input
stringlengths
172
751k
output
stringlengths
222
4.36k
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : visual outcomes are often improved after macular surgery , although complications still occur . among the most significant complications , intraoperative retinal breaks ( rbs ) and the reports available in the literature vary widely : the incidence of intraoperative rbs reported ranges from 0% to 24% , and that of postoperative rrd ranges from 0% to 16% . some investigators evaluate the incidence of exclusively intraoperative breaks located in the periphery , whereas others include only those caused by the induction of posterior vitreous detachment ( pvd ) , and still others only sclerotomy - related breaks . a further parameter that may affect the development of rb and rrd is the choice of instrumentation . both from comparative studies ( 20-gauge vs 23/25-gauge ) and from noncomparative studies , what seems to emerge is a lower number of intraoperative rbs in small - gauge pars plana vitrectomy ( ppv ) ( although this number is not always significant ) . however , the reduced incidence of rbs in small - gauge ppv is still associated with a relatively high incidence of postoperative rrd , which involves the macula in nearly 50% of cases . in the majority of cases , these were due to new rbs . prophylactic measures such as scleral buckling , peripheral cryopexy , or intraoperative laser retinopexy have all been tried , yielding favorable results . after performing intraoperative laser treatment , either for 360 or around the sclerotomy site , a significant reduction in postoperative rrd has been shown in laser - treated groups compared with nonlaser - treated groups . in the small gauge era , some surgeons perform intraoperative prophylactic laser retinopexy treatment around the sclerotomy site , showing a lower rate of postoperative rrd incidence compared with literature data ( 0% in the study by tarantola et al and 0.2% in the study by parolini et al , although in this latter study , ppv was performed for diverse indications ) . few complications are associated with the use of laser retinopexy , and no additional risk of epiretinal membrane ( erm ) formation or macular hole ( mh ) reopening has been found to occur . unfortunately , descriptions of the rrd characteristics , including its extension at presentation and the surgical technique adopted for repair , are lacking from the literature or are incomplete . at our institutions , it is a routine practice to treat patients undergoing macular surgery with preoperative prophylactic peripheral laser retinopexy ( pplr ) . since , to our knowledge , this laser timing has never been adopted before , we studied the incidence and the characteristics of intraoperative rbs and postoperative rrd in macular surgery on such patients . we reviewed the clinical records of patients who were treated with pplr and underwent ppv for erm or mh between january 2008 and march 2014 , at the ophthalmology section of the department of medicine , surgery and neuroscience , university of siena , siena , italy . the research adhered to the principles of the declaration of helsinki , and the institutional review board approved the study . patients were treated after being informed of the nature of the treatment being offered , of the potential risks , benefits , adverse effects , possible treatment outcomes , and after having signed a consent form . pplr was applied between 1.5 and 3 months before undergoing 20-gauge , 23-gauge , or 25-gauge vitrectomy . the exclusion criteria were as follows : prior ppv , diabetic retinopathy , ocular trauma , erm or mhs subjected to ppv without pplr before surgery . each patient underwent a complete preoperative evaluation , including the measurement of best corrected visual acuity ( bcva ) , anterior segment examination , dilated fundus examination using indirect ophthalmoscopy with scleral depression , and slit lamp biomicroscopic observation of the vitreous and the retina . the presence or absence of pvd was defined by biomicroscopic observation using a 90-diopter lens , b - scan ultrasound examination , and ocular coherence tomography ( oct ) examination . thorough retinal periphery examination was regularly performed at follow - up visits . for postoperative evaluation , we considered the bcva between 21 and 24 months after surgery . all patients included in the study underwent 360 pplr between 1.5 and 3 months before ppv . using the visulas 532s ( zeiss , germany ) laser , 3 rows of laser spots were applied anterior to the equator using either a 3-mirror lens or a 160 contact lens . the spot diameter ranged from 100 to 200 microns , the treatment duration from 200 to 300 milliseconds , and the intensity from 200 to 300 milliwatts . the average number of spots was 410 ( range 330490 ) . in cases of mh and erm where lattice degeneration or rb was diagnosed preoperatively , vitrectomy was performed by 2 authors ( gmt , pe ) assisted by a vitreoretinal fellow . each surgeon chose 20-g ppv , 23-g ppv , or 25-g ppv for each procedure . surgery was performed under either local or general anesthesia according to the patient 's general conditions and preference . three - port ppv was performed with one of 2 vitrectomy machines , both using only a venturi pump ( not a peristaltic one ) : either the millenium ( bausch and lomb , rochester , ny ) ( cutting rate : 2500 cpm ; vacuum : 250 mm hg [ 20-gauge ] , 350 mm hg [ 23-gauge ] , 450 mm hg [ 450 mm hg ] ) or stellaris pc ( bausch and lomb , rochester , ny ) ( cutting rate : 5000 cpm ; vacuum : 250 mm hg [ 20-gauge ] , 350 mm hg [ 23-gauge ] , 450 mm hg [ 450 mm hg ] ) vitrectomy instrument . the number of 20 , 23 , and 25-gauge cases was not significantly different between the 2 vitrectomy machines . a panoramic viewing system with wide - field contact lenses ( advanced vitreal instruments , ny ) or a noncontact wide - field viewing system ( resight , zeiss , germany ) was used . if there was no pvd , the induction of pvd was performed with the vitrectomy probe in the cutter - off mode , placed over the optic disc , elevating it anteriorly toward the anterior segment . erm and internal limiting membrane peeling were performed using triamcinolone , indocyanine green , or membrane blue ( dorc , zuidland , the netherlands ) . peripheral vitrectomy was completed at the end of the procedure by performing scleral depression for 360. any newly discovered breaks were treated intraoperatively by laser photocoagulation . in every patient , fluid / air exchange was performed : the air was substituted with gas ( c3f8 11% ) in mh cases and in the presence of any new intraoperative rb . in cases with coexisting cataract affecting visual acuity , phacoemulsification and intraocular lens implantation the medical records were reviewed and the following variables were collected : age at time of the procedure , sex , laterality , preoperative diagnosis , preoperative refraction , pre and postoperative visual acuity , lens status , the presence of lattice degeneration , prior retinal tears in the operative eye , ppv technique , preexisting or intraoperatively induced pvd , whether cataract surgery was undertaken at the time of vitrectomy , the presence / location of intraoperative rbs ( sclerotomy / nonsclerotomy - related ) , the type of tamponing agent used , and the presence / characteristics of postoperative rrd . preoperative refraction was not always available for pseudophakic eyes and was therefore not included in our analysis . for the purpose of the study , an intraoperative sclerotomy - related rb was defined as any break not present at preoperative examination , located anterior to the equator and within 1-clock - hour either side of the sclerotomy site . any new intraoperative break located in other sites was considered not to be sclerotomy - related . preoperative and intraoperative factors were analyzed for their possible association with the development / location of intraoperative rb and postoperative rrd . for this purpose , the preoperative notes were reviewed together with postoperative data on day 1 , day 7 , day 15 , month 1 , month 2 , month 3 , and month 6 . for eyes with longer follow - up periods , multivariate stepwise logistic regression analysis was carried out to identify , among all the risk factors ( independent variables ) , a statistically significant minimum subset of factors with the highest possible accuracy in predicting rrd , intraoperative rbs , and their sclerotomy or nonsclerotomy - related subtypes . logistic discrimination is generally preferable to linear discrimination in small samples , especially when data distributions are suspected of being non - gaussian . the statistical significance of the or was assessed by evaluating the 95% confidence interval ( ci ) of sample estimates . in case the type of ppv technique turned out to be a risk factor , we checked for any differences between the 20-gauge patient group and the small - gauge patient group . for this purpose , the quantitative variables were compared between groups using a 2-tailed mann the statistical association between each qualitative variable and the groups was evaluated using fisher exact test . multivariate stepwise logistic regression analysis was carried out to identify , among all the risk factors ( independent variables ) , a statistically significant minimum subset of factors with the highest possible accuracy in predicting rrd , intraoperative rbs , and their sclerotomy or nonsclerotomy - related subtypes . logistic discrimination is generally preferable to linear discrimination in small samples , especially when data distributions are suspected of being non - gaussian . the statistical significance of the or was assessed by evaluating the 95% confidence interval ( ci ) of sample estimates . in case the type of ppv technique turned out to be a risk factor , we checked for any differences between the 20-gauge patient group and the small - gauge patient group . for this purpose , the quantitative variables were compared between groups using a 2-tailed mann the statistical association between each qualitative variable and the groups was evaluated using fisher exact test . follow - up ranged from 21 to 84 months ( mean : 44.3 months ) . there were 112 males ( 44% ) and 142 females ( 56% ) , with a mean age of 67.60 6.8 years . axial length ranged between 21.37 and 25.48 mm ( mean : 23.13 mm ) . one hundred forty - four patients underwent vitrectomy for erm ( 56.6% ) and 110 patients underwent vitrectomy for mh ( 43.3% ) . in particular , for erm macular thickness ranged from 412 to 580 m ( mean : 481 55 m ) and for mh 42 eyes were stage 2 mh , 41 eyes were stage 3 mh , and 27 eyes were stage 4 mh . preoperatively , 199 patients were phakic ( 78.3% ) and 55 patients were pseudophakic ( 21.7% ) . 109 patients had 20-gauge ppv ( 42.9% ) and 145 patients had 23/25-gauge ppv ( 57.1% ) . pvd induction was performed intraoperatively in 94 patients ( 37% ) ; 140 had air tamponade ( 55.1% ) , whereas in 114 ( 44.9% ) , eyes gas tamponade was used . fourteen patients ( 5.5% ) experienced an intraoperative rb ; in this group , 10 patients presented a sclerotomy - related rb ( 3.9% ) and 4 patients a nonsclerotomy - related rb ( 1.6% ) . in 6 patients , intraoperative rbs occurred during erm surgery , whereas in 8 patients , it occurred during mh surgery . intraoperative rbs occurred in macular surgery with induced pvd in 5 patients , whereas in the other 9 patients , pvd was already present before surgery . two patients showed macula - on postoperative rrd ( 0.7% ) due to a nonsclerotomy - related rb . of these , 1 rrd occurred after erm surgery without pvd induction and air tamponade , whereas the other occurred after mh surgery with pvd induction and c3f8 11% tamponade . in both patients , no rb was present at the end of the macular surgery ( table 1 ) . clinical characteristics of patients at study entry in estimating the relative risk of retinal tear , the stepwise procedure for the logistic model design identified only the vitrectomy gauge as a predictive variable , whereas no other variables could be associated with rrd . in particular , a significantly increased risk for the intraoperative development of sclerotomy - related rb was found in 20-gauge ppv compared with 23/25-gauge ppv ( or 15.8 , 95% ci 2.01123.5 ) . both of the 2 postoperative rrds occurred in the 20-gauge ppv group ( 1.8 ) . no patient experienced postoperative rrd in the 23/25-gauge ppv group ( 0% ) ( p = ns ; table 2 ) . comparison of ocular and patient characteristics between 20-gauge and small - gauge pars plana vitrectomy groups the mean time to diagnosis of rrd in the 2 patients with this postoperative complication was 27.5 days ( range 2035 days ) . one patient underwent ppv for erm and the other for a mh . both of the patients presented with rrd anterior to the equator , not affecting the central visual acuity . the first patient underwent the procedure for erm ( pvd already present before surgery ) without intraoperative complications , and at the end of the procedure air tamponade was used . twenty days postoperatively , she was diagnosed with macula - on rrd due to a new inferotemporal rb located just posterior to the previous laser treatment scar . the second patient underwent vitrectomy for mh with intraoperative induction of pvd without intraoperative complications and at the end of the procedure received 11% c3f8 gas . thirty - five days postoperatively , she was diagnosed with macula - on rrd , due to a new inferior rb located anterior to the previous laser treatment scar . the mean preoperative bcva was 20/127 and the mean postoperative bcva was 20/48 ( p a significant improvement in bcva was also found in the erm subgroup ( mean preoperative bcva 20/110 vs mean postoperative bcva 20/41 [ p < 0.001 ] ) and in the mh subgroup ( mean preoperative bcva 20/139 vs mean postoperative bcva six out of 110 patients with mh showed no mh closure ( 94.5% closure rate ) . among these 6 patients , 2 did not comply with the recommended face - down positioning protocol . among the patients who did show mh closure , all except 2 complied with the recommended face - down positioning . the mean time to diagnosis of rrd in the 2 patients with this postoperative complication was 27.5 days ( range 2035 days ) . one patient underwent ppv for erm and the other for a mh . both of the patients presented with rrd anterior to the equator , not affecting the central visual acuity . the first patient underwent the procedure for erm ( pvd already present before surgery ) without intraoperative complications , and at the end of the procedure air tamponade was used . twenty days postoperatively , she was diagnosed with macula - on rrd due to a new inferotemporal rb located just posterior to the previous laser treatment scar . the second patient underwent vitrectomy for mh with intraoperative induction of pvd without intraoperative complications and at the end of the procedure received 11% c3f8 gas . thirty - five days postoperatively , she was diagnosed with macula - on rrd , due to a new inferior rb located anterior to the previous laser treatment scar . the mean preoperative bcva was 20/127 and the mean postoperative bcva was 20/48 ( p < 0.001 ) . a significant improvement in bcva was also found in the erm subgroup ( mean preoperative bcva 20/110 vs mean postoperative bcva 20/41 [ p < 0.001 ] ) and in the mh subgroup ( mean preoperative bcva 20/139 vs mean postoperative bcva six out of 110 patients with mh showed no mh closure ( 94.5% closure rate ) . among these 6 patients , 2 did not comply with the recommended face - down positioning protocol . among the patients who did show mh closure , all except 2 complied with the recommended face - down positioning . this study is a report of the impact of the prophylactic preoperative laser on rhegmatogenous retinal complications in macular surgery . to our knowledge , this laser timing has never been described in the literature . in line with what seems to emerge both from comparative studies ( 20-gauge vs 23/25-gauge ) and from noncomparative studies adopting no prophylactic measures , we found a greater risk of developing an intraoperative rb in 20-gauge ppv compared with 23/25-gauge ppv . in particular , the or was even higher for sclerotomy - related rbs , whereas for nonsclerotomy - related rbs , and also for postoperative rrd , there was no difference in risk . the higher number of erms among the entry diagnoses and the greater use of air tamponade in the small - gauge group might represent potential confounding factors ( table 2 ) ; however , since the number of pvd inductions did not differ significantly between small and 20-gauge ppv , this finding seems reliable . in a review of the recent literature , we compared the incidence of intraoperative rbs and rrd in our 20-gauge and small - gauge ppv groups with those reported by other authors ( table 3 ) . percentage of intraoperative retinal breaks and postoperative retinal detachment reported in the recent literature and in the present series our incidence of intraoperative rb in the 20-gauge ppv group ( 10% ) is higher than that reported in the study by scartozzi et al , but lower than that reported by all the other authors ( reported range 10.2%24.3% ) , whereas that of our small - gauge ppv group ( 2.1% ) is significantly lower than that of all the series reviewed ( reported range 3.1%18.2% ) ( table 3 ) . as for postoperative rrd this incidence is higher , equal , or lower when compared with series without intraoperative pplr ( reported range 0%11.4% ) , and higher or lower when compared with series with intraoperative pplr ( reported range 0%4.1% ) . this value compares favorably with that reported by authors who did not perform intraoperative pplr and is in line with that reported by the authors who did perform intraoperative pplr ( table 3 ) . the limitations of the present study worth mentioning are its retrospective nature , surgical procedures being performed by 2 surgeons , and the lack of a control group . although without a control group we can not assess the efficacy of preoperative prophylactic laser , some conclusions can nonetheless be drawn . the fact that the rates of rbs and rrd in the present study are comparable with the corresponding rates in other case series that utilized intraoperative laser technique suggests no advantage of preoperative prophylactic laser over intraoperative laser treatment . preoperative 360 pplr might offer some possible advantages over 360 intraoperative pplr , including no intraoperative breakdown of the blood - retinal barrier . for this reason we prefer preoperative rather than intraoperative prophylactic laser treatment ; however , neither of the techniques guarantee the prevention of postoperative rrd , and new retinal breaks can develop at the margin of prior barrier laser scars , as happened in this study . preoperative prophylactic laser showed no detrimental effect on the final bcva outcome or mh closure rate . in fact , our visual acuity results and mh closure rate are in line with other studies on the subject . the choice to perform preoperative pplr was made to create a postoperative barrier against the progression of rrd , which may rapidly involve the macula , if it occurs in vitrectomized eyes . preoperative pplr was performed 360 because postoperative rrd has been reported to be due to nonsclerotomy - related rbs in the majority of cases ( as in the present series ) . this goal was reached since in the present series , neither of the 2 patients with postoperative rrd was macula - off at presentation , one of them being successfully operated on with scleral buckling and the other one managed by observation alone .
### Summary: : abstractthe aim of the study is to evaluate the clinical characteristics of intraoperative retinal breaks ( rbs ) and postoperative retinal detachment ( rrd ) in patients undergoing pars plana vitrectomy ( ppv ) for macular disorders , who were treated preoperatively with prophylactic peripheral laser retinopexy.this observational cohort study comprised of 254 patients who underwent macular surgery and were preoperatively subjected to prophylactic laser retinopexy anterior to the equator . the main outcome measures were the incidence and characteristics of intraoperative rbs and postoperative rrd.intraoperative rbs occurred in 14 patients ( 5.5% ) . ten patients presented a sclerotomy - related rb ( 3.9% ) and 4 patients a nonsclerotomy - related rb ( 1.6% ) . two patients showed postoperative rrd ( 0.7% ) . neither of the 2 patients with postoperative rrd was macula - off at presentation : one of them was successfully operated on with scleral buckling and the other was managed by observation alone . a significantly increased risk for the intraoperative development of sclerotomy - related rb was found in 20-gauge ppv compared with 23/25-gauge ppv.preoperative prophylactic peripheral laser retinopexy does not guarantee the prevention of intraopertaive rbs or postoperative rrd . however , it might prevent the involvement of the macula when rrd occurs postoperatively .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : heart failure is considered to be the last stage of heart disease , and it is a significant cause of mortality and morbidity in the world.1 in recent years , beta - blocker therapy has become a primary pharmacologic intervention in patients with heart failure . although improvement in aerobic capacity has not been proven,2 the use of this therapy arises from an abundance of evidence demonstrating that beta - blockers improve survival and reduce hospitalization.3 the cardiopulmonary exercise test is a well - established technique used in heart failure patients to evaluate peak oxygen consumption ( pvo2 ) . oxygen consumption ( vo2 ) is the best prognostic variable in heart failure patients , and it remains so even in the beta - blocker era.4 aerobic exercise training is also a well - established non - pharmacological method used to increase pvo2 in heart failure patients . in this population , prescription of adequate aerobic exercise intensity based on heart rate is crucial to permit both an increase in exercise capacity and reasonable control of exercise - related risk.1,5,6 heart rate and vo2 are strongly related from rest to the peak of the treadmill cardiopulmonary exercise test in normal individuals.7 this association is especially true when the relationship between the percentage heart rate reserve ( % hrr ) and percentage oxygen consumption reserve ( % vo2r ) is considered.8 a previous study demonstrated that the % vo2r versus % hrr relationship was unreliable for aerobic effort relative intensity assessment in heart failure patients that were on or off beta - blocker therapy . however , these patients were not optimized with a beta - blocker therapy.8 the aim of this study was to evaluate the % hrr-%vo2r relationship in heart failure patients on optimized and non - optimized beta - blocker therapy during a treadmill cardiopulmonary exercise test . twenty - seven sedentary heart failure patients ( 86% male , 5012 years ) on optimized beta - blocker therapy with a left ventricle ejection fraction of 338% ( echocardiography ) and thirty - five sedentary non - optimized heart failure patients ( 75% male , 4710 years ) with a left ventricle ejection fraction of 3010% were included in the study . patients with the following conditions were excluded from the study : atrial fibrillation , use of a pacemaker , noncardiovascular functional limitations ( e.g. osteoarthritis ) , chronic obstructive pulmonary disease , and patients not receiving beta - blocker therapy . optimization was defined as 50 mg / day or more of carvedilol and a resting heart rate between 50 and 60 beats per minute for at least three months.9 this protocol was approved by the ethical committee of the study institution . heart failure patients receiving optimized or non - optimized beta - blocker therapy were asked to refrain from any strenuous physical activities for 24 hours before testing and to avoid the consumption of any stimulants ( e.g. , coffee , tobacco , alcohol ) that especially may influence heart rate . their last meal was ingested at least three hours before the start of the test . all subjects underwent the cardiopulmonary exercise test on a programmable treadmill ( series 2000 ; marquette electronics ; milwaukee , wi , usa ) in a temperature - controlled room ( 2123c ) between 10:00 a.m. and 3:00 p.m. patients were monitored via standard 12 lead continuous electrocardiograms ( max 1 ; marquette electronics ; milwaukee , wi , usa ) and auscultation for blood pressure . minute ventilation , oxygen uptake , carbon dioxide output , and other cardiopulmonary variables were acquired breath - by - breath by a computerized system ( vmax 229 model , sensormedics , yorba linda , ca , usa ) . the resting vo2 and heart rate were computed as the mean values for the final 30 seconds of the resting period , whereas the pvo2 and peak heart rate were the mean values for the final 30 seconds of effort before exhaustion . the heart rate reserve and oxygen consumption reserve were calculated as the difference between the peak and resting heart rate and the mean vo2 value , respectively . the % hrr was calculated as : % hrr = submaximal heart rate rest heart rate / heart rate reserve 100 . the % vo2r was calculated as : % vo2r = submaximalvo2 restvo2/vo2reserve 10010 . resting and peak effort values of both the % vo2r and % hrr were , by definition , 0 and 100 , respectively . respiratory exchange ratios were recorded as the average of samples obtained during each stage for each heart failure patient s protocol ( modified naughton protocol ) . a satisfactory cardiopulmonary exercise test was characterized by a respiratory exchange ratio of greater than 1.05 and symptoms of maximum effort . all heart failure patients received a beta - blocker ( carvedilol ) and an angiotensin converting enzyme inhibitor ( enalapril / captopril ) or an angiotensin ii at1 receptor antagonist ( losartan ) . patients took a beta - blocker , angiotensin converting enzyme inhibitors , angiotensin ii at1 receptor antagonists , and isosorbide 5-mononitrate two times per day . half of the daily dose was taken in the morning ( 9:00 a.m. ) , and the other half was taken at night ( 9:00 p.m. ) . diuretics , digoxin , and spironolactone were taken in the morning ( 9:00 a.m. ) . twenty - seven sedentary heart failure patients ( 86% male , 5012 years ) on optimized beta - blocker therapy with a left ventricle ejection fraction of 338% ( echocardiography ) and thirty - five sedentary non - optimized heart failure patients ( 75% male , 4710 years ) with a left ventricle ejection fraction of 3010% were included in the study . patients with the following conditions were excluded from the study : atrial fibrillation , use of a pacemaker , noncardiovascular functional limitations ( e.g. osteoarthritis ) , chronic obstructive pulmonary disease , and patients not receiving beta - blocker therapy . optimization was defined as 50 mg / day or more of carvedilol and a resting heart rate between 50 and 60 beats per minute for at least three months.9 this protocol was approved by the ethical committee of the study institution . heart failure patients receiving optimized or non - optimized beta - blocker therapy were asked to refrain from any strenuous physical activities for 24 hours before testing and to avoid the consumption of any stimulants ( e.g. , coffee , tobacco , alcohol ) that especially may influence heart rate . their last meal was ingested at least three hours before the start of the test . all subjects underwent the cardiopulmonary exercise test on a programmable treadmill ( series 2000 ; marquette electronics ; milwaukee , wi , usa ) in a temperature - controlled room ( 2123c ) between 10:00 a.m. and 3:00 p.m. patients were monitored via standard 12 lead continuous electrocardiograms ( max 1 ; marquette electronics ; milwaukee , wi , usa ) and auscultation for blood pressure . minute ventilation , oxygen uptake , carbon dioxide output , and other cardiopulmonary variables were acquired breath - by - breath by a computerized system ( vmax 229 model , sensormedics , yorba linda , ca , usa ) . the resting vo2 and heart rate were computed as the mean values for the final 30 seconds of the resting period , whereas the pvo2 and peak heart rate were the mean values for the final 30 seconds of effort before exhaustion . the heart rate reserve and oxygen consumption reserve were calculated as the difference between the peak and resting heart rate and the mean vo2 value , respectively . the % hrr was calculated as : % hrr = submaximal heart rate rest heart rate / heart rate reserve 100 . the % vo2r was calculated as : % vo2r = submaximalvo2 restvo2/vo2reserve 10010 . resting and peak effort values of both the % vo2r and % hrr were , by definition , 0 and 100 , respectively . respiratory exchange ratios were recorded as the average of samples obtained during each stage for each heart failure patient s protocol ( modified naughton protocol ) . a satisfactory cardiopulmonary exercise test was characterized by a respiratory exchange ratio of greater than 1.05 and symptoms of maximum effort . all heart failure patients received a beta - blocker ( carvedilol ) and an angiotensin converting enzyme inhibitor ( enalapril / captopril ) or an angiotensin ii at1 receptor antagonist ( losartan ) . patients took a beta - blocker , angiotensin converting enzyme inhibitors , angiotensin ii at1 receptor antagonists , and isosorbide 5-mononitrate two times per day . half of the daily dose was taken in the morning ( 9:00 a.m. ) , and the other half was taken at night ( 9:00 p.m. ) . diuretics , digoxin , and spironolactone were taken in the morning ( 9:00 a.m. ) . linear regression and pearson product moment coefficients were used to determine the relationship between the % hrr and % vo2r in both heart failure groups . the % hrr was chosen as the independent variable since it is currently used in rehabilitation programs to predict % vo2r values ( i.e. , aerobic exercise relative intensity ) in the absence of a basal cardiopulmonary exercise test . a one - sample t - test was used to verify whether the means of individual slopes and y - intercepts differed from those of the corresponding group regression and from the line of identity ( i.e. , from slope=1 and y - intercept=0 ) . this methodology was used in a previous study.10 to compare the rest , peak , and reserve heart rates , age , body mass index ( kg / m ) , respiratory exchange ratio , left ventricle ejection fraction , pvo2 , vo2 reserve , and current medication between optimized and non - optimized beta - blocker therapy groups , we used one - sample t - tests . to compare heart failure etiology and new york heart association functional class , we used fisher s exact test . data were analyzed using statistical package for social sciences ( spss ) for windows , v 11.5 ( spss inc , chicago , il ) . the non - optimized and optimized groups were well matched for age , body mass index and sex ( table 2 ) . the only noted difference in etiology was hypertension and in current medication intake were captopril and carvedilol . there were no observed significant differences in the new york heart association functional class ( table 1 ) . as expected , the rest and peak heart rates in the optimized beta - blocker therapy group were lower than those in the non - optimized group . the pvo2 and vo2 reserve in the optimized group did not differ from those in the non - optimized group . the respiratory exchange ratio also did not differ between the groups ( table 2 ) . the % vo2r was strongly related to the % hrr in optimized and non - optimized patients analyzed stage - by - stage during the cardiopulmonary exercise test ( r=0.95 , p<0.0001 with 9.3 of residual sd and r=0.91 , p<0.0001 with 12.7 of residual sd , respectively ) . the mean regression line coincided with the line of identity in the optimized beta - blocker therapy group ( p=0.31 ) , but this relationship was not observed in non - optimized patients ( p=0.012 ) ( figures 1 and 2 ) . the mean heart rate slope for the non - optimized group was derived from the points 0.9490.088 ( 0 intercept ) and 1.0550.128 ( 1 intercept ) and had a 95% of confidence interval from 0.171 to 0.537 ( p<0.0001 ) . the heart rate slope for the optimized group was derived from the points 1.0260.108 ( 0 intercept ) and 1.0120.108 and had a confidence interval from 0.011 to 0.016 ( p=0.47 ) . regression linear plots for the heart rate slope during the cardiopulmonary exercise test for each patient in the non - optimized and optimized groups are shown in figure 3 . this regression analysis revealed a slope of 0.986 ( almost perfect , which is achieved with a slope of 1 ) for the optimized group , but the regression analysis for the non - optimized group was 0.030 ( far from perfect , which occurs at values of less than 1 ) . the non - optimized and optimized groups were well matched for age , body mass index and sex ( table 2 ) . the only noted difference in etiology was hypertension and in current medication intake were captopril and carvedilol . there were no observed significant differences in the new york heart association functional class ( table 1 ) . as expected , the rest and peak heart rates in the optimized beta - blocker therapy group were lower than those in the non - optimized group . the pvo2 and vo2 reserve in the optimized group did not differ from those in the non - optimized group . the respiratory exchange ratio also did not differ between the groups ( table 2 ) . the % vo2r was strongly related to the % hrr in optimized and non - optimized patients analyzed stage - by - stage during the cardiopulmonary exercise test ( r=0.95 , p<0.0001 with 9.3 of residual sd and r=0.91 , p<0.0001 with 12.7 of residual sd , respectively ) . the mean regression line coincided with the line of identity in the optimized beta - blocker therapy group ( p=0.31 ) , but this relationship was not observed in non - optimized patients ( p=0.012 ) ( figures 1 and 2 ) . the mean heart rate slope for the non - optimized group was derived from the points 0.9490.088 ( 0 intercept ) and 1.0550.128 ( 1 intercept ) and had a 95% of confidence interval from 0.171 to 0.537 ( p<0.0001 ) . the heart rate slope for the optimized group was derived from the points 1.0260.108 ( 0 intercept ) and 1.0120.108 and had a confidence interval from 0.011 to 0.016 ( p=0.47 ) . regression linear plots for the heart rate slope during the cardiopulmonary exercise test for each patient in the non - optimized and optimized groups are shown in figure 3 . this regression analysis revealed a slope of 0.986 ( almost perfect , which is achieved with a slope of 1 ) for the optimized group , but the regression analysis for the non - optimized group was 0.030 ( far from perfect , which occurs at values of less than 1 ) . the main finding of this study is that the use of the relationship between the % hrr and % vo2r for the aerobic effort relative intensity assessment and prescription is reliable for heart failure patients on optimized beta - blocker therapy but unreliable for non - optimized heart failure patients . the % hrr and % vo2r are strongly related from rest to the peak of the treadmill cardiopulmonary exercise test in normal individuals.7,8 motivated by the report of this relationship , mezzani et al investigated the % hrr and % vo2r relationship in normal individuals and heart failure patients with and without beta - blocker therapy.8 the hypothesis that these heart failure patients would have the same comportment as normal individuals was frustrated by the non - coincidence between the regression line and identity line ( i.e. , the unreliability of the % hrr-%vo2r relationship ) . in this case , the patients on beta - blocker therapy were administered a mean carvedilol dose ( 2214 mg / day ) similar to that administered to those in our non - optimized beta - blocker therapy group ( 217 mg / day ) . as expected , the regression line in our study was similar to those reported in other studies for non - optimized heart failure patients . based on the results from mezzani et al8 and our study , we can not assess the aerobic effort relative intensity and prescribe exercise using the % hrr in non - optimized beta - blocker therapy heart failure patients . another previous study evaluated the % hrr-%vo2r relationship in heart failure patients with and without beta - blocker therapy and found a perfect identity between these variables . for example , a fixed rest vo2 value ( 3.5 mlo2.kg.min ) was used , and no carvedilol dosage was reported by the authors.11 in our study , we found that the % hrr-%vo2r relationship was at the line of identity in optimized heart failure patients . this finding provides evidence for the reliability of the % hrr-%vo2r relationship , and it shows that the % hrr can be used to prescribe exercise training and assess aerobic effort relative intensity . heart failure syndrome is characterized by an exacerbation of the sympathetic system , heart rate increase , and left ventricular dysfunction.12 this situation promotes poor cardiac function and decreased cardiac output.13,14 the maximal vo2 depends on cardiac output , which is expressed by the formula : vo2 = ( systolic volume x heart rate ) x arteriovenous oxygen difference.15 we hypothesized that optimized heart failure patients administered carvedilol exhibit decreased heart rates and improved cardiac function during exercise , probably , more than the non - optimized patients . when we evaluated optimized patients , however , heart rate and sympathetic control seemed to be more rigorous ( i.e. , attenuated ) and cardiac function improved during exercise . additionally , we studied only one type of beta - blocker ( carvedilol ) using one method of cardiopulmonary exercise test ( treadmill ) . the % hrr and % vo2r are strongly related from rest to the peak of the treadmill cardiopulmonary exercise test in normal individuals.7,8 motivated by the report of this relationship , mezzani et al investigated the % hrr and % vo2r relationship in normal individuals and heart failure patients with and without beta - blocker therapy.8 the hypothesis that these heart failure patients would have the same comportment as normal individuals was frustrated by the non - coincidence between the regression line and identity line ( i.e. , the unreliability of the % hrr-%vo2r relationship ) . in this case , the patients on beta - blocker therapy were administered a mean carvedilol dose ( 2214 mg / day ) similar to that administered to those in our non - optimized beta - blocker therapy group ( 217 mg / day ) . as expected , the regression line in our study was similar to those reported in other studies for non - optimized heart failure patients . based on the results from mezzani et al8 and our study , we can not assess the aerobic effort relative intensity and prescribe exercise using the % hrr in non - optimized beta - blocker therapy heart failure patients . another previous study evaluated the % hrr-%vo2r relationship in heart failure patients with and without beta - blocker therapy and found a perfect identity between these variables . for example , a fixed rest vo2 value ( 3.5 mlo2.kg.min ) was used , and no carvedilol dosage was reported by the authors.11 in our study , we found that the % hrr-%vo2r relationship was at the line of identity in optimized heart failure patients . this finding provides evidence for the reliability of the % hrr-%vo2r relationship , and it shows that the % hrr can be used to prescribe exercise training and assess aerobic effort relative intensity . heart failure syndrome is characterized by an exacerbation of the sympathetic system , heart rate increase , and left ventricular dysfunction.12 this situation promotes poor cardiac function and decreased cardiac output.13,14 the maximal vo2 depends on cardiac output , which is expressed by the formula : vo2 = ( systolic volume x heart rate ) x arteriovenous oxygen difference.15 we hypothesized that optimized heart failure patients administered carvedilol exhibit decreased heart rates and improved cardiac function during exercise , probably , more than the non - optimized patients . when we evaluated optimized patients , however , heart rate and sympathetic control seemed to be more rigorous ( i.e. , attenuated ) and cardiac function improved during exercise . additionally , we studied only one type of beta - blocker ( carvedilol ) using one method of cardiopulmonary exercise test ( treadmill ) . the % hrr-%vo2r relationship in patients on optimized beta - blocker therapy was reliable during a treadmill cardiopulmonary exercise test , but this relationship was unreliable in non - optimized heart failure patients .
### Summary: : backgroundthe relationship between the percentage of oxygen consumption reserve and percentage of heart rate reserve in heart failure patients either on non - optimized or off beta - blocker therapy is known to be unreliable . the aim of this study was to evaluate the relationship between the percentage of oxygen consumption reserve and percentage of heart rate reserve in heart failure patients receiving optimized and non - optimized beta - blocker treatment during a treadmill cardiopulmonary exercise test.methodsa total of 27 sedentary heart failure patients ( 86% male , 5012 years ) on optimized beta - blocker therapy with a left ventricle ejection fraction of 338% and 35 sedentary non - optimized heart failure patients ( 75% male , 4710 years ) with a left ventricle ejection fraction of 3010% underwent the treadmill cardiopulmonary exercise test ( naughton protocol ) . resting and peak effort values of both the percentage of oxygen consumption reserve and percentage of heart rate reserve were , by definition , 0 and 100 , respectively.resultsthe heart rate slope for the non - optimized group was derived from the points 0.9490.088 ( 0 intercept ) and 1.0550.128 ( 1 intercept ) , p<0.0001 . the heart rate slope for the optimized group was derived from the points 1.0260.108 ( 0 intercept ) and 1.0120.108 ( 1 intercept ) , p=0.47 . regression linear plots for the heart rate slope for each patient in the non - optimized and optimized groups revealed a slope of 0.986 ( almost perfect ) for the optimized group , but the regression analysis for the non - optimized group was 0.030 ( far from perfect , which occurs at 1).conclusionthe relationship between the percentage of oxygen consumption reserve and percentage of heart rate reserve in patients on optimized beta - blocker therapy was reliable , but this relationship was unreliable in non - optimized heart failure patients .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the first reported case of thoracic duct cyst was in 1964 by steinberg et al . since that time , only 32 cases have been reported in the literature with the largest case series consisting of only 5 patients . the most common approach to managing these lesions is surgical excision with ligation of the thoracic duct . we present the case of a 75 year - old female with a cervical thoracic duct cyst who was successfully treated by cyst - venous anastomosis . to our knowledge , this is the first reported case of successful cyst - venous anastomosis for the treatment of spontaneous cervical thoracic duct cyst ( ctdc ) . a 75-year old female presented with a four month history of left neck mass and left arm swelling . she reported no history of trauma or head and neck surgery . on examination she had edema of the left arm extending from the shoulder to the hand . palpation of the left neck revealed a firm , mobile mass adjacent to the left lobe of the thyroid . jugular venous distention was noted on the left side distal to the mass , but there was no evidence of venous thrombosis . ct and mri of the neck and upper extremity were reviewed revealing a cystic mass measuring 3.1 cm 2.8 cm 1.8 cm which was not in continuity with the thyroid ( fig . 1 ) . the mass appeared to be medial to the carotid artery and jugular vein in the region of the cervical thoracic duct . ultrasound confirmed the cystic nature of the lesion without solid intramural components and an fna was performed showing benign cytology . due to concern that the patient 's symptoms were caused by vascular or lymphatic compression by the mass she was scheduled for surgical excision . the carotid artery was displaced laterally by the mass which was situated between the artery and internal jugular vein ( fig . 2 ) . the mass appeared to emanate from the thoracic duct and several small lymphoid channels were identified emptying into the mass . it was not adherent to adjacent tissues and easily dissected free from the artery and vein . given the benign appearance of the mass , the decision was made to create a lymphovascular shunt . it was felt that this approach would preserve lymphatic function and maintain a more natural anatomic configuration than excision and duct ligation . proximal and distal control of the internal jugular ( ij ) vein was obtained and a satinsky clamp was placed on the cystic mass . the mass and the ij were opened and a side - to - side anastomosis was made with 7 - 0 prolene suture . immediate cyst decompression was achieved and there was no evidence of leakage from the anastomosis . a 7 mm drain was left in place and the skin was closed in a layered fashion . the drain was removed at 1 week and at 1 month follow - up the patient noted improvement of both swelling and pain in her left arm . on follow - up at two years the patient has had no mass recurrence , but left arm swelling has persisted to a lesser degree . the pathogenesis of ctdc is not well defined , but many potential etiologies have been proposed . lymphatic cysts of the neck are known to develop as a complication of previous neck surgery or other form of trauma to the cervical portion of the td . others have postulated that congenital wall weakness or degenerative processes such as inflammation or atherosclerotic changes in the cyst wall may contribute to cyst development . distal obstruction of the duct has been reported as a cause for cyst development , but other authors are more skeptical of this possibility . td ligation is often performed without subsequent development of cysts proximally , theoretically supporting the view that other factors must be present for the development of ctdc to occur . typical features include lack of nodularity , septations or contrast enhancement as well as a well - circumscribed round or oval shape . radiodensity is close to csf with a mean of 10.2 hu reported in the literature . the most critical test for diagnosis is ultrasound guided fine needle aspiration of the identified cystic mass . fluid with lymphocyte predominance and very high levels of triglycerides and chylomicrons ( fat content 0.44% ) is very suspicious for lymphatic cyst . endothelial and epithelial markers have been described which confirm the presence of an epithelial lining . lymphangiography is the gold standard for imaging and diagnosis of malformations of the td , but with the ease and availability of high resolution imaging and needle aspiration this is not often pursued . both medical and surgical approaches have been proposed for the management of ctdc , though the most widely employed method of treatment is surgical ligation . in the review by brauchle et al . only 2 of 15 patients reported in the literature were treated with observation . a follow up report on one of these patients 25 years later showed spontaneous regression of the cyst with conservative management , suggesting that observation is a reasonable option . the psychological angst associated with a mass of unknown origin may be a contributing factor to the generalized practice of surgical resection , but other benefits of excision include definitive histologic exclusion of malignancy and potential relief of symptoms . chyle fistula is a serious potential risk factor associated with cyst excision ; however this has not been reported in the literature at this point . other potential risk factors include injury to the nearby nerves or major vessels ( e.g. vagus n. , phrenic n. , carotid a. , internal jugular v. ) . sclerotherapy is one alternative form of treatment that has been proposed for both cervical lymphoceles and ctdc . cyst aspiration and diet modification have also been discussed . however , both of these reports resulted in eventual surgical excision for definitive management . this case represents a unique scenario in that no previous patients have presented with unilateral arm swelling ipsilateral to the ctdc . given the initial improvement in the patient 's symptoms after cyst drainage we hypothesize that the etiology of her symptoms included an element of lymphatic obstruction caused by the cystic mass . the exact location of obstruction is unclear as one would expect that the extensive collateral network of lymphatics in the arm to allow adequate drainage . she also had moderate persistent edema at 2 years post - surgery suggesting the presence of other factors contributing to her left arm edema . it is important to note that the patient had no evidence of venous thrombus pre - operatively and did not have hypercoagulable risk factors . doppler ultrasonography would be a potentially valuable adjunct in this case , but this has not been arranged thus far . reverse lymphatic mapping of the arm may also reveal anatomic variations responsible for this patient 's obstruction . prior to this case , there have been no reports of ctdc management via cyst - vein anastomosis despite the common application of similar surgical techniques to other clinical problems . several studies have reported success with the treatment of lymphatic disorders via lymphovascular shunting but most of the present studies focus on repairing secondary injury to lymphatic structures . this case illustrates that lymphovascular anastomosis is a potential alternative to surgical excision of ctdc , which allows preservation of a more natural lymphovascular anatomy . we report a novel application for lymphovascular anastomosis for decompression and definitive treatment of this unusual pathology . verbal consent was obtained directly from the patient who was not physically present for written consent . john casler , md performance of operation , patient follow - up and care .
### Summary: : introductioncervical thoracic duct cyst ( ctdc ) is a rare cause of lateral neck mass . surgical excision with ligation of the cervical thoracic duct is the current standard for definitive management with symptomatic patients . we report the first case of an alternative method of management performing a cyst venous anastomosis for decompression.presentation of casea 77 year old female presented with a six month history of left arm pain , swelling and a left - sided cystic neck mass . she was treated with cyst - venous anastomosis between the cyst wall and the left internal jugular vein . at two year follow - up , she has had resolution of pain and no recurrence of the mass.discussionmany potential etiologies have been proposed for ctdc , though surgical management of this rare problem has consistently required cyst excision and thoracic duct ligation . few innovative modes of therapy have been developed to address this problem in a less invasive manor . maintaining a more natural thoracic duct anatomy decreases the likely of complications associated with duct ligation.conclusioncyst-venous anastomosis for the management of ctdc provides an effective , novel form of treatment which maintains the integrity of the thoracic duct and avoids potential complications associated with duct ligation .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : percutaneous treatment of these complex fractures is intended to reduce soft issue complications and postoperative stiffness of the knee joint . we assessed the complications , clinical outcome scores , and postoperative knee range of movements , after fluoroscopic assisted closed reduction and external fixator application . all fractures were managed with closed reduction and external fixator application . in 28 cases with intraarticular split , we used percutaneous cancellous screw fixation for reduction and fixation of condylar parts . in nine open fractures , elevation of depressed segment and bone grafting was required , which was done from a very small incision . all patients were clinically and radiographically evaluated at a mean followup of 26.16 months ( range 660 months ) . forty seven results were scored as excellent , 25 good , 2 fair , and 1 as poor . we believe that minimally invasive treatment by percutaneous techniques and external fixation is a fairly reasonable treatment alternative , if near anatomical reduction of joint surface can be confirmed on fluoroscopy . the tibial plateau fractures , especially in high - energy trauma due to extensive soft tissue damage , pose a therapeutic dilemma . there are various management options , open reduction and internal fixation by using various types of plates and screws is one of the most commonly used treatment , but there also complications like wound problems , infection , deformities , and stiffness are not known to be less.12 the other option is minimally invasive technique using closed reduction and percutaneous internal fixation and/or supportive external fixation.36 the aim of our study was to find out the functional outcome after the latter modality of treatment , especially when conventional open technique is difficult or contraindicated . from april 1999 to march 2010 , in a prospective study , 78 cases of complex tibial plateau fractures were treated by use of conventional external fixator and minimal percutaneous internal fixation with cannulated cancellous screws ( ccs ) when required . a total of 75 cases were available for the study , with a mean followup of 26.16 months ( range 6 - 60 months ) , 3 cases were lost to followup . sixty six cases were closed fractures with most of them having either blisters or significant bruising . all patients presented within 48 h of injury the mean age was 41.96 years ( range 1864 years ) . only complex tibial plateau fractures were included in the study , which belonged to schatzker 's type v and vi89 or type c of a. o. classification , as these are the fractures with soft tissue injury . there were 36 c1 type , 21 c2 type , and 18 c3 type fractures according to a. o. classification.10 fifteen cases had grade 1/2 medial collateral ligament injury , diagnosed clinically on examination of knee , and all of them were treated conservatively . also , none of the patients had lateral collateral ligament , anterior cruciate ligament ( acl ) or posterior cruciate ligament ( pcl ) injuries . treatment was decided on radiological findings only and not based on computed tomography ( ct ) scan . almost all , i.e. 69 out of 78 of these patients , had sustained injuries in road traffic accidents ( rta ) due to high velocity trauma ; the remaining had history of fall at home . all c1 ( n = 36 ) type fractures were primarily managed with closed reduction under fluoroscopy , followed by knee joint sparing external fixator application around the fractured area . but c2 ( n = 21 ) and c3 ( n = 18 ) types of fractures were treated with half pin external fixator and with additional ccs by closed method [ figures 1a and 1b ] , percutaneous joystick method , or through open wound after its debridement and sometimes extending the incision for getting reduction . once reduction was achieved , the fracture was fixed with k wires over which ccs was introduced to stabilize the proximal fragments . the fixator was unilateral ao type in 71 cases [ figures 2a and 2b ] and hybrid in 4 cases . the proximal pins were kept away 14 mm from the joint line to avoid infection in the knee joint . elevation of depressed fracture fragments was done by making a small window in the medial upper tibia metaphysis , with bone grafting1112 in 16 cases . active range of motion ( rom ) exercise was started after 35 days postoperatively in 72 patients , except in three patients where the fixation was not rigid enough to mobilize them early . x - ray anteroposterior and lateral views ( a ) preoperative x - rays showing tibial plateau fracture ( b ) immediate postoperative x - rays showing reduction and fixator in situ ( c ) final followup x - rays of same patient showing maintained joint congruity clinical photographs of same patient showing ( a ) extension at knee ( b ) flexion at knee x - ray anteroposterior and lateral views showing ( a ) preoperative x - rays showing tibial plateau fracture ( b ) postoperative x - ray showing fixator in situ ( c ) final followup x - rays of the same patient clinical photograph showing ( a ) extension at knee ( b ) flexion at knee partial weight bearing crutch walking was started from 10 weeks in c1 type of fractures , whereas it was delayed to 12 weeks in c2/c3 type of fractures . in one case which was badly comminuted all patients were followed up and evaluated clinically as per rasmussen 's criteria [ table 1 ] and radiographically for presence of callus . radiological ( x - rays ) evaluation was six - weekly for the first 3 months , followed by three - monthly for the next 1 year . in this series , the final outcome was evaluated using rasmussen 's criteria.1314 followup ranged from 6 to 60 months ( mean 26.16 months ) . healing of the fractures was assessed clinically by stability without pain and radiographically by the evidence of formation of callus . the fracture healed in all cases except in one open type c3 fracture where there was nonunion which was treated by cancellous bone grafting to augment the process of union . nine patients having compound fractures had mean hospital stay of 8.1 days ( range 7 - 10 days ) , they had to be in hospital for more time for their wound healing . wounds healed completely in all the patients . however , compound fractures fared equally well as compared to simple fractures in terms of rom knee and radiological / clinical signs of union . the final outcome was excellent in 47 ( 62.8% ) cases , good in 25 ( 33.30% ) cases , fair in 2 ( 2.66% ) cases , and poor in 1 ( 1.33% ) case . rasmussen 's functional score system in 12 ( 16% ) cases , varus malunion mean 15 ( range 1020 ) occurred due to loss of reduction / alignment in fixator . fracture anatomy leading to collapse at fracture site and poor hold of pins in metaphyseal bone was the only main reason for loss of alignment and varus malunion . there was superficial pin tract infection in 9 ( 12% ) cases which resolved with pin tract care and oral antibiotics . are complex problems . management of these fractures is difficult and varies from surgeon to surgeon . such injuries are usually associated with extensive soft tissue injury even if they are not open fractures and often there is marked comminution of articular surfaces . the common notion for treating these fractures is open anatomical reduction at least of the articular surfaces , use of cancellous bone graft as required , and fixation using condylar buttress plates.15 for open fractures , treatment using illizarov 's ring fixator , whenever feasible , or knee - spanning external fixator application is preferred . early joint motion is probably the most important factor in promoting cartilage nutrition and healing.16 knee - spanning fixator can not allow early mobilization , so joint stiffness is inevitable in those cases . as it is known , open reduction internal fixation necessitates extensive soft tissue stripping for adequate exposure , and hence is associated with a high incidence of complication , e.g. nonunion , wound dehiscence , infection , and stiffness.17 this joint stiffness occurs even with anatomical reduction of articular surfaces . also as this site being prone for infections even for closed injuries and due to its proximity to knee joint , the fear of pyogenic arthritis of the joint keeps haunting the surgeon . furthermore , sometimes there is a secondary collapse at the fracture site , even with the plate in situ , which occurs after weight bearing and becomes evident on followup x - rays , and then we are left with no option but a re - surgery with its own risks . this can be avoided most of the times with just a simple readjustment in an external fixator . we did not note the exact number of patients who required re adjustment of external fixator . this study shows that optimum reduction of articular surface i.e less than 2 mm of articular step , and use of even knee - sparing external fixator leads to stable biological fixation without any further damage to soft tissue at the fracture site and without periosteal stripping , thus allowing early knee joint mobilization immediately after surgery.18 we believe cancellous bone graft and minimal percutaneous internal fixation with ccs along with fixator , helped in achieving good to excellent clinical outcome . none of our patients had osteoarthritis till the last followup , and we propose this is because there was near anatomical reduction , i.e. maximum articular step of 2 mm , and the early mobilization helped in providing nutrition to the articular cartilage . a long term followup is still needed to come out with a definitive conclusion in this regard . also , one study19 showed that though the fracture healing is good , the range of movement achieved after this technique is less due to the most proximal ring , there is mechanical obstruction to terminal knee movement , and as pins are passing through the soft tissues , there is sometimes pain and difficulty in movements . however , in our series , the knee range of movement was goodfrom very early postoperative period , and thereby we got very good range of movement . the incidence of varus malunion increases with external fixator compared to ring fixator ; also , weight bearing needs to be delayed , and thereby union is slightly delayed . according to a study on the use of external fixators by faldini et al.,20 the average healing time was 24 weeks , nonunion occurred in 1 ( 3.33% ) patient , varus deformity in 2 ( 6.25% ) patients , and the mean knee rom was 105 ( range 75125 ) . according to a study by richard,21 the primary aim is to protect soft tissue and there were high complication rates due to the amount of soft tissue dissection needed to adequately expose the fracture site for open reduction , as it devitalizes the comminuted bone fragments . deep infection rate has been reported to be as high as 7380%,2223 as compared to our study where the deep infection rate was nil . this has caused many surgeons to seek alternative treatment methods such as spanning external fixation or hybrid external fixation to minimize the injuries to the soft tissue while still stabilizing the fracture . the incidence of infection with external fixation is obviously less.2425 if there is significant bruising , swelling , or blistering of the soft tissue envelope , a spanning external fixator to align and distract the fragments is applied and left in place until the swelling subsides and the blisters heal . prevention of further damage to the soft tissues is the most important initial consideration in these fractures . krupp et al.26 compared between locked plating and external fixator , and found that locked plating was associated with decreased union time ( 5.9 vs. 7.4 min ) , decreased malunion ( 7% vs. 40% ) , decreased knee stiffness ( 4% vs. 13% ) , and decreased overall complications ( 27% vs. 48% ) . but schatzker type vi 's subgroup accounted for 93% complication rate in locked plate compared to 83% in external fixator group . their study reserves use of external fixator in the treatment of tibial plateau fractures to span fracture site until the patient is amenable to definitive fixation with locked plating . the results obtained in this study are comparable to those found in literature , though a few known complications occurred like pin tract infection ( 12% ) and varus malunion ( 16% ) [ table 2 ] . comparison of results with other studies we suggest the use of this minimally invasive technique as an alternative treatment method for complex tibial plateau fractures especially resulting from high - energy trauma and having bad skin condition in which conventional buttress plating may be contraindicated .
### Summary: : background : tibial plateau fractures are usually associated with communition and soft tissue injury . percutaneous treatment of these complex fractures is intended to reduce soft issue complications and postoperative stiffness of the knee joint . we assessed the complications , clinical outcome scores , and postoperative knee range of movements , after fluoroscopic assisted closed reduction and external fixator application.materials and methods : seventy eight complex tibial plateau fractures in 78 patients were included in the study . all fractures were managed with closed reduction and external fixator application . in 28 cases with intraarticular split , we used percutaneous cancellous screw fixation for reduction and fixation of condylar parts . in nine open fractures , immediate debridement was done . in 16 cases , elevation of depressed segment and bone grafting was required , which was done from a very small incision . all patients were clinically and radiographically evaluated at a mean followup of 26.16 months ( range 660 months).results : clinical results were evaluated according to the rasmussen 's criteria . average healing time was 13.69 weeks ( range 12 28 weeks ) . mean knee range of motion was 122.60 ( range 110130 ) . forty seven results were scored as excellent , 25 good , 2 fair , and 1 as poor.conclusion:we believe that minimally invasive treatment by percutaneous techniques and external fixation is a fairly reasonable treatment alternative , if near anatomical reduction of joint surface can be confirmed on fluoroscopy .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : this gram - positive anaerobe causes both histotoxic infections , such as gas gangrene ( clostridial myonecrosis ) , and enteric infections , such as human food poisoning . as typical amongst pathogenic clostridial spp . , the virulence of c. perfringens is largely attributable to its ability to produce an arsenal of potent protein toxins . production of four of these toxins ( alpha , beta , epsilon , and iota ) is used to classify c. perfringens strains into one of five types ( a e ) . less than 5% of all c. perfringens type a isolates produce another toxin named c. perfringens enterotoxin ( cpe ) that is biomedically important , although not used in the toxin typing classification system . after a brief introduction to this unique toxin , promising efforts to utilize cpe , or its derivatives , for cancer therapy will be described cpe - producing c. perfringens type a strains cause the second most common bacterial food poisoning in the usa , as well as many cases of human nonfoodborne gastrointestinal diseases , such as antibiotic - associated diarrhea . the food poisoning develops when foods contaminated with large numbers of cpe - producing type a strains are ingested ; the ingested bacteria then briefly grow in the small intestine before committing to sporulation . molecular koch 's postulates analyses have demonstrated that production of cpe is essential for cpe - positive type a human food poisoning or nonfoodborne gastrointestinal disease isolates to cause gastrointestinal effects in animal models . most , but not all , c. perfringens type a food poisoning strains carry their enterotoxin gene ( cpe ) on the chromosome . in contrast , the cpe gene of type a nonfoodborne human disease strains is located on large ( ~7075 kb ) plasmids . amongst cpe - positive type a strains there are two major families of cpe plasmids . these enterotoxin plasmids can be conjugative , presumably due to the presence of a tn916-like region named tcp that has been experimentally shown to mediate transfer of other c. perfringens conjugative plasmids . expression of the cpe gene is regulated by sporulation - associated alternative sigma factors [ 8 , 9 ] . specifically , one alternative sigma factor ( sigf ) controls expression of two other alternative sigma factors ( sigk and sige ) , which then direct transcription of cpe mrna from several sigk- or sige - dependent promoters located upstream of the cpe orf . exceptionally large amounts of cpe can be produced during sporulation ; for example , cpe can represent 20% of total protein in some sporulating cpe - positive c. perfringens type a strains . instead it accumulates in the cytoplasm of the mother cell until the completion of sporulation . when the mother cell then lyses to release the mature spore , cpe is released into the intestinal lumen , where it binds and acts as described in the following section . the in vivo outcome of natural cpe action during gastrointestinal disease is desquamation of the intestinal epithelium , intestinal necrosis , and the accumulation of luminal fluid . these effects account for the natural gastrointestinal symptoms of cpe - associated disease , which most commonly include diarrhea and abdominal cramps . typically , people are sickened with c. perfringens type a food poisoning for 1224 hours and then recover . however , this illness can be fatal in the elderly or in people suffering from medication - induced constipation . as shown in figure 1 , the current model of cpe action begins with binding of this toxin to claudin receptors ( described in detail below ) . this binding results in formation of a small ( ~90 kda ) sds - sensitive complex . besides cpe , the small complex also contains both claudin receptors and claudins incapable of binding cpe ( i.e. , nonreceptor claudins ) . presumably the presence of nonreceptor claudins in small complex is attributable to claudin : claudin interactions . six small complexes are then thought to oligomerize into an sds - resistant large complex named cpe hexamer-1 , or ch-1 . this hypothesis is based upon results of heteromer gel shift analyses , which identified the presence of six cpe molecules in each ch-1 complex . ch-1 is ~450 kda in size and contains , in addition to six cpe molecules , both receptor and nonreceptor claudins . ch-1 initially assembles as a prepore on the membrane surface ; however , at 37c this prepore then rapidly inserts into membranes to form an active pore . formation of the ch-1 pore results in calcium influx , which ( via calpain activation ) leads to cell death [ 13 , 14 ] . at moderate cpe doses , where modest cpe pore formation allows only limited calcium influx , cpe - treated cells die from a classical caspase 3-mediated apoptosis . at higher cpe doses , where large amounts of cpe pore formation results in a massive calcium influx , cells die from oncosis . cpe pore formation also leads to morphologic damage that exposes the basolateral surface of cells . this allows formation of a second bigger ( ~650 kda ) large complex named ch-2 . in addition to six copies of cpe and both receptor and nonreceptor claudins , ch-2 also contains another tight junction protein named occludin [ 11 , 15 ] . formation of ch-2 leads to internalization of occludin into the cytoplasm ; claudins are also internalized inside native cpe - treated cells although it is not clear if this is due to ch-1 formation , ch-2 formation , or to formation of both complexes . these effects likely help to explain the observed ability of native cpe to disrupt tight junctions . cpe consists of a 319 amino acid polypeptide ( mr 35,317 ) with a unique primary sequence . the cpe structure / function relationship has been extensively analyzed by combined genetic , biochemical , and structural biology approaches ( figure 2 ) . as this review this structure revealed that cpe is a three - domain protein , reminiscent of several other pore - forming toxins . the n - terminal 37 amino acids of native cpe lack a definable structure and are not necessary for toxicity . in fact , removing these amino acids by chymotrypsin , as may occur in the intestines during disease , produces a 23-fold more potent toxin . this proteolytic activation occurs because removal of the n - terminal cpe sequences exposes the cpe region between amino acids 47 to 51 , which reside in domain ii , to promote ch-1 formation . site - directed mutagenesis studies showed that particularly important domain ii residues for ch-1 formation are ( i ) the asp at cpe residue 48 and ( ii ) the ile at cpe residue 51 . cpe domain ii also contains a region spanning from residues 81 to 106 that appears to be a transmembrane stem . removal of these residues produces a cpe variant that can form ch-1 but is unable to kill cells or form pores . this effect is consistent with cpe residues 81 to 106 mediating the insertion of this transmembrane stem into membranes . membrane insertion of all six transmembrane stems , from the six cpe proteins present in ch-1 , results in -barrel pore formation . domain iii may undergo structural changes during the prepore to pore transition that facilitate insertion of the cpe transmembrane stem into lipid bilayers , facilitating pore formation . over 20 years ago it was shown that a recombinant cpe fragment corresponding to the c - terminal half of the native toxin retains full receptor - binding activity . however , ( as expected from the preceding section ) this c - terminal cpe fragment named c - cpe was nontoxic since it lacks the n - terminal regions necessary for ch-1 formation and insertion of ch-1 into membranes to form a pore . deletion mutagenesis and synthetic peptide approaches later localized most cpe receptor - binding activity to the 30 c - terminal amino acids ( figure 2 ) . more recently , site - directed mutagenesis studies demonstrated that three tyr residues , located at positions 306 , 310 , and 312 of the native toxin protein are important for receptor binding . c - cpe ( residues 194 to 319 of the native toxin ) approximately corresponds to domain i of the native cpe protein [ 17 , 18 ] . domain i consists of a nine beta strand sandwich that shares structural similarity with the receptor binding domains of some other bacterial toxins , including the large cry family of bacillus thuringiensis toxins . by correlating this c - cpe structure with the previous binding - activity mapping studies described above , it is apparent that the receptor - binding site of cpe resides on a large loop located between beta strands 8 and 9 . mammalian tight junctions act as both fences and gates , that is , they represent important barriers for an epithelium and also regulate paracellular permeability . studies conducted over the past 15 years have determined that the tight junction is comprised of several proteins , the most important of which are the claudins . the claudins are a 24-member family of ~2025 kda proteins that are predicted to consist of four transmembrane domains , two extracellular loops ( ecl-1 and ecl-2 ) , and a cytoplasmic tail that can mediate signaling cascades . , claudins are also overexpressed in many cancers . in 1997 , katahira et al . reported that when fibroblasts , which are naturally cpe- resistant , were transfected to express an ~22 kda vero cell protein , they gained cpe sensitivity . the vero cell protein expressed by these transfectants had properties of a cpe receptor since the fibroblast transfectants acquired the ability to bind significant levels of the toxin and to form high molecular weight complexes that are now recognized as ch-1 . this vero cell cpe receptor protein it was also determined that , at physiologic concentrations , the enterotoxin can bind to transfected fibroblasts expressing claudin-3 , -4 , -6 , -8 , or -14 . however , no cpe binding was detected to transfectants expressing claudins-1 , -2 , -5 , or -10 . a more recent study by robertson et al . demonstrated that cpe also interacts with claudins in naturally cpe - sensitive caco-2 cells , which are a human enterocyte - like cell line . using coimmunoprecipitation and electroelution approaches , this study showed both the cpe small complex and ch-1 large complex formed in caco-2 cells can contain , in addition to cpe , receptor claudins-3 and -4 , along with the nonreceptor claudin-1 . in addition to cpe , receptor claudins , and nonreceptor claudins , the ch-2 complex formed in caco-2 cells also contains occludin . the stoichiometry of claudins in ch-1 and ch-2 , or occludin in ch-2 , has not yet been determined . the structure of a claudin has not been solved at the time when this review is being prepared . however , as mentioned earlier ( and depicted in figure 2 ) , claudins are predicted to possess two extracellular loops named ecl-1 and ecl-2 . an early study using claudin chimeras consisting of the n - terminal half of cpe receptor claudin-4 fused with the c - terminal half of cpe nonreceptor claudin-1 suggested that cpe interacts with the putative ecl-2 region . this hypothesis was rigorously confirmed by a recent study using more specific chimeric claudins , which showed that substituting only the predicted ecl-2 sequence of claudin-4 into a claudin-1 backbone is sufficient to produce fibroblast transfectants that are very sensitive to cpe . the reverse was also true , that is , transfectants expressing a chimeric claudin , where only the claudin-1 ecl-2 had been specifically substituted into the claudin-4 backbone , were cpe - insensitive . several recent studies ( reviewed in ) have focused on understanding the specific ecl-2 residues of claudin receptors that mediate cpe binding . these studies have utilized a variety of approaches including arrays of immobilized ecl-2 synthetic peptides , solubilized claudins , or transfectants expressing claudin mutant . results from these studies suggested that ecl-2 possesses a helix - turn - helix motif that interacts with cpe . an asn residue in the middle of this turn appears to be important for cpe binding ; some evidence suggests that a leu residue located two residues from this asn may also participate in the binding of this toxin . since approximately 85% of malignant tumors are derived from epithelial cells , an epithelium - targeted therapeutic strategy has been the focus of cancer translational research . as mentioned earlier , claudins are the major components of paracellular tight junctions ( tjs ) , distribute at the most apical junctions between epithelial cells , and play an essential role in the control of paracellular transport . furthermore , claudin-3 and -4 have been identified as the specific receptors for cpe , which is of potential therapeutic significance since these two claudins are abundantly expressed in ovarian , breast , uterine , and pancreatic cancers . while cpe can trigger lysis of epithelial cells by binding to claudin-3 and claudin-4 , with resultant initiation of massive permeability changes , osmotic cell ballooning , and cytolysis within 515 min ( see previous sections of this review ) , cells lacking expression of the cpe receptors are completely unaffected by this enterotoxin . these observations have raised the possibility that cpe may be an innovative claudin - targeted therapy for malignant tumors . in fact , efforts have been made to use cpe in the treatment of claudin - overexpressing cancers during the past few years . approximately 90% of patients with advanced - stage ovarian cancer develop recurrence and inevitably die from the development of chemotherapy resistance . previous studies have demonstrated that claudin-3 and -4 were among the six most differentially upregulated genes in ovarian cancer cells , but their expression is undetectable in normal ovaries . of particular note , chemotherapy - resistant / recurrent ovarian cancers express claudin-3 and -4 at significantly higher levels than chemotherapy - sensitive cancers . these overexpressed claudins may represent promising targets for the use of cpe as a tumor - targeting therapy against this aggressive disease . indeed , santin and colleagues successfully used cpe to treat an animal model of chemotherapy - resistant human ovarian cancer . they found that all ovarian cancer cells , regardless of their resistance to chemotherapeutic agents , showed a dose - dependent cytotoxic response and died rapidly after 24 hours of exposure to cpe . furthermore , in this animal model employing chemotherapy - resistant human ovarian cancer xenografts , multiple intraperitoneal ( i.p . ) sublethal doses of cpe ranging from 5 to 8.5 g / ml significantly inhibited tumor growth and extended the survival of mice harboring a large tumor burden of chemotherapy - resistant ovarian cancer . therefore , cpe - based therapy may have potential as a novel treatment for chemotherapy - resistant ovarian cancer . breast cancer is one of the most common malignancies worldwide . despite tamoxifen and aromatase inhibitor having significantly improved long - term survival of patients diagnosed at the early stages , advanced breast cancer and metastatic breast cancer are still incurable diseases . claudin-3 and claudin-4 are overexpressed in most primary breast carcinomas and breast cancer brain metastases but undetectable in normal breast epithelial cells . in 2004 , kominsky et al . reported for the first time that intratumoral cpe treatment of t47d human breast cancer cell xenografts resulted in significant tumor suppression and necrosis in scid mice without any side effects . administration of the same dose of cpe was toxic and had no effect on tumor volume . cpe also damaged breast cancer cell lines in a claudin - dependent manner but did not affect cell lines lacking claudin-3 and -4 . in later studies , those investigators found that intracranial administration of cpe retarded tumor growth and increased survival in two murine models of breast cancer brain metastasis without any apparent systematic or cns toxicity ( figure 3 ) . these two studies suggest that the local administration of cpe may be useful in the treatment of breast cancer . overexpression of claudin-3 and -4 has been found in uterine serous papillary carcinoma ( uspc ) and correlates with a more aggressive phenotype and a worse prognosis . a study by santin et al . has demonstrated that cpe effectively and specifically triggers cytolysis of primary and metastatic uspc cell lines in a dose - dependent manner whereas normal cells lacking claudin-3 and -4 are unaffected by cpe treatment . in particular , multiple intratumoral injections of cpe in large subcutaneous uspc xenografts led to tumor necrosis and even tumor disappearance in 100% of animals . injection of sublethal doses of cpe significantly suppressed tumor growth and extended survival of animals harboring chemotherapy - resistant intra - abdominal uspc . the local / regional administrations of cpe were well tolerated without observable adverse events in animals . cpe has also been used to treat pancreatic and prostate cancers in nude mice or in vitro by different research groups . reported that intratumoral injections of cpe in pancreatic cancer xenografts resulted in apparent tumor suppression and necrosis in mice , and that cpe treatment also caused an acute dose - dependent cytotoxic effect in pancreatic cancer cells in vitro . in prostate cancer , long et al . showed that the prostate cancer metastatic cells from the bone marrow were sensitive to cpe - mediated cytolysis in vitro . these two preclinical studies suggest that cpe may have potential as a novel therapy for primary and metastatic malignancies expressing claudin-3 and -4 . although the specificity and rapidity of cpe - mediated cytolysis may increase anticancer efficacy and reduce opportunity for the development of drug resistance , its clinical application encounters some challenges . since claudin-3 and -4 are expressed in some normal tissues such as prostate , lung , and the gastrointestinal tract , systemic toxicity is an important concern for cpe therapy . in this context , many investigators have chosen the local administration of native cpe to treat cancers . this approach , however , does not appear to be a good option for some metastatic cancers such as lung metastasis or multiple metastases . moreover , some adverse events have sometimes been observed even following the local administration of cpe during several studies [ 30 , 34 ] . furthermore , cpe is recognized as a virulence factor responsible for the pathophysiological responses associated with a common food poisoning , proinflammatory cytokine response and other human diseases . since cpe - associated foodborne illness is so common , many people already have serum antibodies against this toxin . it is unclear whether these serum cpe antibodies include neutralizing antibodies but cpe does contain at least one neutralizing epitope , present in the cpe binding domain . other challenges include determining optimal dosage and regimen , development of drug resistance , and long - term safety concerns . although the clinical application of cpe is limited by its potentially significant toxic side effects , the c - terminal binding domain of cpe ( c - cpe ) overcomes this drawback of cpe and has recently emerged as a promising cancer therapeutic agent due to its unique properties . for example , c - cpe can disrupt the paracellular tj barrier by binding to claudin-3 and -4 in the epithelia and thus improve drug delivery in a noncytotoxic fashion . it also has a smaller molecular size that might provide less immunogenicity than cpe . the paracellular tjs are the primary barrier to the transport of solutes from the apical surface to the core of cells . agent uptake via the paracellular pathway in the epithelia is considered an attractive route for the absorption of chemotherapies . given that claudin-3 and -4 are overexpressed in several cancers and are major components of cell tjs , their downregulation by c - cpe may prove a novel strategy for enhancing conventional chemotherapy delivery into claudin - positive cancer cells . our group recently investigated the efficacy of a combination therapy using a chemotherapeutic agent with c - cpe as compared to the single - agent chemotherapeutic agent . using three - dimensional and monolayer culture models and a xenograft mouse model of human eoc cells , we found that c - cpe enhanced the chemosensitivities of eoc cell lines to taxol or carboplatin at low concentrations in a claudin - dependent fashion . administration of c - cpe in combination with taxol significantly suppressed large tumor burdens by about 59% compared with control or taxol alone and showed no apparent toxic drawback of cpe as encountered in previous studies ( figure 4 ) . our study suggests that , at relatively low concentrations , c - cpe may enhance the sensitivity of eoc cells and other claudin - sensitive tumor cells to conventional chemotherapy and thus alleviate systemic side effects of the agents . indeed , c - cpe could be useful not only as an anticancer drug enhancer but also as a carrier to deliver a variety of toxins leading to a spectrum of new anticancer drugs of high selectivity . tnf- has been demonstrated to be an attractive antitumor agent in a variety of animal models but clinical application has been limited due to its failure to concentrate at the site of tumors and the development of severe side effects . to solve the problem , yuan et al . engineered a c - cpe - tnf fusion toxin that was > 6.7-fold more cytotoxic than free tnf to ovarian cancer cells expressing claudin-3 and -4 ; whereas the tnf component in the fusion was 5-fold less potent than free tnf , suggesting that c - cpe - tnf fusion may prevent or decrease the systemic side effects caused by tnf . besides ovarian cancer , saeki et al . fused c - cpe to the protein synthesis inhibitory factor ( psif ) derived from pseudomonas aeruginosa exotoxin a for breast cancer that expresses high levels of claudin-3 and -4 . the c - cpe - psif fusion selectively damaged claudin - expressing breast cancer cell lines , and repeated intratumoral injections significantly suppressed tumor size by 36% without causing apparent side effects in mice . these two studies indicate that c - cpe may be a useful carrier for delivering toxins to claudin - sensitive malignancies with higher anticancer potency and less systemic side effects . the advantages of this claudin - targeted c - cpe - based cancer therapy are significant : tumor - targeted therapy , less immune response , and an improved therapeutic potency not achieved with previous treatments . there remain challenges to be overcome , however , before we can see any major medical advances in treating cancer with c - cpe : ( 1 ) determining safe dosages and schedules , ( 2 ) choosing optimal administration routes , ( 3 ) avoiding potential immunogenicity , and ( 4 ) improving effectiveness for preventing and/or treating cancer metastases . therefore , further studies and clinical trials are required to determine whether c - cpe could be developed as a claudin - targeted novel therapeutic agent for the treatment of cancer . in addition to cancer treatment , c - cpe has been utilized to treat other medical conditions . for example , with the intention of developing a potent mucosal vaccination approach , a nasal vaccine of c - cpe - fused antigen has been prepared and applied in mice without mucosal injury and side effects . in addition , the ability of c - cpe to enhance paracellular permeability has been exploited by using this protein to increase drug absorption from the intestines . one potential issue regarding the use of c - cpe for increasing intestinal drug absorption could be possible gastrointestinal side effects such as diarrhea , due to increased paracellular permeability . however , c - cpe does not increase luminal fluid levels in rabbit ileal loops , possibly arguing against this concern .
### Summary: : clostridium perfringens enterotoxin ( cpe ) causes the symptoms associated with several common gastrointestinal diseases . cpe is a 35 kda polypeptide consisting of three structured domains , that is , c - terminal domain i ( responsible for receptor binding ) , domain ii ( responsible for oligomerization and membrane insertion ) , and domain iii ( which may participate in physical changes when the cpe protein inserts into membranes ) . native cpe binds to claudin receptors , which are components of the tight junction . the bound toxin then assembles into a hexameric prepore on the membrane surface , prior to the insertion of this oligomer into membranes to form an active pore . the toxin is especially lethal for cells expressing large amounts of claudin-3 or -4 , which includes many cancer cells . initial studies suggest that native cpe has potential usefulness for treating several cancers where claudin cpe receptors are overexpressed . however , some challenges with immunogenicity , toxicity , and ( possibly ) the development of resistance may need to be overcome . an alternative approach now being explored is to utilize c - cpe , which corresponds approximately to receptor binding domain i , to enhance paracellular permeability and delivery of chemotherapeutic agents against cancer cells . alternatively , c - cpe fusion proteins may prove superior to use of native cpe for cancer treatment . finally , c - cpe may have application for other medical treatments , including vaccination or increasing drug absorption . the coming years should witness increasing exploitation of this otherwise formidable toxin .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : cell fusion of hodgkin cells with each other or with other cells ( e.g. , macrophages ) has been suggested as a potential mechanism for rs cell generation . the latter could be excluded by molecular analysis of primary hrs cells and hence , endomitosis was postulated as the most favorable mechanism . however , endomitosis by definition describes mitosis without nuclear division leading to polyploidy ( > 4n ) , but not to multinuclearity ( fig . 1 ) . therefore , the proposed mechanism should have been called acytokinetic mitosis , which is defined as mitosis with nuclear division , but without cellular division ( fig . 1 ) the last stage of mitosis is the complete separation of both daughter cells called cytokinesis . dividing cells display the far majority ( > 95% ) in hl cell lines that also contain a rare population of giant cells ( < 5% ) . giant multinucleated rs cells develop from mononuclear hodgkin cells that undergo mitosis into two separate daughter cells followed by subsequent re - fusion ( 70% of giant cells ) . in the majority of cases , the two daughter cells were still connected by the midbody for hours after mitosis indicating incomplete cytokinesis . additionally , giant mononuclear hodgkin cells might develop via endomitosis ( 30% of giant cells ) . acytokinetic mitosis , defined as mitosis without cell division leading to multinuclearity , was not observed . in a recent study performing continuous single - cell tracking of hl cell lines by long - term time - lapse microscopy , we intriguingly found that re - fusion of daughter cells is the main route to giant hrs cell formation ( fig . 1 ) . of note , hl cell lines contain about 5% of giant hrs cells and we focused on the development of this rare subpopulation at single - cell resolution in real - time . we observed that the majority of giant cell progenitors divided into two daughter cells that often remained separated for many hours , before they subsequently re - fused and developed into giant cells over time . thereby , re - fused cells tremendously increased in cell size accompanied by a highly prolonged lifetime . moreover , we monitored nuclear morphology in real - time by combining time - lapse microscopy with lentivirus - mediated fluorescence labeling of hrs cells . as acytokinetic mitotic events were not observed , it became obvious that only re - fusion leads to multinuclearity and therefore to the formation of giant cells of the rs - type . on the contrary , approximately 30% of giant cells developed without a preceded re - fusion event . as the nuclear mass increased by time in these giant hodgkin cells , it might be speculated that these cells undergo endomitosis during their development . the study was extended to single - cell tracking of hrs cells expressing rfp - tubulin to answer the question , if the re - fusing sister cells are completely separated . in the majority of cases , re - fusion was preceded by an incomplete cytokinesis , visualized by a microtubule bridge between the daughter cells ( figs . 1 and 2 ) . thus , rs cell generation is neither due to cell fusion of unrelated hodgkin cells nor to endomitosis , but is mediated by re - fusion of daughter cells that underwent mitosis . moreover , by single - cell tracking of nuclear fluorescently labeled hrs cells , we were able to identify that multinucleated cells are able to undergo multi - daughter divisions also followed by re - fusion . in most cases , only 2 of the daughter cells re - fused , whereas the remaining cell died . however , also re - fusion of multiple daughter cells could be observed . after the nuclear membrane is disintegrated , microtubules attach to the sister chromatids to form the mitotic spindle that splits the chromatids aligned at the metaphase plate to form two identical nuclei . thereby , a contractile actin ring invaginates at the site of the previous metaphase plate . this leads to condensation of spindle - derived microtubules , which form a so - called midbody ( marked with an arrowhead ) as last connection between dividing cells . disassembly of the midbody completes cytokinesis and thereby the cellular division . during formation of giant rs cells , the midbody connection between dividing cells persists for many hours indicating an incomplete cytokinesis , which in turn leads to re - fusion of daughter cells . alpha - tubulin was chosen as marker to determine complete cytokinesis , because the midbody , which is derived from the mitotic spindle , displays the last connection between dividing cells . the midbody develops after mitosis and during late cytokinesis by condensation of microtubules that pass the area of the former metaphase plate ( fig . 2 ) . importantly , the midbody is only visible for minutes in proliferating cells undergoing mitosis , but in case of the studied re - fusion events of rs - cell progenitors , the midbody persisted for several hours until re - fusion of daughter cells . the presented study unraveled a novel route for the generation of multinucleated rs cells from mononucleated hodgkin cells . rs cells neither develop by endomitosis nor acytokinetic mitosis , but by re - fusion of daughter cells . as visualization of the microtubule network revealed that incomplete cytokinesis precedes re - fusion , one might speculate that re - fusion might be based on an intrinsic mitotic failure . in concordance , mutations of the midbody protein klhdc8b in hl were recently reported . furthermore , downregulation of this gene in hela cells induced increased frequencies of binucleated cells . therefore , upcoming studies will address the functional role of midbody - associated proteins in hrs cells to further illuminate the molecular basis of the described re - fusion phenomenon . understanding the mechanisms involved in fusion - based rs - cell formation could lead to new therapeutic intervention strategies and might have implications beyond hl , as rs - like cells are also regularly seen in other lymphoproliferative disorders , including infectious mononucleosis , b - cell chronic lymphocytic leukemia or t - cell lymphomas .
### Summary: : multinucleated giant tumor cells are frequently observed in tissue sections of lymphoma patients . in hodgkin lymphoma ( hl ) , these cells are pathognomonic for the disease and named reed - sternberg ( rs ) cells . despite the well - described disease - promoting functions of rs cells , their development has remained obscure . we addressed this open question by continuous live cell imaging to observe the generation of rs cells . single - cell tracking of hl cell lines revealed that rs cells develop from mononucleated progenitors that divide and subsequently re - fuse , before they grow and become multinucleated giant cells . thus , rs cell generation is neither due to cell fusion of unrelated hodgkin cells nor to endomitosis , as previously suggested . in the majority of cases , re - fusion of daughter cells was preceded by an incomplete cytokinesis , visualized by a persistent microtubule bridge connecting the cells . this surprising finding describes a novel mechanism for the formation of multinuclear giant cells with potential relevance beyond hl .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : myocardial infarction ( mi ) is one of the major causes of death and disability worldwide and may be a major catastrophic event leading to sudden death or hemodynamic deterioration . a significant proportion of patients with mi is in working age and returning to work after illness is associated with better quality of life . a large number of patients with acute mi , despite being physically able to work , do not return to work because of some complications such as depression and anxiety leading to changing on lifestyle and decreasing the patients health - related quality of life ( hrqol ) . myocardial ischemia and the possibility of fatal dysrhythmias increase the level of stress and endangering the adjustment process and future morbidity of discharged patients . in some studies on patients with heart attack have shown that their feeling and attitude to heart disease ( illness perception ) strongly impact on recovery process . counting empirical evidence from a range of disease groups ( e.g. , cancer , psoriasis , asthma , diabetes , hemophilia , and chronic fatigue syndrome ) suggests that illness perception is a key determinant of recovery and may represent a potential target for clinical intervention . the association between these personal illness perceptions and recovery is based on a theory of self - regulation that posits individuals as active problem solvers who , in response to illness and other health threats , develop parallel cognitive and emotional representations of the threat . one prior study ( n = 105 ) investigated the prospective association between illness perception and depression in a group of mi patients and found that changes in beliefs regarding angina and mi over 1 year made near significant contributions ( p = 0.06 ) to the variance in depressive symptomatology on the hospital anxiety and depression scale ( hads ) . illness perception may impact on other outcomes including hrqol , hrqol is increasingly recognized as a valued outcome in mi patients and is reported to predict cardiac end points . in a study by yan et al . on 124 patients admitted with the first acute mi were randomized to receive routine care or routine care plus a telephone follow - up intervention , which consist of a predischarge education and three telephone follow - up instructions . at the 6 and the 12 week after discharge , patients in the intervention group had significantly positive perceptions about symptoms of mi and better lifestyle after . this study was designed to investigate the possible effects of authors developed brief , practical , easily implementable , and bedside illness perception improvement intervention on quality of life , anxiety , and depression in iranian mi patients . these multicenter , parallel groups randomized controlled trial study was done to compare quality of life , anxiety , and depression in patients with mi who discharged from hospital undergone an illness perception improvement intervention ( study group ) to the routine discharged patients ( control group ) . inclusion criteria were patients who have chest pain lasts at least 20 min or presence of pathological changes indicative of ischemia in the electrocardiographic waves or increasing in cardiac enzymes ( diagnostic criteria of mi ) . those with myocardial infarct secondary to bypass surgery or angioplasty , a history of psychiatric disorders ( anxiety or depression ) , treated depression or anxiety , and substance abuse or dependence were not intended to the study . intervention group was educated to better understand of disease process by a resident of psychiatry and a clinical psychologist , who were trained under the supervision of a cardiologist . intervention was done in three half - an - hour individual and interactive sessions in 3 consecutive days at the bedside of patients , and the control group do not receive any special educational program ( the current method in the hospital ) . in the first session , the patients requested to explain their beliefs regarding the causes of mi and wrong beliefs were described and modified by trainers . the second session implemented to checking the current lifestyle and education regarding healthy lifestyle of patient with mi , and the last session was about the signs of a recovery period , changing the lifestyle to preventing from recurrence of mi , importance of using prescribed drugs regularly , and the role of the partner in the process of recovery . quality of life , anxiety , and depression were measured as the base at the 13 days of admission to hospital , and then 1.5 and 3 months after intervention . participants were recruited between august and december 2014 from chamran , alzahra , and khorshid hospitals in isfahan and shahidbeheshti and milad hospitals in kashan and seyedalshohada hospital in aram in iran . all patients who were hospitalized for a definite mi diagnosed by a cardiologist at this time framework were eligible for participation . sixty - five patients were contacted , 17 patients declined to participate and 48 cases included in the study and allocated with a simple random sampling method in two groups of intervention and control ( 24 cases in each group ) . the study received ethics approval from the relevant institutional review committees , and all participants gave written informed consent . this short questionnaire evaluates the anxiety and depression in medically ill patients by to removing the physical symptoms and focusing on psychological symptoms . anxiety and depression scale consists of 14 items and two subscales of anxiety and depression . each item is a set of 4-point calibration , and a score of 8 or greater on one or both of the subscales indicates the presence of a depressive or anxiety disorder . the developers aimed to discard all ambiguous somatic symptoms such as dizziness and lethargy and instead comprised the depression subscale around the psychopathology of anhedonia and the anxiety subscale based on the cognitive symptoms of anxiety . the hads has been found to perform reliably in psychiatric , nonpsychiatric , and well populations as a screening tool ; however , its use as a diagnostic instrument for research may be inappropriate . in a study in iranian patients , the iranian version of the hads was found to be acceptable to almost all patients ( 99% ) . cronbach 's alpha coefficient ( to test reliability ) has been found to be 0.78 for the anxiety subscale and 0.86 for the depression subscale , respectively . the questionnaire included 26 questions on a likert scale of 15 different aspects of the person 's quality of life . one question measures the total sense of person to own life and other questions measure the feeling and behavior in the last 2 weeks such as ( 1 ) the field of health and physical health ( physical activity , substance dependence and complementary medicines , mobility , pain and discomfort , sleep , rest , and ability to work ) ; ( 2 ) psychological ( feelings toward body appearance , positive and negative emotions , learning , thinking , memory , concentration , confidence , and personality traits spirit ) ; ( 3 ) social relationships ( personal relationships , social support , and sexual activity ) ; ( 4 ) the social environment ( financial resources , liberty and physical security , access to health and social care , home environment , opportunities , access to information , and the opportunity to participate in social activities ) and physical environment ( pollution , and transportation ) . the psychometric properties of these instruments have been confirmed as acceptable in most of these populations . intraclass correlation and cronbach 's alpha values were achieved more than 0.70 in all areas , but in the sphere of social relations was 0.55 . a short form of illness perceptions questionnaire brief was used to basic evaluate and follow - up of illness perception score . five subscales measur cognitive reaction to disease including perceptions of the consequences , disease duration , self - control , controlled by treatment , and cognitive symptoms . one subscale measures capability to understand the condition and cause direction which is an open question . this questionnaire has been reported as a reliable and valid instrument to measure the illness perception in various conditions . analysis was done using descriptive statistics such as mean and standard deviation and analytical statistics such as anova repeated measure by spss 20 software . these multicenter , parallel groups randomized controlled trial study was done to compare quality of life , anxiety , and depression in patients with mi who discharged from hospital undergone an illness perception improvement intervention ( study group ) to the routine discharged patients ( control group ) . inclusion criteria were patients who have chest pain lasts at least 20 min or presence of pathological changes indicative of ischemia in the electrocardiographic waves or increasing in cardiac enzymes ( diagnostic criteria of mi ) . those with myocardial infarct secondary to bypass surgery or angioplasty , a history of psychiatric disorders ( anxiety or depression ) , treated depression or anxiety , and substance abuse or dependence were not intended to the study . intervention group was educated to better understand of disease process by a resident of psychiatry and a clinical psychologist , who were trained under the supervision of a cardiologist . intervention was done in three half - an - hour individual and interactive sessions in 3 consecutive days at the bedside of patients , and the control group do not receive any special educational program ( the current method in the hospital ) . in the first session , the patients requested to explain their beliefs regarding the causes of mi and wrong beliefs were described and modified by trainers . the second session implemented to checking the current lifestyle and education regarding healthy lifestyle of patient with mi , and the last session was about the signs of a recovery period , changing the lifestyle to preventing from recurrence of mi , importance of using prescribed drugs regularly , and the role of the partner in the process of recovery . quality of life , anxiety , and depression were measured as the base at the 13 days of admission to hospital , and then 1.5 and 3 months after intervention . participants were recruited between august and december 2014 from chamran , alzahra , and khorshid hospitals in isfahan and shahidbeheshti and milad hospitals in kashan and seyedalshohada hospital in aram in iran . all patients who were hospitalized for a definite mi diagnosed by a cardiologist at this time framework were eligible for participation . sixty - five patients were contacted , 17 patients declined to participate and 48 cases included in the study and allocated with a simple random sampling method in two groups of intervention and control ( 24 cases in each group ) . the study received ethics approval from the relevant institutional review committees , and all participants gave written informed consent . this short questionnaire evaluates the anxiety and depression in medically ill patients by to removing the physical symptoms and focusing on psychological symptoms . anxiety and each item is a set of 4-point calibration , and a score of 8 or greater on one or both of the subscales indicates the presence of a depressive or anxiety disorder . the developers aimed to discard all ambiguous somatic symptoms such as dizziness and lethargy and instead comprised the depression subscale around the psychopathology of anhedonia and the anxiety subscale based on the cognitive symptoms of anxiety . the hads has been found to perform reliably in psychiatric , nonpsychiatric , and well populations as a screening tool ; however , its use as a diagnostic instrument for research may be inappropriate . in a study in iranian patients , the iranian version of the hads cronbach 's alpha coefficient ( to test reliability ) has been found to be 0.78 for the anxiety subscale and 0.86 for the depression subscale , respectively . the questionnaire included 26 questions on a likert scale of 15 different aspects of the person 's quality of life . one question measures the total sense of person to own life and other questions measure the feeling and behavior in the last 2 weeks such as ( 1 ) the field of health and physical health ( physical activity , substance dependence and complementary medicines , mobility , pain and discomfort , sleep , rest , and ability to work ) ; ( 2 ) psychological ( feelings toward body appearance , positive and negative emotions , learning , thinking , memory , concentration , confidence , and personality traits spirit ) ; ( 3 ) social relationships ( personal relationships , social support , and sexual activity ) ; ( 4 ) the social environment ( financial resources , liberty and physical security , access to health and social care , home environment , opportunities , access to information , and the opportunity to participate in social activities ) and physical environment ( pollution , and transportation ) . the psychometric properties of these instruments have been confirmed as acceptable in most of these populations . the psychometric properties of the persian version were done by nejat et al . intraclass correlation and cronbach 's alpha values were achieved more than 0.70 in all areas , but in the sphere of social relations was 0.55 . a short form of illness perceptions questionnaire brief was used to basic evaluate and follow - up of illness perception score . five subscales measur cognitive reaction to disease including perceptions of the consequences , disease duration , self - control , controlled by treatment , and cognitive symptoms . one subscale measures capability to understand the condition and cause direction which is an open question . this questionnaire has been reported as a reliable and valid instrument to measure the illness perception in various conditions . this short questionnaire evaluates the anxiety and depression in medically ill patients by to removing the physical symptoms and focusing on psychological symptoms . anxiety and each item is a set of 4-point calibration , and a score of 8 or greater on one or both of the subscales indicates the presence of a depressive or anxiety disorder . the developers aimed to discard all ambiguous somatic symptoms such as dizziness and lethargy and instead comprised the depression subscale around the psychopathology of anhedonia and the anxiety subscale based on the cognitive symptoms of anxiety . the hads has been found to perform reliably in psychiatric , nonpsychiatric , and well populations as a screening tool ; however , its use as a diagnostic instrument for research may be inappropriate . in a study in iranian patients , the iranian version of the hads cronbach 's alpha coefficient ( to test reliability ) has been found to be 0.78 for the anxiety subscale and 0.86 for the depression subscale , respectively . the questionnaire included 26 questions on a likert scale of 15 different aspects of the person 's quality of life . one question measures the total sense of person to own life and other questions measure the feeling and behavior in the last 2 weeks such as ( 1 ) the field of health and physical health ( physical activity , substance dependence and complementary medicines , mobility , pain and discomfort , sleep , rest , and ability to work ) ; ( 2 ) psychological ( feelings toward body appearance , positive and negative emotions , learning , thinking , memory , concentration , confidence , and personality traits spirit ) ; ( 3 ) social relationships ( personal relationships , social support , and sexual activity ) ; ( 4 ) the social environment ( financial resources , liberty and physical security , access to health and social care , home environment , opportunities , access to information , and the opportunity to participate in social activities ) and physical environment ( pollution , and transportation ) . the psychometric properties of these instruments have been confirmed as acceptable in most of these populations . intraclass correlation and cronbach 's alpha values were achieved more than 0.70 in all areas , but in the sphere of social relations was 0.55 . a short form of illness perceptions questionnaire brief was used to basic evaluate and follow - up of illness perception score . five subscales measur cognitive reaction to disease including perceptions of the consequences , disease duration , self - control , controlled by treatment , and cognitive symptoms . one subscale measures capability to understand the condition and cause direction which is an open question . this questionnaire has been reported as a reliable and valid instrument to measure the illness perception in various conditions . analysis was done using descriptive statistics such as mean and standard deviation and analytical statistics such as anova repeated measure by spss 20 software . the mean age of the patients in the intervention group ( 17 males , 7 females ) was 54.8 7.6 years and in control group ( 19 males , 5 females ) was 49.9 10.6 years . comparison of demographic variables in two groups the mean duration of returning to work was 28.7 8.1 days in intervention groups and 46 7.6 days in control group that this difference was statistically significant ( p < 0.001 ) . table 2 shows quality of life subscales scores before and over 3 months follow - up after intervention . comparison of quality of life subscales scores over 3-month follow - up after intervention mean of anxiety and depression score was significantly decreased in intervention groups compared to control group after 1.5 and 3 months [ table 3 ] . comparison of anxiety and depression scores over 3-month follow - up after intervention mean of illness perceptions score was significantly decreased in intervention groups compared to control group after 3 months [ table 4 ] . forty - eight patients with a recent mi had been included in this trial in two equal groups of intervention and control . setting the patients on educating the patients to planning exercise schedules , modifying wrong beliefs , changing lifestyle , and a date to return to work into an action plan , together with reinforcing controllable causal attributions were the main component of the intervention in this study . emphasizing on the nature of atherosclerosis and muscle damage , modifying wrong beliefs , and explaining that heart disease is a chronic condition and need to change lifestyle the intervention significantly improved the speed of return to work , physical health , depression and anxiety , and illness perception after 3 months compared to the control group . in other studies , it was found that increasing illness perception can lower patient anxiety and depression and improved patients information regarding mi . in these studies , it was indicated that patients who received the intervention felt more prepared to leave the hospital and reported higher intentions to attend rehabilitation classes than the control group . they reported greater increases in exercise and fewer calls to the general practitioner or hospital relating to their heart condition which could obtain by the following patients in our study . in terms of illness perceptions , the intervention increased patients feeling of coherence about their condition , and this remained over the course of the 3-month follow - up . the intervention also significantly strengthened patients causal attributions for the heart attack to high cholesterol and lack of exercise in comparison to the control group . these changes in coherence and causal attributions gave the patients a coherent illness model on which to base their recovery and modifiable causal attributions and made them to have more physical health score and lowered anxiety and depression . regarding quality of life as shown in table 2 , if the physical health score in intervention group is better on follow - up , the quality of life scores decreased in both intervention and control groups in all domains during 3 month follow - up in comparison to the base scores . this finding shows that mi as a catastrophic accident has a serious side effect on all aspects of the life of affected patients and returning to pre - mi situation needs more time and rehabilitations . causal attributions to internal and controllable factors have been linked to faster return to work and improving depression and anxiety about the disease and changed lifestyle . in a previous research , attributions to fate and luck predicted poor prognosis and lowered functioning in 12 years following of a group of mi patients . previous studies showed illness perceptions are well recognized as a target for treatment , and illness perception interventions have shown promising results for patients with acute and chronic conditions . it is useful to consider why , in contrast to the previous trials , control perceptions were not changed . one possible reason is that the patient education about their disease is not performed routinely in hospitals which were studied and this fact is due to the high patient load in these centers and not having a systematized program of education after mi . moreover , heart disease has been believed as disaster event in iran , which can influence patient 's lifestyle more than the other diseases . the causal attributions have been explained much more than hereditary factors which may reflect a greater understanding of the cause of the patient 's condition that could reduce anxiety associated with not knowing what caused the event . having a solid causal framework could also increase the match between illness perceptions and the need for treatment and lifestyle modification . while a positive family history can not be changed , recognizing a high genetic risk may make the patient more motivated to reduce other risk factors that are modifiable , such as high cholesterol , through exercise , diet , and medication . in this study , this demonstrates that a brief education regarding illness perception for the mi patient can improve their understanding of the mi and lessen their anxiety and depression about the condition and improves them to return to work faster . moreover , our study was based on bedside intervention which can have more influence on the patient 's illness perception , also the length of intervention classes in our study was half - an - hour for 3 consecutive days . however , in other studies , the method of intervention was different that lead to have a less positive influence on the illness perceptions . used one half - hour patient - and - spouse session , and williams et al . moreover , increasing illness perception could be more cost benefits due to decreasing the rehospitalization , mortality , and increase objective health outcomes by preparing them to return to work faster . recent studies in primary care highlight the importance of patients beliefs and emotional responses to their illness as being important in influencing their satisfaction with the consultation , reassurance following negative medical testing , and future health - care use . recent research shows illness perceptions to have associations with a number of outcomes in chronic illness including self - management behaviors and quality of life . as yet , however , few interventions have been developed designed to change illness perceptions and improve illness outcomes . illness perceptions influence the way , in which patients cope and their self - management of the illness . illness perceptions can be assessed quite easily and directly , they inform health - care providers about the psychosocial responses of patients toward their illness , they are responsive to change in the clinical encounter or through self - management intervention training . exploring patient 's illness perceptions , therefore , is a crucial component of good clinical care . first , patients were selected from different hospitals in isfahan and kashan cities , so the results of the study may have limited generalizability . second , further research should extend the follow - up period to assess the long - term outcomes of the intervention . first , patients were selected from different hospitals in isfahan and kashan cities , so the results of the study may have limited generalizability . second , further research should extend the follow - up period to assess the long - term outcomes of the intervention . training mi patients to understand the disease in three half - an - hour sessions for 3 consecutive days can decrease the duration of returning to work , anxiety and depression , and increase illness perceptions which can make a better outcome . however , our results showed that the quality of life of patients has not been affected as much as other studied variable which needs long - term follow - up . in other words , decreasing the rate of anxiety and depression in mi patients may lead to increase the quality of life which needs to be followed up for several months or years . rbs : contributed in the conception of the work , design of the work , conducting the study and agreed for all aspects of the work.mm : contributed in the data collection , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.ghrkh : contributed in the conception of the work , study design , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.mrm : contributed in the study design , data analysis , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work.ep : contributed in the data collection , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . rbs : contributed in the conception of the work , design of the work , conducting the study and agreed for all aspects of the work . mm : contributed in the data collection , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . ghrkh : contributed in the conception of the work , study design , conducting the study , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . mrm : contributed in the study design , data analysis , revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work . ep : contributed in the data collection , drafting and revising the draft , approval of the final version of the manuscript , and agreed for all aspects of the work .
