid:d2a64b03-50d3-47ac-bb62-4edaeaa8ef19>
3.34375
779
Q&A Forum
Science & Tech.
65.911231
Date: Jan 29, 2013 3:33 AM Subject: Matheology § 203 "All" and "every" in impredicative statements about infinite sets. Consider the following statements: A) For every natural number n, P(n) is true. B) There does not exist a natural number n such that P(n) is false. C) For all natural numbers P is true. A implies B but A does not imply C. Examples for A: 1) For every n in N, there is m in N with n < m. 2) For every n in N, the set (1, 2, ..., n) is finite. 3) For every n in N, the construction of the first n nodes of the Binary Tree adds n paths to the Bibary Tree. 4) For every n in N, the anti-diagonal of a Cantor-list is not in the lines L_1 to L_n.
<urn:uuid:af55a530-9217-4bdd-a36e-e0b712def641>
3.59375
210
Q&A Forum
Science & Tech.
94.681905
Unit Testing is the practice of writing code that tests the code in your application and quickly determines if the code is working properly. The concept of unit testing is implemented in libraries for most modern languages, including Objective-C. There are several unit testing frameworks for Objective-C projects. - OCUnit, built in to Apple Xcode and open sourced. Version 27 (pretty old) has been tested with GNUstep - UnitKit, common for Mac OS X until OCUnit was built into Xcode. Now ported to Etoile. - ObjCUnit, a Mac OS X framework that has been ported to GNUstep. - TestKit, an inactive framework - Mock objects
<urn:uuid:33cf3924-f993-468e-b021-e649716b80e3>
3
141
Knowledge Article
Software Dev.
45.239118
Many investigators are faced with the problem of having to conduct field work that is either dull, dirty or dangerous. One solution is rather obvious: assign a graduate student. That time-tested formula has some clear advantages, but now there is another approach worth thinking about—sending a robot into the field. Over the past few years, robotic vehicles have been tested as scientific research assistants on land, under the sea and in the air, and investigators in the earth and planetary sciences are beginning to appreciate what these engineering marvels can and cannot do for them. Perhaps the most impressive class of mobile robotic minions being developed today is the so-called autonomous underwater vehicles, or AUVs. These small pilotless submarines can be equipped with sensors of various kinds and programmed to carry out observations within the ocean. In some instances they provide the only reasonable means to obtain the desired measurements. One example is the current quest to identify deep-sea hydrothermal vents within the Arctic Ocean. The shifting cover of sea ice there prevents an ice-breaking research vessel from making the necessary systematic surveys using towed equipment. And even if the position of a deep-sea vent were somehow identified, it would be impossible to study it in the usual manner, with a piloted deep-sea vehicle, because of the danger. A group of investigators at Woods Hole Oceanographic Institution are, however, hoping to locate and photograph hydrothermal vents beneath the Arctic Ocean in the near future using a combination of two AUVs. The first would prospect for hydrothermal sites on the seafloor by crisscrossing the ocean above them and mapping plumes of telltale chemicals in the seawater given off by the vents below. Once the source was pinpointed, a second, more mobile AUV would, according to Robert Sohn, a geophysicist on the research team, do "stuff you can't do off a torpedo," namely hover over the vent and obtain images of the geology and fauna. For scientific work deep under the polar ice pack, such AUVs may be the only option. But they have proved worthwhile, too, in situations where more traditional oceanographic tools have long been used, such as for mapping the topography of the seabed. For that task, the usual approach is to employ acoustic transducers mounted directly to the hull of a research vessel. When a more detailed view of the seafloor is desired, acoustic equipment can be towed underwater. But it proves quite difficult to maneuver equipment towed from a ship at the end of a lengthy cable. One cannot, for example, make the sensor package turn on a dime or approach the bottom too closely without risking collision. Even when all goes well, surveying in this fashion proceeds slowly, because a long cable cannot be forced through the water at normal cruising speed. AUVs overcome all of these limitations and so can produce highly detailed charts of the seafloor. Woods Hole's Autonomous Benthic Explorer ("ABE") has, for example, mapped volcanic features on the seabed around the East Pacific Rise. This locale has been studied for many years; still, "ABE blew everyone's mind with these bathymetric maps," says Sohn. Surveying the Earth in one way or another also constitutes an important application for many of the robotic vehicles now winging through the air. Unmanned aerial vehicles, or UAVs as they are called, vary enormously in size: One of those flying for science sports a wingspan of only 3 meters, whereas another stretches for more than 75. Judith Curry, an investigator at the University of Colorado, Boulder, and her colleagues have used the smaller variety extensively over the past two years to obtain meteorological observations over the Arctic Ocean and to gather detailed views of the sea ice below. Curry also flew this type of robotic aircraft out of Florida last fall to study the hurricanes brewing nearby. Her plan was to fly the UAV into a hurricane at extremely low altitude, where no sane pilot would be willing to venture. Her scientific objective was, however, thwarted after the attacks of September 11th, when the Federal Aviation Administration forbade aircraft to operate without radar transponders. The diminutive vehicles she uses are too small to carry such equipment. "This is the big deal for UAVs—regulatory issues," says Curry. Others engaged in work with UAVs echo Curry's sentiments. Richard Blakeslee, an atmospheric physicist at NASA's Marshall Space Flight Center, is engaged in a demonstration program using the General Atomics Altus UAV. (This aircraft is a high-altitude variant of the Predator, a remotely operated surveillance plane being used by the U.S. military.) His test flights are limited to the airspace around El Mirage, California, where General Atomics has a flight facility and has worked out special arrangements with the FAA for operating its pilotless plane over land. Like Curry, Blakeslee intends ultimately to study intense storms off the Florida coast. But his motivation for using a pilotless vehicle rather than a conventional research aircraft is different. Flying at great height over a tempest is not particularly dangerous. It is, however, dull—circling a storm for hours on end, as would be required to follow it from inception to final collapse. The Altus can remain airborne for 30 hours, and it is better suited to this mission than most high-altitude research aircraft for a second reason: It flies quite slowly and can thus loiter over a thunderhead. The high-altitude jets of the sort that have been outfitted for research zoom by a storm in a couple of minutes and then must slowly turn around to make another quick pass. As Blakeslee notes, "Most of the time, the plane is somewhere else." Blakeslee thus sees the slowness of Altus as a great advantage. And eventually, it may be cheaper to operate than piloted aircraft, although that is not the case yet. "Right now, these UAVs are not cost effective, if you want to know the truth," explains Blakeslee. Saving money is also not a reason right now to use a robotic vehicle on land. Consider the wheeled Nomad robot, which investigators from Carnegie Mellon University brought to Antarctica two years ago to locate and identify meteorites. "They had gotten from NASA an obscene amount of money," says Ralph Harvey, a planetary geologist at Case Western Reserve University who directs the National Science Foundation's Antarctic Search for Meteorites program. Applying Nomad in the hunt for Antarctica meteorites probably represents the most advanced scientific application so far for robotic vehicles on land. And Nomad, with its elaborate artificial intelligence, displayed an impressive ability to find and classify meteorites. But as Harvey explains, that project was merely a demonstration of the technology, not a realistic strategy for aiding scientists in the field. "It takes time away from humans to nurse-maid a robot right now," says Harvey. He points out that while Nomad indeed found a half-dozen or so meteorites during its Antarctic trials, one person on the support team "found 60 meteorites in his spare time." So for Harvey at least, the traditional solution still looks better than a robot for finding meteorites: "A graduate student can do that 100 times faster—and maybe cook me dinner too."
<urn:uuid:3df69ede-90de-4d2d-bc94-4bc13f4ea85f>
3.9375
1,497
Knowledge Article
Science & Tech.
35.03674
Some exceptionally well preserved specimens of Agoniatites vanuxemi from the middle Devonian Cherry Valley limestone of New York state, U.S.A. Susan M. Klofak1,2, Neil H. Landman1. 1Division of Paleontology (Invertebrates), American Museum of Natural History, Central Park West at 79th St., New York, NY 10024., 2Department of Biology, City College of the City University of New York. 160 Convent Avenue, New York, New York 10031 Representatives of Agoniatites vanuxemi (Hall 1879) occur in discrete beds in the Cherry Valley Limestone (Middle Devonion of New York State, U.S.A. These beds are thought to represent mass mortality events of immigrant populations during times of transgression. The Seneca Stone Quarry preserves such a bed on the top surface of the quarry. After death, the agoniatites fell to the sea floor and were buried rapidly, but incompletely, leaving their topside exposed and subject to dissolution. The shells rested on their sides, which may have favored the preservation of the innermost whorls. By removing these inner whorls from the quarry floor it was possible to examine the internal structures of the juvenile whorls, including the ammonitella. The specimens were embedded in epoxy, ground and polished in a median section and etched with 5% HCL. The calcite in the specimens dissolved leaving the organic membranes and structures, which are preserved as pyrite. THe specimens were then examined with a scanning electron microscope. Two of the specimens exhibit remarkable preservation and are presented here.
<urn:uuid:742ae275-f811-4a5f-a086-3ee0abe1eb93>
2.703125
342
Knowledge Article
Science & Tech.
37.12511
Source: Journal of Geophysical Research-Oceans, doi:10.1029/2011JC007302, 2012 http://dx.doi.org/10.1029/2011JC007302 Title: Application of a data-assimilation model to variability of Pacific sardine spawning and survivor habitats with ENSO in the California Current System Authors: Hajoon Song: Department of Ocean Sciences, University of California, Santa Cruz, California, USA; Arthur J. Miller: Scripps Institution of Oceanography, University of California, San Diego, La Jolla, California, USA; Sam McClatchie, Edward D. Weber, and Karen M. Nieto: Southwest Fisheries Science Center, NOAA, La Jolla, California, USA; David M. Checkley Jr.: Scripps Institution of Oceanography, University of California, San Diego, La Jolla, California, USA. 5. Lake Erie's thermal structure and circulation are backward A series of high-resolution measurements has shown that Lake Erie, one of the North American Great Lakes, is, in some respects, backward. In the majority of thermally stratified lakes, the thermocline, a thin subsurface layer of rapid temperature change, is deeper near the coast than near the center of the lake. Lake Erie, however, has an inverted thermocline, which is deeper offshore than at the coast. Beletsky et al. first mapped this bowl-shaped thermocline during the summer of 2005 with a large network of temperature sensors. In 2005, and again in 2007, moored instruments that collected temperature readings at 1 meter (3.3 feet) depth intervals were spread 30 to 50 kilometers (19 to 31 miles) apart around the central basin of the lake. Supporting these point measurements, the authors collected higher-resolution temperature profiles with a boat-towed sensor. The authors find that th |Contact: Mary Catherine Adams| American Geophysical Union
<urn:uuid:116e3d0d-d01e-4b8a-8d3a-96481a89585d>
3.015625
412
Knowledge Article
Science & Tech.
37.937982
Finding the Area of a Surface of Revolution The nice thing about finding the area of a surface of revolution is that there’s a formula you can use. Memorize it and you’re halfway done. To find the area of a surface of revolution between a and b, use the following formula: This formula looks long and complicated, but it makes more sense when you spend a minute thinking about it. The integral is made from two pieces: The arc-length formula, which measures the length along the surface The formula for the circumference of a circle, which measures the length around the surface So multiplying these two pieces together is similar to multiplying length and width to find the area of a rectangle. In effect, the formula allows you to measure surface area as an infinite number of little rectangles. When you’re measuring the surface of revolution of a function f(x) around the x-axis, substitute r = f(x) into the formula: For example, suppose that you want to find the area of revolution that’s shown in this figure. To solve this problem, first note that for So set up the problem as follows: To start off, simplify the problem a bit: You can solve this problem by using the following variable substitution: Now substitute u for 1+ 9x4 and for x3 dx into the equation: Notice that you change the limits of integration: When x = 0, u = 1. And when x = 1, u = 10. Now you can perform the integration: Finally, evaluate the definite integral:
<urn:uuid:b9628ee7-4a21-400c-95a9-da1a4c764c47>
3.890625
333
Tutorial
Science & Tech.
39.527522
Joshua Blake's Developing Natural User Interfaces with Microsoft Silverlight and WPF 4 Touch at Microsoft's MIX10 conference provided an overivew of Natural User Interfaces (NUI) and their core building blocks. - NUI in terms of input: mutli-touch, voice, motion-tracking, and stylus. Just because we use these input types does not mean it is a NUI application. - “NUI exploits skills that we have acquired through a lifetime of living in the World” –Bill Buxton. Skills we have learned in the real world interacting with people, objects, and your environment. Many skills that people have because they are human. How can we reuse these skills? - Composite skills and simple skills. Composite skills take a long time to learn and are complex. It is difficult to take composite skills to new contexts. Simple skills are very easy to reuse across contexts and can be learned through basic observation. - NUI is designed to reuse existing skills for directly interacting with content. - Direct interaction: physical proximity, temporal proximity, and parallel actions. Direct interactions are high frequency (sizes are smaller so they can happen more often) and contextual (do not see everything you can do at all times –only what you need). - What is the NUI equivalent of WIMP? (windows, icons, menus, pointer) OCGM: objects, containers, gestures, manipulations - Objects are the content in an interface. Containers make relationships between content explicit. Gestures are body motions that have meaning. They are discreet (you have to complete a gesture before it can be interpreted). Manipulations are direct and have continuous feedback. With gestures the feedback does not come until the gesture is complete.
<urn:uuid:c387906b-914f-4dfa-8d89-102a4232e536>
2.75
361
Personal Blog
Software Dev.
39.833905
ONE way to combat global warming is by sequestering the carbon dioxide belched out by power stations, locking it away in buried vaults. A big problem, though, is that only about a tenth of the gas produced by burning fossil fuels is CO2. Most of the rest is nitrogen, which is not a greenhouse gas and would needlessly take up space in the vault. But separating the two gases can be a costly affair. Now a team led by Maciej Radosz at the University of Wyoming in Laramie say they have designed a cheap filter that could capture 90 per cent or more of the CO2 emitted by power stations. "This is a way to capture CO2 for about $20 a tonne - less than half the cost of current methods," says Radosz. Most existing ways of separating CO2 from nitrogen are not very effective at the high ... To continue reading this article, subscribe to receive access to all of newscientist.com, including 20 years of archive content.
<urn:uuid:a9d9dad4-72e3-4bf6-8b37-30158e3c91c6>
3.671875
209
Truncated
Science & Tech.
61.23264
Inventory & Monitoring Much like a physician monitors a patient’s heartbeat and blood pressure for diagnostic purposes, National Park Service officials need accurate information about the resources in their care. Specifically, they need to know how and why natural systems change over time, and what amount of change is normal, in order to make sound management decisions. In 1998, Congress authorized and funded a new initiative designed to build a stronger scientific foundation for the management and protection of natural resources in parks and monuments across the country. As part of The Natural Resource Challenge, Canyonlands joined sixteen other parks on the Colorado Plateau where scientists are designing an integrated inventory and monitoring program. The first goal of the program is to verify records of what plants and animals exist in the parks. To accomplish this, teams of scientists and park biologists are conducting inventories of plants, mammals, reptiles, amphibians and birds. The second phase of the program is the development of vital signs monitoring. Vital signs are measurable, early warning signals that indicate changes which could affect the long-term health of natural systems. Canyonlands, along with other network parks, is planning a program to monitor biological and physical resources like air quality, water quality, exotic species, soils, and threatened and endangered species. For more information, visit the Inventory & Monitoring Program website. Did You Know? The dirt is alive! A living crust called "Biological Soil Crust" covers much of Canyonlands and the surrounding area. Composed of algae, lichens and bacteria, this crust provides a secure foundation for desert plants. Please stay on roads and trails to avoid trampling this important resource. More...
<urn:uuid:716c2bb0-aa7d-468b-a06e-841cd1c6eefc>
3.4375
335
Knowledge Article
Science & Tech.
32.467207
|Apr16-05, 07:20 PM||#1| Viscosity and Upthrust.... Viscosity and upthrust are both forces which occur in liquids, and must both rely on electrostatic effects. So what is there difference between them? What causes these 2 distinctly different effects? Thanks in advance. |Apr16-05, 10:13 PM||#2| none of the really rely on the electrostatic effects. That means that we do not need to know anything about electricity to explain them. What is important is that the liquid molecules may collide to each other. The upthrust comes from the fact that liquid has no shape. So at the equilibrium the pressure on the piece of liquid is the same in all directions. That is pure mechanics, the potential, elastic and kinetic energy are players there. The viscosity comes from thermodynamic. The important player in this game is thermal energy. Now the process becomes irreversible. That is kind of tricky and non-trivial- you need to use reversible mechanical equation to introduce irreversibility. Without going into deep, you may just use known thermodynamical equations. Friction heats. Both viscousity and upthrust exist in gases, too. |Apr17-05, 05:52 AM||#3| But surely it must be an electrostatic effect if it relies on collisions? Afterall, particles when they collide do not actually touch as we often depict them classically ( unless travelling ridiculously fast, eg - after passing through a particle accelerator.) but simply experience repulsion effects. |Apr17-05, 12:17 PM||#4| Viscosity and Upthrust.... yes, of course it is electrostatic because we know that there is no other force responsible. But we don't need to know that to explain these effects. Archimedes knew nothing about the Coulomb. The problems are limited the mechanics and thermodynamics, no theory of electricity is needed (in a first approximation). But if we are working with high energies, when atom and molecules can break down, then yes, we need to know the nature of the binding forces. At low energies only the intermolecular forces are important, and, in the first approximations, we can explain almost everything if we simply assume elastic collisions of solid structures. I probably got your question. The viscosity is an energy redistribution between constituents. It exists without any external force or field. The upthrust exist only if we have an external field- there is no upthrust without gravitation. Viscosity appears because of the internal degrees of freedom of the macroscopic body. Upthrust is due to the interaction of the macroscopic body with the external field. |Similar Threads for: Viscosity and Upthrust....| |Moleculer viscosity? Eddy viscosity?||Mechanical Engineering||4| |upthrust calculations for hovercraft||General Physics||3| |Viscosity||Introductory Physics Homework||1| |Upthrust question||Introductory Physics Homework||3| |Upthrust problem||Introductory Physics Homework||1|
<urn:uuid:a191294d-00d0-435f-aaa8-e9c6757b00aa>
2.859375
676
Comment Section
Science & Tech.
43.757982
6. Bombardier Beetles When attacked, bombardier beetlesin the ground beetle family Carabidaeblast their assailants with a series of boiling-hot toxic sprays from the tips of their abdomens. To produce these pulsed detonations, which can make an audible "pop" sound, the beetles mix chemicals stored in separate glands in a pair of combustion chambers. The resulting reaction forces hot fluid through an "exhaust valve" in the beetle's exoskeleton. Some African species of the beetle have nozzles that pivot, allowing the bombardier to fire with great accuracy in virtually any direction. The beetle's intricate defensive mechanism has translated into a technology called µMist, licensed by the company Swedish Biomimetics 3000 Ltd, which allows for precise control of spray particle size and temperature. Applications include improved fuel-injection systems in automobiles as well as next-generation fire extinguishers and drug delivery systems such as nebulizers, says Andy McIntosh, a professor of thermodynamics and combustion theory at the University of Leeds in the U.K. Though still in the prototype phase, products could be on the market in five to 10 years.
<urn:uuid:f15bf93d-1e56-452c-9e14-e409342a3809>
3.71875
236
Knowledge Article
Science & Tech.
30.309515
The moons have always been the solar system's B Team. Everyone knows the order and names of the eight great planets a club that's gotten even more exclusive since Pluto was demoted in 2006. But the 174 moons that circle six of those planets? Cosmic proletariat. The moons, of course, are worth getting to know and in many cases are far more interesting than the parent worlds they orbit. There's watery Europa and fiery Io circling Jupiter; there's bitter cold Triton clinging close to Neptune; there's the exquisitely named Cordelia, Ophelia, Juliet, Portia, Miranda, Belinda and Puck circling Uranus. And then there's Saturn's Titan, a moon that has long fascinated astronomers for its huge size, its opaque atmosphere, and its rich chemistry that literally drips with organic molecules. Now Titan has gotten more interesting still: According to just-released findings from the Cassini spacecraft, the moon also has a scattering of methane lakes in its tropics one that's half as large as Utah's 21,500 sq. mi (55,685 sq. km) Great Salt Lake making it the only known world apart from Earth to have anything of the kind. At the heart of everything that makes Titan so intriguing is its methane a fundamental ingredient of biology and a chemical precondition for life as we know it. Nothing remotely living has ever been spotted on the miasmic moon, but methane has other roles to play. Infrared imaging had long detected dark spots on Titan's surface, which astronomers theorized might be vast pools of methane, perhaps as large as an ocean. When the Cassini spacecraft arrived at Saturn in 2004, it fired a probe, dubbed Huygens, into the Titanian atmosphere, where it deployed a parachute and descended to the surface at a spot in the tropics known as Shangri-La. In the instants before the atmospheric pressure crushed the life out of it, Huygens signaled home the tantalizing news that its on-board lamp had vaporized a bit of methane from the surface. The probe, it appeared, had landed in a swamp. There was plenty of reason to believe those findings could be in error. Just as Earth has a global water cycle, Titan is thought to have a global methane cycle and the two work essentially the same way. At the marginally warmer equatorial regions of Titan, liquid methane evaporates and rises into the atmosphere. Prevailing winds carry it north and south until it finally reaches the global poles, where cools, rains out and pools on the ground. Methane rain has in fact been detected numerous times at the poles, but only once in the tropics, and that was during the moon's rainy season. (Yes, Titan has one of those too.) Polar lakes would not be a surprise then; tropical ones would be another matter and they'd be hard to explain. But the new infrared readings of Shangri-La and the vicinity confirmed that the lakes are there, and while they're not terribly deep perhaps three ft. (1 m) or so they spread wide. The question was, What's keeping them full? And the answer, NASA scientists believe, is another feature borrowed from Earth: underground springs that continuously percolate up, feeding the lakes with liquid methane from the bottom even as they evaporate away at the top. "[The] likely supplier is an underground aquifer," says Caitlin Griffith, a member of the Cassini team and the lead author of the paper just published in Nature that reported the findings. "In essence, Titan may have oases. The discovery was completely unexpected because lakes are not stable at tropical latitudes." So Titan has organic chemistry, Titan has weather and now we know Titan has tropical lakes. Is it too much of a stretch to suggest that Titan might also have at least primitive life especially since the first organisms on Earth emerged in equatorial oceans and seas? Alas, it's indeed too much. Titan's paralyzingly cold, -290 F (-179 C) temperatures are way too harsh for anything approaching biology as we know it to begin to stir. But that doesn't mean there's not a lot to learn even from so sterile a place. The ancient Earth is thought to have been very similar to the modern Titan chemically if not thermally. A good, close look at Titan is thus something akin to taking a good close look a flash frozen version of the early Earth, at the very moment it was teeing itself up for life. That can help us learn how we've gotten where we are today even if Titan itself will never get there too. "Cassini still has multiple opportunities to fly by this moon going forward," says Cassini project scientist Linda Spilker. "We can't wait to see how the details of this story fill out." It's hard to say what will be found in those later chapters of the spacecraft's mission, but the earlier ones suggest remarkable things.