### Summary: : background : myocardial infarction ( mi ) is one of the major causes of death and disability worldwide , which can reduces quality of life in patients . some disabilities are depression and anxiety which delay returning to work . the aim of this study was to evaluate the effect of illness perception focused intervention on quality of life , anxiety , and depression in mi patients.materials and methods : a randomized controlled trial study of 48 recently hospitalized mi patients was conducted ( 24 in intervention group and 24 in control group ) . intervention group was trained to understand the disease by a mental health counselor in three half - an - hour sessions for three consecutive days . data were collected from three questionnaires : hospital anxiety and depression scale , the world health organization quality of life questionnaire ( short form ) , and illness perceptions questionnaire brief at admission , 1.5 , and 3 months postdischarge . data were analyzed with anova repeated measure.results:the mean duration of returning to work was 28.7 8.1 days in intervention groups and 46 7.6 days in control group which was statistically significant ( p < 0.001 ) . moreover , anxiety , depression , and illness perceptions score were significantly decreased in intervention groups which were 8.3 3.3 , 6.8 3.5 , and 36.5 5 in intervention groups and 15.8 2.1(p < 0.001 ) , 17.1 2.3 ( p < 0.001 ) , and 41.9 4 ( p < 0.001 ) in control group , respectively . mean of quality of life subscales scores just physical health subscale showed a significant reduction after 3 months in the control group.conclusion:training mi patients to understand the disease in three half - an - hour sessions for 3 consecutive days can decrease the duration of returning to work , anxiety and depression , and increase illness perceptions which can make a better outcome .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : while it is well - recognised that chronic rheumatic heart disease results from an autoimmune response following infection with lancefield group a , -haemolytic streptococci in childhood or early adolescence , the influences through which some people develop this adverse reaction to a common organism remain elusive . in the western world acute rheumatic fever and chronic rheumatic heart disease however , the disease remains a major public health problem in both resource poor countries and among the poor indigenous populations of some wealthy countries . historically , rheumatic fever and its cardiac sequelae have been consistently and strongly linked with poor living conditions . surveys carried out in the uk in the earlier years of the twentieth century demonstrated as much as a 30-fold gradient in incidence between deprived and affluent urban areas , and similar gradients are still found in resource - poor countries . however , the processes by which poverty increases susceptibility to this disease are not understood and are not easily explained by the biology of streptococcal infection . because rheumatic fever following streptococcal infection tends to occur only after the age of five , it is likely that poverty exerts its effects prior to this during early childhood . at this stage adverse influences are known to result in lifelong changes in morphology and physiology , a process is known as programming or developmental plasticity . these changes are thought to be important in predisposing to later life disease and underlie the developmental origins hypothesis , which proposes that many common diseases of adult life have their origins during early development . this hypothesis had its origins in epidemiological studies demonstrating that markers of a poor early environment such as low birthweight or poor growth in early infancy correlate with the occurrence of a variety of later life conditions ranging from cardiovascular disease or stroke to chronic bronchitis . the hypothesis has been strongly supported by prospective clinical studies and experimental interventions in animal models . these studies show that the epidemiological associations are not merely due to the persistence of poor living conditions throughout the lifecourse . although there are suggestions that rheumatic heart disease may be primed by conditioning factors operating in early life , for example viruses , nutritional factors , or recurrent exposure to haemolytic streptococci , it is not known whether the disease has a developmental origin although two recent studies have suggested that umbilical cord length , a possible marker of prenatal vascular function , is linked with the disease . the objective of the study was to investigate the possible role of developmental influences in rheumatic heart disease . we used rheumatic heart disease mortality data as an index of disease prevalence and evaluated the geographical correlations with previous infant mortality , an indicator of health in infancy . the study was based on a historical dataset of mortality in england and wales collected between 1968 and 1978 in the 212 local authority areas into which the country was formerly divided . this dataset was compared with infant mortality records , which were maintained from 1911 onwards and included details of mortality at different ages and from different causes . analyses of mortality from coronary heart disease and pulmonary disease based on this dataset have been published and although the study had details of a large number of deaths attributed to chronic rheumatic heart disease , no separate analysis of this condition has been carried out . the office of national statistics made available extracts from all death certificates in england and wales during 196878 , the period covered by the eighth revision of the international classification of diseases ( icd ) . death rates were based on the 1971 census and are expressed as standardised mortality ratios . in england and wales infant mortality rates were recorded from 1911 onwards . the data were divided into neonatal mortality ( deaths during the first month of life ) and postneonatal mortality ( deaths from one month to one year ) numbers of infant deaths by specific causes were published from 1921 and the current analysis is based on the years 192125 . causes of infant deaths were divided into five groups using woolf 's classification congenital , bronchitis and pneumonia , infectious diseases , diarrhoea , and others . adult mortality from chronic rheumatic heart disease ( icd 393398 ) was compared with infant mortality in the four main geographical groupings used by the registrar general that is county boroughs ( larger towns ) , london boroughs , urban areas ( metropolitan boroughs and urban districts outside london ) , and rural areas . these groups divide england and wales into 212 local authority areas comprising 80 county boroughs , 15 london boroughs , 59 urban areas and 58 rural areas . although data on the social class distribution were not available in these early censuses , they did include extensive data on housing . these comprised the number of rooms in each dwelling , the number of families per dwelling , the family size , and the number of rooms per person given separately for all families and families living in houses with up to 9 rooms , in order to exclude people living in boarding houses or institutions . the census reports also provided data on the population density expressed as the number of people per acre . standardised mortality ratios were calculated to allow for geographical differences in the age and sex distribution of the population such that the overall mean for england and wales was 100 . we studied deaths in the 5574 age group as this was the approximate age range of the generation born on or after 1911 and excludes deaths in older age groups where the cause is less likely to have been accurately ascertained . we used poisson regression to model the standardised mortality ratios ( smrs ) for chronic rheumatic heart disease during 196878 . poisson regression weights the analysis appropriately to allow for variation in population size across the 212 areas . the numerator of the smr is an observed number of cases which is fitted using a poisson distribution and a log link with the log of the expected number of cases as an offset . the regression coefficients of the model when exponentiated represent the multiplicative increase in smr per unit change in the predictor variable . during 196878 there were a total of 37,321 deaths from rheumatic heart disease , a rate of 338.6 per million ( 301.6 in men and 338.6 in women ) . of these 16,813 were due to mitral valve disease , 9734 were aortic and 3687 combined aortic and mitral disease . the remaining deaths were due to rheumatic carditis affecting other structures or the site of the disease was unspecified . over the 11 year period the death rate fell from 372.8 to 288.3 per million . age and sex standardised death rates were highest in the london and county boroughs ( standardised mortality rates ( smrs ) 112.8 and 110.2 respectively ) and were lowest in the urban and rural districts ( smrs 93.0 and 84.7 respectively ) . figures 1 and 2 show the geographical distribution of the deaths in the men and women respectively and illustrate the similarity of trends in both genders . a pattern of high mortality rates ( coloured red ) is observed in the major urban concentrations , notably in south wales , london , and the traditional industrial areas of the midlands , the north west and north east . the infant mortality rate in england and wales during 1911 - 15 was 102.5/1000 births and fell to 72.1/1000 in 192125 ( table 1 ) . table 1 also shows the specific causes of infant mortality in 192125 and the data on population density and crowding from the 1921 census . table 2 shows the correlation coefficients between infant mortality in the three time periods and the standardised mortality rate for chronic rheumatic heart disease at age 5574 . in the combined group of all 212 local authority areas , the correlation coefficients were high in all three time periods ( r = 0.72 to 0.73 ) , and the correlations with infant mortality were consistently higher in the postneonatal than the neonatal periods . when the correlations were analysed according to the geographical groups i.e. , county boroughs ( cbs ) , london boroughs ( lbs ) , urban areas and rural areas , the correlations were stronger in the cbs and lbs , although they were still evident in the urban and rural areas . in a multiple regression analysis with mortality from chronic rheumatic heart disease as the independent variable and both neonatal and postneonatal mortality as the independent variables , only the effect of postneonatal mortality remained statistically significant . table 2 also shows that infant deaths from bronchitis and diarrhoea correlated more highly with adult chronic rheumatic heart disease than did infant deaths in any of the other four cause groups . again these trends were paralleled in the analysis divided by geographical grouping ( table 2 and 3 ) . because of the strong correlations between infant mortality due to infectious causes and adult mortality from rheumatic heart disease , we examined the effect of early overcrowding and population density ( table 3 ) . the strongest associations were between the number of rooms per person in 1921 , either in all houses combined ( r = 0.69 ) or restricted to houses with up to nine rooms ( r = 0.66 ) . the effects were evident in the separate groupings of cbs , lbs and urban and rural districts . multiple regression models were used to explore the effects of early infection and crowding ( table 4 ) . in models with chronic rheumatic heart disease as the dependent variable and infant mortality due to bronchitis ( model 1 ) or diarrhoea ( model 2 ) together with the number of persons per room and persons per family ( the only measures of overcrowding which remained statistically significant in the analysis ) as independent variables , both the influence of infection and overcrowding remained strongly statistically significant although the relative risk of both factors were reduced . however , in both models the effects of diarrhoea and bronchitis had by far the strongest influence on disease mortality . we have shown that adult mortality from chronic rheumatic heart disease shows a strong correlation with past infant mortality rates , a trend which were observed in all three time periods , in all age groups and in the different geographical groupings . the correlations were consistently much stronger with postneonatal mortality than with neonatal mortality ; detailed information on the five major causes of infant mortality showed that areas with high mortality from diarrhoea or bronchitis were those who had the highest subsequent mortality from rheumatic heart disease . the adults dying from rheumatic heart disease were aged 55 to 74 and were , therefore , born between 1894 and 1923 and although the mean date of birth , 1908 , is somewhat prior to the years in which the infant mortality data were collected , the long - term stability of the correlations in table 2 and the high degree of correlation between the infant mortality rates between 1911 and 1921 ( r>0.9 ) support the validity of the findings . although mortality from rheumatic heart disease is relatively uncommon , it has been widely used as an indicator of the incidence of the disease as both geographical differences and the marked decline in disease incidence are paralleled by mortality statistics . the mortality rate has been estimated at 1.5% per year , a figure based on prospective studies from north america and the united kingdom . although historically most deaths were registered on the basis of clinical criteria , these are surprisingly accurate . a study of death certification in the united states suggest that 61% were correctly classified . it is unlikely that misclassification of the cause of death could result in the strong correlations seen in table 2 . it could also be argued that correlations between infant mortality rates and death rates from heart disease many decades later could be misleading because of population movements . however during the time period in question , the overwhelming majority of migration occurred over a short distance with only a small minority migrating significant distances . furthermore , an analysis of over 2 million death certificates between 1969 and 1972 showed that the risk of major mortality was more strongly related to the place of birth than the place of death . the observation that the same areas of the uk which had high infant mortality rates early in the 20 century were those with high mortality from rheumatic heart disease some 50 to 60 years later raises the possibility that adverse influences in early childhood may be involved in determining susceptibility to developing rheumatic fever in childhood and subsequent valvular heart disease . the correlations were consistently much stronger with postneonatal mortality ( deaths after the first month of life ) than with neonatal mortality suggesting the influence of the postnatal environment rather than biological factors such as maternal health and the quality of the intrauterine environment , which are important determinants of early postnatal mortality . these findings contrast with other major diseases of adult life such as stroke , which was related to neonatal mortality , chronic bronchitis , which was related to postneonatal mortality and ischaemic heart disease , which was related to both . longitudinal studies in finland and sweden , which show either no association or a weak association between birthweight or other measures of size at birth and a diagnosis of rheumatic heart disease in adult life , also suggest that prenatal factors , with the exception of cord length , are not major factors influencing disease susceptibility . a major finding of this study is that past infant mortality due to infection , particularly respiratory mortality , correlated more closely with adult mortality from rheumatic heart disease than did other causes of past infant death ( table 2 and figure 3 ) . it is possible that these correlations are due to a direct influence of early infection on the risk of developing rheumatic fever and rheumatic heart disease . this is biologically plausible as there is evidence that infections can directly cause organ damage . in children acute infections lead to vascular endothelial damage , which may persist for at least a year . this finding may be relevant to rheumatic heart disease as there is increasing suspicion that the endothelial response to autoimmune - mediated injury is an important determinant of whether there is progression to clinically evident heart disease . it is also possible that the close geographical relationship between infant mortality from respiratory infection and adult rheumatic heart disease depends on the persistence of environmental factors that predispose to both infectious disease in infancy and facilitate the spread of streptococcal throat infection during childhood or adolescence . the risk of infant respiratory infection is reduced by breastfeeding and increased by a number of familial factors such as parental smoking , air pollution , overcrowding , or an attack of bronchitis or pneumonia in a sibling . while there is less epidemiological data on factors which facilitate the spread of group a , -haemolytic streptococcal infection , close person to person contact with infected nasopharyngeal or oropharyngeal mucosal secretions are important and there is known to be an effect of overcrowding . this was demonstrated in the classical studies of military barracks during the 1950s , which showed higher rates of acquisition of streptococcal infections when beds were moved closer together . in our study we found higher disease rates in the larger urban areas ( figures 1 and 2 ) , which is consistent with an effect of overcrowding . in addition , we found strong , statistically significant correlations between adult mortality from rheumatic heart disease and measures of overcrowding such as the number of rooms per person ( table 3 ) . however , a multiple regression analysis ( table 4 ) showed that the association between infant mortality due to diarrhoea or bronchitis and adult rheumatic heart disease although reduced in strength persisted after adjustment for the level of overcrowding , suggesting that while overcrowding had an independent effect it could not itself explain the correlations in table 2 . our findings therefore provide support for the hypothesis that the susceptibility to chronic rheumatic heart disease has its origins in infancy . while they do not indicate a specific aetiology , the strong associations with early infectious disease and particularly with infant bronchitis raise the possibility that these early infections may act as a priming process increasing susceptibility to subsequent rheumatic fever and rheumatic heart disease . alternatively , they suggest future research should address the environmental factors that are linked both with infection in infancy and the subsequent liability to heart disease . this is now known to predispose to mortality from infant bronchitis and also has well - described immunomodulatory effects , which could predispose to the autoimmune processes underlying rheumatic heart disease .
### Summary: : background : the reason why some individuals but not others are susceptible to rheumatic fever and chronic rheumatic heart disease is not understood . because of the substantial evidence that poverty is an important determinant of the disease and must operate in early life , we have investigated the role of the early environment in an ecological study using 20th century mortality as an index of disease prevalence . methods : we analysed 37,321 deaths from rheumatic heart disease in england and wales during 196878 . we compared the geographical distribution of deaths with previous infant mortality records from 1911 onwards . these records included details of mortality at different ages and from different causes . they also included data on housing and population density . results : mortality from rheumatic heart disease showed a strong correlation with past infant mortality that was consistently stronger with postneonatal mortality ( deaths from one month to one year ) than with neonatal mortality ( deaths during the first month of life ) . areas with high infant mortality from diarrhoea or bronchitis had the highest subsequent mortality from rheumatic heart disease . although rheumatic heart disease was linked with early overcrowding , regression analyses suggested that overcrowding could not per se explain the infant mortality associations . conclusions : chronic rheumatic heart disease may have its origins in early infancy . our findings raise the possibility that susceptibility to rheumatic fever and rheumatic heart disease may be linked with infection in the postneonatal period . alternatively , they may be explained by the operation of environmental factors that both predispose to infection in infancy and the subsequent liability to heart disease .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : mindfulness - based stress reduction ( mbsr ) is a well - delineated 8-week mindfulness meditation program and hence lends itself well to be applied clinically and studied systematically . heart rate variability ( hrv ) is the beat - to - beat variation in the heart rate and is a unique way to study sympathovagal balance and autonomic control of cardiopulmonary dynamics . twenty healthy volunteers were recruited from among participants of the mbsr program offered at the university of minnesota . two visits are planned , before and after completion of the mbsr program . after a brief period to help subjects acclimatize , 3 phases of data were recorded , each phase lasting for 5 minutes . resting : served as baseline value.phase 2 . controlled respiration : involved audio cues to control the respiratory rate at a fixed interval of 6/minute.phase 3 . meditation : involved self - guided sitting meditation.echocardiogram , respiration , and skin temperature were recorded continuously throughout each phase . phase 2 . controlled respiration : involved audio cues to control the respiratory rate at a fixed interval of 6/minute . change in the standard deviation of normal - normal rr intervals ( sdnn ) , measure of hrv total power , during a state of meditation ( phase 3 ) at the completion of the mbsr program . change in sdnn during a resting , non - meditative state ( phase 1 ) at the completion of the mbsr program . change in sdnn between controlled respiration ( phase 2 ) and meditation ( phase 3 ) after completion of the mbsr program . change in perceived stress scale score . volunteers will return for their final visit after completion of the mbsr course in june 2013 . with the knowledge gained from this pilot study , we hope to study the effects of the mbsr program in patients with established cardiovascular disease conditions in which sympatho - vagal imbalance is known to play some role in causation , namely myocardial infarction , heart failure , and hypertension .
### Summary: : focus areas : integrative approaches to care , supporting behavioral change , alleviating painbackground : mindfulness - based stress reduction ( mbsr ) is a well - delineated 8-week mindfulness meditation program and hence lends itself well to be applied clinically and studied systematically.heart rate variability ( hrv ) is the beat - to - beat variation in the heart rate and is a unique way to study sympathovagal balance and autonomic control of cardiopulmonary dynamics.methods:twenty healthy volunteers were recruited from among participants of the mbsr program offered at the university of minnesota . two visits are planned , before and after completion of the mbsr program.after a brief period to help subjects acclimatize , 3 phases of data were recorded , each phase lasting for 5 minutes . phase 1 . resting : served as baseline value.phase 2 . controlled respiration : involved audio cues to control the respiratory rate at a fixed interval of 6/minute.phase 3 . meditation : involved self - guided sitting meditation.echocardiogram , respiration , and skin temperature were recorded continuously throughout each phase . each subject will serve as his / her own control . endpoints : change in the standard deviation of normal - normal rr intervals ( sdnn ) , measure of hrv total power , during a state of meditation ( phase 3 ) at the completion of the mbsr program . change in sdnn during a resting , non - meditative state ( phase 1 ) at the completion of the mbsr program . change in sdnn between controlled respiration ( phase 2 ) and meditation ( phase 3 ) after completion of the mbsr program . change in perceived stress scale score.conclusion:volunteers will return for their final visit after completion of the mbsr course in june 2013 . with the knowledge gained from this pilot study , we hope to study the effects of the mbsr program in patients with established cardiovascular disease conditions in which sympatho - vagal imbalance is known to play some role in causation , namely myocardial infarction , heart failure , and hypertension .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : emphysematous pyelonephritis ( epn ) is defined as an acute , severe necrotizing infection of the renal parenchyma and perirenal tissue , which results in the presence of gas within the renal parenchyma , collecting system , or perinephric tissue . x - ray and ultrasound abdomen are preliminary investigations but lack sensitivity and precision ; hence , they can not be always relied upon to visualize the kidney . computed tomography ( ct ) scan of the abdomen is the investigation of choice . this case is reported to highlight the importance of ct scan in the management of epn , as treatment options have evolved over the years from an aggressive surgical approach to a more conservative approach of percutaneous drainage ( pcd ) and antibiotics . a sixty - four year - old male , obese , diabetic , and hypertensive for five years presented with pain in the abdomen localized to the right flank , vomiting , and burning micturition with increased frequency of a seven - day duration . on examination , he was febrile and blood pressure was 160/100 . plain x - ray of the abdomen revealed gas distributed over the right kidney [ figure 1 ] . ultrasound of the abdomen was suggestive of epn of the right kidney [ figure 2 ] . noncontrast ct of the abdomen was characteristic of epn of right kidney which showed renal and perirenal fluid collections with gas in the collecting system , intraparenchymal gas , and extension of gas into the perinephric space [ figure 3 ] . x - ray of the abdomen showing gas distributed over right kidney region ( arrow ) ultrasound of right kidney showing high echogenic areas with dirty shadowing ct of the abdomen showing gas in right renal parenchyma with perinephric extension common modes of epn presentations include fever , abdominal pain , nausea , vomiting , impaired consciousness level , shock , and acute renal failure . thrombocytopenia , acute renal failure , disturbed consciousness , and shock are the factors associated with poor outcome , and definitive treatment is influenced by their presence . nondiabetic risk factors include obstructive uropathy , chronic renal failure , polycystic kidney , renal transplant , alcoholism , and aids . epn is caused by gas - producing coliform bacteria that are able to ferment glucose to lactate and carbon dioxide . the other organisms are klebsiella , proteus mirabilis , pseudomonas , streptococcus spp . , and mixed organisms . the factors that may be involved in the pathogenesis of epn are a high level of tissue glucose , the presence of gas - forming bacteria , impaired tissue perfusion , and impaired host immunity with a defective host defense mechanism . it is postulated that the gas accumulates because the ischemic kidney can not remove it . histopathological examination of kidneys removed from patients with epn reveals vasculopathy as the main feature . diagnostic sensitivities of plain x - ray of the abdomen and ultrasonography ( usg ) of the abdomen for the diagnosis of epn are 3347% and 8085% , respectively . ( 1996 ) as type i : renal necrosis with the presence of gas but no fluid and type ii : parenchymal gas associated with fluid in renal parenchyma , perinephric space , or in the collecting system . classified epn into : class i : gas in the collecting system only.class ii : gas in renal parenchyma only.class iii a : extension of gas or abscess to perinephric space.class iii b : extension of gas or abscess to pararenal space.class iv : bilateral epn or solitary kidney with epn initial management involves care with fluid and electrolytes , hemodynamic status , diabetic control , and appropriate antibiotic therapy . the conventional treatment of epn has historically been emergency nephrectomy and/or open surgical drainage along with antibiotic therapy with a mortality rate of 4050% . increasingly , pcd is used for the treatment of epn with a view to nephron preservation and recovery of renal function . nephrectomy should be limited to the presence of a nonfunctioning kidney , presentation of gross renal parenchymal destruction , display of class iiia or iiib gas pattern , or the existence of two or more risk factors . pcd is the treatment of choice for patients with bilateral disease and solitary kidney with epn . ct scan of the abdomen is the investigation of choice for the diagnosis , treatment options , and prognostication of epn . a diabetic patient with fever , renal angle pain , and pyuria attending emergency should be subjected to immediate ct scan to rule out epn . in hospitals where ct scan is not available , these patients should be subjected to x - ray kub ( kub : kidney , ureters , and bladder)/usg , and if renal gas is detected , referred for a ct scan .
### Summary: : fever and flank pain in a diabetic patient should raise the suspicion of emphysematous pyelonephritis ( epn ) . the clinical course of epn can be severe and life threatening , if not recognized and treated promptly . gas shadows in the renal or perirenal region on plain x - ray , ultrasound , or computed tomography ( ct ) scan of the abdomen are the radiological features of epn . however , ct scan of the abdomen is sine qua non for classification , treatment options , and prognosis .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : in recent years , the interest in oral esthetics has increased , enhancing the demand for such considerations during orthodontic treatment and increasing the use of esthetic brackets , including translucent monocrystalline alumina brackets ( mab ) . however , mab has no chemical affinity with the resin composites that are used to bond the brackets to the enamel surface , consequently the " debonding " of these brackets is an important clinical complication for the orthodontist . with this problem in mind , mab manufacturers have mainly used mechanical retention to promote bonding between mab and enamel . even so , some brackets can fall shortly after the initial bonding , while others have to be purposely repositioned midway through treatment . the need to continue the orthodontic treatment requires the dentist to choose between two options : ( 1 ) replace the loose bracket with a new one ; or ( 2 ) rebond the same bracket . reusing however , its performance could diminish if any additional surface treatment was applied to the base in brackets that use mechanical retention . thus , several chairside methods have been developed to treat the base surface of debonded brackets , such as removing the resin debris by electropolishing , bunsen flame and sandblasting the surface . two types of abrasive particles have been used to blast the base of the bracket : alumina particles and silica - modified alumina particles . these surface modifications should improve resin - ceramic bonding by : a ) removing any organic debris from the ceramic surface ; b ) improving the wetting kinetics of the bonding agents ; and c ) increasing roughness on flatted ceramic surfaces promoting micromechanical locking with the resin . in addition , the silica - modified alumina particles can deposit a layer of silica on the base of the surface of the ceramic bracket allowing reactions with the silane coupling agent . the silane agent applied to the surface reacts with surface hydroxyl groups , forming siloxane bond by condensation . therefore , the silicatization process can improve bond strength results because it increases the number of hydroxyl groups on the silica - coated mab surface , thus improving adhesion quality and compatibility with resin cements and promoting better results than ceramic brackets that are only sandblasted with alumina particles . however , the silanization process is considered technique - sensitive and its instability can cause deterioration in adhesion , particularly when applied to a chemically stable surface , as presented by mab . consequently , efforts to improve silane layer quality that reduce hydrolytic degradation and increase the lifespan of this adhesion interface have been proposed . studies have shown that silane drying conditions and post - heat treatment procedures reduce solvents and enhance the cross - linking reaction to the silane layer , improving bond performance at the interface . an increase was observed in the extent of cross - linking from the outer layers of the silane towards the ceramic surface , with a corresponding increase in mechanical and hydrothermal stability . it is likely that the heat applied to a silanized surface catalyzes the reaction between silica and the silane coupling agent . the energy provided affects the network density , reducing water diffusing through the network , while improving chemical stability at this bond interface . previous research tested the effect of post - heat treatment of silane on adhesion between inorganic ( ceramics systems , quartz fiber post ) and organic materials ( resin composite , resin cement ) ; however , the influence of silica coating followed by silanization and heat treatment on the bond strength of monocrystalline alumina , as used in mab , has not yet been investigated . the aim of this study was to evaluate the associated influence of silica coating , a silane coupling agent and post - heat treatment on the bond strength of a mab - resin - enamel system and its effect on adhesive stability . the hypothesis tested was that the post - heat treatment increases the bond strength between the enamel , resin and " rebonded " mab , improving the bond performance for this interface following different aging procedures . sixty healthy premolar teeth ( intact enamel , without bleaching and no caries ) extracted in the course of orthodontic treatments , with informed consent from each patient , were obtained and stored in distilled water at 5c for up to 2 months . sixty monocrystalline alumina premolar brackets ( pure , orthotechnology , tampa , fl , usa ) , using mechanical retention by zirconia pearls on the base , were randomly divided according to surface treatment strategy ( n=20 ) : gc , new brackets with no surface treatment ( control group ) ; gt , tribochemical silica coating with cojet - sand ( 3 m espe , seefeld , germany ) , using a blasting device ( cojet - preptm , 3 m espe , seefeld , germany ) . the distance between the base of the bracket and the nozzle was standardized at 10 mm and 90 angle . a 2.8 bar pressure was exerted for 5 s. using a clean brush at room temperature ( 20c ) and 50% relative humidity , one layer of monobond - s ( ivoclar vivadent ag , schaan , linchtenstein ) was applied to the ceramic surface for 20 s and left on the ceramic surface for 60 s to allow the chemical reactions to occur . then , the excess silane was removed by air spray , free of oil contamination , for 5 s at 2.8 bar ; gh , after the base surface of the brackets was prepared as described in gs , post - heat treatment was applied to the silanized surface using a hot air dryer ( taiff 6000 w , so paulo , sp , brazil ) at 100c for 60 s. the bonding procedures were performed by the same operator . prior to the bonding procedure , the adhesive area on the labial teeth surface was cleaned with prophylactic paste for 15 s. an adhesive paper was positioned on the enamel to standardize the bonding interface area ( 12.25 mm ) , avoiding adhesive flash on the enamel surface ( figure 1 ) . the brackets were bonded with transbond xt ( 3 m unitek , monrovia , ca , usa ) , in accordance with the manufacturer 's instructions . excess adhesive was gently removed and the brackets were light - cured ( optilight 600 , gnatus , so paulo , sp , brazil ) for 10 s. then , teeth were vertically embedded in autopolymerized acrylic resin , sh that the limit of cementum - enamel on the buccal side was exposed 2 mm above the acrylic resin ( dencr , clssico , so paulo , sp , brazil ) . scanning electron microscopy images in se mode using 2,000x magnification showing : a)base of new bracket with zirconia pearls ( z ) as a mechanical retention mechanism spread on the alumina surface ; b ) base of bracket following tribochemical silica coating . note the absence of zirconia pearls . instead , the alumina surface presented cracks on the spots where the zirconia pearls were sputtered ( c ) the bonded teeth were stored under standard conditions in distilled water at 37c for 100 days . in addition , half of the specimens for each group were thermocycled ( 6,000 cycles ) in water between 51c and 551c with a transfer time of 2 s and a dwell time of 30 s in each bath . the shear bond strength test ( knife - edge set - up ) was performed with a universal testing machine dl-1000 ( emic , so jos dos pinhais , brazil ) , in which the load was applied to the interface at 1 mm / min , using a 50 kgf load - cell . to determine the adhesive remnant index ( ari ) , the brackets were examined under a stereomicroscope at 35x magnification ( stemi 2000-c , zeiss , jena , germany ) and a scanning electron microscope ( sem ) ( jeol jsm 5800-lv , tokyo , japan ) with values ranging up to 350x magnification in se mode . for the qualitative and quantitative topography analyses and roughness of the resin composite following the fracture of the samples , the regions corresponding to adhesive failure with the enamel were evaluated in a digital optical profilometer ( wyko nt 1100 , veeco , plainview , ny , usa ) that was connected to a computer drive containing the software vision 32 ( veeco ) . the roughness measurement parameters were performed at 20x magnification on the central area of 301.3x229.2 m , with two measurements of five randomly selected brackets for each group . to observe the surface features , the rough surface profile was obtained using gaussian filter to remove waviness and form . the roughness parameters evaluated were ( m ) : ra : arithmetical mean of the absolute values of the surface departures from the mean plane within the sampling area . this is a general and commonly used parameter ; rc : mean height of the profile elements ( peak and valley ) ; rsm : mean width of the profile elements ( peak and valley ) . statistical analysis for the sbs test was performed using 2-way anova , considering the surface treatment and aging as the parameters tested . a p value of less than 0.05 was considered to be statistically significant for all tests . analysis of variance 2-way anova for the shear bond strength ( sbs ) and roughness parameters are presented in table 1 . for rsm ( m ) , no statistically significant difference was determined by 2-way anova . the mean rsm results ( m ) were 5.2 tc groups and 5.39 for the non - tc groups . for ra and rc , only the aging factor ( tc ) presented an effect on the results . the mean ra and rc results ( m ) were 0.31 and 0.87 for the tc groups and 0.39 and 1.10 for the non - tc groups . in the fracture analysis , mean bond strengths and standard deviations and the adhesive remnant index ( ari ) for each group are presented in table 2 . the p value by 2-way anova determined for shear bond strength ( sbs ) and roughness parameters ( ra , rsm and rc ) for different factors ( surface treatment , st ; thermocycling , tc ) ( * p<0.05 ) mean and standard deviation for shear bond strength ( sbs ) , roughness parameters ( ra , rsm and rc ) and failure modes of the groups according to the adhesive remnant index ( ari ) on the enamel surface : ari 3 , 100% of composite ; ari 2 , > 50% of composite ; ari 1 , < 50% of composite ; ari 0 , 0% of composite . * same superscript letters indicate no statistically significant differences for sbs . ( tukey test , =0.05 ) figure 1 shows the base of ceramic brackets with and without tribochemical silica coating . two specimens for gc and gt , three specimens for gc - tc , gt and gt - tc showed damage to the enamel surface with eventual dentin fracture ( 3 specimens ) ( figure 2 ) . for gt - tc , two brackets debonded during the thermocycling procedure . scanning electron microscopy images in se mode at 2,000x magnification showing brackets with mixed failure for gh - tc with > 50% of resin composite on the bracket ( adhesive remnant index - ari=1 ) associated with enamel fracture . the bracket ( b ) , composite ( c ) , enamel ( e ) and spot of roughness evaluated ( r ) are showed on the micrograph surface treatments for the " rebonding " procedure of ceramic brackets have been suggested in previous studies . the aim of this research was to test the increase in bond strength and stability of the adhesive using a post - heat treatment on the silanized surface following tribochemical silica coating on monocrystalline alumina brackets that where submitted to different aging procedures . data from the sbs tests verified that this strategy had an effect on bracket adhesion following aging . shear bond strength is the most common test used to evaluate adhesion in orthodontics brackets . however , the literature shows that greater cohesive failure , rather than the nature of the stress , is responsible for bonding failure ; moreover , it seems more appropriate to refer to the term " shear bond strength " as the loading mode . thus , the mechanics of this test associated with the large surface bonding area ( 12.25 mm ) could explain the rate of damage on the enamel surface ( 13 specimens ) ( figure 2 ) . regarding the sandblasted surfaces , alumina and silica - modified alumina particles play an important role in improving the bonding strength of resin to oxide ceramics , as shown by previous studies . this procedure is also used in orthodontic clinical practice to remove resin residue on the brackets permitting " rebonding " . in addition , previous studies have verified that the use of silica - modified alumina particles to promote tribosilicatization of the brackets is preferable for promoting a chemical reaction between the silica and silane coupling agent . furthermore , the original adhesion mechanism ( mechanical retention by zirconia pearls ) was compromised , even when using a lower time ( 5 s ) than other studies ( 15 s ) to sandblast the surface ( figure 1 ) . ( 2010 ) showed that the use of small - sized silica - modified alumina particles , such as cojet , presented less damage on the ceramic surface than other frequently used particles . the sem images suggest that greater bracket roughness was achieved following the protocol used to sandblast the surface concentrated on the zirconia pearl sites ( figure 1 ) . despite this fact , this procedure ( gt ) showed results similar to other studies , in that the bond strength was statistically lower , with a higher adhesive remnant index ( ari ) than the control group ( gc ) ( table 3 ) . however , post - heat treatment ( gh ) restored the bond strength values and ari when the original adhesion mechanism was used on the new brackets ( table 1 ) . this effect was caused by the increase in siloxane links in the bonding agent and solvent evaporation in the mixture . solvent molecules trapped on the adhesive interface can influence the degradation process by accelerating hydrolysis . this study applied post - heat treatment to a silanized surface and verified the influence of this approach on the shear bond strength and ari in ceramic brackets ( table 2 ) . even so , the sbs results for gc and gc - tc showed a lower standard deviation than gh and gh - tc , respectively . the present study also assessed the influence of storage on the shear bond strength results with and without thermocycling . hydration can promote resin matrix plasticization , hydrolytic degradation of the resin matrix with additional interfacial degradation between the resin matrix and inorganic fillers , reducing strength and toughness . the rough amplitude could provide an indication of material toughness when similar fracture modes and composite materials are compared . a general rule of thumb is that the fewer features on the surface , the lower the toughness . the statistically different results ( table 1 ) obtained for both roughness parameters ( ra and rc ) between the thermocycled and non - thermocycled groups , after a gaussian filter was applied to remove the waviness of the surface , suggests that thermocycling has an effect on the mechanical properties of the resin composite . the lower surface roughness in the thermocycled groups indicates that less energy was required for cracks to grow at the resin / enamel interface than in non - thermocycled groups . however , 2-way anova determined that the additional use of thermocycling under storage for 100 days had no statistical effect on the shear bond strength values or on the adhesive remnant index ( table 2 ) , probably due to the test design ( shear bond strength test ) . minimal risk of damage to the enamel surface during " debonding " and no adhesive remnant under the enamel surface are desirable features for a bracket system . the fact that the results were obtained using the shear bond strength test could be a limitation of this study regarding any clinical correlation with enamel damage . despite of the limitations of this study , it can be concluded that : 1 ) post - heat treatment of silanized surface following tribochemical silica coating improved shear bond strength for mab ; 2 ) using a resin composite , the association of thermocycling and storage did not produce any additional effect on the bond strength between the mab and enamel compared with storage alone in distilled water for the same period .
### Summary: : objectivethis study aimed to evaluate the effects of heat treatment on the tribochemical silica coating and silane surface conditioning and the bond strength of rebonded alumina monocrystalline brackets . material and methodssixty alumina monocrystalline brackets were randomly divided according to adhesive base surface treatments ( n=20 ) : gc , no treatment ( control ) ; gt , tribochemical silica coating + silane application ; gh , as per gt + post - heat treatment ( air flux at 100c for 60 s ) . brackets were bonded to the enamel premolars surface with a light - polymerized resin and stored in distilled water at 37c for 100 days . additionally , half the specimens of each group were thermocycled ( 6,000 cycles between 5 - 55c ) ( tc ) . the specimens were submitted to the shear bond strength ( sbs ) test using a universal testing machine ( 1 mm / min ) . failure mode was assessed using optical and scanning electron microscopy ( sem ) , together with the surface roughness ( ra ) of the resin cement in the bracket using interference microscopy ( i m ) . 2-way anova and the tukey test were used to compare the data ( p>0.05 ) . resultsthe strategies used to treat the bracket surface had an effect on the sbs results ( p=0.0 ) , but thermocycling did not ( p=0.6974 ) . considering the sbs results ( mpa ) , gh - tc and gc showed the highest values ( 27.596.4 and 27.182.9 ) and gt - tc showed the lowest ( 8.456.7 ) . for the ra parameter , anova revealed that the aging method had an effect ( p=0.0157 ) but the surface treatments did not ( p=0.458 ) . for the thermocycled and non - thermocycled groups , ra ( m ) was 0.690.16 and 1.120.52 , respectively . the most frequent failure mode exhibited was mixed failure involving the enamel - resin - bracket interfaces . conclusionregardless of the aging method , gh promoted similar sbs results to gc , suggesting that rebonded ceramic brackets are a more effective strategy .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : cognitive impairments in schizophrenic patients can make it difficult to have a daily life or social rehabilitation because the impairment persists even after improvement of psychotic symptoms . patients with chronic schizophrenia especially demonstrate impairments that range between one and a half to two standard deviations below healthy controls on verbal memory , working memory , motor speed , attention , executive functions , and verbal fluency.1 many studies have investigated factors that influence cognitive function . several studies have reported on the influence of aging on cognitive functions in schizophrenic patients.2,3 furthermore , bozikas et al and sugawara et al reported an age related cognitive decline in healthy population by examination of the clock drawing test ( cdt).4,5 previously , we investigated which factor , disease or aging , is a better determinant of cognitive function in schizophrenic patients using the cdt and reported that cognitive function is impaired not only by disease but also by aging.6 the brief assessment of cognition in schizophrenia ( bacs ) is an evaluation of cognitive function for schizophrenic patients that consists of six tests : verbal memory , working memory , motor speed , verbal fluency , attention , and executive function.1 the bacs is fully portable , and the time required for testing is only approximately 30 minutes with minimal extra time for scoring and training demands.7 therefore it has fewer burdens , and it is possible to complete the test in more cases , compared to the matrics consensus cognitive battery.8 there are many studies that have compared bacs score before and after medication of antipsychotics.911 however , there are few studies that have investigated which factor , disease or aging , is a better determinant of cognitive function in schizophrenic patients using the bacs . therefore the present study aimed to investigate the influences of disease and aging on bacs performance in schizophrenic patients using subjects with a wide range of ages a total of 222 schizophrenic patients who were diagnosed according to the diagnostic and statistical manual of mental disorders , 4th edition ( dsm - iv)12 and received medication as outpatients ( n = 78 ) or inpatients ( n = 144 ) were recruited from the hospital of hirosaki university school of medicine ( n = 99 ) , hirosaki - aiseikai hospital ( n = 113 ) , and kuroishi - akebono hospital ( n = 10 ) . of these 222 patients , 74 patients failed to complete all examinations or demonstrate an appropriate intelligence level ; hence , 148 patients completed the study . we also recruited 150 premorbid intelligence - level - matched healthy individuals as a comparison group . the majority of the comparison group was employed as medical staff , such as a nurse , nursing assistant , dietician , occupational therapist , or psychiatric social worker at hirosaki - aiseikai hospital and kuroishi - akebono hospital . there were significant differences between patients and comparison subjects with regard to age , level of education , and gender ratio . the level of education of the comparisons was significantly higher than that of the patients . the data collection for this study was approved by the ethics committee of hirosaki university school of medicine , and all subjects provided written informed consent before participating . the japanese version of the national adult reading test ( jart)13 was also given to all subjects for the purpose to exclude mental retardation . the jart , standardized by matsuoka et al , reflects premorbid iqs in japanese patients with schizophrenia.14 differences in characteristics between the schizophrenic patients and the comparison group were analyzed using t - tests and chi - square tests . a multiple regression analysis of the possible correlations between the six tasks of the bacs - j ( verbal memory , working memory , motor speed , attention , verbal fluency , and executive function ) or the composite score and the clinical variables were performed for each group and all subjects . in the comparison group analysis , the six tasks and the composite score of the bacs - j were set as the dependent variables , whereas diagnosis , age , gender , and level of education were set as the independent variables . for the analyses of the patient group and all subjects , the six tasks and the composite score of the bacs - j were set as the dependent variables , whereas diagnosis , age , gender , level of education , and duration of illness were set as the independent variables all analyses were performed using spss 17.0j for windows ( ibm corporation , armonk , ny , usa ) . a total of 222 schizophrenic patients who were diagnosed according to the diagnostic and statistical manual of mental disorders , 4th edition ( dsm - iv)12 and received medication as outpatients ( n = 78 ) or inpatients ( n = 144 ) were recruited from the hospital of hirosaki university school of medicine ( n = 99 ) , hirosaki - aiseikai hospital ( n = 113 ) , and kuroishi - akebono hospital ( n = 10 ) . of these 222 patients , 74 patients failed to complete all examinations or demonstrate an appropriate intelligence level ; hence , 148 patients completed the study . we also recruited 150 premorbid intelligence - level - matched healthy individuals as a comparison group . the majority of the comparison group was employed as medical staff , such as a nurse , nursing assistant , dietician , occupational therapist , or psychiatric social worker at hirosaki - aiseikai hospital and kuroishi - akebono hospital . there were significant differences between patients and comparison subjects with regard to age , level of education , and gender ratio . the level of education of the comparisons was significantly higher than that of the patients . the data collection for this study was approved by the ethics committee of hirosaki university school of medicine , and all subjects provided written informed consent before participating . the japanese version of the national adult reading test ( jart)13 was also given to all subjects for the purpose to exclude mental retardation . the jart , standardized by matsuoka et al , reflects premorbid iqs in japanese patients with schizophrenia.14 differences in characteristics between the schizophrenic patients and the comparison group were analyzed using t - tests and chi - square tests . a multiple regression analysis of the possible correlations between the six tasks of the bacs - j ( verbal memory , working memory , motor speed , attention , verbal fluency , and executive function ) or the composite score and the clinical variables were performed for each group and all subjects . in the comparison group analysis , the six tasks and the composite score of the bacs - j were set as the dependent variables , whereas diagnosis , age , gender , and level of education were set as the independent variables . for the analyses of the patient group and all subjects , the six tasks and the composite score of the bacs - j were set as the dependent variables , whereas diagnosis , age , gender , level of education , and duration of illness were set as the independent variables . a p - value of < 0.05 was considered statistically significant . all analyses were performed using spss 17.0j for windows ( ibm corporation , armonk , ny , usa ) . the mean standard deviation of the bacs score for all subjects is shown in table 2 . z - scores , standardized bacs results , whereby the mean of comparison was set to zero and the standard deviation set to one were also shown in table 2 . table 3 shows the result of the multiple regression analysis for each group . for the comparison group , age was found to influence five tasks of the bacs ( verbal memory , working memory , attention , verbal fluency , and executive function ) and the composite score . the level of education influenced two tasks ( verbal memory and motor speed ) and the composite score ; and gender influenced only the executive function task . for the schizophrenic patient group , the duration of illness influenced four tasks ( working memory , motor speed , attention , and executive function ) and the composite score . in addition , patient age influenced three tasks ( attention , verbal fluency , and executive function ) and the composite score ; the level of education influenced two tasks ( attention and verbal fluency ) and the composite score ; and gender influenced only the executive function task . table 4 shows the results of the multiple regression analysis for all subjects , in which disease was found to influence all six tasks of performance and the composite score . in addition , age influenced five tasks ( verbal memory , working memory , attention , verbal fluency , and executive function ) and the composite score ; and the level of education influenced four tasks ( verbal memory , motor speed , attention , and verbal fluency ) and the composite score . the duration of illness also influenced four tasks ( working memory , motor speed , attention , and executive function ) and the composite score ; and gender influenced two tasks ( working memory and executive function ) and the composite score . the present study sought to investigate the influences of disease and aging on performance on the bacs in schizophrenic patients . the results of the multiple regression analysis of all subjects indicated that almost all bacs performance components were attributable not only to disease but also aging , level of education , and duration of illness . the results from the multiple regression analysis of the comparison group showed that age was the strongest factor influencing almost all bacs tasks and the composite score ( table 3 ) . on the other hand , the results from the patient group analysis indicated that the influence of the duration of illness was stronger than that of age for many bacs tasks and the composite score and that the influence of age was diminished . furthermore , the standardized regression coefficients of the diagnosis for the analysis of all subjects were large for almost all bacs tasks and the composite score ( table 4 ) . these results suggest that bacs performance among schizophrenic patients is more strongly influenced by disease than age . the bacs is commonly used to assess aspects of cognition found to be most impaired and most strongly correlated with prognosis in patients with schizophrenia.1 accordingly , our results indicate that the bacs can serve as a specific assessment tool for the analysis of schizophrenia in a japanese sample population . however , the present study found that almost all bacs performance tasks and the composite scores of patients with higher levels of education and a younger age were superior to those of subjects with lower education levels and an older age , and these results are inconsistent with those of a previous study . in particular , kishi et al reported no influence of age and education level on many aspects of cognitive function , but did detect an influence for the positive and negative syndrome scale ( panss ) composite score and three tasks of the bacs ( verbal memory , working memory , and executive function).15 however , the relationship between cognitive function and age and level of education has been reported in many previous studies.1,4,16 in the study by kishi et al , clinical factors ( age , sex , duration of illness , level of education , smoking status , the panss score , and medication dosage ) served as the independent variables.15 therefore , the inconsistencies between the results of the present study and those of kishi et al may be attributable to differences in the variables used for analysis . furthermore , this previous study found that the influence of the panss was much greater than that of other factors such as age or level of education.15 the present study did not detect any influence of age but did identify that the level of education influenced the participants motor speed in the comparison and all subject analyses . furthermore , ruff and parker and era et al reported similar results concerning the relationship between additional education and faster performance,17,18 and the relationship between motor speed and level of education was also suggested by jones et al.19 these previous authors reported that sulcus fluid volume , education level , and a measure of general psychiatric symptomology obtained by linear structural relations analysis that relates brain and psychosocial functions to cognitive functioning were significantly related to speed . in addition , ruff and parker and era et al also reported the relationship between age and motor speed,17,18 and keefe et al reported an association between age and motor speed in the bacs task.1 the reason for these inconsistencies between the present study and previous studies concerning the influence of age on motor speed is unclear , although it is possible that the level of education more strongly influences motor speed than age . the influence of education on attention tasks was also shown in the results of the patient group and the all subjects group . from a meta - analysis , one previous study reported the relationship between attention ability and the reduction in gray matter volume.20 furthermore , piras et al reported that for the hippocampus , regions of gray matter may be related to level of education.21 accordingly , the results of the present study may support these findings . on the other hand , the results of the present study were inconsistent with those of kishi et al and jolfael et al , which analyzed the relationship between cognition ( eg , attention ) and clinical profiles ( eg , age , gender , level of education , and severity of symptoms ) in schizophrenic patients.15,22 these inconsistencies between the present study and previous studies may have been caused by differences in dependent variables . the gender influence on executive functions in the bacs tasks was evaluated for the comparison , patient , and all subject groups . gender was shown to influence working memory and the composite score of all subjects ; in particular , males showed better performance on both the bacs tasks and the composite score as compared to females . this result is similar to that of roesch - ely et al , who reported that female schizophrenic patients showed worse performance in executive control as compared to male patients.23 in contrast , leung and chue reviewed the opposite result as reported by seidman et al and goldstein et al.2426 the reason for these inconsistent results may have been due to differences in the examination method . for example , the tower of london procedure , which was the method used in the present study , is used to specifically evaluate planning ability , whereas the method used by roesch - ely et al is a dual performance task that selects high auditory stimulus tones and responds to several types of stimuli and addresses attention ability.23 in contrast , the method used by seidman et al and goldstein et al was the wisconsin card sorting test ( wcst ) , which evaluates the ability of set - shifting.23,26 accordingly , further studies should compare the differences among several types of executive tasks . the current study also revealed the influence of gender on working memory in all subjects . although one previous study also reported that male patients performed better than females on visual working memory tasks,27 lecardeur et al reported the opposite result after examining spatial working memory.28 furthermore , minor and park reported an absence of gender differences on spatial working memory,29 and bozikas et al and roesch - ely et al reported the absence of gender differences on working memory.4,23 related to these inconsistencies among studies that have analyzed working memory , the reason for the influence of gender on working memory shown in the present study remains unclear . . therefore , future longitudinal studies should take into consideration the accelerated cognitive decline that occurs in patients over 60 years of age in both healthy samples4,5 and schizophrenic samples,2 and these studies should also investigate the influence of disease and aging . second , we were not able to examine the influence of other clinical profiles on the scores of the bacs because of the lack of these data . several previous studies have reported correlations between the bacs score and clinical factors such as differences in medications,24,25 severity of symptoms,13 subtypes of schizophrenic disease,26 duration of untreated psychosis,27 and patient age at onset.28 therefore , further studies considering the influences of these clinical profiles are needed . in conclusion , the results of this study suggest that bacs performance in schizophrenic patients is influenced not only by disease .
### Summary: : backgroundthe brief assessment of cognition in schizophrenia ( bacs ) is an evaluation of cognitive function that can be completed with more cases . however , there are few studies that compare which factor , disease or aging , is a better determinant of performance on the bacs . the present study aimed to investigate the influences of disease and aging on bacs performance in schizophrenic patients using subjects with a wide range of ages.methodsschizophrenic patients ( n = 165 ) and a comparison group ( n = 171 ) were recruited as subjects . all participants completed the japanese language version of the bacs ( bacs - j ) , and the influences of disease and aging on performance in the bacs were examined with the use of multiple regression analysis.resultsthere was a significant influence of diagnosis and level of education on all six tasks of the bacs and the performance and composite scores . in addition , age was found to influence five tasks and the composite score , the duration of illness influenced four tasks and the composite score , and gender influenced one task and the composite score.conclusionthe present study suggests that performance on the bacs was impaired not only by disease but also by level of education and aging .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : observed maximum in ocean heat content trend in early 2000s is likely spuriousnet incoming radiation ( n ) reduced by 0.31 0.21 w m during the warming pausepresent - day estimates of n may contain opposing errors in radiative components observed maximum in ocean heat content trend in early 2000s is likely spurious net incoming radiation ( n ) reduced by 0.31 0.21 w m during the warming pause present - day estimates of n may contain opposing errors in radiative components the recent slowdown in the rate of global surface temperature rise [ easterling and wehner , 2009 , knight et al . , 2009 ] has highlighted a need for a better quantification of earth 's energy imbalance [ hansen et al . , 2011 ; katsman and van oldenborgh , 2011 ; balmaseda et al . , 2013 ; trenberth et al . , 2014 ] and improved understanding of the flow of energy in the climate system [ trenberth , 2009 ; meehl et al . , 2011 ; england et al . , earth 's energy imbalance is defined here as the net downward radiative energy flux ( n , expressed in w m averaged over the entire surface of the earth ) through the top of the atmosphere ( toa ) , representing the residual between incoming solar radiation and outgoing reflected ( mainly short - wavelength visible ) and emitted ( mainly long - wavelength infrared ) radiation . n varies naturally on all timescales due to internal variability of the climate system , volcanic eruptions , and variations in incoming solar radiation . however , increased levels of greenhouse gases initially increase n by reducing outgoing longwave radiation , driving climate change until radiative equilibrium is restored and n returns to zero on average . humans also influence n by changing outgoing shortwave radiation through emissions of aerosol particles and changes to land usage which affect surface albedo . furthermore , subsequent changes in n in response to initial perturbations may be amplified or reduced by feedbacks within the climate system [ boucher et al . , 2013 ; myhre et al . , quantifying the time mean and variability of n is therefore fundamental for understanding climate variability and change [ trenberth , 2009 ; hansen et al . allan et al . produced a homogenized satellite data set of n covering the period since 1985 . satellites provide reasonably accurate estimates of interannual variations in n [ loeb et al . , 2012 ] , but absolute values can not be determined accurately [ stephens et al . , however , on multiyear timescales , n is expected to be largely balanced by changes in global ocean heat content [ palmer et al . , 2011 ; palmer and mcneall , 2014 ] , since changes in energy of the atmosphere , land , and cryosphere are much smaller [ levitus et al . , 2001 observations of trends in ocean heat content ( hereafter ht ) therefore potentially enable the satellite observations to be anchored to obtain absolute values [ loeb et al . , 2012 ; allan et al . , 2014 ] , as well as providing independent estimates of variations in n. however , the subsurface ocean was poorly observed historically , with less than 20% of 1 latitude by 1 longitude regions sampled yearly in the upper 700 m before 1990 [ abraham et al . , 2013 ] , and estimates of ht from different ocean analyses appear to show little consistency , at least on interannual timescales [ trenberth et al . , observational coverage increased to 3040% of 1 regions after 1990 , but observation - based estimates of ht for the period 1998 to 2008 vary by a factor of 2 , from 0.31 ( full depth ocean [ church et al . , 2011 ] ) to 0.64 w m ( upper 700 m only , [ lyman et al . , 2010 ] ) . even in the period since 2005 in which more than 70% of 1 regions are sampled by argo floats [ roemmich et al . , 2009 ] , estimates of ht in the upper 700 m range from 0.16 to 0.39 w m over the period 20052012 [ abraham et al . , 2013 ] . furthermore , annual values of ht appear to be inconsistent with satellite observations of n in some years [ trenberth et al . , 2014 ] , suggesting that earth 's energy budget can not be closed with observations even over the relatively well - observed period since 2005 [ trenberth and fasullo , 2010 ] . here we investigate earth 's energy imbalance over the period since 1960 in observations , atmospheric models forced by observed sea surface temperatures and radiative changes ( atmosphere model intercomparison project , amip ) , and fully coupled model simulations ( coupled model intercomparison project , cmip5 ) . we build on allan et al . by including estimates of ht and developing an observation - based record of n extending back to 1960 . we show that two reanalyses of ht in the early 2000s are inconsistent with satellite observations and amip simulations of n and are therefore likely unreliable , helping to explain our inability to close the energy budget . however , prior to 2000 variations in ht in ocean reanalyses are in reasonable agreement with observation - based estimates of n and with cmip5 models , as earth 's energy imbalance was dominated by volcanic eruptions over this period . we also highlight an observation - based reduction in n that likely contributed to the recent slowdown in surface warming . observational estimates of n since 1985 are based on the clouds and the earth 's radiant energy system ( ceres ) instruments since 2000 and the earth radiation budget satellite ( erbs ) wide field of view nonscanning instrument from 1985 to 1999 [ allan et al . , 2014 ] . these two data sets were homogenized , and gaps filled , using the era interim reanalysis [ dee et al . , 2011 ] and high - resolution atmosphere model simulations driven by observed sea surface temperatures and sea ice concentrations ( see figure s1 in the supporting information and allan et al . for full details ) . this satellite - based n is adjusted to be 0.58 w m over the period july 2005 to june 2010 [ loeb et al . , 2012 ] based on ocean heat content changes ( ht ) of 0.47 w m in the upper 1800 m obtained from a linear fit through argo data [ following lyman and johnson , 2008 ] and 0.07 w m below 1800 m [ purkey and johnson , 2010 ] , plus 0.04 w m estimated for heating and melting of ice and heating of the land and atmosphere . we also use n from amip model simulations form ( i ) the upscale project [ mizielinski et al . , 2014 ] over the period 1986 to 2011 and ( ii ) multimodel simulations of the climate of the twentieth century project ( c20c ) [ scaife et al . , 2009 ] for the period 1950 to 2002 . three of the 16 c20c models were eliminated from our study due to unrealistic anomalies of n. amip simulations can not provide absolute values of n because the sea surface temperature ( sst ) forcing potentially provides unrealistic sources or sinks of energy . amip simulations are in good agreement with satellite observations ( r > 0.6 ) for monthly deseasonalized variability in n over the period 1986 to 2011 ( allan et al . and figure s1 ) , showing that sst observations provide useful additional constraints on n. we therefore create an extended observation - based estimate of n ( hereafter no ) by averaging the satellite observations with the ensemble means of the c20c and upscale simulations ( with each data set given an equal weight where available ) . we use no even when satellite data are available since errors are likely to be reduced by including independent information from the sst observations ( via the amip simulations ) . we compute uncertainties from differences between upscale , c20c , and satellite data ( 0.12 w m ) as well as the average spread of the c20c simulations ( 0.09 w m ) added in quadrature to the 1 sigma anchoring uncertainty ( 0.24 w m ) estimated in allan et al . to obtain a total uncertainty on no of 0.28 w m. ocean heat content trends ( ht ) are computed from the slope of a least squares regression using annual time series of heat content and expressed as a flux relative to the total surface area of the earth [ following lyman and johnson , 2008 ] . we compute ht over 5 year periods and compare with rolling 5 year mean n , thereby smoothing out interannual variability related to el nio . absolute values of n can not be determined accurately from satellite observations [ stephens et al . , we therefore also assess rates of change of ht and n ( htt = dht / dt and nt = dn / dt , again computed with least squares regression over 5 year periods ) , since nt does not depend on absolute values . ocean data are taken primarily from the met office statistical ocean reanalysis ( hereafter mosora , updated from smith and murphy ; see supporting information ) . several published analyses of ht for the upper 700 m appear to capture signals associated with major volcanic eruptions , but the timing is not always consistent , and there is little agreement at other times [ trenberth et al . , however , the ora - s4 analysis , in which temperature and salinity observations are assimilated into a dynamical ocean model [ balmaseda et al . , 2013 ] , was found to be in reasonable agreement with model simulations of volcanic impacts and also simulated plausible changes in ht associated with el nio [ trenberth et al . , because full - depth values are available , we also include ora - s4 in our study . time - varying biases in expendable bathythermographs ( xbts ) and mechanical bathythermographs were corrected in mosora based on an average of adjustments proposed by wijffels et al . this approach was tested , and uncertainties estimated , by performing data withholding experiments for the data - rich period 20072013 , which was not used for the covariances . in these experiments , analyses created using all available observations were taken as the reference and compared with analyses created using subsampled observations at locations typical of historical periods . a total of 12 tests were performed using data locations from 1950 to 1956 , 1955 to 1961 , 1960 to 1966 , , 2005 to 2011 . patterns of ht reconstructed with historical observations agree well with the reference ( figure1 ) . for example , the spatial correlation is 0.88 and 0.76 using the 1990s and 1960s observations , respectively ( compare figure1b with figures1d and 1f ) . uncertainties ( which we quote as 1 sigma throughout ) in global heat content range from around 28 zj ( zj = 10 j ) using 19501956 observations to 8 zj using 20052011 observations , corresponding to uncertainties in ht of 0.7 to 0.2 w m ( table s1 ) . we stress that these estimates only assess uncertainties arising from the observational coverage relative to the recent argo era and do not include unknown instrument errors or the potentially large contributions from regions not sampled adequately by argo floats , such as the shelf seas , ice - covered regions , and ocean below 2000 m [ e.g. , von schuckmann et al . , furthermore , our subsampling experiments suggest that the magnitude of ht is not fully captured using the historical data , especially in the southern ocean ( figure1f ) so that ht might be underestimated in the historical period prior to argo , as suggested by durack et al . . ( left ) total number of temperature observations at 1000 m depth during the period 2008 to 2012 using ( a ) all data and subsampled data typical of ( c ) the 1990s and ( e ) the 1960s . ( right ) patterns of ocean heat content trends ( ht , w m ) for the period 2008 to 2012 computed using ( b ) all observations and subsampled observations typical of ( d ) the 1990s and ( f ) the 1960s . we compare observational estimates of ht and n with 21 cmip5 coupled model simulations ( taylor et al . and table s2 ) driven by observed variations in greenhouse gases , aerosols , solar radiation , and land use until 2005 and following representative concentration pathway ( rcp4.5 ) thereafter . there are long - term drifts in the cmip5 models because the preindustrial control simulations were not necessarily in radiative equilibrium [ sen gupta et al . we therefore compute anomalies in the historical and rcp4.5 simulations relative to preindustrial control simulations ( using at least 100 years of the control simulations ) . global ocean heat content , ht and htt from mosora and ora - s4 are in good agreement ( r = 0.94 , 0.80 , and 0.82 respectively for running 5 year averages ) over their overlapping period ( compare red and dashed magenta curves in figure2 ) , despite the lack of historical ocean observations and additional uncertainties involved in computing derivatives for ht and htt . furthermore , over the period 19601999 , ht and htt are in broad agreement with n ( r = 0.58 and 0.56 between mosora and ora - s4 and no ) and nt , ( r = 0.63 and 0.69 ) . these correlations are significantly greater than zero with 99% confidence based on bootstrapping in 5 year blocks to take serial correlation into account [ e.g. , goddard et al . , ( first panel ) annual mean total ocean heat content anomalies ( relative to 19612010 , zj = 10 j ) from mosora ( red ) [ smith and murphy , 2007 ] and ora - s4 ( dashed magenta ) [ balmaseda et al . , 2013 ] . ( second panel ) five year running mean ocean heat content trends ( ht , red and magenta ) and net incoming radiation ( n ) at the top of the atmosphere from satellites [ allan et al . , 2014 ] ( blue curves ) and atmosphere models driven by observed surface temperatures for the climate of the twentieth century ( c20c ) [ scaife et al . , 2009 ] ( cyan ) and upscale [ mizielinski et al . , 2014 ] ( blue shading ) projects . ( third panel ) trends in ht ( htt , red and magenta ) and n ( blue and cyan ) . red shading shows uncertainties ( 1 sigma ) in mosora arising from observational coverage ( see text and table s1 ) . grey shading highlights potentially spurious ocean reanalyses ( see text ) , with significant differences ( 90% level ) between mosora and n shown by black squares . in figure2 ( second to third panels ) the year represents the center of the time period used to compute trends . after 2000 , ht and htt show pronounced variability that is not present in n and nt ( figure2 , second and third panels ) . this is largely caused by the rapid increase in ocean heat content between 2001 and 2004 resulting in a peak ht in 2002 followed by a trough in 20062007 in both mosora and ora - s4 ( figure2 , second and third panels ) . a peak in ht around 2002 is also evident in other ocean analyses [ trenberth et al . , 2014 ] . however , such an increase in heat content is not supported by thermosteric sea level observations , because total sea level increased at a fairly constant rate [ church et al . , 2013 ] while freshwater input from glaciers and ice sheets likely increased [ marzeion et al . , 2012 ; shepherd et al . , 2012 ; church et al . , 2013 ] , implying a reduction in the rate of thermosteric sea level rise ( and hence ocean heat content trend ) over the period 2001 to 2004 . although interpretation of sea level changes is complicated by the nonuniformity of thermal expansion coefficients , warming is not consistent with a reduction in thermosteric sea level trends . given this , and the agreement between independent estimates of n ( and nt ) from satellite observations and amip simulations ( figure2 ) , and from forced ocean model experiments ( figure s2 ) , we suggest that there are likely to be errors in the observational reanalysis of ocean heat content between 2001 and 2007 ( grey - shaded region in figure2 ) . cheng and zhu drew similar conclusions from a different approach , suggesting that these errors are caused by the transition from xbt to argo data . however , this does not appear to be the sole cause in our study since mosora shows a similar peak in ht in 2002 even when argo observations are omitted ( figure2 , black asterisks ) , although the subsequent trough is reduced . further work is therefore needed to understand the cause of these errors in ocean reanalyses . possible explanations include inadequate vertical or horizontal sampling and/or unresolved biases in the instruments themselves . cmip5 coupled models simulate variations in n and ht that are in good agreement with observations ( r = 0.82 between 5 year running mean cmip5 ensemble mean and no , and 0.68 with mosora excluding the period after 2000 , figure3a ) . since internal variability is largely removed in the ensemble mean of the cmip5 models , this agreement suggests that much of the multiyear variability in earth 's energy imbalance from 1960 to 2000 was externally forced by the volcanic eruptions of agung ( 1963 ) , el chichon ( 1982 ) , and pinatubo ( 1991 ) , as noted by trenberth et al . . furthermore , the cmip5 models do not simulate a peak in ht in 2002 , and the observed peak is significantly different from the cmip5 models , consistent with our earlier conclusion that estimates of ht based on ocean analyses between 2001 and 2007 ( grey shading in figure2 ) are likely unreliable . earth 's energy imbalance . ( a ) time series of 5 year running mean n and ht ( as figure2 , second panel ) for 21 cmip5 coupled model simulations ( n in green , ht in orange , ensemble mean in thick lines ) compared with ht from mosora ( red ) and no ( blue , see text ) . black squares ( diamonds ) show where differences between mosora and no ( cmip5 ) are significant with 90% confidence . ( b ) n averaged over different periods in no ( blue , with 1 sigma uncertainties ) compared to the cmip5 models ( green , box showing the mean 1 sigma and whiskers showing the range ) and estimates from the ipcc fifth assessment ( red ) [ rhein et al . , 2013 , box 3.1 ] . averaged over different periods , no is in broad agreement with the intergovernmental panel on climate change ( ipcc ) estimates [ rhein et al . , 2013 , box 3.1 ] and the cmip5 models ( figure3b ) , but it is difficult to draw firm conclusions because uncertainties in the absolute values of no are large . these uncertainties are dominated by the anchoring estimate of ht and could potentially be reduced by averaging ht over longer periods . we do not attempt this because ocean observations in the early 2000s are potentially unreliable ( as discussed above ) , historical analyses do not capture the full magnitude of ht , especially in the southern ocean ( figure1 ) [ durack et al . , 2014 ] , and uncertainties are evident even in the most recent 5 year means which show a decrease in no but an increase in ht ( figure3a ) . we therefore investigate changes in n and anomalies relative to the period 19602011 since these are less affected by anchoring uncertainties . in general , there is good agreement between the cmip5 ensemble mean and observation - based anomalies of n ( r = 0.82 for 5 year running means ) and its components , absorbed shortwave ( asr , r = 0.87 ) and outgoing longwave ( olr , r = 0.80 ) radiation ( figure4 ) . the cmip5 ensemble mean therefore appears to simulate a realistic magnitude of variability associated with volcanic eruptions . , 1997 ; power et al . , 1999 ] may have contributed to no . however , an increase in n is also apparent in the cmip5 ensemble mean in the late 1970s ( especially in asr ; red curves in figure4 ) , suggesting that external forcing may have played a role . time series of 5 year running mean anomalies ( relative to 1960 to 2011 ) of toa - absorbed shortwave radiation ( asr , red ) , outgoing longwave radiation ( olr , green ) , and net radiation ( n = asr - olr , blue ) in no ( dashed ) and the cmip5 models ( solid , with thick line showing the ensemble mean ) . models and observations both show a rapid increase in n during the recovery from the eruption of mount pinatubo , reaching a peak in the late 1990s . however , there is a subsequent decline of 0.43 0.21 w m in no between 1999 and 2005 in the early part of the global warming slowdown which is larger in magnitude than the model ensemble mean ( 0.12 0.06 w m ) and at the lower end of individual models ( + 0.38 to 0.32 w m ) . both the satellite observations and the amip simulations show a decline over this period ( figures2 , middle , 2 bottom , and s3 ) , showing that the observed signal is not an artifact of our averaging procedure . it is also not caused by the transition from erbs to ceres satellites since all six upscale amip simulations show reductions , ranging from 0.30 to 0.52 w m. furthermore , a similar decline in surface flux between 1999 and 2005 is simulated in forced ocean model experiments ( figure s2 ) . we therefore compute the difference averaged over 20042006 minus 19982000 , giving a reduction of 0.31 0.21 w m between the late 1990s and mid-2000s . we find significant correlation ( r 0.6 , p < 0.01 ) between rolling 5 year mean ocean heat content trends ( ht ) in two ocean analyses and net incoming radiation at the top of the atmosphere ( n ) from satellite observations and amip model simulations over the period 1960 to 1999 . ocean reanalyses of this historical period are therefore potentially useful for further studies of the physical processes of ocean heat uptake . however , ocean reanalyses of ht in the early 2000s are inconsistent with observation- and model - based constraints on n. this helps to explain our inability to close earth 's energy budget [ trenberth and fasullo , 2010 ; trenberth et al . , 2014 ] and suggests that observed estimates of ht covering this period [ e.g. , lyman et al . , 2010 , levitus et al . , 2012 , abraham et al . , 2013 ; rhein et al . , 2013 ] should be treated with caution . it also calls into question whether ocean reanalyses can be used to robustly attribute increased ht below the ocean mixed layer in the early 2000s as an explanation for the onset of the recent slowdown in surface warming [ guemas et al . , we create an observation - based estimate of n ( no ) extending back to 1960 , using satellite data and amip model simulations , and compare with 21 cmip5 coupled climate model simulations . variations in n over this period are dominated by the volcanic eruptions of agung in 1963 , el chichon in 1982 , and pinatubo in 1991 [ trenberth et al . , 2014 ] , with good agreement ( r = 0.82 ) between no and the cmip5 ensemble mean . absolute values of no are in broad agreement with the models , but uncertainties are large and improved estimates of ht are needed to provide a more accurate anchor for satellite observations [ loeb et al . , we find a reduction of 0.31 0.21 w m in no between the late 1990s and the mid-2000s which may have contributed to the recent slowdown in global surface warming . , 2011 ; fyfe et al . , 2013 ; haywood et al . , 2014 ; santer et al . , 2014 ] , an extended and deeper solar minimum [ lean , 2009 ; kaufmann et al . , 2011 ] , and possible nitrate and indirect aerosol effects [ shindell et al . , 2013 ; bellouin et al . , 2011 ] that were not included in the cmip5 models [ flato et al . , 2013 , however , the reduction in no is caused by an increase in olr rather than a reduction in asr which would be expected from these factors ( compare green and red dashed curves in figures4 and s3 ) , though asr may have been reduced relative to the models . internal variability may also reduce n during cooling decades [ katsman and van oldenborgh , 2011 ; palmer and mcneall , 2014 ; brown et al . , 2014 ] , but the cmip5 ensemble mean does simulate a weak reduction ( 0.12 0.06 w m , mainly in asr ) , suggesting a potential role for external forcing . further work is therefore needed to unravel the relative roles of internal variability and external factors on earth 's energy imbalance during the recent warming pause . while present - day anomalies in n in the cmip5 ensemble mean are in good agreement with observations , this is potentially achieved through a cancelation of errors ( in models and/or observations ) since both asr and olr are larger in almost all of the models than the satellite observations ( figures4 and s3 ) . both asr and olr are projected to increase further over the coming decades , with anomalies in asr about twice as large as those in olr on average ( in agreement with cmip3 models [ trenberth and fasullo , 2009 ] ) . further analysis of the roles of forcing and feedback on these signals is needed , along with continued satellite and in situ observations of earth 's energy imbalance to monitor future climate variability and change .
### Summary: : observational analyses of running 5 year ocean heat content trends ( ht ) and net downward top of atmosphere radiation ( n ) are significantly correlated ( r 0.6 ) from 1960 to 1999 , but a spike in ht in the early 2000s is likely spurious since it is inconsistent with estimates of n from both satellite observations and climate model simulations . variations in n between 1960 and 2000 were dominated by volcanic eruptions and are well simulated by the ensemble mean of coupled models from the fifth coupled model intercomparison project ( cmip5 ) . we find an observation - based reduction in n of 0.31 0.21 w m2 between 1999 and 2005 that potentially contributed to the recent warming slowdown , but the relative roles of external forcing and internal variability remain unclear . while present - day anomalies of n in the cmip5 ensemble mean and observations agree , this may be due to a cancelation of errors in outgoing longwave and absorbed solar radiation.key pointsobserved maximum in ocean heat content trend in early 2000s is likely spuriousnet incoming radiation ( n ) reduced by 0.31 0.21 w m2 during the warming pausepresent - day estimates of n may contain opposing errors in radiative components
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : as antenatal ultrasonography ( us ) has become more widely used , the number of fetal hydronephrosis diagnoses has increased . vur is an important risk factor in the etiology of recurrent urinary tract infections ( utis ) in childhood . urine backflow to the collecting system due to reflux , particularly when accompanied by fever , may lead to serious health problems : hypertension and renal failure , growth and development can be adversely affected by recurrent utis and the resultant lack of appetite , increased catabolism and tubulointerstitial lesions that develop secondary to reflux nephropathy , urinary concentration defects , electrolyte loss and acidosis . in addition , since reflux nephropathy is one of the major reasons of end stage renal failure ( esrf ) , it is advised that all infants with antenatal hydronephrosis be scanned for vur . the objective of this study was to evaluate uti frequency , degree of renal parenchymal damage and parameters of growth , development and nutritional status in antenatal hydronephrosis cases with vur . among 277 patients with antenatal hydronephrosis ( ah ) referred to our hospital from izmir ege maternity and gynecology training and research hospital during 1998 - 2007 , 36 infants with vur , diagnosed postnatally , were investigated prospectively . hydronephrosis was defined as the dilation of the anteroposterior pelvic diameter ( appd ) of the fetal renal pelvis 5 mm after 20 weeks of gestation . postnatal us ( toshiba ssa-270a color doppler ) examination was performed on the third day of life or when first seen . initial urine samples were taken from each patient for culture before prophylactic antibiotic treatment was started with 10 mg / kg / night dosage of amoxicillin . we were not able to convince the families for urine sampling with urinary catheter or suprapubic aspiration , therefore , the urine was sampled by applying a urine bag in girls , from front to back at vulva and perineum , and in boys , after pulling the prepuce back and wiping with antiseptic solution . the urine bags were changed in half an hour 's period if the infant had not urinated . urine cultures were repeated monthly to enable early detection and treatment of infections . in the presence of bacteriuria with clinical findings , simplified algorithm for postnatal evaluation of infants with prenatally detected hydronephrosis ( us : ultrasonography , vcug : voiding cystourethrogram , vur : vesicoureteral reflux , dmsa : technetium - dimercaptosuccinic acid scan , dtpa : technetium - diethylene triamine penta - acetic scan , ivp : intravenous urogram , uti : urinary tract infection ) regardless of the initial us result , a second us examination was performed on day 10 . a third us was performed in the first month of life . in all patients , micturating cystourethrography ( mcug ) ( siemens model 1801091x1060 ) was performed at the end of the first month . briefly , the area was cleaned and a catheter was placed into child 's bladder . the catheter was connected to a bottle of iodinated contrast material that was visualized on the x - ray screen . after the bladder was filled up with contrast material through urinary catheter , grades i , ii and iii were considered low grade and grades iv and v high grade reflux . a dmsa ( millenium manufactured mpr ) scan was performed to assess the renal damage . renal scarring score was graded according to the following classification system : type 1 : renal lesion with two or less scarstype 2 : renal lesion with more than two scarstype 3 : generalized renal damage , total uptake > 10%type 4 : end stage , atrophic kidney , total uptake < 10% type 1 : renal lesion with two or less scars type 2 : renal lesion with more than two scars type 3 : generalized renal damage , total uptake > 10% type 4 : end stage , atrophic kidney , total uptake < 10% indications for surgery were the presence of multiple scars and/or development of new scars or frequently recurrent uti or persistent uti in patients with high - grade vur . height and weight standard deviation scores ( hsds and wsds ) were calculated to assess growth and development ; weight - for - height ( relative weight ) was calculated to assess nutritional status of the infants . these parameters were calculated every three months for the first 18-month - period and every six months for the rest of the follow - up period . parents were informed by explaining the clinical significance of urinary tract abnormalities as well as the rationale of postnatal follow - up . of 277 patients ( 340 rus ) with hydronephrosis diagnosed by prenatal us , 36 ( 13% ) ( 56=16.5% rus ) were detected to have vur . twenty - five ( 69.4% ) of these patients were males , 11 ( 30.6% ) females , and the male - female ratio was 2.5 . average follow - up duration was 37.824.5 months ( min 12 months , max 72 months ) . mean gestational age at intrauterine ( iu ) diagnosis was 31.56.8 weeks ( min 16 weeks , max 39 weeks ) . mean iu renal pelvic anteroposterior diameter was 11.45.16 mm . mean pelvic anteroposterior diameter was measured as 5 - 9 mm in 25 ( 44.7% ) , 10 - 15 mm in 22 ( 39.3% ) , and > 15 mm in 9 ( 16% ) affected rus . demographic features of the patients iu : intrauterine/ ah : antenatal hydronephrosis/ uti : urinary tract infection the distribution of rus and grades of postnatally detected vur in relation to renal pelvic anteroposterior diameters are given in table 2 . there was no significant correlation between renal pelvic anteroposterior diameter measured by antenatal us and vur grade detected in the postnatal period ( p>0.05 ) . table 2 comparison between intrauterine renal pelvic anteroposterior diameter and vesicoureteral reflux grades in renal units ( p>0.05 ) vur : vesicoureteral reflux ; rus : renal units furthermore , although 5 ( 13.8% ) out of 36 cases with postnatally detected vur had normal us results in weeks 1 and 4 , one patient had grade ii , 3 had grade iii , and 1 had grade iv vur . of 17 patients who had intrauterine fetal renal pelvic diameter between 5 - 9 mm , 4 ( 23.5% ) patients were admitted to surgery , 3 cases ( 17.7% ) are still under medical observation and 10 ( 58.8% ) cases showed recovery by medical treatment . among patients with fetal renal pelvic anteroposterior diameter between 10 - 15 mm ( n=14 patients ) , 6 ( 42.8% ) required surgery , while 7 ( 50% ) recovered by medical therapy and 1 case ( 7.2% ) is still under medical observation . all patients who had a fetal renal pelvic anteroposterior diameter more than 15 mm ( n=5 patients ) , underwent surgical treatment ( p<0.05)(table 3 ) . current state of the patients and their intrauterine renal pelvic anteroposterior diameters ( n=36 patients ) significantly more patients with iu renal pelvic anteroposterior diameter > 15 mm required surgery ( p<0.05 ) a comparison between patients treated medically and requiring surgery in the postnatal period is given in table 4 . the mean iu renal pelvic diameter was significantly higher in infants admitted to surgery in the postnatal period ( 14.717.16 ) than in infants who showed recovery by medical treatment ( 8.02.1 ) and in those who are still on medical follow - up ( 10.06 3.21)(p<0.05 ) . the mean age of patients at the time of surgery was 18.515.9 months and the mean postoperative follow - up duration was19.38.5 months . although statistically insignificant , the frequency of utis was higher in the medically treated group than in the surgery group ( 1.421.27 and 0.90.69 episode / year , respectively)(p>0.05 ) . both initial and final dmsa scans showed significantly more damage in patients admitted to surgery than in medically treated cases ( p<0.05 ) . although infants who required surgery in the postnatal period showed poorer initial growth and development scores ( hsds : -0.170.86 and wsds : 0.000.14 ) as well as nutritional status ( rw : 93.6311.34 ) than medically treated patients ( hsds : 0.280.34 , wsds : 0.120.23 and rw : 98.198.81 ) , the differences were not statistically significant ( p>0.05 ) . although insignificant , in patients who underwent surgery , these parameters improved gradually at the final evaluation ( p>0.05 ) . comparison between cases that required surgery and cases who received medical treatment iu : intrauterine/ uti : urinary tract infection/ dmsa : technetium - dimercaptosuccinic acid scan/ sds : standard deviation score/ rw : relative weight postnatal management and follow - up of infants with antenatally detected hydronephrosis requires time , effort , family support and adequate finances . furthermore , because most of the methods are interventional and entail exposure to low dosage radiation , there are ongoing ethical debates about how to proceed . numerous studies have examined the short- and intermediate - term outcomes of children diagnosed with ah , and vur has been reported in approximately 1020%[811 ] . a total of 277 patients that had a renal pelvic anteroposterior diameter of 5 mm or greater at any gestational phase were included in our study . mcug was performed in every patient , even when the week 1 and week 4 us results were normal . measurement of the renal pelvic anteroposterior diameter is the simplest and most sensitive technique for prenatal diagnosis of congenital hydronephrosis . although pelvic diameter detected antenatally is associated with pathology in the postnatal phase , it does not provide preliminary information regarding pathology to be detected[5 , 13 ] . although the likelihood of pathology increases with increasing appd , to date there is no consensus on the optimal appd threshold for determining the need for postnatal follow - up . indeed , in our prior study , we studied 156 infants ( 193 kidney units ) whose scan showed that one or both appds were 5 mm or greater at > 20 weeks . in 84 of 193 kidney units , intrauterine pelvic dilation was 59 mm . among these , 27 ( 32% ) kidney units were normal and 57 ( 68% ) pathological . of the 57 kidney units with urinary tract abnormality , 12 ( 15% ) were treated surgically . of these 12 kidney units therefore , we suggested that all babies whose routine antenatal scan showed that one or both appds were 5 mm or more should continue to be observed . this study supported the findings of other studies that showed a correlation between urinary tract abnormality and appd measurement as low as 5 mm and suggested that it is not possible to determine a normal upper limit for the antenatal renal pelvis[12 , 13 ] . while an increase in intrauterine renal pelvic anteroposterior diameter suggests that there may be a severe obstructive uropathy , this finding is inadequate for predicting vur occurrence and its severity . although some authors have suggested that mcug is not ethical to perform as being too invasive for mild hydronephrosis , others have thought that a normal postnatal us could not preclude the presence of urinary tract abnormality . marra et al suggest a mcug for patients with a renal pelvic anteroposterior diameter of 5 mm or greater . however , other authors suggest that mcug should be performed when a greater renal pelvic dilatation is detected . another study states that a mcug is not needed for patients with two subsequent normal us results . nevertheless , tiballs et al and mohammadjafari et al argue that the assessment of vur should be performed for all cases with antenatal hydronephrosis . this policy , to our opinion , will help to identify vur cases before occurrence of uti and reduce the risk of further renal injury . in fact , among 36 patients that were detected to have vur in this study , 5 ( 13.8% ) had normal postnatal us results in the first week and first month . however , 4 of these cases had low grade vur , and 1 had high grade vur . this finding , therefore , suggests that normal postnatal us results do not exclude vur and all patients with antenatal hydronephrosis should be subjected to mcug . also , a relationship between iu renal appd and vur grade was not found in our study . patients with no antenatal history and diagnosed postnatally by vur due to recurrent utis , predominantly in girls , usually show moderate disease . on the other hand , most of the patients with antenatal hydronephrosis who were detected to have vur in the postnatal phase are mainly boys . as in our series , many other studies suggest that male sex is a risk factor for vur[5 , 21 , 2223 ] although the spontaneous resolution rate decreases with increasing severity of reflux , resolution can be seen even in cases of high grade vur . spontaneous vur resolution has been detected in 56% of patients with antenatal hydronephrosis that were diagnosed with vur in the postnatal period . specifically , spontaneous vur recovery was found to occur in 72% of low grade cases and 9% of high grade cases . yeung et al reported a resolution rate in 70% of low grade and 43% of high grade vur cases . in our study , we observed a 47.2% recovery rate for vur patients who were on medical treatment . in the postnatal period , infants with reflux previously detected to have a prenatal pelvic dilatation usually show renal damage , possibly congenital , at the time of diagnosis . recurrent utis , pressure caused by reflux of sterile urine and intrarenal reflux are recognized as causes of renal parenchymal defects in infants with vur[25 , 26 ] . in our study , initial dmsa scans showed hypoactive lesions in 16 ( 28.5% ) of 56 rus and the figure decreased to 21.4% ( 12 rus ) at the final dmsa . no damage appeared later during the follow - up period in any of the patients . this recovery in the dmsa underscores the importance of early diagnosis of vur and close follow - up with a multidisciplinary approach . the literature on postnatal follow - up of cases with prenatal hydronephrosis mostly focuses on diagnosis of the disease and treatment options ; therefore , there is limited information on growth , development and nutritional parameters of these patients . main reasons of growth retardation in these infants are increased catabolism and lack of appetite caused by frequent utis and tubulointerstitial dysfunctions associated with intrauterine hydronephrosis . it has been reported that growth and development of infants with antenatal hydronephrosis are not negatively affected by close postnatal follow - up and by appropriate medical or surgical treatment and even in growth retarded infants catch - up growth is observed . there is a consensus that timely diagnosis of utis by close follow - up , decrease in number of utis by antibiotic prophylaxis , if necessary , preventing delay of surgical treatment avoid increased catabolism and lack of appetite , enabling normal growth and development[4 , 27 , 28 ] . in our study , all patients with prenatal hydronephrosis were treated with antibiotic prophylaxis and closely followed - up . both weight and height sds parameters of all cases remained within normal range during the follow - up period . at the final evaluation , height and weight sds and average rw scores were observed to have increased compared to initial evaluation ; however , the difference was not significant ( p>0.05 ) . in recent years , due to diagnostic and therapeutic interventions as well as by close follow - up starting from newborn stage extending to early infancy , there has been a decrease in number of cases of esrf resulting from utis , especially in cases with urinary system malformation , in many developed countries . in turkey , recurrent utis , especially in conjunction with urinary malformations are still the main reasons of esrf due to a lack of follow - up protocols for prenatal , newborn and early infancy stages . first , we did not perform prenatal grading . also , the timing of ah diagnosis is not universal . we defined hydronephrosis as the dilation of the appd of the fetal renal pelvis 5 mm after 20 weeks of gestation . second , although a lack of consensus exists concerning the need for a postnatal mcug in all ah cases regardless of the us findings , we routinely performed a mcug in all infants with ah . the performance of mcug at the first month of life in infants with antenatally detected hydronephrosis enables earlier diagnosis of vur . by detection of these vur cases and close postnatal follow - up , frequent utis and associated problems can be prevented and therefore , normal growth and development can be achieved . moreover , medical or surgical , if necessary , treatment may prevent renal parenchymal scarring , precluding chronic renal failure . however , further large - number , multicenter and prospective studies are needed to clarify this issue .
### Summary: : objectiveto evaluate the frequency of urinary tract infections ( utis ) and degree of renal parenchymal damage as well as the parameters of growth , development and nutritional status in antenatal hydronephrosis cases with vesicoureteral reflux ( vur).methodsinfants , whose antenatal ultrasonography ( us ) showed a fetal renal pelvic diameter of 5 mm or greater were investigated . of the 277 infants with antenatal hn , 36 [ 56 renal units ( rus ) ] were diagnosed with vur . all cases with vur were evaluated in terms of the frequency of utis , scars appearing on 99mtechnetium - dimercaptosuccinic acid scan ( dmsa ) , growth and development [ height and weight standard deviation scores ( hsds and wsds ) ] , and nutritional status [ relative weight ( rw ) ] . statistical evaluation was performed using the chi - squared test.findingsof these 36 patients with vur , 25 ( 69.4% ) were males and 11 ( 30.6% ) females . of the 56 rus , 48 ( 85.7% ) had severe vur ( grade iii ) . the mean duration of postnatal follow - up was 37.824.50 months . the annual uti frequency was found to be 1.250.83 episodes / year . of these 36 infants , 32 ( 88.8% ) recovered from vur following either medical ( 17 patients , 47.2% ) or surgical ( 15 patients , 41.6% ) treatment . the initial dmsa showed parenchymal defects in 16 ( 44.4% ) rus , and 4 rus showed recovery in the final dmsa . although statistically insignificant ( p>0.05 ) , initial growth and development ( hsds : -0.170.86 ; wsds : 0.000.14 ) and nutritional status ( rw : 98.198.81 ) values gradually improved ( 0.051.06 , 0.061.071 and 101.9714.85 , respectively).conclusionpostnatal early diagnosis and appropriate management of vur in infants with antenatal hydronephrosis can prevent the occurrence of frequent utis , renal scarring and malnutrition , enabling normal growth and development .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : treatment of the edentulous mandible has always been one of the most challenging issues in dentistry . however , due to reduced stability when compared with natural teeth or fixed partial dentures , patients often complain of difficulty adapting to a removable prosthesis . there are different approaches , to improve denture stability such as , rebasing and surgical techniques ; yet , they do not create a high level of comfort or function for many . the advent of osseointegrated implants has vastly improved treatment outcomes in patients with complete edentulism . increased stability and retention of prostheses can be accomplished by one of two means , either an implant - retained removable overdenture or an implant - supported fixed prosthesis with distal cantilevers . the most outstanding merit of fixed implant - supported prosthesis over the other implant option is the psychological advantage of being fixed versus having a removable overdenture prosthesis . in addition , fixed prosthesis with posterior cantilevers gains bone in posterior regions 80% of the time ; whilst , implant overdenture with posterior soft tissue support loses bone in posterior regions almost 75% of the time . the biomechanical needs of a patient may necessitate the elimination of cantilevering and the placement of several implants in the posterior mandible ; but most of the time , it is impossible without advanced surgical procedures . on the other hand , fixed implant prosthesis has been one of the most controversial and expensive reconstructions for mandibular edentulism and it may be contraindicated in cases , where the replacement of lost soft and hard tissue and facial support by a prosthesis flange is critical . fewer implants , lower cost and esthetic and speech improvements are the advantages of implant - retained overdenture over fixed implant prosthesis . but like any other treatment option , it has its own drawbacks namely having to remove the prosthesis during the night , continued posterior bone loss , food impaction and long term maintenance [ 79 ] . an alternative treatment option can be a bilateral removable partial denture anchored to a fixed prosthesis , supported by implants placed in the interforaminal region , with stress directors near the connection with the fixed prosthesis . this prosthetic option , regardless of its clinical application , has not been fully validated in the dental literature and only one case report with 3 years of follow up has been published . the authors claim that this treatment method does not require grafting or multiple surgical procedures . furthermore , it has the esthetic and functional advantages of an overdenture , decreases compression of the edentulous ridge in function and the patient can benefit from the fixed anterior segment while removing the posterior part at night . the finite element method ( fem ) , which was first introduced in aerospace modeling , three - dimensional fem is an acceptable , powerful , replicable , and reliable tool in research protocols in dentistry and has proven its efficiency in solving numerous problems [ 1116 ] . the main goal of this study was to evaluate stress distribution differences when the number of implants under an anterior bridge supporting a removable partial denture in the posterior region varies . four three - dimensional finite element models ( 3d fem ) were designed of mandibles containing an implant - supported bridge extending between the canines , and a removable partial denture for premolars and first molars . nonrigid connection ( dalbo mini system , swiss ) was selected as the attachment method between the partial denture and canines of the anterior bridge . the lingual plate was designed as the major connector . the number of implants to support the bridge varied between the models from 2 to 5 with a length of 10 mm and a diameter of 3.8 mm . in the 4 and 5-implant models , the distances were 7.74 mm and 7.76 mm ( center - to - center ) , respectively for the implants moving from the canine position towards the midline . inter - implant distances for 2- and 3-implant models were 31 and 15.50 mm ( center - to - center ) , respectively from the canine position towards the midline . the distances were the same for both sides due to the symmetry of the 3d models ( figure 1a d ) . the next phase was to transfer the models for calculation to the ansys workbench ver . the corresponding elastic properties such as young s modulus and poisson s ratio were determined according to recent research [ 1115 ] ( table 1 ) . models were meshed , between 88900 and 114124 node- and between 49828 and 64740 10-node - quadratic tetrahedron body elements were used in the models with the highest and the lowest number of elements , respectively ( figure 2a d ) . all nodes at the distal and also the inferior surface of the models were restrained so that all rigid - body motions were prevented . von mises stresses on spongy bone , crestal bone and on implants for each model were evaluated . stress amounts showed a decrease from 2 implants to 4 implants but showed an increase in the 5-implant model . stresses on distal and mesial of terminal implants were in similar range when 2 , 3 and 4 implants were used . while , in the 5-implant model the amount of stress on terminal implants increased dramatically . the stresses on implants were similar in all models , with the greatest force on terminal ones . stress amounts showed a decrease from 2 implants to 4 implants but showed an increase in the 5-implant model . stresses on distal and mesial of terminal implants were in similar range when 2 , 3 and 4 implants were used . while , in the 5-implant model the amount of stress on terminal implants increased dramatically . the stresses on implants were similar in all models , with the greatest force on terminal ones . the stress levels that actually cause biological complications , such as resorption or bone remodeling , have yet to be comprehensively verified . there is no physiological limit for bone in regard to von mises stress in the literature . the physiological limit of bone strain , reported by frost ( 3000 ) , can not be compared with our results . application of removable partial dentures in combination with implants , which serve as abutments , is rarely seen in dental articles . jang et al ( 1998 ) used a single implant crown as an abutment for a removable cast partial denture . there is only one article in which , a distal - extension removable partial denture is designed on anterior fixed implant - supported prosthesis . this was done by pellacchia and emtiaz in 2000 . in this clinical case report with 3 years of follow up , the possibility of achieving positive results with a rpd connected to an implant - supported fixed prosthesis was demonstrated . they reported an increase in stability of rpd during function . regarding the optimum number of implants in distal - extension fixed implant - supported prosthesis , reports are limited to cantilever designs . number of implants , in ranges of 4 to 6 , has been reported with variable results in terms of the magnitude and distribution of forces and survival rates of implants [ 20 , 21 ] . misch reported 5 implants to be the best number . in his point of view , increasing the number up to 7 implants , may be more beneficial . while , ogawa showed no significant biomechanical difference between 4 and 5 implants in hybrid models . in overdenture models , klemetti in his literature review reported that patient satisfaction and function are not dependent on the number of implants or attachment type . thus , the number of implants necessary to provide adequate implant support for mandibular overdenture remains open to debate . in our study , stress transferred to spongy bone decreased from 2 to 4 implants ; but it dramatically increased in 5-implant models . in crestal bone of terminal implant models with 2 , 3 and 4 implants similar stresses were shown ; but in the 5-implant model the stresses on terminal implants increased significantly . the probable reason for this stress increase in models with 5 implants could be due to inter - implant distance . considering the advantages of an implant - supported anterior bridge supporting a removable partial denture posteriorly ( namely the function of an overdenture , decreased compression of the edentulous ridge in function and esthetics of having a fixed anterior segment when removing the posterior part during the night ) , it seems that this option can be practical with 2 , 3 or 4 implants ; because , our study showed that there was no significant difference regarding stress transferred to cortical bone and implants in models with 2 , 3 or 4 implants . thus , in financially compromised patients it can be achieved with fewer implants , without fear of placing excess stress on the implants . nevertheless , all patients must be assessed for other factors , including opposing dentition , parafunction , occlusion , etc . additionally , implant diameter and length may also affect the pattern of stress distribution [ 26 , 27 ] . a nonrigid connection was designed between anterior implant - supported fixed prosthesis and posterior removable partial denture . since in implant/ tooth connections stress values were decreased in bone when using non - rigid connections , application of rigid or non - rigid attachments can be based on the posterior bone support . within the limitations of this study , 2- , 3- and 4-implant models showed less stress on cortical and spongy bone in comparison with 5-implant model .
### Summary: : objective : the main goal of this study was to evaluate differences in stress distribution relevant to the number of implants under an anterior bridge when combined with a removable partial denture in the posterior region.materials and methods : four three - dimensional finite element models ( 3d fem ) were designed from a mandible containing an implant - supported bridge extending between canines , and a bilateral distal extension removable partial denture . a nonrigid connection was selected as the attachment method between the partial denture and the anterior implant - supported fixed prosthesis ; 2 , 3 , 4 and 5 implants supporting the bridge all with 10 mm length and 3.8 mm diameter were assessed . with the aid of the finite element program ansys 8.0 , the models were loaded and von mises stresses were evaluated.results:in spongy bone , stress forces showed a decrease from 2 implants to 4 implants but showed an increase in the 5-implant model . stresses on cortical bone of terminal implants were in similar range in the 2- , 3- and 4-implant models . while , in the 5-implant model the amount of stresses on terminal implants increased dramatically . the stresses on implants were nearly similar in all models , with the greatest amount on terminal implants.conclusion:within the limitations of this study , 2- , 3- and 4-implant models showed less stress on cortical and spongy bone in comparison with the 5-implant model . the stresses transferred to implants were nearly similar .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : endometriosis is defined as the presence of normal endometrial mucosa abnormally implanted in locations other than the uterine cavity . the ectopic implants are located in the minor pelvis , the ovaries , the fallopian tubes , and the uterosacral ligaments . more unusual implantation sites are the abdominal scars , scars of the perineum , the navel , the spleen , the kidney , the gallbladder , the pleura , and the nasal mucosa . this condition is not present before menarche , because the ectopic tissue possesses the same steroid and estrogen receptors as normal endometrium and is capable of responding to the normal cyclic hormonal milieu.1,2 endometriosis is the more common cause of chronic pelvic pain in females . its prevalence has been estimated to 1%2% of reproductive age females and is more common ( 15%25% ) among women with infertility problems.1 a 39-year - old female patient was referred to our hospital s emergency surgical department with a palpable tender mass at the left corner of a pfannenstiel incision . medical history revealed that this mass presented four months ago ( 2 cm diameter at the left end of her abdominal incision ) , and since then it exhibited interrupted abdominal tenderness , but with no identifiable pattern of exacerbation . during the last 4 months she received analgesics for intermittent pain management . she had a typical pfannenstiel skin incision having healed normally after having a child birth 4 years and 8 months before admission . the mass was immobile and clinically , aside from the possibility of an incarcerated incisional hernia , one could also entertain the diagnosis of a locally forming tender granuloma or that of a seeding deposit of ectopic endometrial tissue . the patient s laboratory results ( general blood count and serum biochemistry ) were all within the normal range with no indication of an inflammatory response of significance . plain chest and abdominal x - rays failed to provide conclusive evidence of any pathology . thus the patient was programmed without further delay for an exploratory operation scheduled for the next available operation room . the abdominal skin was re - incised along the outer third of the previous incision and the subcutaneous layer was dissected free of the underlying abdominal musculature . upon reaching the lower lateral border of the left rectus abdominus muscle , this mass infiltrated the external oblique , the internal oblique , and the transverse abdominus musculature and reached down to the preperitoneal fat layer . the mass was excised en - block with a small portion of surrounding abdominal wall musculature ( figure 1 ) . a small suction drain was placed preperitoneally and the abdominal wall defect was closed in one layer using a non - absorbable monofilament suture followed by the placement of a synthetic non - absorbable mesh . the histology report concerned a specimen 3.5 2.2 cm in dimension containing fibrous , adipose , and skeletal muscular tissue . within this tissue specimen , the finding of ectopic endometrial tissue within the abdominal wall seems to occur among 0.03% to 1% of women who have undergone prior gynecologic or obstetric surgery , and has been noticed particularly after cesarean section.36 its prevalence as an isolated abdominal wall mass is reported in 4% of the endometrioma cases in another series.7 other studies report an incidence of 1.04% in patients previously operated on the uterus and 0.046% in those who underwent previous cesarean section.8 other authors have reported a much higher incidence of about 0.2% of the cesarean sections performed.9 the literature seems to agree that the clinical appearance of a triad consisting of periodic abdominal scar pain ( associated with menses ) , a history of cesarean section , and an underlying tumor inside a surgical scar is more often than not confirmed to be an endometrioma.10 moreover , the presentation is atypical and thus the preoperative diagnosis poses difficulties in differential diagnosis.11,12 what most authors agree about is the fact that definitive diagnosis can only be established by pathologic analysis of the specimen . in our case , the patient did not link the unsteady nature of the periodic exacerbation of the pain followed by total pain remittance , with her menstruation . the clinical examination revealed a 2 cm hard , immobile , tender mass , which was definitely located within the abdominal wall musculature . thus , an all too familiar irreducible incisional hernia with bouts of incarceration was viewed as the most likely diagnosis . the absence of specific intestinal symptoms allowed us to formulate an alternative diagnosis of the possible existence of a post - operative incisional granuloma formation , attributed to the possible presence of underlying suture material or the formation of an incisional endometrial tumor . malignancy was unlikely , but a small soft tissue sarcoma could not be readily ruled out . during operative dissection no hernia was found and the operative diagnosis tilted towards the existence of a hard granulomatous lesion forming from the scar or fibrous tissue of the previous operation . the patient s post - operative course was uneventful and she was discharged on the third post - operative day in excellent condition . no symptoms or clinical indications of relapse were evident . this case comes to add to the well - known need to elicit an as accurate as possible history from the patient in which all pieces of information are pertinent , no matter how insignificant they may initially seem . it seems that it is a relatively rare finding , given the number of performed cesarean sections . although endometriosis was suspected in most cases , in nearly all , the diagnosis was made histologically . reliable pre - operative diagnosis has been reported with the use of ultrasonography in experienced hands , with the mri scan ( t1/t2 ) , which can detect blood within the endometrioma , and with the performance of a simple needle aspirate followed by cytological evaluation . the significance of having a reliable clinical diagnosis of an endometrioma lies in the fact that some patients may benefit from hormonal and anti - inflammatory therapy , thus reducing the need for operative intervention in a given number of patients .
### Summary: : the case of a tender , isolated abdominal wall tumor within a pfannenstiel incision due to a seeding deposit of endometrial tissue secondary to a previous obstetric operation ( caesarean section ) in a 39-year - old female without previously reported pelvic endometriosis is presented . the lesion clinically mimicked the appearance of an incarcerated incisional hernia at the outer corner of the healed pfannenstiel incision . the preoperative differential diagnosis also included that of a locally forming post - operative tender granuloma and the remote possibility of an incisional endometrioma ( although no link to menstruation could be made ) . local malignancy was not taken as a serious possibility . definitive diagnosis of the excised lesion was made at histology . the pre - operative diagnostic dilemma is presented , along with a short review of the literature .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : during the process of infection , after the engagement of innate immunity into the defence system , adaptive immunity is activated . the principal effectors of cellular immunity are t lymphocytes , while the principle effectors of humoral immunity are b lymphocytes . the activation of adaptive immunity is mediated by the production of antibodies by b lymphocytes that are able , for example , to block the adhesion of pathogens on mucosal surfaces , agglutinate bacteria , or to neutralise pathogens in blood circulation and subsequently activate complement . the antigens are then eliminated by t cells or in concert with specific antibodies further produced by b cells . abnormal cell - mediated immunity , including changes in main immunoglobulins as well as their subclasses that play a specific role in the immune response cascades , namely , igg subclasses igg1 and igg3 are complement activators via their binding to the protein antigens of the pathogens . igg2 usually mediates immune response to polysaccharide ( bacterial ) antigen and opsonisation of encapsulated bacteria . subclass igg4 binds to protein antigens of gram - positive bacteria and activates phagocytic cells . igg subclass deficiencies lead to the alteration of immune defence against microbial pathogens and thus increase the risk of repeated infections [ 5 , 6 ] . the immune system has been studied in patients with diabetes mellitus but with conflicting results [ 811 ] . in the face of chronic hyperglycaemia ( predominantly of more than 10 mmol / l ) , alterations of several steps of phagocytosis [ 1214 ] including oxidative burst [ 15 , 16 ] and occasionally abnormalities of selected lymphocyte subpopulations as well as immunoglobulins have been described in both in vivo and in vitro studies . therefore , we could hypothesised that the impairment of immune system function could be present also in patients with diabetic foot ulcers ( dfus ) , in whom infection related complications occur quite frequently and could lead to lower limb amputation [ 19 , 20 ] . in our previous study , we investigated possible changes of the immune system in patients with chronic dfus . the results of this study revealed mild immunological changes characterised by the activation of the inflammatory response such as increased leucocyte and neutrophil counts , crp , and iga levels . however , more serious immunodeficiencies of adaptive or innate immunity have not been observed in such risk group of diabetic patients to date [ 21 , 22 ] . the aim of our current study was to analyse in detail the presence of possible immunological abnormalities in humoral as well as in cell - mediated immunity in patients with more severe , chronically infected dfus and the potential relationship between immunological alterations and glycaemic control . in addition , we analysed differences in selected immune parameters between the patients with ulcers infected by sensitive pathogens and those infected by resistant bacterial strains recruited presumably from repeated chronic infections and antibiotic therapy [ 23 , 24 ] in whom we hypothesised an immunocompromisation . 68 patients with type 1 and type 2 diabetes mellitus aged between 30 and 70 years with infected dfus were consecutively included into our cross - sectional study . control group was formed by 34 patients matched by age , gender , and type of diabetes but without a history of diabetic foot disease . we included those patients with dfus who had been treated according to current guidance by the iwgdf in our out - patient foot clinic for their dfus for at least six weeks , were classified as texas ii - iii / b - d , and had mild or moderate infection as defined by the pedis system . the presence of infection was confirmed by clinical findings and/or elevated laboratory markers of inflammation ; osteomyelitis was defined clinically , by x - ray , positive microbial findings , and/or laboratory signs of infection . before inclusion , patients with dfus had to have at least two positive wound cultures from swabs taken from the deep tissue after local debridement . resistance to antibiotics was tested by sets of antibiotics composed on the basis of previous analysis of resistance at the institute for clinical and experimental medicine and upon the recommendations of the national reference laboratory on antibiotics , national institute of health , prague , czech republic . microbial resistance to different types of antibiotics was determined by disc diffusion test [ 28 , 29 ] . minimum inhibitory concentration ( mic ) was evaluated only in special cases by broth microdilution testing on microplates or by using the gradient method ( e - test ) . resistant pathogens were defined as those resistant to all oral antibiotics or produced enzymes causing microbial resistance such as esbl ( broad - spectrum beta - lactamase ) , ampc ( beta - lactamase c ) , and mec gen . our department of clinical microbiology works with eucast methodology to interpret the results of sensitivity using clinical breakpoints according to the current version . to identify resistance phenotypes ( determination of resistant / sensitive pathogens ) we also used methods developed by the national reference laboratory on antibiotics , national institute of health , prague , czech republic . patients with critical limb ischemia ( doppler ankle / brachial index < 0.6 and/or doppler toe pressure < 50 mmhg and/or transcutaneous oxygen pressure ( tcpo2 ) < 30 mmhg and/or advanced arterial stenosis or occlusion requiring endovascular / surgical revascularisation based on invasive arterial assessment , angiography , ct- , or mr - angiography ) , with no option critical limb ischemia , advanced renal insufficiency ( based on chronic kidney disease classification of 4th and 5th stage ) , active cancer , signs of acute infection , treatment with corticosteroids or other immunosuppressive drugs , post - organ transplant , with known immune dysfunction , hepatic failure , or malnutrition were excluded . all patients with infected chronic dfus included into our study were further divided into two subgroups : patients from whom sensitive microbial strains were isolated ( subgroup s , n = 50 ) and those from whom resistant microbes ( subgroup r , n = 18 ) were isolated on at least one occasion . these subgroups did not differ significantly in age , tcpo2 , type and duration of dfus , the incidence of osteomyelitis , or dfus characteristics ( depth , area ) . the following were measured in all participants : blood glucose level ( by spectrophotometry ; abbott architect , usa ) , creatinine ( detected enzymatically ; abbott architect , usa ) , and glycosylated haemoglobin ( hba1c : normal values 2042 mmol / mol ; by hplc method ; tosoh g8 , japan ) . from laboratory markers of infection were assessed crp ( determined turbidimetrically ; abbott architect , usa ) , procalcitonin ( by electrochemiluminescence ; eclia , cobac 6000 , roche , switzerland ) , and blood cell counts ( by spectrophotometry ; sysmex , japan ) . complements represented by c3 , c4 ( by immunonephelometry ; abbott architect , usa ) , the absolute amounts and percentages of nk cells ( cd16/56 + cells ) , and cd14+hla - dr cells ( monocytes , which serve as an important prognostic factor for the progression of an infection , especially in septic stage ) were measured . nk cells and cd14+hla - dr cells were determined together with subpopulations of lymphocytes ( see below ) by flow cytometry . phagocytosis was defined by the percentage of phagocytic cells and fagsi ( phagocyte stimulation index ) . phagocytic activity of granulocytes was tested by measuring the respiratory ( oxidative ) burst after their stimulation with e. coli bacteria in human heparinized whole blood using flow cytometry . cd3 + , cd4 + , cd8 + , naive inactive ( cd4+cd45ra+cd62l+ ) , memory inactive ( cd4+cd45racd62l+ ) , naive effector ( cd4+cd45ra+cd62l ) and memory effector cd4 + t lymphocytes ( cd4+cd45racd62l ) and naive inactive ( cd8+cd45ra+cd62l+ ) , memory inactive ( cd8+cd45racd62l+ ) , naive effector ( cd8+cd45ra+cd62l ) , and memory effector cd8 + t lymphocytes ( cd8+cd45racd62l ) were assessed by flow cytometry . also we assessed their indexes counted as naive / memory cells . during flow cytometry venous blood samples were collected into sterile tubes containing edta . lymphocytes from peripheral blood ( 100 l ; approximately 1 10 cells ) were labelled with a 4-color monoclonal antibody panel cyto - stat tetrachrome cd45-fitc ( clone : b3821f4a)/cd56-rd1 ( clone : n901/nkh1)/cd19-ecd ( clone : j3 - 119)/cd3-pc5 ( clone : ucht1 ) + cd16-pe ( clone : 3g8 ) and cd45-fitc ( clone : b3821f4a)/cd4-rd1 ( clone : sfci12t4d11)/cd8-ecd ( clone : sfci21thy2d3)/cd3 ( clone : ucht1 ) ( all beckman coulter , brea , ca ) . the specific antibody panels used for t effector cells consisted of anti - cd4-pe ( clone : 13b8.2 ) , anti - cd8-pc7 ( clone : sfci21thy2d3 ) , anti - cd62l - pc5 ( clone : dreg56 ) , and anti - cd45ra - fitc ( clone : alb11 ) ( all beckman coulter , brea , ca ) . the specific antibody panels used for activation of cd14 + cells consisted of anti - cd14 ( clone : rm052 ) and anti - hla - dr - pe ( clone : immu357 ) ( beckman coulter , brea , ca ) . following staining , samples were analysed using an fc 500 flow cytometer ( beckman coulter ) with cxp and kaluza software ( beckman coulter ) . serum levels of immunoglobulins ( igm , iga , and igg , diagnosed by immunoturbidimetry ; abbott architect , usa ) and igg subclasses ( determined by immunonephelometry ; immage / immage 800 , beckman coulter , usa ) were also measured . in addition to this , we also compared the number of patients with deficits , particularly in igg subclasses . deficiencies were defined as serum levels of certain immunoglo - bulin or its subclass below physiological ranges that were determined by several studies and the producer beckman coulter . the characteristics of patients , laboratory markers of infection , and selected measures of innate and adaptive immunity , including lymphocyte subpopulations and igg subclasses , were compared between the study groups and subgroups . descriptive data were presented as means sd ; differences between all study groups were determined using t - test , mann whitney test , and multiple comparisons for kruskal - wallis test . the spearman rank correlation coefficient was used to determine any significant correlation between assessed data . patients with infected dfus did not differ significantly in basic characteristics from the diabetic controls apart from higher serum creatinine levels ( table 1 ) . study patients with dfus had median of dfu duration 7.5 months ( range 1.548 months ) and median of ulcer area 1 cm ( range 0.0443.4 cm ) . 66.2% of patients had dfus of texas classification iib / d and 33.8% of texas classification iiib / d . total numbers of leukocytes ( 7.7 1.9 versus 8.5 2.4 10/l ; ns ) , neutrophils ( 5.1 1.5 versus 5.3 1.8 10/l ; ns ) , and other laboratory markers of infection instead of crp ( table 1 ) did not differ significantly between patients with dfus and diabetic controls . there were no changes in measures of innate immunity except for lower absolute numbers of nk cells between the two study groups ( table 2 ) . differences were observed predominantly in measures as of cellular as of humoral branch arm of adaptive immunity . reductions of percentages and absolute values of total lymphocytes and decreased absolute numbers of almost all types of lymphocytes subpopulations including b lymphocytes , cd4 + , cd8 + t lymphocytes , and their effector and memory cells ( table 3 ) as well as changes in humoral immunity were found in patients with infected dfus ( table 4 ) . from the evaluated immunological measures only igg2 ( r = 0.2008 ; p < 0.05 ) and igg3 ( r = 0.1972 ; p < 0.05 ) significantly negatively correlated with hba1c . patients infected by resistant pathogens differed significantly from those infected by sensitive microorganisms in the percentage of basophils ( 0.43 0.24 versus 0.66 0.38 10/l ; p < 0.01 ) . other measures of inflammation did not differ significantly between the study subgroups except a significantly higher percentage of nk cells in subgroup r ( 16.6 7.5 versus 12.3 5.7 ; p < 0.01 ) compared to subgroup s. moreover , subgroup r did not reach high levels of iga ( 3.07 1.15 versus 3.74 1.35 g / l ; ns ) , igg ( 11.01 3.01 versus 12.69 3.16 g / l ; p < 0.05 ) , and igg1 ( 6.49 2.13 versus 6.98 2.22 g / l ; ns ) in contrast to subgroup s that differed significantly in mentioned parameters compared to diabetic controls ( figure 1 ) . subgroup r was characterised by significantly lower levels of igg4 compared to subgroup s and diabetic controls ( 0.29 0.25 versus 0.54 0.43 and 0.43 0.38 there were no significant differences in deficits of each immunological subclass between the study groups ( table 4 ) , except a trend to higher igg2 subclass deficiency shown in patients with infected dfus compared to diabetic controls ( 22 versus 15% ) . in our study , we focused on the evaluation of systemic immunity changes to determine the occurrence of immune deficiencies at the level as of innate as of adaptive immunity . we aimed to clarify whether some patients with any kind of immunodeficiency exist among those treated for nonhealing chronically infected wounds . it could help in several cases potentially explain the prolonged dfus healing and inadequate inflammatory response to local infection . we did not assess any immune parameters or mediators at the local level since their concentrations could be modified by a variety of factors including , for example , the mild forms of peripheral arterial disease or previous applications of biological active local dressings . the main findings in patients with chronically infected dfus were the significantly reduced percentages and absolute numbers of lymphocytes in contrast to diabetic controls without dfus . we could explain the lower serum levels of lymphocytes by a previously described impairment of immune system at the level of lymphoid stem cells or mesenchymal cells or other factors including stress , age , and possibly diabetes mellitus alone . such factors could induce dysregulations of cytokine production and glycation of specific proteins may be behind the control of production and differentiation of lymphocytes . moreover , decreased numbers of lymphocytes in patients with chronically infected dfus could be related to an immunological pressure in which bacterial infection induces a production of polymorphonuclear cells potentially leading to relative suppression or increased apoptosis of lymphocytes as was described by arya et al . . nevertheless , we did not find higher levels of neutrophils in our patients with dfus . the reduced number of lymphocytes seen in our study in patients with the dfus was associated with a decline in the absolute numbers of almost all subpopulations of lymphocytes including t - helper , cytotoxic lymphocytes , b lymphocytes and naive , memory inactive , and effector cells as of cd4 + as ofcd8 + t lymphocytes . similar findings have been demonstrated in experimental animal models and also in healthy individuals under conditions of acutely induced hyperglycaemia , which led not only to lymphopenia but also to a decline of subpopulations of lymphocytes including cd3 + , cd4 + , and cd8 + t lymphocytes . in our study , however , correlations between blood glucose levels or hba1c and subpopulations of lymphocytes were not seen . naive cells are defined by the expression of cd45ra antigen , which is present on the surface of approximately 50% of t lymphocytes . t lymphocytes expressing on their surface the cd45ro antigen are antigen activated cells ( memory cells ) . ( cd4 + ) . during the activation of t lymphocytes ( i.e. , due to infection ) , the expression of cd45ra decreases simultaneously with the increase of the expression of cd45ro isoforms . the rise of effector cells , particularly cd8 + effector memory cells , together with the lower indexes of naive / memory cells should be seen during the infection . however , we observed neither increased counts of effector cells nor decreased indexes in patients with diabetes and chronic infection within the diabetic foot . we could speculate that the appropriate activation of selected types of lymphocytes does not occur due to the long - lasting depletion of the immune system by repeated and/or chronic infections . other significant changes that were found in our study were alterations in the humoral arm of the adaptive immune system , in immunoglobulins levels . in addition to elevated serum levels of total iga and igg , patients with dfus had in comparison to diabetic controls significant differences in igg subclasses , specifically increased levels of igg1 and igg3 suggesting activation of immune system by inflammation . both molecules serve as complement activators via binding to the protein antigen of the pathogen . therefore , the elevation of their values is not surprising in infection , although it has not been previously described in patients with chronically infected dfus . since a response to bacterial infection could be altered in patients with dfus , especially in the presence of immunoglobulin deficiencies particularly in igg subclasses , we have also focused on their detection . a high number of patients from both study groups showed igg2 deficiencies ( defined as serum levels below 2.42 g / l ) , exceeding 1520% . in the general population , although the most common selective deficit of igg subclasses is an igg2 deficit , however real prevalence data are unavailable . the occurrence of igg subclass deficiencies in the diabetic population , even in patients with dfus , has not been previously described . since igg2 plays an important role in the inflammatory cascade due to the ability to opsonise bacteria , its deficiency may contribute to an increased risk of infection [ 5 , 6 ] . detected deficits of igg2 subclasses could possibly be secondary to diabetes , since serum levels of igg2 and also igg3 in our study negatively correlated with glycaemic control . we could thus hypothesise that reduced production or greater degradation of immunoglobulins as glycoproteins may be related to their glycation ( b lymphocytes were reduced but their absolute numbers did not correlate with diabetes control ) . conversely , deficits of certain immunoglobulin subclasses could be also caused by long - lasting consumption of them during chronic bacterial load . this theory is supported by the finding of decreased levels of igg and predominantly of igg4 subclasses in the patients repeatedly infected predominantly by resistant pathogens . looking at the possible alterations of the immune system in patients infected by resistant pathogens , we did not find the marked deficits of immune system that we initially supposed in such cohort in contrast to patients infected by sensitive microorganisms . differences were seen predominantly in humoral immunity in the patients with resistant pathogens , in whom the serum levels of individual immunoglobulins and even igg subclasses did not reach the levels detected in patients infected by sensitive microorganisms . in fact , igg4 values were significantly lower , less than half of those found in the subgroup with sensitive pathogens and diabetic controls . we speculate that patients with dfus infected by resistant pathogens have a predisposition to the long persistence of these bacteria possibly due to insufficiently activated humoral immunity , which in turn leads to reduced opsonisation , activation of cell - mediated immunity , and reduced elimination of pathogens by the immune system . our study did not show significant alterations of the immune system at the level of innate immune system including measures of phagocytosis . no changes were found in values of c3 , which is usually reduced during infection due to its consumption or hyperglycaemia . lower absolute numbers of nk cells in our study in patients with dfus were probably given by lower values of total lymphocytes . significantly increased laboratory markers of infection in patients with infected dfus are closely related to physiologically stimulated immune response to inflammation . this confirms the results of other studies [ 42 , 43 ] , which have not demonstrated dramatic increase of inflammation in patients with dfus despite the presence of infectious complications including osteomyelitis . in our study only slightly elevated crp levels up to 10 mg / l ( detected in 33/68 , 49% , of patients with the dfus versus 5/34 , 15% , of diabetic controls ; p < 0.01 ) , and more than half of the patients actually had crp levels within the normal range . elevated serum procalcitonin has been suggested to be a better predictor for the presence of infection or osteomyelitis than the other laboratory markers of inflammation , except crp . however , we did not find significant abnormalities in procalcitonin levels . from other laboratory markers of infection , the numbers of neutrophils were not significantly increased in our patients with dfus , and this finding is in accordance with other studies [ 43 , 46 ] . based on the above data , we could surmise that a significant activation of systemic inflammatory immune response does not occur in patients with infected chronic dfus as could be expected in the case of inflammation including osteomyelitis . we conclude that in this group of patients with infected chronic dfus mild activation of a systemic inflammatory response and significantly reduced numbers of lymphocytes , including nearly all of their subpopulations , were found . there was no evidence , however , of their activation , especially an increase of effector cells or reduction of appropriate subpopulations indexes ( naive / memory cells ) as may have been expected . in patients with infected dfus we further demonstrated abnormalities of the humoral components of immunity particularly at the level of igg subclasses combined with a relatively high incidence of their deficits , especially of igg2 . changes in igg subclasses were more prevalent in patients whose dfus were infected by resistant pathogens . we did not include into our study patients with noninfected diabetic foot ulcers since they represent only a minority group of our complicated patients with the diabetic foot in our foot clinic which provides a comprehensive care for patients from the whole republic , other centers , transplant and immunocompromised patients , and so forth . in our previous study we focused on possible changes of innate or adaptive immunity and compared these results among patients with diabetic foot ulcers ( without clinically relevant infection ) , diabetic controls , nondiabetics with leg ulcers , and healthy volunteers with no largely significant differences [ 21 , 48 , 49 ] . therefore , we tried to select a group of patients with chronically infected nonhealed diabetic foot ulcers , where potential changes of the immune system will be more remarkable in contrast to match control group of diabetic patients . the results of our study showed that there are not major abnormalities of systemic immunity , and only certain deficits mainly at the level of lymphocytes subpopulations and immunoglobulin subclasses are present . its effectiveness may be further reduced at the local level due to a number of factors , including the possible coexistence of mild capillary ischemia contributing to the development of dfus that could lead to worse migration of effector cells to the target destination . we recommend performing more detailed immunological investigations in patients with dfus with recurrent or chronic infectious complications particularly caused by resistant pathogens . these tests should focus on the determination of cell - mediated and humoral immunity , concretely on lymphocyte subpopulations and igg subclasses .
### Summary: : the aim of our study was to analyse immune abnormalities in patients with chronic infected diabetic foot ulcers ( dfus ) especially those infected by resistant microorganisms . methods . 68 patients treated in our foot clinic for infected chronic dfus with 34 matched diabetic controls were studied . patients with infected dfus were subdivided into two subgroups according to the antibiotic sensitivity of causal pathogen : subgroup s infected by sensitive ( n = 50 ) and subgroup r by resistant pathogens ( n = 18 ) . selected immunological markers were compared between the study groups and subgroups . results . patients with infected chronic dfus had , in comparison with diabetic controls , significantly reduced percentages ( p < 0.01 ) and total numbers of lymphocytes ( p < 0.001 ) involving b lymphocytes ( p < 0.01 ) , cd4 + ( p < 0.01 ) , and cd8 + t cells ( p < 0.01 ) and their naive and memory effector cells . higher levels of igg ( p < 0.05 ) including igg1 ( p < 0.001 ) and igg3 ( p < 0.05 ) were found in patients with dfus compared to diabetic controls . serum levels of immunoglobulin subclasses igg2 and igg3 correlated negatively with metabolic control ( p < 0.05 ) . a trend towards an increased frequency of igg2 deficiency was found in patients with dfus compared to diabetic controls ( 22% versus 15% ; ns ) . subgroup r revealed lower levels of immunoglobulins , especially of igg4 ( p < 0.01 ) in contrast to patients infected by sensitive bacteria . the innate immunity did not differ significantly between the study groups . conclusion . our study showed changes mainly in the adaptive immune system represented by low levels of lymphocyte subpopulations and their memory effector cells , and also changes in humoral immunity in patients with dfus , even those infected by resistant pathogens , in comparison with diabetic controls .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : delayed cerebral ischemia ( dci ) is a feared complication and an important cause of poor outcome after aneurysmal subarachnoid hemorrhage ( sah ) . more than 20 years ago , the calcium antagonist nimodipine was identified as a drug that decreases the risk of dci . however , the effect of nimodipine is only modest . many patients still develop this complication and suffer from its consequences magnesium sulfate is a promising drug that is presently being investigated in randomized trials . in the current study , wong and colleagues performed a systematic review and meta - analysis update of randomized controlled trials that investigated the efficacy of magnesium sulfate in patients with aneurysmal sah . the present meta - analysis differs from previous meta - analyses in that it included the results of two recently published randomized trials . outcome measures were dci , cerebral infarction , and functional outcome 3 and 6 months after sah . the number of patients for the various meta - analyses ranged between 381 and 494 . the results showed that magnesium sulfate decreased the rate of cerebral infarction , but not of dci or poor functional outcome . recently , it has been proposed that the main outcome measures of clinical trials and observational studies that investigate the complication of dci should be cerebral infarction and functional outcome . arterial narrowing ( vasospasm ) is a radiographic finding associated with clinical deterioration due to dci , cerebral infarction , and functional outcome . vasospasm is often asymptomatic , and a reduction of vasospasm does not result in better functional outcomes . clinical deterioration due to dci is less reliable than cerebral infarction , since it is more likely subject to inter - observer bias . cerebral infarction represents the ultimate outcome of the ischemic event , while clinical deterioration due to dci is a diagnosis per exclusionem . clinical deterioration after sah can have multiple causes , such as infections , seizures , electrolyte disturbances , and hydrocephalus . the present meta - analysis used both dci and cerebral infarction as outcome measures , and only found a beneficial effect on cerebral infarction . this effect on cerebral infarction did not translate to a beneficial effect on outcome , but as pointed out by the authors , an effect on outcome can not be ruled out because of the relatively low number of included patients . even if the present meta - analysis had shown a beneficial effect of magnesium sulfate on functional outcome , an important unanswered question would be which treatment protocol should be applied in daily practice . the concentration of magnesium sulfate was either 64 or 80 mmol / day , with or without initial bolus , and with or without dosage adjustment according to serum magnesium levels . the magnesium in aneurysmal subarachnoid hemorrhage - ii ( mash - ii : isrctn68742385 ) phase iii clinical trial will hopefully shed more light on the efficacy of magnesium sulfate in this group of patients . mash - ii aims to include 1,200 patients , which is based on a relative risk reduction of poor functional outcome of 22% ( with alpha = 5% and a power of 80% ) . in mash - ii , magnesium sulfate 64 mmol / day or placebo is started within 4 days after sah and continued until 20 days after the hemorrhage . dci : delayed cerebral ischemia ; mash - ii : magnesium in aneurysmal subarachnoid hemorrhage - ii ; sah : subarachnoid hemorrhage . mervyn di vergouwen is financially supported by a grant from the netherlands thrombosis foundation , the netherlands ( 2010 - 4 ) .
### Summary: : delayed cerebral ischemia ( dci ) is a feared complication and an important cause of poor outcome after aneurysmal subarachnoid hemorrhage ( sah ) . in the current study , wong and colleagues performed a systematic review and meta - analysis of randomized controlled trials that investigated the efficacy of magnesium sulfate in patients with aneurysmal sah . outcome measures were dci , cerebral infarction , and functional outcome 3 and 6 months after sah . magnesium sulfate decreased the rate of cerebral infarction , but not of dci or poor functional outcome . regarding outcome , a beneficial effect of magnesium sulfate on outcome can not be ruled out because of sample size limitations . even if this meta - analysis had shown an effect on outcome , the question remains which treatment protocol should be applied in daily practice , since the administration of magnesium sulfate differed between most included studies . the present meta - analysis also underlines the importance of defining clinically relevant endpoints in sah trials . clinical deterioration due to dci is more subject to inter - observer bias compared to cerebral infarction , which represents the ultimate outcome of the ischemic event . the magnesium in aneurysmal subarachnoid hemorrhage - ii ( mash - ii : isrctn68742385 ) phase iii clinical trial nears completion . it aims to include 1,200 patients , and its results are urgently awaited .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : " it is perhaps hard to make firm statements on such questions without having examined them many times aristotle , categories , 8b21 ( translated by j.l ackrill , clarendon press , oxford 1963 ) " over the past ten years , we have witnessed the publication of several chromosomes or complete genome sequences from a variety of bacterial , archaeal and eukaryotic species . the trend towards genome sequencing is expected to continue or even accelerate in the foreseeable future . the wealth of sequence information being produced has generated the need for rapid annotation and subsequent biological interpretation of genome sequences . annotation can be defined as a process by which structural or functional information is inferred for genes or proteins , usually on the basis of similarity to previously characterized sequences in public databases . the annotation process associates genome sequences with functional information and guides experimentation by relating genotypes to phenotypic properties . once a genome - sequencing project is completed and the information is released into the public domain , it is common practice for certain groups of researchers to take a ' second look ' at the original annotation , for various reasons . we define the process of annotating a previously annotated genome sequence as ' re - annotation ' . motivations for re - annotation include discovery of more genes and protein functions , testing and performance - comparison of existing or newly developed annotation methods , and assessment of annotation reproducibility . re - annotation also provides up - to - date information for end - users , using the latest resources - such as new or improved algorithms and richer databases . clearly , the drive for re - annotation goes back in time , arising even before the availability of entire genome sequences . for example , in an attempt to assign function to a number of uncharacterized , hypothetical genes from archaeal species , one of the earliest large - scale re - annotation studies produced a number of novel predictions . what sets whole - genome re - annotation apart from other analyses , however , is its distinctly discontinuous and comparative nature : independent groups of researchers systematically generate novel predictions and compare them with an original set of gene - function predictions in an incremental and stepwise manner . we believe that this mode of annotation provides valuable insights into the process of protein - function assignment . it is different from the continuous mode of annotation adopted by the groups who originally annotate genome sequences having completed them , as they may not always document their annotation methods , or improvements to annotations , in the published record . the groups who perform re - annotation usually have no access to the original primary sequencing data ( such as fluorescence traces from genome - sequencing machines ) , making the detection of certain features - such as frameshift errors - quite cumbersome . the process is labor - intensive , because it considers the entire genome and involves a significant number of manual operations , including the correction of misleading original annotations . finally , the lack of ' gold standards ' by which to judge annotations represents a challenge and raises a serious , but by no means unique , reproducibility issue : because there is no ' right ' answer for annotation , how can we assess its success ? quality control of annotation is probably the most important technical aspect , because it provides critical information on the performance of various approaches , by correcting various errors ( higher precision ) or generating more predictions ( higher coverage ) ; these issues are considered further below . re - annotation has not attracted sufficient attention as a distinct and specialized subject , possibly because of the highly charged and competitive nature of genome bioinformatics . here , we examine as objectively as possible the strengths and weaknesses of current re - annotation approaches and suggest a number of possible improvements . despite progress in the field of computational genomics , the process of annotation is still a largely manual , labor - intensive endeavor . because of the large number of genome sequence entries currently available ( over 300,000 genes ) , no single group has ever been able to generate manual annotations for all proteins . yet there is a great need for up - to - date , exhaustively annotated genome sequences . thus , systems such as genequiz , which infers sequence annotations automatically , provide valuable information resources ; for instance , we have recently been able to generate 73,500 gene annotations for 31 sequenced genomes . during the year 2001 janssen and c.a.o . , unpublished observations ) , and their annotations can be accessed online . re - annotation projects for individual species have been reported in the literature by a handful of groups . the species re - annotated include ( with strain names omitted for brevity ) : haemophilus influenzae , mycoplasma genitalium , methanococcus jannaschii , various archaeal species , mycoplasma pneumoniae , chlamydia trachomatis , thermotoga maritima , saccharomyces cerevisiae , plasmodium falciparum ( chromosome ii ) , aeropyrum pernix , and isolated cases of single genes ( table 1 ) . one interesting , and encouraging , pattern to emerge from these studies is that the level of improvement provided by re - annotation , calculated by expressing the number of genes for which new functions are predicted as a percentage of the total number of genes in the genome , is on average 7% ( table 1 ) . this indicates that , for the most part , various groups using different methods generate sets of predictions that are generally quite similar . these percentages can also be considered to represent the level of disagreement between the various groups ( as a function of genome size ) . proteins can be classified into two broad categories : assigned to a predicted function or unassigned ( sometimes referred to as ' hypothetical ' ) ; the improvement rate usually refers to the re - assignment of hypothetical proteins to proteins of predicted function . the above mentioned re - annotation reports usually claim that there has been an improvement over the original ( or previous ) attempts for genome annotation . but in all these predictions it is not certain whether this improvement represents more accurate identification of a gene or a protein function that escaped detection from the previous analysis . indeed , improvements over previous under - predictions ( or false negatives ) may correspond to current over - predictions ( or false positives ) . there is always pressure when re - annotating a genome to produce a ' better ' result , which can easily be obtained by loosening the criteria for function prediction - for example by using a weaker threshold for sequence - similarity comparisons . a cautionary note is therefore appropriate here : when researchers embark on a re - annotation project , the expectation is that they will be able to assign more functions to a set of sequences using computational methods . this natural tendency is usually supported either by looser thresholds in the analysis or by more up - to - date ( but not necessarily richer ) supporting databases . thus , the ' better ' results may be questionable , because of the subjectivity associated with any manual analysis . we believe the real challenge is therefore to procure and implement objective standards for genome annotation quality . given a gold standard - first , coverage is defined as the ratio of true positives over the sum of true positives plus false negatives - so , if there are no false negatives , coverage is 100% . second , precision is defined as the ratio of true positives over the sum of true positives plus false positives - so , if there are no false positives , precision is 100% . in any analysis , there is a trade - off between coverage and precision . a combined measure of these two numbers is accuracy , which is defined as the ratio of true ( positive plus negative ) cases over the total number of cases ( where ' cases ' are , for example , the number of genes or proteins ) . although these measures have not always been used explicitly in genome - annotation projects , they are usually implied in arguments about prediction accuracy . the problem is that even if we agree on measures of coverage , precision and accuracy , we do not currently have a single gold standard for genome - wide annotation . there is no complete genome for which all the gene structures ( start sites , exons , introns , and so on ) and the encoded protein functions have been experimentally determined . thus , all annotation attempts remain tentative - especially in the case of protein function assignments and descriptions . to assess the reproducibility of sequence - similarity - based annotation , some studies have focused on the set of known enzymes and used the enzyme commission ( ec ) classification number to measure performance : it has been shown in this way that function prediction by homology never reaches 100% accuracy . comparison of genome annotations with proteins of known structure also suggests that 100% accuracy is unattainable , although this result may also be influenced by the smaller number of structures than sequences in the public databases . in short , what we have learned in the past few years we have been able to compare various different approaches to genome annotation , but we are ultimately not aware of the absolute accuracy of these predictions . only experimental verification of gene and protein assignments will conclusively address the performance of computationally based function assignments on a genome - wide scale . this prospect may be within reach in the near future , thanks to the initiatives of structural and functional genomics , but at present we should be seeking a working definition of annotation accuracy for comparison purposes . the absolute ' truth ' for annotation quality could be defined as the maximum amount of information a panel of experts can generate on the basis of computational analysis , which extends beyond standard homology - based prediction and takes into account metabolic pathway analysis , contextual function prediction and whole - genome analysis and comparison . this level of annotation should reflect the maximum amount of information that can currently be generated for a given genome sequence , without the inclusion of errors that may propagate . unfortunately , the above definition of annotation accuracy still contains a subjective factor , which corresponds to the ' panel of experts ' . obviously , this can be very controversial , because it strongly depends on the composition of such a hypothetical panel and the opinions of the panel members . indeed , one interesting experiment would be to assess the degree to which different expert predictions agree by using a set of blind predictions over identical genome datasets , similar in scope and spirit to the casp competition for predicting protein structures . one important issue here is the need for continuous tracking of experimentally verified gene or protein functions . no matter how accurate computational predictions become , all annotations should in principle be traceable to biochemical or genetic experiments that derived a function for a gene product in the first place . this is an issue that has not been sufficiently addressed in the current databases , and there is an acute lack of annotation source and history for a large number of protein database entries , making this task exceedingly difficult . moreover , there is no good mechanism in place for automatically monitoring biological experiments that are pertinent to a particular system under consideration and integrating this information with computational analysis , for example by using databases of published literature . in our own re - annotation projects , we have recently come up with a qualitative scale of genome annotation quality , called the transitive annotation - based score , or tabs ( table 2 ) . first , it represents a distance scale between two annotation attempts . for example , if during re - annotation a particular annotation is considered to have been a false positive , a high penalty is assigned . this does not necessarily imply that the previous annotation was an error but rather that the distance between the two attempts is very high . second , penalty scores are ranked according to their potential damaging effects when propagated in the databases . for example , an over - prediction is potentially more detrimental than an under - prediction , because all homologs are in danger of inheriting this assignment , usually without a trace . for instance , if we detect both a domain error and a typographical error , we penalize the case as having a domain error , because we consider it much more important ( table 2 ) . the tabs scale for annotation quality departs from the traditional ' percentage ' notion of successful assignment and , we believe , provides a first step towards more quantifiable comparisons ; the cumulative sum of assignments maybe considered as a function of the error - propagation potential of the individual assignments . in the future , more complex schemes may be devised that would also weigh individual assignments according to the confidence of the prediction . for example , given two equivalent annotation schemes and assuming no mistakes , the one with the higher confidence should score higher - but errors in high - confidence predictions should result in high penalties . it is fortunate that institutions such as the institute for genomic research ( tigr ) , which has sequenced so many genomes to date , have opted for a high - precision approach . the fact remains , however , that many portions of available genome sequences have yet to be annotated , because researchers hold back from inferring functions with low certainty . occasionally , people who work with particular species have found new homologies that are informative of function , but these results have not been incorporated into any existing database . clearly , there needs to be a robust mechanism by which this occurs - and in the meantime we can only urge all researchers to make their results available in central databases . there are serious attempts to build consensus genome annotations for a number of model organisms ; these projects are community - based initiatives to keep annotations current and of high quality . unfortunately , this is not the case for less well - studied organisms with smaller research communities . we would argue that one obvious way is to provide annotations for all genomes that have been sequenced using automatic , reproducible protocols . we have recently analyzed all genomes available up to year 2001 using genequiz - these can be accessed online . automatically generated annotations may not be carefully curated but they do provide a solid basis , upon which the community can build . frequently , such annotations may be imported into curated databases , such as , for example , swiss - prot . another , more complex , issue is the peer - reviewing process for genome - sequencing articles . results in the published papers that result from sequenced genomes are thoroughly reviewed by expert referees - but the only experimental result of these papers is the genome sequence of the species under consideration . all annotations represent hypotheses that need to be verified , yet these annotations are accepted by databases and are included in the description line of the corresponding database entries . obviously , referees can not possibly review every single annotation provided by the authors , and this is where the classical peer - review system collapses , as indeed it does for most high - throughput , large - scale biological experiments . many open questions remain in our attempts to understand the science and art of genome re - annotation . to what degree can improved function predictions after genome re - annotation be assigned to growth in the public sequence databases , as opposed to the use of improved sequence - analysis algorithms , or simply to the use of different sequence - analysis algorithms ( an algorithm such as blast is heuristic and will miss some similarities - use of a different heuristic algorithm may find other similarities ) , or to different human expertise ? can researchers in the genome - annotation field develop a gold - standard set of proteins to permit more objective evaluation of new automated analysis systems ? how much variability is there in the annotations made by expert scientists ? how much ( if any ) better are expert scientists than purely automated programs for genome annotation ? we have not discussed here various issues related to gene structure prediction , the differences between a variety of semi- and fully - automatic protocols for genome annotation , exchange formats and tools for the dissemination of information and the process of incorporating genome annotations in public databases . undoubtedly , technological developments will assist towards our continually improving capacity for detecting functions encoded in genome sequences . these will , however , always have to be endorsed by the scientific community in order to have a real impact in the quality and scope of properly curated genome information resources of the twenty - first century . re - annotation projects column names and explanations : what , species or chromosome ; how , comments or methods ; why , the reasons for re - annotation - a , to find more genes ; b , a cautionary statement ; c , to find more functions ; d , to achieve fewer errors ; e , using new methods ; f , to assess reproducibility ; % , the improvement - in terms of additional genes predicted - over previous annotations , as a percentage of the total number of genes in the genome ; who , authors ; when , publication year ; reference , citation . n / a denotes not applicable . denotes percentages that have not been taken into account for the calculation . transitive annotation - based scale ( tabs ) : a qualitative distance scale for the assessment of annotation reproducibility in genome projects column names and explanations : score , the score between two assignments ; description , a description of the potential disagreement between two projects ; comment , explanatory comments for ranking / scores . we consider scores of 0 - 3 as relatively benign compared to scores of 4 - 7 , as the latter have a much more significant impact on genome sequence and database quality .
### Summary: : annotation , the process by which structural or functional information is inferred for genes or proteins , is crucial for obtaining value from genome sequences . we define the process of annotating a previously annotated genome sequence as ' re - annotation ' , and examine the strengths and weaknesses of current manual and automatic genome - wide re - annotation approaches .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : in the eastern mediterranean region more than 16 million people are living with diabetes , a staggering number which is expected to rise to almost 43 million by the year 2025 ( stakeholder , 2008 ) . diabetes has reached near - epidemic proportions in the united arab of emirates ( uae ) and saudi arabia , with nearly one out of every five individuals suffering from diabetes in the uae . in saudi arabia , the prevalence is expected to rise to between 40 and 50% by 2020 ( stakeholder , 2008 ) . vascular endothelium modulates blood vessel wall homeostasis through the production of factors regulating vessel tone coagulation state , cell growth , cell death and leukocyte trafficking ( mohsen et al . , 2006 ) . one of the most important endothelial cell products is nitric oxide ( no ) , which is synthesized from l - arginine by the enzyme endothelial nitric oxide synthase ( enos ) . endothelial nitric oxide synthase ( enos ; nos3 ) produces nitric oxide ( no ) from l - arginine . no has diverse physiologic regulatory functions and is involved in smooth muscle relaxation , inhibition of platelet aggregation , immune regulation , neurotransmission and blood pressure regulation ( rabbani et al . , an increased production of reactive oxygen species ( ros ) , including superoxide anion ( o2 ) may contribute to diabetic complications ( mclennan et al . o2 reacts with no with great affinity to produce peroxynitrite ( onoo ) ( gryglewski et al . , 1986 ) which is a weak agonist for activation of cyclic guanosine monophosphate ( cgmp ) ( villa et al . , the activation of nad ( p)h oxidase in diabetes mellitus ( dm ) is postulated to suppress the action of no ( ohishi and carmines , 1995 ) to increase the expression of the mrna for transforming growth factor - 1 ( tgf - 1 ) and fibronectin in the glomerulus , to decrease the expression of matrix metalloproteinases , and to increase the expression of the tissue inhibitor of metalloproteinases in the kidney ( chiarelli et al . , 2009 ) . these diverse effects could contribute to the pathophysiology of diabetic nephropathy ( dn ) ( schnackenberg and wilcox , 2001 ) . dn is a chronic microangiopathic complication of both type 1 and type 2 diabetes mellitus and is the primary cause of end - stage renal disease ( gross et al . , 2008 ) . it has been shown that enos inhibition accelerates atherosclerosis in animal models , and that abnormalities of the endothelial no pathway are present in humans with atherosclerosis ( salimi et al . , 2010).this evidence suggests that no may inhibit several key steps in the atherosclerotic process and that an alteration of no production within the vascular endothelium could contribute to the pathogenesis of atherosclerosis . thus enos could be a candidate gene for atherosclerosis ( manjula , 2011 ) . a single base exchange ( g894 t ) in exon 7 of the human endothelial nitric oxide synthase ( enos ) gene results in a glu asp substitution at residue 298 of the enos gene . the functional significance of this single nucleotide polymorphism ( snp ) remains an issue of controversy since homozygosity for the asp298 variant has been related to reduced enzyme activity ( manolio et al . , 2008 ) . two meta - analyses have discussed the association of enos gene polymorphisms with the risk of dn , the first one supported lack of association between them ( zintzaras et al . , 2009 ) . although the second meta - analysis supports the effects of the three polymorphisms ( 894 g > t , 4b / a , and t-786c ) in the enos gene on the risk of dn , it reported that none of them has been convincingly proved as determinants responsible for the development of dn , and referred that association to the linkage disequilibrium of these polymorphisms with other unidentified functional causative mutations that exist in the enos gene and affect the susceptibility to dn ( zeng et al . , 2010 ) . associations between this variant and coronary spasm , coronary artery disease and acute myocardial infarction have been reported , but data on its relation with disease severity are lacking ( manjula et al . , 2011 ) . until now there are not enough researches on the effect of the enos g894 t snp and the incidence of diabetic nephropathy in type 2 dm in saudi arabia . our objective in this study was to evaluate the association of g894 t polymorphism of enos gene with the risk of dn among type 2 diabetic saudi patients . it was carried out at medical laboratory department , applied medical science , qassim university . the subjects were recruited from endocrinology and nephrology outpatient clinics of the internal medicine department of the public and private hospitals in qassim region and they belonged to the same ethnic group : mixed .- diagnosis of type 2 dm based on the criteria established by the american diabetes association expert committee [ confirmed fasting blood glucose > 126 mg / dl ( 7 mmol / l ) and/or 2-h postprandial glucose level > 200 mg / dl ( 11.1 mmol / l ) on more than one occasion ] ( world health organization , 2006 ) and history of hypoglycemic treatment . type 2 dm subjects were selected on the basis of at least 5 years from diagnosis without insulin treatment and absence of concomitant autoimmune disease . patients who did not meet these criteria as under treatment but who gave a history of t2 dm were also included in the study . dn was defined as urinary albumin excretion of > 30 mg in 24 h urine collections ( lamb et al . , 2009 ) . patients with collagen vascular diseases , chronic infections , liver diseases as well as those with kidney diseases other than dn were excluded from the study . diagnosis of type 2 dm based on the criteria established by the american diabetes association expert committee [ confirmed fasting blood glucose > 126 mg / dl ( 7 mmol / l ) and/or 2-h postprandial glucose level > 200 mg / dl ( 11.1 mmol / l ) on more than one occasion ] ( world health organization , 2006 ) and history of hypoglycemic treatment . type 2 dm subjects were selected on the basis of at least 5 years from diagnosis without insulin treatment and absence of concomitant autoimmune disease . patients who did not meet these criteria as under treatment but who gave a history of t2 dm were also included in the study . dn was defined as urinary albumin excretion of > 30 mg in 24 h urine collections ( lamb et al . , 2009 ) . patients with collagen vascular diseases , chronic infections , liver diseases as well as those with kidney diseases other than dn were excluded from the study . all included subjects were divided into three main groups : group i:40 non diabetic subjects with no family history of diabetes or any chronic disease may interpret our results . exclusion criteria for control subjects were : the presence of type 2 dm or of a first - degree relative with type 2 dm , the presence of collagen vascular diseases , chronic infections and presence of chronic liver and kidney diseases .- diabetic patients were further classified according to the progress of the disease into : ii - group ii40 patients suffered from type 2 dm without nephropathy who had t2 dm for at least 10 years or more after diagnosis and urinary albumin excretion of < 30 mg in 24 h urine collections ( lamb et al . , 2009).iii - group iii40 patients suffered from type 2 dm with dn who had persistent proteinuria . dn was defined as urinary albumin excretion of > 30 mg in 24 h urine collections ( lamb et al . , 2009 ) . diabetic subjects without proteinuria but on antihypertensive drug treatment were excluded from the study group in order to avoid misclassification of phenotype . 40 non diabetic subjects with no family history of diabetes or any chronic disease may interpret our results . exclusion criteria for control subjects were : the presence of type 2 dm or of a first - degree relative with type 2 dm , the presence of collagen vascular diseases , chronic infections and presence of chronic liver and kidney diseases .- diabetic patients were further classified according to the progress of the disease into : diabetic patients were further classified according to the progress of the disease into : 40 patients suffered from type 2 dm without nephropathy who had t2 dm for at least 10 years or more after diagnosis and urinary albumin excretion of < 30 mg in 24 h urine collections ( lamb et al . , 2009 ) . dn was defined as urinary albumin excretion of > 30 mg in 24 h urine collections ( lamb et al . diabetic subjects without proteinuria but on antihypertensive drug treatment were excluded from the study group in order to avoid misclassification of phenotype . history taking included questions about smoking habits , history of hypertension and type 2 diabetes , and current medication used . i - full history and clinical examination.ii-research investigations:1-estimation of fasting blood glucose ( fbg ) level by enzymatic method . ( trinder , 1969).2-determination of glycated hemoglobin ( hba1c ) in blood ( abraham et al . , 1978).3-total lipid profile levels :- triglyceride was determined enzymatically ( bucolo and david , 1973).-total cholesterol was estimated by enzymatic method ( assmann et al . , 1983).-lipoprotein cholesterol ( hdl - c ) ( assmann et al . , 1983).-low density lipoprotein cholesterol ( ldl - c ) ( ldl - c concentration was calculat - estimation of high density ed by the friedewald formula.4-measurement of plasma creatinine ( murray and kaplan , 1989).5 - 24 h urine samples were collected for protein analysis ( orsonneau et al . , 1989).6-determination of plasma nitric oxide ( no ) levels ( green et al . , 1982).7-determination of endothelial nitric oxide synthase ( enos ) g894 t polymorphism by pcr - based rflp ( nishevitha et al . , 2009 ) . full history and clinical examination . ( trinder , 1969).2-determination of glycated hemoglobin ( hba1c ) in blood ( abraham et al . , 1978).3-total lipid profile levels :- triglyceride was determined enzymatically ( bucolo and david , 1973).-total cholesterol was estimated by enzymatic method ( assmann et al . , 1983).-lipoprotein cholesterol ( hdl - c ) ( assmann et al . , 1983).-low density lipoprotein cholesterol ( ldl - c ) ( ldl - c concentration was calculat - estimation of high density ed by the friedewald formula.4-measurement of plasma creatinine ( murray and kaplan , 1989).5 - 24 h urine samples were collected for protein analysis ( orsonneau et al . , 1989).6-determination of plasma nitric oxide ( no ) levels ( green et al . , 1982).7-determination of endothelial nitric oxide synthase ( enos ) g894 t polymorphism by pcr - based rflp ( nishevitha et al . , determination of glycated hemoglobin ( hba1c ) in blood ( abraham et al . , 1978 ) . total lipid profile levels :- triglyceride was determined enzymatically ( bucolo and david , 1973).-total cholesterol was estimated by enzymatic method ( assmann et al . , 1983).-lipoprotein cholesterol ( hdl - c ) ( assmann et al . , 1983).-low density lipoprotein cholesterol ( ldl - c ) ( ldl - c concentration was calculat - estimation of high density ed by the friedewald formula . total cholesterol was estimated by enzymatic method ( assmann et al . , 1983 ) . lipoprotein cholesterol ( hdl - c ) ( assmann et al . , 1983 ) . low density lipoprotein cholesterol ( ldl - c ) ( ldl - c concentration was calculat estimation of high density ed by the friedewald formula . 24 h urine samples were collected for protein analysis ( orsonneau et al . , 1989 ) . determination of plasma nitric oxide ( no ) levels ( green et al . , 1982 ) . determination of endothelial nitric oxide synthase ( enos ) g894 t polymorphism by pcr - based rflp ( nishevitha et al . , 2009 ) . under complete aseptic conditions , 5 ml of venous blood was collected after 12 hour fasting in sterile edta containing tubes and divided into two tubes : one tube of whole blood was collected for dna extraction and enos gene g894 t snp detection and kept immediately at 20 c . plasma specimen of the other tube was obtained by centrifugation at low speed centrifugation at 2500 g ; 15 min for estimating the plasma nitrate levels and other research investigations . dna extraction and dna analysis for enos g894 t polymorphism were achieved by pcr - based rflp . the average dna concentration was determined from absorbance at 260 nm . all dna samples were examined at a 260/280 nm absorbance ratio . the integrity of the dna was checked by electrophoresis on 1.5% agarose gel with an ethidium bromide . genomic dna ( ~ 50 ng ) was incubated in a total reaction volume of 50 l containing equal concentration of the forward primer 5 tcc ctg agg gca tga ggc t-3 ( 70 picomoles ) and reverse primer 5 tga ggg tca cac agg ttc ct-3 , 200 m d ntp , 10x pcr buffer ph8.3 containing 15 mm mgcl2 and 1.5 units of taq dna polymerase . dna was initially denatured at 95 c for 5 min prior to amplification . pcr amplification was accomplished using 30 cycles , consisting of 2 min denaturation at 95 c , 45 sec annealing at 62 c , and 1 min extension at 72 c and the final extension included a 1 min extension at 72 c . restriction digestion was performed in a total volume of 10 l amplicons , 1 l ne buffer ( 50 mm potassium acetate , 20 mm tris - acetate , 10 mm magnesium acetate , 1 mm dithio - threitol ph7.9 at 25 c ) and 8 units of ban ii enzyme . samples then were incubated for 5 h at 37 c and the digested pcr products were separated by 2.5% agarose gel electrophoresis stained with ethidium bromide and visualized on a uv transilluminator with 100 base pair ladder and photographed . i - full history and clinical examination.ii-research investigations:1-estimation of fasting blood glucose ( fbg ) level by enzymatic method . ( trinder , 1969).2-determination of glycated hemoglobin ( hba1c ) in blood ( abraham et al . , 1978).3-total lipid profile levels :- triglyceride was determined enzymatically ( bucolo and david , 1973).-total cholesterol was estimated by enzymatic method ( assmann et al . , 1983).-lipoprotein cholesterol ( hdl - c ) ( assmann et al . , 1983).-low density lipoprotein cholesterol ( ldl - c ) ( ldl - c concentration was calculat - estimation of high density ed by the friedewald formula.4-measurement of plasma creatinine ( murray and kaplan , 1989).5 - 24 h urine samples were collected for protein analysis ( orsonneau et al . , 1982).7-determination of endothelial nitric oxide synthase ( enos ) g894 t polymorphism by pcr - based rflp ( nishevitha et al . , 2009 ) . ( trinder , 1969).2-determination of glycated hemoglobin ( hba1c ) in blood ( abraham et al . , 1978).3-total lipid profile levels :- triglyceride was determined enzymatically ( bucolo and david , 1973).-total cholesterol was estimated by enzymatic method ( assmann et al . , 1983).-lipoprotein cholesterol ( hdl - c ) ( assmann et al . , 1983).-low density lipoprotein cholesterol ( ldl - c ) ( ldl - c concentration was calculat - estimation of high density ed by the friedewald formula.4-measurement of plasma creatinine ( murray and kaplan , 1989).5 - 24 h urine samples were collected for protein analysis ( orsonneau et al . , 1989).6-determination of plasma nitric oxide ( no ) levels ( green et al . , 1982).7-determination of endothelial nitric oxide synthase ( enos ) g894 t polymorphism by pcr - based rflp ( nishevitha et al . , 2009 ) . determination of glycated hemoglobin ( hba1c ) in blood ( abraham et al . , 1978 ) . total lipid profile levels :- triglyceride was determined enzymatically ( bucolo and david , 1973).-total cholesterol was estimated by enzymatic method ( assmann et al . , 1983).-lipoprotein cholesterol ( hdl - c ) ( assmann et al . , 1983).-low density lipoprotein cholesterol ( ldl - c ) ( ldl - c concentration was calculat - estimation of high density ed by the friedewald formula . total cholesterol was estimated by enzymatic method ( assmann et al . , 1983 ) . lipoprotein cholesterol ( hdl - c ) ( assmann et al . , 1983 ) . low density lipoprotein cholesterol ( ldl - c ) ( ldl - c concentration was calculat estimation of high density ed by the friedewald formula . 24 h urine samples were collected for protein analysis ( orsonneau et al . , 1989 ) . determination of plasma nitric oxide ( no ) levels ( green et al . , 1982 ) . determination of endothelial nitric oxide synthase ( enos ) g894 t polymorphism by pcr - based rflp ( nishevitha et al . , 2009 ) . under complete aseptic conditions , 5 ml of venous blood was collected after 12 hour fasting in sterile edta containing tubes and divided into two tubes : one tube of whole blood was collected for dna extraction and enos gene g894 t snp detection and kept immediately at 20 c . plasma specimen of the other tube was obtained by centrifugation at low speed centrifugation at 2500 g ; 15 min for estimating the plasma nitrate levels and other research investigations . dna extraction and dna analysis for enos g894 t polymorphism were achieved by pcr - based rflp . the average dna concentration was determined from absorbance at 260 nm . all dna samples were examined at a 260/280 nm absorbance ratio . the integrity of the dna was checked by electrophoresis on 1.5% agarose gel with an ethidium bromide . genomic dna ( ~ 50 ng ) was incubated in a total reaction volume of 50 l containing equal concentration of the forward primer 5 tcc ctg agg gca tga ggc t-3 ( 70 picomoles ) and reverse primer 5 tga ggg tca cac agg ttc ct-3 , 200 m d ntp , 10x pcr buffer ph8.3 containing 15 mm mgcl2 and 1.5 units of taq dna polymerase . dna was initially denatured at 95 c for 5 min prior to amplification . pcr amplification was accomplished using 30 cycles , consisting of 2 min denaturation at 95 c , 45 sec annealing at 62 c , and 1 min extension at 72 c and the final extension included a 1 min extension at 72 c . restriction digestion was performed in a total volume of 10 l amplicons , 1 l ne buffer ( 50 mm potassium acetate , 20 mm tris - acetate , 10 mm magnesium acetate , 1 mm dithio - threitol ph7.9 at 25 c ) and 8 units of ban ii enzyme . samples then were incubated for 5 h at 37 c and the digested pcr products were separated by 2.5% agarose gel electrophoresis stained with ethidium bromide and visualized on a uv transilluminator with 100 base pair ladder and photographed . statistical power for linkage or association analysis is computed by specifying genetic model parameters such as the disease allele frequency and the conditional probabilities . the appropriate sample size and power of the study pawe-3d calculations showed that the sample size , together with the specified study design , allele frequencies , the incidence of nephropathy among t2 dm patients , and allowable error rates , can give as high as 90% power and can detect variant allele frequency of at least 0.05 . the results for continuous variables are expressed as means and standard deviation ( sd ) . the differences between mean values for each element were tested by one way analysis of variance test ( anova f test ) and post hoc tukey hsd ( high significance difference).tukey 's test calculates a new critical value that can be used to evaluate whether differences between any two pairs of means are significant . the statistical significance of differences in frequencies of variants between the groups was tested using the chi - square ( ) test . in addition , the odds ratios ( ors ) and 95% confidence intervals ( cis ) were calculated as a measure of the association of the e - nos alleles with groups . the mean age sd of diabetic patients without nephropathy ( group ii ) was 51.676 years , for diabetic patients with nephropathy ( group iii ) it was 50.458 years and that of the controls 51.676.01 years . plasma nitrate , fbg and hba1c levels showed statistical significant difference among all studied groups . plasma nitrate levels were significantly increased in diabetic patients more than controls with a more significant increase in group iii patients comparing to patients of group ii ( table 2 ) . plasma levels of tg , total cholesterol , ldl - c and fbg were significantly higher in groups ii and iii patients as compared to controls ( table 2 ) , but no significant differences were found between group ii and iii diabetic patients regarding ldl - c levels ( table 2 ) . hdl - c were significantly decreased in diabetic patient groups when compared to controls with no significant differences between group ii and iii patients ( table 2 ) . no significant differences were found between both groups of diabetic patients ( group ii and iii ) as regarding to hba1c ( table 2 ) . the results showed non - significant differences between controls and patients with dn and patients without dn regarding the genotype and allele distributions of the g894 t snp ( = 0.621 , p = 0.733 , = 2.17 , p = 0.33 ) ( = 0.681 , p = 0 . 409 , = 2.146 , p = 0.14 ) , respectively . moreover , no significant differences of g894 t genotypes could be detected between group ii and group iii ( = 0.687 , p = 0.71 ) ( = 0.41 , p = 0.521 ) , respectively . carriers of the t allele and tt subjects exhibited higher levels of plasma nitrates compared with gt and gg carriers in each group ( p < 0.05 for each ) . the mean age sd of diabetic patients without nephropathy ( group ii ) was 51.676 years , for diabetic patients with nephropathy ( group iii ) it was 50.458 years and that of the controls 51.676.01 years . plasma nitrate , fbg and hba1c levels showed statistical significant difference among all studied groups . plasma nitrate levels were significantly increased in diabetic patients more than controls with a more significant increase in group iii patients comparing to patients of group ii ( table 2 ) . plasma levels of tg , total cholesterol , ldl - c and fbg were significantly higher in groups ii and iii patients as compared to controls ( table 2 ) , but no significant differences were found between group ii and iii diabetic patients regarding ldl - c levels ( table 2 ) . hdl - c were significantly decreased in diabetic patient groups when compared to controls with no significant differences between group ii and iii patients ( table 2 ) . no significant differences were found between both groups of diabetic patients ( group ii and iii ) as regarding to hba1c ( table 2 ) . the results showed non - significant differences between controls and patients with dn and patients without dn regarding the genotype and allele distributions of the g894 t snp ( = 0.621 , p = 0.733 , = 2.17 , p = 0.33 ) ( = 0.681 , p = 0 . 409 , = 2.146 , p = 0.14 ) , respectively . moreover , no significant differences of g894 t genotypes could be detected between group ii and group iii ( = 0.687 , p = 0.71 ) ( = 0.41 , p = 0.521 ) , respectively . carriers of the t allele and tt subjects exhibited higher levels of plasma nitrates compared with gt and gg carriers in each group ( p < 0.05 for each ) . no plays a fundamental role in the regulation of endothelial function and vascular tone in many organs , including the kidney ( drexler and horning , 2009 ) . no inhibits platelet aggregation and leukocyte adhesion to vascular endothelium with inhibition of ldl oxidation ( casas et al . , 2006 ) . alterations of endothelial function play a pivotal role in the development of atherosclerosis and predict the occurrence of atherosclerotic complications ( suwaidi et al . oxidative stress has played a critical role in the pathogenesis of both micro- and macrovascular complications of diabetes , and increased intracellular glucose leads to electron transport chain and increased formation of secondary reactive oxygen species ( ros ) ( forbes et al . , 2008 , brownlee , 2005 ) . a unifying hypothesis has been proposed whereby mitochondrial production of ros in response to chronic hyperglycemia may be the key initiator for these pathogenic pathways . this increases the importance of mitochondrial dysfunction in the progression and development of diabetic complications including nephropathy ( busik et al . , 2008 , evans et al . , 2002 ) . accumulated evidence strongly suggests that enos gene polymorphisms are associated with the bioavailability of enos and endothelial function and have been implicated with dn ( tanus - santos et al . , 2001 , rossi et al . , 2003 however , differences in biochemical phenotypes and clinical findings among the polymorphisms have not yet been fully elucidated . however , variants of the enos gene may cause defective no synthesis and decreased no levels , enhancing the susceptibility to glomerular disease and deteriorating the renal function ( shin et al . , 2004 , ahluwalia et al . , 2008 ) . therefore the present study investigated the impact of enos + 894g / t snp on plasma nitrate levels and tried to clarify the effects of this snp on the rapid progression of dn in type2 diabetic saudi patients in qassim region . our results revealed non - significant differences in genotype and allele frequencies of g894 t polymorphism between the diabetic patients with and without nephropathy and the controls . ( 2000 ) , who revealed non significant differences in the frequencies of genotypes and alleles between the studied diabetic patients with and without dn and the control group . however , the results of the present study disagreed with those of ahluwalia et al . ( 2008 ) , ezzidi et al . ( 2002 ) who recorded a significant increase of homozygous mutated tt genotype , and mutant t allele of g894 t polymorphism among cases of types 1 and 2 diabetes with nephropathy compared to control and concluded that tt genotype and t allele may be considered genetic risk factors for dn . ( 2008 ) found increased tt genotype in dn compared to diabetics without nephropathy in tunisian patients . a recent meta - analysis assessed the association between the alleles of the enos gene 894g / the evidence accumulated suggested that g894 t polymorphism in the enos gene was associated with susceptibility to dn in asian populations but not in caucasian populations ( he et al . , ( 2012 ) examined the three enos polymorphisms ( 894 g > t , 786 t > c and 27-bp - vntr ) and reported that two snps ( 894 g > t and 786 t > c ) were associated with increased risk of dn among type 2 diabetic subjects , whereas no association was found between the 27-bp - vntr polymorphism and the risk of dn in egyptian patients . the discrepancy of the results between the different studies can be attributed to the variability of the number of the patients studied or to the ethnic differences regarding the distribution of this pattern of polymorphism . in the present study , plasma nitrate levels exhibited significant increased levels in diabetics with nephropathy as compared to diabetics without nephropathy and controls . in a trial to examine the functional aspects of the 894 g > t snp with plasma no levels , we compared the nitrate levels according to 894 g > t allele and tt genotypes carriers exhibit higher plasma nitrate levels than g allele and gg genotypes carriers in all studied groups . ( 2011 ) who showed that serum no levels were significantly decreased in the 894(g > t ) gt and tt genotypes in relative to the gg genotype in diabetic patients with and without nephropathy . however , in contrast to our results , ritt et al . ( 2008 ) stated that 894 g > t had no impact on basal no activity in the renal circulation of patients with or without dm , and moon et al . ( 2002 ) revealed that there was no substantial effect of 894 g > t polymorphism on the variance of plasma no levels in a healthy korean population . increased amounts of enos have been detected in pre - glomerular blood vessels in diabetic rat and nos inhibitors have been shown to decrease the glomerular filtration rate ( veelken et al . , 2000 ) . these findings suggest that no and the enos can contribute to the glomerular damage resulting in nephropathy in diabetic patients ( mollsten et al . , 2009 ) . there are a number of studies that have previously investigated the functional aspects of the enos gene polymorphisms . the protein product of enos 894 t is more susceptible to selective proteolytic cleavage in endothelial cells and vascular tissues ( tesauro et al . , 2000 ) , which could lead to reduced vascular no generation . however , other expression studies have demonstrated no difference in no generation between g894 ( 298glu ) and 894 t ( 298asp ) ( bank and aynedjian , 1993 , fairchild et al . ( 2001 ) investigated whether the intron 4 variable number tandem repeat ( vntr ) , 922a / g , 786 t / c and g894 t polymorphisms in the enos gene could influence no production ; they recorded that none of the studied polymorphisms had influenced the serum no even if corrected for the serum creatinine level . another study demonstrated that the median serum no level in g / t and t / t genotype of the g894 t polymorphism was significantly higher than that of g / g genotype in the healthy population but not in the cad patients ( yoon et al . , 2000 ) . decreased renal no accelerates the progression of dn in the rat model , presumably through mechanisms , such as increased renal vascular tone and potentiation of angiotensin ii effects ( zanchi et al . , 2000 ) . thus , reduced enos activity associated with 786 t > c and 894 g > t polymorphism could play a role in down regulation of enos expression and endothelial dysfunction ( shoukry et al . , 2012 ) . we need a larger sample size to identify significant associations of genetic variants with complex qualitative trait , such as dn . moreover we have to examine the association of other snps of enos gene with increased risk of dn among type 2 diabetic subjects . the present study revealed non significant differences in the frequencies of g894 t enos gene genotypes and alleles between the studied diabetic patients and the controls . our findings indicated that enos gene snp may not be considered as genetic risk factors for dn among type 2 diabetic saudi patients . the higher plasma levels of nitrates as a marker of oxidative stress in diabetic patients with nephropathy suggest the possible role of oxidative stress but not endothelial nitric oxide synthase gene snp in pathogenesis of the disease . further studies with larger sample size and on a wider scale of type 2 diabetic patients are needed to confirm this conclusion . our data may enable type ii diabetic patients who are at high risk of nephropathy and renal failure to be identified and , as such , benefit from more targeted therapy and prevention which could save their life .
### Summary: : backgrounddiabetic nephropathy ( dn ) is a chronic microangiopathic complication of type 2 diabetes mellitus ( dm).vascular endothelial dysfunction resulting from impaired nitric oxide synthase ( nos ) activity in the vascular endothelial cells has been suggested as playing an important role in the pathogenesis of diabetic nephropathy ( dn ) . endothelial nitric oxide synthase ( e - nos ) gene g894 t polymorphism has been reported to be associated with endothelial dysfunction leading to dn.our objective was to evaluate the association of g894 t polymorphism of enos gene with the risk of dn among type 2 diabetic saudi patients.methodsone hundred and twenty subjects were included in this study . they were divided into three groups . group i , 40 controls . group ii , 40 type 2 diabetic patients without nephropathy . group iii , 40 type2 diabetic patients with nephropathy . endothelial nitric oxide synthase ( enos ) g894tpolymorphism was detected by polymerase chain reaction restriction fragment length polymorphism ( pcr rflp ) . plasma nitric oxide ( no ) levels were estimated.resultse-nos genotype frequency showed non - significant differences among the all studied groups ( p > 0.05 ) . both diabetic groups had significantly higher plasma nitrate levels than in controls with a significant increase in group iii than in group ii patients ( all p < 0.0001 ) . e nos 894tt genotype was associated with higher plasma nitrate levels in all groups.conclusione-nos gene snp is not considered as genetic risk factor for dn among type 2 diabetic saudi patients . the higher plasma levels of nitrates as a marker of oxidative stress in diabetic patients with nephropathy suggest the possible role of oxidative stress but not e - nos gene snp in pathogenesis of the dn .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : since its development in the 1990s optical coherence tomography ( oct ) became particularly important in the field of ophthalmology . the transition from time domain to fourier domain ( fd- ) oct led to a considerable improvement of sensitivity and acquisition speed [ 2 - 4 ] , aiding clinicians in diagnosis and monitoring major ocular diseases . conventional fd - oct generates images based just on backscattering intensity , which limits its use to structural images with sometimes insufficient tissue contrast and does not provide information on flow . several functional extension , like polarization sensitive ( ps- ) oct and doppler oct ( doct ) [ 7 - 9 ] were developed to overcome these limitations . since major eye diseases such as glaucoma [ 10 - 12 ] , age - related macular degeneration , and diabetic retinopathy [ 14 - 16 ] have been shown to be related to alterations in the retinal blood flow , its quantification is of particular interest . however , the quantification of absolute retinal blood flow still remains a challenge . these approaches can roughly be divided into phase - sensitive and non - phase - sensitive methods . non - phase - sensitive techniques make use of time varying speckle providing quantitative velocity information , with the restriction of not being able to determine the direction of the flow . autocorrelation techniques use statistical intensity fluctuations of backscattered light caused by moving particles to detect motion . in addition , dynamic light - scattering oct can deduce the axial and transverse components of the flow velocity , but requires long measurement times and high computational effort . doct is a phase - sensitive approach providing additional contrast by exploiting the phase shift introduced by moving scatterers , such as blood cells , to calculate velocity and flow . since doct only allows to measure the velocity parallel to the sampling beam , further information is necessary to reconstruct the absolute velocity vector of a moving scatterer and therefore gain access to absolute flow measurements . both single and multibeam ( mb- ) doct approaches were reported , capable to measure absolute flow under certain assumptions . single - beam doct approaches often rely on the extraction of the 3-d vessel geometry to reconstruct the velocity vector . this can be achieved using the local vessel gradient at adjacent vessel cross - sections . the gradient can be obtained using circular scans with different radii or high - speed fd - doct where volume scans can be used to extract vessel orientation , position , and diameter [ 22 - 24 ] . other approaches divide the sample beam into several path length - encoded components with different group delays and doppler angles by the insertion of a thickness - sectored glass plate into the oct probe beam . furthermore , transversal doct utilizing a four - channel quadrant detector was reported to calculate the velocity vector . however , the techniques using a single doppler angle acquire the vessel geometry from consecutive images ; therefore , they are sensitive to sample motions in case of in vivo measurements . the path length - encoded methods depend on calibration measurements and suffer from reduced imaging depth . several mb - doct approaches , using two or more measurement beams , were also reported . dave and milner illuminated an in vitro sample from two angles with orthogonally polarized light . used two sample beams and two spectrometer units to image zebrafish larvae and acquired absolute flow rates in larger vessels . reported a dual beam doct system capable to perform human retinal blood flow measurements as long as the orthogonal vector of the plane , spanned by the two incident beams , and the vessel is close to 90. blatter et al . utilized a rotating dove prism in a dual beam setup to control the relative angle between illumination plane and vessel to assess absolute flow in retinal vessels in vivo using a circular scan pattern used a dual beam doct system with an integrated dynamic vessel analyzer and rotatable beams for vertical and horizontal line scan positions . however , an optimal orientation of the incidence plane with respect to the vessel s angle can not be guaranteed for dual beam setups without additional information on the vessel geometry . as of recently , we reported a three - beam phase - sensitive doct system which enabled the reconstruction of the absolute velocity vector of moving scatterers without a priori knowledge of the vessel geometry . the method is based on illumination of the sample at three different angles with three independent measurement beams focused on one spot . while the basic functionality and promising first results could be demonstrated , the system had several shortcomings . two major issues were the low transversal resolution of ~60 m , due to the small beam diameter , and beam motion at the pupil of the eye , caused by off - pivot axis scanning with a galvo scanner pair with separate mirrors for x and y scanning . the purpose of this work is to present solutions to the above - mentioned shortcomings . we use a custom - made three - facet prism telescope ( fpt ) to reduce the beam separation at the scanning mirror , while maintaining the initial diameter of the beams . this provides a higher numerical aperture of the beams at the sample , which yields a better transversal resolution for retinal imaging . additionally , a two - axis gimbal - less mems scanning mirror is used to considerably reduce the beam motion at the pupil of the eye . consequently , the phase shift in the doppler image was reduced , which makes circular scan patterns more feasible . we demonstrate the performance of the system by circular scan measurements on an in house designed in vitro flow bifurcation phantom of well - defined flow and in vivo for circular scans around vessel bifurcations in the retina of healthy human eyes . our three - beam doct system ( figure 1 ) is based on the spectral domain ( sd- ) oct principle [ 36 - 38 ] . the beams were collimated after exiting the source fiber and aligned in parallel to each other , with respect to a triangle geometry , setting the three beams on the corners of the triangle . when focused in one spot , the system provides sample illumination at three different angles , which enables the reconstruction of the absolute velocity / flow vector without a priori knowledge of the vessel orientation . a description of the interferometer part of the three - beam doct system and a detailed explanation on the alignment and the beam geometry to reconstruct the absolute velocity / flow vector can be found elsewhere . in our setup , a 70/30 ( r / t ) bulk optics beam splitter ( bs ) was used for both , in vitro and in vivo measurements . the first telescope in the sample arm of the original setup was replaced by an fpt ( figure 2 ) which consists of a pair of custom - made three - facet prisms ( fp ) ( figure 3 ) . the angle of inclination between the base and the hypotenuses was 4.26. the prisms were mounted in opposite directions with respect to each other , the tips of the pyramids coinciding with the common optical axis and pointed against each other , while one prism is rotated by 180 along this axis . the material used was n - bk7 , coated with an anti - reflective coating to reduce losses . the beams enter the prism system on the flat surface of fp1 , while the centroid of the beam geometry coincides with the optical axis . after passing the first surface unaltered , they remain collimated and intersect each other after a pseudo focal length fp . after the pseudo focus , the beams diverge until they are inversely refracted to the initial parallel traveling path by the inclined surfaces of fp2 . thus , the fpt does not change the basic parallel beam alignment according to the corners of the triangle nor the beam diameter . however , if the distance between the two fps is not equal to 2fp , the beam spacing is altered . maintaining the beam diameter provides a better resolution for sampling as compared to the original lens telescope which reduces the beam diameter proportional to the separation distance between the beams . since scanning is performed in an off - pivot condition for all three beams , a small beam separation centered around the pivot point considerably reduces the introduced phase shift in the doppler image , caused by the scanning motion of the mirror . therefore , it was necessary to reduce the beam separation to approximately one - fourth of the initial separation distance of 4.4 mm . the initial separation depends on the size of the used collimators c13 and on the in house designed brass monoblock mount . since the dimensions of these components were fixed , the reduction was achieved introducing the fpt . a two - axis gimbal - less mems mirror with 4.2 mm in diameter ( mirrorcle inc . , the mirror was driven with high voltage ranging from 0 to 136 v , allowing maximal optical scanning angles of 16. by providing different voltage inputs to the x- and y - axis , linear , rastered volume , circular or resonant scan patterns can be realized . the usage of a mems mirror significantly reduces the effect of off - pivot scanning in comparison with a pair of galvo scanners . the second telescope features an 80/30 magnification to set the final beam diameter to 1.3 mm , allowing a calculated lateral resolution of ~20 m for retinal imaging . the separation distance of the three beams after the second telescope was approximately 3 mm . this provides a substantially different inclination when the beams are focused on the sample ( ~4 for retinal imaging ) , while it still allows to penetrate an undilated human pupil with all three beams . the system was used for in vitro measurements on a bifurcation flow phantom and for in vivo retinal imaging of healthy human eyes . details of the signal processing routine for our three - beam doct system were reported in our previous paper . since a circular scan pattern was chosen and all beams are offset from the pivot point , the scanning motion of the mems mirror will introduce a phase shift in the doppler data . for a circular scan , the x- and y - axis of the 2-d gimbal - less mems mirror are actuated with a sine pattern of a given amplitude and a phase shift of 90 between the axes . such motion will introduce a non - constant sine - like phase shift in the final circular b - scan . this phase shift needs to be subtracted before the doppler data of the sample can be evaluated . to do so , a histogram - based method was used to determine the introduced phase shift within every a - scan . for in vitro measurements , a sheet of paper was imaged with the three - beam doct system using the same scanning parameters as for the actual measurements . the recorded phase offset caused by the scanner movement was evaluated for every a - scan . thereby , it was possible to subtract the introduced phase offset for the following in vitro measurements . for in vivo measurements , the vessel - free region between the anterior boundary of the vessel and the inner limiting membrane was evaluated with the histogram - based method for every a - scan . this method also corrects for additional phase shifts introduced by the motion of the subject . the phase shift was recorded and subtracted for the three channels individually and the velocities parallel to the axis of each incident beam were calculated from the corrected phase data . the images of all circular b - scans obtained by the different channels need to be correlated with respect to their axial and transversal position to account for sample motion artifacts between b - scans . in order to calculate the absolute velocity vector , a rectangular region of interest ( roi ) around the respective vessel / bifurcation branch the extracted rois of all b - scans of all channels were correlated using a cross - correlation algorithm . the velocity components in the x , y , z directions were used to calculate the velocity magnitudes forming the velocity profile . this total velocity distribution was then averaged over the cross - section to obtain the mean total velocity value , which was then multiplied by the cross - sectional area of the vessel to obtain the total flow . the first telescope in the sample arm of the original setup was replaced by an fpt ( figure 2 ) which consists of a pair of custom - made three - facet prisms ( fp ) ( figure 3 ) . the angle of inclination between the base and the hypotenuses was 4.26. the prisms were mounted in opposite directions with respect to each other , the tips of the pyramids coinciding with the common optical axis and pointed against each other , while one prism is rotated by 180 along this axis . the material used was n - bk7 , coated with an anti - reflective coating to reduce losses . the beams enter the prism system on the flat surface of fp1 , while the centroid of the beam geometry coincides with the optical axis . after passing the first surface unaltered , they remain collimated and intersect each other after a pseudo focal length fp . after the pseudo focus , the beams diverge until they are inversely refracted to the initial parallel traveling path by the inclined surfaces of fp2 . thus , the fpt does not change the basic parallel beam alignment according to the corners of the triangle nor the beam diameter . however , if the distance between the two fps is not equal to 2fp , the beam spacing is altered . maintaining the beam diameter provides a better resolution for sampling as compared to the original lens telescope which reduces the beam diameter proportional to the separation distance between the beams . since scanning is performed in an off - pivot condition for all three beams , a small beam separation centered around the pivot point considerably reduces the introduced phase shift in the doppler image , caused by the scanning motion of the mirror . therefore , it was necessary to reduce the beam separation to approximately one - fourth of the initial separation distance of 4.4 mm . the initial separation depends on the size of the used collimators c13 and on the in house designed brass monoblock mount . since the dimensions of these components were fixed , the reduction was achieved introducing the fpt . a two - axis gimbal - less mems mirror with 4.2 mm in diameter ( mirrorcle inc . the mirror was driven with high voltage ranging from 0 to 136 v , allowing maximal optical scanning angles of 16. by providing different voltage inputs to the x- and y - axis , linear , rastered volume , circular or resonant scan patterns can be realized . the usage of a mems mirror significantly reduces the effect of off - pivot scanning in comparison with a pair of galvo scanners . the second telescope features an 80/30 magnification to set the final beam diameter to 1.3 mm , allowing a calculated lateral resolution of ~20 m for retinal imaging . the separation distance of the three beams after the second telescope was approximately 3 mm . this provides a substantially different inclination when the beams are focused on the sample ( ~4 for retinal imaging ) , while it still allows to penetrate an undilated human pupil with all three beams . the system was used for in vitro measurements on a bifurcation flow phantom and for in vivo retinal imaging of healthy human eyes . details of the signal processing routine for our three - beam doct system were reported in our previous paper . since a circular scan pattern was chosen and all beams are offset from the pivot point , the scanning motion of the mems mirror will introduce a phase shift in the doppler data . for a circular scan , the x- and y - axis of the 2-d gimbal - less mems mirror are actuated with a sine pattern of a given amplitude and a phase shift of 90 between the axes . such motion will introduce a non - constant sine - like phase shift in the final circular b - scan . this phase shift needs to be subtracted before the doppler data of the sample can be evaluated . to do so , a histogram - based method was used to determine the introduced phase shift within every a - scan . for in vitro measurements , a sheet of paper was imaged with the three - beam doct system using the same scanning parameters as for the actual measurements . the recorded phase offset caused by the scanner movement was evaluated for every a - scan . thereby , it was possible to subtract the introduced phase offset for the following in vitro measurements . for in vivo measurements , the vessel - free region between the anterior boundary of the vessel and the inner limiting membrane was evaluated with the histogram - based method for every a - scan . this method also corrects for additional phase shifts introduced by the motion of the subject . the phase shift was recorded and subtracted for the three channels individually and the velocities parallel to the axis of each incident beam were calculated from the corrected phase data . the images of all circular b - scans obtained by the different channels need to be correlated with respect to their axial and transversal position to account for sample motion artifacts between b - scans . in order to calculate the absolute velocity vector , a rectangular region of interest ( roi ) around the respective vessel the extracted rois of all b - scans of all channels were correlated using a cross - correlation algorithm . the velocity components in the x , y , z directions were used to calculate the velocity magnitudes forming the velocity profile . this total velocity distribution was then averaged over the cross - section to obtain the mean total velocity value , which was then multiplied by the cross - sectional area of the vessel to obtain the total flow . to demonstrate the feasibility of the system using the fpt and a mems mirror to perform circular scans to determine total in- , out- , and mean flow from and to a vessel bifurcation , circular scans around an in house designed in vitro bifurcation flow phantom were performed . in a next step , in vivo circular a custom in vitro bifurcation flow phantom ( figure 4 ) was fabricated out of a pmma block . separated by 120 the three branches of the bifurcation with a rectangular flow channel cross - section of 0.09 mm were machined into the pmma using a cnc mill . finally , the open top was sealed with a thin n - bk7 glass window to guarantee a high optical quality for the oct measurement . the phantom bifurcation was perfused with a scattering fluid ( 1:2 milk diluted with water ) at a constant flow . an injection pump for medical applications was used ( mgvg combimat 2000 , flow range 0.02852.8 l / s ) for constant and accurate flow injection . to increase stability and homogeneity of the flow distribution , two branches of the bifurcation were used as an input and one branch as an output . circular scans were performed around the bifurcation phantom to provide a velocity vector component in every spatial direction of an orthogonal coordinate system . the flow was varied between 0.1 and 0.83 l / s for each input branch resulting in mean velocities between 1.6 and 11.8 mm / s . for a circular b - scan , five of those noise - reduced b - scans were used to analyze reproducibility and to calculate mean and standard deviation . the mean velocity was calculated from the velocity profile and multiplied with the branch area ( measured using the oct intensity image ) to determine the absolute mean flow of the scattering fluid through every branch of the phantom . the total measured in- and outflow was compared with the applied total in- and outflow to and from the bifurcation for various input flows ( figure 5 ) . the equation of the linear fit was y = 1.0488x - 0.2013 with an r of 0.9948 . the measured flow agreed well with the applied flow for inflows greater than 0.22 l / s ( corresponding to a mean flow velocity of ~3 mm / s ) . the total flow was overestimated by approximately 20% for an input flow of 0.11 l / s . furthermore , as averaged component magnitudes were used to calculate total velocity profiles and the total flow , the phase noise of the system might have contributed to an overestimation of the total flow at lower flow velocities . because the full geometry of the 3-d flow was calculated , the calculated branch geometry was also compared to the physical branch geometry for different total applied flows ( figure 6 ) . the measured branch geometry agreed very well with the physical branch geometry over a range of applied input flows . for in vivo measurement , circular scans were performed around bifurcations of retinal vessels in healthy human eyes . during in vivo scanning , the combined power of the beams was set to 700 w to agree with the laser safety standards . four thousand and ninety - six a - scans were recorded for one circular b - scan . after the rois for all b - scans around the vessels of the bifurcation obtained by the different channels were properly correlated with respect to each other , the absolute velocity vector profiles and the mean absolute velocities were calculated . the absolute mean flow was computed by extracting the vessel area from the intensity oct image . figure 7(a ) shows a fundus image of a healthy retina with vasculature around the optic nerve head ( onh ) . two vessel bifurcations are covered by the scan : one bifurcation comprises vessel number 1 , 3 , and 4 , the other comprises vessels number 2 , 5 , and 6 . in figure 7(b ) , the oct intensity images of all three channels , imaged by the three - beam doct , are shown . the white numbers link the vessels in the fundus image to the vessels in the intensity image . figure 7(c ) shows the averaged phase difference images of consecutive a - scans for every channel of the roi for vessel 1 . figure 8 shows reconstructed absolute velocity profiles for vessel 2 , 5 , and 6 of the arterial bifurcation from figure 7(a ) . the maximum detectable flow velocity was measured to be 55 mm / s , while the noise floor was measured at 2 mm / s . since the absolute 3-d velocity vector is calculated , the orientation of a vessel can easily be deducted from the spatial orientation of the vector . the black numbers and dotted arrows in figure 7(a ) show the calculated orientation and propagation direction of the flow . the calculated flow orientation was nearly identical to the vessel orientation in the fundus image . table 1 shows the measured mean absolute in- and outflow of retinal vessel bifurcations for four bifurcations of three healthy human eyes . the highest observed discrepancy between in- and outflow was 8% . a custom in vitro bifurcation flow phantom ( figure 4 ) was fabricated out of a pmma block . separated by 120 the three branches of the bifurcation with a rectangular flow channel cross - section of 0.09 mm were machined into the pmma using a cnc mill . finally , the open top was sealed with a thin n - bk7 glass window to guarantee a high optical quality for the oct measurement . the phantom bifurcation was perfused with a scattering fluid ( 1:2 milk diluted with water ) at a constant flow . an injection pump for medical applications was used ( mgvg combimat 2000 , flow range 0.02852.8 to increase stability and homogeneity of the flow distribution , two branches of the bifurcation were used as an input and one branch as an output . circular scans were performed around the bifurcation phantom to provide a velocity vector component in every spatial direction of an orthogonal coordinate system . the flow was varied between 0.1 and 0.83 l / s for each input branch resulting in mean velocities between 1.6 and 11.8 mm / s . for a circular b - scan , five of those noise - reduced b - scans were used to analyze reproducibility and to calculate mean and standard deviation . the mean velocity was calculated from the velocity profile and multiplied with the branch area ( measured using the oct intensity image ) to determine the absolute mean flow of the scattering fluid through every branch of the phantom . the total measured in- and outflow was compared with the applied total in- and outflow to and from the bifurcation for various input flows ( figure 5 ) . the equation of the linear fit was y = 1.0488x - 0.2013 with an r of 0.9948 . the measured flow agreed well with the applied flow for inflows greater than 0.22 l / s ( corresponding to a mean flow velocity of ~3 mm / s ) . the total flow was overestimated by approximately 20% for an input flow of 0.11 l / s . furthermore , as averaged component magnitudes were used to calculate total velocity profiles and the total flow , the phase noise of the system might have contributed to an overestimation of the total flow at lower flow velocities . because the full geometry of the 3-d flow was calculated , the calculated branch geometry was also compared to the physical branch geometry for different total applied flows ( figure 6 ) . the measured branch geometry agreed very well with the physical branch geometry over a range of applied input flows . for in vivo measurement , circular scans were performed around bifurcations of retinal vessels in healthy human eyes . during in vivo scanning , the combined power of the beams was set to 700 w to agree with the laser safety standards . four thousand and ninety - six a - scans were recorded for one circular b - scan . after the rois for all b - scans around the vessels of the bifurcation obtained by the different channels were properly correlated with respect to each other , the absolute velocity vector profiles and the mean absolute velocities were calculated . the absolute mean flow was computed by extracting the vessel area from the intensity oct image . figure 7(a ) shows a fundus image of a healthy retina with vasculature around the optic nerve head ( onh ) . the black circular arrow indicates the direction of the circular scan . two vessel bifurcations are covered by the scan : one bifurcation comprises vessel number 1 , 3 , and 4 , the other comprises vessels number 2 , 5 , and 6 . in figure 7(b ) , the oct intensity images of all three channels , imaged by the three - beam doct , are shown . the white numbers link the vessels in the fundus image to the vessels in the intensity image . figure 7(c ) shows the averaged phase difference images of consecutive a - scans for every channel of the roi for vessel 1 . figure 8 shows reconstructed absolute velocity profiles for vessel 2 , 5 , and 6 of the arterial bifurcation from figure 7(a ) . the maximum detectable flow velocity was measured to be 55 mm / s , while the noise floor was measured at 2 mm / s . since the absolute 3-d velocity vector is calculated , the orientation of a vessel can easily be deducted from the spatial orientation of the vector . the black numbers and dotted arrows in figure 7(a ) show the calculated orientation and propagation direction of the flow . the calculated flow orientation was nearly identical to the vessel orientation in the fundus image . table 1 shows the measured mean absolute in- and outflow of retinal vessel bifurcations for four bifurcations of three healthy human eyes . the highest observed discrepancy between in- and outflow was 8% . the system uses a novel fpt to improve the transversal resolution to approximately 20 m and a two - axis gimbal - less mems scanning mirror to stabilize beam movement at the pupil of the eye , and thereby enables circular scan patterns . the functionality of the system was demonstrated in vitro and in vivo on an in house designed flow phantom bifurcation and on blood vessel bifurcations in healthy human eyes . by performing circular scans around the flow phantom bifurcation , we demonstrated the reliability of the system to reproducibly measure absolute in- and outflow . since the tube cross sections were extracted from the oct data , the measurement also shows that no additional information on the vessel geometry , obtained by other imaging technologies ( e.g. a fundus camera ) , is necessary to measure the absolute mean flow . additionally we demonstrated that the reconstruction of the full 3-d velocity vector resembles the branch geometry and therefore the system s capability to reliably reconstruct the flow orientation in 3 dimensions . applying the circular scan pattern to the human retina showed good agreement between in- and outflow of blood to and from vessel bifurcations in four bifurcations of three different healthy eyes . the measured mean absolute blood flow is well within the range of values reported in literature . furthermore , the orientation of the reconstructed absolute 3-d velocity vector agrees very well with the vessel orientation observed in the fundus photo . this indicates that the reconstruction of the absolute mean blood flow and the absolute velocity vector inside retinal vessels is reliable for circular scan patterns and that no a priori knowledge on the vessel geometry is necessary to measure these parameters . the b - scans of the three channels need to be registered in an appropriate way to minimize errors both in the measured velocity / flow profiles and vessel orientations . since the registration is performed automatically using a cross correlation algorithm operating on the intensity image , inaccurate registering might occur , influencing the accuracy of the resulting velocity profile . deviations from correct registration can be caused by slightly different orientation of vessel cross sections in the different channels caused by the different angles of incidence of the probing beams at the sample . the different cross - section geometry can cause problems with image registration for certain vessel orientations , where the effect is pronounced . . the final goal of this work is to perform circular scans around the onh to measure total in- and outflow of all retinal vessels , a quantity important for glaucoma diagnostics . currently , a circular scan around the onh was not possible due to the limited scanning angle of the mems mirror , which needs to be replaced with a mems mirror allowing wider scan angles . furthermore , the current cameras only allow an acquisition rate of 27 khz which is too slow to measure the fast flow in the large arteries emerging from the onh . in future work after these changes , the three - beam doct system should be capable of measuring the total absolute in- and outflow from and to the onh . to summarize , we developed an improved three beam doct system with increased resolution and the possibility to use circular scan patterns around retinal vessel bifurcations to measure absolute mean blood flow from and to the bifurcation . for all measurements , it was possible to reconstruct the 3-d absolute velocity vector and therefore , gain access to the vessel geometry measured by circular b - scans without an additional fundus image .
### Summary: : an improved three - beam doppler optical coherence tomography system was developed . it utilizes a custom - made three - facet prism telescope to improve the transversal resolution at the sample . furthermore , a two - axis gimbal - less mems mirror is used to minimize off - pivot beam movement at the pupil of the eye , enabling circular scanning for in vivo retinal measurements . we demonstrate the system s abilities for in vitro circular scanning to measure absolute flow and to reconstruct the full velocity vector on a bifurcation flow phantom . moreover , in vivo retinal measurements using circular scanning around vessel bifurcations of healthy human volunteers were performed . measurements of the absolute mean flow and its orientation are in good agreement with the expected values for in vitro measurements . for in vivo measurements , the in- and outflow of blood for retinal vessel bifurcations show an excellent agreement , demonstrating the reliability of the technique .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : neem oil is a vegetable oil obtained from the seed kernels of neem tree ( azadirachta indica ) , an evergreen of the tropics and sub - tropics . azadirachtin , a complex tetranortriterpenoid , is implicated in causing the effects seen in neem oil poisoning . in children , neem oil we report a case of neem oil poisoning in a 73-year - old male who presented with vomiting , seizures , metabolic acidosis , and toxic encephalopathy . a 73-year - old man with the medical history of diabetes mellitus type 2 and psoriasis presented to the emergency department with complaints of vomiting and drowsiness , 1 hour after accidental ingestion of 20 ml of neem oil . the patient 's current medication included human mixtard insulin ( 30/70 ) , 16 u before breakfast and 10 u before dinner . at presentation , the patient was drowsy with glasgow coma scale of 13/15 . his pulse rate was 110/min , respiratory rate 28/min , oxygen saturation of 95% at room air , and blood pressure 150/90 . systemic examination showed : bilateral equal and reacting pupils with no meningeal signs and no focal neurological deficits . respiratory , cardiovascular and abdominal examination were unremarkable . in the emergency department , the patient developed generalized convulsions with loss of consciousness . he was intubated and managed initially with intravenous lorazepam . in the intensive care unit , investigations at presentation showed : hemoglobin 13.3 gm / dl , leukocyte leukocyte count 16800/l , red blood cell count 4.41 million / cmm , platelet count 375000/l , blood sugar 298 mg / dl , serum osmolality 277 mosmol / kg , and normal serum lactate level . an arterial blood gas analysis showed metabolic acidosis : ph 7.34 , po2 81 , pco2 24 , hco3 16 , and po2/fio2 385 . he had normal urine analysis , serum electrolytes , liver , renal , and thyroid function . investigations repeated on day 2 , 3 , and on discharge showed : normal electrolytes , arterial blood gas , liver , and renal function . during the course of illness neem oil , as a traditional medical remedy , is used as anti - bacterial , anti - fungal , insect repellent , and treatment of skin diseases . traditional routes of administration of neem extracts included oral , vaginal , and topical use . neem oil comprises mainly triglycerides , steroids ( campesterol , beta - sitosterol , stigmasterol ) and many triterpenoids , of which azadirachtin is the most well - known and studied . the azadirachtin content of neem oil varies from 300 ppm to over 2500 ppm , depending on the extraction technology and quality of the neem seeds crushed . in children , there are several case reports of neem oil poisoning causing vomiting , hepatic toxicity , metabolic acidosis , and encephalopathy . lai et al . , reported 22 cases of neem oil poisoning in infants , who were given single doses of neem oil ( few drops to 5 ml ) , presented with features of toxic encephalopathy , metabolic acidosis , and hepatic toxicity . sundaravalli et al . , in a case series of 12 children with neem oil poisoning , who were given single dose of neem oil ( 25 - 60 ml ) , reported fatality in 10 cases with features of toxic encephalopathy and metabolic acidosis . sinnaih et al . , reported reyes like syndrome in fatal cases of neem oil poisoning in a case series of 13 children . in adults , there are few case reports of neem poisoning . iyyaduria et al . , reported a case of a 35-year - old female with suicidal poisoning , who presented after ingestion of 250 ml of neem pesticide with encephalopathy and metabolic acidosis with no evidence of hepatic and renal complications . bhasker et al . , reported a 35-year - female with neem oil poisoning who presented with bilateral visual loss . cranial mr imaging , showed symmetrical altered signal intensity bilaterally in the putamen region with extension to the posterior limb of the internal capsule . laboratory findings were within normal limits , and she recovered completely with supportive management . there is no specific antidote available , and gastric lavage is not recommended for neem oil poisoning . our report highlights toxicity related to neem oil poisoning in an elderly male patient presenting with vomiting , seizures , metabolic acidosis , and encephalopathy . his symptoms resolved in 4 days with symptomatic treatment , and he was discharged after 1 week . azadirachtin ( c35h44o16 ) manifests its toxicity possibly by interfering with mitochondrial bioenergetics , resulting in inhibition of the generation of the electrochemical proton gradient ( primary form of energy generated in mitochondria ) . acute poisoning with inhibitors of electron transporting complexes causes symptoms such as muscle weakness , easy fatigability , hypotension , headache , facial flushing , nausea , confusion , and aggravation of latent myocardial angina . the inability to utilize oxygen is manifested as a cytotoxic hypoxia wherein the chemicals cause a metabolic acidosis and hyperpnea , despite normal po2 . however , inhibitors of the supply of reducing substrates for the respiratory chain cause a similar metabolic syndrome that is difficult to distinguish from inhibitors of the electron transport chain .