<urn:uuid:ea0f517d-f1c9-4de2-91a5-0f50d3da0d51>
3.234375
1,013
Truncated
Science & Tech.
51.314927
This is Science Today. The first practical and inexpensive way to develop a magnetic levitation, or maglev, train system has attracted the attention of NASA engineers. Physicist Richard Post of the Lawrence Livermore National Laboratory says his maglev train model, which uses a unique array of permanent magnets to cause trains to levitate over railways, led to a contract with NASA to build a higher speed model. What they'd like to do in the long term is to build a system like this to help launch rockets. So you'd build it up the side of a mountain and get the rockets up to maybe Mach point 8 - almost the speed of sound - before you fire the rockets off and then take off from that initial speed. Such a maglev system would save NASA thirty to forty percent of their rocket fuel. The whole objective is to reduce the cost of launching rockets. A rocket is terribly inefficient when it's first lifting off the pad and this obviates that Narrator: For Science Today, I'm Larissa Branin.
<urn:uuid:64dc3c0a-3b64-4d2c-8bbe-ee49af0c73bb>
4.0625
229
Audio Transcript
Science & Tech.
52.261805
Today, a very big volcano. The University of Houston's College of Engineering presents this series about the machines that make our civilization run, and the people whose ingenuity created them. The worst volcanic eruption in the past two million years took place in northwest Sumatra, 74,000 years ago. When Mount Toba blew, it spewed out ten billion tons of ash, and left a huge hole in the ground. Today, that hole is Lake Toba -- fifty-five miles long, twenty miles wide, and over 1600 feet deep. At the center is Samosir Island -- a lovely tourist spot and the largest island-within-an-island in the world. One might think a volcanic eruption, so long ago, was rather like the philosophical tree falling in the philosophical forest. But it was not. The Toba eruption was the worst disaster the human race experienced -- even ahead of the Genetic anthropologist Stephen Oppenheimer is pretty certain that we modern humans began an emigration from East Central Africa about 85,000 years ago. By the time Mount Toba blew, we were across India, down the Malay Peninsula, into Sumatra and Java, across into Borneo, and up through Indochina into most of the China coast. Then Mount Toba spewed two-thousand times as much ash as Mount St. Helens did. Ash covered all of India to a depth of at least a half foot, and to a depth over twenty feet in some places. But the entire world was devastated by the atmospheric ash. The result was a six-year "nuclear winter" followed by a thousand-year ice-age. The entire human species was devastated, and it was completely exterminated between Java and the present-day border of Iran. When human survivors finally recovered, they renewed their migrations. The now-separate Southeast Asian branch of humans spread down into northern Australia, eastward across New Guinea, as well as back toward India once again. The two human branches finally rejoined around India's southern tip. These human migrations have been pieced together from limited information. Dating has been difficult, and human remains few, after so long a time. But the volcanic ash below the surface of the Kota Tampan area in central Malaysia has yielded fifty thousand or so stone artifacts made by the people smothered under the ashes. Those tools were more primitive than African implements from that time. These people were still making so-called pebble tools, small stones shaped into elementary choppers, scrapers, and hand axes. However, the few survivors on the other side of Malaysia were the adventurers who continued into Australia and China. What I take away from all this is a reminder of how vast time and nature are. At the end of February, 2007, the Horizons spacecraft passed Jupiter's moon Io. It sent back a photo of a huge volcano shooting debris two hundred miles above the surface. That should be a poignant reminder that the inexorable immensity of nature is a wolf lingering close by our doors today, just as surely as she did 74,000 years ago. I'm John Lienhard, at the University of Houston, where we're interested in the way inventive minds For more on the migrations of modern humans out of Africa, see Stephen Oppenheim's site. For more on Mount Toba, Lake Toba, and the Io eruption, see: This Bradshaw Foundation article The Wikipedia article on LakeToba Or this NASA page on the Io volcano. Lake Toba (Images courtesy of Google Earth) The Engines of Our Ingenuity is Copyright © 1988-2006 by John H.
<urn:uuid:ee21208b-6a6a-40c6-82bc-212ec74e5440>
3.75
798
Nonfiction Writing
Science & Tech.
45.56982
Aside from breakpoint commands (see Section 11.1.6.), the debugger provides two ways to store sequences of commands for execution as a unit: user-defined commands and command files. A user-defined command is a sequence of the debugger commands to which you assign a new name as a command. This is done with the define command. User commands may accept up to 10 arguments separated by whitespace. Arguments are accessed within the user command via $arg0...$arg9. A trivial example: define adder print $arg0 + $arg1 + $arg2 To execute the command use: adder 1 2 3 This defines the command adder, which prints the sum of its three arguments. Note the arguments are text substitutions, so they may reference variables, use complex expressions, or even perform inferior functions calls. Define a command named commandname. If there is already a command by that name, you are asked to confirm that you want to redefine it. The definition of the command is made up of other the debugger command lines, which are given following the define command. The end of these commands is marked by a line containing end. Takes a single argument, which is an expression to evaluate. It is followed by a series of commands that are executed only if the expression is true (nonzero). There can then optionally be a line else, followed by a series of commands that are only executed if the expression was false. The end of the list is marked by a line containing end. The syntax is similar to if: the command takes a single argument, which is an expression to evaluate, and must be followed by the commands to execute, one per line, terminated by an end. The commands are executed repeatedly as long as the expression evaluates to true. Document the user-defined command commandname, so that it can be accessed by help. The command commandname must already be defined. This command reads lines of documentation just as define reads the lines of the command definition, ending with end. After the document command is finished, help on command commandname displays the documentation you have written. You may use the document command again to change the documentation of a command. Redefining the command with define does not change the documentation. List all user-defined commands, with the first line of the documentation (if any) for each. Display the debugger commands used to define commandname (but not its documentation). If no commandname is given, display the definitions for all user-defined commands. When user-defined commands are executed, the commands of the definition are not printed. An error in any command stops execution of the user-defined command. If used interactively, commands that would ask for confirmation proceed without asking when used inside a user-defined command. Many debugger commands that normally print messages to say what they are doing omit the messages when used in a user-defined command.
<urn:uuid:67942780-5629-4c3d-9c07-ee70a3e805e0>
3.484375
604
Documentation
Software Dev.
42.318269
Herapath was initially interested in developing an explanation of gravity in terms of the impacts of particles of an ethereal fluid, somewhat along the lines of the "kinetic theory of gravity" proposed by G. S. LeSage and many others. Herapath's version was somewhat different: he proposed to take account of the effect on the gravific particles of the high temperatures in the space near the Sun. In this way he came to consider the relation between temperature and particle velocity. Herapath was puzzled by the old paradox of collisions between atoms: if they meet head-on they must stop at least for an instant before rebounding. Is the collision elastic or inelastic? It can't be elastic, since an atom by definition has no smaller parts and cannot change its size, so how can it store its kinetic energy during that instant? But if it were inelastic, both atoms would have to stop; then what happens to their energy? To avoid the paradox, Herapath decided to adopt momentum instead of energy as the fundamental measure of motion, since momentum is always conserved whether collisions are elastic or inelastic. Herapath simply assumed that the scalar momentum mv of a particle is a measure of its absolute temperature and that the total momentum of a system is conserved in collisions while individual momenta tend to be equalized. (One consequence of this unorthodox definition was that temperature of a mixture of hot and cold fluids should be somewhat lower than one would expect using the ordinary definition of temperature.) Herapath arrived at the same relation between pressure, volume, and particle velocity that Bernoulli had derived (he apparently did not know of Bernoulli's work). But he expressed it somewhat differently: PV is proportional to T_H^2, since T_H, which he called "true temperature," is proportional to mv rather than to mv^2. (I have added the subscript "H" to avoid confusion with the absolute temperature T used elsewhere in this chapter.) Herapath submitted his first paper on kinetic theory to the Royal Society of London in 1820, hoping to get it published in the Philosophical Transactions. That would have given his views wide circulation in the international scientific community; moreover, as Herapath himself frankly admitted, it would have enhanced his personal reputation so that he could embark on a career of teaching and scientific research. Humphry Davy (1778-1829), a well-known chemist, became president of the Royal Society shortly after the submission of Herapath's paper and was mainly responsible for its fate. Davy had earlier supported the general idea that heat is molecular motion rather than a substance, and thus he might have been expected to be receptive to a theory that gave this idea a precise mathematical formulation. But his reaction was negative, for several reasons. The only one he made explicit to Herapath was his reluctance to consider heat as a simple quantity that could be completely extracted from a body by annihilating the motion of its molecules, thus implying the existence of a lowest temperature ("absolute zero"). It is also evident that he found Herapath's derivations difficult to follow and would have preferred a less abstract, less mathematical approach emphasizing instead the correspondence between concepts and observations at each step: that seems to be a persistent difference in the attitudes of chemists and physicists. Finally, we may conjecture that Davy had a metaphysical repugnance for the basic assumption of kinetic theory -- that particles move through empty space with no interactions except when they collide. By this time Davy had adopted some of the sentiments of Romantic nature philosophy; for example, seeing the world as an interconnected system dominated by all-pervading forces rather than by push-pull mechanisms. Herapath was told that his paper would not be published in the Philosophical Transactions and he was advised to withdraw it, since according to the custom of the Royal Society once a paper was "read" (formally presented, if only by title or abstract, at a meeting) it became the property of the Society and could not be returned to its author. Herapath complied with this advice and sent his paper to an independent scientific journal, the Annals of Philosophy, where it was published in 1821. Later he attacked Davy and the Royal Society in a series of letters in the Times of London. Denied recognition by the scientific establishment, Herapath nevertheless did have an opportunity to present his ideas to a larger public. The Annals of Philosophy, though now forgotten, was not by any means an obscure journal in the early 19th century. Michael Faraday and other reputable scientists published there. It was similar in content and circulation to the major physical science journals Philosophical Magazine (with which it merged in 1826), the Annalen der Physik und der Chemie, or the American Journal of Science. So if Herapath's theory was ignored by most scientists in the 182Os, we cannot simply blame Davy and the Roval Society but must recognize that the theory was out of harmony with prevailing ideas about the nature of gases and heat, and failed to convince its readers that those ideas should be revised. Herapath later became editor of the Railway Magazine, a position that give him an opportunity to publish his scientific work though to a limited and perhaps unappreciative audience. In 1836 he presented a calculation of the speed of sound, which he had completed four years earlier. This was in fact the first calculation of the average speed of a molecule from the kinetic theory of gases. (J.P. Joule, was is usually credited with this accomplishment, was simply following Herapath's method.) Herapath found that the speed of sound in air at 32 F should be about 1090 feet per second, in good agreement with the experimental results available at that time. In the 1840s, stimulated by the publications of Thomas Graham on gas diffusion and of Regnault on compressibility, Herapath revised and elaborated his kinetic theory and published the two-volume treatise Mathematical Physics (1847). He claimed that he had calculated from his theory in 1844 a formula for the time required for a given volume of gas to pass through a small hole into a vacuum, and that this formula was subsequently confirmed by the experimental results of Graham. Herapath also claimed to have predicted in advance Regnault's result (1846) that the pressure of very dense gases is greater than that given by Boyle's law. This is indeed what the model of atoms as impenetrable spheres would lead one to expect if one ignores short-range attractive forces. However, earlier experiments had indicated deviations in the opposite direction, suggesting that attractive forces are more important than repulsive. (Later kinetic theories managed to account for the fact that attractive forces dominate at low temperatures, repulsive at high.) The British physicist James Prescott Joule (1818-1889), one of the founders of the law of energy conservation, is the only scientist known to have read Herapath's Mathematical Physics during the first few years after its publication. Joule presented a short paper on kinetic theory, based on Herapath's work, at scientific meetings in 1848, but very few scientists learned about it. Herapath lived long enough to see the kinetic theory revived by others. In 1860, after Maxwell's first paper was reported in a British magazine, Herapath published a letter calling attention to his own earlier work, and thus helped to ensure that he would be remembered as one of the pioneers of kinetic theory -- though by this time he could not be credited with the first kinetic theory, since Daniel Bernoulli's chapter in Hydrodynamica had also been rediscovered. As I mentioned at the beginning of this section, Herapath's version of kinetic theory is inconsistent with Avogadro's hypothesis, a fact that passed unnoticed in the 1820s but would have called for revision if anyone had tried to integrate it with chemical atomic theory after 1860. Like Herapath, Waterston was interested in the problem of explaining gravity by impacts of particles, and his efforts on this problem led him to develop a kinetic theory of gases. Waterston was employed as a Naval Instructor to the East India Company's cadets at Bombay, India. In 1843 he published a book that included some of his early results on the kinetic theory of gases. His most significant conclusion was that "equilibrium of temperature depends on molecules, however different in size" having the same kinetic energy. This was a special case of what later became known as the "equipartition theorem." There is no evidence that any physical scientist read the book; perhaps it was overlooked because of its misleading title, Thoughts on the Mental Functions. Two years later Waterston submitted a long manuscript, presenting a detailed account of the kinetic theory of gases, to the Royal Society of London. Two members of the Society, asked to review the paper, recommended that it should not be published -- primarily because they disagreed with its fundamental premises. But no one had told Waterston, still far away in India, that once his paper had been officially "read" to the Society (i.e. presented by title or abstract, not read word for word) it would not be returned to him; and Waterston had not retained a copy for himself. Thus he could not easily follow Herapath's course of publishing the original paper in an independent journal, although he did try to call attention to his theory by circulating shorter versions, and by mentioning it when he published papers on related subjects. In 1851 Waterston presented a short paper on his kinetic theory at the annual meeting of the British Association for the Advancement of Science. The published abstract of that paper clearly states that in gas mixtures, the average kinetic energy of each kind of molecule is the same; thus he established his priority for the first statement of the equipartition theorem. He also indicated in this abstract that Avogadro's hypothesis follows from the kinetic theory. The German chemist and physicist August Karl Kroenig (1822-1879), who published a short paper proposing a kinetic theory of gases in 1856, was probably familiar with the published abstract of Waterston's 1851 paper and may have been influenced by it (see Daub, 1971). Waterston also attempted to calculate the ratio of the two specific heats (c_p, at constant pressure, and c_v, at constant volume). Because of a numerical mistake he obtained the value c_p/c_v = 4/3 for a monatomic gas instead of the correct theoretical value 5/3. Since his value was fairly close to the observed ratios for air and other gases he didn't realize his error. In 1858 Waterston published a paper arguing that Laplace's calculation of the speed of sound from the caloric theory of adiabatic compression and expansion could be based equally well on Waterston's own kinetic theory of gases and thus did not provide evidence for the caloric theory of heat. In 1891 the British physicist Lord Rayleigh, surveying the literature on acoustics for his comprehensive treatise on that subject, came across Waterston's 1858 paper on the theory of sound, which referred to his unpublished manuscript lying in the Royal Society Archives. Rayleigh was Secretary of the Royal Society at that time, and had no difficulty in retrieving the manuscript and arranging for its belated publication in the Philosophical Transactions. In his introduction to the paper, Rayleigh remarked: "the history of this paper suggests that highly speculative investigations, especially by an unknown author, are best brought before the world through some other channel than a scientific society, which naturally hesitates to admit into its printed record matter of uncertain value. Perhaps one can go further and say that a young author who believes himself capable of great things would usually do well to secure the favourable recognition of the scientific world by work whose scope is limited, and whose value is easily judged, before embarking on greater flights" (see Haldane, 1928, pp. 209-210). These remarks of Lord Rayleigh do not justify the original refusal of the Royal Society to publish Waterston's brilliant paper, but they hint at one of its failures as an organization for advancing scientific knowledge. By rejecting work by authors without established reputations, or theories that contradict established doctrines, a scientific society shirks one of its most important functions. In the case of the kinetic theory of gases, the net result of the Royal Society's refusal to publish the works of Herapath and Waterston was to retard the progress of molecular physics by a decade or two, this permitting the German scientists August Kronig and Rudolf Clausius to gain the major share of credit as founders of the theory and damaging the Society's own reputation.
<urn:uuid:35cfebe1-e7cc-4021-96a2-e5dca0f4fe25>
3.4375
2,625
Academic Writing
Science & Tech.
29.14111
Discover the cosmos! Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. 2011 August 8 Explanation: What is causing these dark streaks on Mars? A leading hypothesis is flowing -- but quickly evaporating -- water. The streaks, visible in dark brown near the image center, appear in the Martian spring and summer but fade in the winter months, only to reappear again the next summer. These are not the first markings on Mars that have been interpreted as showing the effects of running water, but they are the first to add the clue of a seasonal dependence. The above picture, taken in May, digitally combines several images from the the HiRISE instrument on the Mars Reconnaissance Orbiter (MRO). The image is color-enhanced and depicts a slope inside Newton crater in a mid-southern region of Mars. The streaks bolster evidence that water exists just below the Martian surface in several locations, and therefore fuels speculation that Mars might harbor some sort of water-dependent life. Future observations with robotic spacecraft orbiting Mars, such as MRO, Mars Express, and Mars Odyssey will continue to monitor the situation and possibly confirm -- or refute -- the exciting flowing water hypothesis. Authors & editors: Jerry Bonnell (UMCP) NASA Official: Phillip Newman Specific rights apply. A service of: ASD at NASA / GSFC & Michigan Tech. U.
<urn:uuid:7fe71be3-0bb7-4750-9e99-f1b92aaf943f>
3.734375
295
Knowledge Article
Science & Tech.
36.07975
In physics, nonlinear resonance is the occurrence of resonance in a nonlinear system. In nonlinear resonance the system behaviour – resonance frequencies and modes – depends on the amplitude of the oscillations, while for linear systems this is independent of amplitude. Generically two types of resonances have to be distinguished – linear and nonlinear. From the physical point of view, they are defined by whether or not external force coincides with the eigen-frequency of the system (linear and nonlinear resonance correspondingly). The frequency condition of nonlinear resonance reads with possibly different being eigen-frequencies of the linear part of some nonlinear partial differential equation. Here is a vector with the integer subscripts being indexes into Fourier harmonics – or eigenmodes – see Fourier series. Accordingly, the frequency resonance condition is equivalent to a Diophantine equation with many unknowns. The problem of finding their solutions is equivalent to the Hilbert's tenth problem that is proven to be algorithmically unsolvable. Main notions and results of the theory of nonlinear resonances are: - The use of the special form of dispersion functions appearing in various physical applications allows to find the solutions of frequency resonance condition. - The set of resonances for given dispersion function and the form of resonance conditions is partitioned into non-intersecting resonance clusters; dynamics of each cluster can be studied independently (at the appropriate time-scale). - Each resonance cluster can be represented by its NR-diagram which is a plane graph of the special structure. This representation allows to reconstruct uniquely 3a) dynamical system describing time-dependent behavior of the cluster, and 3b) the set of its polynomial conservation laws which are generalization of Manley–Rowe constants of motion for the simplest clusters (triads and quartets) - Dynamical systems describing some types of the clusters can be solved analytically. - These theoretical results can be used directly for describing real-life physical phenomena (e.g. intraseasonal oscillations in the Earth's atmosphere) or various wave turbulent regimes in the theory of wave turbulence. Nonlinear resonance shift Nonlinear effects may significantly modify the shape of the resonance curves of harmonic oscillators. First of all, the resonance frequency is shifted from its "natural" value according to the formula where is the oscillation amplitude and is a constant defined by the anharmonic coefficients. Second, the shape of the resonance curve is distorted (foldover effect). When the amplitude of the (sinusoidal) external force reaches a critical value instabilities appear. The critical value is given by the formula where is the oscillator mass and is the damping coefficient. Furthermore, new resonances appear in which oscillations of frequency close to are excited by an external force with frequency quite different from See also Notes and references - Landau, L. D.; Lifshitz, E. M. (1976), Mechanics (3rd ed.), Pergamon Press, ISBN 0-08-021022-8 (hardcover) and 0-08-029141-4 (softcover) Check - Elmer, Franz-Josef (July 20, 1998), Nonlinear Resonance], University of Basel, retrieved 27 October 2010
<urn:uuid:fbded335-3e40-48cd-a90c-30119521bb5d>
3.421875
679
Knowledge Article
Science & Tech.