### Summary: : neem oil has widespread use in indian subcontinent due to its many bioactive properties . azadirachtin , an active ingredient , is implicated in causing the effects seen in neem oil poisoning . neem oil poisoning is rare in adults . this report highlights the toxicity associated with neem oil poisoning in an elderly male . the patient presented with vomiting , seizures , metabolic acidosis , and toxic encephalopathy . the patient recovered completely with symptomatic treatment .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : audiovisual ( av ) integration in the perception of speech is the rule rather than the exception . the presence of additional visual ( v ) information leads to a considerable improvement of intelligibility of auditory ( a ) input under noisy conditions ( sumby and pollack , 1954 ; schwartz et al . , 2004 ; ross et al . , 2007 ) . furthermore , lip - movements may serve as a further cue in complex auditory environments , such as the proverbial cocktail - party , and may thus enhance selective listening ( driver , 1996 ) . recently , it has been suggested that even under auditory - only conditions , speaker - specific predictions and constraints are retrieved by the brain by recruiting face - specific processing areas , in order to improve speech recognition ( von kriegstein et al . , 2008 ) . a striking effect , first described by mcgurk and macdonald ( 1976 ) , is regularly found when mismatching auditory ( e.g. , /ba/ ) and visual ( e.g. , /ga/ ) syllables are presented : in this case many healthy persons perceive a syllable neither heard nor seen ( i.e. , /da/ ) . this suggests that av integration during speech perception not only occurs automatically but also is more than just the visual modality giving the auditory modality a hand in the speech recognition process . a number of recent neuroimaging studies have addressed the issue of av integration in speech perception and consistently found two different brain areas , the inferior frontal gyrus ( ifg ) and the superior temporal sulcus ( sts ) ( e.g. , cusick , 1997 ; sekiyama et al . , 2003 ; wright et al . , 2003 ; barraclough et al . , 2005 ; szycik et al . , 2008a , b ; brefczynski - lewis et al . , 2009 ; lee and noppeney , 2011 ; , 2011 ; nath and beauchamp , 2011 , 2012 ; stevenson et al . , 2011 ) . as the posterior part of the sts area has been shown to receive input from unimodal a and v cortex ( cusick , 1997 ) and to harbour multisensory neurons ( barraclough et al . , 2005 ; szycik et al . , 2008b ) , it can be assumed to be a multisensory convergence site . this is corroborated by the fact that activation of the caudal part of the sts is driven by av presented syllables ( sekiyama et al . , 2003 ) , monosyllabic words ( wright et al . , 2003 ) , disyllabic words ( szycik et al . , 2008a ) , and speech sequences ( calvert et al . , 2000 ) . whereas the evidence for a role of the sts area in av speech processing is growing , it has to be pointed out that it has also been implicated in the av integration of non - verbal material ( e.g. , macaluso et al . , 2000 ; calvert , 2001 ; jncke and shah , 2004 ; noesselt et al . , 2007 ; driver and noesselt , 2008 ) as well as in diverse other cognitive domains such as empathy ( krmer et al . , 2010 ) , biological motion perception and face processing ( hein and knight , 2008 ) . besides the sts , broca 's area , situated on the ifg of the left hemisphere , and its right hemisphere homologue have been implicated in av speech perception . it can be subdivided into the pars triangularis ( pt ) and the pars opercularis ( po ) ( amunts et al . , 1999 ) , whereas broca 's area has traditionally been deemed to be most important for language production , many neuroimaging studies have suggested multiple functions of this area in language processing [ reviewed , e.g. , in ( bookheimuer , 2002 ; hagoort , 2005 ) and beyond ( koelsch et al . , 2002 ) ] . significantly elaborating on earlier ideas of liberman ( liberman and mattingly , 1989 , 1985 ) , skipper and colleagues ( skipper et al . , 2005 , 2007 ) recently introduced the so - called audio - visual - motor integration model of speech perception . in their model they emphasize the role of the po for speech comprehension by recruiting the mirror neuron system and the motor system . av speech processing is thought to involve the formation of a sensory hypothesis in sts which is further specified in terms of the motor goal of the articulatory movements established in the po . in addition to the direct mapping of the sensory input , the interaction of both structures via feedback connections is of paramount importance for speech perception according to this ( skipper et al . , 2007 ) . to further investigate the roles of the ifg and sts in av speech integration we used naturally spoken syllable pairs with matching av information ( i.e. , visual and auditory information /ba//ba/ , henceforth baba , /ga//ga/ , gaga , or /da//da/ , dada ) and one audiovisually incongruent syllable pair designed to elicit the mcgurk illusion ( auditory /ba//ba/ dubbed on visual /ga//ga/ , henceforth m - dada ) . the study design allowed us to control for the effect of the mcgurk illusion , for the visual respective auditory differences of the presented syllables and for task effects . furthermore , we took advantage of the high signal - to - noise ratio of high - field 7 tesla functional mri . the effect of the mcgurk illusion was delineated by contrasting the m - dada with dada as well as m - dada stimuli that gave rise to an illusion with those that did not . brain areas showing up in these contrasts are considered to be involved in av fusion . contrasting stimuli that were physically identical except for the auditory stream ( m - dada vs. gaga ) revealed brain areas involved in the processing of auditory differences , whereas the comparison m - dada vs. baba revealed regions concerned with the processing of visual differences . all procedures had been cleared by the ethical committee of the university of magdeburg and conformed to the declaration of helsinki . thirteen healthy right - handed native speakers of german gave written informed consent to participate for a small monetary compensation . the dataset of one participant was excluded , as he did not classify any of the target stimuli correctly during the measurement . thus , 12 participants were included in the analysis ( five women , age range 2139 years ) . av stimuli were spoken by a female native speaker of german with linguistic experience and recorded by a digital camera and a microphone . three naturally spoken syllable pairs with matching av information ( av / ga//ga/ , av / ba//ba/ , av / da//da/ , henceforth denoted as gaga , baba , dada ) and one syllable pair designed to elicit the mcgurk illusion by dubbing the audio stream of baba onto the video of the face vocalising gaga ( a / ba//ba / v / ga//ga/ , henceforth denoted as m - dada ) comprised the stimulus set . the m - dada stimulus gave rise to the illusory perception of /da//da/ in many cases . the recorded video was cut into segments of 2 s length ( 250 180 pixel resolution ) showing the frontal view of the lower part of speaker 's face . the eyes of the speaker were not visible to avoid shifting of the participant 's gaze away from the mouth . the mouth of the speaker was shut at the beginning of each video - segment . stimuli were separated by a resting period of 10 s duration resulting in a stimulus - onset - asynchrony of 12 s. during the resting period the participants had to focus their gaze on a fixation cross shown at the same position as the speaker 's mouth . stimuli were presented in a pseudo - randomized order with 30 repetitions per stimulus class resulting in the presentation of 120 stimuli total and an experimental duration of 24 min . to check for the mcgurk illusion , participants were required to press one button every time they perceived /da//da/ ( regardless of whether this perception was elicited by a dada or an m - dada stimulus ) and another button whenever they heard another syllable . thus , to the extent that the m - dada gave rise to the mcgurk illusion , subjects were pressing the /da//da/ button for this stimulus . audio - information was presented binaurally in mono - mode via fmri compatible electrodynamic headphones integrated into earmuffs to reduce residual background scanner noise ( baumgart et al . , 1998 ) . the sound level of the stimuli was individually adjusted to achieve good audibility during data acquisition . visual stimuli were projected via a mirror system by lcd projector onto a diffusing screen inside the magnet bore . magnetic resonance images were acquired on a 7 t magnetom siemens scanner ( erlangen , germany ) located in magdeburg , germany , and equipped with a cp head coil ( in vivo , pewaukee , wi , usa ) . a total of 726 t2-weighted volumes covering part of the brain including frontal speech areas and the middle and posterior part of the sts were acquired ( tr 2000 ms , te 24 ms , flip angle 80 , fov 256 192 mm , matrix 128 96 , from 2126 slices depending on specific absorption rate ( sar ) limitations , slice thickness 2.0 mm , interslice gap 0.2 mm ) ( see figure 1 ) . additionally , a 3d high resolution t1-weighted volume ( mprage , tr 2200 ms , ti 1100 ms , flip angle 9 , matrix 192 2562 , 1 mm isovoxel ) was obtained . the subject 's head was firmly padded with foam cushions during the entire measurement to avoid head movements . illustration of the measured brain volume ( in box ) . analysis and visualization of the data were performed using brain voyager qx ( brain innovation bv , maastricht , netherlands ) software . first , a correction for the temporal offset between the slices acquired in one scan was applied . for this purpose subsequently , 3d motion correction was performed by realignment of the entire volume set to the first volume by means of trilinear interpolation . thereafter , linear trends were removed and a high pass filter was applied resulting in filtering out signals occurring less then three cycles during the whole time course . structural and functional data were spatially transformed into the talairach standard space using a 12-parameter affine transformation . functional epi volumes were resampled into 2 mm cubic voxels and then spatially smoothed with an 8 mm full - width half - maximum isotropic gaussian kernel to accommodate residual anatomical differences across volunteers . prior to the statistical analysis of the fmri data we divided the participants into two groups according to whether or not they were prone to the mcgurk illusion as evidenced by their response pattern . the illusion and no - illusion group comprised seven and five participants , respectively ( for details see table 1 ) . m - dada and dada classified as /da - da/ or other in percent . clearly , the illusion worked only in a sub - group of the participants . for the statistical model a fitted design matrix including all conditions of interest this function was created by convolving the rectangle function with the model of boynton et al . ( boynton et al . , 1996 ) using delta = 2.5 , tau = 1.25 and n = 3 . thereafter a multi - subject fixed effects general linear model ( glm ) analysis was used for identification of significant differences in hemodynamic responses . as regressors of no interest we used overall six translation and rotation vectors derived for each dataset during the 3d motion correction . the statistical analysis included the av native syllable pairs gaga , baba , dada as well as the m - dada events . the latter were separated into those events that gave rise to an illusion and those that gave not ( see table 1 ) . several different linear contrasts were calculated to pinpoint brain regions involved in various aspects of syllable recognition and av integration : the effect of the mcgurk illusion was delineated by calculating the conjunction of m - dada , dada , and m - dada vs. dada . only events for which the participants indicated the perception of /da//da/ were included.by calculating the conjunction of m - dada vs. gaga with m - dada and gaga we investigated brain regions involved in the processing of auditory differences within av stimuli.in a similar fashion we calculated the conjunction of m - dada vs. baba with m - dada and baba to identify regions concerned with the processing of visual differences within av stimuli.finally , brain regions involved in av integration were isolated by contrasting m - dada stimuli that gave or gave not rise to the mcgurk illusion ( i.e. , the percept /da - da/ ) . the effect of the mcgurk illusion was delineated by calculating the conjunction of m - dada , dada , and m - dada vs. dada . only events for which the participants indicated the perception of /da//da/ were included . by calculating the conjunction of m - dada vs. gaga with m - dada and gaga we investigated brain regions involved in the processing of auditory differences within av stimuli . in a similar fashion we calculated the conjunction of m - dada vs. baba with m - dada and baba to identify regions concerned with the processing of visual differences within av stimuli . finally , brain regions involved in av integration were isolated by contrasting m - dada stimuli that gave or gave not rise to the mcgurk illusion ( i.e. , the percept /da - da/ ) . in addition we checked the processing differences between pairs of non - mcgurk syllables gaga , baba , dada and the effects of the task by contrasting gaga , and baba vs. dada . the threshold of p < 0.005 was chosen for identification of the activated voxels . furthermore , only activations involving contiguous clusters of at least 20 functional voxels ( corresponding to a volume of 160 mm ) are reported . the centres of mass of suprathreshold regions were localized using talairach coordinates and the talairach daemon tool ( lancaster et al . , 2000 ) . additionally , we calculated group differences contrasting all m - dada events ( regardless of the response ) of the illusion group ( i.e. , participants who had the mcgurk illusion ) against the no - illusion group . for this analysis the threshold was set to p < 0.005 ( fdr - corrected ) and minimal cluster volume was set to 20 voxels . thirteen healthy right - handed native speakers of german gave written informed consent to participate for a small monetary compensation . the dataset of one participant was excluded , as he did not classify any of the target stimuli correctly during the measurement . thus , 12 participants were included in the analysis ( five women , age range 2139 years ) . av stimuli were spoken by a female native speaker of german with linguistic experience and recorded by a digital camera and a microphone . three naturally spoken syllable pairs with matching av information ( av / ga//ga/ , av / ba//ba/ , av / da//da/ , henceforth denoted as gaga , baba , dada ) and one syllable pair designed to elicit the mcgurk illusion by dubbing the audio stream of baba onto the video of the face vocalising gaga ( a / ba//ba / v / ga//ga/ , henceforth denoted as m - dada ) comprised the stimulus set . the m - dada stimulus gave rise to the illusory perception of /da//da/ in many cases . the recorded video was cut into segments of 2 s length ( 250 180 pixel resolution ) showing the frontal view of the lower part of speaker 's face . the eyes of the speaker were not visible to avoid shifting of the participant 's gaze away from the mouth . the mouth of the speaker was shut at the beginning of each video - segment . stimuli were separated by a resting period of 10 s duration resulting in a stimulus - onset - asynchrony of 12 s. during the resting period the participants had to focus their gaze on a fixation cross shown at the same position as the speaker 's mouth . stimuli were presented in a pseudo - randomized order with 30 repetitions per stimulus class resulting in the presentation of 120 stimuli total and an experimental duration of 24 min . to check for the mcgurk illusion , participants were required to press one button every time they perceived /da//da/ ( regardless of whether this perception was elicited by a dada or an m - dada stimulus ) and another button whenever they heard another syllable . thus , to the extent that the m - dada gave rise to the mcgurk illusion , subjects were pressing the /da//da/ button for this stimulus . audio - information was presented binaurally in mono - mode via fmri compatible electrodynamic headphones integrated into earmuffs to reduce residual background scanner noise ( baumgart et al . , 1998 ) . the sound level of the stimuli was individually adjusted to achieve good audibility during data acquisition . visual stimuli were projected via a mirror system by lcd projector onto a diffusing screen inside the magnet bore . magnetic resonance images were acquired on a 7 t magnetom siemens scanner ( erlangen , germany ) located in magdeburg , germany , and equipped with a cp head coil ( in vivo , pewaukee , wi , usa ) . a total of 726 t2-weighted volumes covering part of the brain including frontal speech areas and the middle and posterior part of the sts were acquired ( tr 2000 ms , te 24 ms , flip angle 80 , fov 256 192 mm , matrix 128 96 , from 2126 slices depending on specific absorption rate ( sar ) limitations , slice thickness 2.0 mm , interslice gap 0.2 mm ) ( see figure 1 ) . additionally , a 3d high resolution t1-weighted volume ( mprage , tr 2200 ms , ti 1100 ms , flip angle 9 , matrix 192 2562 , 1 mm isovoxel ) was obtained . the subject 's head was firmly padded with foam cushions during the entire measurement to avoid head movements . illustration of the measured brain volume ( in box ) . analysis and visualization of the data were performed using brain voyager qx ( brain innovation bv , maastricht , netherlands ) software . first , a correction for the temporal offset between the slices acquired in one scan was applied . for this purpose subsequently , 3d motion correction was performed by realignment of the entire volume set to the first volume by means of trilinear interpolation . thereafter , linear trends were removed and a high pass filter was applied resulting in filtering out signals occurring less then three cycles during the whole time course . structural and functional data were spatially transformed into the talairach standard space using a 12-parameter affine transformation . functional epi volumes were resampled into 2 mm cubic voxels and then spatially smoothed with an 8 mm full - width half - maximum isotropic gaussian kernel to accommodate residual anatomical differences across volunteers . prior to the statistical analysis of the fmri data we divided the participants into two groups according to whether or not they were prone to the mcgurk illusion as evidenced by their response pattern . the illusion and no - illusion group comprised seven and five participants , respectively ( for details see table 1 ) . clearly , the illusion worked only in a sub - group of the participants . for the statistical model a fitted design matrix including all conditions of interest this function was created by convolving the rectangle function with the model of boynton et al . ( boynton et al . , 1996 ) using delta = 2.5 , tau = 1.25 and n = 3 . thereafter a multi - subject fixed effects general linear model ( glm ) analysis was used for identification of significant differences in hemodynamic responses . as regressors of no interest we used overall six translation and rotation vectors derived for each dataset during the 3d motion correction . the statistical analysis included the av native syllable pairs gaga , baba , dada as well as the m - dada events . the latter were separated into those events that gave rise to an illusion and those that gave not ( see table 1 ) . several different linear contrasts were calculated to pinpoint brain regions involved in various aspects of syllable recognition and av integration : the effect of the mcgurk illusion was delineated by calculating the conjunction of m - dada , dada , and m - dada vs. dada . only events for which the participants indicated the perception of /da//da/ were included.by calculating the conjunction of m - dada vs. gaga with m - dada and gaga we investigated brain regions involved in the processing of auditory differences within av stimuli.in a similar fashion we calculated the conjunction of m - dada vs. baba with m - dada and baba to identify regions concerned with the processing of visual differences within av stimuli.finally , brain regions involved in av integration were isolated by contrasting m - dada stimuli that gave or gave not rise to the mcgurk illusion ( i.e. , the percept /da - da/ ) . the effect of the mcgurk illusion was delineated by calculating the conjunction of m - dada , dada , and m - dada vs. dada . only events for which the participants indicated the perception of /da//da/ were included . by calculating the conjunction of m - dada vs. gaga with m - dada and gaga we investigated brain regions involved in the processing of auditory differences within av stimuli . in a similar fashion we calculated the conjunction of m - dada vs. baba with m - dada and baba to identify regions concerned with the processing of visual differences within av stimuli . finally , brain regions involved in av integration were isolated by contrasting m - dada stimuli that gave or gave not rise to the mcgurk illusion ( i.e. , the percept /da - da/ ) . in addition we checked the processing differences between pairs of non - mcgurk syllables gaga , baba , dada and the effects of the task by contrasting gaga , and baba vs. dada . the threshold of p < 0.005 was chosen for identification of the activated voxels . furthermore , only activations involving contiguous clusters of at least 20 functional voxels ( corresponding to a volume of 160 mm ) are reported . the centres of mass of suprathreshold regions were localized using talairach coordinates and the talairach daemon tool ( lancaster et al . , 2000 ) . additionally , we calculated group differences contrasting all m - dada events ( regardless of the response ) of the illusion group ( i.e. , participants who had the mcgurk illusion ) against the no - illusion group . for this analysis the threshold was set to p < 0.005 ( fdr - corrected ) and minimal cluster volume was set to 20 voxels . the performance indicated that participants attentively processed the stimuli and that they experienced the mcgurk illusion in a high proportion of cases ( see table 1 ) . the contrast m - dada vs. dada ( see figure 2a , red activation ) revealed clusters in and near the sts of the right hemisphere . additionally , left and right insula showed greater activity for the m - dada condition in comparison to the dada condition . there were no significantly activated areas showing stronger activity for the dada condition in comparison to the m - dada condition . ( a ) areas showing stronger activity for m - dada in comparison to dada are colored in red . areas showing stronger activity for m - dada with illusory perception relative to m - dada without illusion are colored in yellow . ( b ) areas showing stronger activity for the m - dada with illusion in comparison to naturally spoken gaga , reflecting auditory differences , are shown in green . areas showing stronger activity for the m - dada with illusion in comparison to naturally spoken baba , reflecting visual differences , are shown in blue . l = left , r = right , xtal = talairach coordinate x , ytal = talairach coordinate y , ztal = talairach coordinate z. the comparison of brain activity for the m - dada classified as /da - da/ vs. classified as non-/da - da/ figure 2a ( yellow / orange activations ) revealed areas involved in effective av integration . we did not find any significant activity that was stronger for m - da events not classified as /da - da/ in comparison to events with occurred integration . figure 2b illustrates brain regions involved in the processing of auditory ( green ) and visual ( blue ) differences during av stimulation . the comparison of m - dada vs. gaga events ( auditory difference ) yielded activation in the insula , stg of both hemispheres and additionally in the cuneus of the right hemisphere ( table 2 ) . the activated areas of stg occupy the same spatial location as the stg clusters identified by contrasting m - dada against da and m - dada classified as /da tabulated results of the fmri analysis ( only participants with illusion ) talairach coordinates for the center of mass of the particular cluster and its size in 3 mm . ba = approximate brodmann 's area ; l = left hemisphere , r = right hemisphere . the areas processing visual differences were identified by contrasting m - dada vs. baba events . there were two clusters in the stg respectively insula and cuneus of both hemispheres and one cluster in the right superior and ifg and in the middle occipital gyrus ( table 2 ) . brain responses to the m - dada stimuli differed between the illusion and the non - illusion group ( figure 3 , table 2 and 3 ) . as the illusion group showed greater activation of the sts , this again underscores the importance of this area for the integration of divergent av information into a coherent percept . moreover , within the illusion group those m - dada events leading to an illusion showed a greater response in the sts than m - dada events that did not . further analyses revealed no significant activations when non - mcgurk stimuli were subjected to pair - wise comparisons . ( a ) illustration of activated clusters , l = left , ztal = talairach coordinate z , pink colour indicates the overlap of both contrasts . ( b ) time courses for the m - dada events extracted from both overlap clusters for the group of participants with mcgurk illusion ( n = 7 ) and the group with no - illusion ( n = 5 ) . comparison illusion vs. no - illusion group , m - da stimuli all m - dada stimuli were entered into the analysis regardless of whether they elicited an illusion or not . talairach coordinates for the center of mass of the particular cluster and its size in 3 mm ( qfdr < 0.05 ) . ba = approximate brodmann 's area ; l = left hemisphere , r = right hemisphere . the present study took advantage of very high - field functional mri to define the brain areas involved in the mcgurk illusion during the av integration of speech . importantly , different percepts revealed by the same stimuli evoked different brain activity in the sts region corroborating its role in the av processing of speech . this activation pattern is very similar to that found in other studies comparing av congruent and incongruent speech stimuli ( ojanen et al . , 2005 ; pekkola et al . , 2005 , 2006 ; lee and noppeney , 2011 ; nath et al . , 2011 ; stevenson et al . , 2011 ) . these previous studies employed av speech stimuli with either congruent [ e.g. , auditory : hotel , visual : hotel , ( szycik et al . , 2008a ) ] or incongruent visual information ( e.g. , auditory : hotel , visual : island ) but therefore , the activity in the fronto - temporo - parietal network observed there can not be entirely due to the av integration processes that give rise to the illusion . rather , the increased activity for the av speech percept appears to mainly reflect increased neural processing caused by the divergent input information provided by incongruent av speech . miller and d'esposito ( 2005 ) contrasted synchronous and asynchronous av speech ( identical vowel - consonant - vowel syllables in the auditory and visual domain with different temporal offsets ) and searched for brain areas involved in the perceptual fusion of the information from the two modalities as evidenced by the participants ' report of perceiving both inputs as synchronous . the left sts and left heschl 's gyrus showed increased activity with perceptual fusion defined as perception of synchronous av streams . by comparing the m - dada events that led to an illusion ( i.e. , were perceived as /da - da/ ) vs. m - dada events that did not , brain areas closely related to the fusion processes underlying the illusion could be delineated . also , trials giving rise to the illusion and trials that did not occurred about equally often ( c.f . , table 1 ) making this a valid comparison . this suggests that the bilateral sts is involved in the perceptual binding processes leading to the mcgurk perceptual fusion effect . this region corresponds well to previous results that have suggested an involvement of sts in the integration of auditory as well as visual speech stimuli ( beauchamp , 2005 ; bernstein et al . comparing the activity to m - dada stimuli for subjects that were prone to the illusion and subjects that were not susceptible to the illusion again pointed to the sts region bilaterally as a major site for av integration . this result is similar to one obtained very recently by nath and beauchamp ( 2012 ) . in their study only the left sts showed a significant effect of both susceptibility to the illusion and stimulus condition . as in the present investigation , the amplitude of the response in the left sts was greater for subjects that were likely to perceive the mcgurk effect . nath and beauchamp concluded that the left sts is a key locus for interindividual differences in speech perception , a conclusion also supported by the present data . comparing m - dada ( illusion ) events vs. baba ( gaga ) events enabled us to identify brain regions involved in processing of visual ( auditory ) differences in av presented speech ( figure 2b ) . as the contrasts between the plain dada stimuli with either baba or gaga , as well as that between gaga and dada did not reveal any significant activations , we conclude that the m - dada vs. baba ( gaga ) comparison reflects brain activity - related to the integration of visual and auditory differences in av presented speech . auditory as well as visual differences were processed bilaterally in the anterior insula and the sts . visual differences were additionally processed in right frontal brain structures indicating these impact for mapping of the visual input onto the auditory . the impact of right frontal brain structures on av speech processing has previous been shown , for example in participants suffering from schizophrenia ( szycik et al . , 2009 ) . our results fit with the interpretation of the functions of the sts presented by hein and knight ( 2008 ) . taking into account neuroimaging studies focusing on theory of mind , av integration , motion processing , speech processing , and face processing , these authors suggest that the anterior sts region is mainly involved in speech processing , whereas the posterior portion is recruited by cognitive demands imposed by the different task domains . they further argue against distinct functional subregions in the sts and adjacent cortical areas and rather suggest that the same sts region can serve different cognitive functions as a flexible component in networks with other brain regions . keeping this in mind , our pattern of results is in agreement with a recent model emphasizing the role of the sts region for av speech integration . in the audio - visual - motor model of speech perception of skipper and coworkers ( skipper et al . , 2007 ) , the observation of mouth movements leads to the formation of a hypothesis in multisensory posterior superior temporal areas which is specified in terms of the motor goal of that movement in the po of the inferior frontal cortex which in turn maps onto more explicit motor commands in the premotor cortex . from these motor commands predictions are generated about the auditory ( fed back from the premotor cortex to the posterior sts region ) and somatosensory ( fed back from the premotor cortex to the somatosensory cortex , supramarginal gyrus , and sts region ) consequences such commands would have . these feedback influences shape the speech perception in the sts region by supporting a particular interpretation of the input . importantly , both , the auditory input and the visual input , are used for the generation of hypotheses . for mcgurk stimuli , the hypotheses generated from the auditory and visual input are in conflict and are integrated ( fused ) in the posterior sts region . they further suggest a crucial role of the sts for perception of ambiguous av speech . on a more general level , the current data also speak to the utility of 7 t imaging for cognitive neuroscience . to get an idea about the magnitude of the effects obtained in the current slow event - related design at 7 t , we computed the bold signal change in percent in a roi covering the transverse temporal gyrus in three randomly chosen participants ( shown in red in figure 4 ) . in addition , we did the same for three randomly chosen participants ( shown in blue ) from an earlier study ( szycik et al . , 2008a ) which had used a similar slow - event - related design at 3 tesla ( tr 2000 ms , te 30 ms , flip angle 80 , fov 224 mm matrix 642 , 30 slices , slice thickness 3.5 mm interslice gap 0.35 mm ) . stimuli in the 3 tesla study comprised short video - clips of 2 s ( av presentation of bisyllabic german nouns , no mcgurk illusion intended ) followed by a 16 s rest period . as the soa between the critical stimuli was somewhat longer in the 3 t study ( 18 s , current study 12 s soa ) , the settings in that study were even more favourable for observing large signal changes . in spite of this , the signal change amounted to 57 percent in the 7 t and to only 12 percent in the 3 t study . bold response in the auditory cortex to audiovisual speech stimuli at 3 and 7 tesla . illustration of signal changes in the auditory cortex elicited by audiovisual stimuli at 7 t and 3 t. shown are three participants of the current study and three randomly chosen participants taken from szycik et al . clearly , signal changes are considerably more pronounced at 7 t. this suggests that moving from 3 to 7 tesla allows to either increase signal - to - noise ratio or reduce the number of trials needed . the latter option might be particularly interesting for investigations of patients or in psycholinguistics , where often only small numbers of stimuli are available . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
### Summary: : in natural communication speech perception is profoundly influenced by observable mouth movements . the additional visual information can greatly facilitate intelligibility but incongruent visual information may also lead to novel percepts that neither match the auditory nor the visual information as evidenced by the mcgurk effect . recent models of audiovisual ( av ) speech perception accentuate the role of speech motor areas and the integrative brain sites in the vicinity of the superior temporal sulcus ( sts ) for speech perception . in this event - related 7 tesla fmri study we used three naturally spoken syllable pairs with matching av information and one syllable pair designed to elicit the mcgurk illusion . the data analysis focused on brain sites involved in processing and fusing of av speech and engaged in the analysis of auditory and visual differences within av presented speech . successful fusion of av speech is related to activity within the sts of both hemispheres . our data supports and extends the audio - visual - motor model of speech perception by dissociating areas involved in perceptual fusion from areas more generally related to the processing of av incongruence .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : febrile seizure ( fs ) as the most common form of seizures in childhood , affects 2 - 5% of all children across the world . children rarely develop their first fs before the age of 6 months or after 3 years of age . the international league against epilepsy has defined that seizure events in infancy or childhood is featured with temperatures over 38 c without evidence of acute electrolyte imbalances and cns infection or history of fs . the direct cause of fs is unknown yet , but the most important indirect causes are reported to be fever , hypoglycemia , hypocalcemia , head injury , poisoning and drug overuse , respiratory infection or gastroenteritis . the simple type is characterized by an episode of generalized tonic - clonic seizure lasting less than 15 min in 24 h while in the complex type the convulsions are multiple , lasting more than 15 min . a positive family history for fs can be elicited in 25 - 40% of the patients . predictors of recurrence are complex seizures , positive family history , onset at less than 12 months and temperature < 40c . if the seizure occurs soon after a fever has begun or when the temperature is relatively low , the risk of recurrence will be increased . a long initial fs does not substantially boost the risk of recurrent fs , either brief or long . the odds that children develop epilepsy after a fs is approximately 1% . since a systematic review and meta - analysis on fs recurrence in iran has not yet been done , the present study reviews available reports on fs recurrence frequency and evaluates its associated risk factors in this country . the search strategy , selection of publications and the reporting of results for the review was conducted in accordance with the prisma guidelines . literature on fs among iranian children was acquired through searching scientific information databases ( sid ) , global medical article limberly ( medlib ) , iranian biomedical journal ( iran medex ) , iranian journal database ( magiran ) as well as international databases including pubmed / medline , scopus and isi web of knowledge . the search strategy was limited to the persian and/or english language and articles published up until feb 2012 were considered . all publications with medical subject headings ( mesh ) and keywords in title , abstract and text for words including febrile seizure were investigated . febrile seizure , as these databases do not distinguish synonyms from each other and do not allow sensitive search operation using linking terms such as and , or or not. consequently , this single keyword search was the most practical option . the seizures , pediatrics and iran mesh combined with the operator or vs. and . the search string in pubmed was ( ( seizures [ title ] ) or pediatrics [ title ] ) and iran [ affiliation ] ) . the inclusion criteria were as follow : 1 ) studies in the mentioned databases with full text , despite the language of original text ; 2 ) hospital - based data . exclusion criteria were 1 ) studies upon children overlapping time intervals of sample collection from the same origin ; 2 ) inappropriate study design ; 3 ) inadequate reporting of results ; 4 ) strobe checklist score 's below 7.75 . information was extracted from author , title , year and setting of study , sample selection , sample size , study type , seizure types , age , strobe score and prevalence all data - abstraction forms were reviewed and eligible papers entered into the meta - analysis . the random effects model was used for combining results of studies in meta - analysis . the presence of heterogeneity was determined by the der simonian - laird ( dl ) approach . significance level was < 0.1 and i statistic for estimates of inconsistency within the meta - analyses . the i statistic estimates the percent of observed between - study variability due to heterogeneity rather than to chance and ranges from 0 to 100 percent ( values of 25% , 50% and 75% were considered representing low , medium and high heterogeneity respectively ) . a value of 0% indicates no observed heterogeneity whilst 100% indicates significant heterogeneity . for this review we determined that i values above 75 percent were indicative of significant heterogeneity warranting analysis with a random effect model as opposed to the fixed effect model to adjust for the observed variability . a univariate and multivariate approach was employed to assess the causes of heterogeneity among the selected studies . the search strategy , selection of publications and the reporting of results for the review was conducted in accordance with the prisma guidelines . literature on fs among iranian children was acquired through searching scientific information databases ( sid ) , global medical article limberly ( medlib ) , iranian biomedical journal ( iran medex ) , iranian journal database ( magiran ) as well as international databases including pubmed / medline , scopus and isi web of knowledge . the search strategy was limited to the persian and/or english language and articles published up until feb 2012 were considered . all publications with medical subject headings ( mesh ) and keywords in title , abstract and text for words including febrile seizure were investigated . febrile seizure , as these databases do not distinguish synonyms from each other and do not allow sensitive search operation using linking terms such as and , or or not. consequently , this single keyword search was the most practical option . the seizures , pediatrics and iran mesh combined with the operator or vs. and . the search string in pubmed was ( ( seizures [ title ] ) or pediatrics [ title ] ) and iran [ affiliation ] ) . the inclusion criteria were as follow : 1 ) studies in the mentioned databases with full text , despite the language of original text ; 2 ) hospital - based data . exclusion criteria were 1 ) studies upon children overlapping time intervals of sample collection from the same origin ; 2 ) inappropriate study design ; 3 ) inadequate reporting of results ; 4 ) strobe checklist score 's below 7.75 . information was extracted from author , title , year and setting of study , sample selection , sample size , study type , seizure types , age , strobe score and prevalence all data - abstraction forms were reviewed and eligible papers entered into the meta - analysis . the random effects model was used for combining results of studies in meta - analysis . the presence of heterogeneity was determined by the der simonian - laird ( dl ) approach . significance level was < 0.1 and i statistic for estimates of inconsistency within the meta - analyses . the i statistic estimates the percent of observed between - study variability due to heterogeneity rather than to chance and ranges from 0 to 100 percent ( values of 25% , 50% and 75% were considered representing low , medium and high heterogeneity respectively ) . a value of 0% indicates no observed heterogeneity whilst 100% indicates significant heterogeneity . for this review we determined that i values above 75 percent were indicative of significant heterogeneity warranting analysis with a random effect model as opposed to the fixed effect model to adjust for the observed variability . a univariate and multivariate approach was employed to assess the causes of heterogeneity among the selected studies . overall , 96 studies ( 1 study in pub med , 95 studies in other databases ) were identified . of them , finally 21 articles including 1 in english and 20 in persian language were adopted ( fig . 1 ) . looking for sample sizes , throughout the 21 selected studies , 4599 fs children ( 219 samples per study on average ) including 2734 males ( 59.5% ) were studied ( table 1 ) . age distribution and type of fss prevalence in children under two years and 3 to 6 years were 55.8% ( 95%ci : 50.461.2 ) and 44.1% ( 95%ci : 38.8 - 62.2 ) , respectively . prevalence of simple and complex fs was 69.3% ( 95%ci : 59.5 - 79.0 ) and 28.3% ( 95%ci : 19.6 - 31.0 ) , respectively ( table 2 ) . significant hetero - geneity was observed between studies ( q = 75.24 , p0.001 , i=92.0% ) and consequently the random effect model was employed for the meta - analysis . recurrence and positive familial history of fs was observed in 28.8 children ( 95%ci : 19.3 - 38.4 ) ( fig . results of the systematic literature search forest plots of positive family history ( a ) and recurrent febrile seizure ( b ) for random effects meta - analyses ( squares represent effect estimates of individual studies with their 95%confidence interval ( ci ) of positive family history with size of squares proportional to the weight assigned to the study in the meta - analysis . the diamond represents the overall result and 95%ci of the random - effects meta - analysis ) . feature of childhood febrile seizure at different regions of iran score of strobe checklist . under 7.75 = excluded ; among 7.75 to 15.5 : low ; among 15.5 to 23.5 : medium ; higher than 23.5 : high prevalence of febrile seizure among iranian children through random effect models ci : confidence interval overall recurrence rate of fs was 20.9 percent with ( 95%ci : 12.3 - 29.5 ) ( fig . meta - regression showed association between year of study and prevalence rate of recurrent fs , it showed also causes of the variability in the results of studies . meta - regression showed variability in prevalence of recurrent fs a non - significant effect for years ( reg coef = 0.017 , p=0.1 ) . 3 shows the prevalence rate of recurrent fs that has had an increasing trend during 1995 till 2010 . meta - regression analysis found that sample size significantly affects heterogeneity for the factor recurrent rate fs ( reg coef = 0.0003 , p=0.03 ) ( fig . meta - regression showed that one reason of variability among studies is sample size ; studies with large sample size show higher prevalence rate of recurrent fs in comparison to studies with small sample size . publication bias is a bias with regard to what is likely to be published , among what is available to be published . publication bias is the term for what occurs whenever the research that appears in the published literature is systematically unrepresentative of the population of completed studies . there was no evidence of publication bias ( egger 's test 0 : 0.04 ; p=0.96 ) ( fig . 4 ) , so we tried to consider most of published articles in this subject . meta - regression plots of change in fs recurrence according to changes in continuous study moderator 's year and sample size begg 's funnel plot ( pseudo 95%confidence limits ) showing mean difference in recurrence of febrile seizure by standard error of mean difference the present review aimed to provide recurrent rate and predictive risk factors that enhance risk of recurrence in iranian children using the persian and/or english language articles published up to feb 2012 . this study shows that the pool recurrence fs among iranian children was ( 20.9% ) . previous review studies have reported ( berg , 1990 ; offringa , 1994 ) this as being 31.8% and 32% , respectively . berg ( 2008 ) has reported recurrence rate of 40 - 50% in untreated children . a possible explanation for this inconsistency might be due to the fact that our result was hospital - based and patients were treated . meta - regression thus helps exploring several possible reasons for the observed heterogeneity among studies . results of the meta - regression found no statistically significant relation between year variations in recurrence of fs which shows an approximately constant recurrence during study period . results of the meta - regression also found that recurrence of fs and sample size produced significant levels of heterogeneity . as a result , increasing the sample size is associated with increased recurrence ( fig . younger age at onset is important predictor of recurrent fss and also increases the risk of later fs . these findings correlate with study conducted by shi xl et al instudy 2012 , most ( 75.7% ) children experienced their first onset of fs at 6 months to 3 years of age ( median : 16 months ) , 39.5% of cases were below 12 months and 60.50% over 12 months . a positive family history of fs reveals the importance of genetic factors and common environmental exposures . berg ( 2008 ) found that family history was not consistently associated with an increased risk of fs . in the present study , 28.8% of children had a positive family history of fs in agreement with eseigbe ( 2012 ) findings which showed a prevalence rate of 29.4% . tosune ( 2011 ) reported that 57% of children with fs had a positive family history . other studies have also reported similar results confirming that positive family history increases risk of fs significantly . the positive family history for the simple and complex type was 36.2% and 29.4% , respectively which is consistent with other reports . meanwhile , the authors ability to assess the quality of studies was limited by the fact that many studies failed to offer detailed information of selected subjects or valid data on important factors . our analysis suggests the need for large population - based incidence studies of febrile seizure , particularly in children aged under six year , to generate more accurate estimates as well as provide a reasonably robust assessment of heterogeneity . the increased risk of recurrence in patients with symptomatic seizures needs to be fully considered by parents , physicians , nurses and health policy makers .
### Summary: : objectivefebrile seizure ( fs ) as the most common form of seizures in childhood , affects 2 - 5% of all children across the world . the present study reviews available reports on fs recurrence frequency and evaluates its associated risk factors in iran.methodswe searched the persian database such as : sid , magiran , medlip , irandoc , iranmedex as well as english databases pubmed , isi , and scopus . random effects models were used to calculate 95% confidence intervals . meta regression was introduced to explore the heterogeneity between studies.findingsthe overall fs recurrence rate was 20.9% [ 95% confidence interval ( ci ) : 12.3 - 29.5% ] . the frequency of fs simple and complex types was 69.3% ( 95% ci : 59.5 - 79.0 ) and 25.3% ( 95% ci : 19.6 - 31.0 ) , respectively . a positive familial history of 28.8% ( 95% ci : 19.3 - 38.4% ) was observed for childhood fs including 36.2% ( 95% ci : 27.3 - 39.6% ) for the simple and 29.4% ( 95% ci : 23.1 - 33.5% ) for the complex type . the heterogeneity of recurrent fs was significantly affected by sample size ( p=0.026).conclusionalmost one - third of fs children had a positive familial history . the increased risk of recurrence in patients with symptomatic seizures needs to be fully considered by parents , physicians , nurses and health policy makers .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : gastric cancer is one of the most common cancers in europe ranking the fifth after lung , prostate , colorectal , and bladder cancers in men and breast , colorectal , lung , and cancer of the corpus uteri in women . in ukraine in 2011 the annual age - standardized incidence rate was 21.5/100.000 ranking the fourth after lung , skin , and prostate cancers in men and 8.8/100 000 ranking the seventh after breast , skin , corpus uteri , colon , cervix uteri , and rectal cancers in women . the therapy outcome of gastric cancer is still not satisfactory , and distant metastasis is kept as a key factor in the unfavorable results of gastric cancer treatment . it is known that even curative resection can not always guaranty expected long - term results of therapy that may be explained by the early dissemination of tumor cells even still before the surgical intervention [ 35 ] . tumor cells can disseminate from the earliest preneoplastic lesions , sometimes even before the formation of overt primary tumors . at the same time it is unable to detect early metastasis up till now despite modern tools , for example , mrt , pet . tumor cells leaving primary site can mainly settle in bone marrow ( bm ) with potency to form the metastases . these cells named disseminated tumor cells ( dtcs ) can not be detected by conventional cytological methods , but they may be found both by immunocytochemistry and molecular technologies . it was shown that dtcs in bm may be detected in 2560% of patients with different tumors categorized as m0 [ 47 ] . conception of the detection of micrometastases in bm has been introduced in clinical practice more than 30 years ago . bm is considered now as a common homing - organ for dtcs that escape from epithelial tumor , first of all from breast , lung , prostate , and colorectal cancers . it was shown that persistent dtcs in bm are associated with unfavorable prognosis for breast cancer patients . perhaps firstly publication concerning dtcs in gastric cancer patients appeared in 1991 when schlimok et al . have shown the presence of dtcs in bm of 30% patients with gastric cancer without obvious distant metastases . the correlation between dtcs and some clinicopathological characteristics , in particular regional and distant metastasis , and lauren classification further studies confirmed these data and focused one 's attention on methodology of dtcs search and pointed out the clinical relevance of dtcs in gastric cancer patients , in particular their negative impact on survival [ 1117 ] . studying the influence of neoadjuvant chemotherapy on dtcs in gastric cancer patients have shown that frequency of dtcs finding was significantly decreased after chemotherapy but without substantial impact on disease outcome . nevertheless , authors proposed to continue these studies , in particular in multicenter protocol investigations . at the same time some observations have been published where the clinical relevance of dtcs in gastric cancer patients was not observed [ 1921 ] . allows to conclude that problem of dtcs in gastric cancer is relevant for clinics but it is not fully solved and needs to be clarified to improve the treatment outcome . our study was aimed to evaluate the influence of dtcs in bm of gastric cancer patients on survival and their prognostic significance . moreover , our attention was focused on the assessment of possible correlation between dtcs in bm and hypoxia profile in primary tumor exploiting well - known fact that solid tumors are hypoxic that mediates tumor aggressiveness and poor disease outcome . a total of 89 patients ( 62 men and 27 women ) with primary gastric cancer ( gc ) were diagnosed and treated at the city clinical oncological center ( kiev ) , during period 20082011 ( table 1 ) . tumors were classified and staged according to the 2002 version of the uicc staging system . all patients were thoroughly informed about the study that was approved by the local ethics committee . preoperatively , 2.0 - 3.0 ml of bm aspirates from the sternum with conventional cautions to avoid the hit of skin epithelial cells into the sample was taken into a heparinized syringe and transferred into a tube sarstedt containing edta k. after ficoll - hypaque density centrifugation ( density , 1.077 ; sigma - aldrich , usa ) to isolate the mononuclear cell fraction ( 1105 g for 20 minutes ) , the interphase was washed twice in phosphate - buffered saline ( pbs ) with removing of erythrocytes ( uti - lyse erythrocyte lysing reagent , dako cytomation , usa ) , resuspended to a concentration of 570 10 cells/30 l , and cytocentrifuged on glass slides . specimens were air - dried from 12 to 24 hours and stained immediately or stored at 20c . detection of tumor cells ( cytokeratin - positive cells , ck - positive cells ) in bm cytospin preparations fixed in acetone was provided by apaap method ( alkaline phosphatase - antialkaline phosphatase ) and visualization system envision g/2 system / ap rabbit / mouse ( permanent red ) ( dako cytomaiton , denmark ) . monoclonal mouse antibodies against panck ( clone ae1/ae3 , dako cytomation , denmark ) were used as primary antibodies . each assay was controlled negatively by staining of one cytospin preparation with nonspecific igg1 ( mopc21 , sigma ) . number of tumor cells ( ck - positive cells ) was expressed on 10 bm mononuclear cells . positive if the presence of two or more ck - positive cells per 10 mononuclear cells was detected ( from 6 to 12 slides per patient were screened ) . cytospins were fixed by formol - acetone solution ( ph 6.6 ) in accordance with the instruction . slides were treated by 0.3% triton x-100 solution , washed by pbs and blocking of endogenous peroxidase followed by incubation in 3% bovine serum albumin to switch off nonspecific reaction antigen - antibody . cytospins were incubated with primary polyclonal rabbit antibodies against flt-1 ( sc-316 , santa cruz biotechnology , inc . , usa ) in optimal dilution 1 : 80 within 1 h. after washing of primary antibodies slides were processed with polyvuehrp detection system components ( diagnostic biosystems , usa ) . expression of cd34 ( the endothelial cell marker ) , cd68 ( the commonly used macrophage marker ) , and vegf was evaluated on deparaffinized slides by means of immunohistochemical staining using specific monoclonal mouse antibodies : clone qbend 10 ( 1 : 100 ) , clone pg - m1 ( 1 : 80 ) , and clone vg1 ( 1 : 50 ) , respectively . immunoreactions were detected and visualized with the polymer - peroxidase method ( envision+/hrp and 3,3-diaminobenzidine ; dako cytomation , denmark ) followed by counterstaining with mayer hematoxylin . positive controls were used as monoclonal antibodies against cytokeratins ( clone mnf116 , dakocytomation , denmark ) . microvessel density ( mvd ) , detected by immunostaining for cd34 , was assessed by the hot spot method . cd68-positive cells were counted per 1000 cells in each slide and the number of cd68-positive cells was reported as percent . vegf expression was assessed by scoring the number of all positive cells per 200x field . when the tumor consisted of less than 25% immunoreactive cells , the case was scored as weak , cases with 2650% immunoreactive cells were scored as moderate , and those with 51100% immunoreactive cells were scored as strong . expression of vegfr-1 ( flt-1 ) was detected using polyclonal rabbit antibodies against flt-1 ( sc-316 ( 1 : 80 ) , santa cruz biotechnology , inc . normal rabbit igg ( dako cytomation , denmark ) was used for the negative control . when the tumor consisted of more than 10% immunoreactive cells , the case was scored as positive . tumor specimens and bm aspirates ( 0.5 ml ) were placed into the liquid nitrogen up to processing . activity of mmp-2 and mmp-9 was determined for each sample by zymography in 12% polyacrylamide gel with sds and 0.1% of gelatin as substrate . p nmr spectra of perchloric acid ( pca ) tumor extracts were acquired by means of a high - resolution bruker 400 mhz spectrometer ( widebore ultrashield , av-400 electronics , germany ) using a probe of 5 mm inner diameter . all statistical analyses were conducted using the ncss 2000/pass 2000 and prism , version 4.0 software packages . the survival proportion was estimated by using the kaplan - meier method and differences in survival were analyzed with the log - rank test . prognostic values of relevant variables were analyzed by means of the cox proportional hazards model using hazard ratio and test . individual patient data from a total of 89 histologically confirmed gastric cancer patients were included in this study ( table 1 ) . the median age was 62 years . patients with category m0 had dtcs in bm in 51.4% of cases ( 6.5 2.4 ck - positive cells per 10 mononuclear cells ) , and patients with category m1 in 78.9% cases ( 8.0 2.0 ck - positive cells per 10 mononuclear cells ) . there was no association of dtcs in bm with clinicopathological characteristics ( table 2 ) . meanwhile , the association between the presence of ck - positive cells in bm and level of hypoxia in primary tumor was detected : severe and moderate hypoxia was found in 75% of primary tumors in patients with dtcs in bm while mild and weak hypoxia in 32.2% only ( p < 0.01 ) . level of tumor hypoxia assessed by nmr spectroscopy was ranged as follows : if the pme / pi < 1.0 , tumors are characterized by severe hypoxia , 1.0 < pme / pi < 1.4 moderate hypoxia , 1.4 < pme / pi < 2.0 mild hypoxia , and pme / pi > 2.0 weak hypoxia ( satisfactory oxygenation ) . it was also determined that the probability of appearance of tumor cells in bm of patients with category m0 is increased by a factor of 11.4 ( odds ratio 11.4 , 95% ci 2.7147.89 , = 12.3 , p < it was found that flt-1 positive cells were detected both in bm and tumor , in 58.5% and 79% of patients , respectively . the presence of ck - positive cells in bm was accompanied with the flt-1-positivity of bm in 67% and the absence of ck - positive cells with the flt-1-positivity in 45% of cases . the probability of the presence of flt-1-positive cells in bm was increased by a factor of 2.7 when tumors were characterized by severe and moderate hypoxia although this probability was not statistically significant ( odds ratio = 2.7 ; 95% ci 1.764.72 ; p > 0.05 ) . the mean number of flt-1-positive cells in tumor was 34 3.0% ( median 47% , range 096 ) . it was shown that ck - positive cells in bm were detected in 73% of patients with vegf - positive tumors . the direct correlation between vegf - positive cell number in tumor and dtcs in bm was observed ( r = 0.542 ; p < 0.025 ) . the tendency was only assessed for the correlation between ck - positive bm and number of cd-68-positive cells as well as mvd in primary tumor ( p > 0.05 ) . it was shown that the association between activity of mmp-2 in tumor and presence of dtcs in bm , in particular mmp-2 activity was 9.2 5.1 g / g tissue in patients with dtcs in bm whereas mmp-2 activity , was 4.1 2.8 g / g in patients without dtcs in bm ( p < 0.05 ) . the association of tumor mmp-9 activity with dtcs in bm was not found . at the same time activity of both gelatinases in bm was linked with dtcs in bm ; in particular activities of mmp-2 and mmp-9 were 8.6 4.0 and 7.5 3.4 g / g in patients with dtcs in bm and 2.8 1.4 and 2.6 1.85 g / g in patients without dtcs in bm ( p < 0.05 and p < 0.05 , resp . ) . . overall survival ( os ) of patients with category m0 with dtcs in bm was shorter than that of patients with category m0 and without dtcs in bm ( p = 0.0497 ) ( figure 1 ) . it can indicate that the detection of dtcs in bm may be considered as obligatory procedure before the decision concerning further treatment , in particular of patients with category m0 . median follow - up time was 19.4 ( range , 2.660.85 ) months from diagnosis for all patients ( mean 21.9 1.9 ) . os was significantly shorter in patients with m0 category and with dtcs , compared with patients with no dtcs ( log - rank test : p < 0.05 ) . if overall survival was analyzed for all patients ( m0 and m1 categories ) the difference was not statistically significant ( p > 0.05 ) overall , 30 patients ( 33.7% ) died during follow - up . in 26 patients ( 86.7% ) of 20 patients with dtcs in bm , 8 patients ( 40% ) had m0 category . of 26 patients , who died , 13 ( 50% ) have received any kind of adjuvant chemotherapy , and 10 ( 38.5% ) had dtcs in bm ( 4 patients ( 40% ) had m0 category ) . survival in these patients was significantly shorter in patients with m0 category with dtcs compared with those patients with no dtc : 22.5 versus 39.5 months ( student 's test , p < 0.05 ) . survival in all patients ( with m0 and m1 categories ) was almost the same ( 22.2 and 24.9 months , resp . ) independently from dtcs in bm . it was also found that os of patients with dtcs in bm and flt-1-positive cells in bm was significantly shorter than that of patients with no dtcs in bm , but with flt-1-positive cells in bm ( p = 0.0437 ) ( figure 2 ) . patients in both groups were categorized as m0 and m1 and treated with adjuvant chemotherapy . os of patients with category m0 was not influenced by flt-1 positivity of bm ( p > 0.05 ) . moreover , it was evaluated that os of patients with dtcs in bm and vegf - positive tumor was significantly shorter than that of patients without dtcs in bm and vegf - positive tumor ( p = 0.0486 ) ( figure 3 ) . the patients in both groups were treated with adjuvant chemotherapy and diagnosed as categories m0 and m1 . it is relevant that os of patients with category m0 and dtcs in bm and vegf - positive tumor was significantly shorter than that of patients with category m0 and without dtcs in bm and vegf - positive tumor ( p = 0.0248 ) ( figure 4 ) . it was also found that in patients with category m0 but with dtcs in bm who have been operated only risk of unfavorable outcome increased by a factor of 2 ( hr = 2.0 ; 95% ci = 0.985.76 ; p < 0.05 ) . these data can indicate the necessity of the additional diagnostic procedures for patients with m0 established by conventional methods because some of them may have dtcs in bm and need of adjuvant therapy . our study found that tumor cells present in bm of 51.4% patients with gastric cancer with category m0 . dtcs in bm were detected in 3560% of gastric cancer patients with category m0 by other authors . it has to be noted that there are not enough publications concerning the significance of dtcs in bm in patients with m0 . at the same time , namely , this information is more relevant than that in regard to patients with m1 that are diagnosed by conventional methods . it should be noted that association between dtcs in bm and the level of hypoxia in the primary tumor was found : tumor cells in bm were found in 80% of cases where severe hypoxia was found in the primary tumor , whereas under moderate and mild hypoxia dtcs they were found only in 20% of cases ( p < 0.05 ) . it was also determined that a probability of dtcs appearance in bm is increased by a factor of 11(odds ratio 11.8 , 95% ci 3.058745.60 , = 14.79 , p < 0.001 ) when primary tumors are characterized by severe hypoxia . these data indicate a possible positive impact of hypoxia - associated signaling pathways on the escape of tumor cells from the primary tumor and their dissemination into the bm to form a premetastatic niche as suggested by kaplan et al . . close correlation was observed between dtcs and vegf expression in primary tumor confirmed by early observation , but correlation between dtcs and tumor mvd was not found in contrast to other authors [ 14 , 29 ] . in regard to flt-1 expression in bm it has to be noted that our study confirmed data obtained by mimori et al . that simultaneous presence of tumor cells and flt-1-positive cells in bm is clinically relevant for metastasis . the role of mmps in tumor dissemination is well known , but mmps activity in bm of gastric cancer patients was not determined till now . our study has shown that activity of mmp-2 and mmp-9 in bm of patients with m0 but with dtcs was increased by a factor of 3.1 and 2.9 , respectively . it allows suggesting that gelatinases may play a significant role in the formation of premetastatic niche , in particular , in the reorganization of cellular microenvironment in bm . in conclusion , it may be summarized that 51.4% of gastric cancer patients categorized as m0 have tumor cells in bm . presence of dtcs is correlated with level of tumor hypoxia and accompanied with flt-1 positivity of bm . the probability of flt-1 positivity of bm was increased by a factor of 2.7 in patients with severe and moderate hypoxia in tumor . the significant correlation between ck - positivity of bm and vegf expression there is relevant observation that activity of both gelatinases in bm correlated with presence of dtcs in bm of patients with m0 only . os of patients with m0 with dtcs in bm was significantly shorter than that in patients without dtcs . it was also evaluated that os of patients with dtcs and flt-1 positivity of bm was significantly shorter than that of patients without dtcs but with flt-1-positive bm ( these patients were treated with adjuvant chemotherapy ) . detection of dtcs in gastric cancer patients may be as relevant indicator for personalised cancer therapy , in particular in the choice of treatment tactic for gc patients , especially with category m0 . perhaps , dtcs in bm may be as an argument to use adjuvant chemotherapy , though some other factors have to be taking into account , for instance , the influence of hostile microenvironment on dtcs dormancy in bm .
### Summary: : aim . the evaluation of the clinical relevance of disseminated tumor cells ( dtcs ) in bone marrow ( bm ) of patients with gastric cancer ( gc ) and their association with primary tumor hypoxia . patients and methods . 89 resected specimens were used . dtcs were detected using immunocytochemistry , the level of tumor hypoxia using nmr spectroscopy , cd68 , cd34 , vegf , and vegfr-1 ( flt-1 ) expression using immunohistochemistry , and mmp-2 and mmp-9 activity using zymography . results . dtcs were detected in 51.4% of gc patients with m0 . there was significant correlation between frequency of dtcs in bm and level of tumor hypoxia ( p < 0.024 ) . dtcs presence was accompanied with flt-1 positivity of bm . the correlation between dtcs and tumor vegf expression in patients with m0 was shown ( p < 0.0248 ) . activity of mmp-2 and mmp-9 in bm was linked with dtcs in patients with m0 ( p < 0.05 ) . overall survival ( os ) of patients with m0 and dtcs was shorter than that of patients without dtcs ( patients in both groups were operated only ) ( p = 0.0497 ) . conclusion . appearance of dtcs correlates with hypoxia level in primary tumors . detection of dtcs in gc patients may be relevant indicator for adjuvant chemotherapy using .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : intercellular communication is an essential hallmark of multicellular organisms and can be mediated through direct cell cell contact or transfer of secreted molecules . in the last two decades , a third mechanism for intercellular communication has emerged that involves intercellular transfer of extracellular vesicles ( evs ) . although the release of apoptotic bodies during apoptosis has been long known ( hristov et al . , 2004 ) , the fact that also perfectly healthy cells shed vesicles from their plasma membrane has only recently become appreciated . these vesicles are generally referred to as microvesicles , ectosomes , shedding vesicles , or microparticles among others ( holme et al . , 1994 ; hess et al . , 1999 ; the term exosome was initially used for vesicles ranging from 40 to 1,000 nm that are released by a variety of cultured cells ( trams et al . , 1981 ) , but the subcellular origin of these vesicles remained unclear . later , this nomenclature was adopted for 40100-nm vesicles released during reticulocyte differentiation as a consequence of multivesicular endosome ( mve ) fusion with the plasma membrane ( harding et al . , 1984 ; pan et al . , 1985 ) . one decade later , exosomes were found to be released by b lymphocytes and dendritic cells through a similar route ( raposo et al . , 1996 ; zitvogel et al . , 1998 ) the involvement of mves was demonstrated by the observation that fusion with the plasma membrane released exosomes together with previously endocytosed colloidal gold ( fig . 1 ; see harding et al . in this issue ) . several additional cell types of both hematopoietic and nonhematopoietic origin , such as cytotoxic t cells , platelets , mast cells , neurons , oligodendrocytes , schwann cells , and intestinal epithelial cells , were also shown to release exosomes through mve fusion with the cell surface ( simons and raposo , 2009 ; thry et al . , 2009 ) . that exosomes can also be secreted in vivo had already been proposed by observations that vesicles from prostate epithelial cells ( prostasomes ) correspond in size to the intraluminal vesicles ( ilvs ) of storage vacuoles ( the equivalent of mves ) in these cells ( ronquist and brody , 1985 ) . vesicles with hallmarks of exosomes have been isolated from diverse body fluids , including semen ( ronquist and brody , 1985 ; park et al . , 2011 ; aalberts et al . , 2012 ) 2005 ) , urine ( pisitkun et al . , 2004 ) , saliva ( ogawa et al . , 2011 ) , breast milk ( admyre et al . , 2007 ) , amniotic fluid ( asea et al . , 2008 ) , ascites fluid ( andre et al . , 2002 ) , cerebrospinal fluid ( vella et al . , 2007 ) , and bile ( masyuk et al . , 2010 ) . most of these studies attributed the isolated vesicles to exosomes because of their exosome - like protein contents . however , circulating vesicles are likely composed of both exosomes and microvesicles ( mvs ) , and currently available purification methods , as discussed later , do not allow one to fully discriminate between exosomes and mvs . that a single cell type releases both exosomes and mvs has , for example , either been demonstrated or suggested for platelets ( heijnen et al . , 1999 ) , endothelial cells ( deregibus et al . , 2007 ) , and breast cancer cells ( muralidharan - chari et al . , 2009 ) . confusion on the origin and nomenclature of evs has spread through the literature as well because vesicles with the size of exosomes that bud at the plasma membrane have also been called exosomes ( booth et al . , 2006 ) . for clarity , in this review , we will exclusively refer to exosomes as evs originating from mves and to mvs for those evs that are shed from the plasma membrane ( fig . it should be noted that most studies have not clearly defined the origin of evs under study ; therefore , we will mostly refer to evs rather than mvs or exosomes . a major ongoing challenge is to establish methods that will allow one to discriminate between exosomes and mvs . differences in properties such as size , morphology , buoyant density , and protein composition seem insufficient for a clear distinction ( bobrie et al . , only when we are able to interfere with the molecular machineries required for ev formation and cargo sequestration will their origins be optimally determined . such knowledge will also open new avenues to resolve their respective functions . in this review , we will highlight and discuss current experimental limitations that need to be resolved and the state of the art on the cell biology of evs and their possible functions . ( top left ) exosomes isolated from melanoma cells were contrasted with uranyl - acetate and embedded as whole mount preparations in methylcellulose . note their artificial cup shape appearance ( examples are indicated with arrows ) and heterogeneous size ranging from 30 to 100 nm . ( top right ) exosomes from prostate epithelial cells ( prostasomes ) were directly frozen and observed by cryo the elongated structure ( top right of the micrograph ) is the formvar film on the em grid . ( bottom ) ebv - transformed b lymphocytes were allowed to endocytose bsa coupled to 5-nm gold particles ( bsag 5 ) for 10 min and then chased for 20 min in the absence of bsag 5 . ultrathin cryosections were immunolabeled for mhc class ii with 10-nm protein a gold . an mve fusion profile ( arrows ) in addition to bsag 5 ( arrowheads ) , the exocytic profile contains exosomes labeled for mhc class ii with 10-nm gold ( mhc ii 10 ; small arrows ) . mvs bud directly from the plasma membrane , whereas exosomes are represented by small vesicles of different sizes that are formed as the ilv by budding into early endosomes and mves and are released by fusion of mves with the plasma membrane . the point of divergence between these types of mves is drawn at early endosomes , but the existence of distinct early endosomes feeding into these two pathways can not be excluded . red spots symbolize clathrin associated with vesicles at the plasma membrane ( clathrin - coated vesicles [ ccv ] ) or bilayered clathrin coats at endosomes . membrane - associated and transmembrane proteins on vesicles are represented as triangles and rectangles , respectively . arrows represent proposed directions of protein and lipid transport between organelles and between mves and the plasma membrane for exosome secretion . one major challenge in the field is to improve and standardize methods for ev isolation and analysis ( thry et al . , 2006 ) . currently , evs are mostly isolated from the supernatants of cultured cells grown in fetal calf serum depleted of evs by performing differential ultracentrifugation . next , evs can be efficiently separated from nonmembranous particles , such as protein aggregates , by using their relatively low buoyant density ( raposo et al . , 1996 ; escola et al . , 1998 ; van niel et al . , 2003 ; wubbolts et al . , 2003 ) , and differences in floatation velocity can be used to separate differently sized classes of evs ( aalberts et al . , 2012 ) . the size of exosomes is equivalent to that of the ilvs of the mves from which they originate ( 40100-nm diameter ) . mvs are generally larger ( up to 1,000 nm in diameter ) , but also small vesicles ( 100 nm ) may bud from the cell surface ( booth et al . , 2006 ) . 2003 ) using a protein of interest , which also selects for vesicles with an exoplasmic or outward orientation . because of the increasing interest in exosomes and other evs and their potential use in therapeutics or as biomarkers for disease , commercially available kits that allow for easy isolation procedures are being developed and marketed . such approaches should be taken cautiously because they often fail to distinguish between differently sized evs and membrane - free macromolecular aggregates . further characterization of isolated evs requires complementary biochemical ( immunoblotting ) , mass spectrometry , and imaging techniques . whereas large evs are most often analyzed by conventional electron microscopy , small evs can also be observed as whole mount samples when deposited without sectioning on electron microscopy grids ( raposo et al . , 1996 ) . in the latter approach , evs may collapse during drying , resulting in a cup - shaped morphology , which is often considered erroneously as a typical feature of exosomes ( raposo et al . , 1996 ) . quickly frozen , vitrified vesicles analyzed by cryo electron microscopy indeed show that exosomes and other evs have a perfectly rounded shape ( fig . 1 and not depicted ; conde - vancells et al . , complementary to electron microscopy , nanoparticle tracking analysis allows determination of the size distribution of isolated evs based on the brownian motion of vesicles in suspension ( soo et al . , 2012 ) . because conventional flow cytometers can not distinguish between vesicles that are < 300 nm , a novel high resolution flow cytometry based method has been recently developed for quantitative high throughput analysis of individual ( immunolabeled ) nanosized vesicles ( nolte-t hoen et al . the protein content of evs from different sources has been analyzed by sds - page followed by protein staining , immunoblotting , or proteomic analysis . highly purified evs should be devoid of pollutants , such as serum proteins and protein components of intracellular compartments ( e.g. , the endoplasmic reticulum or mitochondria ) , that are never in contact with evs . as a consequence of their origin , exosomes from different cell types contain endosome - associated proteins ( e.g. , rab gtpase , snares , annexins , and flotillin ) , some of which are involved in mve biogenesis ( e.g. , alix and tsg101 ; van niel et al . , membrane proteins that are known to cluster into microdomains at the plasma membrane or at endosomes often are also enriched on evs . these include tetraspanins , a family of > 30 proteins that are composed of four transmembrane domains ( hemler , 2003 ) . tetraspanins such as cd63 , cd81 , cd82 , cd53 , and cd37 were first identified in b cell exosomes in which they can be enriched > 100-fold relative to the transferrin receptor , which in this cell type can be considered as a genuine marker for both the plasma membrane and early endosomes ( escola et al . , 1998 ) . other studies confirmed that tetraspanins are abundant in evs from other sources ( zller , 2009 ) . protein rafts ( hemler , 2008 ) , evs are also enriched in proteins that associate with lipid rafts , including glycosylphosphatidylinositol - anchored proteins and flotillin ( thry et al . , 1999 ; wubbolts et al . , 2003 ) . in comparison to the plasma membrane , exosomes from a variety of cells ( wubbolts et al . , 2003 ; laulagnier et al . , 2004 ; 2012 ) are highly enriched in cholesterol , sphingomyelin , and hexosylceramides at the expense of phosphatidylcholine and phosphatidylethanolamine . the fatty acids in exosomes are mostly saturated or monounsaturated . together with the high concentration of cholesterol , this may account for lateral segregation of these lipids into ilvs / exosomes during their formation at mves . less is known of the protein and lipid contents of mvs and whether particular components are enriched on mvs relative to their originating plasma membrane . a major breakthrough was the demonstration that the cargo of evs included both mrna and mirna and that ev - associated mrnas could be translated into proteins by target cells ( ratajczak et al . later studies reported on the rna contents of ev isolates from other cell cultures ( skog et al . , 2008 ) and from body fluids ( hunter et al . , 2008 ; rabinowits et al . , 2009 evs with features of exosomes released by immune cells have been demonstrated to selectively incorporate mirna that can be functionally transferred as a consequence of fusion with recipient cells ( mittelbrunn et al . , 2011 ; montecalvo et al . , recently , analysis of rna from evs by unbiased deep sequencing approaches demonstrated that , in addition to mrna and mirna , evs also contain a large variety of other small noncoding rna species , including rna transcripts overlapping with protein coding regions , repeat sequences , structural rnas , trna fragments , vault rna , y rna , and small interfering rnas ( bellingham et al . many rnas that were isolated with evs were found to be enriched relative to the rna profiles of the originating cells ( ratajczak et al . it is important to note that many studies failed to demonstrate whether identified extracellular rnas were truly associated with evs or rather with rna protein complexes that may have been co - isolated with evs . whether rnas are within the cytosolic lumen or associated with the outer membrane of evs can be achieved by measuring flotation into sucrose gradients and resistance to rnase digestion subsequent to protease treatment . also , different rna isolation methods give extensive variation in exosomal rna yield and patterns ( eldh et al . , 2012 ) , and such experimental variations between studies , together with the lack of quantitative data , make it impossible to make a comparative inventory of the rna species assigned to evs so far . the database exocarta ( http://www.exocarta.org ) catalogs proteins , lipids , and rna that have been identified in evs from different sources . this catalog has recently been updated as the compendium vesiclepedia that will continuously be supplemented by novel contributions from different groups working in the field , using as much as possible equivalent and standardized ev isolation protocols ( kalra et al . , the protein content of evs from different sources has been analyzed by sds - page followed by protein staining , immunoblotting , or proteomic analysis . highly purified evs should be devoid of pollutants , such as serum proteins and protein components of intracellular compartments ( e.g. , the endoplasmic reticulum or mitochondria ) , that are never in contact with evs . as a consequence of their origin , exosomes from different cell types contain endosome - associated proteins ( e.g. , rab gtpase , snares , annexins , and flotillin ) , some of which are involved in mve biogenesis ( e.g. , alix and tsg101 ; van niel et al . , 2006 ) . membrane proteins that are known to cluster into microdomains at the plasma membrane or at endosomes often are also enriched on evs . these include tetraspanins , a family of > 30 proteins that are composed of four transmembrane domains ( hemler , 2003 ) . tetraspanins such as cd63 , cd81 , cd82 , cd53 , and cd37 were first identified in b cell exosomes in which they can be enriched > 100-fold relative to the transferrin receptor , which in this cell type can be considered as a genuine marker for both the plasma membrane and early endosomes ( escola et al . , 1998 ) . other studies confirmed that tetraspanins are abundant in evs from other sources ( zller , 2009 ) . although tetraspanin - enriched membrane domains are distinct from detergent - resistant lipid protein rafts ( hemler , 2008 ) , evs are also enriched in proteins that associate with lipid rafts , including glycosylphosphatidylinositol - anchored proteins and flotillin ( thry et al . , 1999 ; wubbolts et al . , 2003 ) . in comparison to the plasma membrane , exosomes from a variety of cells ( wubbolts et al . , 2003 ; laulagnier et al . , 2004 ; 2012 ) are highly enriched in cholesterol , sphingomyelin , and hexosylceramides at the expense of phosphatidylcholine and phosphatidylethanolamine . the fatty acids in exosomes are mostly saturated or monounsaturated . together with the high concentration of cholesterol , this may account for lateral segregation of these lipids into ilvs / exosomes during their formation at mves . less is known of the protein and lipid contents of mvs and whether particular components are enriched on mvs relative to their originating plasma membrane . a major breakthrough was the demonstration that the cargo of evs included both mrna and mirna and that ev - associated mrnas could be translated into proteins by target cells ( ratajczak et al . later studies reported on the rna contents of ev isolates from other cell cultures ( skog et al . , 2008 ) and from body fluids ( hunter et al . , 2008 ; rabinowits et al . evs with features of exosomes released by immune cells have been demonstrated to selectively incorporate mirna that can be functionally transferred as a consequence of fusion with recipient cells ( mittelbrunn et al . , 2011 ; montecalvo et al . , recently , analysis of rna from evs by unbiased deep sequencing approaches demonstrated that , in addition to mrna and mirna , evs also contain a large variety of other small noncoding rna species , including rna transcripts overlapping with protein coding regions , repeat sequences , structural rnas , trna fragments , vault rna , y rna , and small interfering rnas ( bellingham et al . many rnas that were isolated with evs were found to be enriched relative to the rna profiles of the originating cells ( ratajczak et al . , 2006 ; valadi et al . , 2007 ; it is important to note that many studies failed to demonstrate whether identified extracellular rnas were truly associated with evs or rather with rna protein complexes that may have been co - isolated with evs . whether rnas are within the cytosolic lumen or associated with the outer membrane of evs can be achieved by measuring flotation into sucrose gradients and resistance to rnase digestion subsequent to protease treatment . also , different rna isolation methods give extensive variation in exosomal rna yield and patterns ( eldh et al . , 2012 ) , and such experimental variations between studies , together with the lack of quantitative data , make it impossible to make a comparative inventory of the rna species assigned to evs so far . the database exocarta ( http://www.exocarta.org ) catalogs proteins , lipids , and rna that have been identified in evs from different sources . this catalog has recently been updated as the compendium vesiclepedia that will continuously be supplemented by novel contributions from different groups working in the field , using as much as possible equivalent and standardized ev isolation protocols ( kalra et al . , because exosomes are formed in mves and mvs originate by direct budding from the plasma membrane ( fig . 1 and fig . 2 ) , the cellular machineries involved in their formation and release are likely to differ , although mechanistic elements may be shared . within the lysosomal pathway , mves are prone to fuse with lysosomes for degradation of their contents , differently from the itinerary of secretory mves . we and others have provided biochemical and morphological evidence that these two distinct fates rely on distinct populations of mves that coexist within the same cell . localization of cholesterol with the toxin perfringolysin indicated one cholesterol - rich mve population for exosome secretion and another , morphologically identical , but cholesterol - poor population for lysosomal targeting ( mbius et al . , 2002 ) . conversely , lysobisphosphatidic acid is absent in exosomes ( wubbolts et al . , 2003 ) but clearly present in lysosomally destined epidermal growth factor containing mves ( white et al . , 2006 ) . in dendritic cells , sorting of mhc ii into exosomes is , in contrast to lysosomal targeting , independent of mhc ii ubiquitination and rather correlates with incorporation into the tetraspanin cd9-containing detergent - resistant membranes ( buschow et al . , the generation of mves involves the lateral segregation of cargo at the delimiting membrane of an endosome and inward budding and pinching of vesicles into the endosomal lumen ( fig . the molecular machineries involved in the biogenesis of mves en route for degradation have been resolved based on the initial discovery of yeast mutants that were defective in the transport to the vacuole , the yeast analogue of mammalian lysosomes . these evolutionarily conserved proteins assemble into four multiprotein complexes : endosomal sorting complex responsible for transport ( escrt)-0 , -i , -ii , and -iii , which associate with accessory proteins ( e.g. , alix and vps4 ) . the escrt-0 , -i , and -ii complexes recognize and sequester ubiquitinated membrane proteins at the endosomal delimiting membrane , whereas the escrt - iii complex is responsible for membrane budding and actual scission of ilvs ( raiborg and stenmark , 2009 ; hurley , 2010 ) . the discovery of the machinery involved in mve biogenesis gave rise to the speculation on its potential role in exosome formation . as we discuss next , however , the function of escrt components in the formation of secretory mves appears to be more complex than originally supposed . in oligodendroglial cell lines , which secrete the proteolipid protein in association with exosomes , exosome biogenesis and secretion do not require escrt function but are dependent on sphingomyelinase , an enzyme that produces ceramide ( trajkovic et al . , 2008 ) . these observations are consistent with the presence of high concentrations of ceramide and derivatives thereof in exosomes ( wubbolts et al . , 2003 ; trajkovic et al . , 2008 ; brouwers et al . , the existence of escrt - independent mechanisms for mve formation is supported by the finding that cells concomitantly depleted of four subunits of the escrt complex are still able to generate cd63-positive mves ( stuffers et al . , 2009 ) . recruitment of mhc ii to exosomes from antigen - presenting cells occurs independently of mhc ii ubiquitination , again consistent with sorting mechanisms that may operate independently of the escrt machinery ( buschow et al . , our own studies in pigment - producing melanocytes indicate that mammalian cells developed pathways for mve formation independently of both escrts ( theos et al . , 2006 ) and ceramide ( van niel et al . , 2011 ) tetraspanins , which are highly enriched in mves , have often been proposed to play a role in the formation of ilvs and the exosome ( simons and raposo , 2009 ) . mhc class ii molecules in exosomes are associated with large protein complexes also containing tetraspanins ( wubbolts et al . , 2003 ; buschow et al . , 2009 ) . in another cell system , we have shown that cd63 functions in escrt - independent sorting to ilvs of the melanosomal protein pmel ( van niel et al . , 2011 ) , a protein that is targeted to exosomes in melanoma cells ( wolfers et al . , 2001 ) . these aforementioned studies indicate that the escrt system may have distinct functions in ev production versus lysosomal protein sorting . even though ev cargo proteins may not be selected through ubiquitination , some escrt components have been implicated in ev formation . for example , the transferrin receptor , which in reticulocytes is fated for exosome secretion , interacts with the escrt accessory protein alix during its sorting at mves ( gminard et al . , more recently , alix was also shown to be involved in exosome biogenesis and exosomal sorting of syndecans through an interaction with syntenin ( baietti et al . , 2012 ) . our unpublished data exploiting a medium throughput interference ( rnai ) screen targeting 23 different components of escrt-0/i / ii / iii and associated proteins in hela ciita cells expressing mhc class ii indicate a role for only a few members of this family ( stam [ signal - transducing adaptor molecule ] , tsg101 , alix , hrs , and vps4 ; colombo , m. , and c. thry , personal communication ) . the escrt-0 component hrs ( hepatocyte growth factor associated tyrosine kinase ) has been reported to be involved in exosome formation / secretion in dendritic cells ( tamai et al . , 2010 ) . the tumor suppressor protein p53 and its transcriptional target tsap6 have been implicated in the regulation of exosome secretion ( yu et al . , 2006 ) , illustrating potential couplings between signaling and exosome biogenesis ( hupalowska and miaczynska , 2012 ) . moreover , p53 activity has been linked to the escrt - iii component chmp1a ( manohar et al . , 2011 ) , further explaining a role for p53 in mve and maybe exosome biogenesis . how cytosolic constituents are recruited into exosomes is unclear but may involve association of exosomal membrane proteins with chaperones such as hsc70 , that are found in exosomes from most cell types ( thry et al . 2004 ) . using quantitative mass spectrometry , we identified a small subset of cytosolic proteins and proteins that , together with tetraspanins , coimmunoprecipitated with mhc ii from lysed exosomes . these included hsc70 , hsp90 , 143 - 3 epsilon , and pkm2 , all of which could potentially play a role in protein sorting to exosomes ( buschow et al . , 2010 ) . hsc70 was also shown to interact with the transferrin receptor in maturing reticulocytes but not in other cell types ( gminard et al . , 2004 ) . given the unfolding but still incomplete picture of both escrt - independent and -dependent aspects in the biogenesis of exosomes , the mechanism is likely to be complex . similarly , the mechanism for generation of mvs from the plasma membrane is largely undefined . in principle , oligomerization of a cytoplasmic protein in addition to any plasma membrane anchor , including myristoylation and palmitoylation , appears sufficient to drive proteins into mvs ( shen et al . , 2011 ) . mv formation in breast cancer cells requires the actin myosin machinery and the action of small gtpases , such as arf6 ( muralidharan - chari et al . interestingly , a recent study provided evidence for the recruitment of the escrt - i subunit tsg101 to the plasma membrane by means of a tetrapeptide psap motif that drives the arrdc1 ( arrestin 1 domain containing protein 1 ) into mvs ( nabhan et al . , 2012 ) . thus , the molecular machineries for exosome and mv biogenesis may share mechanistic elements . how rna species are sorted into evs recent observations suggest that rnas in evs share specific sequence motifs that may potentially function as cis - acting elements for targeting to evs ( batagov et al . , 2011 ) . although speculative , the finding that escrt - ii is an rna binding complex ( irion and st johnston , 2007 ) opens the possibility that it may also function to select rna for incorporation into evs . moreover , the observations that mves are sites of mirna - loaded risc ( rna - induced silencing complex ) accumulation ( gibbings et al . , 2009 ) and that exosome - like vesicles are considerably enriched in gw182 and ago2 implicate functional roles of these proteins in rna sorting to exosomes . in oligodendroglial cell lines , which secrete the proteolipid protein in association with exosomes , exosome biogenesis and secretion do not require escrt function but are dependent on sphingomyelinase , an enzyme that produces ceramide ( trajkovic et al . , 2008 ) . these observations are consistent with the presence of high concentrations of ceramide and derivatives thereof in exosomes ( wubbolts et al . , 2003 ; the existence of escrt - independent mechanisms for mve formation is supported by the finding that cells concomitantly depleted of four subunits of the escrt complex are still able to generate cd63-positive mves ( stuffers et al . , 2009 ) . recruitment of mhc ii to exosomes from antigen - presenting cells occurs independently of mhc ii ubiquitination , again consistent with sorting mechanisms that may operate independently of the escrt machinery ( buschow et al . , our own studies in pigment - producing melanocytes indicate that mammalian cells developed pathways for mve formation independently of both escrts ( theos et al . , 2006 ) and ceramide ( van niel et al . , 2011 ) tetraspanins , which are highly enriched in mves , have often been proposed to play a role in the formation of ilvs and the exosome ( simons and raposo , 2009 ) . mhc class ii molecules in exosomes are associated with large protein complexes also containing tetraspanins ( wubbolts et al . , 2003 ; buschow et al . , 2009 ) . in another cell system , we have shown that cd63 functions in escrt - independent sorting to ilvs of the melanosomal protein pmel ( van niel et al . , 2011 ) , a protein that is targeted to exosomes in melanoma cells ( wolfers et al . , 2001 ) . these aforementioned studies indicate that the escrt system may have distinct functions in ev production versus lysosomal protein sorting . even though ev cargo proteins may not be selected through ubiquitination , some escrt components have been implicated in ev formation . for example , the transferrin receptor , which in reticulocytes is fated for exosome secretion , interacts with the escrt accessory protein alix during its sorting at mves ( gminard et al . , 2004 ) . more recently , alix was also shown to be involved in exosome biogenesis and exosomal sorting of syndecans through an interaction with syntenin ( baietti et al . , 2012 ) . our unpublished data exploiting a medium throughput interference ( rnai ) screen targeting 23 different components of escrt-0/i / ii / iii and associated proteins in hela ciita cells expressing mhc class ii indicate a role for only a few members of this family ( stam [ signal - transducing adaptor molecule ] , tsg101 , alix , hrs , and vps4 ; colombo , m. , and c. thry , personal communication ) . the escrt-0 component hrs ( hepatocyte growth factor associated tyrosine kinase ) has been reported to be involved in exosome formation / secretion in dendritic cells ( tamai et al . , 2010 ) . the tumor suppressor protein p53 and its transcriptional target tsap6 have been implicated in the regulation of exosome secretion ( yu et al . , 2006 ) , illustrating potential couplings between signaling and exosome biogenesis ( hupalowska and miaczynska , 2012 ) . moreover , p53 activity has been linked to the escrt - iii component chmp1a ( manohar et al . , 2011 ) , further explaining a role for p53 in mve and maybe exosome biogenesis . how cytosolic constituents are recruited into exosomes is unclear but may involve association of exosomal membrane proteins with chaperones such as hsc70 , that are found in exosomes from most cell types ( thry et al . , 2001 ; gminard et al . , , we identified a small subset of cytosolic proteins and proteins that , together with tetraspanins , coimmunoprecipitated with mhc ii from lysed exosomes . these included hsc70 , hsp90 , 143 - 3 epsilon , and pkm2 , all of which could potentially play a role in protein sorting to exosomes ( buschow et al . , 2010 ) . hsc70 was also shown to interact with the transferrin receptor in maturing reticulocytes but not in other cell types ( gminard et al . , 2004 ) . given the unfolding but still incomplete picture of both escrt - independent and -dependent aspects in the biogenesis of exosomes , the mechanism is likely to be complex . similarly , the mechanism for generation of mvs from the plasma membrane is largely undefined . in principle , oligomerization of a cytoplasmic protein in addition to any plasma membrane anchor , including myristoylation and palmitoylation , appears sufficient to drive proteins into mvs ( shen et al . , 2011 ) . mv formation in breast cancer cells requires the actin myosin machinery and the action of small gtpases , such as arf6 ( muralidharan - chari et al . , 2009 , 2010 ) . interestingly , a recent study provided evidence for the recruitment of the escrt - i subunit tsg101 to the plasma membrane by means of a tetrapeptide psap motif that drives the arrdc1 ( arrestin 1 domain containing protein 1 ) into mvs ( nabhan et al . thus , the molecular machineries for exosome and mv biogenesis may share mechanistic elements . how rna species are sorted into evs recent observations suggest that rnas in evs share specific sequence motifs that may potentially function as cis - acting elements for targeting to evs ( batagov et al . , 2011 ) . although speculative , the finding that escrt - ii is an rna binding complex ( irion and st johnston , 2007 ) opens the possibility that it may also function to select rna for incorporation into evs . moreover , the observations that mves are sites of mirna - loaded risc ( rna - induced silencing complex ) accumulation ( gibbings et al . , 2009 ) and that exosome - like vesicles are considerably enriched in gw182 and ago2 implicate functional roles of these proteins in rna sorting to exosomes . the machineries involved in scission / release of mvs from the plasma membrane and those implicated in the mobilization of secretory mves to the cell periphery , their docking , and fusion with the cell surface are still at an early stage of comprehension . these processes require the cytoskeleton ( actin and microtubules ) , associated molecular motors ( kinesins and myosins ) , molecular switches ( small gtpases ) , and the fusion machinery ( snares and tethering factors ; cai et al . , 2007 ) . the first indications for the involvement of rab gtpases in exosome secretion were from studies on reticulocyte cell lines , which required the function of rab 11 for exosome secretion ( savina et al . , 2002 ) . more recently , in an rnai screen in hela cells targeting 59 members of the rab gtpase family , knockdown of rab27a or rab27b significantly reduced the amount of secreted exosomes ( ostrowski et al . , 2010 ) . rab27 is associated with secretory lysosome related organelles ( raposo et al . , 2007 ) , and these findings thus also directly strengthen a role for endocytic compartments in exosome secretion . by analogy with other cell systems hosting secretory endo / lysosomes , rab27 could be involved directly or indirectly in the transport and tethering at the cell periphery of the secretory mves . along this line , silencing of two known rab27 effectors , slp4 ( also known as sytl4 [ synaptotagmin - like 4 ] ) and slac2b ( also known as exph5 [ exophilin 5 ] ) , inhibited exosome secretion and phenocopied silencing of rab27a and rab27b , respectively ( ostrowski et al . , 2010 ) . in a separate screen , targeting rab gtpase - activating proteins , knockdown of the rab gtpase - activating proteins tbc1d10a c and interference with its effector , rab35 , reduced exosome secretion ( hsu et al . , 2010 ) . it should be noted that although rab11 , rab27 , and rab35 all appear to be involved in exosome release , selective inactivation of each of these rabs only partially impacted this pathway . the roles of these gtpases could be either complementary , cell type dependent , or only indirect by regulating pathways upstream of exosome secretion . for example , mv release can be stimulated through activation of purinergic receptors with atp ( wilson et al . , 2004 ) . platelets are stimulated to shed vesicles from the plasma membrane and to release exosomes in response to thrombin receptor activation ( heijnen et al . , 1998 ) . dendritic cells increase the release of mvs and change the protein composition thereof in response to activation by lipopolysaccharides ( obregon et al . , 2006 ; nolte-t hoen et al . , 2012c ) , whereas peptide - loaded immature dendritic cells were stimulated to release exosomes in response to their interaction with t cells recognizing peptide - loaded mhc class ii ( buschow et al . , 2009 ) similarly , plasma membrane depolarization increases the rapid secretion of exosomes by neuronal cells ( faur et al . , 2006 ; lachenal et al . , 2011 ) , and cross - linking of cd3 in t cells stimulates exosome release by t cells ( blanchard et al . one central trigger for the release of evs appears to involve increasing intracellular ca concentrations , as demonstrated , for example , for a human erythroleukemia cell line ( savina et al . , 2005 ) and mast cells ( raposo et al . , 1997 ) . the snare complex involved in ca - regulated exocytosis of conventional lysosomes includes vamp7 and ca binding synaptotagmin vii ( rao et al . , 2004 ) . whether the exocytic fusion of mves is similarly modulated and/or controlled by the same fusion machinery is debated : exosome secretion by maturing reticulocytes appeared to rely on vamp7 function ( fader et al . , 2009 ) , whereas in mdck cells , expression of the longin domain of vamp7 selectively impaired lysosomal secretion but not the release of exosomes ( proux - gillardeaux et al . , 2007 ) . in a recent study , it was demonstrated that secretion of exosomes carrying the morphogen wnt is dependent on the r - snare ykt6 ( gross et al . , 2012 ) . the v0 subunit of the vacuolar v - atpase , which is involved in fusion events independently of its proton pump activity , may , through its association with snares , form fusion pores ( marshansky and futai , 2008 ) . the v0-atpase has been proposed to regulate mve secretion in caenorhabditis elegans ( ligeois et al . , 2006 ) , but these findings await validation in mammalian cells . functions of evs in physiological and pathological processes depend on the ability of evs to interact with recipient cells to deliver their contents of proteins , lipids , and rnas ( fig . 3 ) . specificity of target cell binding is illustrated by the finding that isolated b cell exosomes selectively bind follicular dendritic cells in lymphoid follicles ( denzer et al . , 2000 ) . similarly , evs released by a human intestinal epithelial cell line interacted preferentially with dendritic cells rather than with b or t lymphocytes ( mallegol et al . , 2007 ) . the cellular and molecular basis for ev targeting is still undetermined , but several target cell dependent and conditional aspects are beginning to emerge . target cell specificity for binding of exosomes ( or other evs ) is likely to be determined by adhesion molecules , such as integrins , that are present in evs . containing dendritic cell derived exosomes that are secreted in response to cognate dendritic cell t cell interactions ( buschow et al . , 2009 ) . recruitment of these exosomes required t cell activation and was dependent on an induced high - affinity state of lfa-1 ( leukocyte function - associated antigen-1 ) rather than on t cell receptor specificity ( nolte-t hoen et al . , 2009 ) . exosomes carrying mhc class ii and icam-1 from mature dendritic cells can also be recruited by bystander dendritic cells with help of lfa-1 ( segura et al . , 2007 ) . differences in exosomal tetraspanin complexes also appear to influence target cell selection in vitro and in vivo ( rana et al . , 2012 ) , possibly by modulating the functions of associated proteins , including adhesion molecules such as integrins ( hemler , 2003 ) . yet other molecules , such as galactin-5 and galectin-9 , are involved in the clearance of reticulocyte exosomes by macrophages ( barrs et al . , 2010 ) and in the targeting of nasopharyngeal carcinoma derived evs to cd4 t cells ( klibi et al . , 2009 ) , respectively . membrane - associated ( triangles ) and transmembrane proteins ( rectangles ) and rnas ( curved symbols ) are selectively incorporated into the ilv of mves or into mvs budding from the plasma membrane . mvs and exosomes may dock at the plasma membrane of a target cell ( 1 ) . bound vesicles may either fuse directly with the plasma membrane ( 2 ) or be endocytosed ( 3 ) . endocytosed vesicles may then fuse with the delimiting membrane of an endocytic compartment ( 4 ) . both pathways result in the delivery of proteins and rna into the membrane or cytosol of the target cell . fusion and endocytosis are only represented for exosomal vesicles , but plasma membrane derived mvs may have similar fates . after binding to recipient cells , evs may remain stably associated with the plasma membrane or dissociate , directly fuse with the plasma membrane , or be internalized through distinct endocytic pathways ( fig . when endocytosed , evs may subsequently fuse with the endosomal delimiting membrane or be targeted to lysosomes for degradation . stable and persistent cell surface exposure can be expected , particularly on cells that display little if any endocytic activity , as was proposed for mhc class ii carrying exosomes associated with follicular dendritic cells that do not synthesize mhc class ii themselves but function in the maintenance of t cell memory ( denzer et al . , 2000 ) . detection of fusion of small evs with the plasma membrane by fluorescence microscopy in live cells is limited by resolution and the fast dynamics of fusion events . nevertheless , direct evidence for fusion of exosomes with target cell membranes has been obtained by labeling exosomes with the lipophilic dye r18 , in which self - quenching is relieved upon dilution as a consequence of fusion ( montecalvo et al . , 2012 ) , resulting in flashing and an increase in the fluorescence of target cells . several other studies provided evidence for the accumulation of captured evs in endocytic or phagocytic compartments , with uptake depending on the actin cytoskeleton , phosphatidylinositol 3-kinase activity , and dynamin-2 function ( morelli , 2006 ; barrs et al . , 2010 ; tian et al . , 2010 ) . to our knowledge , one the first studies reporting the functional interaction of evs with cells is the promotion of sperm cell motility by prostasomes ( stegmayr and ronquist , 1982 ) . over the past years , very diverse biological functions have been attributed to evs ( also summarized by harding et al . in this issue ) , and it is now commonly accepted that exosomes and mvs represent important vehicles of intercellular communication in between cells locally or at a distance . in the early 80 s , exosome secretion by reticulocytes was reported as a mechanism to eradicate obsolete molecules ( harding et al . , 2013 ) . later , the capacity of exosomes to act as antigen - presenting vesicles , to stimulate antitumoral immune responses , or rather to induce tolerogenic effects has stimulated the interest of immunologists to investigate their potential use in clinics ( bobrie et al . tumor cells as well as other cells in tumor microenvironments also secrete evs ( exosomes and microvesicles ) , and there is evidence that these contribute to tumor progression by promoting angiogenesis and tumor cell migration in metastases ( rak , 2010 ; hood et al . , 2011 ) . tumor - derived vesicles also bear immunosuppressive molecules , which can inactivate t lymphocytes or natural killer cells , or promote the differentiation of regulatory t lymphocytes or myeloid cells to suppress immune responses ( zhang and grizzle , 2011 ) . evs released apically or basolaterally by intestinal epithelial cells appear to be involved in antigen presentation at inflammatory conditions , and these evs may confer the ability of static epithelial cells to act at a distance ( van niel et al . , evs present in the bronchoalveolar fluid bear tolerizing molecules ( e.g. , in allergen - tolerized mice ) or , conversely , may increase proinflammatory cytokine secretion by airway epithelial cells in asthmatic human patients ( prado et al . recent studies reported the association of membrane - bound morphogens to evs , including wnt ( gross et al . 2013 ) , and the notch ligand dii4 ( sheldon et al . , 2010 ) . through wnt signaling , fibroblast exosomes have recently been demonstrated to promote breast cancer cell dynamics ( luga et al . , 2012 ) . also , in drosophila melanogaster , wnt - associated evs have been implicated in signal transduction , although here , exosomes do not appear to be essential for wnt gradient formation in tissues ( beckett et al . , 2013 ) . in addition to exosomes or mvs , small lipoprotein particles may also contribute to the secretion and be responsible for tissue gradient formation of wnt and hedgehog ( pankov et al . within the nervous system , neurons , oligodendroglial cells , and microglia secrete evs that could be targeted from one cell type to the other ( faur et al . , 2006 ; krmer - albers et al . , 2007 ; lachenal et al . , 2011 ) evs have recently been proposed to participate in myelin formation ( bakhti et al . , 2011 ) as well as in neurite outgrowth and neuronal survival ( wang et al . , 2011 ) . within the central nervous system , several pathogenic proteins that are involved in central nervous system diseases , such as prions ( fevrier et al . , 2004 ) , -amyloid peptide ( rajendran et al . , 2006 ) , superoxide dismutase ( gomes et al . , 2007 ) , and -synuclein ( emmanouilidou et al . , 2010 ) , are released from cells in association with evs . these secreted vesicles are thought to participate in disseminating pathogenesis through interaction with recipient cells . ultrastructural observations in situ in the gut of prion - infected mice showed the presence of a33 antigen - positive evs ( kujala et al . , 2011 ) , supporting their existence in vivo . interestingly , -synuclein can be detected in the plasma and cerebrospinal fluid of humans , extending the interest for evs as biomarkers in disease ( alvarez - llamas et al . , 2008 ; al - nedawi et al . , 2009 ; simpson et al . , 2009 ) . the interest of scientists and physicians in evs has expanded logarithmically over the past decade in response to the discoveries that evs are not only generated in cell culture but are also abundantly present in body fluids , carry rna , and show a wide range of regulatory functions . as discussed , we are still at an early stage of deciphering the molecular mechanisms involved in ev biogenesis and recruitment of cargo therein . specific knowledge of these mechanisms will help us to intervene with ev function in vivo , an absolute requirement to decipher their precise role in physiological processes . also , more accurate and standardized purification methods are required for the implementation in a clinical setting of evs as biomarkers , vaccines , or drug delivery devices . to help coordinate these enormous challenges , the international society for extracellular vesicles
### Summary: : cells release into the extracellular environment diverse types of membrane vesicles of endosomal and plasma membrane origin called exosomes and microvesicles , respectively . these extracellular vesicles ( evs ) represent an important mode of intercellular communication by serving as vehicles for transfer between cells of membrane and cytosolic proteins , lipids , and rna . deficiencies in our knowledge of the molecular mechanisms for ev formation and lack of methods to interfere with the packaging of cargo or with vesicle release , however , still hamper identification of their physiological relevance in vivo . in this review , we focus on the characterization of evs and on currently proposed mechanisms for their formation , targeting , and function .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : alzheimer 's disease ( ad ) is a progressive neurodegenerative disorder that results in the accumulation and aggregation of key proteins within the brain that are believed to drive the symptomatic presentation and pathological progression of the disease . the underlying cause of ad has yet to be elucidated however , there is an increasing burden of proof on the role of metal dysregulation in the pathogenesis of the disease . other papers in this special edition will detail the proposed role of copper in the generation and aggregation of key ad - related proteins . in this paper , we will review the preclinical and clinical trial data related to attempts to affect the ad cascade by the modulation of brain copper levels . in addition , we will also present our own novel data on long - term copper administration to app / ps1 transgenic mice ( one of the more widely used mouse models of ad ) . in this section , we will outline the various animal and human trials that have been conducted that are specifically directed at a modulation of copper . there are a number of additional studies that will not be discussed , as these assess the effect of therapeutics that may alter a diversity of metals such as copper , zinc , and iron . keys among these are our own studies with the metal ionophore , pbt2 , which has shown promising effects in a number of different transgenic mouse models of ad and also in a phase 2a human clinical trial [ 14 ] . its mechanism of action is believed to rely on a normalisation of metal ion ( primarily copper and zinc ) homeostasis within the brain , which subsequently affects a variety of cellular cascades that , among other activities , serve to facilitate the disaggregation and clearance of beta - amyloid ( the principle component of the amyloid plaques that characterises the neuropathology of ad ) and also maintains synaptic health and cognition . while these studies are of great value and have provided impressive data to support this avenue of investigation into the treatment of ad , their mechanisms of action are complex and may not necessarily result from an effect on copper alone . utilising the app23 [ b6-tg(thy1app)23sdz ] mouse line , bayer and colleagues treated aged animals ( 12 months old ) with deionized water containing either sucrose or a combination of sucrose and copper sulfate ( 250 ppm ) . this copper sulfate treatment , which lasted for three months , was sufficient to elevate copper levels in the app23 mice ( ~25% increase ) , thereby remedying the homeostatic copper deficit present in this transgenic mouse line . the net effect on amyloid burden was a shift to decreased levels of both pbs - soluble a1 - 40 and 1 - 42 in male transgenic mice only . likewise , formic - acid - soluble amyloid burden was only lower in the male animals treated with copper sulfate , while histological amyloid load was decreased in both the male and female transgenic mice treated with copper sulfate utilising app / ps1 mice ( b6c3-tg(appswe , psen1de9)85dbo / j on a b6c3 background ( stock#004462 , the jackson laboratory ) ; 7 - 8 months of age at the start of the trial ; animals develop plaques around 4 months of age ) , we assessed the effect of either copper supplementation in the drinking water ( 20 ppm in de - ionised water ; n = 7 ) , cholesterol supplementation in the food ( 2% cholesterol in regular rodent chow , provided by specialty feeds , western australia ; n = 6 ) or a combination of both ( n = 4 ) on the levels of brain amyloid ( control animals received regular rodent chow and regular deionised water ; n = 5 ) . treatment was for a period of 16 weeks and during the week prior to culling the animals were assessed for spatial learning and memory in the morris water maze . in this task , animals were subject to six consecutive days of learning trials ( 4 trials / day / mouse , 90 seconds / trial with a random quadrant entry and a 15 minute inter - trial interval ) and one recall task on the seventh day ( submerged platform removed from the pool , one 90 second swimming trial / mouse ) . we have previously published these techniques [ 3 , 6 , 7 ] . the animals were culled the day after the recall task and the tissues collected ( trans - cardial pbs - perfusion followed by removal of the brain , which was immediately dissected into two hemispheres , frozen on dry ice and stored at 80c prior to analysis ) . utilising an in - house antibody ( wo2 ) , targeted against residues 58 of the human a sequence that detects both full - length monomeric a as well as app species , as well as a commercial a antibody ( 4g8 , residues 1721 ) that detects full - length human a , we assessed a burden by western blot . we have previously published these analytical methods [ 3 , 4 , 7 ] and western blot assessments of a have previously been shown to detect the largest pool of this peptide in human samples . our data ( figure 1 ) demonstrate similar trends for the effect of the individual treatments , with both the elevated copper and the elevated cholesterol diets causing a trend to a decrease in a load . in contrast , a study in a different app / ps1 model ( ps1m146l mice crossed with appk670n , m671l mice ; mice develop plaques at 2 - 3 months of age ) found a trend to an increase in plaque burden in copper - supplemented animals ( plaque volume ( mm ) on distilled water alone : 1.63 0.05 ; on copper - treated distilled water : 1.84 0.05 ; p = 0.06 ) . this study utilised a different start date for treatment ( 11 weeks of age , corresponding to the start of plaque formation ) , period of treatment ( 6 weeks ) , dose of copper ( 0.12 ppm copper sulfate ) and method of quantitation ( histological assessment of a plaque volume using the antibody , 10d5 ) than our own work reported here . these variable experimental parameters are likely to account for the differences in the outcomes observed in both studies . the copper and cholesterol treatments utilised in our paradigm also appear to be additive , in that there was a significant and exaggerated decrease in a in the tg animals that received both elevated copper and cholesterol in their diet , as compared to the transgenic animals receiving the control diet ( anova : p = 0.02 for wo2 pellet / insoluble data , p = 0.007 for 4g8 pellet / insoluble data ) . this effect was consistent across assays with both the in - house ( figure 1(a ) ) and the commercial ( figure 1(b ) ) a antibody . these data suggest an interaction of both copper and cholesterol on a metabolism in this transgenic mouse model of ad . analysis of app levels ( figure 2 ) demonstrated that this reduction in a is likely a function of a direct effect on app , whose protein expression profile closely paralleled that found for a , with a significant reduction in app in the animals that received the combined high cholesterol and high copper diet ( anova : p = 0.0003 ) . there was no significant effect of either the copper treatment ( anova : p = 0.09 ) or the cholesterol treatment ( anova : p = 0.08 ) on app levels , although a trend to decrease was observed with both . despite these changes in a levels , there were no significant effects observed in the performance of animals in the morris water maze task ( figure 3 ) . repeated measures anova across the six days of learning trials demonstrated a trend to an overall difference between all treatment groups ( p = 0.07 ) , with a significant treatment x day interaction ( p < 0.05 ) . post hoc analysis revealed a significant difference across the trial when comparing the high - copper treatment and the high - copper / cholesterol treatment groups ( repeated measures anova : p = 0.02 ) and a trend to a difference between the high - copper and the control transgenic groups ( repeated measures anova : p = 0.07 ) . taken together , these data suggest that the decrease in a resulting from a high - copper diet may improve cognitive function , whereas the combination of both a high - copper and a high - cholesterol diet may negatively impact learning and memory , despite a significant decrease in a burden in those animals . this latter observation , while apparently paradoxical , is consistent with a community - based prospective study that reported that a high - fat diet in conjunction with high - copper intake was associated with a faster rate of cognitive decline in individuals aged 65 years and older . while the mechanisms underlying this have not been pursued , it is likely that an interaction between copper and cholesterol , particularly in the aged brain , may be sufficient to generate unbuffered reactive oxygen species which can contribute to neuronal toxicity and ultimately to cognitive decline . it is also important to note that the effect of elevated copper and/or cholesterol on a diseased brain ( in which , as is the case in the studies mentioned above , there is an existing homeostatic deficit in copper levels in the brain ) . this is apparent from a number of studies where the administration of copper and cholesterol to both rabbits and outbred mice resulted in the accumulation of a and an impairment in various learning / memory tasks . thus , more detailed mechanistic investigations into the effect of copper and cholesterol on pathways related both to a metabolism and to cognitive function in both the wildtype and the app transgenic mouse are required in order to reconcile the differences in these studies . following this same principle of elevating copper levels to try and modulate the ad cascade , phinney and colleagues utilised a genetic approach to achieve this goal . they crossed tgcrnd8 mice ( a common ad transgenic mouse line that shows a very rapid accumulation of a plaques ) with tx mice that harbour an autosomal recessive mutation in the gene encoding the copper transport protein , cuatpase7b . the resulting animals ( harbouring both mutant human app and also homozygous for the atpase7b mutation ) had elevated brain copper levels , and the net effect on amyloid burden was similar to that shown in the two studies above , with a decrease in the total brain levels of both soluble- and formic - acid - extractable a ( assessed by elisa ) and a significant reduction in the number of histologically identified dense - cored plaques . the modulation of brain copper levels , therefore , is sufficient to alter the normal generation and metabolism of a in transgenic mouse models of ad . this hypothesis has been further tested in a number of studies that have pharmacologically manipulated copper levels in the brains of app transgenic mice . the copper chelator pyrrolidine dithiocarbamate , for example , was given chronically in the drinking water ( 20 mg / kg , 7 months ) to app / ps1 mice and resulted in a significant increase in brain copper levels , no significant change to amyloid burden , but did improve spatial memory . in contrast , crouch and colleagues utilised the copper bis(thiosemicarbazone ) complex , cuii(gtsm ) , which elevates cellular copper concentrations and activates various signalling pathways relevant to amyloid metabolism . when administered to app / ps1 animals for 15 weeks ( 10 mg / kg / day ) , there was a significant decrease in pbs - insoluble amyloid , which appeared to be largely driven by a decrease in a trimer species , and a parallel improvement in performance in the y - maze memory task . thus , these preclinical studies suggest that the modulation of brain copper levels may be sufficient to impact the normal pathogenesis of ad . the translation of this work to human studies , however , has not shown the same potential efficacy of this therapeutic approach . in the first study of its kind , squitti and colleagues assessed the effect of the copper - chelating agent , d - penicillamine , ( n = 17 , 600 mg per day for 6 months ; n = 17 placebo ) in a small pilot study in ad patients . a number of cognitive tests were used to assess the effect of the compound , including the mental deterioration battery , mmse , neuropsychiatric inventory , geriatric depression scale , and the gottfries brane steen scale . while no significant cognitive effects were observed , the placebo - treatment group did not decline as expected , and this precluded any conclusions being drawn on the efficacy of d - penicillamine on cognition ( this lack of expected decline in placebo groups has become a recurrent problem in ad trials ) . despite this , the data did suggest that there may have been an effect on a number of the biochemical parameters examined . the authors concluded that larger patient numbers were required to further elucidate the potential efficacy of this approach for the treatment of ad . a more recent clinical trial involved oral copper supplementation in a small cohort of ad patients [ 18 , 19 ] . individuals received either placebo ( n = 33 ) or oral copper orotate ( n = 35 ; equivalent to 8 mg copper per day ) for twelve months . the endpoints that were examined included various csf a species ( 1 - 37 , 1 - 38 , 1 - 39 , 1 - 40 , and 1 - 42 species ) , tau and phospho - tau ( thr181 ) levels and cognitive function , assessed using the alzheimer 's disease assessment scale ( adas - cog ) and the minimental state examination ( mmse ) . the only biomarker that changed was a1 - 42 levels , which decreased less ( 10% drop ) in the copper - supplementation group over the course of the study , as compared to the placebo group ( 30% drop ) . the implications of the effect seen on csf amyloid burden are unclear , and the authors concluded that the copper supplementation had no effect on the progression of the ad phenotype . these data highlight the difficulty in translating basic bench science into effective therapeutics . while it is clear that there is a dyshomeostasis in copper levels in the ad brain that may contribute to the pathogenesis of ad ( both through a disruption to normal copper - dependent pathways and also via an effect of copper on the aggregation and toxicity of amyloid and formation of plaques ) and that in vivo models support the use of compounds that are able to modulate copper levels as being effective at interfering in the normal ad cascades , testing these notions in a human population have thus far been lacking . a definitive understanding of the mechanisms of action and potential interactions of copper in the ad brain are also lacking and are clearly complex . metals such as copper , for example , are very tightly regulated , and in situations where there is a mismetabolism of copper , a simple dietary supplement is unlikely to change this mismetabolism and may not result in a restoration of cellular copper homeostasis . unregulated delivery of copper to the ad brain may , for example , result in a number of consequences : it may potentiate the aggregation and accumulation of -amyloid deposits ( which arguably may represent either a toxic or a protective phenomenon , depending on ones belief about the role of and interaction between soluble oligomers and insoluble a plaques in the pathogenesis of ad ) ; it may aggravate oxidative pathways to generate toxic ros or also have other negative cellular effects ; it may also activate a number of intracellular copper - dependent pathways that mediate an improvement in multiple aspects of the pathophysiology of ad , including facilitating the degradation of a and reducing the abnormal phosphorylation of tau ( as has been shown when using a more targeted pharmacological approach for the normalisation of copper homeostasis , such as cuii(gtsm ) reviewed in ) . it is clear , therefore , that attempting to modulate homeostatic systems is fraught with difficulties and will require sophisticated approaches to the targeted restoration of metal levels within the brain to ensure that the required outcomes are achieved in the absence of any toxicity . a greater burden of proof , and the identification of a candidate compound , is required to help move this avenue of research forward into robust human clinical trials .
### Summary: : the role of metals in the pathophysiology of alzheimer 's disease ( ad ) has gained considerable support in recent years , with both in vitro and in vivo data demonstrating that a mis - metabolism of metal ions , such as copper and zinc , may affect various cellular cascades that ultimately leads to the development and/or potentiation of ad . in this paper , we will provide an overview of the preclinical and clinical literature that specifically relates to attempts to affect the ad cascade by the modulation of brain copper levels . we will also detail our own novel animal data , where we treated app / ps1 ( 7 - 8 months old ) mice with either high copper ( 20 ppm in the drinking water ) , high cholesterol ( 2% supplement in the food ) or a combination of both and then assessed -amyloid ( a ) burden ( soluble and insoluble a ) , app levels and behavioural performance in the morris water maze . these data support an interaction between copper / cholesterol and both a and app and further highlight the potential role of metal ion dyshomeostasis in ad .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : acute pancreatitis is a common condition with various possible etiologies , gall stones and alcohol being the most common . metabolic , structural , and iatrogenic causes account for 20 25% of the cases . hyperlipidemia in the form of hypertriglyceridemia or chylomicronemia , although less frequent , is one of the well - accepted underlying causes of acute pancreatitis in 7% of the cases the most common after gall stones and alcohol . typically hypertriglyceridemia - induced pancreatitis occurs in a patient with a pre - existing lipid abnormality , along with the presence of a secondary precipitating factor ( e.g. , poorly controlled diabetes , alcohol or medication ) . the triglyceride levels of more than 1000 to 2000 mg / dl in patients with type i , iii , iv , and v hyperlipoproteinemia ( friedrickson 's classification ) is the identifiable risk factor . we report a lady presenting with recurrent pancreatitis , with features of hyperlipidemia , and review the literature for pathogenesis and management of hyperlipidemia . a 37-year - old female presented with a chief complaint of epigastric pain for three days . the pain was continuous , radiating to the back , and associated with two episodes of bilious vomiting . four years back she presented with similar complaints and was diagnosed as having acute pancreatitis with type 2 diabetes , hypertension , and combined dyslipidemia . treatment was started with insulin , telmisartan , atrorvastatin , fenofibrate , and a low - fat diet . in between , after stopping treatment on her own , she ended up with two episodes of acute pancreatitis . two of her elder brothers died at the age of 40 to 45 years , because of coronary artery disease and combined dyslipidemias . laboratory parameters of the patient during the previous three presentations with acute pancreatitis on examination , her pulse rate was 120 / minute , blood pressure 150 / 100 mm hg , respiratory rate 26 / minute , and temperature 101.4f . there was a markedly tender and rigid epigastrium , with diminished bowel sounds and hepatosplenomegaly . initial laboratory findings were a total leukocyte count of 16000 / cmm with 86% neutrophils , platelets 220000 / cmm , and c - reactive protein 17.2 gm / dl . serum electrolytes , calcium , liver , and renal function tests , and lactate dehydrogenase and coagulation tests were normal . other investigations were as follows , total cholesterol 741 mg / dl , low - density lipoprotein ( ldl ) cholesterol 249 mg / 74 mg / dl , very - low - density lipoprotein ( vldl ) cholesterol 416 mg / dl , and triglycerides 2080 mg / dl . fasting blood sugar ( fbs ) was 174 mg / dl and post - lunch blood sugar ( plbs ) was 286 mg / dl . ultrasonography of the abdomen showed a grade 1 fatty liver , hepetosplenomegaly with a bulky body , and the tail of the pancreas . enlarged and edematous pancreas with smooth , ill - defined margins , a non - visualized pancreatic duct , and peripancreatic fat stranding the patient was conservatively managed with intravenous fluids and narcotics for pain control . on the basis of high triglycerides , cholesterol , and vldl cholesterol , a diagnosis of type iib hyperlipoproteinemia ( familial combined hyperlipidemia / fchl ) treatment with fenofibrate 160 mg , atorvastatin 20 mg , and omega-3 fatty acids 2 g , twice daily , with antioxidants was started . ct abdomen showing enlarged and edematous pancreas with smooth , ill - defined margins , non - visualized pancreatic duct , and peripancreatic fat stranding the association between acute pancreatitis and hyperlipidemia is well known , both as a precipitant and as an epiphenomenon . hypertriglyceridemia can be primary in less than 5% of the cases , due to genetic causes and more often secondary to other causes like diabetes , obesity , pregnancy , excess carbohydrate intake , hypothyroidism , alcohol , hepatitis , sepsis , renal failure , and drugs like estrogen , glucocorticoids , blocker , bile acid binding resins , thiazide , tamoxifen cyclosporine protease inhibitors , and isotretinoin . in our patient , the presence of a family history of dyslipidemia , with laboratory values of high cholesterol , ldl cholesterol , vldl cholesterol , and triglycerides , led us to the diagnosis of type iib hyperlipoproteinemia . they are present in the circulation when triglycerides are > 10 mmol / l ( 900 mg / dl ) . these are large enough to occlude the pancreatic capillaries , leading to ischemia and subsequent acinar structural alteration , as also a release of pancreatic lipase . enhanced lipolysis leads to an increased concentration of free fatty acids , which results in the release of inflammatory mediators and free radicals culminating in inflammation , edema , and necrosis . our patient had a total of four episodes of pancreatitis ( each time triglycerides were > 900 mg / dl ) after stopping the hyolipidemic agent each time . therefore , abstinence from eating after pancreatitis may allow rapid metabolism of the triglyceride - rich chylomicrons . other non - pharmacological measures include weight reduction , reduced calories , fat , and refined carbohydrate intake . our patient was advised to restrict fat to 10 15% of total energy intake ( about 15 20 gm / day ) with reduction in saturated fats and unsaturated and trans fats . fibrates are the mainstay of therapy , they reduce plasma triglyceride levels by up to 50% and raise the high - density lipoprotein ( hdl ) cholesterol by 20% . they modulate peroxisome proliferator activated receptors- ( ppar- ) in the liver , with decreased hepatic secretion of vldl and increased lipolysis of the plasma triglyceride . statins reduce the cholesterol by inhibiting hydroxylmethylglutaryl coa reductase , thereby reducing coronary heart disease end points in type 2 diabetes . omega-3-fatty acids ( eicosapentanoic and docosahexanoic acid ) reduce plasma triglycerides by 20% when used in combination with other triglyceride - lowering therapies . antioxidant therapies ( selenium , carotene , vitamin c , -tocopherol ) have been used in the reduction of recurrent pancreatitis episodes that have remained markedly hypertriglyceridemic after medical therapy , by virtue of their protection from free radical - induced acinar damage . our patient had been prescribed a combination of fenofibrate , atorvastatin , omega-3 fatty acids , and antioxidants . novel modalities include the use of medium chain triglycerides ( they do not require chylomicron formation for absorption ) , plasmapheresis , insulin and heparin , and lipoprotein lipase gene therapy . hypertriglyceridemia is a common clinical problem , and if markedly elevated , can lead to pancreatitis . general and specific therapies are available to reduce triglycerides during the acute phases of pancreatitis . nutrition , pharmacological therapy , and avoiding aggravating factors are essential for preventing further attacks .