21.258227
On November 8th, Nature published two cool articles about metagenomic studies of twelve Drosophila (“fruit flies”) species. In the the first paper (click here), The Drosophila 12 Genomes Consortium (D12GG) compared the complete genomic sequences of the twelve Drosophila species, which included the model organism species Drosophila Melanogaster. Although the twelve species are related, they exhibit a surprising amount genetic biodiversity. For example, the evolutionary distance between D. Grimshawi and D. Melanogaster is the same distance as between humans and lizards. As a side note, six months earlier (in May 2007), PLoS Genetics published a similar metagenomic comparison of Drosophila (click here for the paper). In the PLoS paper, Hahn et al. present the (somewhat obvious) conclusion: “the apparent stasis in total gene number among species has masked rapid turnover in individual gene gain and loss.” On November 8, Nature also published this paper (click here), in which Stark et al. (including Hahn) used the data from D12GG’s research to demonstrate a truly novel insight about the connection between conserved metagenomic sequence motifs and functional elements. The result of this paper allows us to infer the presence of functional elements with a accuracy far surpassing previous methods. Specifically, Stark et al. show how to infer the following functional elements, based on a metagenomic sample: - Protein-coding regions: have highly constrained condon substitution regions, and indels have a bias for multiples of three. - RNA genes: tolerate substitutions that preserve base pairing. - miRNA: can be detected by looking for conserved palindromic stem sequences, which mutable loop sub-sequences between the two palindrome pieces. - Regulatory motifs: have high levels of genome-wide conservation. - Post-transcriptional motifs: are typically strand-based conservations.
<urn:uuid:6b3e8bcd-ed9e-4763-9d45-0f1f23d7b3ee>
2.78125
421
Personal Blog
Science & Tech.
24.328306
Improvements in deriving energy from hydrocarbon fuels will have a large impact on our efforts to transition to sustainable and renewable energy resources. The hypothesis for this work is that catalysis can extend the useful operating conditions for hydrocarbon oxidation and combustion, improve device efficiencies, and reduce pollutants. Catalysis of propane oxidation and premixed propane-air flames are examined experimentally, using a stagnation-flow reactor to identify the important physical and chemical mechanisms over a range of flow catalyst, and temperature conditions. The propane oxidation studies consider five catalyst materials: platinum, palladium, SnO2, 90% SnO2 – 10% Pt (by mass), and quartz. The volume fractions of CO2, O2, C 3H8, CO, NO and the electric power required to control the catalyst temperature quantify the activity of each catalyst for the equivalence ratios of &phis; = 0.67, 1.00, and 1.50, and over the catalyst temperature range 23-800°C. Quartz is used as a baseline and confirmed to be non-reactive at all conditions. 100% SnO2 has minimal reactivity. Platinum, palladium, and 90% SnO2 – 10% Pt show similar trends and have the highest catalytic activity at &phis; = 1.50. Palladium and 90% SnO 2 – 10% Pt show an increasing catalyst-activation temperature (Tsa) for decreasing &phis;, and platinum shows an approximately constant catalyst-activation temperature for decreasing &phis; (Tsa = 310°C). Of these the 90% SnO2 – 10% Pt catalyst shows the lowest Tsa, occurring for the &phis; = 1.5 mixture (Tsa = 250°C). The studies of premixed propane-air flames consider platinum and quartz stagnation surfaces for fuel-mixture velocities from 0.6-1.6 m/s. Five flame structures are observed: cool core envelope, cone, envelope, disk and ring flames. The lean-extinction limit, disk-to-ring flame transition &phis;, and the disk-flame to stagnation-plane distance are reported. Platinum inhibits the ring flame structure. The lean-extinction limit and disk-flame to stagnation-plane separation distance are insensitive to the stagnation-plane material. The results set directions for development of improved catalyst systems, including the development of lean NOx catalysts with low light-off temperatures, methods to quantify catalyst aging and poisoning properties, and fundamental data to develop models of the catalyst chemistry for the design of novel energy generation techniques.
<urn:uuid:ed3575a0-2898-4495-94f4-9247df85cedb>
2.828125
534
Academic Writing
Science & Tech.
33.118987
What Has Curiosity Found on Mars? Kidding aside, the internet science world is abuzz with the anticipation of some big news from the Mars Science Laboratory team, spurring many on Twitter to make up their own amusing suggestions. (Martian Twinkies??) What that news could be — organic compounds? water ice? methane outgassings? — is still anyone’s guess. But since this IS Mars we’re talking about, any “big news” is of course awaited with bated breath. Stay tuned for more! (And if you don’t know the story that inspired the picture above, click here.) UPDATE: Apparently the NPR article that spurred rumors of big discoveries from Curiosity was a misunderstanding… while data from the rover is “one for the history books,” that pertains to the mission as a whole — not any individual discovery. It was not made entirely clear, but the internet ran with the more exciting option. Another example of why you can’t always believe what you hear. Still, news from the MSL mission will be delivered very soon. “Rumors and speculation that there are major new findings from the mission at this early stage are incorrect… at this point in the mission, the instruments on the rover have not detected any definitive evidence of Martian organics.” – JPL news release, 29 Nov. 2012 Read more here.
<urn:uuid:6b82c9b2-8119-42ee-9044-7cf66cdcd83f>
2.6875
295
Personal Blog
Science & Tech.
54.059653
Each resource will open in a new window. Close the window to return to this page. *Online Manipulatives and Applets Applets for exploring numerous concepts. See "What a Crowd!" (estimation), Multiplication Grid, Math Cats Balance (with items ranging from electrons to galaxies), Old Egyptian Math Cats Fractions, Tessellation Town, much more. fractals tool, shape sorter, shape tool, shape pan balance (visualizing algebra), fraction pie, and many more tools and activities spanning all levels NCTM's Electronic Examples (for implementing Principles and Standards) links to applets with teaching ideas and discussion questions a huge collection of interactive tools and simulations with supplemental materials and links to standards National Library of Virtual Manipulatives British site with a great variety of games and explorations to develop concepts along with skills. See numeracy for grades 1 and 2, numeracy for grades 3 - 6, and Teacher Toolkit for whole class math demonstrations. Math Tools at the Math Forum links to interactive resources and related lesson plans and other support materials, organized by grade and topic OBBL and Math Toys creative applets for open-ended math explorations by Maurici Carbo Jordi, who has developed many of the best activities at Math Cats F. Permadi's homepage (Java and Flash applets) interesting applets: Kaleidoscope Painter, moire patterns, fractal twister, more The recursive lines project is fascinating. Soma Blocks applet *Sites for Creating with Math Math Crafts at Math Cats Create a variety of math crafts offline: polyhedra, hexagrams, ambigrams, string art, tessellations, designs with rotational symmetry, and more. Also see www.mathcats.com/sitemap.html#onlinemathart for activities to create math art online and www.mathcats.com/gallery.html for a math art gallery of geometric designs, each produced with a few words of Logo code. Construct animated "creatures" out of polygons and springs and share them online. Interact with the creations in "manual" mode and turn gravity on and off. Don't miss the Sodazoo! Create a Geometric Creature (Geometry for my Everyday World) Create a geometric animal and describe it on this webquest site. William's Home Page fascinating math crafts to make offline Java Kali at the Geometry Center Tessellation Tool at Boxer Math Draw a miNIMAL aNIMAL with a 15 x 15 black and white grid. More Than Math interactive activities integrating math and visual arts, for grades 3 - 5 Cut the Knot: Curriculum interactive arithmetic logic puzzles, math magic, algebra, much more, for all levels Math Sphere: Fun with Math magic squares, tangrams, puzzles, and more Button Beach Challenge This puzzle combines logic and addition skills (elementary grades). Java on the Brain creative Java applets like rainbow notes, Mastermind C. Malumphy homepage There are several creative applets here - Apple Find game, Color Shapes game with projects that can be shared, African stones (mancala) PuzzleUp Hall of Fame links to puzzle applets NullGee Connect Four Connect Four with zero gravity! lots of intriguing interactive investigations, logic games and puzzles, and more, developed by a British mathematics teacher *Math Games with that "Extra Something" Jefferson Lab Games Index combines coordinate geometry, a guessing game, and deduction (computer gives a directional clue after each guess) PBS Kids - Games interactive logic games involving functions, intersecting circles, measurement, visualizing 3D as 2D, shape matching, etc. Idea: In the cyber-pattern-player, program each drum with a different skip-counting pattern to explore the sounds of multiples. *Sites Targeting Specific Concepts Basic Math Skills: Jefferson Lab Place Value Game The user can select the highest number, number of places, and number of discards (all elementary grades). My Secret Number great logic and number sense game This school-created Flash applet generates number lines marked at intervals (with a decimal option). Hidden numbers help to develop skills in sequencing, skip-counting, and critical thinking. Estimate the value of a position marked on an unlabelled number line; choose number lines up to 10,000 or between 0 and 1. Web Math: Instant Math Help Enter specific numbers and get help with them. (For instance, enter 8/16 in the fractions area, and the page draws this fraction with a pie and uses these numbers to explain the meaning of the fraction.) Sums 4 Fun - Arcade games for enhancing math skills and reasoning (including algebraic thinking) developed by a math teacher in Kuwait. One to Ten: An Arithmetic Game use operations to connect 4 digits to form the numbers from 1 to 10 Make factor pairs to claim four squares in a row on a game board; use number skills and strategy to play against the computer. Sum Sense - Multiplication Make multiplication equations from four digit cards. Drag a number tile to the multiplication grid. If wrong, it gives a prompt. If right, it displays a portion of a puzzle (the area under the tile and its mirror image). Look for factors, multiples, odd or even numbers, and/or triangular numbers within a certain range on a grid. Helps develop multiplication concepts and skills in a fun way. Provides tips. Uses Shockwave. Use this tool to find factors, common factors and GCF of two numbers. While it doesn't teach factoring concepts, the page can be used for rapid investigations and discoveries. Try some of the other interactive tools at motivatingmath.com, too. Use this ten frame tool for counting, visualizing, finding differences to 10, and adding to 20. The applet lets groups of 5 be moved at one time and guides students through the steps of adding sums over 10. Fractions, Decimals, and Percents links to open-ended explorations for developing fraction concepts; NCTM's applet represents fractions, decimals, and percents good fractional number sense game Pie Chart Percentage Estimate what percentage of each pie is filled. a great tool to help teach telling time and changes in time interactive modeling of word problems, including two-step problems, with how-to videos and feedback Beacon Learning Center - Student Web Lessons lively, clear, interactive, story-based web lessons with instant feedback on a range of math skills and concepts Illuminations: Simulating Probability Situations Using Box Models great investigation of probability, one item at a time or with 100 sets of 100 at one time Geometry Step by Step from the Land of the Incas This site presents high school level geometry concepts so creatively and artistically that the animations appeal to all ages. MathSite: an Interactive Source for Seeing, Hearing, Doing Mathematics amazing interactive Flash "rooms" for exploring geometric properties Illuminations: Developing Geometry Concepts Using Computer Programming Environments Use buttons and sliders to program a turtle to travel to a pond using Logo commands. Algebra and Algebraic Thinking links to a variety of interactive algebra pages Math Playground - Algebra Activities Amid a wide variety of interactive explorations on this site, be sure to try the algebra activities and the awesome customizable function machine! (Much of the site is currently undergoing updates - summer 2007 - and some of the recommended activities are not available. See screenshots here.) Check out the Activity Index so you don't miss anything. Algebra Balance Scales Pan Balances at NCTM's Illuminations Site: Pan Balance - Shapes (grades K - 5) Pan Balance - Numbers (grades 6 - 8) Pan Balance - Expressions (grades 3 - 12) These great applets help to develop logic skills along with algebraic thinking. The shape pan balance is for all ages. The Maths File Game Show Several of the games help reinforce algebra skills. Sequences (Triangular Numbers) find the missing number in a sequence of triangular numbers Sequences - from the Sums4Fun Arcade Continue a number pattern, jump to the 10th and 20th values, and express the function rule(s) in algebraic notation. This is one of the simple yet challenging activites from Sums 4 Fun, developed by a math teacher in Kuwait. Sieve of Eratosthenes This informational page includes a link to a great applet. Math and Physics Math and Physics Applets amazing Java applets of waves and other physics simulations *Sites with Real-Life Connections Real World Math outstanding projects investigating real-life problems, utilizing Google Earth - in some instances combined with Google Sketch-Up - along with lessons, activity sheets, and supporting research. The site's creator welcomes new suggestions for real-world investigations as he continues to expand the project library. integrates math and science with interactive lessons and an online airplane design center Mr. Pitonyak's Pyramid Puzzle This webquest integrates reading (David Macaulay's Pyramid), online and offline resources, and several curriculum areas. It provides guidance on project management, a group project with specific roles, a press conference and a scale model. Playing with Time amazing gallery of speeded-up and slowed-down time sequences Music through the Curriculum wonderful online and offline activities connecting music, math, and science *Math Tools and Resources A Maths Dictionary for Kids an interactive math dictionary for elementary students, created in Flash by an Australian teacher Interactive Math Dictionary geared for middle school students A Dictionary of Measures, Units, and Conversions lots of unit conversion information and tables Create a Graph Make bar, line, pie graphs online. What Are Your Chances? Set the number of times to roll a pair of dice and see a chart of results. Ask Dr. Math Browse answers to already-asked questions or ask one of your own. David Bagley homepage a Java abacus and other great Java programs an abacus website Global Schoolhouse Resource Links links to atlases, converters for currency and measurement, and more Internet 4 Classrooms You won't find much open-ended exploration here, but the links are comprehensive and well-organized by each grade level (to grade 8), subject, and standard. Includes self-paced learning modules for teachers, and teacher-generated worksheets for students Graph Paper Printer a free downloadable program for PCs to print many varieties of graph paper (shareware for uncommon paper sizes) graph paper and measurement tools in PDF files *Sites with Data for Kids to Share and Use Google Maps Distance Calculator Zoom, drag, and click to pinpoint two locations, whether local or global, and the page displays the distance between them "as the crow flies." (There are a few ads on the page.) World Almanac for Kids You can find interesting facts and data on a wide range of topics within the online chapters. The Data and Story Library (DASL) This searchable collection of data files and summaries models a variety of real world applications of statistics. U.N. Cyber Schoolbus data Compare data for up to 6 countries on several measures, with printable graphs. Make Maps at NationalAtlas.gov Select from a variety of features; zoom in. Gridded Population of the World Spreadsheet Resources and Real World Data on the Internet lots of links to spreadsheet and data resources Data Library at the Math Forum *Software for Exploring with Math This multimedia version of the Logo programming language empowers students and teachers to create geometric designs, animations, simulations, and games. Exploring and applying math concepts and skills is a natural part of the process of developing projects. The MicroWorlds site includes an extensive project library and several demo versions. The MicroWorlds in Action website - http://mia.openworldlearning.org - offers theme-related demo projects, notes, and extension activities; FAQs with interactive demos; "Ask an Expert," and more. A free multimedia authoring tool that empowers students and teachers to create their own animations, games, and other projects while exploring math in open-ended, meaningful ways. See www.squeakland.org/school/drive_a_car/html/Drivecar12.html for a great illustrated narration of how a first "car" project might develop. Build and run computer programs with drag-and-drop icons while exploring math concepts. Enriched Math (by LCSI, makers of MicroWorlds) A set of 15 modules for middle-school students, featuring games and questions that stimulate classroom conversations about math concepts and problem solving strategies. By LCSI, the makers of MicroWorlds. A CD of 125 activities with open-ended environments for exploring patterns and relationships, designed to reveal the level of mathematical thinking of young users and to improve computing skills. Strategy games: ages 8 to adult. Most other activities: ages 4 - 10. Spreadsheet software (Appleworks, Microsoft Works, Excel) Use repeating patterns or formulas to create an instant multiplication table; use formulas to create money converters or magic squares; combine a formula and a repeating pattern to illustrate exponential growth, such as in the "grains of rice" story; collect and graph data. See mathcats.com/spreadsheets for math-related spreadsheet activities. Dynamic software for creating and exploring geometric constructions. Middle and high school students can create projects; students of all ages can explore finished constructions. Free dynamic mathematics software joining geometry, algebra, arithmetic, and calculus. A free downloadable math tool for creating math art while exploring fractions, developed in Squeak by a grad student at Georgia Tech.
<urn:uuid:54d665af-4ce9-4e67-b5a6-80e054d5481e>
3.15625
2,965
Content Listing
Science & Tech.
34.813679
Phthalo blue is short for phthalocyanine blue. The pigment is made when phthalocyanine binds with copper. Phthalocyanine is synthesized using various derivatives of phthalic acid. Phthalic acid was obtained by Auguste Laurent, who thought he had created a naphthaline derivative, which he named naphthalenic acid. When another chemist showed that it was not a naphthaline derivative, the name was changed to phthalic acid. Naphthaline was derived from naphtha. The word naphtha comes from Latin and Greek... in Ancient Greek it refers to any sort of petroleum or pitch.So now you know where the word phthalo comes from too. :) (To learn more of the fascinating details on each of these compounds, search for them at Wikipedia.) PS: Mr Party-Of-One is currently playing rap music with rude lyrics. Thankfully I can't hear much more than a muffled thumping up here, but the lyrics can be heard clearly in the hall.
<urn:uuid:838e2fb6-a7e3-419e-90e7-48c894976676>
2.734375
217
Personal Blog
Science & Tech.
55.000526
The Beacon: P.M. Puddingwife's blog After a gigantic eyeball washed ashore in Ft. Lauderdale last week (likely belonging to a swordfish) this week the ocean reminded us again what mysteries lurk in the deep when a 15 foot oarfish washed up on the Baja Peninsula. By oarfish standards, though, 15 feet is scrawny. This little known and poorly understood creature has been documented to reach 36 feet in length making it the longest bony fish known to man. Reports of specimens topping 50 feet in length are not uncommon, and the fish is a likely inspiration for tales of sea serpents in centuries past. Oarfish live in tropical and temperate waters worldwide at depths of up to 3,300 feet, drifting in open ocean currents and feeding on fish, crustaceans and squid, but they are almost never seen or caught alive and little is known about their behavior. Residents of Cabo San Lucas who struggled but failed to save the fish, were shocked to find it swimming in their waters, as were a group of Navy Seals who came upon a 23 foot oarfish during training in Coronado, California in 1996 (below). Apart from its length, oarfish are also notable for the brilliant red mane which crowns its head as well a dorsal fin that starts between its eyes and runs the length of its body. Prepare to witness what has to be one of the strangest animals on planet Earth. Behold: the Pacific barreleye. As this video shot by the Monterey Bay Aquarium Research Institute demonstrates, NASA need not look to the heavens to find aliens. 2,000 feet deep in the Pacific ocean lurks this otherworldly creature inside whose bizarre transparent head, more colorfully described as a "cockpit" by some scientists, is a set of extremely sensitive tubular eyes, from which it derives its name. Those eyes are capped by stunning green lenses, pointed ever upward to spot bioluminescent prey and faint silhouettes in the deep sea (the dark eye-like spots on the front of the fishes head are, in fact, olfactory organs). The barreleye is thought to steal food from siphonophores, a group of colonial jellyfish-like animals, and the transparent dome above its eyes provides protection from their stinging tentacles. Like much life in the deep, extremely little was known about this fish until researchers came upon this specimen off of Central California. Bottom trawling and deep sea fisheries are quickly destroying deep sea habitat before scientists have the opportunity to study the fascinating animals that call this poorly understood region home. Who knows what other strange creatures await discovery in the deep? Humans have an unlikely ally in the fight against global warming: sea otters. According to a new study out of the University of California Santa Cruz, the playful, foraging mammals play a vital role in managing kelp forests, which in turn are capable of absorbing large amounts of carbon dioxide. Sea otters prey on sea urchins, which, unchecked, can ravage kelp forests, but thriving sea otter populations help keep the urchins in check. The study looked at 40 years of otter and kelp data from Vancouver Island to the Western Aleutian Islands in Alaska. The researchers found that in areas where otters flourished, so too did kelp. In fact, the kelp was able to absorb 12 times more carbon in areas that were not overrun by sea urchins. Giant kelp can grow as tall as 30 meters and kelp forests are provide important habitat for a number of fish species, including blue sharks. "Right now, all the climate change models and proposed methods of sequestering carbon ignore animals," one of the study’s lead authors, professor Chris Wilmers said. "But animals the world over, working in different ways to influence the carbon cycle, might actually have a large impact.” The study’s authors noted that the carbon sequestered by otter-aided kelp forests alone could be worth between $205 million and $408 million on the European Carbon Exchange, a market for trading carbon credits. Populations of California sea otters, which once numbered around 15,000 along the Pacific coast, were decimated in the 18th and 19th centuries by hunters. In 1938, one lone colony of 50 otters discovered near Big Sur represented the entire population. Today that number has rebounded to almost 3,000 but the animal still faces threats, especially from parasites and infectious diseases which thrive in polluted waters. Otters, which depend on their fur coats for insulation, are also especially vulnerable to oil spills. A decision is expected this December about whether to reopen a “no-otter zone” enforced by the Fish and Wildlife Service which extends from just North of Santa Barbara to the Mexican border in California. The zone was originally established in 1987 to help the fishing industry, and sea urchins have removed large swaths of kelp forest in the area. - What Do Historic CO2 Levels Mean for the Oceans? Posted Tue, May 14, 2013 - U.S. Coast Guard Captures Illegal Fishermen in Texas Posted Tue, May 14, 2013 - Victory! Delaware Becomes Seventh State in U.S. to Ban Shark Fin Trade! Posted Thu, May 16, 2013 - It's Endangered Species Day! Posted Fri, May 17, 2013 - Stocks Show Signs of Recovery, But Still Work to Do Posted Fri, May 17, 2013
<urn:uuid:7b96c51c-c8ec-40b1-8c34-93e50f5a4148>
2.890625
1,150
Personal Blog
Science & Tech.
48.875421
cksum - write file checksums and sizes cksum [file ...] The cksum utility calculates and writes to standard output a cyclic redundancy check (CRC) for each input file, and also writes to standard output the number of octets in each file. The CRC used is based on the polynomial used for CRC error checking in the referenced Ethernet standard. The encoding for the CRC checksum is defined by the generating polynomial: - G(x) = x32 + x26 + x23 + x22 + x16 + x12 + x11 + x10 + x8 + x7 + x5 + x4 + x2 + x + 1 Mathematically, the CRC value corresponding to a given file is defined by the following procedure: - The n bits to be evaluated are considered to be the coefficients of a mod 2 polynomial M ( x of degree n-1. These n bits are the bits from the file, with the most significant bit being the most significant bit of the first octet of the file and the last bit being the least significant bit of the last octet, padded with zero bits (if necessary) to achieve an integral number of octets, followed by one or more octets representing the length of the file as a binary value, least significant octet first. The smallest number of octets capable of representing this integer is used. - M ( x is multiplied by x32 (that is, shifted left 32 bits) and divided by G ( x using mod 2 division, producing a remainder R ( x of degree <= 31. - The coefficients of R ( x are considered to be a 32-bit sequence. - The bit sequence is complemented and the result is the CRC. The following operand is supported: - A pathname of a file to be checked. If no file operands are specified, the standard input is used. The standard input is used only if no file operands are specified. See the INPUT FILES section. The input files can be any file type. The following environment variables affect the execution of cksum: - Provide a default value for the internationalisation variables that are unset or null. If LANG is unset or null, the corresponding value from the implementation-dependent default locale will be used. If any of the internationalisation variables contains an invalid setting, the utility will behave as if none of the variables had been defined. - If set to a non-empty string value, override the values of all the other internationalisation variables. - Determine the locale for the interpretation of sequences of bytes of text data as characters (for example, single- as opposed to multi-byte characters in arguments). - Determine the locale that should be used to affect the format and contents of diagnostic messages written to standard error. - Determine the location of message catalogues for the processing of LC_MESSAGES . For each file processed successfully, the cksum utility will write in the following format: "%u %d %s\n", <checksum>, <# of octets>, <pathname> If no file operand was specified, the pathname and its leading space will be omitted. Used only for diagnostic messages. The following exit values are returned: - All files were processed successfully. - An error occurred. The cksum utility is typically used to quickly compare a suspect file against a trusted version of the same, such as to ensure that files transmitted over noisy media arrive intact. However, this comparison cannot be considered cryptographically secure. The chances of a damaged file producing the same CRC as the original are small; deliberate deception is difficult, but probably not impossible. Although input files to cksum can be any type, the results need not be what would be expected on character special device files or on file types not described by the XSH specification. Since this specification does not specify the block size used when doing input, checksums of character special files need not process all of the data in those files. The algorithm is expressed in terms of a bitstream divided into octets. If a file is transmitted between two systems and undergoes any data transformation (such as moving 8-bit characters into 9-bit bytes or changing "Little Endian" byte ordering to "Big Endian"), identical CRC values cannot be expected. Implementations performing such transformations may extend cksum to handle such situations.
<urn:uuid:d3e8df3e-a213-44d5-a942-aa07054be970>
2.875
930
Documentation
Software Dev.
40.986236
Calilasseia wrote:If memory serves, the heaviest insect capable of flight is the Atlas Moth, Attacus atlas. Which has an 11 inch wingspan, and a total mass of 60 grams in the case of an adult female. The moth with the greatest wingspan, but substantially lower mass (I think it's about half that of an Atlas Moth) is the Great Owlet Moth, Thysania agrippina, which is known to attain a wingspan of just over 12 inches (though rumours persist that the Austrian entomologist Oberthür had a 14½ inch specimen in his collection, which was since lost). In the case of the giant stick insect Acrophylla titan from Queensland, males can fly, whilst females are too large to fly, despite possessing functional wings. Females can reach 30 cm in length. The other large Australian stick insect, Euycnema goliath, the males are also capable of flight, whilst the females are weighed down by a heavy abdomen. However, the longest stick insect known to science is Phobaeticus chani from Borneo. This species can attain a length of over 56 cm, as this page from the Natural History Museum reveals. This species was new to science in 2008. rachelbean wrote:Sometimes I get distracted by my own cleavage. Berthold wrote:Titanus giganteus. Users browsing this forum: No registered users and 1 guest
<urn:uuid:c27c01d3-ebf4-4e2a-865e-62781bd5c98a>
2.828125
300
Comment Section
Science & Tech.
53.3533
This series of videos show just what is possible with intense beams of sunlight. They do not all use sun dishes, but the physics is near identical in form. The inference from these modern solar technologists is that an ancient with a dish could pretty much deliver the same techniques (excepting the computer controls). Materials transforms and cutting are all practical without recourse to anything more exotic than a parabolic concetrator. Solar sinter project AMAZING this guy is making glass from sand by pointing a beam at it. He even makes pots with just a guided beam Big Ass Fresenl lens These guys were just having fun and show how quick a beam will cut thru rocks. Fresnel melts metals easily 5000 Suns this guy is getting famous for showing the potency of the mosaic method of concentrating sunlight The guys at Green energy are doing a great job showing a vast array of possibilities. This link shows one, it links to plent yof others at the end. Just point and click. ”Solar Death Ray” more fun with great marketing 2700 degs F Stirling Engine Solar Glass cutting with a dish If you have any links that you think would make good additions to this post please post them at the bottom of the page. If any links have ceased to work please mention it in the same spot.
<urn:uuid:2b7b53b8-a3ef-4619-905b-3051bb6358f4>
2.90625
274
Personal Blog
Science & Tech.
58.619829
A spacecraft consists of many complex devices and systems which are necessary for the spacecraft to function properly. Often, the more complex a device or system is, the greater the chance that something will go wrong. Many failures, if not fixed, can cause an entire mission to fail. It is important that any failure that exists is identified and corrected as quickly as possible; this is the job of the Mode Identification and Recovery (MIR) piece of Remote Agent. MIR acts like a doctor for a spacecraft. Although a doctor just gives annual check-ups, while MIR is constantly monitoring the health of the spacecraft, there are many similarities between the two. Just as a doctor knows what a healthy person looks like, MIR knows what a healthy spacecraft looks like. A doctor examines a patient and then comes up with a diagnosis if something unexpected is seen. If MIR senses something unusual, it will also come up with the most likely diagnosis of the problem. Once a problem is diagnosed, the doctor will try to treat the problem; for example, by administering medication. When MIR diagnoses a problem, it will also, upon request from the Smart Executive (EXEC) suggest an action to correct the problem. Finally, if a patient's problem cannot be fixed, a doctor will notify the patient or their family and might recommend that the person change their future lifestyle. For example, a doctor may recommend that a heart attack victim stick to a low fat diet. MIR also reports permanent failures to EXEC, so EXEC and Planner/Scheduler (PS) can alter the plans and strategies for carrying out those plans accordingly. MIR greatly increases mission reliability. There is always a possibility that an unexpected problem could occur deep in space during a crucial part of a mission. It is also very possible that communicating with earth in order to solve the problem would take too long, resulting in the failure of a costly mission. MIR is on board the spacecraft and autonomous, in other words, able to work without help from Earth. MIR can fix many problems immediately, without any communication delay, increasing the chance that the problem will be fixed in time to save the mission. MIR is programmed using models of the spacecraft; each spacecraft part, how it should behave, and how it might fail is programmed in separately and the model describes how the parts work together. This model-based program makes MIR easy to change to adapt to new plans or even to adapt to a completely different spacecraft. In the long run, this technology will save NASA engineers much time and effort, thereby decreasing costs. Many of you have heard of Apollo 13 and are aware of the complex, serious problems that the ground controllers were trying to solve in a short amount of time. The future goal is for MIR to be able to do that on its own, with no help from ground control! The technology is not quite that advanced yet, but MIR can still monitor the state of the spacecraft and detect and correct many types of failures. In order to accomplish this task MIR:
<urn:uuid:9e270573-654a-494d-96c3-a36455b395f8>
3.453125
620
Knowledge Article
Science & Tech.
44.304292
22c. Flight (1) 22d. Flight (2) 23. Inertial Forces 23a. The Centrifugal Force 24a.The Rotating Earth 24b. Rotating Frames S-1. Sunlight & Earth S-1B. Global Climate S-3.The Magnetic Sun In the preceding section the motion of the "loop the loop" roller coaster was handled using the centrifugal force. You can also view this problem from the point of view of the outside world, using the centripetal force, but it is not as easy. At point A, on the top of the loop, both gravity and the centripetal force point downwards. So what is there that can keep riders in their seats? Let us try solve that motion, using the concept of the centripetal force. A car going around a loop, with radius R and velocity V, is accelerating at a rate of V2/R towards the center (as long as it stays on the rails), and is therefore subject to a centripetal force mV2/R, also directed to the center. When the car is at point A, that force points downwards. Let "down" be now be taken as the positive direction along the vertical axis. The centripetal force is provided by two sources: the weight mg of the car, directed downwards, and the reaction FR of the rails. We have at point A Now the car rides on rails. At point A the rails are above the car and therefore it can only push up against them. The rails then, reacting to the force, must push it down, somewhat similar to the situation in "Objects at Rest", in section #18 on Newton's second law. Thus FR must be positive: if it were negative it would mean that the rails were pulling the car upwards, which they cannot do. We thus require FR > 0, that is A short article on the Clothoid curve, linked to the Italian version of this web collection, was translated to English by Dr. Giuliano Pinto and after some further editing was incorporated into this collections: click here. Author and Curator: Dr. David P. Stern
<urn:uuid:f884b5fa-3993-4b14-86ba-f71c8269e0f8>
3.421875
465
Knowledge Article
Science & Tech.
73.327607
1. What is the MOST important contribution to DNA structure & curvature? If a protein were to bind to the sequence below, where would be a good place to bend the DNA? (please explain your answer!) 5' TGCGGGAAAGTACATTTCGGAATCCCTGATGATATAAGCGCCCGGAGCGATCAAACGATACG 3' 3. Three questions about DNA compaction: A. How much is the DNA compacted in a typical cell? B. How long would the DNA double helix be, for a single human cell? C. What would be the distance of ALL the DNA stretched out in the B-DNA double helical form, for an average person? How many times would this stretch around the earth (circumference = 40,070 km)? How does this number compare with other distances (see "helpful facts below")? Some helpful facts:
<urn:uuid:554ee127-3e9a-4e53-8b64-750ffd8e7c78>
3.296875
196
Q&A Forum
Science & Tech.
69.860769
Ordinary scoring rules have a string as the first element in the rule. Advanced scoring rules have a list as the first element. The second element is the score to be applied if the first element evaluated to a These lists may consist of three logical operators, one redirection operator, and various match operators. false, and then it'll stop. If all arguments evaluate to truevalues, then this operator will return true. If no arguments are true, then this operator will return There is an indirection operator that will make its arguments apply to the ancestors of the current article being scored. For 1- will make score rules apply to the parent of the 2- will make score rules apply to the grandparent of the current article. Alternatively, you can write ^^, where the number of ^s (carets) says how far back into the ancestry you want to go. Finally, we have the match operators. These are the ones that do the real work. Match operators are header name strings followed by a match and a match type. A typical match operator looks like ‘("from" "Lars Ingebrigtsen" s)’. The header names are the same as when using simple scoring, and the match types are also the same.
<urn:uuid:22d91e70-c44a-4182-9146-7eb8fd5df522>
3.265625
271
Documentation
Software Dev.
49.066688
An ice station is the name that scientists give to a collection of tests and measurements that they run on one piece of sea ice. Ice station data is fed into the growing scientific picture of the health of sea ice across the arctic region. Here the Arctic Sunrise is moored to an ice floe to assist scientists in making an ice station. It is from data collected like this that we know the underlying trend of the sea ice is shrinkage and thinning. © Nick Cobbing / Greenpeace
<urn:uuid:bea66e24-08a8-4dcb-ac4a-1be9c936282c>
2.859375
100
Truncated
Science & Tech.
51.53806
Test Driven Development (TDD) Background Test Driven Development (TDD) was first introduced as a key part of Extreme Programming. In a nutshell, it involves developers creating tests that verify code requirements before the developers actually write the code to implement that requirement. TDD tests are typically implemented using unit test frameworks: either as "pure" unit tests, or as slightly less granular component tests. This paper will use the term "unit test" to refer to any test that is implemented with a unit testing framework such as JUnit, CppUnit, NUnit, etc. Once written, each test is added to an automated regression test suite, which runs on a regular basis (e.g., as part of continuous integration). Tests will fail until the code is implementedproviding the developer a constant reminder that additional implementation work is needed. Once the test passes, code can be refactored as neededwithout fear that the refactoring might inadvertently break or change the verified functionality. If a test failure occurs at any point after the code was implemented, this alerts the team that previously-verified functionality has been impacted by a change to the code base. Test Driven Development and the Agile Manifesto Test Driven Development is critical for supporting Agile Manifesto principles such as: - Enabling early and continuous delivery of valuable software. - Welcoming changing requirements. - Delivering working software frequently. Test-Driven Development Obstacles The key obstacle that development teams face in truly adopting TDD is the time required to build and maintain the required test cases. Without process automation, time constraints allow the TDD practice to become optional. Time constraints stem from two main sources: - Setting up good tests can be complex: The process of writing a test that effectively verifies a requirement involves both creativity and solid coding/testing skills. The complexity of creating effective unit tests adds to the challenge: setting up the proper initial conditions for realistic unit tests can be difficult and time consuming. - The test suite has to be kept in sync with the evolving application: Ideally, as each TDD test is created, it is added to a regression test suite, then run regularly against the evolving code base to alert the team when any code base modifications break or change the already-tested functionality. However, in order for this strategy to deliver the desired results, the team needs to keep the test suite in sync with the evolving application; otherwise, the test results will be so noisy that they will be ignoredor the entire test suite will be abandoned. Considering the compressed nature of today's development schedules and the constant pressure to do more with less, it is not surprising that such tasks tend to get dropped unless TDD tasks are made a natural and non-negotiable part of the team's day-to-day workflow. Parasoft and Test-Driven Development: Unit Testing & Policy-Driven Development Parasoft addresses these obstacles in a number of ways: - To make unit tests more valuablewe offer technology that automatically correlates requirements, tasks, code, tests, builds, developers, and artifactsas well as add coverage tracking, advanced reporting, and runtime error detection during test execution. - To ensure that TDD practices are maintainedwe offer an automated infrastructure that notifies the developer if a unit test is not yet associated with a task or requirement. - To facilitate unit test developmentwe offer technologies that reduce the work required to implement realistic and useful test cases. - To facilitate unit test suite maintenancewe establish an automated infrastructure that automatically assigns each test failure to the responsible developer and distributes it to his IDE to facilitate review and response. - To ensure that manual tasks become a continuous and natural part of the workflowwe help you implement a policy-driven process. Management expectations are set by defining what practices are required as well as when and how to apply them. Related tasks are then seamlessly integrated throughout the SDLC and unobtrusively monitored for compliance. Unit Test Case Development The process of writing unit tests that verify requirements is always a creative one. The developer really needs to think about the code and how to test it effectively. But automation can reduce the work required to implement realistic and useful unit test cases. For instance, Parasoft's object repository stores initialized objects, which are very helpful to use when youre trying to set up realistic initial conditions for unit testing. Parasoft's stub library can be used to stub out external references so the unit can be tested in isolation. Also, test case parameterization can be used to feed additional inputs into the unit test cases inputs from a data source, or a stream of automatically-generated inputs using corner case conditions. As unit tests are being developed, static analysis can be performed to check that the unit tests follow industry-standard unit test guidelines. For instance, static analysis rules check the proper implementation of unit test case: - Test methods - Error message strings - Fail methods - Setup and teardown methods - Test documentation Once unit tests are developed, they can be executed in Parasoft's industry-leading unit test framework. Using this framework, teams can: - Centralize execution and reporting for all unit tests. - Track targeted or cumulative test coverage (both unit-level and system-level) using multiple coverage metrics. - Automatically generate additional unit tests using the TDD unit tests as a template. - Extend the regression test suite with automatically-generated regression test suites that detect regressions in application behavior that your TDD test cases do not cover. - Track which unit test cases failed, since when, and who is responsible for fixing each failure. In addition, runtime error detection can be performed as the TDD and other tests execute. This is key for efficiently identifying defects that manifest themselves only at runtime (for example, file overwrites) and zeroing in on the root causes of the application crashing, running slowly, or behaving unpredictably. Categories of defects detected include race conditions, exceptions, resource & memory leaks, security attack vulnerabilities, null pointers, uninitialized memory, buffer overflows, and more. Unit Test Suite Management and Maintenance To ensure that unit test suite maintenance is as painless as possible, Parasoft establishes a supporting infrastructure and workflow... To read more, download the complete Test Driven Development (TDD) and Unit Testing paper as a PDF. Photo Credit (top image): nyuhuhuu
<urn:uuid:8df2fb13-fa44-4a77-929c-76806fdcea1f>
3.484375
1,323
Knowledge Article
Software Dev.
20.003635
View Full Version : Geography 8-| March 11th, 2010, 09:02 PM I am doing my Geography Assesment at the Moment and am finding difficulty on understanding what global cooling is and how it is caused. I searched all over the net but couldnt find a proper description which was easy to Understand ( Was to complicated XD) So guys... Can you Help me out? :P March 11th, 2010, 09:28 PM If I recall try googling the ice age, that might come up with some results, as well as try googling ocean current shifts and cooling of. March 11th, 2010, 10:01 PM Global cooling? Umm, I think that could be caused in different ways. One is that the earth's orbit can possibly wobble, so the north pole and south pole move. Another is something that happened in Chile during that earthquake, it reconstructed the plates there or something, forgot what my teacher said. Ocean currents can also affect it, so that involves the moon as well. xD March 11th, 2010, 10:22 PM It's an earth natural process, but I don't know how it happens... actually, the earth seems to be getting hot. I think I'll look for this info as well, it made me curious. March 11th, 2010, 10:46 PM ^ lol, you haven't been to Texas this past February, have you? And what exactly do you mean by global cooling? I google it, wikipedia shows up, and it says it was a "hypothesis with little support in the scientific community" from the '40s. It just makes me wonder what you mean when you say global cooling. I'm intrigued, tell me more.
<urn:uuid:e0fa2b71-c947-4ce4-ae5a-62b60abcd693>
3.109375
369
Comment Section
Science & Tech.
83.885484
Written by Roger Pielke Sr. November 22, 2008 Roger Pielke Sr. Originally posted on August 5, 2005. As recognized by the National Research Council in 2005, land-use/land-cover change is a first-order climate forcing. However, its role as a regional and global climate influence is not widely recognized, except as it effects the atmospheric concentration of carbon dioxide and the global average surface albedo. In the summary figure from the IPCC Statement for Policymakers (see Figure ES-2 here), in terms of the global mean radiative forcing, only albedo effects of land use/land cover change are identified. However, numerous studies have shown that the effect of land-cover/land-use change is to alter temperatures and precipitation in regions where the change occurs, as well as weather globally through teleconnections (see, for example, The influence of land-use change and landscape dynamics on the climate system: relevance to climate-change policy beyond the radiative effect of greenhouse gases and The climatic impacts of land-surface change and carbon management, and the implications for climate change mitigation policy). The reason for this influence is described in a presentation I gave entitled "Land-Use/Land-Cover Change as a Major Climate Forcing: Evidence and Consequences for Climate Research." In the talk, I asked the question "why should landscape effects, which cover only a fraction of the Earth's surface, have global circulation effects?" The answer can be summarized as follows: We should, therefore expect global climate effects from land-use/land-cover change. The next IPCC needs to focus more on this first-order climate forcing than they have in the past. The question of searching for a "discernable effect on the climate system" misses the obvious in that we have been altering regional and global climate by land-use/land-cover change for decades. The goal of "preventing dangerous anthropogenic interference with the climate system" (from the UN Framework Convention on Climate Change, article 2, 1999), by focusing on CO2, has overlooked the first order climate forcing of land-use/land-cover change in altering the surface heat and water vapor fluxes.
<urn:uuid:6a4ec0d6-19a9-408b-911c-0602901510ab>
3.40625
456
Nonfiction Writing
Science & Tech.
25.169523
By Glen Phelan Energy Basics: Energized! uses real-world examples to help students understand different forms of energy and how energy affects our lives. Students learn that objects have energy due to their motion. They study how energy can be stored and released at a later time. They learn that energy can change from one form to another, but it can never be lost. Students discover that the Sun is the source of almost all energy on Earth. At the end of each two-page spread, a brief statement called The Bottom Line reinforces students’ understanding by summing up the key ideas about energy covered in those pages.