### Summary: : hypertriglyceridemia is a rare , but well - known cause of acute pancreatitis . a serum triglyceride level of more than 1000 to 2000 mg / dl is the identifiable risk factor . it typically presents as an episode of acute pancreatitis or recurrent acute pancreatitis . the clinical course and routine management of hypertriglyceridemia - induced pancreatitis is similar to other causes . a thorough family history is important , as is the identification of secondary causes of hypertriglyceridemia . the mainstay of therapy includes dietary restriction of fatty meal and fibric acid derivatives . we hereby report the case of a 37-year - old lady with a family history of dyslipidemia presenting with recurrent episodes of acute pancreatitis . we also review the literature for pathogenesis and management of hyperlipidemia .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the atomic depth has been found extremely useful in studying hydrogen / deuterium exchange rates ( 1 ) , the characterization of protein domain size and identification of potential targets for phosphorylation ( 2 ) , quantifications of driving force for a burial residue ( 3 ) , protein fold recognition ( 4 ) and predictions of small - molecule binding cavities in proteins ( 5,6 ) . as a closely related quantity , residue depth was used to study mutational impacts on protein stability ( 7 ) and the relationship of depth measure with protein sequences ( 8,9 ) . in the late 70 , macromolecular shape was described by a map of solvent exclusion , a method that could claim the first computation of atomic depths ( 10 ) . since then the first one used a pre - equilibrated solvent - bath in which the macromolecule of interest is immerged . water molecules that bump with macromolecular atoms are removed from the bath , and the depth is assigned as a value of the distance between any atom and the nearest water molecule on the surface ( 7 ) . several other methods require computations of asa to determine which atoms are buried beforehand ( 11 ) . the depth of a buried atom is then measured as the distance between the atom and its closest solvent - accessible atom ( 2 ) or the closest vertex of asa surface ( 8,9 ) . alternatively , one may attribute the depth index to each atom in the macromolecule by measuring the solvent - exposed volume of a virtual sphere with a varying radius located at the atomic centre ( 12 ) . in this work , we present an unsupervised program , adepth , which computes the atomic depth without requiring previous knowledge of asa or preparations of a solvent bath . another advantage of adepth relies in its integrity on identification of surface atoms and quantification of atomic depths in one run . validation of the program was performed on a well - designed molecular structure with known depth information ( figure 1 ) . applications of adepth includes definition of protein skins with a user - defined thickness , calculations of atom atom overlaps in macromolecular assemblies ( 14 ) and a graphical visualization of depth using iso - surfaces in vmd ( 13 ) . another useful application of adepth concerns the assessment of tip - convolution effects in atomic force microscopy ( afm ) imaging ( 15 ) . in the range of grid spacing 0.51 , adepth has been shown to be more accurate than available servers that were tested in the present study . figure 1.representation of the 3d structure of the standard molecule drawn by the vdw method in vmd ( 13 ) . the cartesian co - ordinates of atoms in the molecule can be expressed as ( rcossin , rsinsin , rcos ) , where r is the radius of sphere , 0 and 0 < 2 ; totally there are 25 sampling points along the coordinate and 50 for the coordinate . atomic depth is colour - coded as follows : cyan = 0 , green = 3 , orange = 6 , yellow = 9 and red = 12 . representation of the 3d structure of the standard molecule drawn by the vdw method in vmd ( 13 ) . each atom was scaled down to 20% of its original size . the cartesian co - ordinates of atoms in the molecule can be expressed as ( rcossin , rsinsin , rcos ) , where r is the radius of sphere , 0 and 0 < 2 ; totally there are 25 sampling points along the coordinate and 50 for the coordinate . atomic depth is colour - coded as follows : cyan = 0 , green = 3 , orange = 6 , yellow = 9 and red = 12 . in the earlier work ( 16 ) , the signed distance function ( sdf ) field of a protein allowed us to identify solvent accessible atoms and determine how deep a residue is inside the protein . in summary , we placed the protein in a rectangular grid of which width , length and height were determined by the size of the protein . the grid was uniformly discretized in three dimensions at user - defined grid spacing ( x , y and z ) . for each atom of the protein , the atomic van der waals ( vdw ) radius was given based on the atomic type defined in the charmm22 force field ( 17 ) , as shown in table 1 . by default , the radius of solvent or probe was set to 1.5 . for representing the solvent - accessible surface of the molecule , an extended radius , the sum of vdw and solvent radii , was assigned to each heavy atom . following level set methods ( 18 ) , we first computed the sdf values at interfacial grid points ( level 0 ) using information of where are limits of atomic and solvent force fields . for a grid point ( i j k ) at next level , the sdf value , d(i j k ) , was obtained by solving the quadratic equation ( 19 ) where table 1.vdw radii used for atoms in adepthatomic typeh ( polar)0.225h ( non - polar)1.320c2.175n1.850o1.800s2.200p2.150 vdw radii used for atoms in adepth the computations were performed level by level until no un - visited grid point was left . the atomic depth was then obtained as tri - linear interpolation of sdfs at the nearest grid points surrounding the atomic centre . the performance of adepth depends on parameters , such as grid spacing , probe radius and atomic vdw radii , used . the finer grid spacing the more accurate results , we found that grid spacing of 0.5 is a good compromise between computational cost and accuracy ( figure 2a and b ) . accounting for atomic size effects on atom depths , we scaled the sdf magnitude by the atomic extended radius . in the output of pdb format , the atomic depths and scaled ones are presented in b - factor and occupancy columns , respectively . in the web server , an option allows the user to obtain the output of dx format so that one can display 3d - field data in the iso - surface form using vmd ( 13 ) . moreover , the user can also request an extruded slice of a macromolecule with pre - defined thickness as the surface skin of the macromolecule ( 14 ) . the cpu time was plotted against the number of atoms ( natom ) of the standard molecule for r = 0.5 , 0.6 , 0.8 and 1.0 . the four sets of data values were fitted with linear regression , resulting in a slope of 0.2 , 0.1 , 0.07 and 0.05 msec / atom for r = 0.5 , 0.6 , 0.8 and 1.0 , respectively . ( b ) validation of adepth and depth on atomic depth calculations for the standard molecule using a probe radius of 1.5 . in the plot , the horizontal dashed lines represent the distances of spherical layers from the surface . data points with open symbols represent the values of averaged atomic depth versus r from adepth , whereas that with filled symbols located along the vertical axis are referred to the depth server . bars around the open symbols represent the standard deviation ; when it is < 1% , bars are not drawn . ( a ) relationship of computational cost and molecular size . the cpu time was plotted against the number of atoms ( natom ) of the standard molecule for r = 0.5 , 0.6 , 0.8 and 1.0 . the four sets of data values were fitted with linear regression , resulting in a slope of 0.2 , 0.1 , 0.07 and 0.05 msec / atom for r = 0.5 , 0.6 , 0.8 and 1.0 , respectively . ( b ) validation of adepth and depth on atomic depth calculations for the standard molecule using a probe radius of 1.5 . in the plot , data points with open symbols represent the values of averaged atomic depth versus r from adepth , whereas that with filled symbols located along the vertical axis are referred to the depth server . bars around the open symbols represent the standard deviation ; when it is < 1% , bars are not drawn . as there is no analytical solution to quantification of atomic depths for the 3d structure of a protein or a nucleic acid , a novel method is usually validated by comparing with other available methods . a qualitative comparison between various methods on different macromolecular architectures is presented in the supplementary figure s1 : a nucleic acid [ 1bna ( 20 ) ] , a fibrous protein collagen [ 1cgd ( 21 ) ] , a large human coagulation factor viii [ 3cdz ( 22 ) ] and the 30s ribosome subunit [ 2wdk ( 23 ) ] . a pseudo - molecule was created as a standard structure that consists of one - atom ( c ) residues , namely , unk ( unk means of unknown type ; atomic co - ordinates of the gold - standard molecule in the pdb format are available in the web server ) . the 3d structure of the standard molecule is formed of four equally spaced ( 3 ) concentric spheres as shown in figure 1 . for the present purpose , how dense the residues packed is not the matter , but how much the space filled up is concerned . totally , there are 1201 residues ( or atoms ) in each spherical layer , and the outermost sphere has a radius of 12 . as described in implementation section , probe radius and atomic radii are factors greatly influencing the results of atomic depth . we have performed calculations on the standard molecule with several values of grid spacing r ( 0.52.0 ) such that r = x = y = z , as well as with different probe radii , 1.41.6 . among available web servers , only depth server ( 6 ) could take in the standard molecule and go through the entire calculation process , whereas others such as the dpx servers ( 24 ) aborted the run because of failure of the associated surface program , whereas the sadic ( 25 ) and pocketdepth servers ( 5 ) did not return any results . it should be noted that the inter - sphere distance is measured according to positions of atomic centres , whereas the depth of an atom depends on the distance between the atomic centre and the probe centre . consequently , to make a direct comparison of depth computations and inter - sphere distances for the standard molecule , one has to subtract the extended radius of an atom from the depth value of that atom . to be explicit , the atomic depth was reduced by 2.175 plus 1.5 from adepth and by 1.53 plus 1.5 from the depth server ( the value of 1.53 was obtained from the carbon - atom type amber force field , the same force field used to equilibrate the solvent - bath in the depth server ) . the results of adepth and depth are plotted in figure 2b where the data of depth were calculated using default parameters in the website . adepth results for the probe radius of 1.4 and 1.6 are not shown , as their values are close to that of 1.5 . each data point in the plot represents an averaged depth over all atoms in a spherical layer . despite deviations from true depths become evident at large grid spacing , the order of depth ranking from the adepth results remains unchanged ( figure 2b ) . the computational accuracy of atomic depth is defined as a ratio of measured depth to the true depth . the measured depth was obtained as data values of averaged depth shown in figure 2b . the dependence of computational accuracy on grid spacing is presented in table 2 . comparing the depth accuracy , we found that globally adepth is more accurate than the depth server at small to medium grid spacing ( 1 ) . nevertheless , for the deepest layer , adepth can obtain better results that depth at fine grid spacing , i.e. 0.1 , which demands high cpu cost and huge memory load . table 2.comparison of computational accuracy between depth and adepthlayertrue depthdepth ( % ) r = 0.5 ( % ) r = 1.0 ( % ) r = 2.0 ( % ) 1317.32.61.18.5267.41.51.06.8395.10.22.49.14120.32.26.713.9the innermost sphere of the standard molecule is labelled 4 ( red in figure 1 ) , and the layer enumeration is decreased by 1 for next outwards sphere ; computations with different grid spacing were performed only by adepth ; true depth and r are in the unit of . comparison of computational accuracy between depth and adepth the innermost sphere of the standard molecule is labelled 4 ( red in figure 1 ) , and the layer enumeration is decreased by 1 for next outwards sphere ; computations with different grid spacing were performed only by adepth ; true depth and r are in the unit of . the relationship between protein interior and atomic depth has been extensively discussed ( 2,7,25 ) . new implications of atomic depths calculated by the adepth server will be illustrated later in the text . once atomic depths for a macromolecule are calculated , a built - in option in the adepth server allows the user to obtain a molecular slice based on values of atomic depths . it is usually done through an exhaustive computation of inter - atomic distance for detecting atomic overlaps in a complex . in practice , this is not necessary because the desired information is to find bumping atoms at the interface ( 14 ) . guided by an extruded surface of a molecular complex , one may reduce the number of atoms in distance calculations by 410 times while maintaining an accurate contour for the complex molecule ( figure 3a ) . ( a ) cartoon representation of the extruded crystal structure of a fab domain of antibody protein using a probe radius of 1.5 , r = 1 , and depth selection threshold < 3.5 . of 3291 atoms , ( b ) iso - surface representation for an expanded surface of an antibody molecule . the crystal structure of the antibody is represented by 1igt ( 26 ) with vdw spheres and coloured atomic types : cyan for carbon , red for oxygen , blue for nitrogen and yellow for sulphur atoms . the atomic depths of 1igt and the associated sdf values at grid points were computed using a probe radius of 1.5 at r = 1 . the iso - surface in orange wireframe was located 50 away from the antibody surface . ( c ) clipped core structure of the serine protease domain of fviia ( 27 ) . the orange wireframe represents the iso - surface of the sdf value at a threshold of 7.5 using vmd . the main - chain conformation is displayed in a ribbon of red - to - white - to - blue spectrum , where red and blue are for buried and solvent - exposed regions , respectively . the mutated glycines with almost no solvent - accessible surface areas are represented by coloured cpk spheres . the residue depth was calculated as 10.0 for gly343 and 4.8 for gly391 ; thus , only gly343 is enclosed in the orange wireframe . ( a ) cartoon representation of the extruded crystal structure of a fab domain of antibody protein using a probe radius of 1.5 , r = 1 , and depth selection threshold < 3.5 . of 3291 atoms , ( b ) iso - surface representation for an expanded surface of an antibody molecule . the crystal structure of the antibody is represented by 1igt ( 26 ) with vdw spheres and coloured atomic types : cyan for carbon , red for oxygen , blue for nitrogen and yellow for sulphur atoms . the atomic depths of 1igt and the associated sdf values at grid points were computed using a probe radius of 1.5 at r = 1 . the iso - surface in orange wireframe was located 50 away from the antibody surface . ( c ) clipped core structure of the serine protease domain of fviia ( 27 ) . the orange wireframe represents the iso - surface of the sdf value at a threshold of 7.5 using vmd . the main - chain conformation is displayed in a ribbon of red - to - white - to - blue spectrum , where red and blue are for buried and solvent - exposed regions , respectively . the mutated glycines with almost no solvent - accessible surface areas are represented by coloured cpk spheres . the residue depth was calculated as 10.0 for gly343 and 4.8 for gly391 ; thus , only gly343 is enclosed in the orange wireframe . another novel feature of adepth allows the user to visualize 3d iso - surface mapping of atomic depths . as an sdf value carries either sign , it is now possible to accurately display an expanded volume of a given macromolecule . this is convenient for examining nearby surfaces of a macromolecule while still tracking the distance from the surface atoms . analogous results could be obtained by traditional computations of asa ; yet , it is not plausible for most surface programs because of the need of a huge probe for generating such a remote surface at 50 away as shown in figure 3b . as known , the tip effects lead to dilations of object boundary in afm images ( 15,28 ) . with a large radius of tip apex when an expanded surface of a macromolecule can be displayed , it is easier to grasp an idea of what to expect from afm imaging on a single molecule ( figure 3b ) . as tip convolution effect mostly occurred as a 2d artefact in an afm image , one may scrutinize the strict 3d representation provided by adepth in certain direction for viewing expected convoluted surfaces for the macromolecule . the final feature of adepth is the use of 3d iso - potential surface for constructing a graphic representation of protein cores . atomic depth is particularly well adapted to the identification of protein core residues as illustrated in the prococoa method ( 25 ) . as previously suggested , the residue depth is an important parameter for interpreting mutational data in proteins ( 7 ) and correlates well with residue hydrophobicity ( 2,3 ) . for instance , graphical representation of atomic depth was helpful in illustrating the puzzling clinical data regarding the impact of a single - nucleotide polymorphism on activities of activated coagulation factor vii ( fviia ) . two apparently similar missense mutations were found in unrelated patients having a gene defect in fvii : gly343ser and gly391ser ; however , the phenotype of gly343ser was severe , whereas that of gly391ser was minor ( 29 ) . using the iso - surface representation of the ternary complex model ( 27 ) , it can be observed that although both gly343 and gly391 are completely buried ( figure 3c ) , gly343 is located deeper in the hydrophobic core than gly391 . thus , the apparent paradox could be interpreted in term of depth rather than solvent - burial . although this observation remains phenomenological , it conveys the already known idea that a deep mutation as a greater impact on protein structure than a solvent - exposed mutation ( 7 ) . commissariat lenergie atomique et aux energies alternatives ; french anr agency [ anr-07-pcvi-0002 - 01 to j .- l.p . ] .
### Summary: : we applied the signed distance function ( sdf ) for representing the depths of atoms in a macromolecule . the calculations of sdf values were performed on grid points in a rectangular box that accommodates the macromolecule . the depth for an atom inside the molecule was then obtained as a result of tri - linear interpolation of sdf values at the nearest grid points surrounding the atom . for testing the performance of present program adepth , we have constructed an artificial molecule whose atomic depths are known as the gold standard for accuracy assessments . on average , our results showed that adepth reached an accuracy of 1.6% at 0.5 of grid spacing , whereas the current reference server depth reached 7.5% . the adepth program provides both depth and height representations ; it is capable of computing iso - surfaces for atomic depths and presenting graphical view of macromolecular shape at some distance away from the surface . web interface is available at http://biodev.cea.fr/adepth .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : molecular oxygen is found only in those biotopes that harbor organisms carrying out oxygenic photosynthesis . in oxygen - deficient systems , the nature of the redox couple and concentrations of electron acceptor / donor determine the succession of dissimilatory metabolisms due to thermodynamic conditions . for a given substrate and under standard conditions , the aerobic dissimilatory metabolisms provide about one order of magnitude more energy than the anaerobic ones , for example , glucose respiration ( g = 2877 kj / mol ) versus glucose fermentation ( g = 197 kj / mol ) . therefore , in sedimentary environments oxygen is exhausted at deeper layers and the dissimilatory metabolisms are anaerobic as a result . anaerobic microorganisms are of interest in extreme environments because environmental parameters such as temperature and salinity regulate the rates of organic matter remineralization . interestingly , the low activity of water and the expense on biosynthesis only select heterotrophs and strict aerobes as extreme halophiles . however , some moderate halophilic and strict anaerobes have been described ; one example is the methanogen methanohalobium evestigatum , which uses methylated compounds ( e.g. , methylamine and methanol ) to generate methane . methylated substrates yield more energy ( g = 78.7 to 191.1 kj per mol substrate ) than h2/co2 ( g = 34 kj / mol substrate ) or acetate ( g = 31 kj mol substrate ) and allow that methylotrophic methanogens such as m. evestigatum can tolerate up to 29.2% nacl . differences in bioenergetic yield determine an exclusion of hydrogenotrophic methanogens such as methanocalculus halotolerans , which tolerates a lesser salinity : up to 12% nacl . a similar pattern has been described for sulfate - reducing prokaryotes : acetoclastic sulfate reducers ( g = 47.6 kj mol substrate ) , most of them belonging to desulfobacteraceae , cease to tolerate high osmolarity conditions , for example , desulfobacter halotolerans grows up to 13% nacl ; on the other hand , desulfohalobiaceae members have higher salt tolerances ( up to 25% nacl ) and grow with h2/co2 ( g = 152.2 kj mol ) or lactate ( g = 160 kj / mol ) . to define whether extremes of salinity are relevant in composition and persistence of anaerobic ecotypes , the ephemeral systems and spatial gradients constitute appropriate sites of study . even though there are some studies about microbial communities present along salt gradients , those approaches have been performed on thalassic microbial mats ; therefore , they are depleted in sulfate at deep layers , but most of them are also formed only on intertidal zones . sulfate is the second most abundant electron acceptor on earth and consequently the dominant electron acceptor for anaerobic metabolism in marine sediments . one interesting ephemeral and sulfate - rich system is tirez lagoon , or sabkha , because it is subjected to flooding / desiccation regimes , located in la mancha , an arid region in spain . tirez lagoon is athalassic since the ionic composition is far from seawater and it is characterized by a low cl : so4 ratio ( about 1.18 in flooded season and 0.35 in the dry season ) , whilst in the dead sea this ratio is above 10 . this system is maintained at a neutral ph due to a high mg and ca concentration in combination with a low co3 content at the saltern and sediment environments . the traces of co3 are removed as dolomite ( camg(co3)2 ) preventing alkalinization . given this scenario , the primary objective of this study was to characterize the composition of the anaerobic populations in the ephemeral and sulfate rich tirez lagoon . the identification of environmental sulfate reducing prokaryotes ( srp ) and sulfur oxidizing prokaryotes ( sop ) can be performed by enrichment culturing and molecular ecology fingerprinting ; however , a characterization of methanogenic archaea ( ma ) through isolation techniques is problematic given their slow growth rates . the use of molecular ecology fingerprinting techniques such as denaturing gradient gel electrophoresis ( dgge ) from pcr - amplified genes is informative to assess the temporal and spatial qualitative diversity in natural samples , and it also requires fewer sequencing resources in comparison to clone libraries and/or metagenomic analysis . instead of the 16s rrna gene , the use of dgge from pcr - amplified functional gene markers is profitable to elucidate the composition of the anaerobic pathways of sulfate respiration ( sr ) , sulfur oxidation ( so ) , and methanogenesis ( mt ) . the 16s rrna gene - based analysis can not provide an unambiguous link between gene sequences and its physiological or metabolic role . whereas the srp and sop organisms are phylogenetically and physiologically disperse along the bacteria and archaea domains , ma organisms are monophyletic restricted to archaea . in the dissimilatory pathways of sulfate reduction and sulfur oxidation , dissimilatory sulfite reductase ( dsr ) and adenosine-5-phosphosulfate ( aps ) reductase ( apr ) are considered as key enzymes . in the sulfate - reducing pathway , sulfate has to be activated to aps by atp - sulfurylase ( ec : 2.7.7.4 ) at the expense of atp ; apr ( ec : 1.8.99.2 ) converts the aps to sulfite and amp ; hereafter , sulfite is reduced to sulfide by dsr ( ec : 1.8.7.1 ) . for the sulfur - oxidizing pathway the alpha subunits of apr and dsr enzymes are found in all known srp and most of sop . regarding the methanogenesis pathway , the methyl coenzyme - m reductase ( mcr ) ( ec : 2.8.4.1 ) catalyses the reduction of a methyl group bound to coenzyme - m , with the concomitant release of methane . mcra gene fragment provides more information than the 16s rrna gene ; even if the saturation rates are similar between the mcra gene fragment and the complete 16s rrna gene , the number of differences per site in the mcra fragment is 2 - 3 times higher than that in the full - length 16s rrs . therefore , assignment of genera with mcra sequences offers more conclusive resolution than assignment with 16s rrna gene sequences . the mutation rates and selective pressures of the apra and mcra metabolic gene markers and of the structural 16s rrna gene are different ; however , phylogenetic studies done with partial sequences of apra and mcra belonging to the srp , sop , and ma lineages have established an agreement with the phylogenetic relationships based on 16s rrna gene sequences [ 13 , 18 ] . therefore , these functional gene markers can provide an estimate of the sr , so , and mt microbial diversity harbored in sediments of tirez lagoon . indeed , databases have been enriched in sequences of model strains for these two enzymes ; as a consequence , the apra and mcra gene markers also provide us information to identify srp , sop , and ma selectively in complex microbial communities , for example , . the second aim of this study was to investigate whether the composition and distribution of the encoded amino acids in apra and mcra genes are indicative of haloadaptation to the hypersaline sediment . diverse lines of evidence report that halophilic microorganisms can bias their amino acid composition to deal with the multimolar salinities of their environment [ 21 , 22 ] . halophiles , where turgidity is maintained by the intracellular accumulation of k that is usually equilibrated with the presence of extracellular cl . therefore , an increase of the acidic nature of cytoplasmic proteins , which is offset by an overall decrease in basic amino acids , is needed to maintain an appropriate folding and functionality under osmotic stress [ 22 , 24 ] . in cytoplasmic proteins , it has been also pointed out a slight decrease in hydrophobicity as another amino acid haloadaptation [ 25 , 26 ] . halophiles build up concentrations of osmolytes ( also named osmoprotectants or compatible solutes ) to increase the intracellular osmolarity ; thereby maintaining the protein native states in spite of a highest energetic cost to manufacture the organic molecules . accordingly , only proteins in salt - out organisms exposed directly to the hypersaline medium exhibit an excess of acidic amino acids . all eukaryotes , most halophilic bacteria , and the halophilic methanogenic archaea ( such as methanohalobium evestigatum ) have evolved the the widely disparate taxonomic position of salt - in prokaryotes ( halobacteriales in archaea , salinibacter ruber , and halanaerobiales in bacteria ) suggests a convergent evolution of this osmoadaptation strategy . several studies have also reported that a high genomic cg content ( often upwards of 60% ) and a gc bias at the codon usage level are common adaptations to hypersaline environments , presumably to avoid uv - induced thymidine dimer formation and accumulation of mutations [ 21 , 23 ] . for example , the high gc composition ( 65.9% ) of halobacterium sp . nrc1 could reduce the chance of such lesions and its third position gc bias correlates with an overrepresentation of acidic residues ( i.e. , asp and glu ) . the unique exception to this general trend has been pointed out so far in another extreme halophile haloquadratum walsbyi shows a remarkably low genomic gc content ( 47.9% ) and a weak gc - bias at the codon usage level . given that other specific features of nucleotide selection may also be involved in the gc content of organisms , the gc - bias measurements are complementary to the amino acid composition but not decisive in order to infer the salt - in strategy . therefore , the findings of this study try to contribute to the knowledge of diversity and haloadaptation of the srp and mt thriving at rich sulfate sediment . additionally , tirez system is analog to the ocean of europa , satellite of jupiter , due to its sulfate abundance and neutral ph , and sulfates have been detected on mars indeed . thus , this knowledge will provide insight regarding the possible biological limits for life in other analogous places . sediment samples were collected from tirez lagoon , which has an area of < 1 km and it was originated after endorheic inflow under semiarid conditions . the lagoon is located in the southern subplateau of the iberian region of la mancha ( 39 32 42 n y 03 21 o ) . the salt content fluctuates from 6% ( w / v ) during winter to 35% ( w / v ) during spring . in summer , the system becomes an evaporite . temperature oscillation is about 40c and 7c , the mean annual thermal oscillation is 55c , and the annual mean rainfall is averaged at 400 mm . water drains through material from the triassic period ; dolomites and ca - sulfate marls are from the tertiary period . samples were collected in february and july 2005 and correspond to the winter and summer seasons , respectively . the winter and summer samplings were done by triplicate in three points at the lagoon ; all of them were located in the salt pan or lagoon basin because it is the region covered by salts in summer . the sample cores were obtained from sites separated from each other by several meters . in order to analyze seasonal changes in the lagoon , the summer samples were obtained from the holes - signals leaved by the winter ( flooded ) sampling . sediment cores were obtained with a ring kit core - sampler for soft soil to a depth of 40 cm . the sampled cores were cooled at 20c with jelly bags and kept until further processing . . eh and ph of the cores were measured with a probe connected to a potentiometer orion model 290a + thermo orion ( thermo fisher scientific ) . also , dissolved oxygen and temperature were measured with a sylant simplair f-15 oxymeter ( syland scientific gmbh ) . in order to determine the interstitial sulfide concentration , the sample cores from surface to 20 cm in depth were sonicated for 5 min ( labsonic b. braun sonicator ) . after centrifugation ( 14,000 rpm 10 min sorvall rc-5 ) , supernatants were mixed with zn acetate ( 2% ) and sulfide concentration was determined using the methylene blue method . the core samples used to analyze ion content ( cl , so4 , and nh4 ) and carbon : nitrogen ( c : n ) ratios were sampled from the surface to 20 cm in depth ; samples were dehydrated at 110c for 12 hrs for ionic chromatography and elemental analysis . ionic chromatography analysis was completed with 100 mg of pulverized samples diluted in 25 ml of filtered milliq water , whilst the elemental analysis was performed with dried and pulverized sediment . the sediments were assayed by chromatographic methods with an ic dionex dx-600 chromatograph and by spectrophotometric methods with a leco chns-932 elemental analyzer at the servicio interdepartamental de investigacin ( uam ) . srp organisms from winter samples were grown in a cysteine - reduced ( 4.12 mm ) medium for sulfate reducers , modified from raskin et al . , and contained glutamic acid ( 5.2 mm ) , glycine ( 0.2 mm ) , methanol ( 14 mm ) , methylamine ( 27 mm ) , peptone ( 250 mg / l ) , and yeast extract ( 250 mg / l ) . the salt content in sulfate - reducing media was 3.5% the tirez saltern . the inoculation was done with sedimentary slurry from samples collected in february 2005 ( winter season ) . cell culture growth was monitored through the count of the cell density with 4,6-diamino-2-phenylindole ( dapi ) , molecular probes ( invitrogen ) in a zeiss axiovert 200 m fluorescent microscope . the three cores with a weight of ~210 g were mixed with three volumes of pbs 1x at 4c to reduce microheterogeneities and to wash salts . integrity of bacterial cells after the treatment was confirmed by 4,6-diamino-2-phenylindole ( dapi ) 1 total genomic dna was extracted from supernatants of washed and centrifuged sediments ( 500 rpm for 1 min hettich mikro 22 r centrifuge to precipitate rocks ) . in order to collect cells from nonaxenic cultures , 100 ml of the samples were filtered onto 0.22 m of polycarbonate filters ( millipore ) . sediment and soil samples are characterized by the presence of inhibitors such as humic acids and exopolimeric substances , thus we used a specialized dna extraction kit ( fast dna spin kit for soil ) ( qbiogene , irving , calif , usa ) which has proved to retrieve a reliable dna extraction to obtain a broad and intense band patterns , in comparison with variants via phenol dna extraction , and it has been used for analyses of microbial diversity by dgge in sediments , for example , . total genomic dna was purified according to genomic dna purification jetquick kit ( genomed ) instructions . pcr reactions were performed in a mixture of 50 l containing : 2 l of template dna , 1 mm dntp 's , 0.5 m of each primer , 3 mm mgcl2 , 1x enzyme buffer , and 0.03 u/l amplitaq dna polymerase ( roche , molecular systems ) . the apra gene fragment of ~0.4 kb was amplified with the apsfw ( tggcagatmatgatymacggg with a gc clamp ) and apsrv ( gggccgtaaccgtccttgaa ) primer pairs . the following conditions were implemented : a first denaturing step at 94c for 3 min , the completion of 35 cycles of 30 s at 94c , an annealing at 60c for 55 s and at 72c for 1 min , and a final extension of 72c for 7 min . in the mcra gene fragment amplification , at first a 0.76 kb fragment was amplified with the primers me1 ( gcmatgcarathggwatgtc ) and me2 ( tcatkgcrtagttdggrtagt ) . the me - pcr reaction was carried out with an initial denaturing step at 94c ( 5 min ) , followed by 25 cycles of 1 min at 94c , an annealing at 57c for 1 min and at 72c for 2 min , and a final extension of 72c during 10 min . me - pcr product was used as template to amplify an internal 0.47 kb fragment ( figure s4 see in supplementary material available at doi : 10.1155/2011/753758 ) . nested pcr was performed with the primers mlf ( ggtggtgtmggattcacacartaygcwacagc ) and mlr ( ttcattgcrtagttwggrtagtt ) with a gc clamp applying the following conditions : a denaturing step of 5 min at 94c , 5 cycles at 95c for 40 s , 55c for 1 min , 72c for 90 s ( a ramp of 0.1c / s was included between the annealing to the extension steps ) , followed by 30 cycles of 95c for 40 s , 55c for 1 min , 72c for 90 s , and an extension of 72c for 7 min . the gc clamp was equivalent to 40 bp of gc at the 5 end in order to prevent a complete melting of the dna fragments . correct length pcr - dgge products were visualized on 0.5 g / ml ethidium - bromide - stained gels at 2% agarose . in order to generate a dgge pattern , an average of 5070 g of dna from pcr - dgge products were resolved using a d - code universal mutation detection system ( biorad laboratories ) in polyacrylamide gels with a horizontal denaturant gradient . all dgge patterns were achieved under standardized denaturant and electrophoretic conditions : constant temperature of 60c polyacrylamide composition ( acrylamide - n , n-methylene bisacrylamide , 37 : 1 ) containing 0100% of denaturants ( 7 m urea and 40% formamide deionized with mixed - bed resin ) , a running time of 4.5 hrs and a constant voltage of 200 v . high resolving band patterns from environmental and culture samples were obtained as follows ( denaturant composition is given in percentage ) : for apra gene fragments , 5080% from nonaxenic cultures , and 4070% from environmental samples . in mcra gene fragments from environmental samples , the performed gradients were done by duplicate at 4070% and 4060% to increase the resolution of distance among bands . the gels were incubated in ethidium bromide for 20 min and rinsed in distilled water for 30 min . all single bands were excised from the gel with scalpels and eluted in 10 l of milliq water to avoid desiccation ; hereafter , they were stored overnight at 4c . dna was extracted from polyacrylamide by electrophoresis in 2% agarose gels ( 40 ma ) . the agarose bands were filtered through glass fiber columns at 14,000 rpm for 2 min ( hettich mikro 22 r centrifuge ) . 510 l of the precipitate obtained were used as dna template for the band reamplification of mcra and apra genes under the same pcr conditions however , a minor fraction of the bands were reamplified . the mcra and apra gene pcr products were sequenced using primer pairs apsfw / apsrv and mlf / mlr in an abi 377 sequencer ( applied biosystems ) . nucleotide sequences were cleaned and assembled using dna baser software ( heracle software , germany , http://www.dnabaser.com/ ) . according to the review of fromin et al . , dgge reproducibility mainly relies on the dna extraction and/or pcr amplification steps ; therefore , the fingerprint analysis ( dgge ) was processed once . the reproducibility of dgge patterns has been tested previously by experimenting differences along the procedure , from sampling to pcr amplification conditions ; despite these modifications , the comparison of dgge patterns was consistent showing changes in band intensities only . thereby , the pattern of apra dgge gel from environmental samples was used to define a dendrogram . then , the bands were qualitatively scored as present / absent and no semiquantitative analyses were performed for band intensity ; the band clustering was performed with the maximum likelihood ( ml ) restriction analysis ( restml ) included in the phylip v.3.67 package . genbank accession numbersthe nucleotide sequence data reported here are available under the genbank accession numbers : eu722715eu722732 , hm466937hm466940 , hm466943hm466946 ( apra phylotypes ) , and eu091355eu091364 , hm466948 ( mcra phylotypes ) . the nucleotide sequence data reported here are available under the genbank accession numbers : eu722715eu722732 , hm466937hm466940 , hm466943hm466946 ( apra phylotypes ) , and eu091355eu091364 , hm466948 ( mcra phylotypes ) . the translations of the apra and mcra sequences into amino acids were defined using the translate tool with a standard code ( http://expasy.org/tools/dna.html/ ) . the best frames for all the apra and mcra fragments were firstly selected by the unstopped amino acid ( aa ) sequences and , secondly , by matching their best hits with those compiled in the nonredundant database of the genbank , which were detected through the blastp program ( e - value 10 ) . the final inferred aa sequences were compared against the swiss prot and genbank databases in order to obtain their homologous counterparts using the wu - blast program with a significant blastp e - value 10 . from a first approach , we also included apra and mcra sequences from reported environmental samples as seed sequences . a complete list of the sequences included in this study to reconstruct a phylogeny for the apra and mcra enzymes can be seen in supplementary material ( tables s1 and s2 , resp . ) . different filters were used , from the thousands of collected sequences , in order to choose the final candidates involved in the reconstruction of a phylogenetic hypothesis . in this sense , we firstly applied a redundant analysis at 90% identity using the cd - hit program . from the obtained sequences , a second analysis at 100% identity was done with the cd - hit program , which excludes redundant phylotypes ( subspecies and variants ) of the same species , warranting the diversity of sequences only by including strictly different species from the same or different genera . the apra phylotypes aps cw 1 ( eu722715 ) and aps cw 16 ( eu722724 ) showed 100% of identity , as well as the phylotypes aps cw 3 ( eu722716 ) and aps cw 10 ( eu722720 ) . only one sequence was taken as a representative of the identity cluster to reconstruct the phylogeny . in order to support a robust identification in the final phylogeny , we included species from the same genera for those cases in which the homologous counterparts are closely related to the phylotypes obtained in this work . when it was necessary , individual phylogenetic trees for the tirez phylotypes were done previously in order to improve their identification and to select the counterpart sequences for the final phylogeny . the aa sequences obtained from the previous approaches were then aligned using the clustalx program with default parameters . in order to identify an evolutionary signal from the sequence fragments obtained in this work and their homologous counterparts , we applied a manual and also an automatic approach to edit the alignment . first , we manually edited the alignment through the use of the bioedit program v.7.0.9 in order to include only the functional domains of the subunits of mcr and apr enzymes . the functional description of these domains is fully detailed in section 4 and in the supplementary material . the n - terminal domain of the -subunit of the apra ( apra_alpha_n ) harbors the fad cofactor - binding domain ( aa positions : 2261 and 394487 ) and the capping domains ( aa positions : 262393 ) . these functional domains have been characterized from archaeoglobus fulgidus in the reduced state ( fadred - aps , pdb i d : 1jnr ) and in the oxidized state ( fadox - aps , pdb i d : 2fja ) as well as in desulfovibrio gigas ( pdb i d : 3gyx ) . thus , a total of 100 aa sequences were included in the apra alignment , where 23 phylotypes are derived from this work . the apra alignment includes two of the nine ( the absent sites are asn - n , tyr - y , glu - e , val - v , gly - g , leu - l , and arg - r ) functional active sites of the apra_alpha_n domain : arg - r and trp - w , previously reported . see the apra alignment and catalytic sites in supplementary material ( figure s2 ) . on the other hand , the c - terminal domain of the -subunit of the mcra enzyme ( mcr_alpha_c ) harbors an all - alpha multihelical bundle domain ( pfam domain : pf02249 ) . this functional domain has been characterized in methanosarcina barkeri ( pdb i d : 1e6y , c - terminal domain : 328460 ) , methanothermobacter thermoautotrophicus ( pdb i d : 1mro , c - terminal domain : 315440 ) , and methanopyrus kandleri(pdb i d : 1e6v , c - terminal domain : 319444 ) . a total of 80 aa sequences , 11 of them derived from this work , were included in the mcra alignment . the mcra alignment includes five of the seven functional active sites of the mcr_alpha_c domain ( absent sites : asn - n and val - v ; present sites : phe - f , tyr - y , phe - f , tyr - y , and gly - g ) . see the mcra alignment and catalytic sites in the supplementary material ( figure s3 ) . finally , we readjusted a final alignment defining the informative sites and conserving the functional active sites of the enzymes previously described , through the use of the software gblocks v.0.91 . therefore , the final alignments were performed on a region of 137 aas for apra and 139 aas for mrca , from which 122 and 132 positions were involved in the phylogenetic analysis , respectively . in order to reconstruct a phylogenetic tree , a character - based approach for the apr_alpha_n and mcr_alpha_c phylogenetic reconstructions was developed using the protpars program in order to construct a maximum parsimony ( mp ) tree of sequences . pyrobaculum aerophilum and archaeoglobus fulgidus were used as outgroups in the apr_alpha_n phylogeny ; whereas methanopyrus kandleri was used as outgroup in the mcr_alpha_c phylogeny . a distance approach for the apr_alpha_n and mcr_alpha_c phylogenetic reconstructions was also developed using the seqboot program to generate 1000 bootstrapped datasets from the sequences , whereby the pseudoreplicates were used in the protdist program in order to generate a distance matrix through the jones - taylor - thornton ( jtt ) model of evolution . the evolutionary distances are in the units of the number of amino acid substitutions per site . the rate variation among sites was modeled with a gamma distribution estimated previously shape parameter = 0.9 for apra and = 0.8 for mcra . then , the distance matrix was used in the neighbor program to construct a neighbor - joining ( nj ) tree . the bootstrap consensus tree inferred from 100 replicates is taken to represent the evolutionary history of the taxa analyzed . branches corresponding to partitions reproduced in less than 60% bootstrap replicates were collapsed with the consensus program ( default parameters ) . the percentage of replicate trees ( > 50% ) in which the associated taxa clustered together in the bootstrap test ( 100 replicates ) is shown next to the branches . no major branching differences were detected between the mp and nj topologies obtained for both enzymes . we calculated the amino acid composition of all apra and mcra sequences used previously to construct the phylogenies . using the perl scripting language , a program was written to read each amino acid sequence ( fasta format ) and calculate the frequency for each amino acid . we also calculated two halophilia indicators from the amino acid composition of every sequence : the pab factor estimates the surplus of polar and acidic amino acid compared to polar and basic ones ( i.e. , pab = [ asx + glx ] [ arg + lys ] ) , and the ab ratio of the acidic amino acids glu and asp to the basic amino acids lys , his , and arg ( i.e. , ab = [ asp + glu ] : [ his + arg + lys ] ) . we divided the amino acid profiles from each marker into two different data sets in order to calculate an average and standard deviation of the samples . the first data set is based on salinity adaptation by dividing sequences in tirez , halophilic , and nonhalophilic species . the second data set is based on the species forming the major taxonomic groups in which the tirez phylotypes are phylogenetically allocated . for apra desulfovibrionales , desulfobacterales , peptococcales , and chromatiales ; whilst for mcra , methanomicrobiales and methanosarcinales . therefore , a spreadsheet was created using microsoft excel software for data tabulation and graph construction . we performed the corresponding nucleotide alignments for all apra and mcra sequences used previously to construct the phylogenies . in order to reduce the bias of the gc measurements by the use of sequences with different length and highly divergent regions ( i.e. , long indels ) , we manually edited and readjusted the final alignment . accordingly , highly and long divergent regions ( insertions and deletions ) were eliminated from the alignment . the final alignments only include the strict codon positions encoding for the functional domains of apra ( 375 nucleotide positions , 125 codons ) and mcra ( 399 nucleotide positions , 133 codons ) described on the phylogenetic analysis section . using the perl scripting language , a program was written to read each nucleotide sequence ( fasta format ) and calculate the total nucleotide percentages as well as at the three individual codon positions for each sequence . we divided the gc profiles from each gene marker into the same data sets used to analyze amino acid composition ( i.e. , salinity adaptation and taxonomic clades ) in order to calculate an average and standard deviation of the samples . a correction for the amino acid usage was applied by the calculation of the relative synonymous codon usage ( rscu ) values from the nucleotide datasets based on salinity adaptation : tirez , halophilic , and nonhalophilic species . the rscu for a particular codon ( i ) is given by : rscui = xi/ xi / n , where xi is the number of times the codon has been used for a given amino acid and n is the number of synonymous codons for that amino acid . rscu values are the number of times a particular codon is observed , relative to the number of times that the codon would be observed in the absence of any codon usage bias . in the absence of any codon usage bias , the rscu value would be 1.00 . a codon that is used less frequently than expected will have a value of less than 1.00 and vice versa for a codon that is used more frequently than expected . finally , a spreadsheet was created using microsoft excel software for data tabulation and graph construction . sulfide showed higher concentrations at the zone of 010 cm depth ( figure 1(a ) ) . the occurrence and distribution of sulfide along the depth profile can reflect a biogenic origin by the presence of sulfate - reducing bacteria ( srb ) in the hypersaline sediment . the concentration of h2s coincided with the presence of a black deposit of iron sulfide mainly in winter ( figure 2 ) . sulfate levels increased with depth , its concentration ranging at 0.2 m , and the highest values were detected at 1015 cm in depth ( 300 mm ) , just below the highest concentration zone of sulfide ( figure 1(a ) ) . the complete sediment profile was anoxic and in accordance with a negative redox potential ( figure 1(b ) ) . the redox potential and oxygen levels slightly increased in the deepest zones ( 1520 cm in depth ) . the redox conditions of most part of the sediment core were in the range of 300 and 200 mv , low enough to allow sr and mt activities . the lowest eh values were reached at 010 cm in depth and coincided with the increase in sulfide concentration ( figure 1(b ) ) . likewise , the highest nh4 concentration ( 46 m ) was observed at 1015 cm in depth ( figure 1(c ) ) . the cl : so4 proportion fluctuated between 0.1 and 0.3 , these ratios are lower than the values reported in the saltern and they reflect the athalassic nature of the system . sulfate concentration in tirez lagoon was lower than in the also athalassic chaka lake sediment ( 10 mm ) . even though chloride was undetermined in chaka lake sediment , its cl : so4 proportion is two times higher than the highest value registered at tirez lagoon . figure 1(d ) shows the ph course on sediment depth ; it is possible to observe the characteristic neutral ph of the system as well as a slight acidification , probably a consequence of biological volatile fatty acids ( vfa ) formation and sulfate reduction processes . the c : n ratio determined in the samples showed values characteristic of low photoautotrophic activity at the surface starting at > 6 at 05 cm depth ( figure 1(d ) ) . therefore , preferential nitrogen mineralizers should be found at the surface preceding carbon mineralizers at deeper zones . figure 1(e ) describes that divalent cations dominate over monovalents . finally , the ratio ( na + k)/(mg+ ca ) in tirez is between 1.8 and 0.09 , whilst in salt lake is > 9.0 . we applied a denaturing gradient gel electrophoresis ( dgge ) fingerprinting analysis through the use of two functional genes : adenosine-5-phosphosulfate reductase ( apr ) and the methyl coenzyme - m reductase ( mcr ) , in order to identify ecotypes from the sediments samples and nonaxenic cultures of tirez lagoon . apra dgge profiles are presented in figure 3 and mcra dgge profile in figure 4 . thus , we obtained sequences of diverse phylotypes from dgge profiles representing the bulk content of three sampling points of the lagoon salt pan . the bands were prefixed as aps and mcr ( from the gene marker ) and subfixed as cw ( from nonaxenic cultures obtained in winter ) and ew and es ( environmental sediment sampled in winter and summer , resp . ) . the apra dgge pattern from sediment profile ( figure 3(b ) ) revealed the presence of a more complex banding pattern in comparison with the profile from nonaxenic cultures ( figure 3(a ) ) . at 1525 cm depth , low yield or no pcr product given that a considerable number of environmental bands from the apra dgge profile could not be sequenced or specifically identified , probably due to the presence of residual pcr inhibitors such as humic acids coextracted with genomic dna that were not purified by the jetquick kit and that comigrate with dna in the polyacrylamide gel changes in population distribution were estimated through the use of p - analysis with maximum likelihood ( ml ) in phylip software in order to identify a significant clustering . the clustering pattern is shown in figure 3(c ) , and it was more in accordance with a disturbance due to seasonality instead of sediment depth . additionally , p value showed no significant differences between nodes w and s being p 0.05 as significant to reject the hypothesis that two population sets were derived from the same communities . from previous studies carried out in thalassic communities , where salt gradient is between 8 and 20% ( within the range of tirez ) , it has been reported that the rate of methanogenesis is below 0.1% of the total sulfate - reduction productivity . therefore , a lower abundance of ma was expected in tirez sedimentary community it is inferred from the lower cl : so4 ratio . in addition , the population size threshold for dgge detection is 1% . thereby , we had to perform a nested pcr from the mcra gene in order to improve the detection of the ma community in the sediment samples from tirez . we firstly obtained a 0.76 kb mcra fragment through the me primer pair . because such a length is inadequate to obtain a discernible dgge pattern and due to low yield in me amplicons , a small 0.47 kb mcra fragment nested in the me region was amplified through the ml primer pair ( supplementary material , figure s4 ) . in agreement with juottonen and collaborators , no differences in the diversity of ma organisms were expected from the use of me and ml pcr products . different dgge gradients for the ml - pcr products were tested in order to obtain the best pattern resolution . we detected two distinctive but adjacent bands in all dgge winter profiles ( e.g. , mcr - ew1 and mcr - ew2 ) obtained through several gradients ( figures 4(a ) and 4(c ) , 4070% and 4060% gradients , resp . ) . a pattern of bands in pairs is a result of the low dgge resolution , where two dna fragments differ in one or few bases due to the use of ambiguous primers . though me - ml primers are ambiguous ( see section 2 ) , the phylotypes were placed in different orders in methanogenic archaea . thereby , nucleotide sequences have similar electrophoretic mobilities but they represent different sequences and , thus , a double band was ruled out . we also obtained a dgge pattern from sediment sampled in flooded and dry seasons at different depths ( figure 4(c ) ) . it is interesting to note that the mcr - ew1 band ( marked in figures 4(a ) and 4(c ) ) appeared uniquely associated with flooded season at 05 cm in depth ( figure 4(c ) ) . phylogenetic reconstructions were done for the inferred amino acid ( aa ) sequences of apra and mcra gene markers and their homologous counterparts . we decided to analyze aa instead of nucleotides because the latter reduces the inherent variation seen in protein sequences , except for the third codon base . we defined two regions of unambiguously aligned aa , the first one located in the n - terminal domain ( 137 aas ) for the subunit of apra ( apra_alpha_n ) , and the second one located in the c - terminal domain ( 139 aas ) of the subunit of mcra ( mrca_alpha_c ) , both of them containing some of the catalytic sites involved in their metabolic role ( supplementary material , figures s2 and s3 , resp . ) . it is important to note that not only the phylogenetic topologies obtained for the apra_alpha_n and mcra_alpha_c sequences are robust , as can be seen by the significant bootstrap values in the main clustering branches , but also the internal groups are supported by the expected clustering of the mcra and apra crystals previously characterized for ( a ) the mcra in methanosarcina barkeri belonging to methanosarcinales , methanothermobacter thermoautotrophicus from methanobacteriales and methanopyrus kandleri in methanopyrales ; ( b ) the apra from archaeoglobus fulgidus in euryarchaeota , and desulfovibrio gigas in deltaproteobacteria . the phylogenetic analysis of the 25 apra tirez sequences is presented in figure 5 . this analysis included representative species from diverse srp and sop taxonomic groups such as euryarchaeota , crenarchaeota , firmicutes , , , and -proteobacteria ( supplementary material , table s1 ) . some of the environmental apra phylotypes were not resolved at genera level , and the result has been discussed for the next taxonomic rank . cultured and environmental srp populations were identified as follows : cultured phylotypes ( desulfohalobiaceae , peptococcaceae , and desulfobacteraceae ) and environmental phylotyeps ( desulfobacteraceae , and peptococcaceae ) . one cluster formed by three phylotypes ( aps - cw2 , -cw4 , and -cw5 ) was closely related to the halotolerant and alkaliphilic desulfonatronovibrio hydrogenovorans . interestingly , the summer sediment did not reveal the presence of species in the haloadapted desulfohalobiaceae . twelve phylotypes obtained from sediment ( summer and winter ) and enrichments were related to the acetoclastic and nonhalophilic species desulfonema magnum . two phylotypes ( aps - cw6 -es29 ) were identified as peptococcaceae . whilst the phylotype aps - cw6 was conclusively affiliated to desulfotomaculum solfataricum belonging to firmicutes , the phylotype aps - es29 was not resolved at genera level ; however , aps - es29 was allocated basal to the representative firmicutes taxa used in this study . actually , the affiliation of phylotype aps - es29 and other sop tirez phylotypes could become particularly uncertain given the well - known horizontal aps reductase ( apr ) gene transfer ( hgt ) events between the srps from firmicutes and -proteobacteria as well as between the sops from and -proteobacteria , respectively ( see figure 5 ) . both main apr - hgt events are identified in this work and are in accordance with previous phylogenetic studies . in four of the environmental sop phylotypes ( aps - ew7 , -ew8 , and -ew13 , aps - es28 ) , the assignment of the apra gene fragment could not be conclusive at species level ; thus , a detailed function in tirez 's system remains uncertain . the closest clade for three phylotypes was a group of noncultured microorganisms ( endosymbionts ) in hydrogenophilaceae in -proteobacteria . the phylotype from summer sediment ( aps - es28 ) remained unidentified at species level , and tree topology helped to designate it as -proteobacteria . the environmental phylotype aps - ew3 was conclusively affiliated to endosymbionts and close to thiotrichaceae and chromatiaceae in -proteobacteria . other three phylotypes were derived from enrichment ( aps - cw11 , -cw12 , and -cw13 ) and resulted with a short distance with the cultured haloalkaliphilic purple bacteria thioalkalivibrio ( ectothiorhodospiraceae ) in -proteobacteria . the phylogenetic reconstruction of the eleven mcra sequences obtained from the anoxic tirez sediments is shown in figure 6 . this analysis included representative ma species within methanomicrobiales , methanosarcinales , methanococcales , and methanobacteriales ( supplementary material , table s2 ) . the phylogenetic tree allowed the identification of mcra phylotypes belonging to the methanosarcinaceae and methanomicrobiaceae . in the same way , phylotype mcr - ew2 was closely related to methanolobus zinderi . finally , the phylotype mcr - ew1 closely clustered to the hydrogenotrophic and nonosmoadapted species methanoplanus petrolearius . salt - in halotolerant organisms have been related to adaptations to high intracellular concentration in order to favor an osmotic balance within an hypersaline environment [ 23 , 25 ] . given that the catalysis of apra and mcra enzymes occur in the cytoplasm , we were interested in determine whether tirez apra and mcra sequences show a bias when compared to their halophilic and nonhalophilic homologous counterparts . thus , we calculated the aa composition from the alignment used to reconstruct the phylogeny in order to estimate the hydrophobic ( gly , leu , val , ile , phe , met , ala , trp , and pro ) , polar ( ser , thr , cys , tyr , gln , and asn ) , basic ( his , arg , and lys ) and acidic ( glu and asp ) contents of the apra and mcra enzyme fragments analyzed in this study . additionally , we used the nucleotide alignment that covers the aa positions selected to reconstruct the phylogeny for each gene marker in order to estimate the general codon bias gc content and the relative synonymous codon usage ( rscu ) ( see section 2 ) . for this purpose , we divided the sequence profiles from each gene markers into two data sets the first one is based on salinity adaptation ( tirez , halophilic and nonhalophilic species ) and the second one is based on the major taxonomic groups in which the tirez phylotypes are phylogenetically allocated ( apra : desulfovibrionales , desulfobacterales , peptococcales , and chromatiales ; mcra : methanomicrobiales and methanosarcinales ) ( supplementary material , tables s1 and s2 , resp . ) . the degree of excess acidic amino acids and dearth of basic amino acids reflects the prevalence of the salt - in strategy and the amount of adaptation necessary to cope with the environmental stress . this can be quantified from two estimations : by calculating the surplus of polar and acidic amino acid compared to polar and basic ones ( i.e. , pab = [ asx + glx ] [ arg + lys ] ) and by the ratio of the acidic amino acids glu and asp to the basic amino acids lys , his , and arg ( i.e. , ab = [ asp + glu ] : [ his + arg + lys ] ) . on average , the amino acid composition measurements ( table 1 ) indicated that apra tirez phylotypes ( pab = 2.87 , ab = 0.62 ) were from similar to slightly higher in comparison with halophilic ( pab = 2.70 , ab = 0.59 ) and nonhalophilic sequences ( pab = 2.35 , ab = 0.62 ) . however , the observed differences in pab and ab indicators between tirez phylotypes and halophilic species are out of proportion to argue a salt - in signal in tirez phylotypes given that apra differences are more than ten times less the difference between escherichia coli and halobacterium salinarum or halomonas elongata and halobacterium salinarum . the total gc content of apra tirez phylotypes , halophiles , and nonhalophiles organisms is 57.60% , 55.70% , and 55.00% , respectively . the gc content of tirez phylotypes is higher than the reported for escherichia coli ( 50.3% ) but lower than the extreme halotolerant species from the dead sea metagenome ( 6267% ) and halobacterium salinarum ( 65.7% ) ( table 1 ) . a codon usage in apra tirez phylotypes is consistent with that expected , when corrected for gc composition ( figure 7 ) . in comparison to halophiles and nonhalophiles , apra tirez phylotypes show a significant overrepresentation of amino residues with a preferential use for a g or c in the third or first position : val ( guc ) , ser ( ucc ) , gln ( cag ) , lys ( aag ) , asn ( aac ) , asp ( gac ) , and glu ( gaa ) . even though arg ( cgg , agg ) , ala ( gcg ) , and cys ( ugc ) are underrepresented amino acids in apra tirez phylotypes as well as leu ( cug ) and gly ( ggc , ggg ) do not show compositional differences when compared with halophiles and nonhalophiles sequences ( supplementary material , figure s1b ) , all of them show a significant codon usage with gc bias ( rscu > 1.5 ) ( figure 7 ) . accordingly , the first , second , and third codon positions of apra tirez phylotypes have gc percentages of 54.2% , 42.4% , and 76.0% , respectively , and they agree with the gc content values previously reported in some salt - in halophiles ( table 1 ) , with high gc content and a third position gc bias [ 21 , 29 ] . similar trends on aa composition and gc content can be seen for the apra clades ( table s3 and figure s1 ) . a slighter segregation of the mcra tirez phylotypes from the nonhalophilic species is shown in table 1 . accordingly , the ab indicator for mcra phylotypes was slightly lower ( 1.50 ) in comparison with the average of halophilic ( 1.67 ) and nonhalophilic species ( 1.75 ) , whilst an opposite trend is shown with the pab indicator : 16.62 for tirez , 15.99 for halophiles , and 16.44 for nonhalophiles . in contrast to the apra tirez phylotypes , the total gc content ( 47.20% ) and the third codon gc bias ( 46.10% ) are significantly lower than the estimated for halophiles and nonhalophilic species ( table 1 ) . the gc content of the first ( 53.1% ) and second ( 42.4% ) codon positions does not change the trend of mcra tirez phylotypes ( supplementary material , figure s3c ) . nevertheless , an overrepresentation of amino residues in mcra tirez phylotypes with a preferential codon use ( in comparison to nonhalophiles sequences only ) can be pointed out for ile ( auu ) , pro ( cca ) , ala ( gca ) , tyr ( uau ) , and asn ( aac , aau ) . even though lys ( aaa ) , asp ( gau ) , ser ( ucc , ucu ) , and thr ( aca ) are underrepresented amino acids in mcra tirez phylotypes in comparison to halophiles and nonhalophiles sequences ( supplementary material , figure s1b ) , all of them show a preferential codon usage . furthermore , it is important to note that the aa composition and gc content trends for mcra clade profiles showed a differentiated tendency in contrast to the estimated average from all mcra tirez phylotypes ( supplementary material , table s3 ) . the first , second , and third codon position of methanomicrobiales present a high gc content values of 52.6% ( tirez 54.1% ) , 40.0% ( tirez 39.1% ) , and 73.1% ( tirez 77.4% ) , respectively . similarly , the polar and acidic content in methanomicrobiales ( pab = 17.12 and ab = 1.70 ) is interestingly higher than the bulk cell protein content reported for e. coli ( 15.85 ) and close to the haloadaptation threshold of h. elongata ( 17.56 ) . srp and ma are the frequent ecotypes responsible of major biogeochemical processes in sedimentary systems . a functional gene pcr - dgge approach was applied to identify these anaerobic ecotypes . regarding the sediment profile and community structure along time and depth , the bands identified in the apra dgge pattern from environmental samples are in agreement with the presence of black sediments below the evaporite layer observed in summer and winter seasons ( figure 2 ) . this mineral precipitation and the sulfide detected in the sediment ( figure 1(a ) ) are probably attributable to a dissimilatory sulfate reduction where ma were also detected ( figure 3(c ) ) . the use of a nested pcr implies additional amplification cycles , and , thus , it has been used to increase the visualization sensitivity of species present in low numbers by dgge . interestingly , our findings via this approach denote a predominance of the srp - sop ecotypes over ma , given that we performed the nested - pcr approach to obtain a positive pcr product of mcra gene fragment , whilst it was not necessary to apply it for the apra gene fragment . finally , a predominance of srp - sop ecotypes in tirez lake is in accordance with the high values of sulfate registered on the sediment . after the clustering analysis of sedimentary populations represented in the apra dgge pattern , the changes are better explained by a seasonal disturbance in accordance with the ephemeral lagoon . it is suggestible that population resilience is mainly regulated by changes in salinity because the main nodes indicate a partition into dry and flooded patterns ( figure 3(c ) ) ; note that salinity fluctuates from 6% ( w / v ) during winter to 35% ( w / v ) during spring . however , the strong temperature oscillation can be also associated with salinity over community composition . additionally , the p values ( > 0.05 ) indicate that the partition winter / summer is not significant enough to describe well - differentiated communities since flooded node and dry node are more clustered than expected by chance . interestingly , most of the sop , srp , and ma phylotypes obtained in this work were related to environmental sequences described from alkaliphilic or thalassic hypersaline systems [ 6 , 20 ] . were detected phylotypes ( aps - cw4 , -cw-5 , and -cw2 ) from desulfonatronovibrio hydrogenovorans , a lithoheterotrophic , halotolerant ( grows in a salinity range of 112% nacl ) , and alkaliphilic sulfate respirer . surprisingly , d. hydrogenovorans does not grow at ph of 7 and the highest ph of tirez is below 8.0 . desulfohalobiaceae species are commonly adapted to high osmolarity due to the anabolic metabolism of compatible solute synthesis and dependent on the use of lactate and hydrogen as electron donors . desulfohalobium retbaense is considered the neutrophilic and thalassic counterpart of d. hydrogenovorans , but it was not detected in tirez . gram - positive desulfotomaculum solfataricum ( aps - cw6 ) was detected in enrichments . another phylotype , aps - es29 , is also a member of peptococcaceae , but it could not be assigned to a specific genus . these phylotypes did not cluster with desulfotomaculum halophilum sequences , which tolerates up to 12% nacl . sulfate - reducing bacteria in peptococcaceae perform oxidation from a broad spectrum of electron donors such as lactate . compatible solutes in peptococcaceae have not been characterized ; however , the theoretical energy yield , for example , in medium supplied with lactate is g = 160 kj / mol , would give enough energy for the osmoprotectant synthesis or transport as , for example , desulfovibrio vulgaris ; d. vulgaris is trophically analog to desulfotomaculum species . d. vulgaris synthesizes sugars such as trehalose or accumulates amino acids such as glycine betaine and proline as compatible solutes as response to under salt stress . stress response in d. vulgaris is based on genes with homologous in diverse and distant species such as bacillus subtilis ; thus , the finding of peptococcaceae in tirez , under analog bioenergetic constraints , could be explained in the terms of the salt - out strategy ( see section 4 ) . the presence of methanohalobium evestigatum and methanolobus zinderi in the sulfate - rich and anoxic sediment is easily sustained by functional arguments , even in summer samples , because their metabolism requires methylated substrates ; thus , it is noncompetitive with srp . m. evestigatum and m. zinderi are theoretically productive in bioenergetic terms , enough to exhibit compatible solute synthesis . methanolobus zinderi was isolated from an estuary and grows at the higher rate and tolerates upper levels of divalent cations ( mg ) in comparison with monovalent na . this characteristic is remarkable because m. zinderi could be adequate to tirez given that divalent cation ca dominate over monovalents in the sediment ( figure 1(e ) ) . on the other hand , the increase of ammonium ( nh4 46 m ) at 1015 cm depth and the decrease of eh across the sediment profile ( figure 1 ) suggest the development of strict anaerobic and methylotrophic ma metabolisms . none of the genera detected in both seasons clustered with acetoclastic ma . the absence of acetoclastic ma in hypersaline systems has been widely accepted as a consequence of the low gibbs free energy dissipated from acetate as substrate . however , acetoclastic ma activity was reported in napoli mud volcano brines with 4.0 m chloride , where the cl : so4 ratio is 200 times higher than the observed in tirez . in tirez , the absence of acetoclastic ma is probably explained by substrate outcompetition , because the sulfate - reducing conditions prevail due to the high abundance of sulfate in tirez and to the putative adaptation of acetoclastic srp such as desulfonema magnum to the extreme sediment . some of the phylotypes from environmental and enrichment culturing were affiliated to endosymbionts ; its potential ecological role in the sediment is supported by the view that the sulfur cycle has been described in marine oligochaetes , where endosymbionts identified as proteobacterial microorganisms participate as sulfur oxidizers . therefore , it is plausible that the free - living and nonisolated relative populations in tirez sediment have an analogous metabolic role . three phylotypes from winter sediment and enrichments were affiliated to the chemoautotrophic genus thioalkalivibrio and sulfur oxidizing endosymbionts in /-proteobacteria clade ( figure 5 ) . these anaerobic ecotypes are expected to be found in the extremely saline sediment as much as the h2s is present ( figure 1(a ) ) ; in turn , h2s would be oxidized anaerobically by these purple bacteria given that low eh and partial o2 pressure were observed in the sampling site ( figure 1 ) . the discrepancy in the finding of thioalkalivibrio is due to its narrow range of optimal ph ( 9.510.0 ) , the fact that species in thioalkalivibrio are true alkaliphilic and are well adapted to athalassic soda lakes , that is , dominated by monovalent cations , and considering that other sulfur oxidizing and halophilic sop species such as thiomicrospira halophila or hallochromatium spp . unfortunately , the sop tirez phylotype from summer sediment was not identified at species level . it has been argued that hypersaline environments are inappropriate for the biological development of anaerobic acetate oxidation as a consequence of the low negative balance of the standard g yielded by this dissimilatory metabolism and due to the high maintenance energy needed for the synthesis / accumulation of compatible solute under high osmotic conditions . however , at high sulfate concentrations , desulfonema magnum populations were unequivocally detected in the evaportitic sediment and winter sediment samples ( environmental and derived from enrichment culturing ) at 015 cm depth under an extreme salinity stress of 35% salts . this acetate - oxidizing desulfobacteraceae has not been described in hypersaline systems and was the most abundant phylotype identified in tirez lagoon . d. magnum has an optimal salinity about 2.5% nacl and has been described in marine microbial mats . previous studies have shown that desulfobacteraceae are present in thalassic hypersaline basins and athalassic soda lakes . this is a notable finding for the understanding of carbon cycle in extreme hypersaline ecotypes because under extreme conditions there is a decline in organic matter remineralization ; thereby , organisms encoding the corresponding apra gene probably face the salinity changes . halophilic species from desulfobacterales have not been isolated ; desulfobacter halotolerans is member of desulfobacterales but has an optimum growth with only of 1 - 2% nacl . nevertheless , very little is known about the mechanisms involved in energy conservation that allow acetoclastic srp organisms to survive in extreme saline conditions . salt - in osmoadaptation has been suggested for desulfobacteraceae ecotypes identified in soda lakes to compensate saline stress . possibly , desulfonema , being an acetoclastic sr , exerts additional energy conserving mechanisms ( as in the case of ma and acetogenic bacteria ) consisting in extra transference of electrons from membrane complexes dependent on h or na pumping . such process is likely to occur in the acetoclastic desulfobacteraceae desulfobacterium autrotrophicum whose conservation mechanism of chemiosmotic energy is analogous to that in homoacetogenic bacteria . a mcra phylotype from the hydrogenotrophic methanoplanus petrolearius was detected in the surface dgge profile from winter sediment at 05 cm depth ( figure 4 ) , when salt content in the saltern is averaged at 6% w / v . this organism has a maximum tolerance at 5% and an optimal growth at 13% nacl . it is feasible that the m. petrolearius salt tolerance determines its absence in summer samples and is correlated with the low energy yielded by the methanogenic pathway based on h2 and formate as electron donors . mt activity based on these substrates has a low theoretical energy yielded ( g ) . methanoplanus clones , which have been reported in thalassic hypersaline sediments but at 2.2 m cl and sulfate below the detection limit . in order to adjust to lower water activities of the environment and the resulting decrease in cytoplasmic water , microorganisms must accumulate intracellular ions or organic solutes to reestablish the turgor pressure and preserve enzyme activity [ 27 , 88 ] . halophiles are adapted to hypersaline environments by a mechanism that involves at least equimolar extracellular and intracellular salt concentrations by a selective influx of potassium ions into the cytoplasm . strategy favors solubility and is energetically efficient , but unfolds proteins at high concentration . as a consequence , this halotolerant strategy requires that the entire intracellular machinery , that is , proteins , nucleic acids , s and their specific interactions with one another , must be adapted to high salt intracellular levels . the adaptations generally include an increase of the acidic nature of intracellular proteins and/or an increment of genomic cg content and a gc - bias at the codon usage level . nevertheless , paul et al . demonstrated common genomic and proteomic trends in halophiles that transcend the boundary of phylogenetic relationship and the genomic gc content of the species . accordingly , it has been suggested that distantly lineages adopted salt - in strategy independently by convergent evolution given its radical nature . all previous studies have estimated average trends of amino acid composition and gc content from selected sequences or enzymes in marine aerobic populations [ 21 , 57 ] or from completely sequenced genomes obtained from diverse aerobic environments [ 22 , 25 ] . even though salt - in strategy was recently proposed to explain the finding of the resilience desulfobacteraceae at hypersaline and alkaline lakes , this salt - adaptation strategy has been neither reported in species of the srp - sop nor in ma ; in part , given therefore , we consider it useful to use apra and mcra markers to test salt - in signals . an intuitive justification would be to expect a naturally biased selection for apra and mcra enzymes given their frequent or higher expression levels in the cytoplasm ( in comparison to other encoded genes at the genome ) in order to cope with their ecological and metabolic role on anaerobic and hypersaline sediments . our results can not be conclusive regarding the halotolerant strategies carried out by tirez phylotypes , until a large sequence data set can be achieved for these organisms . nevertheless , the amino acid composition , gc content , and preferential codon usage trends exhibited by the apra marker from tirez phylotypes suggest a plausible salt - in signal when compared to halophiles and non - haphiles . the increase in negatively charged ( asp and glu ) and polar ( ser , asn , and gln ) residues in apra tirez phylotypes can be explained by a codon usage with gc bias at the third position . the overrepresentation of these amino acid residues and their preferential codon usage are consistent with reports on salt - in adaptation [ 22 , 25 ] . similarly , a higher frequency of val in apra tirez phylotypes compared to nonhalophiles and halophiles supports the observation of madern et al . and paul et al . , but disagree with earlier propositions on underrepresentation of all strong hydrophobic residues in halophiles . we also report a slight decrement of the basic residue arg in apra tirez phylotypes . the role of arg in haloadaptation is quite controversial ; its increment in halophilic species can be expected by mutational bias given that five of the six codons have a bias towards gc nucleotides ; however , arg has been also reported in a consistent decrement in specific haloadapted species [ 29 , 57 ] . even though the slight increment of lys observed in apra tirez phylotypes contradicts all previous propositions on underrepresentation of the most important basic residues in all salt - in halophiles [ 22 , 25 ] , it has been recently suggested that dipeptides like val - lys significantly contribute to the halostability in proteins . as described on results , the mcr - ew1 tirez phylotype allocated in methanomicrobiales shows an interestingly phylogenetic tendency to use amino acids , not initially biased by gc content or codon usage , that could be involved in a weak - moderate for example , slight increments of the polar residues asn , ser , and tyr , the negatively charged residues asp and glu , and the hydrophobic residues ala , ile , and pro in mcra methanomicrobiales phylotypes are in agreement with salt - in signals previously reported . charged amino acids prevent charged ions from attaching to proteins and thus they have a significant role in stabilizing proteins against salty conditions and keeping water molecules around these proteins [ 25 , 50 ] . similar to apra tirez phylotypes , we observed a decrement of arg and an increment of lys ( supplementary material , table s3 ) . the remaining mcra tirez phylotypes do not exhibit a clear tendency about expected aa composition , gc content , and codon usage bias to carry out salt - in haloadaptation . these phylotypes could compensate high salt extracellular concentrations through mechanisms independent of amino acid composition and gc content and that do not compromise the enzymatic activity . the salt - out strategy requires the accumulation of specific small - molecular - weight compounds ( i.e. , compatible solutes or osmolytes ) into the cytoplasm . salt - out signal can be expected on the mcra tirez phylotypes close clustered at methanohalobium evestigatum and methanohalobium sp . species belonging to the methanosarcinales . it is also well know that m. evestigatum uses methylated compounds such as methylamine and methanol to generate methane . these methylated substrates not only provide more energy to m. evestigatum than the use of others substrates for anabolic reactions , including the synthesis of compatible solutes , but also allow a tolerance up to 29.2% of nacl . in salt - out strategy , little or no adjustment is required to intracellular macromolecules ; in fact , the compatible solutes often act as more general stress protectants as well as just osmoprotectants . furthermore , halophiles do not live at constant salt concentrations ; but in many natural settings they are exposed to changing salinities due to evaporation or rain , and thus also the intracellular conditions change considerably . accordingly , enzyme activity on salt - in halophilic strategy will depend not only on the nature and concentration of the salt , but also on extensive genetic alterations as a prerequisite for adaptation to a saline intracellular environment [ 24 , 27 ] . tajima 's neutrality test for the apra and mcra enzyme fragments ( used in this study ) shows that both gene markers are evolving under positive selection ( dapra = 3.13 and dapra = 2.96 ) ( supplementary material , table s4 ) . this means that key functional enzymes of anaerobic microorganisms on tirez lagoon could undergone extensive genetic alterations that , if they help the organism to cope and adapt with a saline intracellular environment , could be clearly differentiated and fast fixed on the populations . two clear examples of this flexible genetic alterations and selective fixation can be seen on apra sequences of same species but that were obtained from different strains : thermodesulforhabdus norvegica dsm 9990 ( ef442952.1 ) ; af418159.1 , and archaeoglobus fulgidus dsm 4304 ( pdb : 1jnr - a ) ; pdb : 2fja - a , , which show interesting amino acid changes from basic ( lys and k ) to polar ( gln , q and asn , n ) residues ( see figure 5 and supplementary figure s2 ) . in spite of the considerable diversity in nucleotide content and amino acid composition of the apra and mcra enzyme fragments involved in all analyses , it can be seen a crucial conservation of catalytic sites ( arg - r - trp - w in apra and phe - f - tyr - y - phe - f - gly - g in mcra ) as well as of cofactor and nucleotide binding sites in both gene markers ( figures s1 and s2 for apra and mcra aa alignments , resp . ) . as previously reported for mcra , the same conservative trend holds true for most of the surrounding residues of the apra and mcra catalytic sites . probably , the amino acid conservation and/or the structural localization of these catalytic regions on apra and mcra gene markers underestimate the general trend composition of salt - in adaptation from moderately to high halotolerant organisms in tirez lagoon . in fact , it is not possible to figure out at the moment if the diversity , weakness , or absence of amino acid , gc content , and codon usage patterns reported for tirez phylotypes in this study are a consequence of a minor and biased coverage of their not completely sequenced genomes or if these inconclusive trends are true salt - in signals or a consequence of the use of complementary salt - adaptation strategies in bioenergetically constrained species , given that tirez phylotypes have a clear anaerobic mode of life on highly saline and sulfate sediments . accordingly , we do not discard the presence of mixed types of osmoadaptation in apra and mcra tirez phylotypes , where k accumulates to high levels ( salt - in ) along with neutral and negatively charged organic solutes ( salt - out ) , as previously reported for many slightly and moderately halophilic methanogens . for example , methanohalophilus portucalensis grows in 2.0 m nacl and its intracellular concentration of k is 0.76 m , indicating that concentration of intracellular k need not be the same as that of extracellular na . presumably , m. portucalensis uses three zwitterions and other osmolytes to balance osmotic pressure [ 92 , 96 ] . likewise , k plays an important role in the response of methanococcus thermolithotrophicus to hyperosmotic ( increased nacl ) or hypoosmotic ( decreased nacl ) shock . at the beginning of higher nacl extracellular concentration , m. thermolithotrophicus internalizes k until reach a new steady - state intracellular concentration the k--glutamate pair functions as a temporary osmolyte whilst the nonmetabolizable zwitterion ( ne - acetyl - b - lysine ) is synthesized and accumulated by m. thermolithotrophicus exclusively in response to high salt concentrations [ 96 , 97 ] . the characterization of srp , sop , and ma diversity in tirez lagoon contributes to the knowledge of anaerobic diversity of microorganisms in athalassohaline systems and has inferences on the survival and adaptation of life under steep salt gradients . a characterization of the anaerobic diversity in tirez lagoon is a first step to explain functional issues such as why not all anaerobic dissimilatory pathways occur optimally in extreme biotopes and whether an anaerobic way of life faces higher energetic constraints in hypersaline systems in terms of salt composition . any quantitative interpretation can be inferred because pcr - dgge fingerprint is an inconclusive source of information and fluorescence in situ hybridization ( fish ) , parallel experiments designed specifically to quantify -proteobacteria and methanogen populations along the sediment profile ( winter and sediment ) , failed to yield any positive result ( data not shown ) . the structure and activity of hydrogenotrophic methanogenesis and acetoclastic sulfidogenesis under thalassic hypersaline systems have been extensively studied [ 98 , 99 ] . but , it should be kept in mind that tirez sediment is a sulfate - rich system with a peculiar salt composition , considering that in the evaporitic period minerals such as gypsum ( caso42h2o ) , epsomite ( mgso4 7h2o ) , and hexahydrite ( mgso46h2o ) are deposited and dominate over halite ( nacl ) , and most importantly , the sulfate has a relevant role in anaerobic systems as electron acceptor . thus , present results might be of importance for the understanding of acetate mineralization as a key process for carbon cycling in extreme environments . in tirez sulfate - rich sediment , among all the detected phylotypes , desulfonema magnum and methanoplanus petrolearius are the ecotypes of major interest due to energetic constraints ; therefore , these ecotypes constitute a probable signal of haloadaptation in anaerobic populations . although it was possible to characterize several anaerobic prokaryotes involved in distinctive metabolic lineages across the tirez sediment , dgge and phylogenetic analyses revealed a poor srp , sop , and ma phylotype composition ; probably underestimated in comparison with other extreme systems . nevertheless , extant conditions in tirez , as well as in other hypersaline environments , enable the persistence of low energetic anaerobic metabolic capabilities such as the halanaerobiales fermenting bacteria ( manuscript in prep . ) , which use a well - adapted fermentation of organic compounds to produce co2/h2 and volatile fatty acids ( vfa ) such as acetate by the use of the salt - in strategy . typically , the carbon cycle in halophilic communities implicates low rates of carbon mineralization to co2 which explains the accumulation of acetate at salt saturation levels . in addition to h2 and acetate , methylated compounds as fermentation products of compatible solutes can be mineralized by ma [ 78 , 103 ] . the perspective for the nitrogen cycle is different in tirez , its completion is predictable given that it shares the characteristics of other hypersaline systems , where methylotrophic ma contribute to nitrogen mineralization . about the sulfur cycle , the sulfate - reducing microorganisms were identified in the sulfate - rich sediment and represent probable suppliers of sulfide for sulfur - oxidizing populations . this understanding is useful to infer possible biological processes in analogous systems such as europa because the ocean present in the satellite is rich in sulfates and divalent cations and probably it is also in anoxic state [ 31 , 104 ] . phylogenetic studies have been traditionally determined by physiological characterization of marine species , and the records of anaerobic phylotypes in hypersaline systems are dominated by thalassic species . tirez lagoon has sabkha properties thus , it is a brine of interest to analyze strong spectra in salinity . also , tirez lagoon is characterized by a low chloride / sulfate ratio ; this is remarkable considering that sulfate serves as terminal electron acceptor in the marine systems ; however , few biological descriptions have been made when this anion is abundant under hypersaline conditions . using the pcr - dgge fingerprint technique for the functional adenosine-5-phosphosulfate ( apra ) and the methyl coenzyme m reductase ( mcra ) gene markers , we have confirmed the occurrence of hydrogenotrophic methanogenic and acetoclastic sulfate - reducing organisms in tirez sediment . despite the steep osmotic change along the year in the lagoon , changes in composition of pcr - dgge dendrogram reflected weak differences on winter - summer community structure . the persistence of desulfobacteraceae phylotypes in summer sediment as well as the finding of methanomicrobiales at the hypersaline and sulfate - rich sediment is remarkable ( hydrogenotrophic ma are outcompeted by srp in high concentrations of sulfate ) . probably , these ecotypes are energetically constrained and , unfortunately , our findings on amino acid and nucleotide compositions can not be currently conclusive regarding the halotolerant strategies carried out by tirez phylotypes until a large sequence data set can be achieved for these uncultured , anaerobic and bioenergetically constrained organisms . nevertheless , it looks like apra gene marker could be a useful salt - in indicator for different environmental ( e.g. , marine versus sedimentary ) samples , not only because its amino acid overrepresentation and codon usage bias well correlate with those found in halophiles but also because apra gene marker could exhibit a preferential use of amino acid ( e.g. , val and lys ) on sediments in contrast to those found in marine and aerobic environments . similarly , mcra gene marker shows an unexpected amino acid and nucleotide composition with nonclear salt - in signals exhibited . however , we speculate that the diverse and not conclusive salt - in signals in these ecotypes ( perhaps due to the absence of complete sequenced mcra genes ) could reflect that whereas protective osmolytes salt - out can be produced by ma tirez populations in response to salt stress , probably also a weak salt - in strategy may contribute to adaptation of osmotic stress on sedimentary ma tirez populations . an extended understanding for acetoclastic sulfate reducing activity under high osmolarity conditions is needed in order to elucidate mechanisms that are involved in the biological carbon mineralization . on the long term , the findings of this work will provide valuable information to determine habitable conditions of europa , the most interesting moon of jupiter for the astrobiology field , as an anoxic and hypersaline environment . l. montoya , i. lozada - chvez , i. marn and r. amils conceived the study . l. montoya , i. marn , r. amils and n. rodriguez were involved in the fieldwork . l. montoya and i. lozada - chvez performed the analysis and interpretation of data , and wrote the paper . all authors read , improved , and approved the final paper .
### Summary: : our goal was to examine the composition of methanogenic archaea ( ma ) and sulfate - reducing ( srp ) and sulfur - oxidizing ( sop ) prokaryotes in the extreme athalassohaline and particularly sulfate - rich sediment of tirez lagoon ( spain ) . thus , adenosine-5-phosphosulfate ( aps ) reductase ( apra ) and methyl coenzyme m reductase ( mcra ) gene markers were amplified given that both enzymes are specific for srp , sop , and ma , respectively . anaerobic populations sampled at different depths in flooded and dry seasons from the anoxic sediment were compared qualitatively via denaturing gradient gel electrophoresis ( dgge ) fingerprint analysis . phylogenetic analyses allowed the detection of srp belonging to desulfobacteraceae , desulfohalobiaceae , and peptococcaceae in -proteobacteria and firmicutes and sop belonging to chromatiales / thiotrichales clade and ectothiorhodospiraceae in -proteobacteria as well as ma belonging to methylotrophic species in methanosarcinaceae and one hydrogenotrophic species in methanomicrobiaceae . we also estimated amino acid composition , gc content , and preferential codon usage for the apra and mcra sequences from halophiles , nonhalophiles , and tirez phylotypes . even though our results can not be currently conclusive regarding the halotolerant strategies carried out by tirez phylotypes , we discuss the possibility of a plausible salt - in signal in srp and sop as well as of a speculative complementary haloadaptation between salt - in and salt - out strategies in ma .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : chronic pancreatitis ( cp ) is characterized by irreversible damage to the pancreas that may lead on to the development of abdominal pain as well as varying degrees of endocrine and exocrine insufficiency . however , pancreatic biopsy is usually not performed in routine clinical settings because obtaining a histological diagnosis of cp is risky and carries a high rate of potentially severe complications . the diagnosis of cp is thus based upon the demonstration of morphological and/or functional changes in the pancreas that occurs because of irreversible damage to the pancreatic parenchyma . the morphological changes in the pancreas can be appreciated by various imaging methods such as abdominal x - ray , transabdominal ultrasound ( ultrasonography ) , computed tomography ( ct ) , magnetic resonance imaging and endoscopic retrograde cholangio pancreatography . however , these imaging modalities can pick up advanced morphological changes only , and the diagnostic ability of these modalities to diagnose early and minimal cp is limited . the pancreatic function tests have been shown to improve the diagnostic sensitivity and specificity but because of associated technical challenges , patient discomfort and limited availability , these functional tests are infrequently performed . due to the ability to place the transducer in close proximity to the pancreas , endoscopic ultrasound ( eus ) is considered to be the most sensitive imaging modality for diagnosing pancreatic disorders . eus has been shown to demonstrate subtle alterations in the pancreatic parenchymal and ductal structure even before traditional imaging and functional testing demonstrate any abnormality . the eus diagnosis of cp is based upon the demonstration of ductal and parenchymal features , and a number of diagnostic criteria incorporating these eus features have been proposed to diagnose cp . improvement in eus equipment and availability of newer and sophisticated eus applications like color doppler , contrast eus and elastography , have further improved the diagnostic ability of eus . the eus features to diagnose cp [ figures 19 ] have evolved over a period from a pure qualitative approach to more advanced and complicated scoring systems incorporating multiple parenchymal and ductal eus features . increasing the number of these eus features required for diagnosis of cp increases the specificity and lowering the threshold number of criteria increases the sensitivity , but decreases the already poor specificity of eus . the rosemont criteria developed by leading experts has attempted to surmount the limitations of the current diagnostic criteria , define precisely each eus criterion and thus develop criteria that have good inter - observer agreement . the various eus features that have to be demonstrated for the diagnosis of cp are : examination of pancreatic body from stomach using radial echoendoscope . thus , this patient has one major a and 4 minor endoscopic ultrasound features and is consistent with chronic pancreatitis examination of pancreatic body from stomach using radial echoendoscope . thus , this patient has only 4 minor endoscopic ultrasound features and is indeterminate for chronic pancreatitis examination of pancreatic body from stomach using radial echoendoscope . thus , this patient has only 4 minor endoscopic ultrasound features and is indeterminate for chronic pancreatitis examination of pancreatic body from stomach using radial echoendoscope . thus , this patient has one major a and 2 minor endoscopic ultrasound features and is suggestive of chronic pancreatitis examination of pancreatic body from stomach using radial echoendoscope . the main pancreatic duct is dilated with an irregular contour and has echogenic structures suggestive of calculi . thus , this patient has two major a endoscopic ultrasound features and is consistent with chronic pancreatitis examination of pancreatic body from stomach using linear echoendoscope . thus , this patient has one major a and 2 minor endoscopic ultrasound features and is suggestive of chronic pancreatitis quantitative endoscopic ultrasound ( eus ) elastography and strain ratio measurement with radial echoendoscope at the body of pancreas : the eus shows echogenic foci with shadowing ( right side ) . a stable eus image for at least 5 s is obtained for eus quantitative analysis . the region of interest for the elastographic evaluation is manually selected to include the targeted area of the pancreas ( region a ) and soft ( red ) reference area corresponding to normal gastric wall ( region b ) . a strain ratio of 13.6 has been obtained quantitative endoscopic ultrasound ( eus ) elastography and strain ratio measurement with radial echoendoscope at the body of pancreas : the eus shows stranding with echogenic foci and lobularity ( right side ) . a stable eus image for at least 5 s is obtained for eus quantitative analysis . the region of interest for the elastographic evaluation is manually selected to include the targeted area of the pancreas ( region a ) and soft ( red ) reference area corresponding to normal gastric wall ( region b ) . a strain ratio of 147.7 has been obtained examination of pancreatic body from stomach using radial echoendoscope . thus , this patient has major a and b criteria along with 1 minor criteria and is consistent with chronic pancreatitis hyperechoic foci with shadowing ( major a ) : they have been defined as echogenic structures 2 mm in length and width that shadow . they histologically correlate with pancreatic parenchymal calcification.lobularity with honeycombing ( major b ) : well - circumscribed , 5 mm structures with rims that are hyperechoic relative to the echogenicity of its central areas are defined as lobules . at least three contiguous lobules that are present in the body or tail of the pancreas are labeled as honeycombing lobularity . the histological correlate of lobularity is not known.lobularity without honeycombing ( minor ) : lobules as defined above that are non - contiguous and present in body and tail.hyperechoic foci without shadowing ( minor ) : defined as above but without shadowing.cysts ( minor ) : anechoic , rounded / elliptic structures that should measure 2 mm in short axis.stranding ( minor ) : hyperechoic lines 3 mm in length seen in at least two different directions with respect to the imaged plane . hyperechoic foci with shadowing ( major a ) : they have been defined as echogenic structures 2 mm in length and width that shadow . lobularity with honeycombing ( major b ) : well - circumscribed , 5 mm structures with rims that are hyperechoic relative to the echogenicity of its central areas are defined as lobules . at least three contiguous lobules that are present in the body or tail of the pancreas are labeled as honeycombing lobularity . lobularity without honeycombing ( minor ) : lobules as defined above that are non - contiguous and present in body and tail . cysts ( minor ) : anechoic , rounded / elliptic structures that should measure 2 mm in short axis . stranding ( minor ) : hyperechoic lines 3 mm in length seen in at least two different directions with respect to the imaged plane . all other features should be looked in the body and tail of pancreas only main pancreatic duct ( mpd ) calculi ( major a ) : echogenic structures within mpd with acoustic shadowing located anywhere in the head , body and tail.irregular mpd contour ( minor ) : mpd that is uneven or irregular in outline and ectatic in its course . these features should be demonstrated in the body and tail of pancreas only.dilated side branches ( minor ) : presence of 3 tubular anechoic structures each measuring 1 mm in width and communicating with mpd . these should be demonstrated in the body and tail of pancreas only.main pancreatic duct dilatation ( minor ) : mpd diameter 3.5 mm in the pancreatic body or 1.5 mm in the pancreatic tail.hyper echoic duct margin ( minor ) : relatively hyperechoic duct wall found in > 50% of the entire mpd of the body and tail . main pancreatic duct ( mpd ) calculi ( major a ) : echogenic structures within mpd with acoustic shadowing located anywhere in the head , body and tail . irregular mpd contour ( minor ) : mpd that is uneven or irregular in outline and ectatic in its course . dilated side branches ( minor ) : presence of 3 tubular anechoic structures each measuring 1 mm in width and communicating with mpd . main pancreatic duct dilatation ( minor ) : mpd diameter 3.5 mm in the pancreatic body or 1.5 mm in the pancreatic tail . hyper echoic duct margin ( minor ) : relatively hyperechoic duct wall found in > 50% of the entire mpd of the body and tail . endoscopic ultrasound diagnosis of chronic pancreatitis based upon rosemont criteria consistent with cp : one major a feature with 3 minor features or 1 major a feature and major b feature or 2 major a features.suggestive of cp : one major a feature with <3 minor features or 1 major b feature with 3 minor features or 5 minor features.indeterminate for cp : 3 or 4 minor features with no major features or major b feature alone or with <3 minor features . consistent with cp : one major a feature with 3 minor features or 1 major a feature and major b feature or 2 major a features . suggestive of cp : one major a feature with <3 minor features or 1 major b feature with 3 minor features or 5 minor features . indeterminate for cp : 3 or 4 minor features with no major features or major b feature alone or with <3 minor features . a number of conditions such as aging , smoking , obesity , and chronic alcohol consumption may cause similar eus changes in the pancreas . although , rosemont criteria has refined the past criteria with more objectivity initial studies have failed to demonstrate any significant improvement in kappa scores . to decrease interobserver variability adjunctive imaging technologies like digital image analysis and elastography have been used for diagnosis of cp with encouraging results . however , further studies with larger sample size are needed to determine the exact diagnostic role of these ancillary eus techniques . hyperechoic foci with shadowing ( major a ) : they have been defined as echogenic structures 2 mm in length and width that shadow . they histologically correlate with pancreatic parenchymal calcification.lobularity with honeycombing ( major b ) : well - circumscribed , 5 mm structures with rims that are hyperechoic relative to the echogenicity of its central areas are defined as lobules . at least three contiguous lobules that are present in the body or tail of the pancreas are labeled as honeycombing lobularity . the histological correlate of lobularity is not known.lobularity without honeycombing ( minor ) : lobules as defined above that are non - contiguous and present in body and tail.hyperechoic foci without shadowing ( minor ) : defined as above but without shadowing.cysts ( minor ) : anechoic , rounded / elliptic structures that should measure 2 mm in short axis.stranding ( minor ) : hyperechoic lines 3 mm in length seen in at least two different directions with respect to the imaged plane . hyperechoic foci with shadowing ( major a ) : they have been defined as echogenic structures 2 mm in length and width that shadow . lobularity with honeycombing ( major b ) : well - circumscribed , 5 mm structures with rims that are hyperechoic relative to the echogenicity of its central areas are defined as lobules . at least three contiguous lobules that are present in the body or tail of the pancreas are labeled as honeycombing lobularity . lobularity without honeycombing ( minor ) : lobules as defined above that are non - contiguous and present in body and tail . cysts ( minor ) : anechoic , rounded / elliptic structures that should measure 2 mm in short axis . stranding ( minor ) : hyperechoic lines 3 mm in length seen in at least two different directions with respect to the imaged plane . all other features should be looked in the body and tail of pancreas only main pancreatic duct ( mpd ) calculi ( major a ) : echogenic structures within mpd with acoustic shadowing located anywhere in the head , body and tail.irregular mpd contour ( minor ) : mpd that is uneven or irregular in outline and ectatic in its course . these features should be demonstrated in the body and tail of pancreas only.dilated side branches ( minor ) : presence of 3 tubular anechoic structures each measuring 1 mm in width and communicating with mpd . these should be demonstrated in the body and tail of pancreas only.main pancreatic duct dilatation ( minor ) : mpd diameter 3.5 mm in the pancreatic body or 1.5 mm in the pancreatic tail.hyper echoic duct margin ( minor ) : relatively hyperechoic duct wall found in > 50% of the entire mpd of the body and tail . main pancreatic duct ( mpd ) calculi ( major a ) : echogenic structures within mpd with acoustic shadowing located anywhere in the head , body and tail . irregular mpd contour ( minor ) : mpd that is uneven or irregular in outline and ectatic in its course . dilated side branches ( minor ) : presence of 3 tubular anechoic structures each measuring 1 mm in width and communicating with mpd . main pancreatic duct dilatation ( minor ) : mpd diameter 3.5 mm in the pancreatic body or 1.5 mm in the pancreatic tail . hyper echoic duct margin ( minor ) : relatively hyperechoic duct wall found in > 50% of the entire mpd of the body and tail . endoscopic ultrasound diagnosis of chronic pancreatitis based upon rosemont criteria consistent with cp : one major a feature with 3 minor features or 1 major a feature and major b feature or 2 major a features.suggestive of cp : one major a feature with <3 minor features or 1 major b feature with 3 minor features or 5 minor features.indeterminate for cp : 3 or 4 minor features with no major features or major b feature alone or with <3 minor features . consistent with cp : one major a feature with 3 minor features or 1 major a feature and major b feature or 2 major a features . suggestive of cp : one major a feature with <3 minor features or 1 major b feature with 3 minor features or 5 minor features . indeterminate for cp : 3 or 4 minor features with no major features or major b feature alone or with <3 minor features . a number of conditions such as aging , smoking , obesity , and chronic alcohol consumption may cause similar eus changes in the pancreas . although , rosemont criteria has refined the past criteria with more objectivity initial studies have failed to demonstrate any significant improvement in kappa scores . to decrease interobserver variability adjunctive imaging technologies like digital image analysis and elastography have been used for diagnosis of cp with encouraging results . however , further studies with larger sample size are needed to determine the exact diagnostic role of these ancillary eus techniques . hyperechoic foci with shadowing ( major a ) : they have been defined as echogenic structures 2 mm in length and width that shadow . they histologically correlate with pancreatic parenchymal calcification.lobularity with honeycombing ( major b ) : well - circumscribed , 5 mm structures with rims that are hyperechoic relative to the echogenicity of its central areas are defined as lobules . at least three contiguous lobules that are present in the body or tail of the pancreas are labeled as honeycombing lobularity . the histological correlate of lobularity is not known.lobularity without honeycombing ( minor ) : lobules as defined above that are non - contiguous and present in body and tail.hyperechoic foci without shadowing ( minor ) : defined as above but without shadowing.cysts ( minor ) : anechoic , rounded / elliptic structures that should measure 2 mm in short axis.stranding ( minor ) : hyperechoic lines 3 mm in length seen in at least two different directions with respect to the imaged plane . hyperechoic foci with shadowing ( major a ) : they have been defined as echogenic structures 2 mm in length and width that shadow . lobularity with honeycombing ( major b ) : well - circumscribed , 5 mm structures with rims that are hyperechoic relative to the echogenicity of its central areas are defined as lobules . at least three contiguous lobules that are present in the body or tail of the pancreas are labeled as honeycombing lobularity . lobularity without honeycombing ( minor ) : lobules as defined above that are non - contiguous and present in body and tail . cysts ( minor ) : anechoic , rounded / elliptic structures that should measure 2 mm in short axis . stranding ( minor ) : hyperechoic lines 3 mm in length seen in at least two different directions with respect to the imaged plane . except for ductal calculi all other features should be looked in the body and tail of pancreas only main pancreatic duct ( mpd ) calculi ( major a ) : echogenic structures within mpd with acoustic shadowing located anywhere in the head , body and tail.irregular mpd contour ( minor ) : mpd that is uneven or irregular in outline and ectatic in its course . these features should be demonstrated in the body and tail of pancreas only.dilated side branches ( minor ) : presence of 3 tubular anechoic structures each measuring 1 mm in width and communicating with mpd . these should be demonstrated in the body and tail of pancreas only.main pancreatic duct dilatation ( minor ) : mpd diameter 3.5 mm in the pancreatic body or 1.5 mm in the pancreatic tail.hyper echoic duct margin ( minor ) : relatively hyperechoic duct wall found in > 50% of the entire mpd of the body and tail . main pancreatic duct ( mpd ) calculi ( major a ) : echogenic structures within mpd with acoustic shadowing located anywhere in the head , body and tail . irregular mpd contour ( minor ) : mpd that is uneven or irregular in outline and ectatic in its course . these features should be demonstrated in the body and tail of pancreas only . dilated side branches ( minor ) : presence of 3 tubular anechoic structures each measuring 1 mm in width and communicating with mpd . main pancreatic duct dilatation ( minor ) : mpd diameter 3.5 mm in the pancreatic body or 1.5 mm in the pancreatic tail . hyper echoic duct margin ( minor ) : relatively hyperechoic duct wall found in > 50% of the entire mpd of the body and tail . endoscopic ultrasound diagnosis of chronic pancreatitis based upon rosemont criteria consistent with cp : one major a feature with 3 minor features or 1 major a feature and major b feature or 2 major a features.suggestive of cp : one major a feature with <3 minor features or 1 major b feature with 3 minor features or 5 minor features.indeterminate for cp : 3 or 4 minor features with no major features or major b feature alone or with <3 minor features . consistent with cp : one major a feature with 3 minor features or 1 major a feature and major b feature or 2 major a features . suggestive of cp : one major a feature with <3 minor features or 1 major b feature with 3 minor features or 5 minor features . indeterminate for cp : 3 or 4 minor features with no major features or major a number of conditions such as aging , smoking , obesity , and chronic alcohol consumption may cause similar eus changes in the pancreas . although , rosemont criteria has refined the past criteria with more objectivity initial studies have failed to demonstrate any significant improvement in kappa scores . to decrease interobserver variability adjunctive imaging technologies like digital image analysis and elastography have been used for diagnosis of cp with encouraging results . however , further studies with larger sample size are needed to determine the exact diagnostic role of these ancillary eus techniques . the eus procedure for looking for changes of cp is similar to the standard eus examination of the pancreas . the complete eus examination of the pancreas is possible from gastric and duodenal stations with uncinate process being visualized from the second part of the duodenum . both radial and linear eus have been shown to be equally accurate for the diagnosis of cp . radial eus , however , provides cross sectional imaging similar to other cross sectional imaging modalities like ct and this makes the imaging of mpd easier as it is seen as a long linear structure in contrast to a dot like appearance on linear eus . in order to correctly identify the changes of cp , the endoscopist needs to know the normal appearances of the pancreas as well as the normal variations seen in a nonpathological pancreas . the important things to keep in mind are : the normal pancreas has a diffusely speckled salt and pepper pattern of the body and tail with a barely visualized single , smooth and anechoic mpd.with the current advanced eus imaging systems side branches of mpd can also be seen in normal individuals especially the elderly and only if side branches are 1 mm , they are considered to be abnormal.even in normal individuals the mpd can be mildly tortuous and therefore the mpd should be carefully evaluated for a gradual decrease in its diameter from the head to tail , which is an important feature of the normal duct.the duct of alternating sizes or beading is abnormal.the dorsal and ventral pancreas can have different echogenicity with the dorsal anlage of the pancreas being more echogenic than the ventral pancreas . the normal pancreas has a diffusely speckled salt and pepper pattern of the body and tail with a barely visualized single , smooth and anechoic mpd . with the current advanced eus imaging systems side branches of mpd can also be seen in normal individuals especially the elderly and only if side branches are 1 mm , they are considered to be abnormal . even in normal individuals the mpd can be mildly tortuous and therefore the mpd should be carefully evaluated for a gradual decrease in its diameter from the head to tail , which is an important feature of the normal duct . the dorsal and ventral pancreas can have different echogenicity with the dorsal anlage of the pancreas being more echogenic than the ventral pancreas . as mentioned above most of these eus features of cp are visualized in the body and tail and currently it is not clear how best to diagnose focal cp in the head as the isolated eus findings like lobularity in the head with normal body and tail of pancreas are generally reported as normal . endoscopic ultrasound elastography has also been shown to be an accurate tool for the diagnosis of cp and strain ratio obtained using quantitative eus elastography has been shown to vary significantly in various rosemont classification groups thus allowing quantification of pancreatic fibrosis . in quantitative elastography , the tissue stiffness is measured in the targeted area ( region of interest [ roi ] a ) and outside the targeted area in a region representing normal tissue ( roi b ) . thereafter , the strain ratio value is calculated as the quotient b / a , which seems to be better and more objective than visual color changes of qualitative elastography [ figures 7 and 8 ] . in a study on eus elastography in cp , region b selected was the normal surrounding gastroduodenal wall and strain ratio cut - off of 2.25 yielded an accuracy of 91.1% for diagnosis of cp . the results appear promising , but further studies with larger sample size are needed to confirm these interesting results . although eus can demonstrate subtle alterations in the pancreatic parenchymal and ductal structure , the exact role of eus in the diagnosis of cp is still not established.the eus features to diagnose cp have evolved over a period of time from a pure qualitative approach to more advanced and complicated scoring systems incorporating multiple parenchymal and ductal eus features.the rosemont criteria have attempted to define precisely each eus criterion and thus have good inter - observer agreement . but , initial studies have failed to demonstrate any significant improvement in the inter - observer variability.a number of conditions such as aging , smoking , obesity , and chronic alcohol consumption may cause eus changes similar to cp . therefore , eus findings should be interpreted in appropriate clinical context.most of the eus features of cp except ductal calculi and cysts should be located in the body and tail only.in order to correctly identify the changes of cp , the endoscopist needs to know the normal appearances of the pancreas as well as the normal variations seen in nonpathological pancreas.quantitative eus elastography appear promising technique for diagnosis of cp . although eus can demonstrate subtle alterations in the pancreatic parenchymal and ductal structure , the exact role of eus in the diagnosis of cp is still not established . the eus features to diagnose cp have evolved over a period of time from a pure qualitative approach to more advanced and complicated scoring systems incorporating multiple parenchymal and ductal eus features . the rosemont criteria have attempted to define precisely each eus criterion and thus have good inter - observer agreement . but , initial studies have failed to demonstrate any significant improvement in the inter - observer variability . a number of conditions such as aging , smoking , obesity , and chronic alcohol consumption may cause eus changes similar to cp . therefore most of the eus features of cp except ductal calculi and cysts should be located in the body and tail only . in order to correctly identify the changes of cp , the endoscopist needs to know the normal appearances of the pancreas as well as the normal variations seen in nonpathological pancreas .