<urn:uuid:928a843f-7f13-4ed3-b93c-68c430b54c7b>
3.96875
129
Truncated
Science & Tech.
51.741667
First, don't feel stupid. This board is designed to help people with questions, no matter what the author thinks of his/her project. Second, in order for something to rust, it needs air. Oxidation (the technical tern fro rust) is the same chemical process as burning something. Fire needs oxygen. It may begin rusting underwater because water naturally has oxygen in it (that's how fish survive), but it will rust water in air. The water provides the other element necessary for rust, surplus protons. science buddies expert
<urn:uuid:98fd1808-a49f-48e1-a754-a4a5ec76d68f>
2.765625
112
Comment Section
Science & Tech.
57.049101
Want to stay on top of all the space news? Follow @universetoday on Twitter Object Name: Messier 66 Alternative Designations: M66, NGC 3627, (a member of the) Leo Trio, Leo Triplet Object Type: Type Sb Spiral Galaxy Right Ascension: 11 : 20.2 (h:m) Declination: +12 : 59 (deg:m) Distance: 35000 (kly) Visual Brightness: 8.9 (mag) Apparent Dimension: 8×2.5 (arc min) Locating Messier 66: Even though you might think by its apparent visual magnitude that M66 wouldn’t be visible in small binoculars, you’d be wrong. Surprisingly enough, thanks to its large size and high surface brightness, this particular galaxy is very easy to spot directly between Iota and Theta Leonis. In even 5X30 binoculars under good conditions you’ll easy see both it and M65 as two distinct gray ovals. A small telescope will begin to bring out structure in both of these bright and wonderful galaxies, but to get a hint at the “Trio” you’ll need at least 6″ in aperture and a good dark night. If you don’t spot them right away in binoculars, don’t be disappointed – this means you probably don’t have good sky conditions and try again on a more transparent night. The pair is well suited to modestly moonlit nights with larger telescopes. What You Are Looking At: Enjoying life some 35 million light years from the Milky Way, the group known as the “Leo Trio” is home to bright galaxy Messier 66 – the easternmost of the two M objects. In the telescope or binoculars, you’ll find this barred spiral galaxy far more visible and much easier to see details within its knotted arms and bulging core. Because of interaction with its neighboring galaxies, M66 shows signs of a extremely high central mass concentration as well as a resolved noncorotating clump of H I material apparently removed from one of the spiral arms. Even one of its spiral arms got it noted in Halton Arp’s collection of Peculiar Galaxies! So exactly what did it collide with? “The combined CO and H I data provide new information, both on the history of the past encounter of NGC 3627 with its companion galaxy NGC 3628 and on the subsequent dynamical evolution of NGC 3627 as a result of this tidal interaction. In particular, the morphological and kinematic information indicates that the gravitational torque experienced by NGC 3627 during the close encounter triggered a sequence of dynamical processes, including the formation of prominent spiral structures, the central concentration of both the stellar and gas mass, the formation of two widely separated and outwardly located inner Lindblad resonances, and the formation of a gaseous bar inside the inner resonance. These processes in coordination allow the continuous and efficient radial mass accretion across the entire galactic disk.” says Xiaolei Zhang (et al), “The observational result in the current work provides a detailed picture of a nearby interacting galaxy which is very likely in the process of evolving into a nuclear active galaxy. It also suggests one of the possible mechanisms for the formation of successive instabilities in postinteraction galaxies, which could very efficiently channel the interstellar medium into the center of the galaxy to fuel nuclear starburst and Seyfert activities.” Ah, yes! Star forming regions… And what better way to look deeper than through the eyes of the Spitzer Space Telescope? “M66′s blue core and bar-like structure illustrates a concentration of older stars. While the bar seems devoid of star formation, the bar ends are bright red and actively forming stars. A barred spiral offers an exquisite laboratory for star formation because it contains many different environments with varying levels of star-formation activity, e.g., nucleus, rings, bar, the bar ends and spiral arms.” says R. Kennicutt (University of Arizona) and the SINGS Team, “The SINGS image is a four-channel false-color composite, where blue indicates emission at 3.6 microns, green corresponds to 4.5 microns, and red to 5.8 and 8.0 microns. The contribution from starlight (measured at 3.6 microns) in this picture has been subtracted from the 5.8 and 8 micron images to enhance the visibility of the dust features.” Messier 66 has also been deeply studied for evidence of forming super star clusters, too. “Super star clusters are thought to be precursors of globular clusters and are some of the most extreme star formation regions in the universe. They tend to occur in actively starbursting galaxies or near the cores of less active galaxies. Radio super star clusters cannot be seen in optical light because of extreme extinction, but they shine brightly in infrared and radio observations. We can be certain that there are many massive O stars in these regions because massive stars are required to provide the UV radiation that ionizes the gas and creates a thermally bright HII regions.” says David Meier, “Not many natal SSCs are currently known, so detection is an important science goal in its own right. In particular, very few SSCs are known in galactic disks. We need more detections to be able to make statistical statements about SSCs and fill in the mass range of forming star clusters. With more detections, we will be able to investigate the effects of other environments (e.g. bars, bubbles, and galactic interaction) on SSCs, which could potentially be followed up in the far future with the Square Kilometer Array to discover their effects on individual forming massive stars.” But there’s still more. Try magnetic properties in M66′s spiral patterns. “By observing the interacting galaxy NGC 3627 in radio polarization we try to answer the question; to which degree does the magnetic field follow the galactic gas flow. We obtained total power and polarized intensity maps at 8.46 GHz and 4.85 GHz using the VLA in its compact D-configuration. In order to overcome the zero-spacing problems, the interferometric data were combined with single-dish measurements obtained with the Effelsberg 100-m radio telescope. The observed magnetic field structure in NGC 3627 suggests that two field components are superposed. One component smoothly fills the interarm space and shows up also in the outermost disk regions, the other component follows a symmetric S-shaped structure.” says M. Soida (et al), “In the western disk the latter component is well aligned with an optical dust lane, following a bend which is possibly caused by external interactions. However, in the SE disk the magnetic field crosses a heavy dust lane segment, apparently being insensitive to strong density-wave effects. We suggest that the magnetic field is decoupled from the gas by high turbulent diffusion, in agreement with the large Hi line width in this region. We discuss in detail the possible influence of compression effects and non-axisymmetric gas flows on the general magnetic field asymmetries in NGC 3627. On the basis of the Faraday rotation distribution we also suggest the existence of a large ionized halo around this galaxy.” History: Both M65 and M66 were discovered on the same night – March 1, 1780 – by Charles Messier, who described M66 as “Nebula discovered in Leo; its light is very faint and it is very close to the preceding: They both appear in the same field in the refractor. The comet of 1773 and 1774 has passed between these two nebulae on November 1 to 2, 1773. M. Messier didn’t see them at that time, no doubt, because of the light of the comet.” Both galaxies would be observed and cataloged by the Herschel family and further expounded upon by Admiral Smyth: “A large elongated nebula, with a bright nucleus, on the Lion’s haunch, trending np [north preceding, NW] and sf [south following, SE]; this beautiful specimen of perspective lies just 3deg south-east of Theta Leonis. It is preceded at about 73s by another of a similar shape, which is Messier’s No. 65, and both are in the field at the same time, under a moderate power, together with several stars. They were pointed out by Mechain to Messier in 1780, and they appeared faint and hazy to him. The above is their appearance in my instrument. These inconceivably vast creations are followed, exactly on the same parallel, ar Delta AR=174s, by another elliptical nebula of even a more stupendous character as to apparent dimensions. It was discovered by H. [John Herschel], in sweeping, and is No. 875 in his Catalogue of 1830 [actually, probably an erroneous position for re-observed M66]. The two preceding of these singular objects were examined by Sir William Herschel, and his son [JH] also; and the latter says, “The general form of elongated nebulae is elliptic, and their condensation towards the centre is almost invariably such as would arise from the superposition of luminous elliptic strata, increasing in density towards the centre. In many cases the increase of density is obviously attended with a diminution of ellipticity, or a nearer approach to the globular form in the central than in the exterior strata.” He then supposes the general constitution of those nebulae to be that of oblate spheroidal masses of every degree of flatness from the sphere to the disk, and of every variety in respect of the law of their density, and ellipticity towards the centre. This must appear startling and paradoxical to those who imagine that the forms of these systems are maintained by forces identical with those which determine the form of a fluid mass in rotation; because, if the nebulae be only clusters of discrete stars, as in the greater number of cases there is every reason to believe them to be, no pressure can propagate through them. Consequently, since no general rotation of such a system as one mass can be supposed, Sir John suggests a scheme which he shows is not, under certain conditions, inconsistent with the law of gravitation. “It must rather be conceived,” he tells us, ” as a quiescent form, comprising within its limits an indefinite magnitude of individual constituents, which, for aught we can tell, may be moving one among the other, each animated by its own inherent projectile force, and deflected into an orbit more or less complicated, by the influence of that law of internal gravitation which may result from the compounded attractions of all its parts.” May you equally be attracted to this galactic pair! Top M66 image credit, Palomar Observatory courtesy of Caltech, Messier 66 2MASS image, Messier 66 Hubble Space Telescope, M66 Spitzer/SINGS Image, M66 courtesy of the Sloan Digital Sky Survey, M66 Logarithmic Spiral SSDS Overlay and M66 color image courtesy of NOAO/AURA/NSF.
<urn:uuid:a78886fc-8719-4c80-acc9-c2cf96a073c1>
2.84375
2,393
Knowledge Article
Science & Tech.
44.526968
Scientists associated with NASA’s Spitzer Telescope have discovered polycyclic aromatic hydrocarbons: “NASA’s Spitzer Space Telescope has shown complex organic molecules called polycyclic aromatic hydrocarbons (PAHs) are found in every nook and cranny of our galaxy. While this is important to astronomers, it has been of little interest to astrobiologists, scientists who search for life beyond Earth. Normal PAHs aren’t really important to biology,” Hudgins said. “However, our work shows the lion’s share of the PAHs in space also carry nitrogen in their structures. That changes everything.” This is important because: “Much of the chemistry of life, including DNA, requires organic molecules that contain nitrogen,” said team member Louis Allamandola, an astrochemist at Ames. “Chlorophyll, the substance that enables photosynthesis in plants, is a good example of this class of compounds, called polycyclic aromatic nitrogen heterocycles, or PANHs. Ironically, PANHs are formed in abundance around dying stars. So even in death, the seeds of life are sewn,” Allamandola said. Looking back over the years it is totally amazing to me how many different types of organic chemicals have been found in outer space. Once upon a time it used to be thought that outer space was barren of organic chemicals and origins of life research focused on chemicals believed to be present on early earth. It seems the picture is changing…
<urn:uuid:3a127c81-98b4-4c2a-b49f-2e06b2dc195d>
3.78125
326
Personal Blog
Science & Tech.
27.163231
General ecology of the Cane Toad, Bufo marinus, and examination of direct effects on native frog choruses at Heathlands, Cape York Peninsula. Cohen, Martin P., and Williams, Stephen (1993) General ecology of the Cane Toad, Bufo marinus, and examination of direct effects on native frog choruses at Heathlands, Cape York Peninsula. In: Cape York Peninsula Scientific Expedition Wet Season 1992. Royal Geographical Society of Queensland, Brisbane, QLD, Australia, pp. 243-245. |PDF - Repository staff only - Requires a PDF viewer such as GSview, Xpdf or Adobe Acrobat Reader| Experiments performed on the introduced cane toad (Bufo marinus) during the Heathlands wet season expedition are outlined. Twenty cane toads were collected at Cockatoo Creek dam during a native frog chorus. Stomach content analysis of these toads demonstrated no direct predatory effect on the native frogs. Ten cane toads were spool-tracked around the Cockatoo Creek dam. Seven of these toads were tracked to a shelter site, six of which were retraced the following day. Most toads favoured shelter sites amongst the long grass around the dam. Some toads moved distances of up to 200 m into the nearby heath. Nine toads were similarly spool-tracked from a small roadside pool of water. Shelter sites and movement of these toads were recorded. Shelter sites included an old goanna burrow, hollow logs and under clumps of grass. Most toads remained in close proximity to the pool. Toad retreat sites tended to be near water and atleast partially shaded. A mark-recapture program (along a transect from Heathlands homestead to Bertie Creek) and examination of stomach contents of toads were also performed. Few toads were recaptured during the mark-recapture program, possibly due to the dry conditions. The stomach contents of toads collected around the homestead showed a diet of primarily insects, with ants and beetles being the dominant groups. |Item Type:||Book Chapter (Non-Commercial)| |Keywords:||cane toad, Bufo marinus, Cape York, Queensland, Australia, Heathlands, native frog, chorus, predation| |FoR Codes:||06 BIOLOGICAL SCIENCES > 0602 Ecology > 060208 Terrestrial Ecology @ 0%| |Deposited On:||12 Sep 2007| |Last Modified:||16 Mar 2011 15:05| Last 12 Months: 0 Repository Staff Only: item control page
<urn:uuid:716bceee-fcb2-45d5-9602-35a31d79f5d9>
3.34375
549
Academic Writing
Science & Tech.
40.890885
Journalists reporting that neutrinos can travel faster than the speed of light have jumped the gun and done a disservice to scienceA little before six last night, Reuters tweeted a report stating that Italian scientists had detected tiny particles called 'neutrinos' moving faster than the speed of light (paper). If true, they have witnessed a phenomenon that, according to established theory, should be impossible. If. Within hours of Reuters' tweet, a chorus of physicists had expressed their reservations, culminating this morning in Professor Jim Al-Khalili bravely threatening to eat his boxer shorts live on television if the findings are correct. Science; red in tooth, claw and underpants.More, er, detailed critiques have come from Czech physicist Luboš Motl, particle physicist Ben Still, and Phil "Bad Astronomer" Plait, with New Scientist publishing a suitably sceptical article this morning. Twitter's reaction was, inevitably, a humorous hashtag, #mundaneneutrinoexplanations: @alinasnd: Neutrinos going... - University of Huddersfield physicist investigates the Big Bang particleSat, 10 Nov 2012, 17:51:17 EST - Underground search for neutrino properties unveils first resultsMon, 4 Jun 2012, 15:34:32 EDT - Einstein's relativity survives neutrino testWed, 15 Oct 2008, 14:22:18 EDT - BU researcher plays key role in discovery of new type of neutrino oscillation Wed, 15 Jun 2011, 15:38:31 EDT - Measuring elusive neutrinos flowing through the Earth, physicists learn more about the sunFri, 7 Oct 2011, 13:35:53 EDT
<urn:uuid:09395795-afec-4fb3-88ba-f50921dbd1e3>
2.953125
350
Content Listing
Science & Tech.
36.692222
In January, I gave a guest lecture in a class on reflection and metaprogramming at HPI Potsdam. A screencast of the talk is now available. It’s an introduction to the concept of mirrors, which is the goodthink way of doing reflection. It’s mostly language neutral, but there is a brief demo using mirrors in Newspeak. Because it’s a screencast rather than a video, occasionally some detail may be unclear, but by and large it is the most comprehensive introduction to mirrors available other than the OOPSLA paper. Some people may not have an hour to watch the entire screen cast, and the paper is by no means an easy read, so I’ve decided to post the executive summary here. The classic approach to reflection in object-oriented programming languages originates with Smalltalk, and is used in most class based languages that support reflection: define a reflective API on Object. Typically, Object supports an operation like getClass() which returns an object representing the class of the receiver. The API of classes defines most additional reflective operations available. For example, in Java, you can get reflective descriptors for a class’ methods (java.reflect.Method), fields (java.reflect.Field) and constructors (java.reflect.Constructor). You can even use these descriptors to evaluate program code dynamically - say, ask the user for the name of a method and invoke it. In Smalltalk, you can also add and remove methods and fields, change a class’ superclass, remove classes from the system etc. Another approach is used in many scripting languages. The language constructs themselves introduce code on the fly, modifying the program as they are executed. For example, a class comes into being when a class declaration is evaluated, and might change if another declaration of a class with the same name is executed later. The third approach is that of mirrors, and originates in Self. Mirrors have been used in class based systems such as Strongtalk, and even in the Java world. JDI, the Java Debugger Interface, is a mirror based reflective API. Here, the reflective operations are separated into distinct objects called mirrors. This seemingly minor restructuring has significant implications. Reflection is no longer tied into the behavior of every object in the system (as it is via getClass()) or (even worse) into the very syntax of the language. Instead, it resides in separable components that can be removed or replaced. Reflection is now a distinct capability, in the sense of the object capability model. If you are worried about security, this is good news. If you don’t provide a program with the means to manufacture mirrors (e.g., you do not provide the mirror factory object), said program cannot do any reflection. You can also provide mirrors with limited capabilities - say mirrors that only reflect the program’s own code, or mirrors that do not allow you to modify code or access non-public members etc. Caveat: The truth is, mirrors have not really been used for security. Their utility for security seems clear, but a working API has yet to be demonstrated. Mirrors are good news for other reasons. Say your program doesn’t use reflection, and needs to fit into a small footprint such as an embedded device. It is easy to take it out. Another advantage is that you can easily plug in alternate implementations of reflection - so if you need to reflect on remote objects, you can do so. Historical note: This is why JDI uses mirrors; indeed, it is why JDI had to be introduced. The original intent was that Java reflection would be used to support debugging; but once you need to deal with cross-process debugging, you need a distinct implementation of reflection; core reflection is tied to a single built in implementation. Mirrors support a clear boundary between the base-level of your program (the level which deals with the problem domain your program is intended to solve) and the meta-level (the level where your program is discussing itself, where reflection takes place). The classic design, where the class is the main repository of reflective information, tends to blur these lines. Classes often have both base level functionality (like creating instances) and meta-level functionality (reflection). This is most acute in languages like Smalltalk and CLOS. In Java, the base level roles of classes are often supported by specialized constructs like constructors (which have their own, worse, problems) and static members (likewise). Even in Java, class objects may be used in a base level capacity (as type tokens, for example). There is much work to be done in this area. No mirror API has yet fulfilled all my claims and ambitions - least of all the Newspeak mirror API, which needs extensive revisions. Still, I hope you’re curious enough to watch the talk and/or read the paper. A place to be (re)educated in Newspeak - ▼ 2010 (12) - ► 2009 (14) - ► 2008 (13) - ► 2007 (10)
<urn:uuid:5fd3c25c-ed06-403d-b1d9-8d64bb25b5c3>
3.015625
1,059
Personal Blog
Software Dev.
44.801337
Recently, I was included (with a group of ex-grad school cohorts and colleagues) in an email thread begun by a prominent ornithologist at my alma mater. In it, he refers to (and includes a PDF of) a recent paper published in the journal BioScience entitled "Changes in Bird Abundance in Eastern North America: Urban Sprawl and Global Footprint". The authors and reviewers will remain nameless - you can look it up if you're curious. However, let it be known that I wouldn't let a dermatologist do brain surgery on me, if you know what I mean.... The major conclusions of the paper are: Overall, breeding bird species numbers in North America have declined 19% since 1965. In addition: Forest bird numbers are increasing. Neotropical migrant bird numbers are increasing. Birds that breed and winter in North America are decreasing. Rock Doves and House Sparrows are declining significantly. Hmm. There seems to be something counter-intuitive about this. Most of us have learned or studied the effects of forest fragmentation and the loss of forest habitat over the last 300 years in North America. Fragmentation of forest exposes nesting birds to increased nest parasitism by Cowbirds, and increased predation by crows, jays, domestic cats, and raccoons, all of whom favor open habitats. Evidence is mounting that neotropical migrant numbers are decreasing due to deforestation in the tropics, which is rampant and increasing. Studies are currently being done which may point to the loss of stopover habitat in the southern U.S. as another cause of the decrease in populations of a number of migrant species. To reach the conclusions listed above, Breeding Bird Survey data was analyzed from 1965 to 2005. The entire basis for the analysis done was a table listing bird species from the Atlantic and Mississippi flyway. Each species was catagorized by where it bred, and where it spent the boreal winter. Fully resident in North America, migrate south to southern U.S., Mexico, northern South America and the Amazon basin, or migrate to southern South America. Unfortunately, the table contained a significant amount of data that was just plain wrong. Chestnut-backed Chickadee winters in Mexico? The bird is a N. American resident, and occurs nowhere near the Atlantic or Mississippi flyway. Canada Warbler a N. American resident? The species winters in north and central South America. Cape May Warbler winters in Amazonia? Nope - the West Indies - no records for South America. And so on. Probably more than 20% of the table is wrong. In addition, on BBS counts it is widely understood that common species will be recorded in large numbers, and this must be accounted for in any population trend study. A classic case of using statistics on bad data and coming up with stupid conclusions. Obviously the authors did not know much about the ranges of N. American birds (not sure what happened with the reviewers). Unfortunately, the conclusions of this paper are now in the literature, and may influence conservation decisions. Expect to see a retraction or major revision to this paper - none of the ornithologists I know are going to let it pass.
<urn:uuid:eb48df86-8015-4397-91e9-9de145b4b93a>
2.8125
655
Personal Blog
Science & Tech.
49.068353
Click to viewHumans can't walk in straight lines. If there's no fixed point of reference, we just walk in circles and inevitably get lost. Nobody knows why, but researchers at the Max Planck Institute for Biological Cybernetics have confirmed it in several experiments. If you walk, drive or sail blindfolded, in the middle of the fog or at night, with no stars in sight, you will not be able to keep a straight line. No matter how hard you try, you will end going in circles because, for some mysterious reason, humans have a tendency to lean to one side more than the other. Some people speculate that this is because one side of the brain is the dominating one. Others point out that the reason may be purely mechanical, because one of our legs is always sightly shorter than the other. But, according to the results of the study, these are not the causes for this unique behavior. At least, there's not one single explanation and it may be a combination of many.
<urn:uuid:408065a2-07ae-44e9-b423-dfa74b5cb620>
3.109375
208
Truncated
Science & Tech.
53.998757
In the task-parallel model represented by OpenMP, the user specifies the distribution of iterations among processors and then the data travels to the computations. In data-parallel programming, the user specifies the distribution of arrays among processors, and then only those processors owning the data will perform the computation. In OpenMP’s master / slave approach, all code is executed sequentially on one processor by default. In data-parallel programming, all code is executed on every processor in parallel by default. The most widely used standard set of extensions for data-parallel programming are those of High Performance Fortran (HPF). With HPF, a user declares how to DISTRIBUTE data among abstract processors, usually in a BLOCK or CYCLIC fashion, the former intended for applications with nearest-neighbor communication, and the latter for load-balancing purposes. Additionally, the user may also ALIGN data elements with each other. The elements of arrays that have thus been mapped will be assigned to exactly one processor; all other (non-mapped) data is copied to each of the processors. To parallelize a loop, the user declares its iterations as being INDEPENDENT. Data within the loop that has been given the NEW attribute will remain private in scope; all other data is copied to each processor. Correctness is left to the user. While HPF has been designed for NUMAs, its performance in practice has been unpredictable. The reason does not appear to be the communication, but rather the data manipulation that occurs before and after the communication. It is important here to observe that the performance impact of modern high-performance networks is actually less of an issue compared to the software’s overhead. Another key observation to make at this time is that of the “optimization envy” of the parallelizing-compiler groups. Just as some OpenMP users seek to exploit NUMAs, there are a few HPF users who hope to achieve better performance on SMPs. One approach has been to include DYNAMIC and GUIDED attributes for the SHARE clause associated with INDEPENDENT. The compiler then produces multithreaded object code, rather than message-passing code. An important difference with this approach from the standard is that non-mapped data is owned by a single master thread and is globally accessible by all other threads. The performance benefit of this approach is that there is no software translation of the global address as the hardware already provides this support. Address translation is a major source of overhead during runtime.
<urn:uuid:d0400685-5ba1-4e80-92ca-17847920e567>
3.21875
527
Knowledge Article
Software Dev.
30.247395
Phys. Rev. Focus27, 22 (2011) – Published June 3, 2011 Theorists created a gravitational model that is mathematically analogous to one for a standard superconducting device, extending the ways that the tools of general relativity can lead to insights into condensed matter physics. Phys. Rev. Focus21, 13 (2008) – Published April 17, 2008 Researchers used a magnetic material to create a difference in current-carrying properties between two perpendicular directions in a superconductor. They could easily change the directions with an external magnetic field, which could be useful in superconducting devices. Phys. Rev. Focus18, 8 (2006) – Published September 11, 2006 Weaving together experimental clues and theoretical insights, three physicists devised in 1957 the first fundamental theory of superconductivity, one of the most successful theories in solid state physics. Phys. Rev. Focus7, 2 (2001) – Published January 19, 2001 New evidence confirms that the lattice of so-called magnetic vortices in a superconductor can melt, just like a real solid. The vortices directly affect the amount of electric current a superconductor can carry.
<urn:uuid:2ec65b83-8648-4307-b0c9-2902a70a1892>
3.5625
243
Content Listing
Science & Tech.
37.897293
Since polymorphic behavior is one of the cornerstones of object-oriented design, our C++ coding standard has to provide some pointers on how to apply inheritance. - 8.1. Public inheritance must only be used to model the "is a" relation. - 8.2. Use private and protected inheritance sparingly, and only to model the "looks like a" relation. - 8.3. Only inherit publicly from an abstract base class. - 8.4. Destructors of public base classes must be pure virtual (but implemented). - 8.5. Don't use multiple inheritance. Rule 8.2 used to read "Use only public inheritance". The original rationale was this: You might find private or protected inheritance useful to save a few lines of code somewhere. But I claim you should just duplicate the lines of code, rather than couple together classes which are so different conceptually that public inheritance can't be used. They might be structurally the same today, but if they are conceptually different, that structural similarity may change over time and give you a huge headache. There's some truth to what's said above, so use private inheritance sparingly. But I softened my stance about private inheritance when I realized how useful the C++ usingdeclaration is. You can re-use as many of the member functions of a private base class as you want with simple one-liners, without allowing polymorphic access to the base class. That way your class can expose all the useful parts of, say, std::map<A,B>, without the risk of someone confusing your class with the underlying map. I know that the textbooks say private inheritance models "is implemented in terms of", and it's OK to think of it that way. But containment seems like a better model of "in terms of", and this "using" idiom seems to me to be the most useful part of private inheritance, so I'm going to start thinking of private inheritance modeling "looks like". It looks like std::map, for instance, but it isn't one. Rule 8.3 springs from the same concern about coupling as 8.2. If you inherit from a non-abstract class, you're tying yourself to an interface that may change over time to meet the evolving needs of the parent class. Keeping base classes abstract means that you can change the behavior or implementation of any concrete class without shaking up some other concrete class. It sounds odd to implement a pure virtual function, as Rule 8.4 demands, but it is in fact a legal thing to do. Legal and useful: there's little chance that someone will later remove the destructor from the class, so it will always be there to make the class abstract. When might you break this rule? If you have a memory-sensitive class where subclasses will not be used polymorphically (or do not require polymorphic destruction), you can disregard the rule and get rid of the virtual table pointer. But that's really weird: why didn't you use private inheritance if the classes are not to be used polymorphically? It sounds like you are not really modeling "is a", and you're probably skating on thin ice. I suppose there are applications for multiple inheritance, but even if you avoid the diamond problem, you still often end up with extra complications in code that uses multiple inheritance. Before declaring a class public Fish, public Fowl, ask yourself if there is another solution, and if the derived class truly "is a" Fish and a Fowl. Next: preprocessor issues.
<urn:uuid:f520842d-4dbe-4097-8da8-8e7eb7e54776>
3.21875
736
Personal Blog
Software Dev.
53.168976
Data binding is a DHTML feature that lets you easily bind individual elements in your document to data from another source, such as a database or comma-delimited text file. When the document is loaded, the data is automatically retrieved from the source and formatted and displayed within the element. One practical way to use data binding is to automatically and dynamically generate tables in your document. You can do this by binding a table element to a data source. When the document is viewed, a new row is created in the table for each record retrieved from the source, and the cells of each row are filled with text and data from the fields of the record. Because this generation is dynamic, the user can view the page while new rows are created in the table. Additionally, once all the table data is present, you can manipulate (sort or filter) the data without requiring the server to send additional data. The table is simply regenerated, using the previously retrieved data to fill the new rows and cells of the table. To provide data binding in your documents, you must add a data source object (DSO) to your document. This invisible object is simply an ActiveX control or Java applet that knows how to communicate with the data source.
<urn:uuid:fa2de476-5d72-4b28-a778-fbcfb5b98925>
3.03125
252
Knowledge Article
Software Dev.
39.357185
Science Fair Project Encyclopedia The scorpionfish or rockfish are a family (Scorpaenidae) of mostly marine fish that includes many of the world's most venomous species. The family is a large one, with hundreds of members. They are widespread in tropical and temperate seas, but mostly found in the Indo-Pacific area. General characteristics of family members include a compressed body, ridges and/or spines on the head, one or two spines on the opercle , and three to five spines on the preopercle . The dorsal fin will have 11-17 spines, often long and separated from each other, and the pectoral fins will be well-developed, with 11-25 rays. The spines of the dorsal, anal, and pelvic fins all have venom glands at their bases. Most species are bottom-dwellers that feed on crustaceans and smaller fish, in some cases using the spines to paralyze their victims before gulping them. Others, such as the stonefish, wait in disguise for prey to pass them by before swallowing. Scorpaenid systematics are complicated and unsettled. Fishes of the World recognizes ten subfamilies with a total of 388 species, while (as of 2003) FishBase follows Eschmeyer and has three subfamilies and less than 200 species, some of the species being removed to family Sebastidae which other authorities do not follow. In addition to the two basic names above, common names for family members also include "firefish", "turkeyfish", "barbfish", and "stingfish", usually with adjectives added. The contents of this article is licensed from www.wikipedia.org under the GNU Free Documentation License. Click here to see the transparent copy and copyright details
<urn:uuid:8e0ad3f8-9aa0-469b-9804-dacea342b8e0>
3.359375
373
Knowledge Article
Science & Tech.
40.933358
Before we begin, I would first like to define what a List is: A list is exactly what is sounds like. It is a list that is created to hold data, in a given order. A List is one of the Data Structures that is used in the Python language and is similar to an array or an ArrayList in Java, for those of you who already know Java. During this tutorial, I will assume that we all have a basic understanding of Lists. The basic idea of a nested list is that you have, essentially, a list made up of lists. For example: L1 = [1,2] L2 = [[1,2,3],[4,5,6]] Now, I believe that most people reading this will know that a computer starts counting at 0, not at 1. So we know that L1 the first element in the list, not L1. With that said, let's explore a bit. From the example that I have provided, we can see that L1 is equal to 1, and L1 is equal to 2. In a nested list, such as L2, the first element of the List, is a List itself. So, L2 is the list of [1,2,3], and L2 is the list of [4,5,6]. Understanding this point is vital to understanding my next point. When asking for a specific element in a List, we say: L1[x], where x is the element desire. But what do we say when we want a specific element from a nested list? We say: L1[x][y]. This is easier to show than it is to explain, so here is an example: L1 = [ 1, [73,89,42,32], 62, [24, 32], 99 ] In this example, L1 has the value of 1, but L1 has the value of [73,89,42,32]. From here, we will act exactly as if we were getting an element from a non-nested list, with only one difference. We are going to add another set of square brackets into the mix. Example: L1 = [ 1, [73,89,42,32], 62, [24,32], 99 ] L1 = [73,89,42,32] L1 = 73 L1 = 89 L1 = 42 L1 = 32 Errors in Nested Lists Nested lists can go as deep as your list will let it. Meaning that in the above example we can legally say L1 = 73, but if we try to go deeper, say we try to ask for L1, then we will get an error. We will also get an error if we try to ask for an element that doesn't exist, in a level that does exist. Ex: L1 = [ 1, [73,89,42,32], 62, [24,32], 99 ] L1 = 73 # Good Statement! L1 = 32 # Good Statement! L1 = ? # Bad Statement! L1 = ? # Bad Statement! The first two examples given are perfectly legal. However, the other two examples are illegal and each will throw an error. L1, in this case, would throw what is known as a TypeError. What this means is that the sub-level you requested, does not exist. This will happen whenever you try to go too deep into your list. L1 is also an illegal statement. The difference between this example and L1 is that this example doesn't go too deep, it goes too far. This will through an IndexError. An IndexError will occur whenever you try to request an index that doesn't exist. In L1, the last entry is 32, this is known as L1. So, we can't call L1, because it doesn't exist. I hope this tutorial was helpful, and if all goes well then I plan to write more in the future. Please let me know what you did or did not like in the tutorial, or if I did not explain something well. I am more than glad to answer any questions that you have!
<urn:uuid:fbbe2e05-65d6-422f-b4b5-307329a451fc>
4.40625
870
Q&A Forum
Software Dev.
90.002055
Joined: 16 Mar 2004 |Posted: Mon Nov 27, 2006 11:33 am Post subject: Bacteria make the rotor go round |Bacteria make the rotor go round Micro-organisms found in freshwater fish form the basis for a microscale motor device. SEM image showing the silicon dioxide rotor, the circular silicon track where the bacteria glide, and the channel down which the bacteria enter the track. Scientists in Japan have used gliding bacteria to turn a microscale rotor made of silicon dioxide. The motor device could ultimately be used to drive microrobots. "It was theoretically predictable that a microrotary motor driven by bacteria works," Yuichi Hiratsuka of Japan's National Institute of Advanced Industrial Science and Technology (AIST) told nanotechweb.org. "We were extremely excited when we first saw the motor rotate because its rotation was smoother than we ever imagined and it did not look like an uncertain device driven by living materials." Hiratsuka and colleagues at the AIST, Osaka City University, and Japan Science and Technology Agency used the bacterium Mycoplasma mobile, which has been found in freshwater fish and is known for its gliding motion. The researchers employed the bacteria in conjunction with a microstructure consisting of a 20 µm diameter silicon dioxide rotor sitting in a circular silicon track. By introducing the bacteria to a central square chamber with a system of asymmetric channels leading to the track, the researchers ensured that most of the bacteria entering the track were moving in a clockwise direction. The team promoted motion of the bacteria by coating the bottom of the silicon structure's channels and tracks with molecules of fetuin, a sialic protein. The gliding bacteria were able to move the rotor as biotin molecules chemically added to their cell walls linked to molecules of streptavidin coating the rotor. As a result, the bacteria pulled the rotor with them as they glided along. "We believe that this work will stimulate and encourage a number of researchers from broad disciplines, especially in the field of nanotechnology," said Hiratsuka. "I hope that nanotechnologists would be interested in our approach to integrate biological materials with inorganic microstructures." Typically, the rotor began to move within a few minutes while rotations in some cases lasted more than one minute. The rotation rate was 1.5–2.6 rpm. The team believes that it may be useful to genetically modify the bacteria's surface proteins either to aid biotin linking to cargo or to cause the cells to migrate in a particular direction in response to a chemical. In order to avoid potential biohazard issues, the researchers propose the use of "ghost" bacteria, i.e. dead versions of the cells in which the motor units are still active as long as adenosine triphosphate is available externally. "We can suggest use of the device as a micropump in microTAS [micro total analysis systems, also known as labs-on-a-chip], so that external pumps and pipes would no longer be necessary, and they become real on-chip devices," said Hiratsuka. "Alternatively, we may be able to construct electronic generator systems, which generate electric energy from abundant chemical energy – glucose – in the body." In the long term, the team would like to make microrobots driven by biological motors. "We will make such sophisticated micro devices by further developing this work," said Hiratsuka. "Before realizing them, we need to improve the stability and lifetime of the motor. Although in this case we used living bacteria as driving units, we will develop micromechanical devices using purified motor proteins, such as myosin or kinesin, as well as living bacteria." This story was posted on 1st September 2006.
<urn:uuid:3710afc0-25c3-45a8-bc96-0f8a531eea26>
3.3125
781
Comment Section
Science & Tech.
30.059946
ONE of the oldest arm bones ever has been discovered. It belonged to an ancient amphibian, suggesting that forelimbs developed to help animals pop their heads out of water, long before they took their first steps onto land. Exactly how and when fish fins evolved into limbs remains unclear. The humerus fossil was part of a 365-million-year-old amphibian fossil discovered by Neil Shubin, a palaeontologist at the University of Chicago, and his team. The bone was hinged to the shoulder joint in a peculiar way consistent with it being powered by heavy muscles to move the animal up and down, but lacking the front-to-back motion essential for walking ( The as-yet unnamed amphibian lived in a shallow, slow-moving stream with lush vegetation in what is now Pennsylvania. As fish evolved into amphibians, they are thought to have used their fins to move around in such environments, ... To continue reading this article, subscribe to receive access to all of newscientist.com, including 20 years of archive content.
<urn:uuid:b95dcfa9-b28b-4122-8293-b637a27e4a7c>
3.90625
217
Truncated
Science & Tech.
49.196767
|Oscillations and Waves > Instruments > Air Columns||DCS# 3D30.40| Sweep through the frequencies of the function generator and listen for the resonant frequency of the spherical cavity. Use a microphone and oscilloscope to show the change in amplitude. Helmholtz resonators were an early version of the spectrum analyzer: to identify frequency components in a given note, place one end of the resonator of the frequency of interest to your ear and listen for that frequency in the note. Tom Greenslade's early physics apparatus pages:
<urn:uuid:47b7a541-b33f-413c-92a6-3f774527e689>
3.515625
117
Tutorial
Science & Tech.
30.000368
Basic Installation ================== These are generic installation instructions. The `configure' shell script attempts to guess correct values for various system-dependent variables used during compilation. It uses those values to create a `Makefile' in each directory of the package. It may also create one or more `.h' files containing system-dependent definitions. Finally, it creates a shell script `config.status' that you can run in the future to recreate the current configuration, a file `config.cache' that saves the results of its tests to speed up reconfiguring, and a file `config.log' containing compiler output (useful mainly for debugging `configure'). If you need to do unusual things to compile the package, please try to figure out how `configure' could check whether to do them, and mail diffs or instructions to the address given in the `README' so they can be considered for the next release. If at some point `config.cache' contains results you don't want to keep, you may remove or edit it. The file `configure.ac' is used to create `configure' by a program called `autoconf'. You only need `configure.ac' if you want to change it or regenerate `configure' using a newer version of `autoconf'. The simplest way to compile this package is: 1. `cd' to the directory containing the package's source code and type `./configure' to configure the package for your system. If you're using `csh' on an old version of System V, you might need to type `sh ./configure' instead to prevent `csh' from trying to execute `configure' itself. Running `configure' takes awhile. While running, it prints some messages telling which features it is checking for. 2. Type `make' to compile the package. 3. Optionally, type `make check' to run any self-tests that come with the package. 4. Type `make install' to install the programs and any data files and documentation. 5. You can remove the program binaries and object files from the source code directory by typing `make clean'. To also remove the files that `configure' created (so you can compile the package for a different kind of computer), type `make distclean'. There is also a `make maintainer-clean' target, but that is intended mainly for the package's developers. If you use it, you may have to get all sorts of other programs in order to regenerate files that came with the distribution. Compilers and Options ===================== Some systems require unusual options for compilation or linking that the `configure' script does not know about. You can give `configure' initial values for variables by setting them in the environment. Using a Bourne-compatible shell, you can do that on the command line like this: CC=c89 CFLAGS=-O2 LIBS=-lposix ./configure Or on systems that have the `env' program, you can do it like this: env CPPFLAGS=-I/usr/local/include LDFLAGS=-s ./configure Compiling For Multiple Architectures ==================================== You can compile the package for more than one kind of computer at the same time, by placing the object files for each architecture in their own directory. To do this, you must use a version of `make' that supports the `VPATH' variable, such as GNU `make'. `cd' to the directory where you want the object files and executables to go and run the `configure' script. `configure' automatically checks for the source code in the directory that `configure' is in and in `..'. If you have to use a `make' that does not supports the `VPATH' variable, you have to compile the package for one architecture at a time in the source code directory. After you have installed the package for one architecture, use `make distclean' before reconfiguring for another architecture. Installation Names ================== By default, `make install' will install the package's files in `/usr/local/bin', `/usr/local/man', etc. You can specify an installation prefix other than `/usr/local' by giving `configure' the option `--prefix=PATH'. You can specify separate installation prefixes for architecture-specific files and architecture-independent files. If you give `configure' the option `--exec-prefix=PATH', the package will use PATH as the prefix for installing programs and libraries. Documentation and other data files will still use the regular prefix. In addition, if you use an unusual directory layout you can give options like `--bindir=PATH' to specify different values for particular kinds of files. Run `configure --help' for a list of the directories you can set and what kinds of files go in them. If the package supports it, you can cause programs to be installed with an extra prefix or suffix on their names by giving `configure' the option `--program-prefix=PREFIX' or `--program-suffix=SUFFIX'. Relocatable Installation ======================== By default, `make install' will install a package with hardwired file names, and the package will not work correctly when copied or moved to a different location in the filesystem. Some packages pay attention to the `--enable-relocatable' option to `configure'. This option makes the entire installed package relocatable. This means, it can be moved or copied to a different location on the filesystem. It is possible to make symlinks to the installed and moved programs, and invoke them through the symlink. It is possible to do the same thing with a hard link _only_ if the hard linked file is in the same directory as the real program. For reliability it is best to give together with --enable-relocatable a `--prefix' option pointing to an otherwise unused (and never used again) directory, for example, `--prefix=/tmp/inst$$'. This is recommended because on some OSes the executables remember the location of shared libraries (and prefer them over LD_LIBRARY_PATH !), therefore such an executable will look for its shared libraries first in the original installation directory and only then in the current installation directory. Installation with `--enable-relocatable' will not work for setuid / setgid executables. (This is because such an executable kills its LD_LIBRARY_PATH variable when it is launched.) The runtime penalty and size penalty are nearly zero on Linux 2.2 or newer (just one system call more when an executable is launched), and small on other systems (the wrapper program just sets an environment variable and execs the real program). Optional Features ================= Some packages pay attention to `--enable-FEATURE' options to `configure', where FEATURE indicates an optional part of the package. They may also pay attention to `--with-PACKAGE' options, where PACKAGE is something like `gnu-as' or `x' (for the X Window System). The `README' should mention any `--enable-' and `--with-' options that the package recognizes. For packages that use the X Window System, `configure' can usually find the X include and library files automatically, but if it doesn't, you can use the `configure' options `--x-includes=DIR' and `--x-libraries=DIR' to specify their locations. For packages that use the GNU libiconv library, you can use the `configure' option `--with-libiconv-prefix' to specify the prefix you used while installing GNU libiconv. This option is not necessary if that other prefix is the same as the one now specified through --prefix. For packages that use the GNU libintl library, you can use the `configure' option `--with-libintl-prefix' to specify the prefix you used while installing GNU gettext-runtime. This option is not necessary if that other prefix is the same as the one now specified through --prefix. Particular Systems ================== On HP-UX, the default C compiler is not ANSI C compatible. If GNU CC is not installed, it is recommended to use the following options in order to use an ANSI C compiler: env CC="cc -Ae" ./configure On AIX 3, the C include files by default don't define some necessary prototype declarations. If GNU CC is not installed, it is recommended to use the following options: env CC="xlc -D_ALL_SOURCE" ./configure On BeOS, user installed software goes in /boot/home/config, not /usr/local. It is recommended to use the following options: ./configure --prefix=/boot/home/config Specifying the System Type ========================== There may be some features `configure' can not figure out automatically, but needs to determine by the type of host the package will run on. Usually `configure' can figure that out, but if it prints a message saying it can not guess the host type, give it the `--host=TYPE' option. TYPE can either be a short name for the system type, such as `sun4', or a canonical name with three fields: CPU-COMPANY-SYSTEM See the file `config.sub' for the possible values of each field. If `config.sub' isn't included in this package, then this package doesn't need to know the host type. If you are building compiler tools for cross-compiling, you can also use the `--target=TYPE' option to select the type of system they will produce code for and the `--build=TYPE' option to select the type of system on which you are compiling the package. Sharing Defaults ================ If you want to set default values for `configure' scripts to share, you can create a site shell script called `config.site' that gives default values for variables like `CC', `cache_file', and `prefix'. `configure' looks for `PREFIX/share/config.site' if it exists, then `PREFIX/etc/config.site' if it exists. Or, you can set the `CONFIG_SITE' environment variable to the location of the site script. A warning: not all `configure' scripts look for a site script. Operation Controls ================== `configure' recognizes the following options to control how it operates. `--cache-file=FILE' Use and save the results of the tests in FILE instead of `./config.cache'. Set FILE to `/dev/null' to disable caching, for debugging `configure'. `--help' Print a summary of the options to `configure', and exit. `--quiet' `--silent' `-q' Do not print messages saying which checks are being made. To suppress all normal output, redirect it to `/dev/null' (any error messages will still be shown). `--srcdir=DIR' Look for the package's source code in directory DIR. Usually `configure' can determine that directory automatically. `--version' Print the version of Autoconf used to generate the `configure' script, and exit. `configure' also accepts some other, not widely useful, options.