### Summary: : as endoscopic ultrasound ( eus ) is the most sensitive imaging modality for diagnosing pancreatic disorders , it can demonstrate subtle alterations in the pancreatic parenchymal and ductal structure even before traditional imaging and functional testing demonstrate any abnormality . in spite of this fact and abundant literature , the exact role of eus in the diagnosis of chronic pancreatitis ( cp ) is still not established . the eus features to diagnose cp have evolved over a period from a pure qualitative approach to more advanced and complicated scoring systems incorporating multiple parenchymal and ductal eus features . the rosemont criteria have attempted to define precisely each eus criterion and thus have good inter - observer agreement . however , initial studies have failed to demonstrate any significant improvement in the inter - observer variability and further validation studies are needed to define the exact role of these criteria . the measurement of strain ratio using quantitative eus elastography and thus allowing quantification of pancreatic fibrosis seems to be a promising new technique .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : pc12 cells were transiently transfected using lipofectamine 2000 ( invitrogen ) ( 1:3 dna to lipofectamine ratio ) , with gfp - fused wt or mutated syns or with gfp - containing control vector ; the quantity of dna was chosen according to previously reported data , as the syn expression level was low and comparable to the average physiological levels of the protein in the brain . after sds - page , proteins were transferred onto polyvinylidene difluoride membranes and immunostained with the following antibodies : anti- tubulin mouse igg ( clone b-512 , sigma - aldrich ) ; anti - tyrosinated tubulin mouse igg ( clone tub-1a2 , sigma - aldrich ) . immunostaining was revealed by enhanced chemiluminescence super - signal west pico chemiluminescent , pierce ) . quantification was performed by image j software ( nih ) and subtracting the background around bands . transfected pc12 cells were fixed with cold methanol ( 6 min at 20c ) ; to remove unassembled tubulin , before fixation , some slides were extracted in pem buffer ( 80 mm k - pipes , 5 mm egta , 1 mm mgcl2 , ph 6.8 , containing protease inhibitors ) with 0.5% triton x-100 , 0.2 m nacl and 10 m paclitaxel ( sigma - aldrich ) . pc12 cells were stained with anti- tubulin mouse igg or anti - tyrosinated tubulin mouse igg and alexa fluor 568 donkey anti - mouse . by using image j software , total fluorescence intensity the region of interest was manually drowned and the analyses of the surface extension revealed that there were no significant differences between control cultures and wt - expressing pc12 cells ( data not shown ) . pc12 cells were transiently transfected using lipofectamine 2000 ( invitrogen ) ( 1:3 dna to lipofectamine ratio ) , with gfp - fused wt or mutated syns or with gfp - containing control vector ; the quantity of dna was chosen according to previously reported data , as the syn expression level was low and comparable to the average physiological levels of the protein in the brain . after sds - page , proteins were transferred onto polyvinylidene difluoride membranes and immunostained with the following antibodies : anti- tubulin mouse igg ( clone b-512 , sigma - aldrich ) ; anti - tyrosinated tubulin mouse igg ( clone tub-1a2 , sigma - aldrich ) . immunostaining was revealed by enhanced chemiluminescence super - signal west pico chemiluminescent , pierce ) . quantification was performed by image j software ( nih ) and subtracting the background around bands . transfected pc12 cells were fixed with cold methanol ( 6 min at 20c ) ; to remove unassembled tubulin , before fixation , some slides were extracted in pem buffer ( 80 mm k - pipes , 5 mm egta , 1 mm mgcl2 , ph 6.8 , containing protease inhibitors ) with 0.5% triton x-100 , 0.2 m nacl and 10 m paclitaxel ( sigma - aldrich ) . pc12 cells were stained with anti- tubulin mouse igg or anti - tyrosinated tubulin mouse igg and alexa fluor 568 donkey anti - mouse . by using image j software , total fluorescence intensity the region of interest was manually drowned and the analyses of the surface extension revealed that there were no significant differences between control cultures and wt - expressing pc12 cells ( data not shown ) . the authors are grateful to all the members of the lab and to all the people which contribute in delineating the syn functions . this work was supported by fondazione grigioni per il morbo di parkinson , milan , italy [ to g.c . ] ; dote ricerca ,
### Summary: : abstractthe partitioning between tubulin dimers and microtubules is fundamental for the regulation of several neuronal activities , from neuronal polarization and processes extension to growth cone remodelling . this phenomenon is modulated by several proteins , including the well - known microtubule destabilizer stathmin . we recently demonstrated that -synuclein , a presynaptic protein associated to parkinson 's disease , shares structural and functional properties with stathmin , and we showed that -synuclein acts as a foldable dynamase . here , we pinpoint the impact of wild type -synuclein on the partitioning between tubulin dimers and microtubules and show that parkinson 's disease - linked mutants lose this capability . thus , our results indicate a new role for -synuclein in regulating microtubule system and support the concept that microtubules and -synuclein are partners in the modulation of neuronal health and degenerative processes . furthermore , these data strengthen our hypothesis of the existence of a functional redundancy between -synuclein and stathmin .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : conjugated equine estrogens ( cee ) have been widely administered for the relief of menopausal symptoms . while there are obvious benefits to women suffering from menopausal symptoms , for instance , the evidence linking estrogen metabolite levels and cancers of the reproductive system continues to grow . scientists are also studying the effects of estrogen metabolites in different racial populations . with this information , physicians now are faced with wondering which of their patients should have cee administered . the short - term benefits need to be carefully weighed against any possible long - term detriments . in 2003 , the women 's health initiative ( whi ) reported that women being administered cee plus progesterone had an increased number of cardiovascular events compared to those given a placebo . unfortunately , confusion about the benefits of hormone replacement therapy ( hrt ) was introduced with the 2004 whi estrogen - only trial that showed no increase in such cardiovascular events . although this study did not provide a conclusive answer , it did suggest that women aged 50 to 59 years who received estrogen therapy enjoyed lower rates of heart disease . a recent study , entitled the whi coronary - artery calcium study ( whi - cacs ) , examined the effects of estrogen on coronary - artery calcification in women between the ages of 50 and 59 who were enrolled in the cee trial . the results of this study showed that women receiving estrogen had less coronary - artery calcification compared to the control group receiving a placebo . estrogen therapy is known to affect large numbers of proteins and metabolites , beyond those related to cardiovascular events . low- and high - density lipoproteins , tri - glycerides , insulin , insulin - like growth factors , glucose and c - reactive protein are just a few of the molecules whose levels have been shown to be affected by estrogen administration . considering the wide range of effects that estrogen exerts , there are undoubtedly many as yet undiscovered molecules and functional pathways that are affected by estrogen treatment . in the recent article published in genome medicine entitled ' application of serum proteomics to the women 's health initiative conjugated estrogen equine estrogens trial reveals a multitude of effects relevant to clinical findings ' , katayama et al . sought to discover novel proteomic changes affected by cee and this group used a method termed intact protein analysis system ( ipas ) to compare protein levels in serum samples collected from women prior to initiation of cee treatment and one year after initiation of treatment . the samples were prepared by pooling equal - volume aliquots from groups of ten women . the ipas system utilizes two dimensions of chromatography ( anion exchange followed by reversed - phase ) to fractionate intact proteins . aliquots collected from the reversed - phase column are tryptically digested and the proteins are identified and quantified using high - throughput mass spectrometry ( ms ) . prior to their chromatographic separation , the proteins from the cee - treated and control group were differentially isotopically labeled to allow their relative abundances to be measured via the ms measurements . all of the serum samples were also subjected to high - abundant protein depletion , eliminating such proteins as albumin and immunoglobulins from the analysis . the combination of high - abundant protein removal and extensive fractionation permitted proteins across seven orders of magnitude of abundance to be measured . a total of 611 proteins were quantified between the serum samples acquired pre- and one - year post - cee treatment . a statistically significant difference in the abundance of 116 proteins was observed between the two comparative samples . of these , 64 proteins had a false discovery rate ( fdr ) less than 0.5 relative to all of the quantified proteins . classification of these proteins into networks revealed five significant functional processes that were affected by cee treatment : blood coagulation , kallikrein - kinin system , cell adhesion - platelet - endothelium - leukocyte interactions , complement system , and ossification . comparison of these 64 proteins to previous findings yielded 13 ( > 20% ) that had been reported in the literature to have an association with estrogen therapy . the remaining 41 proteins where no association with estrogen therapy had been previously reported were associated with functions such as blood coagulation , ossification , cell growth , blood pressure maintenance , blood vessel morphogenesis , and angiogenesis . to confirm the ipas results , enzyme - linked immunosorbent assays ( elisas ) were carried out on 13 of the proteins using both non - pooled samples that were part of the original ipas study and an independent sample set . in both validation tests , this manuscript provides an excellent demonstration of the value of global comparative proteomic studies . using a non - biased method , katayama et al . were able to correlate their results with a number of findings that had previously been reported to be associated with cee . the authors were able to discover several proteins related to ossification and osteogenesis that had increased abundances in samples obtained from women that had been administered cee . they were also able to show changes in several proteins that play roles in circulatory processes such as coagulation , angiogenesis , and blood pressure regulation . these results may be connected to the previously mentioned benefits of lower heart disease rates . there is a misconception related to the value of the information to be gleaned from global proteomic studies as illustrated by katayama et al . many scientists that are unfamiliar with the technology anticipate that a global comparison provides a ' neat little package ' of proteins whose abundance is affected by a particular stimulus . unfortunately , many investigators are exasperated when the data they receive back is a long list of proteins with a large number of them showing a change in abundance . often investigators find that the number of observed differences overwhelms their ability to decide which direction to follow . katayama et al . have done an excellent job demonstrating the efficacy of turning a list of proteins into meaningful conclusions and further hypotheses . by grouping the proteins that showed a significant change in abundance they were able to uncover functional pathways that were affected by cee treatment . these findings can now be used to interrogate specific proteins in order to gather a greater depth of information concerning the effect of cee on a physiological function . in this study , a number of cee - associated functions were uncovered , some previously shown and some novel . following up on these non - biased results this decision , while highly subjective , needs to carefully consider the quality of the data obtained in the global comparative study and the relative functional importance of each protein pathway . for example , in the search for a cancer biomarker , considerable effort would not be exerted to further study acute phase response proteins , although many of these would probably be detected as having higher abundances in samples taken from cancer - affected individuals . what this study has illustrated is the utility of global comparative proteomic analyses for identifying changes in protein abundances within clinical samples obtained from different groups of individuals . the affected proteins were adequately validated using an orthogonal method and independent sample set . while this study is not the first to use a non - biased global approach to discover proteins and molecules that change as a result of an external perturbation , health scientists and institutions are still reluctant to utilize technologies ( such as the type used in this study ) to conduct investigative research . while such global proteomic studies can be time consuming , taking months to complete , the richness of information obtainable more than makes up for the effort spent . in this cee study , five functional groups of proteins were discovered to be perturbed , using the same data set . non - biased global studies , as illustrated in this manuscript , are a very efficient route to discovering novel effects of perturbations to biologic systems . cee : conjugated equine estrogens ; elisa : enzyme - linked immunosorbent assay ; fdr : false discovery rate ; hrt : hormone replacement therapy ; ipas : intact protein analysis system ; ms : mass spectrometry ; whi : women 's health initiative ; whi - cacs : whi coronary - artery calcium study . this project has been funded in whole or in part with federal funds from the national cancer institute , national institutes of health , under contract hhsn261200800001e . the content of this publication does not necessarily reflect the views or policies of the department of health and human services , nor does mention of trade names , commercial products , or organizations imply endorsement by the us government .
### Summary: : with the increase in technological capabilities for measuring biological molecules , there is a greater trend to conduct non - biased , discovery - driven studies that collect information on hundreds of molecules in a single study . the hope is that novel findings can be detected within these large datasets . for protein analysis , these non - biased studies are particularly challenging as no technology is presently capable of providing a view of the entire proteome . the ability of non - biased studies to accurately detect specific differences within the proteomes of samples obtained from differentially treated individuals must be conclusively demonstrated before investigators will routinely adopt these methods as part of their experimental protocols . this need is especially true for clinical and epidemiological studies in which limited amounts of samples are available .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : cox maze procedure has remained the gold standard for the surgical treatment of atrial fibrillation for almost two decades . in 1991 , james cox and associates introduced this openheart surgical approach , to block the reentrant pathways by making multiple atrial incisions and to block propagation of microreentrant wavelets ( 1 ) . after multiple modifications ( 2 , 3 ) , cox maze iii and more recently , cox maze iv operation reported success rate that ranges from 79 to 99% ( 4 , 5 ) . preoperative left atrium size and duration of atrial fibrillation have been identified as two important determinants in restoring sinus rhythm ( 6 - 9 ) . however , much of the studies were focused on the success rate and predictors of sinus conversion and less is known about the electrocardiographic characteristics in those who maintain sinus rhythm . therefore this type of procedure could alter p wave morphology in the surface ecg , which might prevent exact diagnosis of the cardiac rhythm of patients . however , characteristics of p wave in these patients have not been yet elucidated systematically . this study was aimed to describe the characteristics of p wave morphology and amplitude using standard 12-lead ecg in patients with normal sinus rhythm at 6 months after the cox maze procedure . between january and december 2007 , total 61 consecutive patients underwent the modified cox maze iii or iv operation at seoul national university hospital . the standard 12-lead surface ecg and 2-dimensional transthoracic echocardiography were performed at 6 months after the operation . six - month ecg was not available in 7 patients and 18 patients did not show normal sinus rhythm on the 6-month ecg . therefore total 36 patients were included to evaluate the p wave . in cox maze iii operation , specific ' maze ' of incisions is made along both atria by ' cut and sew ' technique , and left atrium appendage is excised . the cox maze iv operation is rather simplified by replacing many of the traditional cut and sew lesions with linear lines of ablation by using a bipolar radiofrequency energy device . the cox maze iv operation isolates right and left pulmonary veins as two islands , preserves right atrial appendage and leaves most of the left atrium in electrical continuity with remainder of the atrium . amplitude and duration of p waves of all 12 leads were measured using an electronic caliper in each patient . paired sample t - test was used to compare the preoperative and postoperative echocardiographic parameters . between january and december 2007 , total 61 consecutive patients underwent the modified cox maze iii or iv operation at seoul national university hospital . the standard 12-lead surface ecg and 2-dimensional transthoracic echocardiography were performed at 6 months after the operation . six - month ecg was not available in 7 patients and 18 patients did not show normal sinus rhythm on the 6-month ecg . therefore total 36 patients were included to evaluate the p wave . in cox maze iii operation , specific ' maze ' of incisions is made along both atria by ' cut and sew ' technique , and left atrium appendage is excised . the cox maze iv operation is rather simplified by replacing many of the traditional cut and sew lesions with linear lines of ablation by using a bipolar radiofrequency energy device . the cox maze iv operation isolates right and left pulmonary veins as two islands , preserves right atrial appendage and leaves most of the left atrium in electrical continuity with remainder of the atrium . all electrocardiograms were reviewed by two independent electrocardiographers . amplitude and duration of p waves of all 12 leads paired sample t - test was used to compare the preoperative and postoperative echocardiographic parameters . fourteen patients ( 38.9% ) were males and the mean heart rate was 7813 beats per minute . twenty patients had undergone the modified cox maze iii operation and 16 patients had the modified cox maze iv operation . twenty - three patients had been diagnosed as mitral stenosis and all patients had undergone concomitant cardiac procedures , most of which was mitral valve replacement ( 33/36 , 91.7% , table 1 ) . the preoperative and postoperative left atrium ( la ) diameters were 56.57.6 mm and 48.36.5 mm , respectively . all the medications of the patients were reviewed , which included digoxin , amiodarone , beta blockers , calcium channel blockers , ace inhibitors and arbs . neither medications nor type of the operation affect characteristics of p wave on ecg . on surface ecg at 6 months after the operation , the patients with sinus rhythm showed average p - wave axis of 6530 degrees . none of the recruited patients showed sinus node dysfunction including severe sinus bradycardia , sinus pauses , or atrial tachyarrhythmias . the average amplitude of p wave was less than 0.1 mv in all 12-leads , with highest amplitude in v1 , which was 0.070.03 mv ( table 2 ) . the morphology of p wave were mostly monophasic with positive polarity ( 49% ) , except the lead avr which appeared monophasic with negative polarity . table 3 shows frequency of different morphologies in ecg after cox maze procedure , according to each leads . p mitrale or large negative p terminal force in lead v1 , which are commonly accepted as typical ecg of left atrial enlargement , were not found in our patients . among 36 patients , when we compared the patients with la activity versus those without la activity , there were no significant differences in characteristics of p wave and echocardiographic parameters ( table 4 ) . also , the morphology of p wave did not show significant difference when two types of maze operation were compared . in this study , the morphology of p wave was different from what is usually seen in la enlargement , which is characterized by wide and notched p wave , so called p mitrale , in the leads i and ii and large p - terminal force in v1 . the most common morphology of p wave in our study was different from these , despite enlarged la . after the modified cox maze procedure , most of the la , especially posterior wall and appendage , become electrically isolated . these regions are mainly responsible for notched wide p wave in i and ii and large p - terminal force in v1 . they studied p wave morphology of patients undergoing atrial compartment operation for chronic atrial fibrillation , and found that 93% of patients showed altered p wave , which was small with average amplitude of 1.00.3 mm , and increased negative terminal force was not seen in v1 . study of lo et al . differed from our study in the aspects that their surgical management was not the cox maze operation and the number of enrolled patient was smaller ( n=15 ) than that of our study . they showed terminal negative deflection in inferior leads which corresponds to the right atrial appendage activation . this finding was not seen in our patients because the right atrial appendage as well as the left appendage is isolated or obliterated in the cox maze operation . therefore the results of the present study would be the first systematical evaluation of p wave morphology in patients with successful outcome of the modified cox maze operation . our study showed that p waves in ecg of these patients were very small with amplitude less than 0.1 mv , as a result of the cox maze procedure . the maze circuit lengthens the period of atrial depolarization which leads to small or even absent p waves and make it hard to identify p waves in a standard 12 lead ecg . the difficulty in identifying the p wave may also be due to the low gain of the standard 12-lead ecg , which can be overcome by amplifying the gain and frequency of the ecg . ( 11 ) reported that adding right precordial leads from v3r through v6r to the standard 12-lead surface ecg can improve detection of p waves and identification of atrial electrical activity . they studied 30 patients after combined cox - maze iii procedure and mitral valve surgery , and reported right precordial ecg , especially v4r , is a helpful tool for visualization p waves . our data showed 30.6% of patients with recovered la activity at 6 months after the maze operation . the low rate of la activity may be due to delayed recovery of atrial function after the atrial compartment operation , which has been reported from earlier studies ( 12 , 13 ) . this " period of left atrial paralysis " may have contributed to the low rate of atrial activity in our patients . first , this is a single - center study and the number of patients enrolled in the present study was not large . however , we think that the data would be representative enough to observe the ecg characteristics of the patients after cox maze operation because the patients were consecutively enrolled and the same design of suture or cryoablation line was applied to all patients . second , none of the enrolled patients underwent electrophysiological study , which might be the most accurate method to identify the patient 's rhythm . in our series of 61 patients , small portion of these 18 patients might have sinus rhythm with very small amplitude of p waves , thus their ecg diagnoses were considered as non - sinus rhythm such as junctional rhythm . however the effects on the overall data might be minimal . in conclusion , the morphology of p wave in patients after maze operation showed loss of typical ecg pattern of p mitrale . the characteristics of p wave morphology after maze operation was small in amplitude , monophasic and with positive polarity .
### Summary: : maze operation could alter p wave morphology in electrocardiogram ( ecg ) , which might prevent exact diagnosis of the cardiac rhythm of patients . however , characteristics of p wave in patients with sinus rhythm after the operation have not been elucidated systematically . consecutive patients who underwent the modified cox maze operation from january to december 2007 were enrolled . the standard 12-lead ecg and echocardiography were evaluated in patients who had sinus rhythm at 6 months after the operation . the average axis of p wave was 6530 degrees . the average amplitude of p wave was less than 0.1 mv in all 12-leads , with highest amplitude in v1 . the most common morphology of p wave was monophasic with positive polarity ( 49% ) , except avr lead , which was different from those in patients with enlarged left atrium , characterized by large p - terminal force in the lead v1 . there were no significant differences in p - wave characteristics and echocardiographic parameters between patients with la activity ( 30.6% ) versus without la activity ( 69.4% ) at 6 months after the operation . in conclusion , the morphology of p wave in patients after maze operation shows loss of typical ecg pattern of p mitrale : p wave morphology is small in amplitude , monophasic and with positive polarity .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : this article does not contain any studies with human subjects performed by any of the authors . this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited .
### Summary: : ciclosporin is widely used in a number of inflammatory disorders and has the potential for drug interactions . we report here a case of acute kidney injury due to the interaction of ciclosporin with methyl-1-testosterone . this has not been previously reported and it is relevant as methyl-1-testosterone can be purchased online . physicians should be aware of any over the counter or online purchased supplements and consider possible drug interactions.electronic supplementary materialthe online version of this article ( doi:10.1007/s13555 - 013 - 0038 - 6 ) contains supplementary material , which is available to authorized users .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the aim of endodontic treatment is to eliminate microorganism from the root canal system and prevention of reinfection . to achieve this objective , root canals were cleaned before filling using mechanical instrumentation , supplemented with irrigants and intracanal medication.1 morphology of root canals is very complex , some organic tissue and bacteria are left inside the canal system despite using various chemomechanical preparations . thus , root canal irrigation solution needed to aid canal debridement.2 studies have shown that the mechanical instrumentation of root canals leave a smear layer covering the instrumented wall.3 the smear layer has been shown to hinder the penetration of intracanal disinfectants and sealer into dentinal tubules and has potential to compromise the seal of root canal filling.4 sodium hypochlorite is most popularly used chemical solution in the chemo - mechanical preparation of the root canal system , and it has been systematically used in endodontics in a concentration ranging from 0.5% to 5.25% . although it has excellent antimicrobial activity and capacity of dissolving organic materials , this solution alone does not effectively remove the smear layer , because its physiochemical action is limited to the removal of organic particles . therefore , combination of naocl and edta are capable of removing the smear layer.5 the use of chemicals , ultrasonics , and lasers in combination or alone has been evaluated for removal of the smear layer with varying results . it has been reported that smear layer removal is less predictable in the apical region as compared with coronal and middle third of the root . this could be attributed to comparatively smaller apical canal dimensions hindering the penetration of irrigants and resulting in limited contact between canal wall and irrigants.1 during canal preparation , apical size has been crucial , in defining successful debridement of the root canal system.6 the irrigant penetration into the apical one - third of canal and removal of debris is dependent on the final size of the instrument used in the canals . the master apical file ( maf ) size has been related to the initial apical size in many studies . historically , the three sizes up from the first file to bind , rule was still being used in modified forms.7 possible methods of increasing the penetration of irrigating solution into the apical third of root canal and dentinal tubule include the use of ultrasonics and addition of surfactants to reduce surface tension of irrigating solution.1 forty freshly extracted human maxillary first molar teeth with distobuccal root length of 19- 21 mm were used in this study . the access cavity was prepared , working length ( wl ) of the distobuccal canal was determined by # 10 k - file 0.5 mm short of the apical foramen . then the distobuccal root end was covered with melted wax to disable the operator from seeing root canal instrumentation during cleaning and shaping . the teeth were divided into four experimental groups of eight teeth each , and two control groups with four teeth in each . the distobuccal canals were instrumented by crown down technique using hand files ( dentsply ) and rotary files ( k3 sybron endo ) . the teeth in the four experimental groups were enlarged to a # 20 size file ( 0.06 taper ) in group 1 ; # 25 size file ( 0.06 taper ) in group 2 ; # 30 size file ( 0.06 taper ) in group 3 ; and # 35 size file ( 0.06 taper ) in group 4 . the two control groups were enlarged to # 40 size file ( 0.06 taper ) . during the process of instrumentation , all groups were irrigated with 2 ml of 5% sodium hypochlorite using a 27-gauge needle . in the four experimental groups and positive control group each root canal received a final irrigation of 5 ml of smear clear for 1 min followed by 5 ml of 5% naocl . final irrigation in the negative control group was only with 5 ml of 5% naocl . root canals in all groups were irrigated with 5 ml of saline to remove any residue of irrigants and dried with paper points . one - half of each root was randomly selected and placed in 2% glutaraldehyde solution for 24 h. the fixed specimens were rinsed two times with a sodium cacodylate buffered solution ( 0.1 m. ph 7.2 ) , incubated in osmium tetraoxide for 1 h , dehydrated with ascending concentration of ethyl alcohol ( 30 - 100% ) and placed in a dessicator for at least 24 h. each specimen was then mounted on a aluminium stub , coated with 25 m of gold palladium , and examined under a scanning electron microscope . photographs of the apical third of each canal were taken for final evaluation with a magnification of 2500 . in a blind manner , three investigators scored the presence or absence of smear layer on the surface of a root canal or in the dentinal tubules from the coded photomicrographs . a score 1 through 8 was used for the evaluation of photomicrographs.2 score 1 : the surface is devoid of debris and smear layer . score 2 : the surface is devoid of smear layer , but little of debris is observed . score 3 : the surface has been cleaned , but both smear layer and debris are dispersedly observed . score 4 : the surface has been cleaned , but the level of smear layer and debris is also noticeable . score 5 : the clean surface is bit greater than the un - clean surface . all of the four specimens in the positive control group were free of smear layer and had significant erosion at the orifices of the dentinal tubules ( figure 1 ) . all the specimens in the negative control group were covered with smear layer and debris ( table 1 and figure 2 ) . all of the specimens in the experimental group 1 were covered with smear layer and debris ( figure 3 ) . the mean score for specimens in the experimental group 2 ( figure 4 ) ( instrumented at the wl to a # 25 size file ) was 2.45 ( figure 5 ) . the mean score for experimental group 3 was 1.06 indicating that 90% of debris and smear layer was removed in this group . similar observations were made in all the specimens in experimental group 4 ( table 2 and figure 6 ) . graph 1 shows the percentage of smear layer and debris removal from the apical third of canals in all four groups . statistical analysis of data using kruskal wallis and mann whitney ( table 3 ) . average scores of the smear layer and debris removal for control groups . scanning electron microscope image of negative control . scanning electron microscope image of group 1 . scanning electron microscope image of group 2 . average scores of the smear layer and debris removal for four groups . scanning electron microscope image of group 4 . the aim of chemomechanical preparation is to widen the apical canal enough for placement and replacement of irrigation solution , for the placement of intracanal medicament . on the other side dulton et al.8 also showed that with increasing file size , there was an increased reduction in bacteria and 0 also increases the risk of fracture.8 sodium hypochlorite ( naocl ) is most widely used chemical solution in the chemo - mechanical preparation of root canal system . however , despite of its excellent antimicrobial activity and dissolving organic materials , this solution alone does not effectively remove the smear layer . because it s physiochemical action naocl has been used in association with chelators like edta , which acts on the inorganic debris formed in instrumented root canals . therefore , combination of these substances is capable of removing the smear layer , mainly from middle and cervical thirds.5 possible method to increase the penetration of irrigating solutions into the apical third of the root canal and dentinal tubule include the addition of surfactants to irrigating solutions . intimacy of an irrigating solution to the dentinal walls depends on the wettability of the solution on solid dentine , which in turn dependent on low surface tension . the surface tension of an irrigating solution can be reduced with the addition of surfactants and therefore translate to better cleaning efficiency in the root canal.9 reducing surface tensions of endodontic solutions also improves their flow into narrow root canals . it may be speculated that reduction of surface tension of an endodontic irrigating solution by addition of surfactants should improve its efficiency in the narrow apical region of the root.1 aktener et al.10 reported in their study that adding surface - active agents to irrigants led to controversial results . this surface active agents which were aimed to increase the penetrability of the irrigating solutions may also increase the penetration of smear layer into dentinal tubules as a result of adhesive forces between them . this packing phenomenon of the smear material into the dentinal tubules can be explained by capillary action and fluid dynamics . this criticism was overcome by the findings of gambarini11 who reported that at the end of instrumentation , root canal diameters have been adequately enlarged with a funnel shape that provides easier and superior penetration of irrigants in the apical portions . moreover , no more instrumentation is required and consequently no more smear layer is produced . tubules packing phenomenon and allows the irrigant solution , which are left undisturbed for an adequate period of time , to effectively remove the remaining debris and smear layer.12 anil dhingra reported that smear layer removal was better with passive ultrasonic irrigation than with syringe irrigation.13 in our study , we used smear clear which contain 17% edta and anionic and cationic surfactant for better penetration in narrow apical preparations . the results of this study were also in comparison with the study of khademi et al.2 who reported that apical instrumentation up to # 30 file with 0.06 taper is effective for the removal of smear layer from the apical portion of root canal . it appears unnecessary to remove dentine in the apical part of the root canal when a suitable coronal taper is achieved . however , senia et al.6 showed minimum penetration of naocl to the apical part of the canals enlarged up to # 30 files . the probable reason might be the taper of the instrument and irrigant containing a surfactant in our study . for proper penetration of irrigants , removal of debris , and smear layer from the apical third region , enlargement to 30 size file is adequate when the suitable coronal taper is achieved .
### Summary: : background : the aim of this study was to determine minimal apical enlargement for irrigant penetration into apical third of root canal system using scanning electron microscope ( sem).materials and methods : distobuccal canals of 40 freshly extracted human maxillary first molar teeth were instrumented using crown - down technique . the teeth were divided into four test groups according to size of their master apical file ( maf ) ( # 20 , # 25 , # 30 , # 35 0.06% taper ) , and two control groups . after final irrigation , removal of debris and smear layer from the apical third of root canals was determined under a sem . data was analyzed using kruskal wallis and mann whitney tests.results:smear layer removal in apical third for maf size # 30 was comparable with that of the control group ( size # 40).conclusion : minimal apical enlargement for penetration of irrigants to the apical third of root canal system is # 30 size .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : we studied a cohort of 414 gastric cancer patients who underwent gastrectomy with lymph node dissection at pusan national university hospital ( pnuh ) between 2005 and 2007 , which was same cohort previously published . the group comprised 288 males and 126 females with a mean age of 59.0 years ( range , 42 to 75 years ) . standard formalin - fixed and paraffin - embedded sections were obtained from the department of pathology , pnuh , and the national biobank of korea , pnuh . we assessed the following clinicopathological factors according to the korean standardized pathology report for gastric cancer as well as the american joint committee on cancer staging manual , 7th edition : site , gross type , tumor size , depth of invasion , histological classification ( i.e. , intestinal or diffuse ) , and lymphovascular invasion.16 - 18 to monitor clinical outcomes , patients were followed up from the date of surgery to the date of death or january 1 , 2012 . the follow - up period ranged from approximately 1 - 82 months ( mean , 52.9 months ) . the cases lost to follow - up or death from any cause other than gastric cancer were designated censored data and were not included in our analysis of survival rates . we assessed the following histopathological features by examination of standard hematoxylin and eosin stained slides : 1 ) extent of tumor necrosis , < 10% vs. 10% of tumor mass , 2 ) proportion of extracellular mucin formation , < 10% vs. 10% of tumor mass , 3 ) presence of crohn's - like reaction ( a minimum of three lymphoid aggregates ) , 4 ) tils , < 2/high power field ( hpf ) vs. 2/hpf , and 5 ) growth pattern of tumor at the advancing edge ( expanding , infiltrative , or mixed ) . sections were dewaxed and rehydrated according to standard procedure and washed with phosphate buffered saline ( pbs ) . for immunohistochemical staining , sections were heated twice in a 600-w microwave oven , for 5 minutes each , in 0.01 m citrate buffer ( ph 6.0 ) . sections were immersed in 3% h2o2 to quench endogenous peroxidase activity , and unspecified binding was blocked in 5% normal goat serum ( 0.1% bovine serum albumin in pbs ) . immunohistochemical staining was performed using the avidin - biotin peroxidase complex method with aminoethylcarbazole as a chromogen using the vectastain abc elite kit ( vector laboratories , burlingame , ca , usa ) according to the manufacturer 's instructions . immunohistochemical staining was carried out using monoclonal antibodies against the mucin antigens ( table 1 ) . muc5ac and muc6 reflect gastric phenotypes and are markers for gastric foveolar cells and antral / cardiac mucous glandular cells , respectively . muc2 and cd10 exhibit the typical intestinal epithelial cell phenotype and are markers for goblet cells and the brush border of intestinal absorptive epithelial cells , respectively . adenocarcinomas with at least 10% reactivity for each mucin were identified as positive . on the basis of the combination of positive staining for muc5ac , muc2 , muc6 , and cd10 , the cases were further subdivided into gastric mucin predominant ( gc - gps ) , intestinal mucin predominant ( gc - ips ) , and null phenotype , as described previously.19 the dna of cancerous tissue and the corresponding normal gastric mucosa the extracted dna was amplified by polymerase chain reaction ( pcr ) with fluorescent dye - labeled primers targeting five microsatellite loci : bat25 , bat26 , d5s346 , d2s123 , and d17s250 , as recommended by the nci guidelines.3 dna was detected using a temperature - controlled dna sequencer ( prism 377 , perkin - elmer corp . , foster city , ca , usa ) , and fragment analyses were carried out with genescan software ( perkin - elmer corp . ) . msi status was determined by size variation and the presence of additional bands in the pcr product from tumor dna that were not observed in the dna from normal tissue from the same patients ( fig . 1 ) . in accordance with the nci criteria,3 msi - h was defined as instability in at least two of the five microsatellite loci ; msi - l as instability in only one locus ; and mss when none of the loci were shifted . clinicopathological features were analyzed by student 's t - test , the test , or fisher 's exact test to determine differences between msi - h vs. mss and msi - l status . histopathological factors associated with msi - h gastric cancers were identified using the binary logistic regression analysis . cumulative survival plots were obtained using the kaplan - meier method , and significance was compared using the log - rank test . prognostic factors were identified using the cox regression stepwise method ( proportional hazard model ) adjusted for the patient age , tumor site , depth of invasion , and lymph node metastasis . we studied a cohort of 414 gastric cancer patients who underwent gastrectomy with lymph node dissection at pusan national university hospital ( pnuh ) between 2005 and 2007 , which was same cohort previously published . the group comprised 288 males and 126 females with a mean age of 59.0 years ( range , 42 to 75 years ) . standard formalin - fixed and paraffin - embedded sections were obtained from the department of pathology , pnuh , and the national biobank of korea , pnuh . we assessed the following clinicopathological factors according to the korean standardized pathology report for gastric cancer as well as the american joint committee on cancer staging manual , 7th edition : site , gross type , tumor size , depth of invasion , histological classification ( i.e. , intestinal or diffuse ) , and lymphovascular invasion.16 - 18 to monitor clinical outcomes , patients were followed up from the date of surgery to the date of death or january 1 , 2012 . the follow - up period ranged from approximately 1 - 82 months ( mean , 52.9 months ) . the cases lost to follow - up or death from any cause other than gastric cancer were designated censored data and were not included in our analysis of survival rates . we assessed the following histopathological features by examination of standard hematoxylin and eosin stained slides : 1 ) extent of tumor necrosis , < 10% vs. 10% of tumor mass , 2 ) proportion of extracellular mucin formation , < 10% vs. 10% of tumor mass , 3 ) presence of crohn's - like reaction ( a minimum of three lymphoid aggregates ) , 4 ) tils , < 2/high power field ( hpf ) vs. 2/hpf , and 5 ) growth pattern of tumor at the advancing edge ( expanding , infiltrative , or mixed ) . sections were dewaxed and rehydrated according to standard procedure and washed with phosphate buffered saline ( pbs ) . for immunohistochemical staining , sections were heated twice in a 600-w microwave oven , for 5 minutes each , in 0.01 m citrate buffer ( ph 6.0 ) . sections were immersed in 3% h2o2 to quench endogenous peroxidase activity , and unspecified binding was blocked in 5% normal goat serum ( 0.1% bovine serum albumin in pbs ) . immunohistochemical staining was performed using the avidin - biotin peroxidase complex method with aminoethylcarbazole as a chromogen using the vectastain abc elite kit ( vector laboratories , burlingame , ca , usa ) according to the manufacturer 's instructions . immunohistochemical staining was carried out using monoclonal antibodies against the mucin antigens ( table 1 ) . muc5ac and muc6 reflect gastric phenotypes and are markers for gastric foveolar cells and antral / cardiac mucous glandular cells , respectively . muc2 and cd10 exhibit the typical intestinal epithelial cell phenotype and are markers for goblet cells and the brush border of intestinal absorptive epithelial cells , respectively . adenocarcinomas with at least 10% reactivity for each mucin were identified as positive . on the basis of the combination of positive staining for muc5ac , muc2 , muc6 , and cd10 , the cases were further subdivided into gastric mucin predominant ( gc - gps ) , intestinal mucin predominant ( gc - ips ) , and null phenotype , as described previously.19 the dna of cancerous tissue and the corresponding normal gastric mucosa were obtained from formalin - fixed and paraffin - embedded surgical blocks . the extracted dna was amplified by polymerase chain reaction ( pcr ) with fluorescent dye - labeled primers targeting five microsatellite loci : bat25 , bat26 , d5s346 , d2s123 , and d17s250 , as recommended by the nci guidelines.3 dna was detected using a temperature - controlled dna sequencer ( prism 377 , perkin - elmer corp . , foster city , ca , usa ) , and fragment analyses were carried out with genescan software ( perkin - elmer corp . ) . msi status was determined by size variation and the presence of additional bands in the pcr product from tumor dna that were not observed in the dna from normal tissue from the same patients ( fig . 1 ) . in accordance with the nci criteria,3 msi - h was defined as instability in at least two of the five microsatellite loci ; msi - l as instability in only one locus ; and mss when none of the loci were shifted . clinicopathological features were analyzed by student 's t - test , the test , or fisher 's exact test to determine differences between msi - h vs. mss and msi - l status . histopathological factors associated with msi - h gastric cancers were identified using the binary logistic regression analysis . cumulative survival plots were obtained using the kaplan - meier method , and significance was compared using the log - rank test . prognostic factors were identified using the cox regression stepwise method ( proportional hazard model ) adjusted for the patient age , tumor site , depth of invasion , and lymph node metastasis . of the 414 gastric cancers examined , 380 ( 91.7% ) , 11 ( 2.7% ) , and 23 cases ( 5.6% ) were mss , msi - l , and msi - h , respectively , based on the nci criteria ( table 2 ) . compared to mss and msi - l gastric cancers , msi - h cancers were significantly associated with older age ( p=0.010 ) , increased tumor size ( p=0.014 ) , more excavated gross features ( p=0.042 ) , and intestinal histotypes ( p=0.028 ) . furthermore , msi - h gastric cancers exhibited more aggressive behaviors than mss and msi - l cancers , such as increased t stage ( p=0.009 ) , presence of perineural invasion ( p=0.022 ) , and lymphovascular tumor emboli ( p=0.027 ) ( table 2 ) . there was no significant relationship between msi status and tumor location , gender , or lymph node metastasis . in agreement with our finding of a positive relationship between msi - h and increased aggressiveness ( increased depth of invasion , presence of lymphovascular tumor emboli , and perineural invasion ) , there was a tendency for msi - h to associate with reduced overall survival in intestinal - type gastric cancer ( p=0.054 ) , but not in overall gastric cancer ( p=0.369 ) ( fig . msi - h intestinal - type gastric cancers were associated with poorer survival compared to mss / msi - l intestinal - type gastric cancers ( 71.01.6 months vs. 58.67.2 months ) . however , msi status was not identified as an independent prognostic factor after adjusting for tumor location , depth of invasion , and lymph node status in the cox regression proportional hazard model ( p=0.197 ) ( table 3 ) . we examined the histopathological features that were associated with msi and found that tumor necrosis ( p=0.041 ) , presence of til ( 2/hpf ) ( p<0.001 ) , and expanding / mixed growth patterns ( p=0.038 ) were associated with msi - h gastric cancer compared to mss / msi - l gastric cancers ( table 4 , fig . crohn's - like lymphoid aggregates and extracellular mucin formation were not features of msi - h gastric cancers . mucin expression analysis of the 414 gastric cancers determined that 35.5% ( 147/414 ) , 67.4% ( 279/414 ) , 44.9% ( 186/414 ) , and 20.5% ( 85/414 ) were positive for muc2 , muc5ac , muc6 , and cd10 , respectively ( table 4 ) . in contrast to mss and msi - l cancer , msi - h gastric cancer was associated with muc6 expression ( p=0.024 ) ( fig . 3 ) . there was no statistically significant difference in muc5ac , muc2 , or cd10 expression between msi - h and mss / msi - l gastric cancers . based on their mucin expression patterns , gastric cancers were further subdivided into gc - gps ( 248/414 , 59.9% ) , gc - ips ( 118/414 , 28.5% ) , and null phenotypes ( 48/414 , 11.6% ) . msi - h gastric cancer demonstrated gc - gps phenotypes compared to mss and msi - l gastric cancers ( p=0.031 ) ( table 5 ) . using binary logistic regression analysis , we determined that tumor necrosis ( 10% of tumor mass ) ( p=0.031 ) , tils ( 2/hpf ) ( p<0.001 ) , intestinal histologic type ( p=0.014 ) , and gastric predominant mucin phenotypes ( p=0.020 ) could be considered independent features associated with msi - h gastric cancers ( table 6 ) . of the 414 gastric cancers examined , 380 ( 91.7% ) , 11 ( 2.7% ) , and 23 cases ( 5.6% ) were mss , msi - l , and msi - h , respectively , based on the nci criteria ( table 2 ) . compared to mss and msi - l gastric cancers , msi - h cancers were significantly associated with older age ( p=0.010 ) , increased tumor size ( p=0.014 ) , more excavated gross features ( p=0.042 ) , and intestinal histotypes ( p=0.028 ) . furthermore , msi - h gastric cancers exhibited more aggressive behaviors than mss and msi - l cancers , such as increased t stage ( p=0.009 ) , presence of perineural invasion ( p=0.022 ) , and lymphovascular tumor emboli ( p=0.027 ) ( table 2 ) . there was no significant relationship between msi status and tumor location , gender , or lymph node metastasis . in agreement with our finding of a positive relationship between msi - h and increased aggressiveness ( increased depth of invasion , presence of lymphovascular tumor emboli , and perineural invasion ) , there was a tendency for msi - h to associate with reduced overall survival in intestinal - type gastric cancer ( p=0.054 ) , but not in overall gastric cancer ( p=0.369 ) ( fig . msi - h intestinal - type gastric cancers were associated with poorer survival compared to mss / msi - l intestinal - type gastric cancers ( 71.01.6 months vs. 58.67.2 months ) . however , msi status was not identified as an independent prognostic factor after adjusting for tumor location , depth of invasion , and lymph node status in the cox regression proportional hazard model ( p=0.197 ) ( table 3 ) . we examined the histopathological features that were associated with msi and found that tumor necrosis ( p=0.041 ) , presence of til ( 2/hpf ) ( p<0.001 ) , and expanding / mixed growth patterns ( p=0.038 ) were associated with msi - h gastric cancer compared to mss / msi - l gastric cancers ( table 4 , fig . crohn's - like lymphoid aggregates and extracellular mucin formation were not features of msi - h gastric cancers . mucin expression analysis of the 414 gastric cancers determined that 35.5% ( 147/414 ) , 67.4% ( 279/414 ) , 44.9% ( 186/414 ) , and 20.5% ( 85/414 ) were positive for muc2 , muc5ac , muc6 , and cd10 , respectively ( table 4 ) . in contrast to mss and msi - l cancer , msi - h gastric cancer was associated with muc6 expression ( p=0.024 ) ( fig . 3 ) . there was no statistically significant difference in muc5ac , muc2 , or cd10 expression between msi - h and mss / msi - l gastric cancers . based on their mucin expression patterns , gastric cancers were further subdivided into gc - gps ( 248/414 , 59.9% ) , gc - ips ( 118/414 , 28.5% ) , and null phenotypes ( 48/414 , 11.6% ) . msi - h gastric cancer demonstrated gc - gps phenotypes compared to mss and msi - l gastric cancers ( p=0.031 ) ( table 5 ) . using binary logistic regression analysis , we determined that tumor necrosis ( 10% of tumor mass ) ( p=0.031 ) , tils ( 2/hpf ) ( p<0.001 ) , intestinal histologic type ( p=0.014 ) , and gastric predominant mucin phenotypes ( p=0.020 ) could be considered independent features associated with msi - h gastric cancers ( table 6 ) . in this study , msi status in gastric cancers was significantly associated with tumor progression , lymphovascular and perineural invasion , and poor prognosis . furthermore , we confirmed previous reports that stated that msi - h gastric cancers are significantly associated with older age , increased tumor size , and intestinal histologic type . it was also revealed that tumor necrosis ( 10% of tumor mass ) , tils ( 2/hpf ) ( p<0.001 ) , intestinal histologic type ( p=0.014 ) , and gastric predominant mucin phenotypes ( p=0.020 ) could represent independent features associated with msi - h gastric cancers . it has been reported that msi - h cancers are associated with defects involving dna mmr genes such as hmlh1 and hmsh2 as a result of mutations or promoter methylation.20 msi - h colorectal cancer was reported to have good survival rates , more favorable responses to chemotherapy , and is an indicator of hereditary non - polyposis colorectal carcinoma syndrome.8,21,22 the recent discovery of impaired epithelial - to - mesenchymal transition in msi - h colorectal cancers provides a molecular mechanism supporting the favorable prognosis of msi - h colorectal cancers.23 based on the clinical significance of msi in colorectal cancers , many attempts to identify histopathologic predictors of msi status have been conducted.9 - 11 in contrast to colorectal cancer , the clinical significance and role of msi in gastric cancer remain controversial ( table 7 ) . it has been reported that msi - h gastric cancer is associated with older age , increased tumor size , and intestinal histologic type , which is in accordance with our data . however , there are conflicting reports of the relationship between msi status and gastric cancer aggressiveness and survival . the present study demonstrated that , compared to mss and msi - l gastric cancers , msi - h cancers exhibit aggressive behaviors ( increase of t stage , presence of perineural invasion , and lymphovascular tumor emboli ) . furthermore , poor survival was demonstrated for msi - h gastric cancer in intestinal - type gastric cancers , but not in diffuse or overall gastric cancers . in accordance with our data , oki et al.24 reported increased lymphovascular tumor emboli , and seo et al.12 reported increased lymphatic invasion ( p=0.104 ) and lymph node metastasis ( p=0.157 ) in msi - h gastric cancer compared to mss / msi - l gastric cancers . recently , a study comprising a large series of gastric cancer patients demonstrated clinical significance of msi status.24,25 an et al.25 reported the largest series of koreans ( 1,990 gastric cancer patients ) , showing no prognostic significance of the disease . they revealed that there was no significant difference of disease - free survival between mss / msi - l and msi - h gastric cancers at each clinical stage of i , ii , iii , and iv . also it was reported that there were no benefits of 5-fluorouracil ( 5-fu)-based adjuvant chemotherapy in msi - h gastric cancer compared to better disease - free survival in the mss / msi - l gastric cancers.25 oki et al.24 reported that msi status has no significant effect on overall survival or response to 5-fu in gastric cancer . these conflicting reports render it difficult to reach a conclusion regarding the effect of msi in gastric cancer and are in contrast to the consensus data that point to a favorable prognosis in msi - h colorectal cancers . we speculate that the reasons for this difference might be due to the high heterogeneity of gastric cancer in terms of morphological , phenotypic , and molecular aspects . gastric cancer is usually divided into two groups based on the tendency of gland formation : intestinal ( differentiated ) and diffuse ( undifferentiated ) . it was reported that intestinal- and diffuse - type gastric cancers demonstrate different phenotypic and molecular features.26 - 28 in addition , there is the possibility of gastric cancer type being influenced by different types and numbers of microsatellite markers ( 2 - 10 markers ) , as well as ethnic differences ( tendency of lower msi - h gastric cancer prevalence in asians [ commonly < 10% of all gastric cancer cases ] ) ( table 6 ) . in accordance with previous studies,29,30 our study demonstrated that muc6-positive or gastric mucin - phenotype gastric cancers were associated with msi - h gastric cancer . compared to previous reports that limited data to intestinal - type early gastric cancer30 or intestinal - type gastric cancer,29 we investigated a large series of all gastric cancer types ( intestinal+diffuse types ) and demonstrated the importance of muc6 or gastric mucin phenotypes in view of msi status in gastric cancer . we found that tumor necrosis , expanding growth pattern , and tils were associated with msi - h gastric cancers . unlike in colorectal cancers , poor differentiation ( diffuse - type morphology ) , extracellular mucin , and prominent lymphoid aggregates at advancing edge ( crohn's - like reaction ) were not associated with msi status in gastric cancer.9 - 11 we assume that these differences are associated with different roles of msi between gastric and colorectal cancers . further analysis on a defined patient population will be required to achieve consensus on the utility of microsatellite repeats as predictive markers of prognosis and response to chemotherapy in gastric cancer .
### Summary: : backgroundgastric cancers with microsatellite instabilities ( msi ) have been reported to be associated with favorable prognosis . however , the significance of the effect of msi on the clinicopathological features , as well as its association with mucin phenotype , remains unclear.methodsmsi status was assessed in 414 cases of gastric cancer using polymerase chain reaction analysis of five microsatellite loci , as recommended by national cancer institution criteria . the expression of mucins ( muc5ac , muc6 , muc2 , and cd10 ) was assessed.resultsout of 414 total cases of gastric cancer , 380 ( 91.7% ) , 11 ( 2.7% ) , and 23 ( 5.6% ) were microsatellite stable ( mss ) , low - level msi ( msi - l ) , and high - level msi ( msi - h ) , respectively . compared to mss / msi - l , msi - h gastric cancers were associated with older age ( p=0.010 ) , tumor size ( p=0.014 ) , excavated gross ( p=0.042 ) , intestinal type ( p=0.028 ) , aggressive behaviors ( increase of t stage [ p=0.009 ] ) , perineural invasion [ p=0.022 ] , and lymphovascular emboli [ p=0.027 ] ) . msi - h gastric cancers were associated with tumor necrosis ( p=0.041 ) , tumor - infiltrating lymphocytes ( 2/high power field , p<0.001 ) , expanding growth patterns ( p=0.038 ) , gastric predominant mucin phenotypes ( p=0.028 ) , and muc6 expression ( p=0.016 ) . tumor necrosis ( 10% of mass , p=0.031 ) , tumor - infiltrating lymphocytes ( p<0.001 ) , intestinal type ( p=0.014 ) , and gastric mucin phenotypes ( p=0.020 ) could represent independent features associated with msi - h gastric cancers . msi - h intestinal type gastric cancers had a tendency for poor prognosis in univariate analysis ( p=0.054 ) but no association in cox multivariate analysis ( p=0.197).conclusionsour data suggest that msi - h gastric cancers exhibit distinct aggressive biologic behaviors and a gastric mucin phenotype . this contradicts previous reports that describe msi - h gastric cancer as being associated with favorable prognosis .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : at 14:46 on march 11 , 2011 , a strong earthquake of magnitude 9.0 struck off the pacific coast of tohoku , and the resulting massive tsunami inflicted immense damage on eastern japan . after the great east japan earthquake , tohoku university hospital , located in a disaster - stricken region , immediately started emergency rescue operations and concurrently received patients from other hospitals in the region . furthermore , medical teams were sent to the disaster - stricken regions to conduct relief operations at disaster base hospitals and evacuation centers . as part of the disaster relief operations of tohoku university hospital , the department of traditional asian medicine at tohoku university also conducted medical operations immediately after the earthquake disaster , mainly employing traditional asian medical practices , in onagawa town and ishinomaki city in miyagi prefecture and aizu - bange town in fukushima prefecture . because there was a rise in people suffering from chronic pain and neck / shoulder stiffness approximately 1 month after the earthquake , we provided acupuncture / massage therapy along with traditional asian medical treatments at the request of physicians . we herein report the details of our disaster relief operations with acupuncture / massage therapy . during the first three months after the great east japan earthquake , we participated in the disaster medical operations of the department of traditional asian medicine at tohoku university and provided a total of 17 sessions of voluntary acupuncture / massage therapy at seven evacuation centers in miyagi and fukushima prefectures . we used the data from medical records on the therapy performed at five evacuation centers set up in elementary and junior high schools in ishinomaki city . the data extraction period was two months from april through may ( total of five operations ) . while massage therapy was performed manually , acupuncture therapy was performed mainly with filiform needles ( diameter of 0.16 mm and length of 30 mm ; seirin corporation , shizuoka , japan ) and press tack needles ( pyonex , diameter of 0.2 mm and length of 0.6 mm ; seirin corporation , shizuoka , japan ) . we did not conduct research , such as asking people to fill out questionnaires , in order to avoid burdening the evacuees . because medical records have many lack of data of symptoms and affected sites in the situation of disaster , we used medical records of 128 patients that include enough data . the data corrected from medical records were so varied , therefore we could not perform statistical analysis . a dedicated treatment room was set up only in one evacuation center . at the other four centers , table 1 shows the information about age , gender , symptoms , and affected sites of 128 patients who received acupuncture / massage therapy . the common complaints were pain ( total 41.4% ) and stiffness ( total 62.5% ) , and common sites were the shoulder and back ( total 64.1% ) and lumber ( total 41.4% ) ( table 1 ) . after the great east japan earthquake , the department of traditional asian medicine at tohoku university conducted medical operations , mainly providing traditional asian treatments , in the extensively damaged coastal regions of miyagi and fukushima prefecture . because western medical treatment was also limited at the evacuation centers , there were some evacuees with prolonged symptoms of the common cold , gastroenteritis , allergic reactions , insomnia , etc . through these medical operations , we realised that traditional asian treatments can alleviate various symptoms when given in combination with western medical practices even under such difficult circumstances as those encountered after the disaster.1 moreover , the characteristic symptoms were stiffness and pain that started to increase approximately 1 month after the earthquake . it is said that chronic pain often occurs based on not only systemic changes but also with a psychological background.2 in the early period after the great east japan earthquake , at least 50,000 people were evacuated in miyagi prefecture alone.3 we speculate that those complaining of pain affecting various parts of the body increased due to the unaccustomed stay at an evacuation center , as well as lying down in a space too small to roll over , contents of meals , environmental problems , psychological shock , stress , etc . in addition to relief of pain and stiffness , acupuncture / massage therapy can contribute to early detection of other problems that evacuees might be prone to develop because long therapy sessions allow practitioners to listen attentively to evacuees . the therapy satisfaction rate of 92.3% may reflect not only simple effects of physical treatment but also relaxing effects derived from the inherent sense of trust and safety generated by the warmth of manual treatment and conversation during the therapy sessions . in early april , when voluntary acupuncture / massage therapy was started , running water had not yet been restored at any evacuation center . under the sanitary conditions at the time , evacuees could not bathe or even wash their hands properly . during this period , we performed only massage therapy in consideration of infection risks and gave consideration to performing acupuncture therapy after the evacuees were again able to bathe . under such conditions of inadequate sanitation , the use of contact needles that noninvasively stimulate the skin may be an option . moreover , the circumstances for setting up a treatment room varied among the evacuation centers . a dedicated treatment room was set up in only one center . when acupuncture / massage therapy is performed , a dedicated treatment room may be necessary to protect the safety and privacy of evacuees . we also consider it to be necessary , if no treatment room is available , that a dedicated space be set up with tents , drapes , etc . , because acupuncture / massage therapy often requires exposure of the skin . acquiring a dedicated space has the merit of facilitating hygiene and risk management in addition to protecting privacy . in conversation with treated evacuees , some told us that being able to lie down alone , even if only during a therapy session , was valuable because there is no solitude while staying at an evacuation center . we also considered it to be necessary to provide time and space to relax for those experiencing the stress of living in an evacuation center . interestingly , history - taking before treatment revealed many evacuees to be taking oral antiplatelet or anticoagulant drugs . the incidences of haemorrhage and haematoma formation due to acupuncture therapy are low but these complications have been reported.4 in order to predict the occurrence of these adverse events , it is essential to determine medication usage , blood pressure , pulse , etc . , beforehand by sufficiently interviewing evacuees . while questioning patients about the history of infection as thoroughly as possible , practitioners should ensure the use of gloves , proper management of disposable needles , etc . , for infection control . furthermore , possible responses of the body to acupuncture / massage therapy , such as lassitude , internal haemorrhage and discomfort , should be sufficiently explained before treatment . especially in volunteer operations that are likely to provide one - time treatment , consideration must be given to reducing the amount of stimulation because evacuees can not be followed up . the medical teams of tohoku university hospital accompanied us in our operations , and physicians performed history - taking whenever possible . acupuncture / massage therapy at the time of the disaster was widely requested by medical professionals . there were also rescue medical teams that performed physiotherapy or musculoskeletal manipulation of their own accord . in the medical operations of the primary care for all team of japan primary care association,5 the association of medical doctors of asia,6 the disaster victim assistance project team,7 etc . , practitioners of acupuncture and massage accompanied the medical teams and performed therapy at their request . in operations conducted at the time of disaster , collecting various forms of information and making decisions are often left to individual practitioners . however , conducting medical operations with medical staff assures the adequacy of history - taking , questioning patients about medication usage , and risk management . , there are nearly 90,000 nationally certified acupuncturists , moxacauterists , and masseuses in japan.8 it is expected that many would want to participate in volunteer disaster - relief operations . however , these practitioners may have to abandon this desire because no route for participating in such operations has yet been established . thus , we hope that organisations , such as academic societies , will develop strategies and programmes for recruiting volunteers , possibly via websites and so on , before the next great need arises . requests for acupuncture / massage therapy are increasing not only from evacuees but also from medical professionals . acupuncture / massage therapy , which can be performed based on physical findings , may be among the effective medical treatments offered at the time of a major disaster . however , there is a possibility that the emotional status of the survivors were affected and comforted by the attention and treatment offered to them at this point in time .
### Summary: : the great east japan earthquake inflicted immense damage over a wide area of eastern japan with the consequent tsunami . department of traditional asian medicine , tohoku university , started providing medical assistance to the disaster - stricken regions mainly employing traditional asian therapies.we visited seven evacuation centers in miyagi and fukushima prefecture and provided acupuncture / massage therapy . while massage therapy was performed manually , filiform needles and press tack needles were used to administer acupuncture . in total , 553 people were treated ( mean age , 54.0 years ; 206 men , 347 women ) . assessment by interview showed that the most common complaint was shoulder / back stiffness . the rate of therapy satisfaction was 92.3% . many people answered that they experienced not only physical but also psychological relief.at the time of the disaster , acupuncture / massage therapy , which has both mental and physical soothing effects , may be a therapeutic approach that can be effectively used in combination with western medical practices .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the golgi apparatus is an organelle on the secretory pathway required for the processing of complex sugar structures on many proteins and lipids , and for the sorting of these proteins and lipids to their correct subcellular destinations ( farquhar and palade , 1998 ) . it is comprised of a series of cisternal membranes organized into a stacked structure , the first or cis - face receives material from the er , whereas the final or trans - cisternae packages it for delivery to the plasma membrane and endocytic pathways ( farquhar and palade , 1998 ) . this structure is maintained by an exoskeleton or golgi matrix which has been proposed to be required for linking cisternae together into the characteristic golgi stack structure , and also for vesicle recognition during membrane traffic ( warren and malhotra , 1998 ; seeman et al . , 2000 ) . the most studied components of the golgi matrix are p115 , the grasp65gm130 complex , and an integral membrane protein , giantin ( linstedt and hauri , 1993 ; nakamura et al . , 1995 ; sapperstein et al . , 1995 ; barr et al . grasp65 was identified in a screen for factors involved in the stacking of cisternae , and later shown to be a specific binding partner of gm130 required to target it to the golgi ( barr et al . , 1998 ) . gm130 in turn is a receptor for p115 , required for tethering vesicles to their target membrane ( barroso et al . , 1995 ; more recently , the formation of golgi stacks from cisternae in vitro was found to require p115 , discrete from its membrane fusion function , and giantin ( shorter and warren , 1999 ) . gm130 and p115 also make interactions with giantin during vesicle docking , and potentially during cisternal stacking ( shorter and warren , 1999 ; dirac - svejstrup et al . the network of interactions between these proteins may be regulated by the rab gtpases , as both p115 and gm130 have been shown to interact with the active or gtp form of rab1 ( allan et al . , 2000 ; recruitment of p115 to vesicles destined to fuse with the cis - golgi is mediated via the interaction with rab1 ( allan et al . , 2000 ) , whereas the consequences of rab1 binding to gm130 are unknown . a second grasp complex , containing grasp55 and the coiled - coil protein golgin-45 , exists in golgi membranes ( shorter et al . , this complex also binds a rab gtpase and is required for the maintenance of normal golgi structure and protein transport ( short et al . , 2001 ) . in addition to the golgi matrix proteins discussed above , some membrane proteins are of potential importance to golgi structure . one such group is the medial - golgi enzymes , found to specifically bind to the golgi matrix although the mechanism remains uncharacterized ( slusarewicz et al . , 1994 ) . another is the p24 family of cargo receptors , identified as major transmembrane components of vesicles recycling between the er and golgi complex , and as potential structural golgi proteins in mammalian cells ( wada et al . , 1991 ; stamnes et al . , 1995 ; all p24 proteins share a common structure , with a short cytoplasmic domain containing binding signals for the cop - i and cop - ii vesicle coat complexes , plus a lumenal domain with potential secretory cargo binding capabilities ( fiedler et al . , 1996 ; at least one p24 protein , tmp21 , is an essential gene in mammals , and a heterozygous deletion shows reduced levels of the protein and a partially disrupted golgi apparatus ( denzel et al . , 2000 ) . however , in yeast , all p24 family members can be deleted with little or no effect on protein transport or secretory pathway morphology ( springer et al . , 2000 ) . the drug brefeldin a disrupts the golgi apparatus and causes golgi enzymes , but not putative structural components such as the grasps and gm130 , to be relocated to the er ( nakamura et al . under conditions in which the golgi is first disrupted with brefeldin a and then allowed to recover while protein transport from the er is blocked , a golgi - like structure forms that lacks golgi enzymes but contains golgi matrix proteins ( seeman et al . , 2000 ) however , under the electron microscope , these structures lack some key features of normal golgi membranes , such as well - defined stacked cisternae . therefore , the golgi matrix must interact with additional factors , either integral membrane proteins or specific lipids to organize golgi membranes . therefore , we decided to investigate whether grasps could provide a link between golgi matrix components and transported integral membrane proteins . analysis of purified grasp55 complexes by electrophoresis on nonreducing polyacrylamide gels showed that in addition to grasp55 and golgin-45 , distinct protein bands at 21 and 25 kd were visible ( fig . 1 a ) . mass spectrometric tryptic fingerprinting revealed these proteins to be members of the p24 cargo receptor family ( fig . 1 a ) . comparing the intensity of the coomassie blue stained grasp55 and p24 protein bands suggests a stoichiometric complex of grasp55 and tmp21 , assuming equal staining efficiency and allowing for the difference in molecular masses . western blotting of grasp55 and grasp65 immunoprecipitates with antibodies specific to p24a and gp25l showed that they are in complexes with both grasps ( fig . these are specific complexes , as grasp55 immunoprecipitates did not contain grasp65 , and vice versa ( fig . 1 c ) . to find out if grasps are present in complexes containing both golgins and p24 proteins , immunoprecipitates of golgin-45 and gm130 were western blotted for p24a , gp25l , and the grasps . this revealed that gm130 immunoprecipitates contained both p24 proteins tested for , whereas golgin-45 immunoprecipitates did not ( fig . 1 b ) , despite the fact that grasp55 was easily detected ( fig . 1 c ) . in summary , grasp65 is found in a complex containing both gm130 and p24 proteins , whereas grasp55 may exist in two discrete complexes containing either golgin-45 or p24 proteins . a 10% coomassie blue stained minigel run under nonreducing conditions is shown ; loadings corresponding to 1/30 and 29/30 of the total isolated material . bands corresponding to the specifically interacting proteins seen in all experiments performed ( n = 5 ) were excized ( arrowheads and bracket ) , and tryptic digests of the proteins contained therein analyzed by mass spectrometry . asterisks indicate rat serum albumin confirmed by mass spectrometry and sequencing of tryptic peptides . the total eluted material from a minus antibody control is also shown . ( b ) immunoprecipitations ( ips ) were performed from 200 g golgi membranes with the following antibodies : sheep anti - grasp55 , mouse anti - grasp65 , rabbit anti - golgin-45 , and sheep anti - gm130 . ( c ) blots with the following antibodies were performed as controls : grasp55 and grasp65 ips with rabbit anti - gm130 , and rabbit anti golgin-45 ; gm130 ips with sheep anti - grasp55 and mouse anti - grasp65 ; golgin-45 ips with sheep anti - grasp55 and mouse anti - grasp65 . the asterisk indicates cross - reactivity to the heavy chain of the sheep anti - gm130 antibody . if the presence of p24 proteins in the purified grasp complexes is relevant for grasp function , there should be an interaction between the cytoplasmic domains of these proteins with grasp55 and grasp65 . to investigate this we used the yeast two - hybrid system , fusing the cytoplasmic domains of different p24 proteins as baits , and full - length grasp55 and grasp65 as prey . this screen revealed no interaction between any of the p24 proteins tested or tgf- with either grasp , despite the fact that gm130 showed an interaction with the grasps ( fig . 2 , a and b ) . one property these proteins share is that they exist as dimers or oligomers within the cell ( dominguez et al . , 1998 ; kuo et al . , 2000 ) , suggesting that oligomeric state might be important for their recognition by grasps . to oligomerize the cytoplasmic domains , a coiled coil was added to the two - hybrid bait constructs . this resulted in positive signals being obtained for both grasps with p24a , p24b , and tgf- , in addition to gm130 in the growth ( fig . the coiled - coil domain used gave no interaction with grasps on its own ( unpublished data ) , and a number of the p24 proteins tested failed to interact with grasps , even with the coiled coil . purified grasp55 and grasp65 were able to bind directly to the cytoplasmic domains of p24a , p24b , tgf- , and the gm130 cooh terminus immobilized at high density on the surface of agarose beads ( fig . 2 d ) , consistent with the two - hybrid results . no binding was observed to a glutathione s - transferase ( gst ) * control , and only weak binding to other p24 proteins ( fig . the only discrepancy between the two approaches was that the tmp21 cytoplasmic tail , which did not show an interaction in two - hybrid system bound to grasp55 in the protein - binding assay . therefore , grasp55 and grasp65 directly interact with the p24a and p24b cytoplasmic domains , and this recognition is apparently dependent on the oligomeric state of the signal . ( a ) grasp55 and ( b ) grasp65 were screened against the cytoplasmic tails of the p24 proteins indicated , tgf- , and gm130 either with or without a coiled - coil sequence to mediate oligomerization . interactions were selected by the ability to grow on media lacking leucine , tryptophan , histidine , and adenine ( qdo ) after initial growth on minimal media lacking leucine , tryptophan and adenine ( -lwa ) . ( c ) grasp55 and grasp65 two - hybrid interactions were measured using the lac - z reporter gene . gm130 ( -cc ) is the monomeric form of the signal lacking the coiled coil . ( d ) binding of purified grasp55 and grasp65 to gst fusion proteins bearing the cytoplasmic tails of the various p24 proteins , tgf- , and gm130 . we then sought to define the nature of the grasp binding site in the cytoplasmic domain of the p24a protein . visual inspection of the p24a sequence revealed that it ends with two valine residues , identical to tgf- and similar to gm130 . mutation of these residues to alanine reduced the interaction of p24a with grasp55 and grasp65 in the growth ( fig . 3 , a and b ) and lacz reporter two - hybrid assays ( fig . 3 , c and d ) , reminiscent of previous observations that a hydrophobic signal at the extreme cooh terminus of gm130 is needed for it to bind grasp65 ( barr et al . , 1998 ) . alteration of the adjacent arginine residues had no effect on recognition of the signal by either grasp , whereas a double mutant behaved identically to the double valine to alanine mutation ( fig . protein binding assays confirmed that point mutations reducing the two - hybrid interaction between the grasps and the p24a cytoplasmic tail also decrease the interaction between the respective proteins ( fig . therefore , grasp55 and grasp65 directly recognize a signal in the cytoplasmic tail of p24a comprised of the two valines at its extreme cooh terminus , and whereas the adjacent arginines are not important , the contribution of other residues to this signal can not be excluded . a grasp binding motif exists in the p24a cytoplasmic tail . ( a ) grasp55 and ( b ) grasp65 were screened against sequences corresponding to the cytoplasmic tail of wild - type and point mutant forms of p24a either without ( monomer ) or with ( oligomer ) a coiled - coil sequence to mediate oligomerization . interactions were tested for by selection on qdo after initial growth on minimal media lacking leucine and tryptophan ( -lw ) . ( c ) grasp55 and grasp65 two - hybrid interactions were quantitated using the lac - z reporter gene . ( d ) binding of purified grasp55 and grasp65 to gst fusion proteins bearing the wild - type and point mutant forms of the p24a cytoplasmic tail , and gm130 . background binding of grasps to the beads is also shown ( control ) . if the interaction of p24 proteins with grasps is important for their function , disruption of the grasp binding signal should perturb their localization or transport . mutation of the grasp binding site in p24a caused the protein to appear at the cell surface even at low expression levels , whereas the wild - type protein was efficiently retained inside the cell ( fig . quantitation revealed that surface levels of p24a increased fourfold after inactivation of the grasp binding site ( fig . 4 b ) . a double mutation in which the cop ii transport signal was abolished by mutating the two phenylalanines in the p24a cytoplasmic tail to alanine reverted this effect ( fig . the cop ii binding mutation alone was trapped in the er and some adjacent vesicular structures as expected ( fig . 4 a ) ( fiedler et al . , 1996 ) . mutating the two arginines alone had little effect on the transport of p24a to the cell surface , whereas combining the grasp binding site and arginine motif mutations gave a reduced level of transport to the cell surface to half that of the grasp binding mutant alone ( fig . 4 , a and b ) , indicating a transport rather than a retention defect . therefore , the grasp binding site in p24a is required for its efficient retention in the golgi apparatus , but not for p24a transport to the golgi or retention in the er . this signal acts at the level of the golgi , as a cop ii transport signal mutant is trapped in the er , and combining this with the grasp binding mutant reduces cell surface levels of p24a . ( a ) cells were transfected for 18 h with plasmids encoding gfp - tagged p24a with either the wild - type cytoplasmic tail , or mutants abolishing the grasp binding site , vvaa , the phenylalanine and arginine motifs , ffaa and rraa , or combinations thereof , ffvvaa and rrvvaa . total fluorescence was visualized with gfp , and cell - surface fluorescence by an antibody to gfp detected with a cy3-coupled secondary antibody . ( b ) extent of p24a transport to the cell surface was measured for wild - type and mutant p24a tails constructs . this ratio does not approach unity due to the different dyes used to measure surface and total fluorescence . bar , 20 m we initially purified p24 proteins in a complex with grasp55 from golgi membranes , and subsequent analysis revealed that grasp65 also binds to p24 proteins . it is known that four p24 proteins , gp25l , p24a , tmp21 , and p27 , form a stoichiometric complex ( fllekrug et al . , 1999 ) , consistent with our observation that three of these p24 proteins are found in association with grasp55 and grasp65 . the basis for this association appears to be an interaction between the cytoplasmic tail of p24a and the grasps . we also found that p26/p24b , which is not present in the gp25l - containing complex , can interact with grasps in the two - hybrid system . interestingly , the grasp - binding p24 proteins , p24a and p24b , have been shown previously not to interact with cop i ( dominguez et al . , 1998 ) . therefore , our observations may help to explain how complexes containing these two p24 proteins are retained in the golgi , as grasp interaction was only seen when the p24 cytoplasmic tail sequences were oligomerized , and no binding was observed with monomeric p24 tails . this may be a mechanism by which grasps can distinguish p24 protein complexes in the golgi apparatus from those present in the er . a relevant observation in this regard is that complexes containing up to 50 copies of the p24 proteins exist in golgi membranes ( dominguez et al . , 1998 ) . therefore , specific interaction of golgi matrix proteins with p24 proteins in post - er membranes could be an avidity effect , mediated by virtue of the approximately tenfold higher concentration ( compared with the er ) of transported proteins , and presumably cargo receptors , in the golgi apparatus ( quinn et al . the transmembrane precursor of tgf- also binds to grasp55 in the golgi , an interaction necessary for its correct localization and transport ( kuo et al . we show that grasp65 can also bind to the tgf- cytoplasmic domain , raising the possibility that grasps could bind to a variety of transmembrane cargo proteins via their cytoplasmic domains . therefore , interaction with golgi matrix proteins may be a general sequestration mechanism to regulate the transport and retention of integral membrane proteins within the golgi apparatus . antibodies to grasp55 , grasp65 , gm130 , and golgin-45 were described previously ( barr et al . , 1997 ; shorter et al . , 1999 ; short et al . , 2001 ) ; antibodies were raised in rabbits against the peptides ecffervtsgtkmg from p24a , and kcfieeipdetmvi from gp25l . the plasmid encoding green fluorescent protein ( gfp)-tagged p24a was a gift from dr . r. blum ( institut fr physiologie , ludwig maximilians universitt , mnchen , germany ) . the max - planck - institute of biochemistry 's oligonucleotide synthesis laboratory ( martinsried , germany ) provided dna oligonucleotides . grasp55 complexes were purified as described previously ( short et al . , 2001 ) . aliquots of total extract and bound protein complexes were analyzed by sds - page on 10% minigels under nonreducing conditions . proteins were extracted from coomassie blue stained gel slices and digested with sequencing - grade trypsin ( promega ) for analysis of the peptide fragments by maldi - tof ( reflex iii ; bruker ) and probability - based database searching ( perkins et al . , 1999 ) . standard molecular biology techniques were used for the construction of all constructs , and all constructs were confirmed by dna sequencing ( medigenomix ) . double - stranded oligonucleotides corresponding to the cytoplasmic domains of the p24 proteins , tgf- , and the cooh terminus of gm130 were inserted into the ecori and bamhi sites of pgbt9 . containing constructs were made by inserting a pcr - amplified fragment corresponding to amino acids 755974 of gm130 into the ecori site of pgbt9 . the full - length rat grasp55 and grasp65 constructs in pact2 were described previously ( shorter et al . , 1999 ) . yeast two - hybrid assays were performed as described previously ( short et al . , 2001 ) . measurements of lacz reporter gene expression were performed according to the clontech yeast protocol handbook , and the results are expressed in miller units ( miller , 1992 ) . bacterial hexahistidine tagged gst fusion protein constructs for p24 , tgf- , and gm130 were constructed by transferring the ecori and hindiii fragment containing the various tail sequences from pgbt9 to pgat2 . proteins were expressed in bl21(de3 ) for pgat2 constructs at 37c for 3 h , or jm109 for pqe32 constructs at 23c for 18 h. fusion proteins were purified on nitrilotriacetic acid nickel agarose according to the manufacturer 's instructions ( qiagen ) , dialyzed against pbs , and then stored at 80c . for each binding assay , 5 g of gst fusion protein was bound to 10 l glutathione - sepharose ( amersham - pharmacia biotech ) . these beads were incubated in the presence of 10 ng/l grasp55 or grasp65 in a total volume of 200 l pnt ( 25 mm sodium phosphate , ph 7.2 , 100 mm nacl , 0.1% tx-100 ) for 1 h at 4c on a rotating wheel . beads were washed three times with 400 l pnt , and then bound proteins eluted with sample buffer for analysis by sds - page and western blotting . bound grasp proteins were detected using a monoclonal antibody to the hemaglutinin epitope or the 7e10 monoclonal antibody to grasp65 , and gst fusion proteins with a polyclonal antibody to gst . gfp - tagged p24a expression constructs were made by amplification of the p24a lumenal and transmembrane domains using primers that replaced the cytoplasmic domain with the required mutant sequence . these fragments were then cloned back into the gfp - p24 expression vector ( blum et al . , 2000 ) . hela cells plated on glass coverslips were transfected with a plasmid encoding gfp - tagged p24a , or mutants thereof , for 18 h at 37c . cell surface p24a was detected with a sheep antibody to gfp attached to the lumenal domain and a donkey anti sheep secondary coupled to cy3 ( jackson immunoresearch laboratories ) , and total p24a by gfp fluorescence . images were collected using a zeiss axioskop-2 with 63 plan apochromat objective equipped with a 1300 by 1030 pixel cooled - ccd camera ( princeton instruments ) , and metaview software ( universal imaging corp . ) . the ratio of surface to total measured fluorescence was used to normalize the amount of p24a at the cell surface . antibodies to grasp55 , grasp65 , gm130 , and golgin-45 were described previously ( barr et al . , 1997 ; shorter et al . , 1999 ; short et al . , 2001 ) ; antibodies were raised in rabbits against the peptides ecffervtsgtkmg from p24a , and kcfieeipdetmvi from gp25l . the plasmid encoding green fluorescent protein ( gfp)-tagged p24a was a gift from dr . r. blum ( institut fr physiologie , ludwig maximilians universitt , mnchen , germany ) . the max - planck - institute of biochemistry 's oligonucleotide synthesis laboratory ( martinsried , germany ) provided dna oligonucleotides . grasp55 complexes were purified as described previously ( short et al . , 2001 ) . aliquots of total extract and bound protein complexes were analyzed by sds - page on 10% minigels under nonreducing conditions . proteins were extracted from coomassie blue stained gel slices and digested with sequencing - grade trypsin ( promega ) for analysis of the peptide fragments by maldi - tof ( reflex iii ; bruker ) and probability - based database searching ( perkins et al . , 1999 ) . standard molecular biology techniques were used for the construction of all constructs , and all constructs were confirmed by dna sequencing ( medigenomix ) . double - stranded oligonucleotides corresponding to the cytoplasmic domains of the p24 proteins , tgf- , and the cooh terminus of gm130 were inserted into the ecori and bamhi sites of pgbt9 . coiled coil containing constructs were made by inserting a pcr - amplified fragment corresponding to amino acids 755974 of gm130 into the ecori site of pgbt9 . the full - length rat grasp55 and grasp65 constructs in pact2 were described previously ( shorter et al . , 1999 ) . yeast two - hybrid assays were performed as described previously ( short et al . , 2001 ) . measurements of lacz reporter gene expression were performed according to the clontech yeast protocol handbook , and the results are expressed in miller units ( miller , 1992 ) . bacterial hexahistidine tagged gst fusion protein constructs for p24 , tgf- , and gm130 were constructed by transferring the ecori and hindiii fragment containing the various tail sequences from pgbt9 to pgat2 . proteins were expressed in bl21(de3 ) for pgat2 constructs at 37c for 3 h , or jm109 for pqe32 constructs at 23c for 18 h. fusion proteins were purified on nitrilotriacetic acid nickel agarose according to the manufacturer 's instructions ( qiagen ) , dialyzed against pbs , and then stored at 80c . for each binding assay , 5 g of gst fusion protein was bound to 10 l glutathione - sepharose ( amersham - pharmacia biotech ) . these beads were incubated in the presence of 10 ng/l grasp55 or grasp65 in a total volume of 200 l pnt ( 25 mm sodium phosphate , ph 7.2 , 100 mm nacl , 0.1% tx-100 ) for 1 h at 4c on a rotating wheel . beads were washed three times with 400 l pnt , and then bound proteins eluted with sample buffer for analysis by sds - page and western blotting . bound grasp proteins were detected using a monoclonal antibody to the hemaglutinin epitope or the 7e10 monoclonal antibody to grasp65 , and gst fusion proteins with a polyclonal antibody to gst . gfp - tagged p24a expression constructs were made by amplification of the p24a lumenal and transmembrane domains using primers that replaced the cytoplasmic domain with the required mutant sequence . these fragments were then cloned back into the gfp - p24 expression vector ( blum et al . , 2000 ) . hela cells plated on glass coverslips were transfected with a plasmid encoding gfp - tagged p24a , or mutants thereof , for 18 h at 37c . cell surface p24a was detected with a sheep antibody to gfp attached to the lumenal domain and a donkey anti sheep secondary coupled to cy3 ( jackson immunoresearch laboratories ) , and total p24a by gfp fluorescence . images were collected using a zeiss axioskop-2 with 63 plan apochromat objective equipped with a 1300 by 1030 pixel cooled - ccd camera ( princeton instruments ) , and metaview software ( universal imaging corp . ) . the ratio of surface to total measured fluorescence was used to normalize the amount of p24a at the cell surface .
### Summary: : the golgi apparatus is a highly complex organelle comprised of a stack of cisternal membranes on the secretory pathway from the er to the cell surface . this structure is maintained by an exoskeleton or golgi matrix constructed from a family of coiled - coil proteins , the golgins , and other peripheral membrane components such as grasp55 and grasp65 . here we find that tmp21 , p24a , and gp25l , members of the p24 cargo receptor family , are present in complexes with grasp55 and grasp65 in vivo . grasps interact directly with the cytoplasmic domains of specific p24 cargo receptors depending on their oligomeric state , and mutation of the grasp binding site in the cytoplasmic tail of one of these , p24a , results in it being transported to the cell surface . these results suggest that one function of the golgi matrix is to aid efficient retention or sequestration of p24 cargo receptors and other membrane proteins in the golgi apparatus .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : percutaneous cardiopulmonary support ( pcps ) is a mode of circulatory support provided to bridge patients with severe cardiac failure to recovery or heart transplantation.1)2 ) if venoarterial pcps is applied , left heart distension and pressure overload may develop and lead to pulmonary edema , subendocardial ischemia , and further deterioration of left ventricular function . therefore , left heart decompression is often necessary following pcps.3 - 5 ) although the percutaneous transseptal approach is considered to be more practical and leads to less complications than other techniques , it fails to effectively achieve left heart decompression in adult patients.6)7 ) we report a case of successful left heart decompression in an adult during pcps by using percutaneous transseptal left atrium ( la ) drainage with a large venous cannula . a 28-year - old male was referred to our unit with a 4-week history of high fever . laboratory results confirmed anemia , thrombocytopenia , decreased fibrinogen level . bone marrow biopsy confirmed hemophagocytosis in the bone marrow and reduced natural killer - t cell activity . steroid and intravenous immunoglobulin were administered , but on the fifth hospital day the patient developed hemodynamic failure despite increased medical support . he was transferred to the intensive care unit , where echocardiography revealed severe left ventricular systolic dysfunction with an ejection fraction of 20% . on the next day , the patient experienced a seizure followed by pulseless cardiac arrest . pcps was rapidly applied using a 21-fr venous cannula in the right femoral vein and a 17-fr arterial cannula in the right femoral artery ( fig . stable blood pressure was maintained but pulmonary edema and left heart distention rapidly deteriorated ( fig . thirty - four hours later , it was decided to perform percutaneous transseptal la decompression under fluoroscopic guidance . transseptal puncture was performed via the left femoral vein using a brockenbrough transseptal needle with a 8-fr mullin sheath . a 28-fr cannula was positioned in the la after dilating the puncture site of the atrial septum with a percutaneous mitral valvuloplasty dilator . the patient 's pulmonary edema improved considerably , and his distended left heart diminished ( fig . 2 ) . decompression continued for 5 days , and the patient was weaned from pcps after a total of 6 days following restoration of stable hemodynamics without neurologic sequelae . echocardiography performed 4 months after discharge revealed normal left ventricular function without left to right shunting through the transseptal puncture site . hlh is often a fatal disease caused by specific gene mutations , various infections , hematologic malignancies , autoimmune disorders or drugs . hlh may manifest with multiple organ dysfunction , including cardiac involvement.8)9 ) according to the extracorporeal life support organization registry , there was an increase in the proportion of pediatric patients undergoing la decompression over the study period , from 4% between 1995 and 1998 , to 30% between 2003 and 2006.2 ) however , the data regarding adult patients are limited , and the frequency of left heart decompression and success rates have not been reported . as ischemic heart disease a very common underlying conditions in adult patients with pcps , there may be greater need for left heart decompression in adult patients than in pediatric patients . therefore , it is important to develop a useful left heart decompression method in adult patients during pcps . aiyagari et al.6 ) showed that adequate decompression of the left heart could be achieved by transseptal left atrial sheath placement incorporated into an extracorporeal membrane oxygenation venous circuit in a study of 7 cases . larger la cannulae diameters and higher maximum la cannula flow rates indexed to body surface area were associated with more satisfactory left heart decompression.6 ) poor outcomes in adult patients may be attributable to small cannula size . therefore , we inserted a large cannula ( 28-fr ) into the la under fluoroscopic guidance for our patient . transsepal left heart catheterization using a large cannula has been widely applied to manage patients with various indications , such as ablation of atrial fibrillation and percutaneous mitral valvuloplasty , in which its safety and feasibility have been demonstrated.10 - 12 ) in addition , gradual dilation of the puncture site in the atrial septum may lower the risk of complications . to our knowledge , this is the first report describing effective left heart decompression and successful weaning of pcps via percutaneous transseptal la drainage in an adult patient . in summary , percutaneous transseptal left atrial drainage with a large venous cannula appears to be feasible and effective for the decompression of the left heart in adult patients during pcps .
### Summary: : a 28-year - old male with hemophagocytic lymphohistiocytosis presented with left ventricular dysfunction and cardiac arrest . percutaneous cardiopulmonary support ( pcps ) was initiated , but left heart distension developed with associated aggravation of pulmonary edema . percutaneous transseptal left atrial sheath ( 28-fr ) drainage was incorporated into the pcps venous circuit under fluoroscopic guidance to enable left heart decompression 1 days after pcps initiation . the patient 's pulmonary edema improved markedly , and distention of his left heart diminished . he was successfully weaned from pcps 5 days later . percutaneous transseptal left atrial drainage with large venous cannulae is feasible and effective in decompressing the left heart in adult patients during pcps .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : a retrospective chart analysis was performed to identify 89 patients who presented acute symptoms due to hemorrhagic pituitary adenoma and underwent a ttea for resection of the lesion at qilu hospital of shandong university between july 2004 and june 2014 . records of those patients were evaluated for patient age , sex , presentation , tumor size , extent of resection , clinical outcomes , and surgical complications . patients without any acute symptom who preoperatively , however , informed apoplexy intraoperatively were excluded from this study , because those patients were asymptomatic and treated as general pituitary adenoma . the protocol for this study was reviewed and approved by the ethics committee of qilu hospital of shandong university ( no . patients were diagnosed as having acute symptoms of headache and visual loss , signs of hemorrhage on imaging examinations , and subsequent course , such as informed findings intraoperative . all the patients were performed emergent eeta for resection of hemorrhagic pituitary adenoma in 24 hours of initial symptoms . tumor with old blood clot was removed with curettage and/or suction , and a 30 endoscope was used to inspect the sellar region for residual tumor which was removed . mr imaging was performed within 13 days and at 3 months after surgery to evaluate the extent of tumor resection . extent of resection was classified into 4 categories : total resection , subtotal resection , partial resection , and insufficient resection . patients were instructed to avoid any activity that can raise intracranial pressure such as valsalva maneuvers or nose blowing . early postoperative diabetes insipidus ( di ) was treated with subcutaneous injection of hypophysin for 3 days . we do not use controlled released vasopressin tannate because its effects may be difficult to control , and because it is an inconvenient method of treatment for patients . this 43-year - old female patient presented with severe headache and acute deterioration of visual acuity and field . admission t1-weighted mr imaging demonstrated hemorrhage in a pituitary tumor and obvious compression of the optic chiasm ( fig . the patient was treated with emergent endoscopic transsphenoidal surgery within 24 hours of initial presentations . intraoperative endoscopic views showed dural of the sellar floor was bluish violet and under high tension ( fig . after surgery , her headache disappeared and visual acuity obviously improved to 0.5/0.8 bilaterally , with resolution of hemipanopia . on follow - up at 6 months mr imaging for 43-year - old female patient presenting with severe headache and acute deterioration of visual acuity and field . initial sagittal ( a ) and coronal ( b ) t1-weighted mr imaging demonstrated hemorrhage ( black arrowhead ) in a pituitary tumor and marked compression of the optic chiasm ( white arrowhead ) . the patient was treated with emergent endoscopic transsphenoidal surgery within 24 hours of initial presentations . intraoperative endoscopic views showed dural of the sellar floor was bluish violet and under high tension ( black arrowhead ) , ( c ) tumor ( black arrowhead ) and hemorrhage ( blue arrowhead ) underneath of the dural ( d ) . e , f , following - up mr imagings . on follow - up at 6 months postoperatively , sagittal ( e ) and coronal ( f ) t1-weighted mr imaging demonstrated no recurrence or residual of the adenoma . ( blue arrowhead ) optic chiasm ( red fine arrowhead , e ) and pituitary stalk ( red bold arrowhead , f ) also were showed clear . a retrospective chart analysis was performed to identify 89 patients who presented acute symptoms due to hemorrhagic pituitary adenoma and underwent a ttea for resection of the lesion at qilu hospital of shandong university between july 2004 and june 2014 . records of those patients were evaluated for patient age , sex , presentation , tumor size , extent of resection , clinical outcomes , and surgical complications . patients without any acute symptom who preoperatively , however , informed apoplexy intraoperatively were excluded from this study , because those patients were asymptomatic and treated as general pituitary adenoma . the protocol for this study was reviewed and approved by the ethics committee of qilu hospital of shandong university ( no . patients were diagnosed as having acute symptoms of headache and visual loss , signs of hemorrhage on imaging examinations , and subsequent course , such as informed findings intraoperative . all the patients were performed emergent eeta for resection of hemorrhagic pituitary adenoma in 24 hours of initial symptoms . tumor with old blood clot was removed with curettage and/or suction , and a 30 endoscope was used to inspect the sellar region for residual tumor which was removed . mr imaging was performed within 13 days and at 3 months after surgery to evaluate the extent of tumor resection . extent of resection was classified into 4 categories : total resection , subtotal resection , partial resection , and insufficient resection . patients were instructed to avoid any activity that can raise intracranial pressure such as valsalva maneuvers or nose blowing . early postoperative diabetes insipidus ( di ) was treated with subcutaneous injection of hypophysin for 3 days . we do not use controlled released vasopressin tannate because its effects may be difficult to control , and because it is an inconvenient method of treatment for patients . this 43-year - old female patient presented with severe headache and acute deterioration of visual acuity and field . admission t1-weighted mr imaging demonstrated hemorrhage in a pituitary tumor and obvious compression of the optic chiasm ( fig . the patient was treated with emergent endoscopic transsphenoidal surgery within 24 hours of initial presentations . intraoperative endoscopic views showed dural of the sellar floor was bluish violet and under high tension ( fig . after surgery , her headache disappeared and visual acuity obviously improved to 0.5/0.8 bilaterally , with resolution of hemipanopia . on follow - up at 6 months postoperatively , mr imaging demonstrated no recurrence or residual adenoma ( fig . mr imaging for 43-year - old female patient presenting with severe headache and acute deterioration of visual acuity and field . initial sagittal ( a ) and coronal ( b ) t1-weighted mr imaging demonstrated hemorrhage ( black arrowhead ) in a pituitary tumor and marked compression of the optic chiasm ( white arrowhead ) . blue triangles point to the adenoma ( a , b ) . the patient was treated with emergent endoscopic transsphenoidal surgery within 24 hours of initial presentations . intraoperative endoscopic views showed dural of the sellar floor was bluish violet and under high tension ( black arrowhead ) , ( c ) tumor ( black arrowhead ) and hemorrhage ( blue arrowhead ) underneath of the dural ( d ) . e , f , following - up mr imagings . on follow - up at 6 months postoperatively , sagittal ( e ) and coronal ( f ) t1-weighted mr imaging demonstrated no recurrence or residual of the adenoma . ( blue arrowhead ) optic chiasm ( red fine arrowhead , e ) and pituitary stalk ( red bold arrowhead , f ) also were showed clear . cohort consisted of 37 ( 41.6% ) male and 52 ( 58.4% ) female patients aged 1473 years ( mean 41.8 years ) . the most frequent clinical presentation was onset of severe headache , 86 ( 96.6% ) patients experienced headache in this series , followed by nausea and vomiting ( 93.3% ) , and then deterioration of visual acuity and visual field with rates of 80.9% and 73.0% , respectively . as results of the preoperative radiological study , 46 ( 51.7% ) showed suprasellar extension , 15 had cavernous sinus invasion , 20 showed suprasellar and cavernous sinus extension , and only 8 patients were intrasellar . thirty one ( 34.8% ) of the 89 adenomas were active secreting , most of which were prl - secreting adenoma , accounting for 19.1% of 89 patients ( table 1 ) . seventy eight ( 87.7% ) patients achieved total resection , 7 ( 7.9% ) had subtotal resection , and 2 ( 2.2% ) patients had partial resection ; no patient experienced insufficient resection . after surgery , 57 ( 90.5% ) of 63 patients who had visual acuity deterioration preoperatively obtained visual acuity improvement and normalization , and the rate for visual field improvement was 87.5% . other symptoms , such as severe headache , mental status alteration , and loss of consciousness , had recovery with 100% of the rates . endocrinological remission encountered in 28 ( 90.4% ) of 31 patients with active secreting adenoma . three ( 3.4% ) patients incurred csf leakage which was managed with lumbar drainage . nine ( 10.1% ) patients incurred transient di postoperatively , and 2 ( 2.2% ) of them developed persistent di . seven ( 7.9% ) patients developed hypopituitarism which was treated with replacement therapy of hormone . one ( 1.1% ) experienced craniotomy for intracranial hemorrhage and died from severe surgical complications postoperatively . apoplectic pituitary adenoma consists of approximately 10% of pituitary adenoma , and is associated with severe morbidity and potential fatality . the pathophysiological mechanism of the lesion is not being explained clearly , although pregnancy , trauma , surgery , dynamic endocrine testing , and stress can be precipitating factors . hemorrhagic apoplectic pituitary adenoma may consist of majority of these fatal clinical syndromes , and may present a series of acute symptoms including onset of severe headache , sudden decreased vision , nausea and vomiting , altered consciousness , and infrequently cranial nerve palsy . most pituitary tumor apoplexy occurs in pituitary adenoma , although ectopic pituitary apoplexy has been described in the cavernous sinus and the clivus . the management of hemorrhagic pituitary adenoma usually involves medical treatment and emergent transsphenoidal resection of lesion , early detection and effective decompression of the optic chiasm and optic nerve may be crucial to prevent mortality . hemorrhagic apoplectic pituitary adenoma can occur in any age group ; the majority of this population was middle - aged patients who aged 3049 years , which accounted for 61.8% of 89 patients and was consistent with prior reports . the most frequent complaint was onset of severe headache , 86 ( 96.6% ) patients presented above symptom in this series , followed by nausea and vomiting with rate of 93.3% , headache and nausea were associated with rapid compression of sellar and parasellar structures due to expansion of hemorrhagic pituitary adenoma , and headache may also have resulted from meningeal irritation . optic chiasm and optic nerve compression from hemorrhagic pituitary adenoma also result in sudden deterioration of visual acuity and visual field , with rates of 80.9% and 73.0% , respectively , in our series . alerted mental status was uncommon , which occurred in 5 ( 5.6% ) patients in the current study , but more likely to indicate damage to hypothalamus and emergent surgical management . apoplectic hemorrhage of pituitary adenoma most typically encountered in macroadenoma , with predominance of inactive secreting adenoma . the rates of macroadenoma and inactive secreting adenoma were 91% and 65.2% in the present study in agreement with prior reports . of active secreting adenomas accounted for 34.8% of the pituitary adenomas with hemorrhagic apoplexy , the majority was prolactin ( prl ) secreting adenomas with a rate of 19.1% , which is correlated with the high prevalence of prl - adenoma . the rate of biochemical remission for active secreting adenoma was 90.4% in our series . during follow - up period of mean 51 months , 87.7% patients obtained total resection ( table 2 ) , which is comparable with prior reports of endoscopic transsphenoidal surgery . the rate of resection may be associated with appropriate approach , surgeon 's experience , morphological and biological characteristics of tumor , such as volume , location , and adherence . in our opinion , good lighting and panoramic view provided by the endoscope allows a neurosurgeon to obtain a better surgical condition , which together with meticulous and precise manipulation permits the neurosurgeon to resect lesion more extensively with less injury . during the operation , the use of angled endoscopes allows the surgeon to remove the tumor around corners of surgical field . moreover , hemorrhage from pituitary adenoma apoplexy may be helpful to resection with lower risk of impairment to parasellar neurovasculature . acute deterioration of visual acuity and visual field may be associated with rapid compression of chiasm and optic nerve due to sudden extension of the adenoma caused by intratumoral hemorrhage . cardoso et al indicated in a review that the level of visual recovery depended mainly on early and effective transsphenoidal decompression rather than on the severity of initial visual loss . all the patients underwent emergent endoscopic transsphenoidal decompression of optic chiasm or nerve in 24 hours of onset of initial symptoms . preoperative deterioration visual acuity and visual field were normalized or improved significantly with 90.5% and 87.5% of rates respectively , which supported previous reports . as our experience , timely and effective endoscopic transsphenoidal decompression facilitated improvement of visual symptoms . despite techniques of skull base reconstruction , csf leak remains a considerable associated complication of ets . three ( 3.4% ) patients in this series experienced postsurgical csf leak which was managed successfully with lumbar drainage , which is comparable to previously reported rates of csf leak from ets for the sellar and parasellar region . factors that may lead to csf leak include surgical manipulation , surgeon 's experience , tumor 's location , volume , and relationship to surrounding neurovascular structures . the most important factor that leads to postoperative csf leakage might be repair technique of the skull base , although feature of the tumor and surgeon 's preference may affect surgical result . in our institute , we routinely used reconstruction of skull base on the basis of the multilayered technique with or without pnsf resulting in an excellent result , which showed that hemorrhage from pituitary tumor apoplexy did not affect reconstruction of the skull base or increase occurrence of csf leakage . furthermore , the unparalleled panoramic endoscopic view in ets enables detection of tiny fistulas which can be repaired with skull base reconstruction . it is possible that surgical manipulation to the sellar in the context of preexisting compromise of the blood supply to the magnocellular neurons of the hypothalamus from apoplexy manifested as a reversible disturbance of arginine vasopressin ( avp ) transport to the posterior pituitary gland . in this study , however , the presence of permanent di ( 2.2% ) is lower than most reported rates , and indicates that most surgical injury is reversible . pituitary dysfunction may be associated with compression or destruction of the posterior labe of pituitary gland from hemorrhagic apoplexy . chowdhury et al observed in a series of 152 patients that 71% of the patients with apoplexy encountered postsurgical di . also , 16% incidence of transient di in patients of pituitary apoplexy was reported in a series of randeva et al . the above observations may indicate that incurrence of di was associated with pituitary apoplexy ; therefore , timely decompression was crucial for saving endocrinological function of pituitary gland . besides interruption of the blood supply to pituitary gland due to hemorrhage , injury or edema of pituitary stalk is an important reason that results in postoperative di . nemergut et al found that postoperative di , both transient and permanent , may be associated with intraoperative leak resulting from aggressive manipulation ; however , our results did not support the above conclusion . meticulous manipulation to avoid track injury of pituitary stalk may decrease the risk of postoperative endocrinological complication . all the patients encountering hypopituitarism postoperatively were managed by replacement of hormone with better outcomes . intracranial hemorrhage after endoscopic resection of acute hemorrhagic pituitary tumor is uncommon and lethal , which often occurs in 12 hours after surgery , and also often encounters in the patients who experienced subtotal removal of macroadenoma . patel and colleagues reported a patient of delayed postoperative pituitary hemorrhagic apoplexy treated by emergent reexploration . in our series , 1 ( 1.1% ) any acute complication from hemorrhagic apoplectic pituitary tumor can lead to death ; cares should be taken to prevent perioperative hemorrhage . hemorrhagic apoplectic pituitary adenoma can occur in any age group ; the majority of this population was middle - aged patients who aged 3049 years , which accounted for 61.8% of 89 patients and was consistent with prior reports . the most frequent complaint was onset of severe headache , 86 ( 96.6% ) patients presented above symptom in this series , followed by nausea and vomiting with rate of 93.3% , headache and nausea were associated with rapid compression of sellar and parasellar structures due to expansion of hemorrhagic pituitary adenoma , and headache may also have resulted from meningeal irritation . optic chiasm and optic nerve compression from hemorrhagic pituitary adenoma also result in sudden deterioration of visual acuity and visual field , with rates of 80.9% and 73.0% , respectively , in our series . alerted mental status was uncommon , which occurred in 5 ( 5.6% ) patients in the current study , but more likely to indicate damage to hypothalamus and emergent surgical management . apoplectic hemorrhage of pituitary adenoma most typically encountered in macroadenoma , with predominance of inactive secreting adenoma . the rates of macroadenoma and inactive secreting adenoma were 91% and 65.2% in the present study in agreement with prior reports . of active secreting adenomas accounted for 34.8% of the pituitary adenomas with hemorrhagic apoplexy , the majority was prolactin ( prl ) secreting adenomas with a rate of 19.1% , which is correlated with the high prevalence of prl - adenoma . the rate of biochemical remission for active secreting adenoma was 90.4% in our series . during follow - up period of mean 51 months , 87.7% patients obtained total resection ( table 2 ) , which is comparable with prior reports of endoscopic transsphenoidal surgery . the rate of resection may be associated with appropriate approach , surgeon 's experience , morphological and biological characteristics of tumor , such as volume , location , and adherence . in our opinion , good lighting and panoramic view provided by the endoscope allows a neurosurgeon to obtain a better surgical condition , which together with meticulous and precise manipulation permits the neurosurgeon to resect lesion more extensively with less injury . during the operation , the use of angled endoscopes allows the surgeon to remove the tumor around corners of surgical field . moreover , hemorrhage from pituitary adenoma apoplexy may be helpful to resection with lower risk of impairment to parasellar neurovasculature . acute deterioration of visual acuity and visual field may be associated with rapid compression of chiasm and optic nerve due to sudden extension of the adenoma caused by intratumoral hemorrhage . cardoso et al indicated in a review that the level of visual recovery depended mainly on early and effective transsphenoidal decompression rather than on the severity of initial visual loss . all the patients underwent emergent endoscopic transsphenoidal decompression of optic chiasm or nerve in 24 hours of onset of initial symptoms . preoperative deterioration visual acuity and visual field were normalized or improved significantly with 90.5% and 87.5% of rates respectively , which supported previous reports . as our experience , timely and effective endoscopic transsphenoidal decompression facilitated improvement of visual symptoms . despite techniques of skull base reconstruction , csf leak remains a considerable associated complication of ets . three ( 3.4% ) patients in this series experienced postsurgical csf leak which was managed successfully with lumbar drainage , which is comparable to previously reported rates of csf leak from ets for the sellar and parasellar region . factors that may lead to csf leak include surgical manipulation , surgeon 's experience , tumor 's location , volume , and relationship to surrounding neurovascular structures . the most important factor that leads to postoperative csf leakage might be repair technique of the skull base , although feature of the tumor and surgeon 's preference may affect surgical result . in our institute , we routinely used reconstruction of skull base on the basis of the multilayered technique with or without pnsf resulting in an excellent result , which showed that hemorrhage from pituitary tumor apoplexy did not affect reconstruction of the skull base or increase occurrence of csf leakage . furthermore , the unparalleled panoramic endoscopic view in ets enables detection of tiny fistulas which can be repaired with skull base reconstruction . it is possible that surgical manipulation to the sellar in the context of preexisting compromise of the blood supply to the magnocellular neurons of the hypothalamus from apoplexy manifested as a reversible disturbance of arginine vasopressin ( avp ) transport to the posterior pituitary gland . in this study , however , the presence of permanent di ( 2.2% ) is lower than most reported rates , and indicates that most surgical injury is reversible . pituitary dysfunction may be associated with compression or destruction of the posterior labe of pituitary gland from hemorrhagic apoplexy . chowdhury et al observed in a series of 152 patients that 71% of the patients with apoplexy encountered postsurgical di . also , 16% incidence of transient di in patients of pituitary apoplexy was reported in a series of randeva et al . the above observations may indicate that incurrence of di was associated with pituitary apoplexy ; therefore , timely decompression was crucial for saving endocrinological function of pituitary gland . besides interruption of the blood supply to pituitary gland due to hemorrhage , injury or edema of pituitary stalk is an important reason that results in postoperative di . nemergut et al found that postoperative di , both transient and permanent , may be associated with intraoperative leak resulting from aggressive manipulation ; however , our results did not support the above conclusion . meticulous manipulation to avoid track injury of pituitary stalk may decrease the risk of postoperative endocrinological complication . all the patients encountering hypopituitarism postoperatively were managed by replacement of hormone with better outcomes . intracranial hemorrhage after endoscopic resection of acute hemorrhagic pituitary tumor is uncommon and lethal , which often occurs in 12 hours after surgery , and also often encounters in the patients who experienced subtotal removal of macroadenoma . patel and colleagues reported a patient of delayed postoperative pituitary hemorrhagic apoplexy treated by emergent reexploration . in our series , 1 ( 1.1% ) any acute complication from hemorrhagic apoplectic pituitary tumor can lead to death ; cares should be taken to prevent perioperative hemorrhage . in the current series , we obtained excellent surgical outcomes and comparable lower complications after ets for management of hemorrhagic apoplectic pituitary adenoma . acute hemorrhage from apoplectic pituitary tumor is an emergent and life - threatening condition that may require surgical intervention to prevent progression and morbidity . on the contrary , ets provided a safe and effective surgical option for acute hemorrhagic apoplexy of pituitary adenoma . early detection and timely emergent endoscopic transsphenoidal surgery resulted in a favorable surgical outcome with low rate of surgical complications .