<urn:uuid:3b774153-bedd-42b9-b8a9-7facdea79928>
3.046875
2,373
Documentation
Software Dev.
43.228028
Control structures are probably the most useful (and important) part of PL/pgSQL. With PL/pgSQL's control structures, you can manipulate PostgreSQL data in a very flexible and powerful way. RETURN with an expression is used to return from a PL/pgSQL function that does not return a set. The function terminates and the value of expression is returned to the caller. To return a composite (row) value, you must write a record or row variable as the expression. When returning a scalar type, any expression can be used. The expression's result will be automatically cast into the function's return type as described for assignments. (If you have declared the function to return void, then the expression can be omitted, and will be ignored in any case.) The return value of a function cannot be left undefined. If control reaches the end of the top-level block of the function without hitting a RETURN statement, a run-time error will occur. When a PL/pgSQL function is declared to return SETOF sometype, the procedure to follow is slightly different. In that case, the individual items to return are specified in RETURN NEXT commands, and then a final RETURN command with no arguments is used to indicate that the function has finished executing. RETURN NEXT can be used with both scalar and composite data types; in the later case, an entire "table" of results will be returned. Functions that use RETURN NEXT should be called in the following fashion: SELECT * FROM some_func(); That is, the function is used as a table source in a FROM clause. RETURN NEXT expression; RETURN NEXT does not actually return from the function; it simply saves away the value of the expression (or record or row variable, as appropriate for the data type being returned). Execution then continues with the next statement in the PL/pgSQL function. As successive RETURN NEXT commands are executed, the result set is built up. A final RETURN, which need have no argument, causes control to exit the function. Note: The current implementation of RETURN NEXT for PL/pgSQL stores the entire result set before returning from the function, as discussed above. That means that if a PL/pgSQL function produces a very large result set, performance may be poor: data will be written to disk to avoid memory exhaustion, but the function itself will not return until the entire result set has been generated. A future version of PL/pgSQL may allow users to allow users to define set-returning functions that do not have this limitation. Currently, the point at which data begins being written to disk is controlled by the SORT_MEMconfiguration variable. Administrators who have sufficient memory to store larger result sets in memory should consider increasing this parameter. IF statements let you execute commands based on certain conditions. PL/pgSQL has four forms of IF: IF ... THEN IF ... THEN ... ELSE IF ... THEN ... ELSE IF and IF ... THEN ... ELSIF ... THEN ... ELSE IF boolean-expression THEN statements END IF; IF-THEN statements are the simplest form of IF. The statements between THEN and END IF will be executed if the condition is true. Otherwise, they are skipped. IF v_user_id <> 0 THEN UPDATE users SET email = v_email WHERE user_id = v_user_id; END IF; IF boolean-expression THEN statements ELSE statements END IF; IF-THEN-ELSE statements add to IF-THEN by letting you specify an alternative set of statements that should be executed if the condition evaluates to FALSE. IF parentid IS NULL or parentid = '''' THEN return fullname; ELSE return hp_true_filename(parentid) || ''/'' || fullname; END IF; IF v_count > 0 THEN INSERT INTO users_count(count) VALUES(v_count); return ''t''; ELSE return ''f''; END IF; IF statements can be nested, as in the following example: IF demo_row.sex = ''m'' THEN pretty_sex := ''man''; ELSE IF demo_row.sex = ''f'' THEN pretty_sex := ''woman''; END IF; END IF; When you use this form, you are actually nesting an IF statement inside the ELSE part of an outer IF statement. Thus you need one END IF statement for each nested IF and one for the parent IF-ELSE. This is workable but grows tedious when there are many alternatives to be checked. IF boolean-expression THEN statements [ ELSIF boolean-expression THEN statements [ ELSIF boolean-expression THEN statements ...]] [ ELSE statements ] END IF; IF-THEN-ELSIF-ELSE provides a more convenient method of checking many alternatives in one statement. Formally it is equivalent to nested IF-THEN-ELSE-IF-THEN commands, but only one END IF is needed. Here is an example: IF number = 0 THEN result := ''zero''; ELSIF number > 0 THEN result := ''positive''; ELSIF number < 0 THEN result := ''negative''; ELSE -- hmm, the only other possibility is that number IS NULL result := ''NULL''; END IF; The final ELSE section is optional. With the LOOP, EXIT, WHILE and FOR statements, you can arrange for your PL/pgSQL function to repeat a series of commands. [<<label>>] LOOP statements END LOOP; LOOP defines an unconditional loop that is repeated indefinitely until terminated by an EXIT or RETURN statement. The optional label can be used by EXIT statements in nested loops to specify which level of nesting should be terminated. EXIT [ label ] [ WHEN expression ]; If no label is given, the innermost loop is terminated and the statement following END LOOP is executed next. If label is given, it must be the label of the current or some outer level of nested loop or block. Then the named loop or block is terminated and control continues with the statement after the loop's/block's corresponding END. If WHEN is present, loop exit occurs only if the specified condition is true, otherwise control passes to the statement after EXIT. LOOP -- some computations IF count > 0 THEN EXIT; -- exit loop END IF; END LOOP; LOOP -- some computations EXIT WHEN count > 0; END LOOP; BEGIN -- some computations IF stocks > 100000 THEN EXIT; -- illegal. Can't use EXIT outside of a LOOP END IF; END; [<<label>>] WHILE expression LOOP statements END LOOP; The WHILE statement repeats a sequence of statements so long as the condition expression evaluates to true. The condition is checked just before each entry to the loop body. WHILE amount_owed > 0 AND gift_certificate_balance > 0 LOOP -- some computations here END LOOP; WHILE NOT boolean_expression LOOP -- some computations here END LOOP; [<<label>>] FOR name IN [ REVERSE ] expression .. expression LOOP statements END LOOP; This form of FOR creates a loop that iterates over a range of integer values. The variable name is automatically defined as type integer and exists only inside the loop. The two expressions giving the lower and upper bound of the range are evaluated once when entering the loop. The iteration step is normally 1, but is -1 when REVERSE is specified. Some examples of integer FOR loops: FOR i IN 1..10 LOOP -- some expressions here RAISE NOTICE ''i is %'',i; END LOOP; FOR i IN REVERSE 10..1 LOOP -- some expressions here END LOOP; Using a different type of FOR loop, you can iterate through the results of a query and manipulate that data accordingly. The syntax is: [<<label>>] FOR record | row IN select_query LOOP statements END LOOP; The record or row variable is successively assigned all the rows resulting from the SELECT query and the loop body is executed for each row. Here is an example: CREATE FUNCTION cs_refresh_mviews () RETURNS INTEGER AS ' DECLARE mviews RECORD; BEGIN PERFORM cs_log(''Refreshing materialized views...''); FOR mviews IN SELECT * FROM cs_materialized_views ORDER BY sort_key LOOP -- Now "mviews" has one record from cs_materialized_views PERFORM cs_log(''Refreshing materialized view '' || quote_ident(mviews.mv_name) || ''...''); EXECUTE ''TRUNCATE TABLE '' || quote_ident(mviews.mv_name); EXECUTE ''INSERT INTO '' || quote_ident(mviews.mv_name) || '' '' || mviews.mv_query; END LOOP; PERFORM cs_log(''Done refreshing materialized views.''); RETURN 1; end; ' LANGUAGE 'plpgsql'; If the loop is terminated by an EXIT statement, the last assigned row value is still accessible after the loop. The FOR-IN-EXECUTE statement is another way to iterate over records: [<<label>>] FOR record | row IN EXECUTE text_expression LOOP statements END LOOP; This is like the previous form, except that the source SELECT statement is specified as a string expression, which is evaluated and re-planned on each entry to the FOR loop. This allows the programmer to choose the speed of a pre-planned query or the flexibility of a dynamic query, just as with a plain EXECUTE statement. Note: The PL/pgSQL parser presently distinguishes the two kinds of FOR loops (integer or record-returning) by checking whether the target variable mentioned just after FOR has been declared as a record/row variable. If not, it's presumed to be an integer FOR loop. This can cause rather nonintuitive error messages when the true problem is, say, that one has misspelled the FOR variable name. You can also use var_name := function_name(); instead of the SELECT INTO ... beast. The return NEXT function is positional, i.e. you have to order the columns in the order they are defined in the return row type - regardless of whether you are assigning column names or not. create type row_return as (col_a int, col_b text); -- ** This will work for r in select integer_col, text_col from data_tbl return next r; -- ** This will not for r in select text_col, integer_col from data_tbl return next r;
<urn:uuid:79478ccb-3f01-48b2-97ab-a010a02701e6>
2.875
2,279
Documentation
Software Dev.
50.591143
Research on groundwater fauna is timely, as many groundwater pumps are falling out of use. Their removal and the destruction of old wells leads to a loss of valuable sample sites. Just like any lake, stream or river also the water beneath our feet is teeming with life. It may be hard to believe, but in the giant maze of wet interconnected spaces within soils and rocks highly specialised animals scrape a living in eternal darkness. These mostly tiny animals have to overcome huge challenges, because food is scarce and finding partners is difficult. And yet they have been around for a very long time in our planet’s history. Some species represent orders of animals whose “relatives” in surface waters have already become extinct. These animals are often called “living fossils”, because their body plan is so incredibly ancient. Some species of groundwater animals are unique to Ireland. Such species are called endemic. They have diverged genetically from “relatives” in mainland Europe millions of years ago due to geographic separation. So they may indeed represent the oldest indigenous inhabitants of Ireland. In general however, our knowledge of groundwater animals still is very limited. Just like the deep sea, the elusive groundwater is therefore one of the last largely uncharted waters in ecology research. We do not even know yet, how many groundwater species there are in Ireland and where they live. We would also like to know of course, how these animals live and whether they are doing anything that is useful for us, e.g. by helping to keep the groundwater clean. Some of these questions have been addressed in a recent EPA Ireland (Environmental Protection Agency) STRIVE research project.
<urn:uuid:1652c984-378a-40cd-a0bb-fa1fb010040a>
3.703125
341
Knowledge Article
Science & Tech.
36.370263
Aug 27, 2009 | 28 Here's a seemingly simple solar power fact*: the sun bathes Earth with enough energy in one hour (4.3 x 1020 joules) to more than fill all of humanity's present energy use in a year (4.1 x 1020 joules). So how to convert it? In the world of solar energy harvesting, there's a constant battle between cost and efficiency. On the one hand, complex and expensive triple-junction photovoltaic cells can turn more than 40 percent of the (specially concentrated) sunlight that falls on them into electricity. On the other, cheap, plastic solar cells under development convert less than 5 percent. In between, ubiquitous photovoltaics—the multicrystalline silicon solar panels cropping up on rooftops across the country and, indeed, the world—struggle to balance the need for (relatively) easy manufacturing and low cost with technology to get the most electrons for your solar buck. Aug 24, 2009 | 3 Chevron will tap sunlight to help it get more oil out of the ground in California. The company will partner with BrightSource Energy—a solar start-up that Chevron helps fund—to develop 29 megawatts of thermal power from the sun's rays. The idea is simple (and ancient): use mirrors to concentrate the sun's rays onto a water tank, turning said water to steam. The steam can then be used to turn a turbine and produce electricity or, in this case, pumped down a well to loosen heavy oils. The plant slated for the Coalinga Oil Field near Fresno will employ at least 3,000 mirrors to concentrate light on a more than 300-foot tower with water inside. Chevron hopes it will be fully operational by the end of next year. "The only problem we have is when it's cloudy," said Sergio Hoyos, a business developer at Chevron Technology Ventures, at the city council meeting last week where the plan was unveiled, according to Reuters. May 15, 2009 | 44 If solar power is ever going to take off—and the world needs it to—photovoltaic cells will have to become a whole lot cheaper to produce. Making solar cells from silicon, the most common approach, can be expensive and relatively inefficient at turning sunlight into electricity. As semiconductor manufacturer Applied Materials chief technology officer Mark Pinto told me last year: "With solar, it's all about cost." But there are signs of improvement, writes Richard Swanson of SunPower Corp. in this week's Science. Last year, manufacturers made 5 gigawatts of photovoltaic panels. And some of these panels required just under six grams of silicon per watt of power—down from 15 grams at the turn of the century. And that watt of power now costs around $1.40 to produce compared with $2 or more in the 1990s. May 13, 2009 | 5 Duke Energy wants to put a power plant on your house. Over the next year, the utility plans to spend $50 million to plop a variety of photovoltaic panels on commercial buildings, the roofs of private homes, and other property in North Carolina. Once installed, the 10 megawatts worth of solar panels are expected to produce enough alternating-current electricity to power 1,300 homes. But the utility’s main goals for the demonstration project are to gain experience with distributed generation—putting the power plant closer to the customer—and with integrating intermittent, renewable resources like sunshine into the grid. Feb 4, 2009 | 3 It was a banner year for wind-energy in 2008, with the U.S. installing enough wind turbines to power two million homes and surpassing Germany to become the country with the most capability of generating power from wind. But can the U.S. remain in the lead in the midst of the recession? A report released Monday by two wind-power advocacy organizations—the Brussels-based Global Wind Energy Council (GWEC) and Washington, D.C.'s American Wind Energy Association (AWEA)—showed that the U.S. doubled its capacity to create wind power last year. Meanwhile, a clean-energy analyst at investment bank Jeffries & Co., Michael McNamara, told Reuters that the U.S. will become the world's top solar producer this year. (Update [Feb. 6]: McNamara tells us today that the statement attributed to him wasn't quite right. "The U.S. will likely be the biggest producer of solar power in the future," he said.) More than 1,000 megawatts in solar power capacity were installed in the U.S. last year, says Monique Hanis, a spokesperson for the Solar Energy Industries Association (SEIA). Jan 5, 2009 | 9 Toyota won't just be adding solar panels to its popular Prius gas-electric hybrid car—like the solar electric conversion kit seen at left—it'll be powering a version of it exclusively via sunshine, according to The Nikkei, Japan's business newspaper. In fact, Toyota will be relying on the solar-electric car to "turn around its struggling business," which resulted in its first operating loss in more than 70 years, the Associated Press reports. ScientificAmerican.com and other media outlets reported last summer that Toyota was planning to begin selling a Prius with some solar panels as early as May of this year. But the latest reports are that the Japanese automaker is seeking to build a totally solar-driven vehicle. Nov 24, 2008 | 1 Maybe they're trying to bring the dead back to life. A Spanish town alarmed about climate change has installed solar panels on its mausoleums, turning "a place of perpetual rest into one buzzing with renewable energy," the Associated Press reports with mirth. The 462 panels are mounted on graves in the blue-collar town of Santa Coloma de Gramenet outside of Barcelona. The panels started absorbing energy from the sun to power the local grid last Wednesday, three years after the project began, according to the AP. Nov 11, 2008 | 2 So long, Mars Lander. The NASA robot’s $475-million mission is over, after increasingly cold weather and diminishing sun on Mars got the better of the lander, which relied on sunlight to recharge its solar battery, scientists said yesterday. It hasn’t contacted Earth since November 2. "We are actually ceasing operations, declaring an end to operations at this point," Barry Goldstein, Phoenix mission project manager at NASA's Jet Propulsion Laboratory in California, told reporters yesterday. "We'll constantly turn on the radio and try to hail Phoenix and see if it's alive, but at this point nobody on the team has any expectations of that happening." Aug 15, 2008 | 4 The amount of solar photovoltaics harnessing electricity from sunshine in the U.S. will more than double by 2013, thanks to plans to build 800 megawatts (MW) worth in California. The two vast solar farms—covering more than 12 square miles—will be among the largest ever built in the world and dwarf the current U.S. record holder: Nellis Air Force Base in Nevada with 14 MW. In fact, the total amount of solar photovoltaics connected to the grid in the entire U.S. is just 473 MW at present. "These landmark agreements signal the arrival of utility-scale PV solar power that may be cost-competitive with solar thermal and wind energy," said Jack Keenan, chief operating officer and senior vice president for utility PG&E, which made the deal, in an announcement yesterday. Deadline: Aug 31 2013 Reward: $100,000 USD The Geoffrey Beene Foundation Alzheimer’s Initiative (GBFAI) is launching the 2013 Geoffrey Beene Global NeuroDiscovery Challenge whose Deadline: Jul 25 2013 This challenge provides an opportunity for Solvers to build a web-based or mobile “app” to explore data relationships in scholarly conte Save 66% off the cover price and get a free gift! Learn More >>X
<urn:uuid:a81f4750-11b7-4235-b8bc-0d770ce211f0>
3.546875
1,687
Content Listing
Science & Tech.
55.213278
Table of Contents pthread_sigmask, pthread_kill, sigwait - handling of signals in threads int pthread_sigmask(int how, const sigset_t *newmask, sigset_t *oldmask); int pthread_kill(pthread_t thread, int signo); int sigwait(const sigset_t *set, int *sig); pthread_sigmask changes the signal mask for the calling thread as described by the how and newmask arguments. If oldmask is not NULL, the previous signal mask is stored in the location pointed to by oldmask. Pthreads-w32 implements this function but no other function uses the signal mask yet. The meaning of the how and newmask arguments is the same as for sigprocmask(2). If how is SIG_SETMASK, the signal mask is set to newmask. If how is SIG_BLOCK, the signals specified to newmask are added to the current signal mask. If how is SIG_UNBLOCK, the signals specified to newmask are removed from the current signal mask. Recall that signal masks are set on a per-thread basis, but signal actions and signal handlers, as set with sigaction(2), are shared between all threads. pthread_kill send signal number signo to the thread thread. Pthreads-w32 only supports signal number 0, which does not send any signal but causes pthread_kill to return an error if thread is not valid. sigwait suspends the calling thread until one of the signals in set is delivered to the calling thread. It then stores the number of the signal received in the location pointed to by sig and returns. The signals in set must be blocked and not ignored on entrance to sigwait. If the delivered signal has a signal handler function attached, that function is not called. Pthreads-w32 implements this function as a cancellation point only - it does not wait for any signals and does not change the location pointed to by sig. sigwait is a cancellation point. On success, 0 is returned. On failure, a non-zero error code is returned. The pthread_sigmask function returns the following error codes on error: The pthread_kill function returns the following error codes on error: The sigwait function never returns an error. Xavier Leroy <Xavier.Leroy@inria.fr> Modified by Ross Johnson for use with Pthreads-w32. In any implementation, for sigwait to work reliably, the signals being waited for must be blocked in all threads, not only in the calling thread, since otherwise the POSIX semantics for signal delivery do not guarantee that it’s the thread doing the sigwait that will receive the signal. The best way to achieve this is to block those signals before any threads are created, and never unblock them in the program other than by calling sigwait. This works because all threads inherit their initial sigmask from their creating thread. Pthreads-w32 does not implement signals yet and so these routines have almost no use except to prevent the compiler or linker from complaining. pthread_kill is useful in determining if the thread is a valid thread, but since many threads implementations reuse thread IDs, the valid thread may no longer be the thread you think it is, and so this method of determining thread validity is not portable, and very risky. Pthreads-w32 from version 1.0.0 onwards implements pseudo-unique thread IDs, so applications that use this technique (but really shouldn't) have some protection. Table of Contents
<urn:uuid:b142c4bb-3212-4f37-82b1-42dd774a8723>
3.171875
772
Documentation
Software Dev.
57.641799
> The word believe is what bugs me!!! I read it in the website you mentioned > and now I read it in your own post. It bugs you for one simple reason. You want to equate the word with faith, as in "I believe in God." However, "believe" has several meanings, only one of which is religious faith. Here are the definitions from the American To accept as true or real. (Fox's protocells certainly are real.) To credit with veracity. (People who accept the evidence credit Fox's claim that protocells are alive with veracity.) To expect or suppose; think. (See the last definition.) To have firm faith, especially religious faith. (This is the only meaning that does not apply. As I said before and as you have yourself confirmed, you don't need faith when you have evidence.) To have faith, confidence, or trust. (Those who trust the evidence are confident that Fox was right.) To have confidence in the truth or value of something. (Again, those who accept the evidence are confident that the claim that Fox's protocells are alive is true.) To have an opinion; think. (Even people who have not seen the evidence can be of the opinion that Fox's protocells are alive without engaging religious The point is that when any scientist (even a physicist) says he believes in something, he is not expressing religious faith, but his confidence that the concept is real, is valid and is true based on the evidence. > In physics we use the word believe > extremely rarely. Perhaps in questions about origin of the universe, > planets, etc. But nowhere else in physics do we use the word believe. Of course they use it, and frequently, but they do not mean religious faith. You are simply playing word games, trying to justify your refusal to look at > is the experimental aspect of physics. We give experimental data that can > be reproduce by anyone and prove the claims being made. The evidence that protocells are alive is experimental data, has been reproduced by a great many people (including high school students) and proves the claims that Fox made for protocells. Stop hiding your head in the sand and read the evidence! Start with the Fox symposium on that webpage. Then read the references posted there. You'll find out all you need to know to convince yourself that Fox's protocells are alive. > The claim that life, > as an ordinary person understands it--as something that can die, for > instance---HAS BE REPRODUCED IN THE LAB FROM PURE CHEMICALS IS Fox uses a definition of life any ordinary person would agree with -- cellularity, metabolism, reproduction, and response to stimuli -- to prove that his protocells are alive. And they can be killed, just like any living thing. I have told you where you can find the evidence that provides that proof, and I will provide more. You, on the other hand, have never offered any biological or evidential support for your absolutist claim, and when I challenge you to do so you claim you are no expert and duck the question. Yet you imply you are expert enough to dogmatically assert that life has not been created in the lab. I told you before, you can't have it both ways. You say the claim that life has been created from pure chemicals is false; then you can provide evidence or a biological argument that supports your claim. You have also contradictory claimed that you don't know enough biology to be able to provide such evidence or such an argument; then you cannot assert that the claim is false. Which is it Moorad: do have actual evidence or do you only *believe* it? > Scientists of all disciples would have known about it. Including me! There are lots of concepts in biology that only biologists know about, but which have a profound impact on people's lives. For example, have you ever heard of apoptosis? It is the mechanism by which otherwise normal heathy cells simply up and die. The cells literally self-destruct; another way to put it is that they commit suicide. Apoptosis explains why plants and animals die. All normal cells only live for so long then self-destruct. Aging occurs because cells begin to self-destruct faster than they can be replaced; death occurs when too many cells self-destruct to maintain gross physiology. If we can figure out how apoptosis works, we could theoretically greatly extend human life. Cells would still die from necrosis (injury, disease, poisoning, starvation, etc.) and eventually their genetic systems would accumulate too many replication errors for them to maintain their metabolism, but cells that cannot apoptose could live at least ten times longer than a normal cell. Imagine living to be 700 instead of seventy, and being "old" only for perhaps the last few decades of that long life. I'm sure you've read about so-called aging or death genes, but I'ld bet you've never heard of apoptosis as the solution to that mystery, or how control of apoptosis could make us virtually immortal. That's because the biologists who believe they are on that very threshold are being very cautious about making public claims they cannot yet substantiate. Similarly, Fox and his colleagues were very cautious about making claims they could not substantiate, but now that they have the accumulated evidence to do so they are going public with their claims rather than making them only to each other or to limited audiences. (Actually this trend started more than a decade ago, but it is gaining momentum.) I cannot tell you why the popular press never ran with the story the way they do other discoveries, but the lack of such wide dissemination does not invalidate the scientific evidence. Besides, considering your claim that scientists should be persuaded by evidence only, your implication that the lack of popularization of this claim somehow invalidates the scientific evidence sounds contradictory, even Kevin L. O'Brien
<urn:uuid:162341a0-e0c8-4ba5-a526-28e32a3a7413>
2.796875
1,310
Comment Section
Science & Tech.
49.77928
Hot summer = global warming?by Opinion Staff When South Florida shivered through the winter and blizzards battered our friends up north, some folks declared the concept of global warming stone-cold dead. But one of the coldest winters on record has been followed by hot, hot weather in June, July and August. In fact, average temperatures for those summer months in West Palm Beach were the hottest on record at 84.6 degrees, which is 2.4 degrees above normal. The heat toyed with the area in other ways. Temperatures were above 90 on 79 days, and lows stayed above 80 degrees for 25 days, which is a record. Will all those critics of climate change warm to idea now that summer has been so hot? Of course not. They’re looking for excuses not to believe in global warming. And as a matter of fact, warm weather over any given three-month period could happen without global warming. Just as we could have three cold months even if global warming is happening. Long-term trends and an increase in violent weather are what scientists point to as proof of global warming. The record-high sea surface temperatures and the parade of storms coming across the Atlantic fit into that pattern. But what do you think? Is this summer’s record-breaking heat evidence that global warming is real? Take our poll.
<urn:uuid:dadbdc6c-0701-45a4-8753-849a67b7f711>
2.6875
280
Nonfiction Writing
Science & Tech.
67.582088
I'm writing a science-fiction novel in which, during a couple of chapters, the characters travel for a three-month journey in a starship transport that simulates gravity with centrifugal force. Check my math, please. I can't seem to find this information in NASA's design study on space colonies. If the ship is designed with the primary living quarters existing within a torus, rotating on a central hub, and that torus is 600 meters in diameter, how often would it need to rotate to simulate Earth gravity? I assumed (and I may be wrong) that the ring would have to travel at 9.8 meters per second to simulate 1g. Since the circumference would be approximately 1,880 meters, a full rotation would take 3.2 minutes. That would put it well under the minimum rotational frequency (NASA says 1 rpm is safe) to provide comfort for humans and avoid dizziness from the Coriolis effect in the human ears, right? Am I right? Also, what would be the line of sight range from within a corridor? At what distance would the curvature of the hallways become apparant?
<urn:uuid:9f8122ee-f3a1-45d4-9ed6-d6854280ef68>
3.140625
234
Comment Section
Science & Tech.
58.966272
KREEP, an acronym built from the letters K (the atomic symbol for potassium), REE (Rare Earth Elements) and P (for phosphorus), is a geochemical component of some lunar impact breccia and basaltic rocks. Its most significant feature is somewhat enhanced concentration of a majority of so-called "incompatible" elements (those that are concentrated in the liquid phase during magma crystallization) and the heat-producing elements, namely radioactive uranium, thorium, and potassium (due to presence of the radioactive 40K). Typical composition The typical composition of KREEP includes about one percent, by mass, of potassium and phosphorus oxides, 20 to 25 parts per million of rubidium, and a concentration of the element lanthanum that is 300 to 350 times the concentrations found in carbonaceous chondrites. Possible origin Indirectly, it has been deduced that the origin of KREEP is contained in the origin of the Moon. This is now commonly thought to be the result of a rocky object the size of Mars that struck the Earth about 4.5 billion (4.5×109) years ago. This collision threw a large amount of broken rock into orbit around the Earth. This ultimately gathered together to form the Moon. Given the large amount of power that was generated by this collision, it has been deduced that a large portion of the Moon would have been liquified, and this formed a lunar magma ocean. As the crystallization of this liquid rock proceeded, minerals such as olivine and pyroxene precipitated and sank to the bottom to form the lunar mantle. After the solidification was about 75 percent complete, the material anorthositic plagioclase began to crystallize, and because of its low density, it floated, forming a solid crust. Hence, elements that are usually incompatible (i.e., those that usually partition in the liquid phase) would have been progressively concentrated into the magma. Thus a "KREEP"-rich magma was formed that was sandwiched at first between the crust and mantle. The evidence for these processes comes from the highly anorthositic composition of the crust of the lunar highlands, as well as the presence of the rocks rich in KREEP. Lunar Prospector measurements Before the mission of Lunar Prospector lunar satellite, it was commonly thought that these KREEP materials had been formed in a widespread layer beneath the crust. However, the measurements from the gamma ray spectrometer on board this satellite showed that the KREEP-containing rocks are primarily concentrated underneath the Oceanus Procellarum and the Mare Imbrium. This is a unique lunar geological province that is now known as the Procellarum KREEP Terrane. Basins far from this province that dug deeply into the crust (and possibly the mantle), such as the Mare Crisium, the Mare Orientale, and the South Pole–Aitken basin show only little or no enhancements of KREEP within their rims or ejecta. The enhancement of heat-producing radioactive elements within the crust (and/or the mantle) of the Procellarum KREEP Terrane is almost certainly responsible for the longevity and intensity of mare volcanism on the nearside of the Moon. See also |Look up KREEP in Wiktionary, the free dictionary.| - G. Jeffrey Taylor (August 31, 2000). "A New Moon for the Twenty-First Century". Planetary Science Research Discoveries. Retrieved August 11, 2009. - Charles Shearer and 15 coauthors, C. K. (2006). "Thermal and magmatic evolution of the Moon". Reviews in Mineralogy and Geochemistry (Mineralogical Society of America) 60 (1): 365–518. doi:10.2138/rmg.2006.60.4. Retrieved August 11, 2009. More than one of - C. R. Neal, and L. A. Taylor, "K-Frac + REEP-Frac": A New Understanding of KREEP in Terms of Granite and Phosphate Petrogenesis, Abstracts of the Lunar and Planetary Science Conference, volume 19, page 831 (1988) - Belbruno, E.; Gott III, J. Richard (2005). "Where Did The Moon Come From?". The Astronomical Journal 129 (3): 1724–1745. arXiv:astro-ph/0405372. Bibcode:2005AJ....129.1724B. doi:10.1086/427539. - G. Jeffrey Taylor (November 22, 2005). "Gamma Rays, Meteorites, Lunar Samples, and the Composition of the Moon". Planetary Science Research Discoveries. Retrieved August 11, 2009. - Mark Wieczorek and 15 coauthors, M. A. (2006). "The constitution and structure of the lunar interior". Reviews in Mineralogy and Geochemistry (Mineralogical Society of America) 60 (1): 221–364. doi:10.2138/rmg.2006.60.3. Retrieved August 11, 2009. More than one of - Jolliff, Bradley; Gillis, Jeffrey; Haskin, Larry; Korotev, Randy; Wieczorek, Mark (2000). "Major lunar crustal terranes: Surface expressions and crust-mantle origins". Journal of Geophysical Research: 4197–4216. Bibcode:2000JGR...105.4197J. doi:10.1029/1999JE001103. Retrieved August 11, 2009. - Moon articles in Planetary Science Research Discoveries, including articles about KREEP
<urn:uuid:f1656304-3ddc-45bb-9b28-029cfb375d3e>
4.03125
1,197
Knowledge Article
Science & Tech.
54.994586
[erlang-questions] correct terminology for referring to strings Thu Aug 2 05:18:47 CEST 2012 > There is no byte sequence valid in UTF-8 that is not also > valid in Latin-1. This is incorrect. Latin-1 code points are a subset of Unicode codepoints. Codepoints are not bytes. Codepoints are indexes in character tables. latin-1 is a table of a possible 256 characters where as Unicode is at this point a table of more that 100,000 characters. There are actually codepoints in the range of 127-159 which are unused and if used are technically invalid Latin-1 and Unicode. When it comes to the binary representation of these codepoints. Latin-1 is encoded as literal bytes because all codepoints are less than 256. Unicode codepoints on the other hand can be larger than 255 so in order to represent them as bytes they need to be encoded. Latin-1 bytes larger than 126 are not the same character in UTF-8 because UTF-8 uses the 8th bit for encoding multi byte sequences to represent Unicode codepoints which are larger than 126. So while values in a list greater than 126 are valid Latin-1, if those values represent UTF-8 bytes, the characters are not the same. For instance, 233 is the codepoint for an accented e in Latin-1 and Unicode, the binary representation of that character in Latin-1 is literally the byte <<233>> but when the codepoint is encoded as UTF-8, it is the bytes <<195,169>>. The list [195,169] is never going to be an accented e in Erlang because as far as Erlang is concerned, that is a list of Latin-1 codepoints which are the characters à and ©. Ever see Café on a webpage? That is because they told the browser that their HTML was latin-1 when it was actually UTF-8. It just so happens that [195,169] is also of type chardata() because all valid latin-1 codepoints are also valid Unicode codepoints. In either case, [195,169] is not an accented e. At the very least it is a list of integers whose values represent UTF-8 encoded bytes but until you convert those UTF-8 bytes to Unicode codepoints it'll never be chardata() with the To summarize: Unicode is a table of codepoints. A codepoint is an index in the table. UTF-8 is a codec for turning codepoints to and from bytes. UTF-8 cannot be used to refer to what Erlang calls chardata(). chardata() is a list of integer() whose value is a valid Unicode codepoint. UTF-8 can only refer to a sequence of bytes. -------------- next part -------------- An HTML attachment was scrubbed... More information about the erlang-questions
<urn:uuid:8101be32-8d39-406b-850b-d5db328d2680>
3.234375
675
Comment Section
Software Dev.
60.127374
An Infrared and Sub-millimetre Observatory The Herschel telescope is a scientific space mission developed by the European Space Agency (ESA) dedicated to observing the Universe in the infrared and sub-millimetre ranges (wavelengths between 60 et 670 µm), a window of the electromagnetic spectrum that is still largely unexplored. It measures 9 m in length, 4 m in diameter and will weigh over 3 metric tons upon launch. Herschel arrived at ESA in January 2008 and will be launched by an Ariane 5 rocket from Kourou on 31th, October 2008. It will then be, with its 3.5 m-diameter mirror, the largest telescope ever sent into space. The main objectives of the mission are based on two approaches related to the question of Origins. Close to Earth, Herschel will probe the molecular clouds, which are true breeding grounds for young stars, with a view to understand the first stages in star formation. Further away, it will map out the heavens to discern galaxies at the time they were formed and thus enrich our attempts to explain the evolution of the Universe, from the Big Bang to the present. To achieve these objectives, the Herschel telescope’s focal plane houses three instruments that work in complement with one another: HIFI, a very high-resolution spectrometer and two cameras, SPIRE and PACS. Observation of this range of wavelengths requires instruments to be cooled to extreme temperatures, close to absolute zero. The PACS camera has two detector arrays, red and blue, and consists of matrices of bolometers cooled to a temperature of 300 millikelvins. The development of this camera is a major achievement of modern technology. The Herschel mission has been developed through a mostly European collaboration, with significant US contribution. CEA is deeply involved in the development of instrumentation for Herschel. The LETI (Laboratory of Electronics and Information Technology in Grenoble) is developing and manufacturing the detectors for the PACS camera while the SBT (Low Temperature Department in Grenoble) is equipping SPIRE and PACS instruments with cryo-refrigerators designed to cool the detectors to a temperature of 300 millikelvins. DAPNIA is responsible for the construction of the PACS camera and its associated electronics, together with much of the electronics for the SPIRE camera. Teams of scientists from DAPNIA’s Astrophysics Department are actively involved in scientific and technical preparation of the SPIRE and PACS instruments. last update : 10-25 00:00:00-2007 (2267) Innovation for detection systems Development of detectors Structure formation in the Universe Cosmology and structure formation in the Universe Structure formation in the Universe Galaxy formation and evolution
<urn:uuid:9197352a-1b9c-4679-9ad9-64d37b0dbc92>
3.359375
565
Knowledge Article
Science & Tech.
25.550392
European Red List of Butterflies 28 May 2010 | Downloads - publication The European Red List of Butterflies The European Red List is a review of the conservation status of c.6,000 European species (mammals, reptiles, amphibians, freshwater fishes, butterflies, dragonflies, and selected groups of beetles, molluscs, and vascular plants) according to IUCN regional Red Listing guidelines. It identifies those species that are threatened with extinction at the regional level – in order that appropriate conservation action can be taken to improve their status. This Red List publication summarises results for European Butterflies.
<urn:uuid:5cc20f70-74fd-4ad3-9631-4a3e29992d08>
3.328125
126
Knowledge Article
Science & Tech.
25.699794
Consider the following snippet of code: upto :: Int -> Int -> [Int] upto from to = if from > to else from : upto (from+1) to Here's what the compiled function would look like: -- Arguments and results are (usually) kept in registers. -- We generate a new calling convention for each function. upto from to = case from `gtInt` to of 1 -> do -- Return a single tag representing ''. 0 -> do -- Allocate 5 heap cells. heap <- allocate 5 -- CInt is the constructor for Int. heap := CInt heap := from -- Fupto represents a suspended call to 'upto'. heap := Fupto heap := from+1 heap := to -- Return a node as three separate pieces. -- &heap is the head of the list and &heap is the tail. return [CCons, &heap, &heap] As we can see, calling this function will only give us a single node (the node in this case is either a CNil or a CCons with two arguments). We will have to call it again to get more information out of it. For example, fully computing 'upto 1 10' requires 11 calls to 'upto' (10 CCons nodes and 1 CNil). Looking at the steps in 'upto' shows us that it isn't doing a whole lot. All variables (even arguments and results) are in registers and the data can easily fit in the cache. We could almost say that calling this function is as fast as looping in C. Let's add a bit more code and see what happens: main = showMyList (upto 1 10) showMyList = return () = do print x The same code, now compiled to our intermediate language: main = do heap <- allocate 3 heap := Fupto heap := 1 heap := 10 = do -- Read the arguments to 'upto' from the 'lst' pointer. Fupto from to <- fetch lst -- Call 'upto'. The results are kept in registers. -- 'a' and 'b' are undefined if 't' is CNil. [t, a, b] <- upto from to -- Inspect the node tag. case t of CNil -> return [CUnit] CCons -> do -- Call print on 'a'. This call might invoke the garbage collector. -- Recurse on the tail. This looks rather well. We could be proud if this was the end. However, there is one thing that we haven't considered: garbage collection. The garbage collector may run when we call 'print' and if it does then the pointer we have in 'b' will no longer be valid. A common solution is to push 'b' to a stack (which the GC can walk and modify) and reload it after 'print' has returned. However, a stack allocation cost about as much as the call to 'upto' and hence incurs an overhead of nearly 50%. Fortunately there's a way around this. We can "simply" have the garbage collector update all registers that contain heap pointers. Doing so isn't exactly easy but it does allow us to keep pointers in registers and to avoid all unnecessary stack allocations. The details of how to accomplish this will have to wait for another time.
<urn:uuid:18ab7613-f10f-417e-aa22-366e52926c27>
3.5
742
Documentation
Software Dev.
71.390676
The Java Persistence API (JPA) is a specification from Sun Microsystems for the persistence of Java objects to any relational datastore. JPA requires J2SE 1.5 (also referred to as "Java 5") or higher, as it makes heavy use of new Java language features such as annotations and generics. This document provides an overview of JPA. Unless otherwise noted, the information presented applies to all JPA implementations. For coverage of OpenJPA's many extensions to the JPA specification, see the Reference Guide. This document is intended for developers who want to learn about JPA in order to use it in their applications. It assumes that you have a strong knowledge of object-oriented concepts and Java, including Java 5 annotations and generics. It also assumes some experience with relational databases and the Structured Query Language (SQL).
<urn:uuid:077b16e6-15d9-48fc-999a-9ef1adb87887>
2.734375
176
Documentation
Software Dev.
29.761928
|Papers and Studies logo 130|| This paper offers a preliminary and exploratory assessment of the potential benefits and costs of climate engineering (CE). We examine two families of CE technologies, solar radiation management (SRM) and air capture (AC), under three emissions control environments: no controls, optimal abatement, and limiting temperature change to 2°C. Our analysis suggests that, today, SRM offers larger net benefits than AC, but that both deserve to be investigated further. In the case of SRM, we investigate three specific technologies: the injection of aerosols into the stratosphere, the increase of marine cloud albedo, and the deployment of a space-based sunshade. We estimate direct benefit-cost (B/C) ratios of around 25 to 1 for aerosols and around 5000 to 1 for cloud albedo enhancement. Technological progress might significantly lower direct cost estimates of stratospheric aerosols and thus raise the expected benefits. Yet, large uncertainties remain about the science and engineering of SRM. Only a substantial research program could resolve these uncertainties, but the very large potential net benefits of SRM offer strong prima facie evidence for including R&D on SRM as a part of any portfolio of climate policies during the next decade. Therefore, we suggest that the Copenhagen Consensus allocate an average of approximately 0.3% of its $250 billion climate-change budget ($750 million per year) to SRM and AC research over the next decade. SRM is the higher priority, owing to its larger and more current net benefit potential. This research program should explicitly focus on identifying possible side effects, especially those which might imply non-trivial costs. Lee Lane is a resident fellow at AEI and codirector of the AEI Geoengineering Project. J. Eric Bickel is an assistant professor in both the Operations Research/Industrial Engineering Group and the Department of Petroleum and Geosystems Engineering at the University of Texas at Austin.
<urn:uuid:612a54f7-8d9a-4470-990b-57d233c4fbff>
2.734375
409
Academic Writing
Science & Tech.
28.453769