### Summary: : objective : to assess safety and effectiveness of endoscopic transsphenoidal surgery ( ets ) for acute hemorrhagic apoplectic pituitary adenoma.methods:eighty nine patients with hemorrhagic apoplectic pituitary tumor undergoing endoscopic transsphenoidal surgery were included into a retrospective chart of this study . charts were reviewed for patient age , sex , presentation , lesion size , surgical procedure , extent of resection , clinical outcome , and surgical complications.results:seventy eight ( 87.7% ) patients achieved total resection , 9 ( 10.1% ) had subtotal resection , and 2 ( 2.2% ) patients had partial resection ; no patient experienced insufficient resection . after surgery , 65 ( 90.3% ) of 72 patients who had visual acuity deterioration preoperatively normalized and improved significantly ; the rate for remission of visual field was 87.7% . all other acute symptoms , such as severe headache , nausea , vomiting , alteration of mental status , and loss of consciousness , vanished postoperatively . twenty eight ( 90.4% ) of 31 patients with active secreting adenoma had hormonal remission based on endocrinological evaluation . three ( 3.4% ) patients incurred csf leakage which was managed with lumbar drainage . nine ( 10.1% ) patients incurred transient di postoperatively , and 2 ( 2.2% ) of them developed permanent di . seven ( 7.9% ) patients developed hypopituitarism which was treated with replacement therapy of hormone . one ( 1.1% ) experienced craniotomy for intracranial hemorrhage and died from severe surgical complications postoperatively . there were no patients of meningitis or carotid artery injury.conclusion:early detection and emergent endoscopic transsphenoidal surgery provided a safe and effective surgical option for hemorrhagic apoplectic pituitary tumor with a low morbidity and mortality .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : avulsion amputation of the fingers is fortunately rare . a forceful pull on a ring worn by a person can lead to a wide variety of injuries from a simple contusion to total degloving and amputation . current trend is to replant the avulsed tissue in spite of a high rate of failure . a number of additional procedures such as venous flaps and arterialised venous flaps have been reported by various authors . however , there is a group of patients where either the avulsed part is missing or mutilated and unsuitable for revascularisation . many grafts and local and distant flaps have been reported to cover the stump after avulsion of the ring finger in various combinations . these include split skin grafts , full thickness skin grafts , cross finger flaps , fillet flaps , local flaps from the hand and groin and abdominal flaps . there has also been a preference for a revision amputation due to poor results of attempts at reconstruction . the use of de - epithelialised flaps has been described for various applications including hand and finger injuries . in 2010 abo - hashem azab moosa reported the use of double cross finger flaps to cover the stump of the injured finger in a series of 22 cases with good results followed - up for a mean period of 6 months . the author has performed a similar procedure in three patients in 1987 , but was not able to follow these patients and hence could not publish his results . these cases were presented at the annual conference of the association of plastic surgeons of india at baroda in 1988 as the sandwich technique. one of the patients returned to the hospital for some other reason in 2012 and provided us with an opportunity to see a 25 year follow - up of this technique . a 33-year - old right handed male small time businessman presented with a history of injury to his left ring finger . his ring was caught in some part of a bus as he alighted and the bus moved forward pulling off his finger [ figure 1 ] . on examination , there was a total loss of the terminal phalanx and degloving of the middle phalanx . it was decided to salvage the degloved middle phalanx using a cross finger flap each from the two adjoining fingers . the flap from the middle finger provided cover for the volar aspect and the tip of the ring finger . the de - epithelialised flap from the little finger was used to cover the dorsal aspect of the ring finger . the flaps were divided and set in after 3 weeks . the healing was primary and the recovery was uneventful [ figures 2 and 3 ] . after a month , the patient was given a locally manufactured inexpensive prosthesis made of polyvinylchloride on a trial basis . silicon prosthesis was to be made to order if the patient found the prosthesis useful . , the patient brought his son , who had sustained burns , to the hospital to consult the author and we had an opportunity to see a long term follow - up of the procedure [ figures 47 ] . a 25 year follow - up - open hand a 25 year follow - up complete fist open hand with temporary prosthesis for dress occasions the cosmetic appearance of the finger was compromised because of the absence of the terminal phalanx . the grip was good demonstrating the value of saving the proximal inter phalangeal joint and a length of the middle phalanx . although the author was trying to save a stump for accommodating prosthesis , the patient seemed to be more comfortable without one . this was one of the reasons that he did not come for follow - up . the injury occurs when a ring worn by a person gets caught in the moving part of a machine . we have seen patients who were injured when the ring was caught in a moving vehicle , while the person wearing the ring was alighting . the severity of the injury varies from bruising to total amputation of the terminal phalanx and degloving of the middle phalanx , as was the case in this patient . replantation of the digit or revascularisation of the avulsed soft tissue is the first choice in management . where replantation is not possible because of mutilation or loss of tissue , attempt should be made to save the length of the finger . the tissue closest to the defect is the best in terms of colour and texture match and causes least inconvenience of immobilisation . for that reason the author chose to use cross finger flaps to cover the stump . the recovery was uneventful and a short term follow - up showed a good result . a better prosthesis was to be made once the patient was satisfied about its usefulness . the patient decided that he felt better without the prosthesis and hence did not attend follow - up . cosmetic prostheses in fingers are not very popular with working class patients in india because they hamper function . many procedures are available for the salvage of a non replantable ring avulsion injury . in our hands , the simple procedure of cross finger flaps has given a good long - term result . although the intention was to provide a stump on which the patient could wear prosthesis the patient chose to avoid the latter .
### Summary: : avulsion amputation of the fingers are rare . current trend is to replant the avulsed tissue in spite of a high rate of failure . there are situations where replantation is not possible . various salvage procedures have been mentioned . the author is presenting a 25 year follow up of a double cross finger flap done in 1987 . a similar procedure has been reported by other authors but with a short term follow up .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : temporal lobe epilepsy ( tle ) manifests with partial seizures whose semiology can reflect a dynamic interplay among several anatomical divisions of the temporal lobe , in addition to their sites of origin . approximately 20%30% of tle patients are intractable to treatment with antiepileptic drugs though they may still benefit from surgical resection of the epileptogenic focus ( ef ) . it is , therefore , essential to localize the ef in patients with focal epilepsy and to discern the large - scale cortical and subcortical networks involved in seizure generation . this is best achieved with the use of simultaneous , multimodal techniques that are able to elucidate complex functional relationships through converging or parallel operations . the development of electroencephalogram ( eeg ) recording of epileptic patients inside a magnetic resonance imaging ( mri ) scanner was largely driven by the necessity of localizing and delineating mesial or deeply originating ef electrically and metabolically during presurgical evaluation [ 37 ] . the concurrent measures allow for the monitoring of abnormal hypersynchronous events in the ef , as well as the full - brain coverage of variations in blood flow and oxygenation in response to epileptic discharges conducive to a wide range of research applications within epileptology . simultaneous eeg - fmri has the potential to become a routine diagnostic test , complementing the diagnostic accuracy of clinical acumen and eeg to greatly improve medical and surgical managements of patients with intractable epilepsy , a goal that was set since its first introduction . investigation of spontaneous , low - frequency , and blood - oxygenation - level - dependent ( bold ) fluctuations measured by fmri has revealed spatially organized and distributed brain networks [ 816 ] . the coherent patterns of hemodynamic oscillations occur in the absence of any overt task and as such are referred to as resting - state networks ( rsns ) . rsns are believed to be the epiphenomenon of endogenous neural activity and shaped by structural connections [ 16 , 1821 ] though their functional significance and neuronal correlate remain an active area of research [ 22 , 23 ] . alterations of rsns have recently been reported in several conditions , including psychiatric and developmental disorders , alzheimer 's disease , schizophrenia , coma , and epilepsy [ 2730 ] , revealing changes in connectivity between network nodes . by contrast , spontaneous neuronal rhythm measured using eeg evince endogenous patterns of connectivity and synchronicity underlying states of attention , perception , and consciousness . a comprehensive understanding of the functional network dynamics related to the electrical activity recorded from the ef during ictal and interictal epileptiform discharges ( ieds ) remains elusive [ 3235 ] . however , empirical evidence does indicate disruption of the normal distributed networks ; temporal lobe ieds of patients with complex partial seizures secondary to tle have been reported to affect the activity in regions comprising the default - mode rsn ( discussed below ) . therefore , spontaneous neural activity and its associated hemodynamic manifestation ( bold contrast ) allow not only for the noninvasive exploration of temporal and spatial patterns of the brain but can also be envisaged as early diagnostic or prognostic markers of disease states [ 14 , 24 , 3743 ] . this review places an emphasis on the fundamentals of spontaneous eeg - fmri and extends the unified framework we previously proposed to a new avenue of exploring the neuronal and physiological basis underlying intrinsic brain activity . only studies relevant to specific aspects of simultaneous eeg - fmri in mesial tle ( mtle ) studies in the context of resting state including seizure - induced alterations of the conscious state are discussed in here . the prevalent strategy is to continuously sample the interictal and ictal events while measuring the bold signal for spontaneous eeg - fmri study . unfortunately , continuous - recording eeg on epileptic patients inside the magnet suffers various kinds of noise problems such as muscle contraction motions , eye movements , perspiration , 50/60 hz power interference , and ballistocardiogram . motion - related artifacts of patients such as involuntary gross head movements , swallowing , and coughing can also impose adverse consequence on both eeg signals and mri images . as such , these confounds make data acquisition in the high - field environment more difficult through deteriorating the shimming performance and causing unexpected susceptibility issues arising from magnetic field inhomogeneities at air - tissue interfaces . there have been a number of postprocessing methods developed to handle the epileptic electrophysiological data by focusing on the focal spike density , phase coherence [ 3235 , 46 ] , and noise separation . but , many of these artifacts including signal loss , image distortion , and poor bold contrast - to - noise ratio can occur both focally and globally in an unpredictable manner . they may also vary slowly with physiological vitals , extending beyond straightforward image misregistration and invoking more advanced mathematical techniques to mitigate these confounds . independent component analysis ( ica ) has emerged as a popular data - driven method that has been used successfully to remove ballistocardiogram and other mri - related artifacts during the past decade [ 4751 ] . for the purposes of reliably detecting clean , discrete interictal and ictal spike events , noise components either from statistically independent decomposition or adequately sampled recording in a specific reference channel can be simply subtracted out from an unsaturated raw eeg trace , or in more elaborate techniques such as adaptive noise cancellation . nevertheless , ica has been successfully utilized to reveal intrinsic functional connectivity patterns of rsns in human and animal fmri data sets [ 8 , 11 , 12 , 52 ] . besides the difficulties summarized above , the relation between the detectable anatomical abnormalities , epileptic neuronal activity ( i.e. , various types of epileptic seizures ) , and functional mri signal remains largely unclear [ 53 , 54 ] . this elusive relationship also generates a strong motivation for those seeking to improve the recording eeg inside the mri scanner . one of many emerging issues is to detect the high - frequency oscillations with clinical instruments . previously bold changes have been reported to occur before the happening of ieds in patients with focal epilepsies , suggesting the alteration of synchronized neuronal activity in the spike field before the generation of eeg spike . similar findings have been reported before the onset of epileptic seizures [ 56 , 57 ] . in the study by jacobs and colleagues , the early focal bold changes were localized in the mesial temporal lobe where neuronal activity might not be detectable by the scalp eeg . scalp potentials arise from the spatial summation of synchronous dipole moments over the neocortical volume with a weighting that depends upon the anisotropic conductivity of the cranium [ 58 , 59 ] . areas that are too deep or lack a sufficient amount of synchrony are unable to produce a measurable potential difference on the scalp . the blurring and low - pass filtering effects of the skull and scalp can be overcome with invasive depth recordings , as only a fraction of spikes recorded intracranially in mtle patients are detectable by the eeg . more recently with small clinical contacts and clinical amplifiers , high - frequency oscillations ( hfos , referred to as ripples 80250 hz and fast ripples 250500 hz ) have been recorded in animal and human subjects [ 6062 ] , suggesting a possible relation with ictogenesis [ 61 , 63 , 64 ] and epileptogenesis . moreover , chtillon and colleagues demonstrated that the contact size did not significantly affect hfo detection in intracerebral eeg recordings in a rat epilepsy model . they have shown that the optimal size of a recording electrode should be dependent on the potential generation , distribution , amplitude , and frequency of the targeted signal , even though it was conventionally deemed that the contact size may influence hfo recording ability by affecting impedance and sampling volume . specifically , they suggested there should be no difference in hfo detection in human recordings using contact from 0.036 mm to 1.698 mm . the generation of the hfo varies in anatomical structures and pathological conditions that could lead to the difference in its detectability reported by different groups . further research with regard to synchrony in large neuronal circuitry is needed for detailed and complete understanding of the underlying mechanism from a global network perspective . note that analysis of changes in phase synchronization , frequency bands , and rhythmicity was not conducted by jacobs and colleagues and presents an exciting avenue for future study . the challenges of concurrent eeg - fmri are not solely limited to noise removal , but also arise when developing the framework of analysis . this represents a fundamental issue which can influence the seeking of the correspondence between the measured spontaneous eeg and resting - state fmri signals ( see figure 1 for a unified framework ) . since little is known about the bold response to epileptic discharges prior to the analysis , two fundamental assumptions must be made to establish the link between neural activity and hemodynamic modulations . the first is that the shape and time course of the hemodynamic response function ( hrf ) derived from the normal human or animal subjects is also appropriate for epileptic brains [ 3 , 27 , 66 ] . the second is that the nature of neural hemodynamic coupling derived from an epileptic subject is homogenous across different brain regions regardless of the location inside or outside the epileptogenic focus . judicious selection of an hrf and experimentally based assumptions about the nature of the cortical electrical activity are important first steps in the general linear model analysis of fmri data sets [ 27 , 49 , 50 ] . many of the published epilepsy studies using fmri have been bound by these two underlying assumptions . a growing body of evidence is challenging the validity of these two working hypotheses and suggest that the hrf and its uniformity of epilepsy patients deviate from the normal population [ 55 , 66 , 6870 ] . the result has been a greater preference for the utilization of data - driven or exploratory methods such as ica and temporal clustering analysis [ 71 , 72 ] . a major advantage of data - driven analyses is the flexibility to circumvent a priori hypothesized hrf while simultaneously deducing the activated fmri response . however , it suffers an inherent deficit : the lack of statistical measure to assess the intended hypothesis . to be considered clinically useful , the epileptogenic zones defined by hemodynamic and metabolic modulation through ica analysis must be spatially consistent and statistically robust across individuals and scanning sessions . consequently , one has to rely on comparison of the results with the linear model method for validation [ 49 , 50 ] . mckeown has proposed a hybrid method which can gracefully navigate from a fully data - driven approach to a fully model - driven approach . building on this early work , we further improved it by replacing a vital priori hypothesis ( presumed neuronal response ) used in mckeown 's work with the actual eeg signal and obtained statistically robust bold activation in an animal model of focal epilepsy . with regard to the framework of eeg - fmri , the integration of superior spatial information provided by mr images and temporal information of eeg can be improved by linking them with hemodynamic transfer functions as we previously proposed . in our framework , the variation of the hrf can be estimated rather than simply assuming a fixed canonical response . another advantage is that intermodal , interregional , and interindividual variability can be explicitly taken into account in the estimation . thus , it becomes more straightforward to fit epileptic discharge events into continuous fmri recordings under a spontaneous condition since this type of data does not contain sparse / blocked stimulus inputs . paradoxical imaging changes can occur in the nonepileptogenic and epileptogenic zones that do not always accurately reflect the underlying electrical activity [ 57 , 66 ] . during absence seizures , it still remains largely unknown if a decrease in fmri signal during seizure activity has been found in those regions such as spike - wave discharges , relative silence , or some other electrophysiological phenomenon occurring [ 27 , 49 , 7579 ] . from a large - scale network perspective , it is uncertain if in the complex partial seizures of temporal lobe origin that either reduced excitation or increased inhibition ( or both ) results in decreased activity in the frontoparietal cortex [ 8082 ] . the characterization of the neuronal correlate of spontaneous bold signal still remains an open issue . typical observations of spontaneous eeg contain a complex spectral composition including the alpha rhythm ( 812 hz oscillations ) , sleep spindles ( ~1214 hz oscillations ) , and individual ieds . bold fmri contrast should be sensitive to these and any changes in neuronal function that result in alteration ( either increase or decrease ) of brain metabolism [ 8486 ] . it should be noted that failure to consider the background eeg oscillations when seeking the electrical basis of the bold response may cause poor correlation between these two measures and confusion when attempting to explain their direct correspondence [ 55 , 87 ] . for example , evidence from simultaneous fmri and depth recordings in monkeys and individuals undergoing invasive clinical monitoring has suggested that spiking , multiunit activity , and band - limited power changes in the gamma frequency range were the primary correlate of resting state fmri activity and connectivity [ 17 , 88 ] . this is in conflict with other work in humans suggesting a direct linkage of low - frequency bold fluctuations and the posterior alpha rhythm . further , he and raichle proposed that the low - frequency end of field potentials ( < 4 hz , also termed as slow cortical potential , scp ) is also correlated with bold signal in its raw spontaneous fluctuations in the light of its temporal scale overlapping with that of fmri signal [ 15 , 90 ] . correlation at or below delta band lfps is also in agreement with a rat investigation . de munck and colleagues have further reported that power fluctuations of different eeg bands are significantly correlated and are similar to the alpha harmonics . in striking contrast , other studies yield different results as to the role what other frequency bands play [ 92 , 93 ] , some suggesting unique frequency profiles across multiple bands representing characteristic eeg microstates [ 67 , 94 ] ( see figure 2 for the eeg microstates informed fmri analysis ) . it has yet to be adequately clarified how changes in distinct bands of electrical signal are related to the hemodynamic response under different states of brain activity . therefore , two important caveats should be noted when one attempts to resort to a consistent interpretation of these controversial observations . one is that intrinsic synchrony of brain activity is network specific and exists at multiple spatial levels . another is that spontaneous activity not only reflects the functional architecture of the brain by forming structured spatiotemporal profiles but can also encode traces of previous behavior history ( memory retrieval ) and predict future decisions in view of its ongoing internal representations . in other words , the role of the brain oscillations within an interested frequency range could be highly contextual . taken together , further study of humans and animal models with the use of simultaneous , spontaneous eeg - fmri recording is necessary to elucidate the complex , dynamic , behavior of intrinsic hemodynamic oscillations , and their neuronal correlate . revealing the underlying mechanisms of brain oscillations , coupling , and functional significance will provide a valuable measure for the assessment of both normal and pathological brain functions , especially epilepsy . tle is often considered the prototype of localization - related epilepsy , even though evidence indicates a multiplicity of sources involving cortical and subcortical structures outside the epileptogenic temporal lobe . for instance , mtle is the most common type of focal epilepsy in adult patients and is usually caused by hippocampal sclerosis ( hs ) . a large number of concurrent eeg - fmri studies have sought fmri activations during ieds to localize the epileptogenic focus in their presurgical evaluation of patients with medically refractory partial epilepsies . surgical outcomes in mtle are good , but far from optimal , particularly in long - term followup studies [ 41 , 95 ] . one of potential reasons of poor clinical outcome could be that hemodynamic activation and deactivation patterns are not always of localizing merit since current understanding of neurovascular regulation is limited . when studying functional connectivity of the mesial temporal lobe , one must consider that the subregions within temporal lobe structures are critical components of other cortical networks . tle focal seizure onset can propagate to subcortical structures impairing the ascending reticular activating system ( aras ) which mediates arousal and in turn deactivating the cortical hierarchy , particularly the large frontal - parietal associative cortical areas . this fits within the network inhibition hypothesis suggesting that partial complex seizures that lead to impaired consciousness affect an entire network as opposed to only the local epileptogenic focus [ 1 , 96 , 97 ] . interestingly , these cortical areas are implicated in the default - mode network ( dmn ) , a rsn , which comprises the posterior cingulate cortex / precuneus , lateral parietal cortex , ventral anterior cingulate cortex / mesial prefrontal cortex , angular gyrus , and inferior temporal cortex , in addition to the mesial temporal lobes ( see figure 3 ) . mesial tle patients show significantly increased connectivity within the mesial temporal lobes and decreased connectivity within / between the frontal and parietal lobes implicated in the dmn . in addition , cerebral blood flow ( cbf ) has been shown to increase in the medial thalamus correlating with a reduction in activity within the dmn regions . morgan et al . showed increased negative connectivity across thalamic , brainstem , frontal , and parietal brain regions , in accordance with the idea that there is inhibited function in subcortical and cortical structures during ictal propagation . these findings suggest that both thalamocortical activation and suspension or disturbance of the default state contribute to the abnormality in responsiveness of patients with medial temporal origin . they are in concordance with what gotman and coworkers found using concurrent eeg - fmri . the brain could temporarily suspend baseline processes and engender deactivations in this higher - order associative network . the overlap of cortical between the dmn and tle may provide some context as to why altered consciousness occurs in tle ( see figure 4 for illustration of the network inhibition hypothesis ) . the role of the dmn is still largely unclear , however , two hypotheses have been proposed relating to conscious awareness ( for review see ) . the dmn has been suggested to be responsible for unconstrained conscious internal mental processes such as mind wandering or alternatively may involve low - level monitoring of the external environment [ 10 , 100 ] . regardless of the fact that one or both hypotheses may be correct , both relate to awareness ( either of self or environment ) , and thus the contents of consciousness . the potential role of the dmn governing conscious awareness has been investigated through imaging in altered states of consciousness where awareness is thought to be absent including such conditions as anesthesia [ 16 , 101 ] , sleep , vegetative state [ 38 , 42 , 103 ] , and coma [ 14 , 37 ] . under light sedation in healthy subjects , greicius et al . found significantly reduced connectivity in the posterior cingulate cortex ( pcc ) within the dmn suggesting that focal reductions of the pcc may reflect decreased levels of consciousness . in deep sleep , a more natural occurrence of decreased consciousness , a decoupling of the medial prefrontal cortex to the rest of the cortical regions in dmn , have been shown to occur . a disruption of functional connectivity in the dmn in vegetative state ( vs ) , a pathological disorder of consciousness whereby a patient lacks awareness while regaining arousal , has also been reported . in three vs patients , it was found that the degree of functional connectivity within the network correlated with the severity of the neurological impairment . an absence of dmn has also been reported in a vs patient who was scanned 21 years after anoxic injury . examined dmn connectivity in 14 patients with range of altered states of consciousness including locked - in syndrome , minimally conscious , vegetative states , and comatose patients and found that the dmn connectivity decreased in proportion to the degree of consciousness impairment . when taken together , the integrity of the dmn may correlate with levels of consciousness , and a fully intact dmn may be needed for normal levels of consciousness to occur . the dmn has also been proposed to have some other intrinsic role in functional brain organization . preserved dmn connectivity has been documented in one case of vs , in coma [ 14 , 37 ] , and in a possible homologous network under isoflurane anesthesia in the monkey . it has been suggested that dmn may be needed for consciousness to occur but can not be exclusively responsible for conscious awareness [ 16 , 37 ] . possibly , dmn connectivity may be an indicator of the extent of cortical disruption and predict reversible impairments in consciousness . the role of dmn in mediating consciousness is supported by known metabolic impairments in vs patients which occur in cortical areas known to be implicated in the dmn such as the prefrontal , temporoparietal association areas , and posterior cingulate cortex / precuneus . in addition , the emergence from reversible vegetative state coincides with recovery - related metabolic changes in areas such as the precuneus and thalamus [ 40 , 105 ] . the dmn is an attractive candidate for the neural correlate of consciousness as it has a great deal of functional and structural connectivity across large associative cortical areas [ 98 , 106 ] including long - range corticothalamic connections , in addition to its role in internal mental processes and/or involvement in gathering information about the external environment , as well as disruptions in altered states of consciousness . the dmn fits within the global workspace ( gw ) theory of consciousness that suggests long - distance connectivity between multiple cortical networks that usually operate separately work together in an organized fashion to enable consciousness to occur . intracerebral eeg signals in tle seizures resulting in alterations in consciousness have been shown to cause oversynchronization in long - range corticocortical and corticothalamic connections . excessive synchrony of these connections , reported to be important in the gw , is thought to prevent the variation and complexity needed to allow for a conscious state . intracerebral eeg recordings in the thalamus and temporal lobe structures ( hippocampus , entorhinal cortex , and neocortex ) , have shown increased neuronal synchrony with the occurrence of seizures and early loss of consciousness . the concept of consciousness has long been central to epileptology since generalized seizures and complex partial seizures both can induce a variable degree of impairment in consciousness , as frequently observed in mtle patients . besides linking the scp to the resting bold fluctuations as discussed above , he and raichle made a remarkable stride forward in arguing that this slow frequency of cortical oscillation might contribute directly to the emergence of consciousness . their work has triggered a debate in the field of whether the scp per se in widespread cortical networks carries specific details sufficient to express our vivid daily conscious experience , as opposed to the proposed role of gamma oscillation established in higher level of cognitive experience like attention . it has been well known that the contents of conscious states as well as the level of awareness are affected to varying degrees during different types of epileptic seizures [ 27 , 31 , 110 , 111 , 115 ] . accordingly , epilepsy can be used to provide an easily accessible entry into the working mechanism of altered conscious states . in principle , carefully constructed experiments that manipulate the onset / offset and subjective level of consciousness loss could dissociate hardly defined awareness from activity of either the scp or gamma oscillation ( or both ) . over the past decade , simultaneous eeg - fmri recording has become technically feasible with applications in multiple areas of basic and applied sciences . converging evidence from fmri and depth eeg in humans and animals has already revealed that generalized seizures do not affect all brain areas indiscriminately , whereas complex partial seizures alter functional brain activity less focally than previously thought . spontaneous eeg - fmri investigations into topics such as asymmetry of the background activity in the homeostatic neural networks , paroxysmal focal delta or theta oscillations , and other nonepileptic but abnormal phenomena may provide additional clinically meaningful information , particularly relevant to impairment of conscious experience in patients . it will greatly enhance our understanding of the underlying mechanism in generation of generalized seizures , provide unique insight into the brain regions involved in the generation and/or propagation of epileptiform activity , determine the neural substrate of various forms of dyscognitive seizures , and offer clinicians neuronally validated spatial guidance for surgical planning to benefit patients with medically intractable tle .
### Summary: : the combination of electroencephalography ( eeg ) and functional magnetic resonance imaging ( fmri ) has been shown to have great potential for providing a greater understanding of normal and diseased states in both human and animal studies . simultaneous eeg - fmri is particularly well suited for the study of epilepsy in that it may reveal the neurobiology of ictal and interictal epileptiform discharges and noninvasively localize epileptogenic foci . spontaneous , coherent fluctuations of neuronal activity and the coupled hemodynamic responses have also been shown to provide diagnostic markers of disease , extending our understanding of intrinsically structured ongoing brain activity . following a short summary of the hardware and software development of simultaneous eeg - fmri , this paper reviews a unified framework of integrating neuronal and hemodynamic processes during epileptic seizures and discusses the role and impact of spontaneous activity in the mesial temporal lobe epilepsies with particular emphasis on the neural and physiological correlates of consciousness .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the best clinicians excel in their ability to discern the correct diagnosis in perplexing cases . this skill requires an extensive knowledge base , keen interviewing and examination skills , and the ability to synthesize coherently all of the available information . unfortunately , the level of expertise varies among clinicians , and even the most expert can sometimes fail . there is also a growing appreciation that diagnostic errors can be made just as easily in simple cases as in the most complex . given this dilemma and the fact that diagnostic error rates are not trivial , clinicians are well - advised to explore tools that can help them establish correct diagnoses . clinical diagnosis support systems ( cdss ) can direct physicians to the correct diagnosis and have the potential to reduce the rate of diagnostic errors in medicine.1,2 the first - generation computer - based products ( e.g. , qmr first databank , inc , ca ; iliad university of utah ; dxplain massachusetts general hospital , boston , ma ) used precompiled knowledge bases of syndromes and diseases with their characteristic symptoms , signs , and laboratory findings . the user would enter findings from their own patients selected from a menu of choices , and the programs would use bayesian logic or pattern - matching algorithms to suggest diagnostic possibilities . typically , the suggestions were judged to be helpful in clinical settings , even when used by expert clinicians.3 these diagnosis support systems were also useful in teaching clinical reasoning.4,5 surprisingly and despite their demonstrated utility in experimental settings , none of these earlier systems gained widespread acceptance for clinical use , apparently related to the considerable time needed to input clinical data and their somewhat limited sensitivity and specificity.3,6 a study of iliad and qmr in an emergency department setting , for example , found that the final impression of the attending physician was found among the suggested diagnoses only 72% and 52% of the time , respectively , and data input required 20 to 40 minutes for each case.7 in this study , we evaluated the clinical performance of isabel ( isabel healthcare inc , usa ) , a new , second generation , web - based cdss that accepts either key findings or whole - text entry and uses a novel search strategy to identify candidate diagnoses from the clinical findings . the clinician first enters the key findings from the case using free - text entry ( see fig 1 ) . there is no limit on the number of terms entered , although excellent results are typically obtained with entering just a few key findings . the program then uses natural language processing and search algorithms to compare these terms to those used in a selected reference library . for internal medicine cases , the library includes 6 key textbooks anchored around the oxford textbooks of medicine , 4th edition ( 2003 ) and the oxford textbook of geriatric medicine and 46 major journals in general and subspecialty medicine and toxicology . the search domain and results are filtered to take into account the patient s age , sex , geographic location , pregnancy status , and other clinical parameters that are either preselected by the clinician or automatically entered if the system is integrated with the clinician s electronic medical record . the system then displays a total of 30 suggested diagnoses , with 10 diagnoses presented on each web page ( see fig . 2 ) . the order of listing reflects an indication of the matching between the findings selected and the reference materials searched but is not meant to suggest a ranked order of clinical probabilities . as in the first generation systems , more detailed information on each diagnosis can be obtained by links to authoritative texts . the query terms can be entered manually from the key findings or findings can be pasted from an existing write - up . this patient was ultimately found to have a b - cell lymphoma secreting a cryo - paraproteinfigure 2the first page of results of the isabel diagnosis support software . the query terms can be entered manually from the key findings or findings can be pasted from an existing write - up . this patient was ultimately found to have a b - cell lymphoma secreting a cryo - paraprotein the first page of results of the isabel diagnosis support software . more diagnoses box the isabel cdss was originally developed for use in pediatrics . in an initial evaluation , 13 clinicians ( trainees and staff ) at st mary s hospital , london submitted a total of 99 case scenarios of hypothetical case presentations for different diagnoses , and isabel displayed the expected diagnosis in 91% of these cases.8 out of 100 real case scenarios gathered from 4 major teaching hospitals in the uk , isabel suggested the correct diagnosis in 83 of 87 cases ( 95% ) . in a separate evaluation of 24 case scenarios in which the gold standard differential diagnosis was established by two senior academic pediatricians , isabel decreased the chance of clinicians ( a mix of trainees and staff clinicians ) omitting a key diagnosis by suggesting a highly relevant new diagnosis in 1 of every 8 cases . in this study , the time to enter data and obtain diagnostic suggestions averaged less than 1 minute.9 the isabel clinical diagnosis support system has now been adapted for adult medicine . the goal of this study was to evaluate the speed and accuracy of this product in suggesting the correct diagnosis in a series of complex cases in internal medicine . we considered 61 consecutive case records of massachusetts general hospital ( new england journal of medicine , vol . 350:166176 , 2004 and 353:189198 , 2005 ) . each case had an anatomical or final diagnosis , which was considered to be correct by the discussants . we excluded 11 cases ( patients under the age of 10 and cases that focused solely on management issues ) . the 50 remaining case histories were copied and pasted into the isabel data - entry field . the pasted material typically included the history , physical examination findings , and laboratory test results , but data from tables and figures were not submitted . beyond entering the patient s age , sex , and nationality , the investigators did not attempt to otherwise tailor the search strategy . findings were compared to the recommended ( but slightly more time consuming ) strategy of entering discrete key findings , as compiled by a senior internist ( mlg ) . because the correct diagnosis is presented at the end of each case , data entry was not blinded . using the recommended method of manually entering key findings , the list of diagnoses suggested by isabel contained the correct diagnosis in 48 of the 50 cases ( 96% ) . the 2 diagnoses that were not suggested ( progressive multifocal encephalopathy and nephrogenic fibrosing dermopathy ) were not included in the isabel database at the time of the study ; thus , these 2 cases would never have been suggested , even with different keywords . using the copy / paste method for entering the whole text , the list of diagnoses suggested by isabel contained the correct diagnosis in 37 of the 50 cases ( 76% ) . isabel presented 10 diagnoses on the first web page and 10 additional diagnoses on subsequent pages up to a total of 30 diagnoses . because users may tend to disregard suggestions not shown on later web pages , we tracked this parameter for the copy / paste method of data entry : the correct diagnosis was presented on the first page in 19 of the 37 cases ( 51% ) or first two pages in 28 of the 37 cases ( 77% ) . similar data were not collected for manual data entry because the order of presentation depended on which key findings were entered . both data entry approaches were fast : manually entering data and obtaining diagnostic suggestions typically required less than 1 minute per case , and the copy / paste method typically required less than 5 seconds . diagnostic errors are an underappreciated cause of medical error,10 and any intervention that has the potential to produce correct and timely medical diagnosis is worthy of serious consideration . our recent analysis of diagnostic errors in internal medicine found that clinicians often stop thinking after arriving at a preliminary diagnosis that explains all the key findings , leading to context errors and premature closure , where further possibilities are not considered.11 these and other errors contribute to diagnoses that are wrong or delayed , causing substantial harm in the patients affected . systems that help clinicians explore a more complete range of diagnostic possibilities could conceivably reduce these types of error . many different cdsss have been developed over the years , and these typically matched the manually entered features of the case in question to a database of key findings abstracted from experts or the clinical literature . the sensitivity of these systems was in the range of 50%60% , and the time needed to access and query the database was often several minutes.3 more recently , the possibility of using google to search for clinical diagnoses has been suggested . however , a formal evaluation of this approach on a subset of the same case records cases used in our study found a sensitivity of 58%,12 in the range of the first - generation cdsss and unacceptably low for clinical use . the findings of our study indicate that cdss products have evolved substantially . using the isabel cdss , we found that data entry takes under 1 minute , and the sensitivity in a series of highly complex cases approached 100% using entry of key findings . entry of entire case histories using copy / paste functionality allowed even faster data entry but reduced sensitivity . the loss of sensitivity seemed primarily related to negative findings included in the pasted history and physical ( e.g. , the patient denies chest pain ) , which are treated as positive findings ( chest pain ) by the search algorithm . there are several relevant limitations of this study that make it difficult to predict how isabel might perform as a diagnostic aid in clinical practice . first , the results obtained here reflect the theoretical upper limit of performance , given that an investigator who was aware of the correct diagnosis entered the key findings . further , clinicians in real life seldom have the wealth of reliable and organized information that is presented in the case records or the time needed to use a cdss in every case . to the extent that isabel functions as a learned intermediary,13 success in using the program will also clearly depend on the clinical expertise of the user and their facility in working with isabel . a serious existential concern is whether presenting a clinician with dozens of diagnostic suggestions might be a distraction or lead to unnecessary testing . we have previously identified these trade - offs as an unavoidable cost of improving patient safety : the price of improving the odds of reaching a correct diagnosis is the extra time and resources consumed in using the cdss and considering alternative diagnoses that might turn out to be irrelevant.14 in summary , the isabel cdss performed quickly and accurately in suggesting correct diagnoses for complex adult medicine cases . however , the test setting was artificial , and the cdss should be evaluated in more natural environments for its potential to support clinical diagnosis and reduce the rate of diagnostic error in medicine .
### Summary: : backgroundclinical decision support systems can improve medical diagnosis and reduce diagnostic errors . older systems , however , were cumbersome to use and had limited success in identifying the correct diagnosis in complicated cases.objectiveto measure the sensitivity and speed of isabel ( isabel healthcare inc . , usa ) , a new web - based clinical decision support system designed to suggest the correct diagnosis in complex medical cases involving adults.methodswe tested 50 consecutive internal medicine case records published in the new england journal of medicine . we first either manually entered 3 to 6 key clinical findings from the case ( recommended approach ) or pasted in the entire case history . the investigator entering key words was aware of the correct diagnosis . we then determined how often the correct diagnosis was suggested in the list of 30 differential diagnoses generated by the clinical decision support system . we also evaluated the speed of data entry and results recovery.resultsthe clinical decision support system suggested the correct diagnosis in 48 of 50 cases ( 96% ) with key findings entry , and in 37 of the 50 cases ( 74% ) if the entire case history was pasted in . pasting took seconds , manual entry less than a minute , and results were provided within 23 seconds with either approach.conclusionsthe isabel clinical decision support system quickly suggested the correct diagnosis in almost all of these complex cases , particularly with key finding entry . the system performed well in this experimental setting and merits evaluation in more natural settings and clinical practice .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : therefore , results obtained in studies on a single cell type should be considered with caution when extrapolated to the whole body . a large series of studies , having become internationally known in 1986 after the publication in the lancet , has been continued until today . cultures of smooth muscle cells from human aorta and , in some studies , of peritoneal macrophages , were used as an in vitro model for testing of serum atherogenicity and anti- or pro - atherogenic action of various substances . the following , among other things , was reported : within 24 hours of cultivation with diluted ( 40% ) sera of coronary atherosclerosis patients , the total intracellular cholesterol ( ch ) increased twofold to fivefold . low density lipoproteins ( ldl ) from patients with coronary atherosclerosis caused a twofold to fourfold rise in cholesteryl esters in cultured human blood monocytes and intimal smooth muscle cells isolated from the normal aorta , . cultivation with the sera or ldl from healthy individuals failed to induce intracellular lipid accumulation , . furthermore , calcium antagonists ( verapamil , nifedipine , darodipine , isradipine , diltiazem , etc . ) reduced the ch level in cultured cells and , at the same time , lowered the incorporation of h - thymidine by the cells , which was interpreted as decreased cell proliferation . furthermore , beta - blockers ( propranolol , alprenolol , metoprolol , atenolol , pindolol , and timolol ) caused a 1.5- to 2-fold rise in ch level of cultured cells and stimulated their proliferation . ex vivo model was used : within 24 h after an oral administration of a beta - blocker ( propranolol ) , plasma became atherogenic i.e. its addition to the cell culture medium induced intracellular ch accumulation and stimulated proliferation of the cultured cells . at the same time , blood plasma of patients receiving calcium antagonists acquired antiatherosclerotic properties manifested by its ability to lower the intracellular ch and to inhibit cells proliferation in a culture . another example : garlic extract added to the medium , where smooth muscle cells from atherosclerotic plaques had been cultured , significantly reduced the ch level in the cells and inhibited their proliferation . blood serum taken from patients 2 hours after an oral administration of 300 mg of garlic powder significantly lowered ch accumulation in the cultured cells . remarkably , infiltration of cultured cells by lipids was reported to be associated with their increased proliferation : in the cultures of smooth muscle cells taken from zones of fatty infiltration and fatty streaks in the human aortic intima , the thymidine index exceeded the normal value 4.5- and 3-fold respectively . pharmacological agents , modifying intracellular lipid accumulation , influenced cell proliferation in the same direction . in general pathology , however , fatty infiltration is seen as a manifestation of cell damage ( degeneration ) , which can hardly be expected to come along with enhanced proliferation . furthermore , recommendations for practice were formulated on the basis of cell culture experiments , including drug dosage : to decrease atherogenic potential of serum and to maintain it at a low level , verapamil should be administered at a dose of 40 mg 5 times daily with a 4- to 5-hour interval between doses . this recommendation should be seen within the scope of a broader question , whether data from cellular models may be used directly for clinical recommendations without clinical trials . a response of cellular systems to an agent influencing transport across the plasma membrane can have opposite effects in cells compared to the whole body . as an explanation for atherogenicity of serum from patients with coronary atherosclerosis , a causative role of ch - containing immune complexes was maintained . however , among the mechanisms of atherogenesis induced by immune complexes , discussed in the literature , are inflammatory phenomena such as release of proinflammatory cytokines from macrophages , increase in adhesion molecules and dysfunction of endothelial cells , , , , which are not reproduced in the cell monocultures . known action mechanisms of antiatherogenic or lipid - lowering drugs include regulation of ch synthesis , lipid metabolism in the liver , intestinal absorption of lipids or endothelial functions , , . in addition , drugs like statins have numerous pleiotrophic effects that can be beneficial but are not reproducible in the cultures . inflammatory phenomena , addressed by some antiatherogenic agents , , are also not reproduced by this model . in vivo , the relationship between ch uptake by cells and atherogenesis is inverse rather than direct . for example , in familial hypercholesterolemia , caused by abnormality of lipoprotein receptors , ineffective clearance of ldl - ch from serum causes hypercholesterolemia and predisposes to atherosclerosis . moreover , up - regulation of ldl receptors ( and , correspondingly , of the ldl - ch uptake by cells ) is one of the therapeutic strategies for atherosclerosis . accordingly , if a pharmacological agent reduces ch uptake by cells in vitro , it should be expected to cause serum ch elevation in vivo . in other words , pharmacologic agents displaying an antiatherogenic effect in cell cultures should be expected to have a pro - atherogenic effect in vivo . therefore , conclusions and recommendations , formulated on the basis of the cell culture studies discussed above , can be based on misunderstanding . moreover , an anti - atherosclerotic drug allicor , a derivative of garlic , was developed on the basis of the cell culture experiments . discussing the mode of action of the allicor , both articles refer to the cell culture study . in fact , the results of the trials , are at variance with those of the cell culture experiments : if garlic indeed lowers the intake of ch by the cultured smooth muscle cells , it might cause elevation of serum ch in vivo . it is written in with reference to a review , obviously implying effectiveness of garlic : lipid - lowering properties of garlic - based drugs and preparations are studied rather well . however , it is stated in that there is increasingly less evidence for lipid lowering properties of garlic preparations . a later review on this topic concluded that evidence , based on rigorous clinical trials of garlic , is not convincing . for hypercholesterolemia , the reported effects of garlic are small and may be of no clinical relevance . previously we discussed other trials on hypercholesterolemia , results of which have not been convincingly confirmed by other researchers . note that allicor is produced by inat farma fused with the institute of aterosclerosis research ( http://inat.ru ) , where the above - mentioned cell culture experiments have been performed . with pharmaceutical costs increasing faster than most other health care expenditures , studies should meet the needs of evidence - based treatments and not just the needs of the manufacturers . the material from this paper was presented at several conferences ( e.g. , ) ; and the author was asked , why it is focused on reports of mostly one research group and the topic is not discussed in a broader perspective . in fact , there have been no other studies , where serum atherogenicity and atherogenic / antiatherogenic potencies of drugs were evaluated directly on cell cultures and practical recommendations given on the basis of such evaluations . earlier experiments with culturing of smooth muscle cells from atherosclerotic plaques , culturing or incubation of different cells in lipoprotein - containing media ( e.g. , , ) included neither measurement of serum atherogenicity nor drug evaluations . in conclusion , a reason for submitting this paper to an open access journal is to draw the attention of the scientific community to the fact that doubtful information was published in numerous pharmacological , clinical and other editions ( e.g. , , , , , ) including a recently published russian - language handbook , and is still being referred to in more recent studies ( e.g. , , ) . however , the study disagreed with the results of some experiments by the research group under discussion in this paper ; and an artifact in these experiments was proposed as an explanation for the disagreement .
### Summary: : in a large series of studies was reported that culturing of smooth muscle cells with serum from atherosclerosis patients caused intracellular lipid accumulation , while serum from healthy controls had no such effect . cultures were used for evaluation of antiatherogenic drugs . numerous substances were reported to lower serum atherogenicity : statins , trapidil , calcium antagonists , garlic derivatives etc . on the contrary , beta - blockers , phenothiazines and oral hypoglycemics were reported to be pro - atherogenic . known antiatherogenic agents can influence lipid metabolism and cholesterol synthesis , intestinal absorption or endothelium - related mechanisms . all these targets are absent in cell monocultures . inflammatory factors , addressed by some antiatherogenic drugs , are also not reproduced . in vivo , relationship between cholesterol uptake by cells and atherogenesis must be inverse rather than direct : in familial hypercholesterolemia , inefficient clearance of ldl - cholesterol by cells predisposes to atherosclerosis . accordingly , if a pharmacological agent reduces cholesterol uptake by cells in vitro , it should be expected to elevate cholesterol in vivo . validity of clinical recommendations , based on serum atherogenicity testing in cell monocultures , is therefore questionable . these considerations pertain also to the drugs developed on the basis of the cell culture experiments .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : diabetic autonomic neuropathy ( dan ) is one of the major diabetic complications , and it increases morbidity and mortality in patients with both type 1 diabetes mellitus ( t1 dm ) and type 2 diabetes mellitus ( t2 dm ) . it can involve sensory , motor , and autonomic nerves and all three types of involvement can coexist . in the past century , however , dan has been considered to be a rare complication . currently dan is considered to be a serious and underestimated frequent complication of diabetes . the first reason is that dan is a systemic disease that involves every organ in the body by affecting the entire autonomic nervous system ( ans ) and it leads to increase in morbidity and mortality . the second reason is that dan is almost always asymptomatic or reveals non - specific symptoms in the early stages , and , therefore , many clinicians fail to recognize the opportunity for early diagnosis and treatment . dan has specific clinical abnormalities by hyperglycemia and hypoglycemia in skin , cardiovascular , gastrointestinal , genitourinary , and other organs . although some epidemiologic data on diabetic peripheral neuropathy has been known to be existed , very limited epidemiologic data for dan had been published . more than 50% of patients with t2 dm had been reported to have dan and 45.3% of patients with newly detected t2 dm had dan at the time of diagnosis . however , early diagnosis of dan is very difficult because confirmed diagnostic parameters and criteria do not exist . therefore , in the absence of exact diagnostic criteria for dan , objective evaluation and diagnostic methods of dan are needed . recently , we commonly used autonomic function test rather than skin and target organ biopsy because of its convenience . however , autonomic function test is indirect test that influenced by the functional status and dual innervations of target organs . therefore , autonomic function test and morphological study has some differences in the diagnosis of dan . compare to autonomic function tests , morphological studies have high sensitivity and specificity for dan diagnosis and discriminates between the autonomic and somatic nerve , and , also sympathetic and parasympathetic nerve . so , the usefulness of target organ biopsy should be evaluated and introduced for dan diagnosis . the ans usually works without our will and controls many functions of all innervated visceral organs . it operates throughout the body to adapt organ function to changes in the internal and external environments . afferent sensory division integrates all sensory input in neural centers located mainly in the brainstem and the hypothalamus . it operates , in part , through visceral reflexes in which sensory signals from visceral organs activate central autonomic regions that , in turn , send back subconscious reflex responses to visceral organs to change their activities ( fig . the efferent autonomic signals are transmitted to the organs through the parasympathetic and sympathetic nervous systems . because the ans , for example parasympathetic axons , have a diffuse and wide distribution , we do not know the exact mechanism and morphological changes that occur in autonomic neural control in diabetic patients with dan . dan includes both parasympathetic and sympathetic nerve dysfunction in both t1 dm and t2 dm patients . it is unknown what the changes and role of the ans are during the progression of diabetes ? the prevalence of sympathetic and parasympathetic neuropathy , respectively , is similar in t1 dm versus t2 dm patients . the explanation for these discrepancies might be that parasympathetic nerve function is more severely affected in t2 dm patients . as parasympathetic nerve damage seemed to be more advanced than sympathetic nerve damage , it might be that parasympathetic neuropathy precedes sympathetic neuropathy in t2 dm , which was like ewing 's concept . parasympathetic nerves are composed of large nerve fibers because they have longer and thicker myelinated preganglionic fibers , sympathetic nerves are thinner and longer nonmyelinated postganglionic fibers . the fact that impaired glucose tolerance patients may develop both parasympathetic and peripheral sensory neuropathy suggests that large myelinated nerve fibers are affected early in t2 dm . therefore , the order of morphological changes in sympathetic and parasympathetic nerves of various organs in diabetic patients must be evaluated . autonomic dysfunction ( e.g. , heightened activity of the sympathetic nervous system and suppressed activity of the parasympathetic nervous system ) impairs the ability of the ans to regulate the cardiovascular system , and inflammatory , metabolic and neurological disease processes . autonomic imbalance may be shown to be a key component involved in both the etiology and clinical course of cardiovascular , gastrointestinal , genitourinary , and other organs . the protein gene product ( pgp ) 9.5 as an ubiquitin hydrolase component of axons provided unequivocal evidence of the presence of unmyelinated nerve fibers in the epidermis of the skin , stomach , kidney , and pancreas . this method is an important diagnostic tool for small fiber sensory neuropathy and autonomic neuropathy according to qualitative and quantitative studies of sensory and autonomic nerve fiber densities and morphology in diabetic research . skin biopsy is a useful tool to diagnose small fiber sensory neuropathy in clinical practice and to monitor the progression of neuropathy using immunohistochemical techniques . this morphometric analysis method proved to be reliable , reproducible and unaffected by the severity of neuropathy . recently , a rapid and innovative method , called optical clearing ( use of immersion solution to reduce scattering ) which was introduced by fu et al . and tang et al . can be used to distinguish sensory nerve fibers from autonomic nerve fibers very clearly . in the epidermis , unmyelinated sensory nerve fibers were innervated . these intraepidermal nerve fibers run to the skin surface or are divided with horizontal branches . they can be labeled with antibodies such as , pgp 9.5 and transient receptor potential vanilloid type 1 ( trpv1 ) . the subpapillary dermis of both hairy and glabrous skin is innervated by bundles of unmyelinated and thinly myelinated fibers and glabrous skin also contains large myelinated fibers . in the dermis , autonomic structures such as sweat glands , blood vessels , arrector pili muscles , and hair follicles existed . they could be evaluated by the various antibodies ; for example , tyrosine hydroxylase ( th ) and dopamine hydroxylase ( dh ) for adrenergic sympathetic fibers ( anti - th , anti - dh ) , neuropeptide y for noradrenergic fibers , vasoactive intestinal peptide ( vip ) for cholinergic fibers ( anti - vip ) , and calcitonin gene related peptide ( cgrp ) and substance p ( sp ) for vasodilatory peptidergic fibers ( anti - cgrp , anti - sp ) ( table 1 ) . morphometric analysis of skin nerves is readily accomplished through the use of immunohistochemical techniques , and has proved to be reliable , reproducible and unaffected by the severity of neuropathy . one further advantage of skin biopsy over conventional nerve biopsy is that it allows somatic nerve fibers to be distinguished from autonomic nerve fibers . immunoperoxidase staining allows bright - field quantification , and immunofluorescent staining can be coupled with either epifluorescence microscopy or confocal microscopy . species - specific secondary antibodies may be used to visualize multiple antigen - bound primary antibodies selected in a number of combinations to investigate neuronal structures , cutaneous structures , and neurotransmitters relevant to the sensory system and the autonomic system ( table 1 ) . performed degeneration and regeneration experiments on cutaneous autonomic nerve fibers by using a topical capsaicin application in healthy subjects . they found that sudomotor , vasomotor , and pilomotor nerve fibers are degenerated and impaired function . the autonomic nerve fibers tend to degenerate more gradually and recover more rapidly than sensory fibers . therefore , they suggest nerve susceptibility and/or pathophysiological mechanisms of nerve degeneration and regeneration may differ between autonomic and sensory nerve fibers treated with capsaicin . as seen from these results , further studies on the degeneration sequences of autonomic nerves are necessary to define which autonomic nerve function is affected earlier by hyperglycemia and hypoglycemia in humans . anatomically , the gastrointestinal tract has many neuronal populations , such as , enteric ( intrinsic ) neurons , extrinsic sensory afferent neurons , viscerofugal neurons , sympathetic neurons , and parasympathetic neurons . viscerofugal neurons which the cell bodies located in the myenteric plexus , project to postganglionic sympathetic visceromotor neurons in the prevertebral ganglia along the extrinsic nerve trunk . the other efferent limb of the cns arises from parasympathetic motor neurons . in the stomach we published the morphological comparison of gastric mucosal nerve fibers in t2 dm and non - diabetic patients and suggested that the gastric mucosal nerve density can be used as a biomarker of gastric autonomic neuropathy . selim et al . also suggested that gastric mucosal density can be a practical method for histologic diagnosis of gastric autonomic neuropathy in t1 dm patients . the autonomic neuropathic stomach showed decreased mucosal nerve fiber length and volume density , and an altered mucosal nerve fiber innervation pattern in animal diabetes model ( fig . although gastric mucosal nerve fiber loss is associated with diabetic sensory peripheral neuropathy and diabetes duration , intraepidermal nerve fiber density could not predict mucosal nerve fiber deficiency . so , intraepidermal nerve fiber density can not be used as a surrogate marker of gastric mucosal nerve density . morphology and innervation of mucosal and muscular nerve fibers defined by immunoreactivity of neurochemicals including th , sp , cgrp , and vip . using immunohistochemical studies , gastric sensory neuronal axons , parasympathetic and sympathetic axons , endocrine cells and vascular cells localization and distribution can be revealed . the parasympathetic innervation was identified by the presence of cholinergic marker antibodies ( e.g. , vesicular acetylcholine transporter , choline acetyltransferase , and vip ) and the sympathetic innervation by the expression of catecholaminergic markers antibodies ( th ) . gastric mucosal neuropeptide immunohistochemical distribution of vip , cgrp , and sp differed by disease and location . for example , vip positive nerve fibers were abundant in the fundus compared to sp positive nerve fibers , and vip and sp positive nerve fibers were almost the same in the antrum . although gastric mucosal nerve fiber length and density evaluation is a useful method in the presence of autonomic neuropathy , we do not know the status of autonomic nerve involvement . therefore , we need a precise evaluation method for sympathetic and parasympathetic nerve fiber innervation and degeneration . in clinical practice , various autonomic function tests have been proposed to study patients with suspected autonomic neuropathy . dan involves every organ in the body and shows various symptoms matching each organ . to diagnose specific autonomic neuropathy the sensitivity and specificity of autonomic function tests vary and a combination of various autonomic tests comprising a composite scoring scale has been suggested to be a maximally sensitive and specific approach . last year , thaisetthawatkul et al . suggested that autonomic evaluation is independent of somatic evaluation for small fiber neuropathy . therefore , both autonomic and sensory tests should be performed concurrently for distal small fiber neuropathy diagnosis . recently , skin biopsy has been widely used as a diagnostic method for somatic and autonomic neuropathy . skin biopsy has several advantages for sensory and autonomic neuropathy evaluation because it is a less invasive procedure and can be repeated to monitor disease progression . additionally , immunohistochemistry with an optical clearing process can discriminate the sympathetic and parasympathetic nerve fibers . in the stomach , endoscopic mucosal biopsy has the same advantages and can be used for histological diagnosis of autonomic neuropathy and optical clearing with immunohistochemistry can observe the sympathetic and parasympathetic nerve innervation and morphologic changes in diabetic patients . introduction of optic clearing and the development of three - dimensional visualization can be used to observe the skin , stomach , pancreas , and kidney with high resolution . these advances enable the evaluation and monitoring of the autonomic nerve fibers , such as sympathetic and parasympathetic nerve fiber innervation , morphologic changes , and degeneration and regeneration sequences .
### Summary: : diabetic neuropathy is one of the major complications of diabetes , and it increases morbidity and mortality in patients with both type 1 diabetes mellitus ( t1 dm ) and type 2 diabetes mellitus ( t2 dm ) . because the autonomic nervous system , for example , parasympathetic axons , has a diffuse and wide distribution , we do not know the morphological changes that occur in autonomic neural control and their exact mechanisms in diabetic patients with diabetic autonomic neuropathy ( dan ) . although the prevalence of sympathetic and parasympathetic neuropathy is similar in t1 dm versus t2 dm patients , sympathetic nerve function correlates with parasympathetic neuropathy only in t1 dm patients . the explanation for these discrepancies might be that parasympathetic nerve function was more severely affected among t2 dm patients . as parasympathetic nerve damage seems to be more advanced than sympathetic nerve damage , it might be that parasympathetic neuropathy precedes sympathetic neuropathy in t2 dm , which was ewing 's concept . this could be explained by the intrinsic morphologic difference . therefore , the morphological changes in the sympathetic and parasympathetic nerves of involved organs in t1 dm and t2 dm patients who have dan should be evaluated . in this review , evaluation methods for morphological changes in the epidermal nerves of skin , and the intrinsic nerves of the stomach will be discussed .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the maturation of most of the eukaryotic mrnas involve three vital processes : capping , splicing , and polyadenylation . in the process of polyadenylation , a long stretch of untemplated adenosines , the poly(a ) tail , many studies have unveiled the molecular mechanisms of mrna 3 end processing machinery , as well as the roles of polyadenylation in the metabolism of mrnas ( proudfoot , 2011 ) . briefly , the maturation of 3 end of an mrna involves a two - step reaction : the endonucleolytic cleavage of the pre - mrna and the addition of poly(a ) tail at the cleavage site . this two - step reaction requires the coordinated actions of various protein factors as well as specific sequence elements in pre - mrna , which can guide the trans - acting factors to form 3 end processing complex at the cleavage site ( fig . the core players in the plethora of these protein factors that carry out the cleavage and polyadenylation include multi - subunit protein complexes cpsf ( cleavage and polyadenylation specificity factor ) , cstf ( cleavage stimulation factor ) , cfi and cfii ( cleavage factors i and ii ) , as well as the poly(a ) polymerase ( pap ) . as for the essential sequence elements that signal 3 end formation , they center on a hexanucleotide poly(a ) signal ( pas ) , whose canonical sequence is aauaaa . it is often flanked by auxiliary upstream elements ( use , u - rich or ugua elements ) and downstream elements ( dse , u - rich or gu - rich elements ) . both use and dse have been shown to have a role in facilitating the usage of the pas , and the strength of the pas can be influenced by the relative positions and sequence variations of these elements ( beaudoing et al . together they form a use - pas - dse pattern for signaling 3 end processing ; this pattern is largely conserved in eukaryotes ( graber et al . , 1999 ) . this binding is assisted by cstf complex , which binds to dse , as well as many other factors not mentioned here . the endonuclease cpsf3 then cleaves the pre - mrna at the cleavage site , which is usually after a ca dinucleotide 1530 nucleotide downstream of the pas and 020 nucleotide upstream of dse . finally , pap is recruited to the cleavage site to catalyze the addition of the poly(a ) tail ( colgan and manley , 1997 ) . the poly(a ) tail has been shown to be essential for many aspects of mrna metabolism , including translation , stability , localization , etc . ( zhang et al . , 2010 ) . with the advent of modern sequencing technologies , recent studies revealed that most of the human genes contain more than one poly(a ) sites , suggesting the prevalence of alternative polyadenlylation ( apa ) . in fact , possibly more than 70% of human genes are capable of producing mrna isoforms by apa ( elkon et al . , 2013 ) . there are two major types of apa : utr - apa ( untranslated region alternative polyadenylation ) and cr - apa ( coding region alternative polyadenylation ) ( fig . 1b ) ( di giammartino et al . , 2011 ; tian and manley , 2013 ) . in the case of utr - apa , the alternative poly(a ) sites are located in the 3 utr of the mrna , with the majority them residing closer to stop codons ( proximal ) compared to canonical poly(a ) sites ( distal ) . therefore , usage of the alternative poly(a ) sites will result in 3 utr shortening in most cases , without changing the coding capacity of the mrna . since the 3 utr of mrna often contains many binding sites for regulatory rna - binding proteins and micrornas , utr - apa may lead to altered mrna stability , localization , or protein translation efficiency due to variation of 3 utr length ( fabian et al . , the alternative poly(a ) sites reside in the upstream introns of genes . unlike utr - apa , cr - apa can produce different protein isoforms ; these protein isoforms lack a chunk of polypeptides at the c - termini , rendering the truncated proteins the potential to behave differently from the full - length counterparts ( hoque et al . , 2013 ) . alternative poly(a ) sites often possess non - canonical poly(a ) signals such as auuaaa , aguaaa , or uauaaa , etc . and are considered however , these non - canonical pas can be favored over the canonical pas under certain physiological conditions and/or when the levels of trans - acting factors vary , leading to apa ( beaudoing et al . , 2000 ) . apa has gained much attention recently as it is considered a new layer of general mechanism for gene expression regulation . the maturation of most of the eukaryotic mrnas involve three vital processes : capping , splicing , and polyadenylation . in the process of polyadenylation , a long stretch of untemplated adenosines , the poly(a ) tail , many studies have unveiled the molecular mechanisms of mrna 3 end processing machinery , as well as the roles of polyadenylation in the metabolism of mrnas ( proudfoot , 2011 ) . briefly , the maturation of 3 end of an mrna involves a two - step reaction : the endonucleolytic cleavage of the pre - mrna and the addition of poly(a ) tail at the cleavage site . this two - step reaction requires the coordinated actions of various protein factors as well as specific sequence elements in pre - mrna , which can guide the trans - acting factors to form 3 end processing complex at the cleavage site ( fig . the core players in the plethora of these protein factors that carry out the cleavage and polyadenylation include multi - subunit protein complexes cpsf ( cleavage and polyadenylation specificity factor ) , cstf ( cleavage stimulation factor ) , cfi and cfii ( cleavage factors i and ii ) , as well as the poly(a ) polymerase ( pap ) . as for the essential sequence elements that signal 3 end formation , they center on a hexanucleotide poly(a ) signal ( pas ) , whose canonical sequence is aauaaa . it is often flanked by auxiliary upstream elements ( use , u - rich or ugua elements ) and downstream elements ( dse , u - rich or gu - rich elements ) . both use and dse have been shown to have a role in facilitating the usage of the pas , and the strength of the pas can be influenced by the relative positions and sequence variations of these elements ( beaudoing et al . together they form a use - pas - dse pattern for signaling 3 end processing ; this pattern is largely conserved in eukaryotes ( graber et al . , 1999 ) . this binding is assisted by cstf complex , which binds to dse , as well as many other factors not mentioned here . the endonuclease cpsf3 then cleaves the pre - mrna at the cleavage site , which is usually after a ca dinucleotide 1530 nucleotide downstream of the pas and 020 nucleotide upstream of dse . finally , pap is recruited to the cleavage site to catalyze the addition of the poly(a ) tail ( colgan and manley , 1997 ) . the poly(a ) tail has been shown to be essential for many aspects of mrna metabolism , including translation , stability , localization , etc . with the advent of modern sequencing technologies , recent studies revealed that most of the human genes contain more than one poly(a ) sites , suggesting the prevalence of alternative polyadenlylation ( apa ) . in fact , possibly more than 70% of human genes are capable of producing mrna isoforms by apa ( elkon et al . , 2013 ) . there are two major types of apa : utr - apa ( untranslated region alternative polyadenylation ) and cr - apa ( coding region alternative polyadenylation ) ( fig . 1b ) ( di giammartino et al . , 2011 ; tian and manley , 2013 ) . in the case of utr - apa , the alternative poly(a ) sites are located in the 3 utr of the mrna , with the majority them residing closer to stop codons ( proximal ) compared to canonical poly(a ) sites ( distal ) . therefore , usage of the alternative poly(a ) sites will result in 3 utr shortening in most cases , without changing the coding capacity of the mrna . since the 3 utr of mrna often contains many binding sites for regulatory rna - binding proteins and micrornas , utr - apa may lead to altered mrna stability , localization , or protein translation efficiency due to variation of 3 utr length ( fabian et al . , the alternative poly(a ) sites reside in the upstream introns of genes . unlike utr - apa , cr - apa can produce different protein isoforms ; these protein isoforms lack a chunk of polypeptides at the c - termini , rendering the truncated proteins the potential to behave differently from the full - length counterparts ( hoque et al . , 2013 ) . alternative poly(a ) sites often possess non - canonical poly(a ) signals such as auuaaa , aguaaa , or uauaaa , etc . and however , these non - canonical pas can be favored over the canonical pas under certain physiological conditions and/or when the levels of trans - acting factors vary , leading to apa ( beaudoing et al . , 2000 ) . apa has gained much attention recently as it is considered a new layer of general mechanism for gene expression regulation . in recent years , advanced sequencing technologies have allowed us to study apa at a transcriptome - wide scale . many tissue - specific and biological process - specific global apa events have been reported . for example , it has been shown that mrna transcripts in brain and nervous tissues are prone to usage of distal poly(a ) sites , leading to 3 utr lengthening , while transcripts in tissues a such as retina and placenta tend to use proximal poly(a ) sites ( licatalosi et al . , 2008 ; zhang et al . , 2005 ) . this progressive 3 utr lengthening can also be recapitulated during the differentiation of mouse myoblast cells c2c12 ( ji et al . , 2009 ) . on the contrary , intriguingly , 3 utr shortening is observed when generating induced pluripotent stem cells from differentiated tissues ( ji and tian , 2009 ) . moreover , during b cell and t cell activation , global 3 utr shortening is also observed ( sandberg et al . , 2008b ) . together , these studies suggest that global utr - apa events are tissue - specific , and that 3 utr shortening seem to correlate positively to cell proliferation and negatively to cellular differentiation . indeed , sandberg et al . ( 2008b ) showed that , by comparing among different tissues and samples , there is a good correlation between the proliferative - ness of the cells and the degree of global 3 utr shortening . it has been found that transcripts with short 3 utrs are widespread in the transcriptomes of various transformed cell lines and cancer samples ( mayr and bartel , 2009 ; singh et al . , 2009 ) . moreover , global 3 utr shortening is reported in human colorectal carcinomas , breast , and lung cancers ( lembo et al . , 2012 ; morris et al . , 2012 ) ; surprisingly , in these studies , the apa profiles are shown to correlate with the degree of cancer development and prognosis , suggesting the potential utility of apa as a diagnostic marker and treatment target . nevertheless , whether the apa is driven by the proliferation or transformation of the cancer cells is still unclear ( tian and manley , 2013 ) . despite the substantial progress in our observations of global utr - apa events and their correlation with biological processes , their biological importance and functional roles in various biological processes nevertheless , in recent years , a number of specific utr - apa events are studied more extensively , which can help reveal the physiological roles of the widespread utr - apa observed in various cellular contexts . since more than 50% of the conserved microrna target sites reside downstream of proximal poly(a ) sites in mammalian genes ( sandberg et al . , 2008a ) , utr - apa can enable the transcripts to evade microrna regulation , and can have significant biological effects especially if the mrnas targeted by utr - apa are coding for genes that play regulatory roles in cellular signaling . one interesting example is one of the master regulators of myogenic differentiation pax3 , whose transcript has a mir-206 target site in the 3 utr . it has been shown that in different muscle types , muscle stem cells express varying ratios of long and short 3 utr containing pax3 transcripts , leading to varying degrees of negative regulation by mir-206 , and thus varying translation efficiencies , which may partially explain the different differentiation patterns in different muscle types ( boutet et al . , 2012 ) . 3 utrs also serve as binding platforms for many different rna - binding proteins ( rbps ) . the binding of rbps to these elements can control various characteristics of the bound mrna transcripts , such as their stability and localization ( di giammartino et al . therefore , utr - apa can allow a transcript to avoid the regulation of rbps , resulting in altered characteristics . for example , rna - binding protein celf1 binds to gu - rich elements ( gre ) in the 3 utr of select transcripts and target them for rapid decay . however , during t cell activation , a number of transcripts involved in cell division undergo utr - apa and exclude the gre in their 3 utrs , allowing them to evade the regulation by celf1 and produce more protein products ( beisang et al . , 2014 ) . it has been shown that many mrna transcripts that contain mbnl1 binding sites in their 3 utr display differing localization between the long and short 3 utr containing isoforms , with the long 3 utr transcripts preferentially localizing to insoluble compartments compared to short 3 utr transcripts ( wang et al . , 2012 ) . furthermore , in a study on rna granule formation , it has been observed that transcripts with longer 3 utrs tend to precipitate in rna granules ( han et al . , 2012 ) , while in another study , transcripts with short 3 utrs tend to form polysomes more efficiently , leading to a more robust protein translation ( chang et al . , 2015 ) . the modulations of the 3 utr length of a transcript can determine when , where , and how much a transcript is to be translated . the fact that various physiological conditions correlate with the varying profiles of global and specific apa events , as presented above , indicates that apa events are actively regulated . in the past decade , many mechanistic studies on apa have been performed , providing much insight in the mechanistic details of the apa regulation . below , we will briefly discuss what has been known and proposed regarding the mechanisms of utr - apa . it has been known that the process of polyadenylation is regulated by the strength and availability of the cis - acting sequence elements , as well as the concentration and activity of the trans - acting protein factors ( barabino and keller , 1999 ; danckwardt et al . , 2007a ) . these factors indeed also constitute the regulation of apa events ( di giammartino et al . , 2011 ; tian and manley , 2013 ) : one of the first mechanistic insights in apa regulation is the differential expression of cstf2 during b cell activation ( takagaki et al . , 1996 ) . when b cells are activated , the level of cstf2 is upregulated , leading to a preferential usage of the weaker proximal poly(a ) sites of some genes ( chuvpilo et al . , 1999 later on , a transcriptome - wide study showed that the level of cstf2 is indeed positively correlated to the tendency of global 3 utr shortening ( yao et al . , 2012 ) . the proposed mechanism for cstf2 regulated apa is the following : when cstf2 is limited , distal poly(a ) site with strong canonical pas is preferred however , when cstf2 is upregulated , it can bind to the dse near proximal poly(a ) site more efficiently to facilitate its usage , albeit having a weaker pas sequence . moreover , according the first - come - first - served model ( danckwardt et al . , 2007a ) , which is well - accepted in the field , another advantage the proximal poly(a ) site has is that with the facilitation of enhanced csft2 binding , it has a higher chance to be utilized before the distal poly(a ) site is even transcribed and can become a competition for the recognition of 3 end processing factors . apart from cstf2 , factors belonging to cfi , cpsf5 and cpsf6 , have also been implicated in influencing poly(a ) site choices . it has been reported that the loss - of - function and knockdown of cpsf5 and cpsf6 lead to global usage of proximal poly(a ) site ( martin et al . , 2012 ; the proposed mechanism is that since distal poly(a ) sites tend to possess stronger cpsf5/6 binding sites in their uses compared to proximal poly(a ) sites , down - regulation of cpsf5 and cpsf6 will render the preferential recruitment of core 3 end processing factors to distal sites by cpsf5/6 less prominent , leading to more usage of proximal poly(a ) sites ( martin et al . , 2012 ) . interestingly , in a subset of glioblastoma tumors , cpsf5 is downregulated . and the downregulation of cpsf5 results in enhanced tumorigenesis in tumor cells , possibly via its apa modulations ( masamha et al . , 2014 ) . many other 3 end processing factors and different rbps have also been found to be capable of regulating apa . for example , pabpn1 , whose function was thought to control poly(a ) tail length ( khn et al . , 2009 ) , has recently been shown to have a role in modulating 3 utr length , as well ( de klerk et al . these studies showed that loss - of - function and knockdown of pabpn1 can promote widespread 3 utr shortening in the transcriptome . moreover , they proposed that pabpn1 has a role in suppressing the usage of proximal poly(a ) sites via direct interaction with non - canonical pas . u2af2 , the splicing factor binding to polypyrimiding tracts , has been shown to be capable of interacting with and recruiting cfi to facilitate 3 end formation near polypyrimidine tracts ( millevoi et al . , 2006 ) . other rbps , such as cpeb1 and hu , have also been reported to be capable of modulating 3 utr lengths , possibly through similar mechanisms ( bava et al . , 2013 ; zhu et al . , 2007 ) . in an effort to study the mechanism(s ) of apa regulation systematically , li et al . ( 2015 ) performed sirna knockdown and deep sequencing on various 3 end processing factors , splicing factors , and some rna binding proteins , and examined their effect on global apa events . indeed , factors previously known to be capable of regulating global apa events such as cfi , cfii , pabpn1 , etc . are shown to affect utr - apa events across the transcriptome upon knockdown . although this type of study can reveal the general mechanistic actions of apa regulation , it still comes up short in terms of linking to physiological contexts . the apa events and regulations they observe in this particular cell line may not be translatable to other physiological conditions . moreover , while showing that differential expression of trans - acting factors can modulate apa events is crucial to understandin the mechanism of apa , the mechanisms through which the differential expressions of these factors are achieved in various physiological contexts are still lacking . one of the puzzle pieces that can potentially fill in this missing link is the transcription regulation by e2f transcription factors . it has been shown that many 3 end processing factors tend to possess proliferation - related sequence elements in their promoters , such as e2f binding sites , and their transcriptions are indeed affected by e2f knockdown ( elkon et al . , 2012 ) . this may provide a partial mechanistic explanation for the correlation between proliferation and upregulation of polyadenylation factors , which leads to 3 utr shortening . furthermore , we have recently shown that mtorc1 activation also drives global 3 utr shortening in the transcriptome ( chang et al . , we observed that 16.4% of the utr - apa - eligible transcripts can be actively targeted for 3 utr shortening . to understand the physiological role of the mtorc1-activated 3 utr shortening events , we performed kyoto encyclopedia of genes and genomes ( kegg ) enrichment analysis on the genes that show significant 3 utr shortening upon mtorc1 activation . intriguingly , in our analysis , ubiquitin - mediated proteolysis pathway is the pathway most targeted by mtorc1-mediated 3 utr shortening . when comparing the differential expression data from quantitative mass spectrometry and rna deep sequencing , we observed that genes belonging to ubiquitin - mediated proteolysis pathway show increased protein expressions without changing mrna levels significantly upon mtorc1 activation , suggesting that the upregulation in protein level is mediated by 3 utr shortening . indeed , in the polysome profiling experiment , we found that shorter 3 utr - containing transcripts of these genes tend to form polysomes more efficiently than their longer 3 utr - containing counterparts , indicating elevated translation efficiency . overall , we demonstrated that mtorc1 can activate ubiquitin - mediated proteolysis pathway by selectively targeting their mrna transcripts for 3 utr shortening ( fig . our study may provide a cellular mechanistic explanation for these global 3 utr shortening events as mtorc1 pathway is often hyperactivated in various cancer types ( laplante and sabatini , 2012 ) . moreover , novel physiological roles of 3 utr shortening and mtorc1 pathway in cancer biology are implicated as we have preliminary data demonstrating that tumor suppressors such as arf and securin are targeted for faster turnover by the upregulated ubiquitin - mediated proteolysis pathway . as for the mechanism of how mtorc1 mediates global 3 utr shortening , we have observed that many of the known regulators of utr - apa display altered expression levels upon mtorc1 activation . we believe that the mtorc1-mediated global 3 utr shortening events are the result of the combinatorial actions by the differential expressions of these trans - acting factors . nonetheless , more detailed mechanistic research is needed to obtain a clearer picture in this regard . utr - apa is a widespread post - transcriptional regulatory mechanism that can modulate the behavior of mrna transcripts . as demonstrated by the above mentioned individual examples of the physiological roles of utr - apa , the global utr - apa events coupled with various biological processes can most likely play significant roles in regulating cellular biology . however , the physiological roles of most of the biological process - coupled global utr - apa events are still missing . to this end , technologies and experiments capable of examining the differential protein expression efficiency , stability , and localization of utr - apa isoforms at a transcriptome - wide scale need to be employed in various relevant biological contexts . moreover , these global utr - apa events have been shown to be actively regulated . current understandings of the mechanisms of apa regulation tend to be limited to the direct actions of various trans - acting factors . however , how are the actions of these trans - acting factors are regulated by cellular signaling pathways in various cellular contexts is still largely unknown . to better understand the functional role and significance of global utr - apa events in their respective biological processes , and perhaps to be able to better manipulate these apa events as therapeutic means , more research needs to be done to link cellular signaling pathways to global apa events .
### Summary: : almost all of eukaryotic mrnas are subjected to polyadenylation during mrna processing . recent discoveries showed that many of these mrnas contain more than one polyadenylation sites in their 3 untranslated regions ( utr ) and that alternative polyadenylation ( apa ) is prevalent among these genes . many biological processes such as differentiation , proliferation , and tumorigenesis have been correlated to global apa events in the 3 utr of mrnas , suggesting that these apa events are tightly regulated and may play important physiological roles . in this review , recent discoveries in the physiological roles of apa events , as well as the known and proposed mechanisms are summarized . perspective for future directions is also discussed .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the patient was a 78-year - old male with an unremarkable family history ; he had a previous history of hypertension and had undergone laparotomies for prostate cancer and colon cancer . on march 21 , 2009 , the patient was diagnosed with impending rupture of abdominal aortic aneurysm by abdominal computed tomography ( ct ) and immediately transferred to our hospital . careful examination at our hospital revealed that the patient did not have an impending rupture , and thus he underwent elective surgery . based on subsequent examinations , the patient was diagnosed with inflammatory abdominal aortic aneurysm caused by retroperitoneal fibrosis , and artificial blood vessel replacement was scheduled for april 3 . preoperative blood test results were found to be within the normal range except for slight deviations for blood coagulation ( prothrombin time [ pt ] 97.2% , [ activated partial thromboplastin time ] 56.8% , fibrinogen [ fib ] 635 mg / dl , antithrombin iii [ at - iii ] 34.4% , d - dimer 0.88 g / ml ) and renal function ( blood urea nitrogen [ bun ] 22.07 mg / dl , creatinine [ cr ] 0.71 mg / dl ) . preoperative abdominal ct scan revealed that the abdominal aorta measured 31 mm in its greatest diameter at the point of celiac artery bifurcation , and thickened fibrous tissue was found in the periphery . while the right ureter was functioning normally , a narrowing of the lumen was seen in the left ureter at the point of renal artery bifurcation where the ureter was enveloped by fibrous tissue surrounding the aorta . for anesthesia , 100 mg of propofol , 0.25 g / kg / min of remifentanil , and 30 mg of rocuronium were used ; tracheal intubation was performed . for maintenance of anesthesia , a mixture of 2 l / min of oxygen and 3 l / min of air , 1 - 1.5% sevoflurane , and 0.25 - 0.5 changes in central venous pressure ranged from 7 to 15 mmhg , indicating a sufficient volume of infusion . furosemide ( 40 mg ) was tried , but was also ineffective ; anuria continued until the end of surgery . duration of surgery was 8 hours 16 min ; duration of anesthesia was 9 hours 52 min . the surgery completed as scheduled , and the intubated patient was transferred to the intensive care unit ( icu ) . fig . 1 and 2 show urine volume and renal function after the patient entered the icu . after entering the icu , urine output was approximately 100 ml / hr . a blood test after the patient entered the icu showed markedly elevated levels of bun ( 72.10 mg / dl ) and cr ( 8.30 mg / dl ) . three hours later , the blood test was repeated and showed further elevated levels of bun ( 70.35 mg / dl ) and cr ( 8.58 mg / dl ) . abdominal ultrasonography was performed to examine the cause ; significant bilateral hydronephrosis was observed ( fig . the patient was diagnosed with postrenal arf and a bilateral ureteral stent was placed . during placement , in particular , severe stenosis of the left ureter was observed at the l4 - 5 level . renal function swiftly improved , and there was no need for blood purification therapy . by postoperative day 10 , the patient 's renal function returned to preoperative levels ( bun 19.7 mg / dl , cr 0.79 mg / dl ) . the patient was a 41-year - old male with unremarkable family history ; he had a history of hypertension since 2006 and had undergone an aortic arch replacement for acute aortic dissection in september 2006 . prior to aortic arch replacement , the patient had an abdominal ct scan which revealed abdominal aortic aneurysm and bilateral iliac artery aneurysm . preoperative blood tests were unremarkable with the exception of slightly elevated fib ( 635 mg / dl ) . preoperative imaging findings revealed abdominal aortic aneurysm at the renal artery level , with 42 mm as the greatest diameter . furthermore , an aneurysm measuring 43 mm in its greatest diameter was observed in a region from the lower abdominal aorta at the renal artery bifurcation to the bilateral iliac artery . the day before surgery , an epidural catheter was indwelled at th 11/12 . for anesthesia , 150 mg of propofol , 0.25 g / kg / min of remifentanil , and 10 mg of vecuronium were used ; tracheal intubation was performed . for maintenance of anesthesia , a mixture of 2 l / min of oxygen and 3 l / min of air , 1 - 1.5% of sevoflurane , and 5 ml of 1% mepivacaine were intermittently administered . changes in central venous pressure ranged from 7 to 12 mmhg , indicating a sufficient volume of infusion . perioperative urine volume was satisfactory ( 950 ml ) at a rate of 30 - 300 ml / h . duration of surgery was 8 hours 16 min ; duration of anesthesia was 9 hours 52 min . the surgery completed as scheduled , and the intubated patient was transferred to the icu . the patient exhibited no marked deterioration in renal function during the perioperative period and had a satisfactory outcome . the patient was a 78-year - old male with an unremarkable family history ; he had a previous history of hypertension and had undergone laparotomies for prostate cancer and colon cancer . on march 21 , 2009 , the patient was diagnosed with impending rupture of abdominal aortic aneurysm by abdominal computed tomography ( ct ) and immediately transferred to our hospital . careful examination at our hospital revealed that the patient did not have an impending rupture , and thus he underwent elective surgery . based on subsequent examinations , the patient was diagnosed with inflammatory abdominal aortic aneurysm caused by retroperitoneal fibrosis , and artificial blood vessel replacement was scheduled for april 3 . preoperative blood test results were found to be within the normal range except for slight deviations for blood coagulation ( prothrombin time [ pt ] 97.2% , [ activated partial thromboplastin time ] 56.8% , fibrinogen [ fib ] 635 mg / dl , antithrombin iii [ at - iii ] 34.4% , d - dimer 0.88 g / ml ) and renal function ( blood urea nitrogen [ bun ] 22.07 mg / dl , creatinine [ cr ] 0.71 mg / dl ) . preoperative abdominal ct scan revealed that the abdominal aorta measured 31 mm in its greatest diameter at the point of celiac artery bifurcation , and thickened fibrous tissue was found in the periphery . while the right ureter was functioning normally , a narrowing of the lumen was seen in the left ureter at the point of renal artery bifurcation where the ureter was enveloped by fibrous tissue surrounding the aorta . for anesthesia , 100 mg of propofol , 0.25 g / kg / min of remifentanil , and 30 mg of rocuronium were used ; tracheal intubation was performed . for maintenance of anesthesia , a mixture of 2 l / min of oxygen and 3 l / min of air , 1 - 1.5% sevoflurane , and 0.25 - 0.5 changes in central venous pressure ranged from 7 to 15 mmhg , indicating a sufficient volume of infusion . furosemide ( 40 mg ) was tried , but was also ineffective ; anuria continued until the end of surgery . duration of surgery was 8 hours 16 min ; duration of anesthesia was 9 hours 52 min . the surgery completed as scheduled , and the intubated patient was transferred to the intensive care unit ( icu ) . fig . 1 and 2 show urine volume and renal function after the patient entered the icu . after entering the icu , urine output was approximately 100 ml / hr . a blood test after the patient entered the icu showed markedly elevated levels of bun ( 72.10 mg / dl ) and cr ( 8.30 mg / dl ) . three hours later , the blood test was repeated and showed further elevated levels of bun ( 70.35 mg / dl ) and cr ( 8.58 mg / dl ) . abdominal ultrasonography was performed to examine the cause ; significant bilateral hydronephrosis was observed ( fig . the patient was diagnosed with postrenal arf and a bilateral ureteral stent was placed . during placement , in particular , severe stenosis of the left ureter was observed at the l4 - 5 level . renal function swiftly improved , and there was no need for blood purification therapy . by postoperative day 10 , the patient 's renal function returned to preoperative levels ( bun 19.7 mg / dl , cr 0.79 mg / dl ) . the patient was a 41-year - old male with unremarkable family history ; he had a history of hypertension since 2006 and had undergone an aortic arch replacement for acute aortic dissection in september 2006 . prior to aortic arch replacement , the patient had an abdominal ct scan which revealed abdominal aortic aneurysm and bilateral iliac artery aneurysm . preoperative blood tests were unremarkable with the exception of slightly elevated fib ( 635 mg / dl ) . preoperative imaging findings revealed abdominal aortic aneurysm at the renal artery level , with 42 mm as the greatest diameter . furthermore , an aneurysm measuring 43 mm in its greatest diameter was observed in a region from the lower abdominal aorta at the renal artery bifurcation to the bilateral iliac artery . the day before surgery , an epidural catheter was indwelled at th 11/12 . for anesthesia , 150 mg of propofol , 0.25 g / kg / min of remifentanil , and 10 mg of vecuronium were used ; tracheal intubation was performed . for maintenance of anesthesia , a mixture of 2 l / min of oxygen and 3 l / min of air , 1 - 1.5% of sevoflurane , and 5 ml of 1% mepivacaine were intermittently administered . changes in central venous pressure ranged from 7 to 12 mmhg , indicating a sufficient volume of infusion . perioperative urine volume was satisfactory ( 950 ml ) at a rate of 30 - 300 ml / h . duration of surgery was 8 hours 16 min ; duration of anesthesia was 9 hours 52 min . the surgery completed as scheduled , and the intubated patient was transferred to the icu . in contrast to case 1 , the patient exhibited no marked deterioration in renal function during the perioperative period and had a satisfactory outcome . in surgery for abdominal aortic aneurysm , decreased renal blood flow caused by aortic blockage is associated with a high risk of postoperative renal dysfunction . however , if renal function is normal prior to surgery , and appropriate perioperative management is conducted , postoperative postrenal arf rarely occurs . in general , the most common cause of arf is acute tubular necrosis , while postrenal - related causes account for approximately 13% of the total . in case 1 , the patient developed postoperative postrenal arf . possible causes included : the presence of concomitant retroperitoneal fibrosis ; narrowing of renal tubules caused by retroperitoneal fibrosis ; and edema resulting from laparotomy , which led to ureteral compression that progressed during surgery . postrenal failure was promptly diagnosed by measures such as examining perioperative urine volume , renal function by blood sampling , and presence or absence of hydronephrosis by abdominal ultrasonography . these measures enabled the patient to receive appropriate treatment before his condition became serious and allowed for his steady recovery . in case 2 , a ureteral stent was preoperatively indwelled in the left ureter . throughout the perioperative period , the patient had satisfactory urine output with no sign of deterioration in renal function or complications of the urinary tract . consequently , the patient had a better outcome than the patient in case 1 . retroperitoneal fibrosis , a relatively rare disease in japan , forms adjacent to retroperitoneal organs and , in some cases , can occlude the ureter , which may cause urinary retention . while retroperitoneal fibrosis is caused by various factors , idiopathic retroperitoneal fibrosis with unknown causes account for a majority of cases ( 70% ) . other causes include : malignant tumor , infection , retroperitoneal injury , autoimmunity , and history of laparotomies . this syndrome is now classified in the inflammatory pathology group , which includes chronic periaortitis and inflammatory aneurysm , all of which will lead to fibrosis . in patients with inflammatory abdominal aortic aneurysm , the possibility of complications with retroperitoneal fibrosis should be considered . in case 1 , this suggests that in some patients , abdominal aortic aneurysm may be complicated by retroperitoneal fibrosis . therefore , when performing emergency aortic surgery on patients who exhibit urinary retention , retroperitoneal fibrosis should be considered a disease that requires differential diagnosis . magnetic resonance imaging ( mri ) surgical resection may be considered in cases where patients develop marked fibrosis or have complications such as postrenal failure with ureteral stenosis or inflammatory abdominal aortic aneurysm . one study reports that in inflammatory abdominal aortic aneurysm , proliferation of peripheral fibrous tissue eventually envelops the ureter , causing it to become narrower . although abdominal aortic aneurysm is rarely a cause of ureteral stenosis , one study reports that unilateral or bilateral ureteral stenosis was observed in 62% of abdominal aortic aneurysm cases . another study on inflammatory abdominal aortic aneurysm caused by retroperitoneal fibrosis reports that new hydronephrosis occurred after surgery in 19% of cases . therefore , there is a high likelihood that bilateral ureteral stenosis occurs after surgery . given that ureteral occlusion tends to occur during the perioperative period , intraoperative management is important ; during laparotomy on patients with concomitant retroperitoneal fibrosis , we should bear in mind that ureteral stenosis may occur due to ureteral edema or edema formed in adjacent tissue as a result of surgical invasion . to avoid such problems , it may be worth considering the use of steroid and albumin / fresh frozen plasma . furthermore , as seen in the second case , preoperative ureteral stent placement may allow for safer management . in abdominal surgery on such patients , ureteral occlusion may occur during the perioperative period , even when the patient 's renal function was normal before surgery . furthermore , for early detection of postoperative hydronephrosis , it is important to measure urine volume , examine renal function by blood sampling , and determine the presence or absence of hydronephrosis by abdominal ultrasonography . if there is suspicion of postrenal failure , retrograde pyelography should be performed , and ureteral stent placement is required immediately after definitive diagnosis .
### Summary: : retroperitoneal fibrosis is associated with fibroblast proliferation due to inflammatory changes in adipose / fibrous tissue . given that aortic dilation in abdominal aortic aneurysm can cause compression of the ureter , abdominal aortic aneurysm complicated by retroperitoneal fibrosis is likely to result in urinary tract obstruction . accordingly , close attention to changes in perioperative urine volume is warranted when operating on patients with abdominal aortic aneurysm complicated by retroperitoneal fibrosis . we have recently performed laparotomies on two cases of abdominal aortic aneurysm complicated by retroperitoneal fibrosis . in the first case , surgery was performed without the placement of a ureteral stent . the patient developed postrenal acute renal failure caused by postoperative urinary retention . in the second case , ureteral stent placement in advance enabled perioperative management without complications . the clinical course of these cases suggests that , in laparotomy with concomitant retroperitoneal fibrosis , preoperative ureteral stent placement can prevent postoperative complications in the renal and urinary systems .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : effective response to emerging health issues requires public health programs and policies that evolve based on trends in population health and health risk factors . health surveillance plays a key role by gathering information and shedding light on spatial and temporal variations in health measures . health surveillance is particularly relevant in countries that exhibit rapid economic development , given that changes to population health measures and risk factors are imminent and largely dynamic . thus , in countries that exhibit rapid economic growth , research studies should aim to examine the links between social , demographic , and economic contextual factors and health , in order to guide policy and address new emerging health issues . the united arab emirates ( uae ) is a country that has experienced unprecedented growth in the past forty years . the uae currently ranks 12th among world economies in relation to gross national income per capita . the federation is situated in the southeast of the arabian peninsula in southwest asia on the persian gulf . it consists of abu dhabi ( the nation 's capital ) , dubai , sharjah , ajman , umm al - quwain ( uaq ) , ras al - khaimah ( rak ) , and fujairah . using oil revenue , the uae seeked to reduce reliance on oil and to diversify its economy from a conventional , labor - intensive economy to one based on knowledge , technology , and skilled labor . this fast pace economic development caused a large influx of migrant workers to the uae , making the uae one of the most ethnically diverse countries in the world . according to census data 2005 , only 20.1% of the population ( estimated at over 4 million ) is of emirati national origin . the remainder consists of other arabs and iranians ( 23% ) , south asians ( 50% ) , and others including expatriates from europe , north america , and east asia ( 8% ) [ 5 , 6 ] . with economic growth , inevitable influences on lifestyle , the built environment , and opportunities and access to resources took place . for the emirati population , these changes resulted in social transformations that affected the traditional way of living and increased the prevalence of certain risk factors . many of these risk factors are known to be associated with the development of chronic diseases . changes to the socioeconomic environment and lifestyle influenced food consumption ( i.e. , increase in the consumption of meat , poultry , sugar , and fat ) . in addition , these changes led to heavy reliance on car transportation , sedentary lifestyles , domestic help , and a preference for indoor activities . indeed , research findings point to the low levels of physical activity among emirati postsecondary and school - aged females [ 9 , 10 ] . uae - based research findings highlight concerns for diverse health outcomes such as asthma , obesity , diabetes , anemia , motor vehicle injuries , cardiovascular diseases , and other genetic diseases [ 8 , 1114 ] . cardiovascular diseases are a major concern and the leading cause of overall death in the uae . in 2004 , data on causes of death indicate that 27% of death in abu dhabi was attributed to cardiovascular diseases in 2010 . both obesity and diabetes are high risk factors associated with cardiovascular diseases and are more recently affecting the young uae population . with high blood pressure prevalence in the uae much higher than the world average at 41% of the population , health professionals from dubai have called for a national screening for hypertension that targets secondary school children . medical professionals have attributed the disproportionate number of young heart patients in the uae to the high prevalence of diabetes and unhealthy lifestyles including smoking , sedentary lifestyle , stress , and unhealthy eating habits . other social risk factors include increased genetic predisposition due to marriages within families and the flux of migrant workers who may not be aware of certain health risks such as smoking . consanguineous marriages are common practice among the national uae population and contribute to the prevalence of blood disorders such as thalassemia . thalassemia is a major public health issue in the uae with one in 12 persons said to be a thalassemia carrier . earlier findings estimate the prevalence of alpha thalassemia , g6pd deficiency , beta thalassemia , and sickle haemoglobin at 16.5 , 8.7 , 1.7 , and 1.9% among the adult uae population . more recently , the prevalence of anemia , iron depletion , iron - deficiency anemia , g6pd deficiency , sickle cell trait , and beta thalassemia among arabic preschool children were estimated at 36.1% , 26% , 9.9% , 9.1% , 4.6% , and 8.7% , respectively . in fact , the prevalence of thalassemia in the national uae population is one of the highest in the world . although the entire uae population is affected by these fast - paced transformations and lifestyle changes , the impact of these changes on the uae adolescent population is of particular relevance for two main reasons . first , evidence increasingly suggests that adolescents may be disproportionately impacted by social and physical environmental changes . second , the adolescent population constitutes over 16% of the uae population ; thus health effects on this subpopulation will result in a large burden on healthcare . furthermore , since most uae - based health research tends to be based on small - scale studies in defined geographical areas within the federation , there is a clear need for a national study that examines the health of the adolescent uae population . in order to address this need , two researchers in collaboration with the uae ministry of education developed a research program entitled a national study of population health in the uae ( nsphuae ) ( 20072009 ) . the program consisted of developing and administering a comprehensive large - scale cross - sectional survey on over 6,300 adolescent children that attend public and private schools in the seven emirates of the federation , including 9 educational zones , thereafter referred to by geographical regions . the first component collected data on active and smoking behaviors , type and frequency of tobacco use , hygiene practices , health promotion behaviors , fish consumption , ultraviolet exposure , injury including severity and location , physical inactivity , wireless usage frequency as proxy for exposures to electromagnetic fields , frequency and type of physical activity patterns , medication use , self - reported sensory health , school absenteeism , functional capacity , quality of life , self - reported medical diagnoses , symptoms in relation to respiratory health , healthcare access and use , road traffic risk factors , and demographic and socioeconomic data . the second component collected data related to residential mobility and locations , residential characteristics including age of residents and exposures to renovations , pesticides , insecticides , source of water supply , proximity to industries / overhead power lines , concern over air pollution , and medical diagnoses for parents and siblings . data was analyzed using univariate analysis and bivariate analyses that examined differences in the prevalence of high blood pressure , heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia across the emirates , gender , and ethnicity . multivariate modeling examined the relative contribution of explanatory sociodemographic and lifestyle variables in predicting the occurrence of various health outcomes . this paper is the first of a series of publications that disseminates results of the nsphuae . the paper addresses three main objectives : ( i ) to determine the prevalence of medical diagnoses related to blood disorders any thalassemia , sickle cell anemia , and iron - deficiency anemia- , and blood circulatory conditions high blood pressure and heart disease among the uae adolescent population ; ( ii ) to examine spatial differences in the prevalence of these medical diagnoses in relation to the geographical regions ; ( iii ) to examine prevalence differences in relation to gender and among the local ( emirati ) and expatriate adolescent uae subpopulations ; ( iv ) to determine significant socioeconomic , demographic , and lifestyle predictors of blood disorders , high blood pressure , and heart disease among the uae adolescent population . the study included a randomly selected stratified sample of 147 public and private secondary schools . school enrolment data from the uae ministry of education ( 2005 - 2006 for private schools and 2006 - 2007 for public schools ) was used in the stratification strategy . the appropriate boards within the uae ministry of education and the uae ministry of health approved the study prior to survey administration . the researchers held training workshops for social workers , employed by the uae ministry of education . the social workers administered the cross - sectional survey on students from three randomly selected classes from each participating school ( one class from each of grades 10 , 11 , and 12 ) . the first component of the survey was administered on the adolescent participants during a spare period in a classroom setting . social workers collected the completed survey at the end of the defined one - hour period . the second component of the survey was sent home with the student overnight , in order for the student to seek parental assistance in completing it . when the student participants returned it the following day , a participant identification code allowed it to be matched to the first component . social workers packaged the completed surveys in preassigned boxes and sent the boxes to the uae ministry of education , where researchers picked them up . researchers entered and analyzed the data using the statistical package for the social science ( spss - v16 ) . in order to address the study objectives , analysis included answers to items that collect data related to sociodemographic , residential , and lifestyle . sociodemographic variables included sex , birth year , parental marital status , ethnicity , and socioeconomic status . two variables categorized ethnicity by whether the participant is local ( emirati ) or expatriate , and whether the participant falls into one of the following categories : uae local , gcc ( includes participants from gcc ( gulf cooperation council ) countries or gafta ( greater arab free trade area ) including kuwait , kingdom of saudi arabia , oman , qatar , bahrain , and yemen ) , arab / middle east ( participants from lebanon , syria , jordan , palestine , and iraq ) , arab / africa ( includes egypt , tunisia , morocco , algeria , libya , sudan , and somalia ) , south east asia ( includes india , pakistan , bangladesh , sri lanka , philippines , and indonesia ) , western ( europe , usa , australia , and canada ) , no nationality , and others ( all other nationalities ) . similar cultures , traditions , ancestral linkages , or geographical origins accounted for the categorization of these ethnicities . data related to annual family income , father 's employment status and education level , type of school attended ( private versus public ) , number of individuals that reside in the household , number of bedrooms in the main residence , and property tenure assessed socioeconomic status . family income was included as a bivariate variable with those that report an annual family income at or below aed15,000 in one category versus those that report a family income greater than aed15,000 . this cut - off was selected based on data from the uae ministry of economy indicating that the average monthly income for emirati households is aed36,438.10 and that for expatriate households is aed15,074.30 . the ratio for the number of individuals that reside in the household over the number of bedrooms in the main residence assessed residential crowding , which was determined using a ratio greater than 2 . eight items collected data related to residential characteristics and exposures . the educational zone of the school that the participant attended categorized the location of residence into one of 9 geographical regions : city of abu dhabi ( auh ) , western region of auh ( thereafter the western region ) , al ain auh ( thereafter al ain ) , dubai , sharjah , ajman , ras al - khaimah ( rak ) , fujairah , and umm al - quwain ( uaq ) . one item asked whether the property of residence was built prior to 1988 ; this variable was used as proxy for exposure to lead in residential paint and other construction materials that are known to impact health and that had been used in the uae in older residences . items collected data on whether the place of residence is subject to regular use of pesticides or insecticides , pest infestations , and whether they live near to industrial plants , gas stations , dumpsites , or construction or near to overhead power lines or plants . items related to one 's lifestyle collected data on smoking , exposure to smoking , illegal drug use , unconventional drug use , and physical activity . this included questions on whether they ever smoked cigarettes , tobacco , shisha ( waterpipe ) , or midwakh . they were also asked whether participants smoked cigarettes , tobacco , shisha , or midwakh in the past 30 days . active smokers consisted of participants who reported occasional or daily smoking of cigarette , tobacco , shisha , or midwakh in the past 30 days . items collected data on the age when participants first smoked any kind of tobacco , the frequency that they were exposed to tobacco at home or among their friends , and the age when they were regularly exposed at least twice a week to smoking at home or when with friends . passive smokers consisted of those who reported occasional or daily exposure to smoking . in relation to substance abuse , two items asked whether participants have ever used illegal drugs such as marijuana , hashish , or cocaine and whether they ever purposely smelled gasoline , glue , fumes , correctors , car exhaust , or burning black ants . these other forms of substance abuse are common knowledge in the uae adolescent population . a series of questions that asked participants whether they participated in any of a number of 17 activities in the past 12 months assessed participation in physical activity . self - reported responses to items that collected data on medical diagnoses assessed health outcome variables . these included items on whether or not a doctor or health professional had ever told participants that they have any of the following conditions : high blood pressure or hypertension , heart disease , thalassemia , sickle - cell anemia , any other type of anemia , and any other major health diagnosis . an open - ended item provided participants an opportunity to specify their medical diagnosis , in relation to heart disease , anemia , and other medical diagnosis . univariate analysis consisted of frequency analyses for high blood pressure , heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia . bivariate analyses were used to identify significant differences in the prevalence of these medical conditions across the emirates , in relation to gender and among locals versus expatriates . the chi - square value and the f statistic were used to determine measures of association , with a p value less than 0.05 determining statistical significance . conditional logistic regression modeling was used to assess the relative contribution of explanatory sociodemographic , residential , and lifestyle variables in predicting the occurrence of the health outcomes . for each of the modeled health outcomes , forward stepwise entry of groups of variables was conducted ; thus , explanatory variables were entered into the model one step at a time in order to identify significant predictors of the health outcome using a significance level of p 0.1 . for categorical independent variables , one category was chosen to be the reference category , with each category of the variable then compared to the reference category ( e.g. , in relation to the relative contribution of family income , participants with family income above aed15,000 are compared to those whose family income at or below aed15,000 , the latter being the reference category ) . this process resulted in a model that included significant explanatory variables ( thereafter predictors ) that explain the health outcome . the specificity ( proportion of correct prediction of individuals who do not have the health outcome ) and sensitivity ( proportion of correct predictions of individuals who have the health outcome ) of the model were noted . in order to determine possible significant interactions between each predictor and every other predictor , first - order interactions of significant predictors was performed using a backward stepwise entry with a p 0.1 ( i.e. , all interaction terms are entered into the model and then removed one step at a time ) . the last step involved entering significant predictors and significant first - order interactions into the model using forward stepwise entry with a p 0.1 . this gave rise to a new model that included significant predictors and significant first - order interactions , as well as recalibrated specificity and sensitivity measures . finally , the model with the highest sensitivity was retained as the best - fit model for each health outcome , thus predicting the highest proportion of individuals who have the health outcome . overall , 52 public and 44 private schools participated in the study . response rate ranged from 9% ( private schools in dubai ) to 100% ( public schools in fujairah and private and public schools in western region ) , resulting in an overall response rate of 65% ( table 1 ) . while undersampling of private schools was relatively high for the emirate of dubai and modest for the emirate of ajman , the statistically significant relationship between ethnicity ( local versus expatriate ) and the type of school attended ( = 2161.1 , p = 0.000 ) implies that stratification by ethnicity is appropriate in meeting the study objectives . there were significant differences across the emirates in relation to gender with a notably low percentage of males from the uaq . overall , 88% of the students report that their parents are married ( table 2 ) . the majority of expatriate students are middle eastern ( 15.7% ) , south east asian ( 16.8% ) , and north african arabs ( 10% ) . in relation to socioeconomic status , overall 74.3% of students reported an annual family income below aed15,000 , 14.4% reported that their father is unemployed , 57.8% of students reported that their father did not complete high school , 60.5% reported residential crowding , and 51% owned their property of residence . significant differences across the nine geographic regions were found for all sociodemographic variables except for parental marital status ( table 2 ) . overall , 21.8% of students resided in a property built prior to 1988 , 72.2% reported regular use of pesticides or insecticides in their homes , 59.4% reported seeing pests in their residence , 15.6% resided near industry , gas stations , dumpsites , or construction , and 16.1% resided near high power lines or power plants . significant differences across the nine regions were found for all residential variables with students from the uaq reporting the highest proportions of residing in older properties and regular exposure to pesticides or insecticides ( table 2 ) . those from rak had the highest prevalence of reporting pests in their place of residence and residing in proximity to power lines or power plants . moreover , 26.4% of students from the western region of abu dhabi resided in proximity to industry , gas stations , dumpsites , or construction . for each of the nine regions , at least 7.6% reported active smoking , 23.1% reported passive smoking , 0.4% reported ever using illegal drugs , and 22.9% reported using nonconventional substance abuse . the reported mean number of physical activities practiced in the past 12 months was 4.1 . significant differences across the nine regions were found for active and passive smoking , and the number of experienced physical activities ( table 2 ) . overall , the prevalence of high blood pressure , heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia in our sample was 1.8 , 1.3 , 0.9 , 1.6 , and 5% , respectively ( table 3 ) . analysis revealed statistically significant differences among local and expatriate adolescents for diagnosis with thalassemia ( = 8.806 , p = 0.003 ) , sickle - cell anemia ( = 15.066 , p = 0.000 ) , and iron - deficiency anemia ( = 29.461 , p = 0.000 ) . these significant differences were also seen between female locals and female expatriates for thalassemia ( = 11.062 , p = 0.001 ) , sickle - cell anemia ( = 5.729 , p = 0.017 ) , and iron - deficiency anemia ( = 18.275 , p = 0.000 ) . among males , significant differences were found between male locals and male expatriates for diagnosis with sickle - cell anemia ( = 9.676 , p = 0.002 ) and iron - deficiency anemia ( = 4.44 , p = 0.035 ) . on a regional scale , statistically significant differences in the prevalence of iron - deficiency anemia among locals and expatriate student participants were found in abu dhabi ( = 17.413 , p = 0.000 ) , western region ( = 5.048 , p = 0.025 ) , and al - ain ( = 7.377 , p = 0.007 ) . finally , significant differences existed between local and expatriate females for diagnosis with iron - deficiency anemia in abu dhabi ( = 10.176 , p = 0.001 ) . in relation to diagnosis with high blood pressure , significant differences were found between the local and expatriate population from sharjah ( = 6.965 , p = 0.008 ) . results of conditional logistic regression modeling for diagnosis with high blood pressure revealed significant predictors of living in proximity to industry , gas stations , dumpsites , or construction ; smoking at an earlier age , exposure to smoking at an earlier age , and ever purposely smelling gasoline , glue , fumes , correctors , car exhaust , or burning black ants ( table 4 ) . results suggested that students from gcc were 11.64 times more likely to develop heart disease , 6.80 times more likely to be diagnosed with sickle - cell anemia , and 3.10 times more likely to be diagnosed with iron - deficiency anemia , when compared with students from south east asian origin . local students were more likely to be diagnosed with thalassemia ( or = 7.92 ) , sickle - cell anemia ( or = 4.58 ) , and iron - deficiency anemia ( or = 3.10 ) . participants who were diagnosed with these blood disorders were also more likely to experience a higher number of physical activities in the past year . females were more likely to be diagnosed with thalassemia ( or = 3.24 ) and iron - deficiency anemia ( or = 3.97 ) . this study is the first to examine the prevalence of diagnosis with high blood pressure , heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia among the uae adolescent population . high blood pressure is known to be prevalent in the adult emirati population aged from 30 to 50 years , with higher prevalence among females than males ( 53% versus 47% , resp . ) . high blood pressure among the adolescent subpopulation is particularly relevant given that it is a leading health risk factor responsible for 2.24.9% loss of dalys , ( dependent on a country 's income group ) and can lead to heart disease . despite the young age group of the study participants , an overall 1.8% report diagnosis with high blood pressure , and 1.3% report diagnosis with heart disease . in relation to blood disorders , with over 260 known genetic diseases in the uae , public health efforts have focused on premarital genetic screening in order to decrease the incidence of prevalent blood disorders like sickle - cell diseases , thalassemia , haemophilia , and haemoglobin disorders [ 26 , 27 ] . overall , the prevalence of thalassemia , sickle - cell anemia , and iron - deficiency anemia in our sample was 0.9% , 1.6% , and 5% . the latter is largely understudied among uae adolescents and is in dire need of investigation given the critical role that iron plays in the development of muscle , brain , and red blood cells . female susceptibility to iron - deficiency anemia is particularly relevant to public health , given that an estimated 18% of maternal mortality in low- and middle - income countries is attributed to iron deficiency . another important contribution of this study relates to findings concerning potential predictors of these health outcomes . despite significant differences in demographic , socioeconomic , and lifestyle profiles across the nine regions , , significant predictors of high blood pressure are largely attributed to lifestyle and residential variables such as proximity to industry , gas stations , dumpsites , or construction , age when smoking or exposure to smoking began , and ever purposely smelled gasoline , glue , fumes , correctors , car exhaust , or burning black ants . results of the global youth tobacco survey suggested that 30% of uae male youths and 13% of females used tobacco at least once or more in the past 30 days . although , the overall prevalence of active smoking in our sample is 14.7% , it is significantly higher among expatriate males ( 25% ) compared to expatriate females ( 6% ) , and it is also linked to ethnicity . these rates are notably high among adolescent expatriates from arab / middle eastern countries ( 27.7% , 37% among males only ) and western origins ( 27.5% ) . the same applies for exposure to second - hand smoking with a larger proportion of males exposed to passive smoke ( 50% ) compared to females ( 31% ) . significant predictors of heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia include ethnicity . in addition , the increased likelihood of participating in a higher number of physical activities among those that report diagnosis with thalassemia , sickle - cell , and iron deficiency anemia can be attributed to these students ' quests for an activity that provides both the benefits and comfort . this can be challenging and subject to trial and error given that individuals with anemia tire more easily than others . significant predictors of iron - deficiency anemia include residing in proximity to industry , age when regular exposure to smoking began , number of physical activities experience in the past year , being local , ethnic background , and sex . overall , this study suggests that among the adolescent subpopulation , emirati local adolescents are more likely to be diagnosed with thalassemia , sickle - cell anemia , and iron - deficiency anemia than adolescent expatriates that reside in the uae . while genetic and ethnic factors may be linked to these differences , other possible explanations may be related to the healthy migrant effect , which suggests that immigrants are in general healthier than the host population . arguments for this phenomenon include health screening by recipient countries , healthy behavior prior to migration , and immigrant self - selection where healthier and wealthier individuals from relatively higher socioeconomic status tend to search for better opportunities in new host countries . interestingly , variables that did not emerge as significant predictors of high blood pressure , heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia include socioeconomic status , parental marital status , father / mother 's employment status , residential crowding , father / mother 's education level , property tenure , pests in residence , residing near power lines or plants , concern over air pollution , and illegal drug use . these results highlight the need for programs and policy efforts that target uae adolescents and promote awareness related to the role of lifestyle , particularly smoking behavior , and heart health . it is highly likely that the social environment of the uae promotes smoking behaviour , as evidenced by the increased popularity of shisha or waterpipe in the arab world , particularly among young male adolescents . adolescents need to be made aware of the dangers related to smoking and other substance abuse such as purposely smelling gasoline , glue , fumes , correctors , car exhaust , or burning black ants . in addition , knowledge translation in relation to the prevention of iron - deficiency anemia should target the adolescent uae population , particularly females ; results of this study suggest that an appropriate venue would be through the uae public school system . in relation to thalassemia and sickle - cell anemia , public health efforts in the uae have led to important developments ; for example , in 2006 , an independent health centre was established in dubai to provide professional and quality care for patients with thalassemia , as well as to provide extensive screening , counseling , and prevention policies that aim to reduce the number of newborns affected with thalassemia . around 40 per cent of the patients at the dubai thalassemia centre are national emiratis , another 40 per cent are expatriates from asian and african countries , while the other 20 per cent are arab nationals . first , data are self - reported and may have been subject to response bias . second , sampling led to lower representations of adolescents that attend private schools in dubai and among males that reside in the uaq . this is relevant given that the population of dubai consists of a large proportion of expatriates ; hence , results related to the expatriate population in dubai are likely to be biased . despite these limitations , this study contributed to knowledge on the epidemiology of high blood pressure , heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia among the uae adolescent population , as well as knowledge on spatial , gender , and ethnic differences in the diagnosis of these health conditions in the uae . future research should continue to examine the health of the adolescent uae population and the underlying factors linked to their health , in order to facilitate the development of tailored strategies and programs that aim to improve population health . despite the young age group of the study participants , the prevalence of high blood pressure , heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia is 1.8 , 1.3 , 0.9 , 1.6 , and 5% respectively . despite significant differences in demographic , socioeconomic , and lifestyle profiles across the nine regions , results suggest that significant predictors of high blood pressure and heart disease are largely attributed to lifestyle and residential variables , while those of thalassemia and sickle - cell anemia include ethnicity and sex . these findings highlight the need for targeted education and awareness programs that focus on the role of lifestyle ( particularly smoking behavior ) , nutrition , and heart health .
### Summary: : this study examined the prevalence of high blood pressure , heart disease , and medical diagnoses in relation to blood disorders , among 6,329 adolescent students ( age 15 to 18 years ) who reside in the united arab emirates ( uae ) . findings indicated that the overall prevalence of high blood pressure and heart disease was 1.8% and 1.3% , respectively . overall , the prevalence for thalassemia , sickle - cell anemia , and iron - deficiency anemia was 0.9% , 1.6% , and 5% , respectively . bivariate analysis revealed statistically significant differences in the prevalence of high blood pressure among the local and expatriate adolescent population in the emirate of sharjah . similarly , statistically significant differences in the prevalence of iron - deficiency anemia were observed among the local and expatriate population in abu dhabi city , the western region of abu dhabi , and al - ain . multivariate analysis revealed the following significant predictors of high blood pressure : residing in proximity to industry , nonconventional substance abuse , and age when smoking or exposure to smoking began . ethnicity was a significant predictor of heart disease , thalassemia , sickle - cell anemia , and iron - deficiency anemia . in addition , predictors of thalassemia included gender ( female ) and participating in physical activity . participants diagnosed with sickle - cell anemia and iron - deficiency anemia were more likely to experience different physical activities .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : coronary recanalization does not always lead to effective myocardial tissue reperfusion : this phenomenon is known as no - reflow . no - reflow is associated with poor prognosis , being related to adverse left ventricular remodeling , heart failure , and an increased risk of arrhythmias and mortality . the aim of our study was to investigate whether tissue doppler imaging ( tdi ) , classically used to study systolic and diastolic function , could give indirect information about myocardial perfusion assessed by myocardial blush grade ( mbg ) as reference method . this study was designed and conducted as a prospective study , enrolling patients with acute myocardial infarction ( ami ) , both st - elevation myocardial infarction ( stemi ) and non - st - elevation myocardial infarction ( nstemi ) ( 64 patients , 49 males and 15 females ; mean age 64.9 10.61 years ) , subjected to myocardial revascularization with percutaneous coronary intervention ( pci ) . the most common cardiovascular risk factors in this population were hypertension , dyslipidemia , family history , and smoking [ table 1 ] . inclusion criteria were : a typical chest pain lasting 30 minutes in medical history , st - segment elevation > 0.2 mv in at least two contiguous leads , or st - segment depression of at least 1 mv or t inversion in at least two leads ; timi flow grade 0 or 1 of the culprit vessel in the baseline angiogram ; treatment with primary pci for stemi patients or urgent / early invasive strategy for nstemi patients ; successful epicardial reperfusion assessed by timi flow grade 2 ( suboptimal result ) and 3 ( optimal result ) . myocardial reperfusion was performed in all patients at baseline ( t0 ) in agreement with the recent esc guidelines . coronary flow and microvascular perfusion ( timi and mbg ) we defined the basal timi before pci , according to the timi study group grading system . after revascularization , we re - evaluated the final timi : an optimal procedural success was defined as timi-3 flow in the culprit vessel , while suboptimal result was defined as timi-2 . at the end of the angiography according to mbg , patients were divided into two groups , those with normal blush ( a group ) and those with reduced blush ( b group ) . clinical and echocardiographic variables and adverse cardiovascular events were related to the myocardial blush categories . furthermore , cardiological evaluation including ecg and transthoracic echocardiography with tissue doppler imaging was made one month ( t1 ) and every year ( t2 ) after revascularization for a mean follow - up of 24.9 months 6.93 months . adverse cardiac events ( such as reinfarction , need of new revascularization procedures , and new onset / worsening signs or symptoms of heart failure ) were assessed during follow - up . before revascularization , all patients received lysine acetylsalicylate 250 mg i.v . , an initial bolus of unfractionated heparin 70 u / kg ( or low - molecular - weight heparin s.c . , or fondaparinux , for nstemi patients ) , and additional boluses during the procedure in order to achieve aptt values < 250 s ; clopidogrel loading dose of 300 or 600 mg orally , or ticagrelor 180 mg , or prasugrel 60 mg ; gp iib / iiia inhibitors according to clinical , laboratory , and instrumental characteristics of patients . furthermore , after the acute phase , patients received clopidogrel 75 mg / day , ticagrelor 90 mg b.i.d . , or prasugrel 10 mg for 12 months and aspirin 100 mg / day indefinitely . we measured left ventricular ejection fraction ( lvef ) by a modified biplane simpson 's method , chamber dimensions , peak early filling ( e - wave ) and late diastolic filling ( a - wave ) velocities , the e / a ratio , and deceleration time ( dt ) of early filling velocity using the apical view to record the mitral inflow pattern . peak systolic velocity ( s - wave ) , early diastolic ( e-wave ) and late diastolic ( a-wave ) velocities were measured by placing a sample volume at the septal side of the mitral annulus with tdi . we also calculated the ratios e / e and e/(a s ) ( eas index ) as measures of lv filling pressures and systo - diastolic function , respectively . the s - wave was considered as normal if 8 cm / s and pathological if < 8 cm / s . according to guidelines , diastolic dysfunction was defined as follows : baseline characteristics of the study population angiographic characteristics of the study population lad = left anterior descending artery , cx = circumflex artery , rca = right coronary artery , cad = coronary artery disease echocardiographics parameters of the study population lvedv = left ventricular end - diastolic volume grade i ( mild diastolic dysfunction ) : e / a ratio is < 0.8 , dt is > 200 ms , ivrt is 100 ms , annular e is < 8 cm / s and e / e ratio is < 8 ( septal and lateral);grade ii ( moderate diastolic dysfunction ) : e / a ratio is 0.8 - 1.5 ( pseudonormal ) and decreases by 50% during the valsalva maneuver , e / e ( average ) ratio is 9 - 14 , and e is < 8 cm / s;grade iii ( severe diastolic dysfunction ) : e / a ratio is 2 , dt is < 160 ms , ivrt is 60 ms and septal e / e is 15 ( average ) . grade i ( mild diastolic dysfunction ) : e / a ratio is < 0.8 , dt is > 200 ms , ivrt is 100 ms , annular e is < 8 cm / s and e / e ratio is < 8 ( septal and lateral ) ; grade ii ( moderate diastolic dysfunction ) : e / a ratio is 0.8 - 1.5 ( pseudonormal ) and decreases by 50% during the valsalva maneuver , e / e ( average ) ratio is 9 - 14 , and e is < 8 cm / s ; grade iii ( severe diastolic dysfunction ) : e / a ratio is 2 , dt is < 160 ms , ivrt is 60 ms and septal e / e is 15 ( average ) . an e / e ratio 8 suggested normal lv filling pressures , whereas patients with e / e 15 were classified as having elevated filling pressures . in the range of e / e of 9 - 14 , continuous variables were expressed as mean sd and student 's t - test was used to compare variables between the two groups ( normal mbg and reduced mbg ) . on the other hand , categorical variables were expressed as percentages and were analyzed using the chi - square ( ) test . multiple regression was used to detect the variables independently associated with reduced mbg . the correlation between data this study was designed and conducted as a prospective study , enrolling patients with acute myocardial infarction ( ami ) , both st - elevation myocardial infarction ( stemi ) and non - st - elevation myocardial infarction ( nstemi ) ( 64 patients , 49 males and 15 females ; mean age 64.9 10.61 years ) , subjected to myocardial revascularization with percutaneous coronary intervention ( pci ) . the most common cardiovascular risk factors in this population were hypertension , dyslipidemia , family history , and smoking [ table 1 ] . inclusion criteria were : a typical chest pain lasting 30 minutes in medical history , st - segment elevation > 0.2 mv in at least two contiguous leads , or st - segment depression of at least 1 mv or t inversion in at least two leads ; timi flow grade 0 or 1 of the culprit vessel in the baseline angiogram ; treatment with primary pci for stemi patients or urgent / early invasive strategy for nstemi patients ; successful epicardial reperfusion assessed by timi flow grade 2 ( suboptimal result ) and 3 ( optimal result ) . myocardial reperfusion was performed in all patients at baseline ( t0 ) in agreement with the recent esc guidelines . coronary flow and microvascular perfusion ( timi and mbg ) we defined the basal timi before pci , according to the timi study group grading system . after revascularization , we re - evaluated the final timi : an optimal procedural success was defined as timi-3 flow in the culprit vessel , while suboptimal result was defined as timi-2 . at the end of the angiography according to mbg , patients were divided into two groups , those with normal blush ( a group ) and those with reduced blush ( b group ) . clinical and echocardiographic variables and adverse cardiovascular events were related to the myocardial blush categories . furthermore , cardiological evaluation including ecg and transthoracic echocardiography with tissue doppler imaging was made one month ( t1 ) and every year ( t2 ) after revascularization for a mean follow - up of 24.9 months 6.93 months . adverse cardiac events ( such as reinfarction , need of new revascularization procedures , and new onset / worsening signs or symptoms of heart failure ) were assessed during follow - up . before revascularization , all patients received lysine acetylsalicylate 250 mg i.v . , an initial bolus of unfractionated heparin 70 u / kg ( or low - molecular - weight heparin s.c . , or fondaparinux , for nstemi patients ) , and additional boluses during the procedure in order to achieve aptt values < 250 s ; clopidogrel loading dose of 300 or 600 mg orally , or ticagrelor 180 mg , or prasugrel 60 mg ; gp iib / iiia inhibitors according to clinical , laboratory , and instrumental characteristics of patients . furthermore , after the acute phase , patients received clopidogrel 75 mg / day , ticagrelor 90 mg b.i.d . , or prasugrel 10 mg for 12 months and aspirin 100 mg / day indefinitely . we measured left ventricular ejection fraction ( lvef ) by a modified biplane simpson 's method , chamber dimensions , peak early filling ( e - wave ) and late diastolic filling ( a - wave ) velocities , the e / a ratio , and deceleration time ( dt ) of early filling velocity using the apical view to record the mitral inflow pattern . peak systolic velocity ( s - wave ) , early diastolic ( e-wave ) and late diastolic ( a-wave ) velocities were measured by placing a sample volume at the septal side of the mitral annulus with tdi . we also calculated the ratios e / e and e/(a s ) ( eas index ) as measures of lv filling pressures and systo - diastolic function , respectively . the s - wave was considered as normal if 8 cm / s and pathological if < 8 cm / s . according to guidelines , diastolic dysfunction was defined as follows : baseline characteristics of the study population angiographic characteristics of the study population lad = left anterior descending artery , cx = circumflex artery , rca = right coronary artery , cad = coronary artery disease echocardiographics parameters of the study population lvedv = left ventricular end - diastolic volume grade i ( mild diastolic dysfunction ) : e / a ratio is < 0.8 , dt is > 200 ms , ivrt is 100 ms , annular e is < 8 cm / s and e / e ratio is < 8 ( septal and lateral);grade ii ( moderate diastolic dysfunction ) : e / a ratio is 0.8 - 1.5 ( pseudonormal ) and decreases by 50% during the valsalva maneuver , e / e ( average ) ratio is 9 - 14 , and e is < 8 cm / s;grade iii ( severe diastolic dysfunction ) : e / a ratio is 2 , dt is < 160 ms , ivrt is 60 ms and septal e / e is 15 ( average ) . grade i ( mild diastolic dysfunction ) : e / a ratio is < 0.8 , dt is > 200 ms , ivrt is 100 ms , annular e is < 8 cm / s and e / e ratio is < 8 ( septal and lateral ) ; grade ii ( moderate diastolic dysfunction ) : e / a ratio is 0.8 - 1.5 ( pseudonormal ) and decreases by 50% during the valsalva maneuver , e / e ( average ) ratio is 9 - 14 , and e is < 8 cm / s ; grade iii ( severe diastolic dysfunction ) : e / a ratio is 2 , dt is < 160 ms , ivrt is 60 ms and septal e / e is 15 ( average ) . an e / e ratio 8 suggested normal lv filling pressures , whereas patients with e / e 15 were classified as having elevated filling pressures . in the range of e / e of 9 - 14 , continuous variables were expressed as mean sd and student 's t - test was used to compare variables between the two groups ( normal mbg and reduced mbg ) . on the other hand , categorical variables were expressed as percentages and were analyzed using the chi - square ( ) test . multiple regression was used to detect the variables independently associated with reduced mbg . the correlation between data in our study , after pci , a normal mbg was found in 43 ( 67.2% ) of 64 patients ( a group ) , while 21 ( 32.8% ) showed a reduced mbg ( b group ) . the relationship between mbg and clinical variables , and between mbg and echocardiographic variables at 1 month ( t1 ) is showed in table 4 . among clinical variables and cardiovascular risk factors , dyslipidemia and in particular , there was a statistically significant difference between dyslipidemic patients with normal mbg ( n = 21/43 ) and dyslipidemic patients with reduced mbg ( n = 16/21 , p = 0.038 ) . similarly , a statistically significant difference was found between patients with nyha class > 1 and normal mbg ( n = 19/43 ) and in patients with nyha class > 1 and reduced mbg ( n = 15/21 , p = 0.040 ) . mbg analysis , clinical and echocardiographic variables at 1 month follow - up among echocardiographic parameters , a statistically significant relationship was observed between mbg and systo - diastolic dysfunction , measured by a new echocardiographic parameter , the eas index ( p = 0.013 ) . in addition , 40 patients ( 30 patients with normal mbg and 10 with reduced mbg ) were evaluated during a mean follow - up of 24.9 months 6.93 months . the following adverse cardiovascular events were described : four reinfarctions and need of new revascularization procedures in four cases . we also assessed the relationship between mbg and clinical variables and between mbg and echocardiographic variables during the midterm follow - up as shown in table 5 . patients with reduced mbg did not show more adverse events than patients with normal blush , although a trend toward significance ( p = 0.068 ) was observed . during the follow up , patients with reduced mbg continued to have statistically significant lower eas values ( p = 0.003 ) . specifically , mbg worsened as eas index increased ( r = 0.356 , p = 0,028 ) . over the years , considerable efforts have been made to improve the outcome of patients with acute coronary syndrome ( acs ) . the primary aim of reperfusion therapy is not only the restoration of blood flow in the epicardial coronary artery but also the complete and sustained reperfusion of myocardial tissue , thus limiting the extension of myocardial necrosis . in this category of patients , the rapid recognition of symptoms and timely access to revascularization do not always achieve an effective reperfusion , a condition known as no - reflow . this term refers to a microvascular obstruction and reduced myocardial flow after opening an occluded artery , because of microcirculatory injury . the proportion of patients who receive an optimal myocardial reperfusion after pci is approximately 35% . several studies have shown that no - reflow has a strong negative prognostic impact , thus negating the potential benefit of pci . indeed , patients with no - reflow show a higher prevalence of post - infarction complications ( e.g. , arrhythmias , pericardial effusion , cardiac tamponade , early congestive heart failure ) , adverse lv remodeling , and mortality . therefore , it is important to know and prevent this phenomenon . despite the well - established diagnostic accuracy of myocardial contrast echocardiography ( mce ) in the assessment of myocardial perfusion , mbg is an index that evaluates the opacification of coronary microcirculation and its clearance after a contrast injection . as known from literature data , mbg is a predictor of adverse prognosis and it has a strong negative impact on outcome : in a population of 777 patients , vant hof et al . have demonstrated that mbg assessed immediately after pci is related to the infarct size and predicts lv function and long - term mortality . other studies have shown that despite timi 3 flow restoration in the infarct - related artery ( ira ) , patients with mbg 0 - 1 had a higher risk of lv remodeling at 6 months than patients with effective myocardial reperfusion ( mbg 2 - 3 ) . furthermore , a reduced mbg was significantly associated with the development of symptoms of heart failure and cardiovascular adverse events . in our study , patients with reduced mbg did not show a higher rate of adverse events than patients with normal mbg , although a trend toward significance was observed probably because of the small sample size . because of the well - known prognostic implications , an evaluation of mbg is needed in patients with acs undergoing revascularization . in our study , we found a relationship between mbg and eas index measured by tdi at the site of mitral annulus . pulsed wave ( pw ) tdi is characterized by easy accessibility and reproducibility , and it is widely used and validated in literature to study cardiac function by analyzing myocardial velocities . assuming that a perfusion defect results in subclinical systolic or diastolic dysfunction , measurement of tdi parameters e , a , and s - waves could provide indirect information about myocardial perfusion . previous studies have only partly stressed the relationship between the non - invasive echocardiographic approach and mbg as an invasive method for estimating myocardial perfusion . in 2008 , streb et al . compared the values of mce , mbg , and tdi in the assessment of micro circulation in 39 patients with first ami of the anterior wall , whereas none of the mce parameters showed significant correlation with perfusion assessed by mbg . on the other hand , the presence of impaired contractile function by tdi better reflected myocardial perfusion than mce did . in patients with mbg 0 - 1 who underwent left anterior descending ( lad ) artery revascularization after ami , abdel - wahab et al . demonstrated a significant deterioration of systolic tdi parameters in the infarct - related segments at the mitral annular level eas is a new index derived from tdi that reflects combined systolic and diastolic performances . it is known that s - wave reduction provides information on impaired cardiac function and increased e/a ratio is associated with increased mortality . lv dysfunction assessed by a combined index ( eas index ) of systolic and diastolic performances is an independent predictor of death in the general population , and it is superior to other echocardiographic parameters . recently , in patients with significant lv dysfunction , eas index has been considered as an independent predictor of nyha functional class , and it has been also associated with cardiac mortality and hospitalization for heart failure . in our study , we did not observe a significant association either between mbg and systolic function assessed by s - wave or between mbg and diastolic function evaluated by e-wave and e / a ratio . however , the combined measurement of systolic and diastolic dysfunction by eas index showed that this parameter was significantly impaired in patients with reduced mbg compared to that in those with normal blush with either a monthly or a medium term follow - up . our study does not claim to identify an index of impaired regional perfusion in eas but rather a sensitive parameter that could unmask a precocious myocardial dysfunction that could be related to perfusion defects in patients who underwent revascularization . the advantages of this parameter are that it is very simple , it is derived from transmitral doppler and tissue doppler at the site of mitral annulus , and it does not require specific software and new generation equipments that are not often widely available . however , like all doppler - derived techniques , it is influenced by angle dependence and therefore , it could not provide regional information . therefore , larger studies are needed to validate our results . moreover , we included patients with ami in different sites . furthermore , we are conscious that eas index is a global index of cardiac function and therefore , it can not provide regional information about perfusion but it unmasks a precocious systo - diastolic myocardial suffering . furthermore , we are conscious that eas index is a global index of cardiac function and therefore , it can not provide regional information about perfusion but it unmasks a precocious systo - diastolic myocardial suffering . thus , eas index could be used to suspect perfusion defect in patients who underwent revascularization , although this is an index of global systo - diastolic function and does not provide regional information . moreover , it could be speculated the utility of this index in patients with cardiovascular risk factors and unknown coronary artery disease . this procedure could also be useful in case of chest pain , unmodified ecg , and normal levels of cardiac biomarkers . to confirm our data ,
### Summary: : background : no - reflow phenomenon is a complication of myocardial revascularization and it is associated with a worse prognosis.materials and methods : a prospective study was carried out enrolling patients with acute myocardial infarction ( 64 patients , 49 male and 15 female , median age 64.9 10.61 years ) , both stemi and nstemi , who underwent myocardial revascularization with percutaneous coronary intervention ( pci ) . timi flow and myocardial blush grade ( mbg ) were assessed at baseline ( t0 ) , in addition to tissue doppler imaging ( tdi ) and electrocardiogram . cardiological evaluation was also performed at t1 ( one month after pci ) and t2 ( every year after revascularization for a mean follow - up of 24.9 months 6.93 months ) . patients were divided into two groups on the basis of mbg.results:in the present study , we found at t1 a significant association between mbg and dyslipidemia ( p = 0,038 ) and nyha class and mbg ( p = 0,040 ) , among clinical variables and cardiovascular risk factors . moreover , a statistically significant relationship was observed between mbg and a new echocardiographic index of systolic and diastolic dysfunction , the eas index measured with tissue doppler imaging ( p = 0,013 ) . at t2 , the eas parameter was also significantly impaired in patients with reduced mbg , compared to patients with normal mbg ( p = 0,003).conclusions : this study demonstrates that the combined evaluation of systolic and diastolic dysfunction by eas index , according to the literature , could detect a subclinical ventricular dysfunction due to a perfusion defect . therefore , eas index could be a useful parameter to be measured in the follow - up of patients undergoing revascularization .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : three features are characteristic : ( 1 ) interstitial lymphoplasmacytic infiltrates with dominant igg4-positive plasma cells ; ( 2 ) the ratio of igg4-positive / igg - positive plasma cells over 40% ; and ( 3 ) obliterative phlebitis . a cut - off value of > 10 igg4-positive plasma cells / high - power field ( hpf ) and/or ratio of igg4-positive / igg - positive plasma cells > 40% was used in the previous japanese study . soon after , in the consensus guideline on igg4-rd in 2012 , different cut - off values were applied in the number of igg4-positive plasma cells according to the type of specimen received . in renal biopsy samples , > 10 igg4-positive plasma cells / hpf are enough , but > 30 igg4-positive plasma cells / hpf are required in nephrectomy specimens . the infiltrate may be patchy in distribution ; therefore , the possibility of igg4-rd should not be excluded based on negative biopsy results , especially in the presence of other supportive clinical and imaging features of igg4-rd . the igg4/igg ratio of plasmacytic infiltration over 40% was maintained in the consensus guideline , which is a reasonable value as it demonstrated a sensitivity of 58.8% and a specificity of 90.2% in a meta - analysis . in the lymphocytic infiltrates , inflammatory infiltrates may extend into the renal capsule , which has not been known in tin of other non - infectious causes ( fig . glomeruli are usually spared , but when glomerulonephritis is associated , membranous nephropathy is the most common . vascular changes are not common , but renal arteritis was reported in one case associated with tin . interstitial immune deposits tend to be restricted in inflamed areas and they are regarded as a late change . by electron microscopy , electron - dense deposits are frequently found in the tubular basement membrane and interstitium ( fig . 1e ) . in an earlier report of idiopathic hypocomplementemic tin , which is now regarded as a form of igg4-tin , glomerular mesangial and bowman s capsular deposits were also frequently observed under electron microscopy , even though glomeruli showed no significant changes by light and immunofluorescent microscopy . renal involvement was reported in six of 132 ( 4.5% ) , 10 of 114 ( 8.8%),21 54 of 235 ( 23.0% ) , and 20 of 57 ( 35.1% ) patients with igg4-rd . patients present with acute renal failure , urinary abnormalities , or mass formation with urinary obstruction . if membranous nephropathy is associated , nephrotic range proteinuria may be present . in the presence of renal failure , serum igg4 levels ( > 135 mg / dl ) may be elevated in up to 93% of igg4-tin , which are higher than the prevalence of about 70% in total igg4-rd . this high rate may be related to the organ specificity , but it may reflect the increased number of involved organs because other organs are frequently involved at the time of diagnosis . serum igg4 levels have been reported to decrease with steroid treatment , and increase with relapse . elevated igg4 serum levels were reported in 10.8% of sle and 12.9% of rheumatoid arthritis patients . igg4 levels may even show a paradoxical response , showing an increase despite effective treatment . hypocomplementemia , elevated ige levels , and eosinophilia have been reported in 56.0%69.6% , 71.4% , and 33.0%47.8% , respectively . antinuclear antibodies ( ana ) and rheumatoid factors , usually in low titers , were reported in 31.0%69.6% and 38.9% , respectively . although histology may be highly suggestive of igg4-tin , confirmatory diagnosis relies on both histological and clinical features . in addition to igg4-positive plasma cells > 10/hpf , the presence of at least one other feature from the imaging studies , serology , or other organ involvement categories was suggested for the diagnosis . cases showing clinical and laboratory features suggestive of sle , sjgren syndrome , or anca - associated vasculitis should be excluded . other organ involvement is frequent at the time of diagnosis of tin ( 83.0%95.7% ) . among them , the salivary glands ( 82.6% ) , lymph nodes ( 43.5% ) , pancreas ( 39.1% ) , and lacrimal glands ( 30.4% ) are most frequently involved either synchronously or metachronously ( table 1 ) [ 7,8,13,26 - 28 ] . in cases of renal involvement without extrarenal manifestation , imaging studies may be helpful ( fig . four patterns of round or wedge - shaped renal cortical nodules , peripheral cortical lesions , mass - like lesions , and renal pelvic involvement , were reported . . a recent report of repeated biopsy after steroid treatment showed advanced fibrosis but decreased inflammatory activity with fewer igg4-positive plasma cells and reduced expression of connective tissue growth factor mrna . regarding disease activity , elevated serum igg4 levels and igg4-positive plasmablast levels were suggested in one study . lupus nephritis is usually characterized by proliferative glomerulonephritis with massive immune deposits and accompanying mild to moderate interstitial inflammation . rarely , it may present with predominant tin without significant glomerular changes [ 31 - 37 ] . up to now interstitial inflammatory infiltrate was composed of mixture of cd4 + and cd8 + t cells , b cells , macrophages , and plasma cells . igg , c3 , and c1q deposits were present in the tubular basement membranes , whereas glomerular deposits were negative or minimal . electron - dense deposits could be seen in tubular basement membranes and interstitium ( fig . 2 ) . igg4-positive plasma cells may infiltrate in the interstitium and igg4 deposits may be present in the peritubular interstitium and along the tubular basement membrane in lupus tin , similar to igg4-tin . in contrast to igg4-tin , immune deposits in lupus tin are rather diffuse . c1q deposits , if prominent , favors lupus tin . however , if mass - effects on an imaging study or patchy inflammatory infiltrate extending to renal capsule and beyond are present , it is unlikely to be lupus tin . distinction between igg4-rd and sle depends on the clinical diagnostic criteria , despite some differential histologic features . the american college of rheumatology ( acr ) and systemic lupus international collaborating clinics ( slicc ) criteria may be applied to the diagnosis of sle . depending on the criteria applied , a variable proportion of tin cases with igg4-positive plasma cells may be categorized into sle or other autoimmune diseases . however signs of sle may appear late and may not fulfill the diagnostic criteria at the time of biopsy . clinical and laboratory features which frequently present in igg4-rd may also be present in sle patients . reported ana subclasses in sle and igg4-rd , demonstrating igg1 , 2 , or 3 subclasses in sle and predominantly igg2 in igg4-rd , but very rare or no igg4 in both conditions . sjgren syndrome is characterized by keratoconjunctivitis sicca and xerostomia due to immunologic destruction of lacrimal and salivary glands . distal renal tubular acidosis and acute kidney injury are the main clinical manifestations . chronic tin is the most commonly observed form on renal biopsy , but glomerulonephritis may also be observed . in tin of sjgren syndrome , lymphocytes with a t - cell dominance and macrophages infiltrate in the interstitium along with mild tubulitis and tubular atrophy ( fig . clinically , symptoms of dry eye and mouth or arthralgia are more frequent in sjgren syndrome than in igg4-rd . ss - b antibodies is characteristic and was present in 71% and 54% , respectively , in one large series . serum igg4 levels were reported to be elevated in 7.5% of the patients with primary sjgren syndrome . one tin patient with sjgren syndrome showed elevated serum igg4 levels and renal interstitial igg4-positive plasma cell infiltrate . by contrast , seven of 23 igg4-tin cases fulfilled the criteria of sjgren syndrome , and anti interstitial inflammatory infiltrate is composed of lymphocytes , plasma cells , and some neutrophils . in typical cases , glomerular crescents or necrotizing lesions are commonly found with or without vasculitis and the distinction from igg4-rd is not difficult . igg4-positive plasma cells may be present , but the number of igg4-positive plasma cells and/or igg4-positive / igg - positive plasma cell ratio is usually not high . in addition , elevated c - reactive protein ( crp ) or erythrocyte sedimentation rate ( esr ) is in favor of anca - associated vasculitis . rarely , igg4-dominant tin may present with concomitant cytoplasmic anca and antibody to proteinase 3 . among the three types of anca - associated vasculitis , eosinophilic granulomatosis with polyangiitis ( egpa ; churg - strauss syndrome ) shows a close similarity with igg4-rd , in terms of upper airway involvement and eosinophilia . it may be related to up - regulation of th2 cytokines associated with increased igg4 response . yamamoto et al . reported elevated serum igg4 levels and increased igg4-positive / igg - positive plasma cell ratio and also igg4 renal infiltrate in egpa patients . vaglio et al . showed that igg4 levels correlated with the disease activity in egpa patients . chang et al . showed increased igg4-positive cells in 18.6% of 43 cases of granulomatosis with polyangiitis ( wegener s granulomatosis ) including four kidney samples , but the cases were limited to sinonasal or orbital / periorbital biopsies . a case of anca - negative egpa showed salivary gland swelling , high serum igg4 levels , membranous nephropathy with eosinophil - rich tin , and leukocytoclastic vasculitis . tubulointerstitial nephritis and uveitis with dominant igg4-positive plasma cells was suggested as a form of igg4-tin , but it was not supported by others . recently , a case of multiple organ involvement remarkably similar to that of igg4-rd was reported . the patient showed multiple hypodense renal lesions in radiographic examination and lymphoplasmacytic infiltrates with storiform fibrosis , but did not have accompanying elevated serum igg4 and igg4-positive plasma cell infiltration . igg4-tin was reported in a patient with chronic lymphocytic leukemia , and in a renal allograft patient . cases showing clinical , laboratory , and histological overlap of igg4-tin and tin of autoimmune diseases have been introduced in previous sections , and summarized in table 2 . even though each disease accompanies unique histological features , confirmatory diagnosis is made by the diagnostic criteria of each disease . the acr and slicc criteria for sle have been well established and used , but they have been modified by consensus among the experts , statistical results , and pathogenetic mechanisms . sjgren syndrome also has complex diagnostic criteria incorporating clinical features and histological findings . as mentioned previously , the diagnostic criteria of igg4-rd are also composed of a combination of histological , clinical , imaging , and laboratory features . furthermore , these complex diagnostic criteria may evolve as our understanding of the pathogenetic mechanisms and clinical course of the disease extends , as in sle . in fact , some cases that had originally been diagnosed as rheumatoid arthritis , sjgren syndrome or antiphospholipid syndrome were re - categorized into igg4-rd . even if we apply the above diagnostic criteria , symptoms are protean and laboratory abnormalities and organ involvement may vary in each individual patient . clinical and laboratory findings supportive of autoimmune diseases or igg4-rd may not be apparent at the time of biopsy . furthermore , in some cases it is not possible to distinguish igg4-tin from tin of autoimmune diseases due to overlapping clinical and laboratory features . cases in this gray zone should be collected and reserved in a separate category until we have more clear understanding on the pathogenetic mechanisms of igg4-rd and so we can unveil the possible link between them . membranous nephropathy is the most common , and about 30 cases have been reported in the english literature so far [ 26,63 - 69 ] . membranous nephropathy presented concurrently with tin in most case reports , but in one collective series , four of nine cases presented with only glomerulonephritis . glomerular histology is similar to that of idiopathic membranous nephropathy , except for a negative staining against phospholipase a2 receptor ( pla2r ) antibodies . by light microscopy , glomerular cellularity is normal and the basement membrane is mildly thickened with occasional spikes ( fig . igg4 is usually dominant among the igg subclasses and c3 deposits are frequent . on electron microscopy , electron dense - deposits are present mainly in the subepithelial and occasionally in the intramembranous areas , ranging from stage i to iii . although glomerular iga , igm , or c1q deposits are rare in igg4-rd , strong c1q deposits have been reported in a few cases of igg4-rd . mesangial or subendothelial deposits were present in three and four of nine cases of membranous nephropathy associated with igg4-rd , respectively . tubuloreticular inclusions , which are regarded as a characteristic feature of lupus nephritis , were observed in one case of igg4-rd . some authors proposed differential igg subclass staining , which demonstrated strong igg2 staining in lupus but not in igg4-rd . igg3 staining intensity similar to or exceeding that of igg4 or igg2 was reported in membranous lupus nephritis , but its comparison with that in igg4-rd has not been done . similar to tin , distinction between membranous nephropathy associated with igg4-rd and lupus membranous nephritis could not be made with certainty in a few cases . in a recent report of a case of membranous nephropathy , clinical features of both sle and igg4-rd were present . features suggestive of sle were vitiligo , elevated esr and crp , hypocomplementemia , positive ana and weakly positive anti - dsdna antibody and atypical panca , while increased serum igg4 levels , sialadenitis , lymphadenopathy , large kidneys , and marked hepatomegaly favored igg4-rd . we experienced a case of membranous nephropathy in a patient satisfying ara and slicc criteria for sle , but the patient also had retroperitoneal fibrosis . except for membranous nephropathy , henoch - schnlein purpura nephritis [ 73 - 75 ] , membranoproliferative , and endocapillary proliferative glomerulonephritis have been reported anecdotally . cases with henoch - schnlein purpura nephritis had mesangial iga deposition in addition to tin . it is unclear whether these glomerulonephritides have a direct relation with igg4-tin or develop co - incidentally . in a case of endocapillary proliferative glomerulonephritis with crescent formation , the patient had hydroureteronephrosis due to retroperitoneal fibrosis and elevated circulating immune complexes , which might raise a suspicion of urinary tract infection causing glomerulonephritis .
### Summary: : tubulointerstitial nephritis ( tin ) is the most common form of renal involvement in igg4-related disease . it is characterized by a dominant infiltrate of igg4-positive plasma cells in the interstitium and storiform fibrosis . demonstration of igg4-positive plasma cells is essential for diagnosis , but the number of igg4-positive cells and the ratio of igg4-positive / igg - positive plasma cells may vary from case to case and depending on the methods of tissue sampling even in the same case . igg4-positive plasma cells can be seen in tin associated with systemic lupus erythematosus , sjgren syndrome , or anti - neutrophil cytoplasmic antibody associated vasculitis , which further add diagnostic confusion and difficulties . to have a more clear view of igg4-tin and to delineate differential points from other tin with igg4-positive plasma cell infiltrates , clinical and histological features of igg4-tin and its mimickers were reviewed . in the rear part , cases suggesting overlap of igg4-tin and its mimickers and glomerulonephritis associated with igg4-tin were briefly described .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the authors of this manuscript aimed to show the importance of porosity and condensation in health according to traditional persian medicine ( tpm ) with consideration of new evidence in conventional medicine . cardinal traditional medical and pharmacological texts were searched for the traditional terms of takhalkhol ( porosity ) and takassof ( condensity ) focused on preventive methods . the findings were classified and compared with new medical findings . according to traditional persian medicine , porosity and condensity are the two crucial items that contribute to human health . somatotype is a taxonomy based on embryonic development , which may be considered in parallel with porosity and condensation . there are many causes for acquired porosity comprising hot weather , too much intercourse , rage , starvation , and heavy exercises . in general , porosity increases the risk of diseases as it makes the body organs vulnerable to external hot and cold weather . on the other hand , the porose organs are more susceptible to accumulation of morbid matters because the cellular wastes can not be evacuated in the normal way . there are some common points between traditional and conventional medicine in the context of porosity and condensity . condensity and porosity are the two basic items cited in the tpm resources and contribute to health maintenance and disease prevention of body organs . creating a balance between these two states in different body organs , choosing proper modality including diet , drug therapy , and manual therapy depends on the amount porosity and stiffness of the considered organ and the preferred porosity of the affected organ keeping in a normal healthy state .
### Summary: : background : the authors of this manuscript aimed to show the importance of porosity and condensation in health according to traditional persian medicine ( tpm ) with consideration of new evidence in conventional medicine.methods:cardinal traditional medical and pharmacological texts were searched for the traditional terms of takhalkhol ( porosity ) and takassof ( condensity ) focused on preventive methods . the findings were classified and compared with new medical findings.results:according to traditional persian medicine , porosity and condensity are the two crucial items that contribute to human health . somatotype is a taxonomy based on embryonic development , which may be considered in parallel with porosity and condensation . however , these terms are not completely the same . there are many causes for acquired porosity comprising hot weather , too much intercourse , rage , starvation , and heavy exercises . in general , porosity increases the risk of diseases as it makes the body organs vulnerable to external hot and cold weather . on the other hand , the porose organs are more susceptible to accumulation of morbid matters because the cellular wastes can not be evacuated in the normal way . there are some common points between traditional and conventional medicine in the context of porosity and condensity . the relation between diet and somatotype is an example.conclusion:condensity and porosity are the two basic items cited in the tpm resources and contribute to health maintenance and disease prevention of body organs . creating a balance between these two states in different body organs , strongly contributes to disease prevention , treatment and diminishing chronic diseases period . choosing proper modality including diet , drug therapy , and manual therapy depends on the amount porosity and stiffness of the considered organ and the preferred porosity of the affected organ keeping in a normal healthy state .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : shortages in the health care workforce in sub - saharan africa ( ssa ) have reached a crisis point [ 13 ] , limiting effective reduction of hypertension related morbidity and mortality rates in patients . in ssa , there are 2.4 million doctors and nurses , which translates to 2 doctors and 11 nursing / midwifery personnel per 10,000 people , compared to 19 doctors and 49 nursing / midwifery personnel per 10,000 in north america . the shortage of health workers is partly due to brain drain or the movement of health personnel in search of a better standard of living , higher salaries , professional advancement opportunities , ready access to advanced technology , and more stable political conditions . these shortages are a multifaceted problem , and improvements are needed if reduction in hypertension related morbidity in ssa is to be achieved . by the year 2020 , available evidence estimates that 75% of all deaths in ssa will be attributable to hypertension . this startling statistic raises important questions about how to best mitigate barriers to optimal hypertension control in the region [ 711 ] . in ssa countries like ghana , hypertension is now a major public health concern and the second leading cause of outpatient morbidity in adults aged 45 and above [ 7 , 1214 ] . the magnitude of the hypertension problem , including in - depth knowledge of underlying risk factors , remains incompletely understood . moreover , hypertension is increasing at alarming rates for reasons including urbanization , rapid migration from rural to urban areas , changes in dietary habits , aging of population , and social stress [ 9 , 12 , 15 , 16 ] . poorly managed hypertension also exacerbates the burden of chronic diseases such as stroke , end - stage renal disease , and heart failure , leading to increased morbidity and mortality rates in africa [ 17 , 18 ] . also , knowledge and awareness of hypertension in ssa are alarmingly low , with only 6%34% of hypertensive adults showing awareness of their status [ 12 , 19 , 20 ] . although rates of hypertension treatment range from 28% in ghana [ 12 , 19 ] to roughly 80% in nigeria [ 21 , 22 ] , actual rates of patients with maintained blood pressure control are as low as 2% . most of the existing literature to date in ssa related to hypertension management focuses exclusively on patients [ 2325 ] and sheds little light on physicians ' factors or attitudes likely to influence poor patient outcomes . yet published literature conducted elsewhere suggests that physicians and patients differ substantially in their perceptions , knowledge , and/or attitudes which may lead to conflict or poor patient outcomes . as a result , a better understanding of physicians ' perceptions the purpose of the current study was to determine perceived physician - related barriers and/or facilitators to optimal management and control of hypertension in the region . a group of physicians attending the cardiovascular research training ( cart ) institute at the university of ghana , college of health sciences , was invited to participate in this study . the mission of cart is to train the next generation of researchers with expertise in cardiovascular epidemiology in ssa , social determinants of cardiovascular disease ( cvd ) , comparative effectiveness research , community - based participatory research , and dissemination and implementation of community- and practice - based interventions targeted at cardiovascular risk reduction . the investigators met with physicians attending cart and explained that the goal of the project was to identify factors that influence optimal hypertension control in patients in sub - saharan africa . following consent , the investigative team asked participants to complete the concept mapping steps below using the concept systems global max software ( concept systems , inc . , inclusion criteria for the study were participants being at least 18 years of age and participating in the cart training program . twelve physicians participated in this study ( nine from nigeria and three from ghana ) . smaller groups are more conducive to concept mapping methods , detailed below , which is the rationale for the small sample size . concept mapping , a structured , participatory mixed - methods approach to data collection , was used to gather and interpret the ideas generated from physicians in the region . the main steps of concept mapping have been described extensively in the literature [ 27 , 28 ] . it is a six - step process that integrates group process activities on a topic of interest with several multivariate quantitative analytical tools ( multidimensional scaling and hierarchical cluster analysis ) to yield both statistical and graphical representation of a conceptual domain . ( 1 ) preparation : the researchers outline the research goals and describe that the primary focus is participants ' perceptions of factors influencing blood pressure management and control . ( 2 ) generation : the researchers present participants with a focus prompt ( e.g. , a specific factor that influences blood pressure control is ) . the investigative team reviews the list to remove duplicates to create a final list of generated ideas . ( 3 ) structuring : participants engage in sorting sessions , in which statements are grouped based on similarities into clusters identified and created by the participants . the sorting provides the data needed to generate clusters of factors that influence hypertension management . ( 4 ) representation : computerized analyses are run and the data are summarized into concept maps . ( 5 ) interpretation : participants are invited back to interpret the final cluster maps . these interpretation group discussions are designed to address the research goal of exploring factors that influence optimal management of blood pressure control in west africa . concept mapping is a unique approach that promotes trustworthiness in the analysis of qualitative data as it includes participants in all aspects of the research process [ 28 , 29 ] . also , the application of the quantitative tools provides structure and reliability to data generated through qualitative techniques [ 27 , 29 ] . the following prompt was used to elicit ideas from physicians : as a health care provider , a specific factor that affects your ability to control high blood pressure is ; brainstorming sessions were conducted online in order to promote candid responses and reduce potential desirability effects . in response to the focus statement , participants were asked to provide concise statements that described factors related to optimal hypertension management and control in patients . the investigative team then distilled these into 54 distinct statements by eliminating duplicate statements , editing statements for clarity , or combining similar statements that reflected physicians ' perceptions of factors influencing optimal management of hypertension . the statements from the brainstorming session were then randomly reordered for concept mapping sorting and rating steps . physicians worked on an individual basis to sort the statements into conceptually similar groups and were asked to rate the importance and feasibility of statements separately on a 5-point scale . importance and feasibility were rated on a 5-point scale that ranged from , for importance , 1 : relatively unimportant , to 5 : extremely important , and , for feasibility , 1 : not at all feasible , to 5 : extremely feasible , compared to all other statements . for instance , for each statement physicians were asked , how important is this to hypertension management and how feasible is this to address ? see figure 2 for sample sorting . concept systems software was also used for analyzing data generated from the sorting and rating exercise . the software used multidimensional scaling ( mds ) to create a two - dimensional point map that illustrates the distances between the statements generated for each set of sort data . aside from being used to structure the sort data , mds does not independently influence the interpretation of results . the mds analysis is based on the measurement model that assumes that the relative similarity of objects can be represented in terms of the relative distance between pairs of points . the two - dimensional point map is chosen for its ease and interpretability . on the point map , items that are more similar based on participant appear closer together . we also calculated the stress value of the point map , which is a measure of how well the mds solution maps the original data . a lower stress value indicates a better fit of the mds point map to the original data . subsequently , we conducted hierarchical cluster analysis of the mds coordinates and computed average rates of each statement and cluster of statements . this created a cluster map that partitions the statements on the point map into conceptual domains . the maps that result show the individual statements in two - dimensional ( x , y ) space with more similar statements located nearer to each other and also show how the clusters partition the space on the map [ 28 , 29 ] . since there are no criteria by which a final number of clusters can be selected , investigators independently evaluated potential solutions ( i.e. , 6 clusters and 9 clusters ) and agreed on the final model . in the interpretation phase of concept mapping , we asked physicians to examine different cluster solutions to determine the best number of clusters and grouping of the statements . items that are closer together illustrate greater degrees of similarity and were sorted together by more people . a seven - cluster solution was initially presented to the physicians because the statements within the clusters were conceptually similar to each other . following further discussion , a four - cluster solution was considered to be visually superior in summarizing the results of the concept mapping . go zone matrices assign x- and y - axes to sets of data rated by the physicians where each statement is assigned coordinates based on its respective mean rating . lines in the go zone matrix , which correspond to the mean rating for each axis , divide the graph into four quadrants ( low / low , low / high , high / low , and high / high ) . for instance , items in the top right quadrant are those that were rated as highly important to hypertension management and feasible to address . following the assumption that high ratings are ideal , the high / high quadrant is considered the go zone as it contains those ideas rated most highly on both criteria ( i.e. , importance and feasibility for addressing patients ' blood pressure ) . clusters include patient self - efficacy and support factors ( 20 statements ) , physician - related factors ( 14 statements ) , policy level factors ( 15 statements ) , and economic factors ( 5 statements ) . the statements in the clusters are denoted by numbers in the figure and they correspond to the item numbers in table 1 . salient statements from the patient self - efficacy clusters included lack of patient compliance to therapies : diet , medication , physical activity , and stress management ( workplace , home , etc . ) ( item number 3 ) and patients think hypertension is curable after some time on medication ( item number 43 ) . these statements also reflect physicians ' doubt of patients ' treatment efficacy . the cluster of physician - related factors reflects barriers and facilitators that physicians themselves may face with helping patients manage and control their hypertension . two salient statements in the cluster : we do not adequately counsel our patients on ways to control their blood pressure ( item number 9 ) and the failure of physicians to adopt a patient centered model in educating patients about their conditions ( item number 14 ) , highlight that physicians ' attitudes towards hypertension management may be more important than their actual knowledge of the disease . furthermore , statements in relation to workload ( item number 46 high patient burden at hypertension clinics ) may also make it difficult to have good doctor - patient communication or engage in strategies such as patient counseling which would contribute to reduction in high blood pressure rates . policy level factors and economic factors reflect physician perceptions of barriers to hypertension management and control operating at the systems level which patients may have little or no control over . for example , statements , such as primary healthcare systems are nonfunctional ( item number 31 ) and the cost and availability of blood pressure drugs ( item number 38 ) , may affect the hypertension care outcome in patients or contribute to physician inertia that may have anticipated or unanticipated effects with hypertension awareness , treatment , control , and medication adherence in the region . figure 4 provides the go zones matrices for each of the four clusters . these statements were rated either above or below the mean for both importance and feasibility by the physicians . of all the statements , the one rated highest for importance was item number 1 : our patients are in denial and they fail to accept their condition , and the highest for feasibility is item number 13 : we do not have the required equipment to provide the needed care for the management of high blood pressure . the statement that was ranked among the lowest for importance is item number 7 : the age of the patient influences physicians ability to discuss blood pressure management . two items were ranked as not feasible ; both were patient related issues and they include item number 22 : patients experience stress of modern day life , and item number 24 : patients lack resources for follow - up care . using concept mapping , this study examined physicians ' perceptions of factors influencing hypertension management and control in patients in sub - saharan africa . unlike other methods of qualitative inquiry such as focus groups , concept mapping allows for a shared understanding of factors influencing optimal management and control of hypertension in patients through a wide range of physician generated statements and ideas . in total , 54 statements were generated and grouped into four clusters that reflect patient self - efficacy and support factors , physician - related factors , policy level factors , and economic factors . although physicians generally agreed on the importance and feasibility of these statements , it can be surmised from their ratings that two specific factors , namely , patient - related factors ( i.e. , the patient 's ability to come to terms with their diagnosis of hypertension ) and economic factors ( access to medical resources / equipment for the management of hypertension ) , were regarded as the most important hurdles that are not too difficult or too costly to surmount . particularly with regard to patients , failure to accept their condition and denial of hypertension were noted as the most important factor influencing patient adherence to medication and behavioral changes . this may be in part due to the lack of adequate patient counseling on blood pressure management as well as the failure to adopt a patient centered model , which were both noted as barriers to optimal blood pressure management in this study . it might also be inferred that high workload may preclude their engagement of ineffective hypertension management strategies . indeed , this result complements those of other studies examining chronic disease in sub - saharan africa . murphy and colleagues found that negative provider interactions affected patients ' ability to accept their condition as well as their motivation to engage with providers about behavioral and lifestyle changes needed to manage diabetes . patients also noted the lack of sufficient counselling and discussed that they wanted providers to spend more time educating them on the disease and management , as they felt ill - equipped to handle it themselves . additionally , our study found that lack of a functional primary health care mechanism and patients ' lack of resources for follow - up care , including regular access to medication , greatly hamper efforts to control blood pressure . , in south africa , in which the authors found that over half of the households surveyed could not afford regular follow - up care ; in some cases families had no income and depended on gifts from friends and other family members to afford health care . majority of these cases received intermittent treatment at best . even among households with the means to seek care , weaknesses at the health systems level including poor referral systems , interrupted medication supply , and poor provider - patient interactions were primary barriers to consistent treatment . interventions addressing these barriers at the provider and health systems level are needed to facilitate optimal maintenance and treatment of hypertension . though there is ample evidence that hypertension is an increasing problem in ssa , there is a lack of evidence regarding health care workers ' perceptions of factors that influence optimal disease management . our results complement the few studies that have investigated this topic and are similar to those reported in a recent review of systems level factors influencing hypertension control in ssa . in many parts of ssa , workforce shortage has reached a crisis point and severely limits the ability of physicians to effectively reduce hypertension related morbidity and mortality rates . workforce shortage and overworked physicians et al . , a survey of 16 health practitioners also identified medical staff shortage as a challenge to the effective management of hypertension at primary care facilities in south africa . similarly , an analysis of interviews conducted among patients from 18 community health centers in cape town suggested that doctors and nurses were working under increasingly difficult circumstances and staff shortages are the main barriers to effectively managing patients with chronic conditions such as hypertension similarly , a nurse - led protocol for the management of hypertension in 454 patients over a 26-month period led to a drop of systolic pressure ( 11.7 mmhg ) and diastolic pressure in patients ( 7.8 mmhg ) between baseline and final visits . task - shifting is one possible solution to the noted barriers by physicians in this study as it would ( 1 ) reduce the workload for currently practicing physicians and ( 2 ) allow patients to receive more time with health care providers discussing how to properly manage hypertension through appropriate lifestyle changes . as providers in this study noted that patient self - efficacy factors related to acceptance and management of their condition were among the several barriers to optimal hypertension control , more in - depth and longer sessions with health care providers could help patients improve self - efficacy and address concerns related to disease management . despite the implications for policy and practice , there are limitations to the current study . the relatively low sample size makes it difficult to generalize findings to other physicians in the region . furthermore , the concept mapping process itself was very intensive , requiring several hours of participation for brainstorming , sorting of statements , and rating of those statements . the use of the cardiovascular research training program ( cart ) was extremely helpful as coordinators allocated time during the training which enabled physicians to finish the various concept mapping steps on time . however , the time demand of concept mapping may have prohibited more physicians from participating due to their high workload . the findings of our study suggest that hypertension management and control as reflected in the perceptions of physicians is a multifaceted problem . patient self - efficacy and support , physician - related factors , policy factors , and economic factors are important aspects that must be addressed if reduction in hypertension related morbidity and mortality rate in sub - saharan africa is to be achieved . the strength of this study is the focus on key stakeholders ( i.e. , physicians ) in sub - saharan africa who are often left out of discussions of ways to mitigate the worldwide rising problem of hypertension . their practical experience allows them insight into a wide range of factors that may impede efforts to reduce hypertension related morbidity and mortality not only at a local but also on a regional and global level . given the work demands for physicians , future research should explore viable and cost - effective strategies such as task - shifting or the rational distribution of tasks among health care workforce teams in sub - saharan africa .
### Summary: : hypertension , once a rare problem in sub - saharan africa ( ssa ) , is predicted to be a major cause of death by 2020 with mortality rates as high as 75% . however , comprehensive knowledge of provider - level factors that influence optimal management is limited . the objective of the current study was to discover physicians ' perceptions of factors influencing optimal management and control of hypertension in ssa . twelve physicians attending the cardiovascular research training ( cart ) institute at the university of ghana , college of health sciences , were invited to complete a concept mapping process that included brainstorming the factors influencing optimal management and control of hypertension in patients , sorting and organizing the factors into similar domains , and rating the importance and feasibility of efforts to address these factors . the highest ranked important and feasible factors include helping patients accept their condition and availability of adequate equipment to enable the provision of needed care . the findings suggest that patient self - efficacy and support , physician - related factors , policy factors , and economic factors are important aspects that must be addressed to achieve optimal hypertension management . given the work demands identified by physicians , future research should investigate cost - effective strategies of shifting physician responsibilities to well - trained no - physician clinicians in order to improve hypertension management .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : van der woude syndrome is an autosomal dominant syndrome characterized by cleft lip or cleft palate , distinctive pits of the lower lips , or both . the degree to which individuals who carry the gene are affected widely varies , even within families . in general about 1 - 2% of patients with cleft lip or cleft palate have van der woude syndrome . hypodontia ( absent teeth ) also has been increasingly recognized as a frequently associated anomaly . we present a case of van der woude 's syndrome , which was managed by both orthodontic and surgical means in the mixed dentition period . a female patient aged 6 years and 7 months , reported to our department with the chief complaint of malaligned upper and lower front teeth . the extra - oral examination revealed a surgical scar on the upper lip , bilateral symmetrical lower lip pits , obtuse nasolabial angle and a concave profile due to recessive upper lip and everted lower lip [ figures 1a and 1b ] . ( a ) pre - treatment extraoral frontal view , ( b ) pre - treatment extraoral profile view , ( c ) pre - treatment intraoral frontal view , ( d ) pre - treatment orthopantomograph a bilateral cleft of the alveolus was observed intra - orally with an overhanging mobile premaxilla . the patient was in mixed dentition stage with permanent central incisors still in erupting stage [ figure 1c ] . phase i of the treatment consisted of expansion of the maxillary arch to correct the posterior cross - bite [ figure 2 ] . expansion was continued for 6 months until the posterior cross - bite was overcorrected and the quad helix was retained in place . maxillary central incisors and canines were bonded and 0.016 niti arch - wire was ligated to prevent an anterior cross - bite from developing [ figure 3 ] . phase i treatment with quad helix for maxillary expansion 0.016 niti archwire ligated to prevent development of anterior crossbite phase ii of the treatment involved secondary alveolar bone grafting to provide adequate bone support for the eruption of canines . at the cleft site , the bone graft was then placed in the pouch and the flap edges were approximated and sutures placed . the oronasal fistula on the right side of the cleft was completely obliterated by the graft . on reviewing the case after 6 months , it was decided that maxillary protraction would not be required as the profile had become sufficiently straight . however , to maintain the arch width and to facilitate unhindered growth of maxilla till the permanent canines erupted , functional regulator-3 ( fr-3 ) was delivered [ figures 4a and 4b ] . ( a ) status of the dentition 6 months post - surgery , ( b ) functional regulator-3 appliance delivered to maintain the expansion ( 5 mm ) and to promote unimpeded maxillary growth , ( c ) extraoral frontal view 6 months post - functional regulator-3 appliance therapy , ( d ) extraoral profile view post - functional regulator-3 appliance therapy it was observed that the premaxilla had immobilized completely and the profile had improved esthetically to a considerable extent [ figures 4c and 4d ] . the patient was followed - up regularly for a period of 6 months after which she had to discontinue the treatment at our institution as her parents had migrated . treatment of cleft patients in mixed dentition requires an accurate judgment on the diagnosis and treatment plan priorities . teeth if made to erupt through the grafted bone further increase bone stock and respond well to orthodontic forces . need for secondary alveolar grafts : closing oronasal fistulae stabilizing the maxillary segments restoring the alveolar ridge providing a bony support for teeth adjacent to the cleft minimizing maxillary growth disturbance . bone grafting is typically performed between the ages of 9 and 11 years of age shortly before canine eruption . in this case also the secondary alveolar grafting as done to achieve adequate bone level for canine eruption . the anterior iliac crest is the most common donor site used today ( gold standard ) . this site is preferred as adequate amount of bone can be mobilized , which has high particulate cancellous bone content . calvarium and mandibular bone has been advocated , as being a superior donor however , there are inconsistent clinical results . radiographic follow - up demonstrated adaptation of the cancellous bone of the iliac crest to the host area , making it impossible to distinguish the mesial and distal limits of the cleft . the findings of present case agree with other studies in which teeth erupted through the grafted bone . cancellous bone graft is quickly incorporated and vascularized and most importantly , does not interfere in presence of the tooth contributes to the preservation of the grafted bone and to the differentiation of the periodontal support . the use of fr in cleft lip and palate patients has not been studied in detail . it has been said that frankel appliances promote periosteal growth in either of the jaws depending on the type of appliance used . in this case , we decided to use fr-3 as a retention appliance to promote maxillary growth and to maintain the changes achieved till the permanent teeth especially , the canines erupt . this has given a better lip support , enhancing facial and dental esthetics and dental occlusion . one thing which really encouraged us was the increased positive psychologic impact on her personality and self - esteem .
### Summary: : this article presents the case of a patient with van der woude syndrome treated with orthodontic and orthopedic intervention in the mixed dentition stage . the patient had a bilateral cleft of the lip and alveolus accompanied by lip pits on the lower lip . intra - orally , there was bilateral anterior and posterior cross - bite with a collapsed maxilla . the maxillary transverse deficiency was managed with orthopedic expansion and the second phase of treatment involved secondary alveolar bone grafting followed by retention with functional regulator-3 . the mild maxillary retrognathia and deficient lip support was managed with dental compensation .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : proximal hypospadias with chordee is a complex problem accounting for 10% to 20% of all hypospadias . no single technique has given consistently good results , various procedures have evolved , ranging from single stage modified koyanagi repair is a one - stage procedure for severe hypospadias with the added benefit of correcting the associated transposition . from 2008 to 2011 , boys with proximal penile or penoscrotal hypospadias with chordee and poor urethral plate requiring its transection were selected to undergo a modified koyanagi repair . all these patients were operated by the senior author at either of the two institutions . the flap was transposed ventrally by buttonholing the fascia containing the vascular pedicle [ figure 2 ] . medial edges of the lateral limbs of the flap were sutured together in the midline to create a wide neourethral plate [ figure 2 ] . also , 7/0 or 6/0 ( depending on the age ) long - term absorbable monofilament sutures ( maxon or pds in centres 1 and 2 respectively ) were used . the neourethral plate was then tubularised over a silastic 8f catheter using the same suture [ figure 3 ] . marking of skin flaps parameatal flap transposed ventrally and their medial edges sutured to form wide urethral plate tubularization of flap and completed repair subsequently , glans wings were raised and meatoplasty and glansplasty completed . finally , a tunica vaginalis flap was used as reinforcement for the repair . the byar s flap created from the dorsal hood was brought around ventrally to complete the skin cover [ figure 3 ] . in patients with transposition , the scrotal flaps were rotated medially and downward and sutured at the base of the penis ventrally . only a single dose of preoperative antibiotic was used ( cefotaxime 50 mg / kg in centre 1 and cefazolin 50 mg / kg in centre 2 ) . postoperatively , all patients received oral analgesics , laxative ( lactulose ) , and anticholinergic ( oxybutinin ) until the catheter was removed . in centre 2 , all children were discharged as day care and called back on postoperative day 7 for dressing and catheter removal , while , in centre 2 , the dressings were removed after 48 h and the patients were discharged following catheter removal on postoperative day 7 . all patients underwent a single calibration 1 week after catheter removal and subsequently if necessary . the patients were assessed at follow - up for urinary stream , glans configuration , straightness of shaft , and completeness of transposition correction . absence of any complications , normal good caliber , and uninterrupted stream qualified for a good functional outcome . conical glans , straight shaft , and absence of penoscrotal transposition were considered a good cosmetic result . a total of 24 boys ( age : 9 months to 11 years ) underwent the repair . the overall complication rate was 45.8% ( n = 11 ) , of which 12.5% ( n = 3 ) were major , 20.8% ( n = 5 ) fistulas , and 12.5% major complications included one each of complete breakdown , glans breakdown ( that was subsequently repaired ) , and urethral stenosis ( that needed laying open of distal neourethra ) . the remaining were minor complications ; 5 boys developed a fistula , of whom , 3 underwent fistula closure , 1 closed spontaneously and 1 is awaiting fistula closure [ table 1 ] . also , 2 boys had meatal stenosis that was amenable to dilatation and 1 boy developed lateral chordee due to scarring of the transposition correction suture line . the child with complete failed repair and the one with lateral chordee are awaiting further surgery . koyanagi repair uses a vascularized parameatal based foreskin flap to provide the necessary long urethroplasty . the original koyanagi repair used a y - shaped flap that was later modified to a although it was first reported more than 25 years ago , it did not become popular due to high complication rates ( 47% ) . this was attributed to the fact that no specific care was taken to preserve blood supply of the flap . this deficit was later corrected in the modified koyanagi repair put forth by koff et al . , and hayashi et al . , hayashi also modified the koyanagi repair by preserving a wide vascular pedicle for the distal skin flaps and by utilizing the distal urethral plate as the base for the distal neourethra . he reported that this lowered the incidence of complications ( 8% in his series ) . recent publications report success rate of the modified koyanagi repair varying from 70% to 82% [ table 2 ] . comparative analyses of complications in different series modified koyanagi repair is based on a vascularized flap , and blood supply to that must be well preserved . in this series , complications were seen initially when broad - tip bipolar cautery was used . non - availability of fine - tip bipolar may have hampered the fragile blood supply of the pedicle and the resulting ischemia , which is the cause of complications . this is one reason some authors recommend suture ligation of only significant bleeders instead of using bipolar cautery . in addition , the major complications occurred during the early period of the study and are attributed to the learning curve . it is important to ensure that a flap width of 7 - 8 mm is maintained throughout . flap can be accidentally narrowed at the site of native meatus and at the junction between ventral and dorsal skin . some authors recommend preoperative hcg ( 250 iu intramuscular twice weekly for 5 weeks or 80 iu / kg once a week for 3 weeks ) . the results of the modified koyanagi are comparable to those of other single - stage repairs . although it appears that the complication rate with this technique is significantly high , our data reveals that most complications are self - limiting ones or amenable to minor second - stage procedures . there is no torsion or bulking of the penile shaft as is apparent in other repairs . finally , the major dissection and tubularization is performed on a virgin tissue plane without underlying scar affecting vascularity . this repair also allows simultaneous repair of associated penoscrotal transposition with a good cosmetic and functional outcome . modified koyanagi repair in a select group of severe hypospadias with chordee gives a good cosmetic and functional result . complications rate is low once the learning curve is crossed as it allows simultaneous correction of associated transposition with a good cosmetic outcome .
### Summary: : aim : to report the results of an early series of patients who underwent modified koyanagi repair for severe hypospadias.materials and methods : a total of 24 boys ( age : 9 months to 11 years ) with proximal hypospadias , chordee , and poor urethral plate underwent modified koyanagi repair between september 2008 and january 2012 . nine boys had associated penoscrotal transposition that was corrected simultaneously . vascularized parameatal based foreskin flap was used to correct the hypospadias in a single stage . the follow - up ranged from 6 months to 3.5 years.results:a total of 13 of the 24 children had a good outcome and were voiding normally , while 11 boys developed complications , 3 of which were major and 8 minor . the major complications were complete breakdown ( n = 1 ) , meatal and distal neourethral stenosis requiring laying open of distal urethra ( n = 1 ) , and glans breakdown ( n = 1 ) . the minor complications included fistulae ( n = 5 ) , meatal stenosis amenable to dilatation ( n = 1 ) , and lateral chordee ( n = 1 ) . majority of the complications were in the initial patients , with successful outcomes in the last 1 year . most of these complications were successfully managed by minor second procedures.conclusion:modified koyanagi repair not only corrects severe hypospadias with chordee but also corrects the associated penoscrotal transposition in a single stage . the results are good once the learning curve is crossed .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : atrial fibrillation ( af ) is the most common cardiac arrhythmia and increases the risk of stroke and death . inflammation is an important factor related to the initiation , maintenance , and recurrence of af . this abnormal inflammation may cause a prothrombotic state , finally resulting in thromboembolism . in persistent af , atrial enlargement and structural and electrical remodeling form the basis of atrial changes . structural remodeling is associated with an activated and gradually progressive fibrosis and inflammation process in the atrial extracellular matrix ( ecm ) [ 35 ] . matrix metalloproteinases ( mmps ) are major mediators of normal ecm remodeling [ 35 , 7 ] . moreover , studies have increased our understanding of the role of inflammation in af by showing that c - reactive protein ( crp ) [ 68 ] and the neutrophil - to - lymphocyte ratio ( nlr ) are associated with af [ 911 ] . however , the exact mechanism of the pathogenesis and progression of af remains to be elucidated . a growing body of evidence is showing that galectin-3 [ 1214 ] , lipocalin-2/neutrophil gelatinase - b - associated lipocalin ( lcn2/ngal ) [ 1517 ] and n - terminal propeptide of type iii procollagen ( piiinp ) [ 1820 ] seem to play important roles in the cardiovascular inflammation and fibrosis that result in cardiac remodeling . in the present study , we aimed to investigate whether serum levels of galectin-3 , lcn2/ngal , piiinp , and nlr differ in patients with af compared with patients with a sinus rhythm , with guidance of known markers such as serum mmp-9 and hs - crp levels . we also evaluated the associations of these markers with atrial structural remodeling , which was interpreted by measuring the left atrial volume index . the study population included 85 patients who were seen in our outpatient clinic between march 2012 and january 2013 . fifty - two patients diagnosed with non - valvular ( mitral and aortic valve ) persistent af ( af duration longer than 1 month ) were recruited into the af group . end - stage hepatic or renal disease , malignancy , any prior blood transfusions , carotid artery disease , prior transient ischemic attack and ischemic or hemorrhagic stroke , oral anticoagulant usage , and nyha functional class iii or iv patient were exclusion criteria in our study . thirty - three age - matched patients with sinus rhythm were recruited into the control group . a clinical history of risk factors such as diabetes mellitus , hypertension , hypercholesterolemia , and cardiovascular disease were recorded . for each patient , we calculated height , weight , body mass index ( bmi ) , and body surface area ( bsa ) . based on the serum creatinine level on admission , estimated glomerular filtration rate ( e - gfr ) was calculated by using the modification of diet in renal disease ( mdrd ) formula . the ethical implications regarding the study were approved by the local ethics committee and informed consent was obtained from each patient . the lv ejection fraction ( ef ) was assessed by the modified biplane simpson method . cardiac dimensions were measured according to the recommendations of the american society of echocardiography by m - mode and 2-dimensional echo . lv mass ( lvm ) was calculated from 2d echocardiographic measurements by using devereux formula : lvm=1.04 * [ ( lvsw + lvpw + lvedd ) ( lvedd)]13.6 and was indexed to body surface area . two cardiologists , blinded to patient clinical history , performed the physical examinations , measured outcome variables , interpreted all echocardiograms , and verified lv volumetric analyses . left ventricular ejection fraction ( lvef ) was calculated using the biplane method of discs ( modified simpson s rule ) in the apical 4- and 2-chamber views at end systole and end diastole . the left atrial volume was calculated by using the biplane method of discs ( modified simpson s rule ) in the apical 4- and 2-chamber views at end diastole of the atria . the samples were kept at room temperature for 15 min to permit coagulation and were then centrifuged at 1000 g for 15 min . the serum was separated with the aid of a pipette , transferred to eppendorf tubes , and kept at 40c until analysis . the serum levels of galectin-3 , mmp-9 , lcn2/ngal , and piiinp were measured using commercial enzyme - linked immunoassay kits , and each assay was carried out in duplicate . the galectin-3 level was determined using sandwich elisa ( human galectin-3 elisa kit ; ebioscience ) , ngal levels ( human lipocalin-2/ngal elisa kit ; biovendor research and diagnostic products ) , mmp-9 levels ( human matrix metalloproteinase 9 ; bio - medical assay ) , and a piiinp kit ( human procollagen iii n - terminal propeptide ; bio - medical assay ) . the minimal measurable concentrations for these detection systems are 120 pg / ml for galectin-3 , 20 pg / ml for ngal , 60 pg / ml for piiinp , and 50 pg / ml for mmp-9 . the hemoglobin level and white blood cell count were determined as part of the automated complete blood count using a sysmex xt-1800i ( usa ) hematology analyzer . the baseline nlr level was measured by dividing the neutrophil count by the lymphocyte count . a white blood cell count of > 12,000 cells/l or < 4,000 cells/l and high body temperature of > 38c were excluded from the study to ensure a subclinical inflammatory status . continuous variables are expressed as mean sd or median ( interquartile range ) when appropriate . to compare parametric continuous variables , student s t - test was used ; to compare nonparametric continuous variables , the mann - whitney u - test was used . to compare categorical variables , the pearson and spearman correlation coefficient were used to determine parametric and nonparametric measure of statistical dependence between 2 variables . multivariate regression analysis was used to identify the independent predictors of higher lavi value > 48 mm\m ( mean lavi value is 48 mm\m ) . all variables showing significance values of less than 0.1 on univariate analysis were included in the model . a 2-tailed p - value of less than 0.05 was considered to indicate statistical significance . the statistical analyses were performed using software ( spss 15.0 , spss inc , chicago , il ) . the study population included 85 patients who were seen in our outpatient clinic between march 2012 and january 2013 . fifty - two patients diagnosed with non - valvular ( mitral and aortic valve ) persistent af ( af duration longer than 1 month ) were recruited into the af group . end - stage hepatic or renal disease , malignancy , any prior blood transfusions , carotid artery disease , prior transient ischemic attack and ischemic or hemorrhagic stroke , oral anticoagulant usage , and nyha functional class iii or iv patient were exclusion criteria in our study . thirty - three age - matched patients with sinus rhythm were recruited into the control group . a clinical history of risk factors such as diabetes mellitus , hypertension , hypercholesterolemia , and cardiovascular disease were recorded . for each patient , we calculated height , weight , body mass index ( bmi ) , and body surface area ( bsa ) . based on the serum creatinine level on admission , estimated glomerular filtration rate ( e - gfr ) was calculated by using the modification of diet in renal disease ( mdrd ) formula . the ethical implications regarding the study were approved by the local ethics committee and informed consent was obtained from each patient . the lv ejection fraction ( ef ) was assessed by the modified biplane simpson method . cardiac dimensions were measured according to the recommendations of the american society of echocardiography by m - mode and 2-dimensional echo . lv mass ( lvm ) was calculated from 2d echocardiographic measurements by using devereux formula : lvm=1.04 * [ ( lvsw + lvpw + lvedd ) ( lvedd)]13.6 and was indexed to body surface area . two cardiologists , blinded to patient clinical history , performed the physical examinations , measured outcome variables , interpreted all echocardiograms , and verified lv volumetric analyses . left ventricular ejection fraction ( lvef ) was calculated using the biplane method of discs ( modified simpson s rule ) in the apical 4- and 2-chamber views at end systole and end diastole . the left atrial volume was calculated by using the biplane method of discs ( modified simpson s rule ) in the apical 4- and 2-chamber views at end diastole of the atria . the samples were kept at room temperature for 15 min to permit coagulation and were then centrifuged at 1000 g for 15 min . the serum was separated with the aid of a pipette , transferred to eppendorf tubes , and kept at 40c until analysis . the serum levels of galectin-3 , mmp-9 , lcn2/ngal , and piiinp were measured using commercial enzyme - linked immunoassay kits , and each assay was carried out in duplicate . the galectin-3 level was determined using sandwich elisa ( human galectin-3 elisa kit ; ebioscience ) , ngal levels ( human lipocalin-2/ngal elisa kit ; biovendor research and diagnostic products ) , mmp-9 levels ( human matrix metalloproteinase 9 ; bio - medical assay ) , and a piiinp kit ( human procollagen iii n - terminal propeptide ; bio - medical assay ) . the minimal measurable concentrations for these detection systems are 120 pg / ml for galectin-3 , 20 pg / ml for ngal , 60 pg / ml for piiinp , and 50 pg / ml for mmp-9 . the hemoglobin level and white blood cell count were determined as part of the automated complete blood count using a sysmex xt-1800i ( usa ) hematology analyzer . the baseline nlr level was measured by dividing the neutrophil count by the lymphocyte count . a white blood cell count of > 12,000 cells/l or < 4,000 cells/l and high body temperature of > 38c were excluded from the study to ensure a subclinical inflammatory status . continuous variables are expressed as mean sd or median ( interquartile range ) when appropriate . to compare parametric continuous variables , student s t - test was used ; to compare nonparametric continuous variables , the mann - whitney u - test was used . to compare categorical variables , the pearson and spearman correlation coefficient were used to determine parametric and nonparametric measure of statistical dependence between 2 variables . multivariate regression analysis was used to identify the independent predictors of higher lavi value > 48 mm\m ( mean lavi value is 48 mm\m ) . all variables showing significance values of less than 0.1 on univariate analysis were included in the model . a 2-tailed p - value of less than 0.05 was considered to indicate statistical significance . the statistical analyses were performed using software ( spss 15.0 , spss inc , chicago , il ) . the baseline characteristics of the groups ( mean age , 718 years ; minimum age , 42 years ; maximum age , 85 years ; 62% female ) are presented in table 1 . there were no differences between the groups in terms of baseline characteristics , excluding congestive heart failure , and no differences in the conventional laboratory findings . aspirin and digitalis use was significantly higher in the nvaf group , but there were no differences in the remaining medications . the ef was significantly lower and the lvmass , lav , and lavi were significantly higher in patients with nvaf ( table 1 ) . there were significant differences between the groups in terms of inflammatory and remodeling markers , with the exception of the ngal levels ( table 2 ) . the galectin-3 , mmp-9 , and piiinp levels were significantly higher in patients with nvaf ( 1166 pg / ml ( 11261204 ) and 1204 pg / ml ( 11661362 ) p=0.001 , 104 ( 81179 ) pg / ml and 404 ( 162564 ) pg / ml p<0.0001 , and 1101 ( 5001960 ) pg / ml and 6710 ( 23709950 ) pg / ml p<0.0001 respectively , mann - whitney u test fol all . the nlr and hs - crp levels were also higher in patients with nvaf ( 2.11.0 vs. 2.71.1 mg / l , p=0.04 , student s t - test , respectively ) ( figures 1 and 2 ) . figures 3 and 4 demonstrate a correlation between lavi and the inflammatory and remodeling markers as shown by the correlation analyses . nlr showed a significant correlation with lavi , whereas hs - crp did not ( p=0.007 , r=0.247 , pearson s test and p=0.808 , r=0.025 , pearson s test , respectively ) . moreover , galectin-3 , mmp-9 , and piiinp showed a strong positive correlation with lavi ( p=0.021 , r=640 , spearman s test ; p=0.004 , r=0.319 , pearson s test ; and p=0.004 , r=0.325 , pearson s test , respectively ) . in univariate analysis , a cut point was determined as mean lavi value , mmp-9,piiinp , nlr , and ef were correlated with high lavi ( lavi > 48 mm / m ) ( table-3 ) . in multivariate analysis , piiinp [ odds ratio ( or)=1.22 , 95% confidence interval ( ci ) ( 1.111.41 ) , p=0.001 ] was the only independent factor associated with high lavi . the baseline characteristics of the groups ( mean age , 718 years ; minimum age , 42 years ; maximum age , 85 years ; 62% female ) are presented in table 1 . there were no differences between the groups in terms of baseline characteristics , excluding congestive heart failure , and no differences in the conventional laboratory findings . aspirin and digitalis use was significantly higher in the nvaf group , but there were no differences in the remaining medications . the ef was significantly lower and the lvmass , lav , and lavi were significantly higher in patients with nvaf ( table 1 ) . there were significant differences between the groups in terms of inflammatory and remodeling markers , with the exception of the ngal levels ( table 2 ) . the galectin-3 , mmp-9 , and piiinp levels were significantly higher in patients with nvaf ( 1166 pg / ml ( 11261204 ) and 1204 pg / ml ( 11661362 ) p=0.001 , 104 ( 81179 ) pg / ml and 404 ( 162564 ) pg / ml p<0.0001 , and 1101 ( 5001960 ) pg / ml and 6710 ( 23709950 ) the nlr and hs - crp levels were also higher in patients with nvaf ( 2.11.0 vs. 2.71.1 mg / l , p=0.02 , student s t - test and 4.21.9 vs. 6.04.7 mg / l , p=0.04 , student s t - test , respectively ) ( figures 1 and 2 ) . figures 3 and 4 demonstrate a correlation between lavi and the inflammatory and remodeling markers as shown by the correlation analyses . nlr showed a significant correlation with lavi , whereas hs - crp did not ( p=0.007 , r=0.247 , pearson s test and p=0.808 , r=0.025 , pearson s test , respectively ) . moreover , galectin-3 , mmp-9 , and piiinp showed a strong positive correlation with lavi ( p=0.021 , r=640 , spearman s test ; p=0.004 , r=0.319 , pearson s test ; and p=0.004 , r=0.325 , pearson s test , respectively ) . in univariate analysis , a cut point was determined as mean lavi value , mmp-9,piiinp , nlr , and ef were correlated with high lavi ( lavi > 48 mm / m ) ( table-3 ) . in multivariate analysis , piiinp [ odds ratio ( or)=1.22 , 95% confidence interval ( ci ) ( 1.111.41 ) , p=0.001 ] was the only independent factor associated with high lavi . the most important finding of our study is the new fibrosis and inflammation markers in patients with af : galectin-3 , pniiip , lcn2/ngal , hs - crp , and nlr . we have shown higher levels of these fibrosis and inflammation markers with the guidance of the serum levels of mmp-9 , hs - crp , and echocardiographic measurements such as lavi in patients with af compared with patients with a sinus rhythm . mmps are upregulated , indicating that the unbalanced expression of the mmp / timp system may have a role in the process of atrial structural remodeling . our findings confirm those of previous studies in which enhanced mmp-9 activity was proposed as a major molecular mechanism contributing to the dilation of the atria . the role of galectin-3 in the pathogenesis of cardiac fibrosis involves the recruitment of additional macrophages , myofibroblasts , and fibroblasts , resulting in cellular proliferation and secretion of procollagen after mechanical and neurohormonal stimuli , which results in secretion of galectin-3 from macrophages . galectin-3 has been shown to mediate cell - to - cell and cell - to - ecm interactions and acts as a novel chemo - attractant for monocytes and macrophages . to the best of our knowledge , we found higher levels of galectin-3 in patients with af than in the control group , indicating that galectin-3 may play a crucial role in the migration of inflammatory cells . based on these data , we suggest that galectin-3 can be used as a novel target in patients with af to decrease the degree of fibrosis and inflammation in the atria . cardiomyocytes , vascular wall cells , and fibroblasts in myocarditis strongly express lipocalin-2/ngal , which is associated with insulin resistance . lipocalin-2/ngal has been studied in various cardiovascular diseases ( e.g. , myocarditis and coronary heart disease ) but not yet in af . we found no significant difference in the levels of lipocalin-2/ngal between patients with af and the control group . lipocalin-2/ngal levels are generally higher in obese patients , and in our patient population there was no significant difference in the mean body mass index . therefore , in this study , statin use in the control group was slightly higher . one of the serum markers of collagen synthesis is piiinp , which reflects collagen turnover . its role as a marker of collagen synthesis has been shown in various cardiovascular diseases , but to date few study in af has been performed [ 1820,29,30 ] . swartz et al . have demonstrated that piiinp levels correlate with presence of la fibrosis and may be a predictor for post - operative af . piiinp is a cardiac remodeling marker and is used to monitor the anti - remodeling effect of various drugs such as aldosterone antagonists . in this study , we showed significantly higher levels of piiinp in patients with af compared with the control group , indicating that during collagen turnover , piiinp may play a role in the remodeling of the atria in patients with af . previous studies have contributed to our understanding of the role of inflammation in af by showing that hs - crp [ 68,33 ] and nlr are associated with af [ 911 ] . according to the review by bhat et al . , the association of nlr with af has not been evaluated in detail . recently , in association between nlr and af , few studies have focussed on cardioversion success , ablation therapy results , and thromboembolic stroke risk . in our study , nlr showed a significant correlation with lavi , whereas hs - crp did not . according to our study results , nlr is an inflammatory marker that plays a role in remodeling of the atria . on a molecular and cellular level , galectin-3 and various other markers activate and increase the numbers of monocytes and macrophages involved in cell - to - cell and cell - to - ecm interactions during atrial remodeling . the renin - angiotensin - aldosterone system plays an important role in structural atrial remodeling . the current literature indicates that angiotensin - converting enzyme inhibitors ( aceis ) and angiotensin ii receptor blockers ( arbs ) prevent the development of af ( primary prevention ) . contrary to these data , the significance of the role of aceis and arbs in upstream therapy ( secondary prevention ) is not clear . some results have been encouraging , whereas others have been very unfavorable ; however , some data show a positive anti - remodeling effect in patients with af . in light of recent reports , and according to our data , piiinp , galectin-3 , and nlr levels could be important in determining the presence of underlying heart disease ( remodeling status ) in patients who are candidates for medical therapy . a reduction in new - onset af has been reported in patients with remarkable underlying heart disease treated with aceis or arbs , but the benefit was minimal in patients with moderate structural heart disease and recurrent af . a gissi - af echocardiographic sub - study revealed that during 1 year arb for did not reverse la remodeling or prevent af recurrence . therefore , early anti - remodeling therapy should be recommend to patients with persistent af before irreversible ecm remodeling occurs , as pointed - out by gramley et al . . it is important to identify the time at which atrial remodeling starts in patients likely to develop af in the short term . reported a purpose for new clinical concepts of af in the facilitation of intensive clinical monitoring and management . based on our results , we suggest that lavi and new fibrosis and inflammation markers such as galactin-3 , piiinp , and nlr may predict the beginning of the atrial remodeling process . the main limitation is the lack of histologic correlation , because we did not perform a histopathological examination of atrial tissue . however , research on fibrosis and inflammation markers at the tissue level would contribute additional information . the main limitation is the lack of histologic correlation , because we did not perform a histopathological examination of atrial tissue . however , research on fibrosis and inflammation markers at the tissue level would contribute additional information . several unexplained mechanisms of atrial remodeling remain , but the present study has taken the first step in elucidating the mechanisms involving fibrosis and inflammation markers . although targeting fibrosis and inflammation as early anti - remodeling therapy is not supported by the current data , present study findings also suggest that galectin-3 , piiinp , and nlr may contribute to the clinical and therapeutic management of af as novel targets for therapies that aim to decrease fibrosis and inflammation in the atria .
### Summary: : backgroundstructural remodeling is associated with the fibroinflammatory process in the atrial extracellular matrix . in the present study we aimed to investigate whether serum levels of new circulating remodeling markers differ in patients with atrial fibrillation ( af ) compared to patients with sinus rhythm.material/methodsthe study population included 52 patients diagnosed with non - valvular af and 33 age - matched patients with sinus rhythm . serum levels of galectin-3 , matrix metalloproteinase-9 ( mmp-9 ) , lipocalin-2 ( lcn2/ngal ) , n - terminal propeptide of type iii procollagen ( piiinp ) , hs - crp , and neutrophil - to - lymphocyte ratio ( nlr ) were measured . the left atrial volume ( lav ) was calculated by echocardiographic method and lav index was calculated.resultsgalectin-3 , mmp-9 , and piiinp levels were significantly higher in af patients except ngal levels ( 1166 pg / ml ( 11261204 ) and 1204 pg / ml ( 11661362 ) p=0.001 , 104 ( 81179 ) pg / ml and 404 ( 162564 ) pg / ml p<0.0001 , and 1101 ( 5001960 ) pg / ml and 6710 ( 23709950 ) pg / ml p<0.0001 , respectively ) . the nlr and hs - crp levels were also higher in af ( 2.11.0 and 2.71.1 p=0.02 and 4.21.9 mg / l and 6.04.7 mg / l p=0.04 , respectively ) . in correlation analyses , nlr showed a strongly significant correlation with lavi , but hs - crp did not ( p=0.007 r=0.247 , pearson test and p=0.808 r=0.025 , pearson test , respectively ) . moreover , galectin-3 , mmp-9 , and piiinp had a strong positive correlation with lavi ( p=0.021 r=640 , spearman test and p=0.004 r=0.319 pearson test , and p=0.004 r=0.325 pearson test , respectively).conclusionsnovel fibrosis and inflammation markers in af are correlated with atrial remodeling . several unexplained mechanisms of atrial remodeling remain , but the present study has taken the first step in elucidating the mechanisms involving fibrosis and inflammation markers .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : since its introduction more than twenty years ago , the american association of physicists in medicine task group 43 ( aapm tg-43 ) dose calculation formalism for photon - emitting radionuclide sources [ 1 , 2 ] has become a mainstay of brachytherapy dosimetry clinical practice . originally developed for low - energy interstitial implants , the formalism has subsequently been applied broadly to intracavitary and superficial treatments , and to treatments delivered using miniaturized electronic radiation sources , so that today it is recognized as a de facto international standard . tg-43 dose calculation methodology is based on the parameterization and superposition of single - source dose distributions , obtained in liquid water under fixed geometry conditions approximating full scatter , and incorporates the assumption that these distributions have cylindrical symmetry . demonstrable benefits to the brachytherapy community accruing from the use of the tg-43 formalism include standardization of the dose calculation method and of the single - source dosimetry parameter sets , and simplicity and universality of implementation in commercial treatment planning systems ( tpss ) . such extensive standardization has brought a high level of consistency to the comparison of treatment regimens and clinical outcomes across institutions , a feature that is especially valued in clinical trials research . nevertheless , despite these benefits , the tg-43 approach is limited by several inherent simplifications as noted by rivard et al . . these are based in the radiological physics domain and involve a lack of consideration of : 1 ) differences between absorbed dose in water and tissues ; 2 ) differences between radiation attenuation in water and tissues ; 3 ) radiation interactions with an applicator or other sources ; 4 ) radiation scattering conditions in and immediately adjacent to the patient , and 5 ) dose contributions from electrons . the extent to which each limitation influences the accuracy of dose calculation depends upon the anatomic site and the energy of the radiation source . for example , in ir breast treatments , the lack of consideration of scattering conditions near the skin surface can lead to skin dose estimates that are more than 5% higher . for another example , in pd and i prostate implants , inter - seed attenuation can potentially reduce dose by more than 10% along the needle insertion direction and lower planning target volume ( ptv ) d90 by as much as 5% . conveniently summarized the sensitivity of the most common anatomic sites to the aforementioned dosimetric limitations in tabular form , and observed that most applications of brachytherapy are impacted to some degree . as 3d image - based , volume - optimized treatment planning began to replace film - based planning in brachytherapy , more sophisticated approaches to dose calculation having their origins in nuclear science and the nuclear industry were adapted to meet the need for greater dose calculation accuracy . collectively referred to as model - based dose calculation algorithms ( mbdcas ) by aapm tg-186 for their capacity to calculate dose deposition in a patient using information from medical images , these algorithms employ a variety of methods to improve calculation accuracy . the resulting improvements are expected to be greatest for low - energy ( < 50 kev ) sources , for which dose deposition is demonstrably most sensitive to differences in tissue and applicator composition . as a result of concerted developmental efforts , motivated by perceived clinical need , a number of different algorithms have found their way into commercial tpss . in this article , we briefly describe the commercial mbdcas that are currently available , identify professional society guidance intended to facilitate their safe and appropriate use , and highlight some considerations associated with their introduction into clinical practice . we also look at early applications of these mbdcas including some examples from our own work in progress , and conclude with a summary of their current and anticipated future benefits . given the article s broad scope , the approach taken has been to present material concisely and to provide salient references for readers desiring more detail . presently , commercial treatment planning systems that incorporate a mbdca include brachyvision ( varian medical systems , palo alto , ca ) for ir high - dose - rate ( hdr ) and pulsed - dose - rate ( pdr ) brachytherapy , oncentra brachy for ir hdr , ir pdr , and co hdr brachytherapy ( nucletron , an elekta company , elekta ab , stockholm , sweden ) , as well as radiance ( gmv sa , madrid , es ) for intraoperative radiotherapy with low - energy x - rays ( < 50 kev ) , which in several respects is similar to electronic brachytherapy . the following brief overview and comparison of the three mbdcas available in these tpss were gleaned from product - related literature [ 8 , 9 , 10 ] , white papers [ 11 , 12 ] , and a recent review of brachytherapy dose calculation algorithms . in terms of radiation physics , the transport of particles ( photons , electrons , protons , etc . ) through matter and their interaction with it is governed by the linear boltzmann transport equation ( lbte ) . for any given irradiation set - up , involving an inhomogeneous medium , solutions can be obtained using one of three main approaches : 1 ) monte carlo ( mc ) simulation , which tracks a large number of particles undergoing successive random interactions in the medium ; 2 ) grid - based numerical methods , which directly solve a discretized version of the equation , and 3 ) point kernel superposition methods , which take a solution for a much simpler set - up and adapt it to the set - up at hand . the mbdcas available in the three commercial tpss identified above each take a unique approach to solving the lbte for photon - emitting brachytherapy sources , but with some notable similarities . these include performing dose calculations on a variably - sized 3d cartesian grid for efficiency , assuming charged - particle equilibrium so that dose can be equated to collisional kerma , employing a primary / scatter dose separation framework enabling the dose from primary photons ( photons exiting the source not scattered in the medium ) to be calculated analytically , and reporting the dose to local medium for transport in full medium , d m , m , as defined and recommended by aapm tg-186 . as well , two of the mbdcas ( acurosbv in brachyvision and the advanced collapsed - cone engine [ ace ] in oncentra brachy ) use a semi - analytic first - scatter distributed source approach to mitigate ray - effect artifacts that can arise from photon angle discretization . first released in 2009 , the acurosbv mbdca in brachyvision was inspired by attila ( transpire inc . , gig harbor wa , usa ) , a general - purpose software system for radiation transport calculations that originated in the los alamos national laboratory . acurosbv is an independent , dedicated software package that employs a numerical solution method optimized specifically for brachytherapy dose calculations . supported radiation sources are individually modelled as one or more point sources representing the energy and angular dependent photon intensity emitted from the source surface . acurosbv solves the lbte directly by discretizing all six of its independent variables : space ( 3 variables ) , photon angle ( 2 variables ) , and photon energy ( 1 variable ) . the fineness or coarseness of the discretizations affects both the accuracy and speed of dose calculation , and so an appropriate balance is required . this balance has been optimized for ir sources in the current software , and can not be modified by the user . a potential issue with angular discretization methods is the presence of ray - line artifacts in the dose distribution , however these have been essentially eliminated in acurosbv . early versions of the software reported only dose to water for photon transport in full medium , d w , m ; however , since 2013 , the user has been offered a choice between d m , m and d w , m . studies indicate there is little difference between d m , m and d w , m in soft tissues for ir sources , but potentially large differences for low - energy sources such as i [ 7 , 17 , 18 , 19 ] . a complete description of acurosbv and its approach to solving the lbte for brachytherapy applications can be found in varian brachytherapy product literature . the ace mbdca in oncentra brachy , first released in 2014 , is the result of research done to extend the collapsed - cone convolution / superposition ( cccs ) dose calculation method used in external beam radiotherapy planning to brachytherapy . supported radiation sources are individually modelled as anisotropic point emitters , with near - source corrections ( obtained from mc simulation ) applied for the finite extent of the source , for dose gradient averaging over finite voxels , and to a limited extent , for electron transport . advanced collapsed - cone engine calculates the dose as the sum of three components representing contributions from primary , once - scattered , and multiply - scattered photons . in principle , the first two components solve the lbte , whereas the last component is an approximation . once- and multiply - scattered dose contributions are successively calculated by ccc of the local photon fluence with pre - computed point dose kernels . the dose kernels are generated in a fixed - size water volume using mc simulation and scaled to reflect the influence of each different material in the inhomogeneous medium . both the fixed water volume size and scaling operations are approximations that can limit algorithm performance in certain circumstances [ 20 , 21 ] . parameters in the calculation that influence accuracy and over which the user is given limited control include the numbers of photon transport directions ( coincident with the collapsed cone axes ) for once- and multiply - scattered photons . as for acurosbv , angular discretization ( in the form of photon transport directions ) brings with it the possibility of ray - line artifacts , which for ace are comparatively more pronounced , but of limited clinical concern . a comprehensive description of the implementation can be found in a recent publication dedicated to the topic . finally , the hybrid mc algorithm in the radiance tps , initially released in 2015 , was developed specifically for intra - operative radiotherapy . it combines ray - tracing to obtain primary dose with a custom mc code to obtain scatter dose for a photon beam generated by a miniaturized linear accelerator ( xrs 4 ) , and collimated by an applicator . the algorithm is made to execute quickly by considering only photoelectric interactions and the first two orders of compton scattering , incorporating a condensed history method for photon transport , and employing variance reduction techniques . as each xrs 4/applicator combination typically has a different photon emission spectrum , the algorithm does its work in two phases . in an initial , commissioning phase , it models the emission spectrum by simulating radiation transport in the applicator and then weighting the spectrum to fit a measured percentage depth dose curve in water medium . the result is a phase space file that is used in the ensuing clinical application phase , as the source of primary photons for radiation transport simulation in the treatment medium and dose calculation in a user - defined volume of interest . the approach is more fully described in a conference abstract , a white paper , and an appendix in the radiance user s manual . however , at this time , detailed information regarding algorithm implementation is limited . in contrast to the tg-43 formalism , which is based on the simplifying ( and convenient ) assumptions identified earlier , the model - based approach to dose calculation requires that the treatment applicator and the patient anatomy in the vicinity of the treatment site be adequately described , in addition to the radiation source . this involves specifying photon emissions from the radiation source , and geometry and material compositions for the treatment applicator and patient . vendors have integrated the first two inputs into the tps in the form of predefined source models and applicator libraries , respectively . the user selects a source and applicator model , and then places and orients the applicator within a virtual representation of the patient obtained from 3d images , most commonly ct scans . the 3d image set forms the basis for the third input , the patient anatomy description , which must be constructed by the user . this is done by delineating structures of interest through the familiar process of contouring , and then assigning the material properties of chemical composition and mass density to each of them . the assignment can be done in several ways : 1 ) by selecting from a predefined list , a material whose properties are uniformly assigned to all voxels in a structure ; 2 ) for ct images , by stipulating that a mapping of hounsfield numbers to materials be used , which assigns material properties to each voxel individually in a structure ; 3 ) for ct images , by assigning chemical composition via 1 . and mass density via 2 . all mbdca implementations involve a tradeoff between dose calculation accuracy and execution speed , over which a tps might provide the user some control . for example , oncentra brachy does this for the ace algorithm by offering a choice between standard ( sace ) and high accuracy ( hace ) calculation , the latter involving a greater number of transport directions and so requiring a longer execution time . such a choice , if available , needs to be made on an individual treatment basis after gaining experience with a mbdca , as described in the next section . commissioning a brachytherapy tps involves verifying the proper functioning of key system components and of the overall system . general guidance in carrying out these tasks can be found in professional society reports such as aapm tg-40 , aapm tg-56 , estro booklet 8 , and specifically for hdr ir systems , aapm tg-59 . when the tps incorporates a mbdca , additional algorithm - specific tasks need to be done as recommended in the aapm / estro / abg tg-186 report . recently , a web - based mbdca commissioning registry was opened to support physicists and dosimetrists in performing these additional tasks , as reported at the 2016 world congress of brachytherapy by the joint aapm / estro / abg working group on mbdcas in brachytherapy [ 16 , 29 ] . in brief , the registry enables an mbdca user to compare a locally calculated dose distribution with a reference dose distribution generated , using mc simulation , for a series of well - defined test plans. commissioning resources available on the registry are presently limited to an initial set of four generic test plans for hdr ir brachytherapy ; however , these will be augmented with clinical site - specific hdr ir test plans and eventually extended to include i brachytherapy . the peer - reviewed literature also offers guidance and resources to aid in mbdca commissioning [ 30 , 31 , 32 , 33 , 34 ] . the dose distribution can differ substantially from that obtained using tg-43 , and therefore , it is essential to assess how such differences might impact clinical practice . this needs to be done on a treatment site- and technique - specific basis , in order to ascertain whether current prescription doses and dose limits on organs at risk require revision for mbdca dosimetry . for this reason , professional societies recommend that treatment providers perform tg-43 and mbdca dosimetry in parallel and carefully compare results for a period of time sufficient to gain confidence in making the clinical transition to a mbdca [ 7 , 35 , 36 ] . some clinically - motivated examples illustrating this parallel dosimetry approach can be found in the recent review article by papagiannis et al . . it should also be noted that because the commercial mbdcas described above each use a different dose calculation method whose implementation is proprietary and might change over time , performing parallel dosimetry is also advisable when transitioning from one tps to another . a general expectation is that the use of a mbdca will provide more accurate dose calculations for brachytherapy treatment planning . this premise rests on a number of key assumptions that are important to bear in mind and that require careful scrutiny : radioactive sources are sufficiently well modeled ; applicator models in tps libraries are accurate ; ct / mri images are properly converted to materials and material densities ; radiation transport sufficiently approximates a solution to the linear boltzmann transport equation ; spatial and temporal aspects of the treatment plan ( applicator position , source dwell positions , dwell times , and anatomy ) match those of the treatment delivery . the literature contains several instructive examples of the type of work required to test the preceding assumptions . a single example for each involving a hdr ir source is cited for the benefit of interested readers : figure 1 in ma et al . presents dose ratio maps for ace / tg-43 calculations in water medium ( tg-186 level 1 commissioning ) ; mikell et al . describe verification of a shielded applicator model for cervix brachytherapy ; mikell et al . report that rectal dose parameters in cervix brachytherapy may be sensitive to the mapping of radiopaque packing material ; zourari et al . note that for an esophagus treatment plan created using a voxelized thorax phantom , acurosbv doses differ from mc by up to 6% at points lying close to directions defined by primary photon ray - paths tangential to cylindrical trachea and spine structures ; ma et al . caution within the context of a breast case that a sufficiently large ct / mr image volume be scanned and imported into the tps to enable the mbdca to properly calculate the scatter contribution to dose , which is especially important in low - dose regions containing organs at risk ( oars ) . finally , it should be reiterated that acurosbv includes the option to calculate d w , m rather than d m , m . users need to be aware of this option and should choose d m , m for clinically related work with ir sources as recommended by tg-186 , unless they are conducting an investigation that requires d w , m . axial ( a ) and lateral ( b ) views of the multichannel vaginal cylinder . one of the two outer grooves is visible in the lateral view ( identified with an arrow ) clinically relevant experience using commercial mbdcas is limited as these algorithms became available only recently . in the following sections , we present selected accounts from the literature and from some of our own work in progress . the earliest work with mbdcas focused on cervix treatments delivered using unshielded tandem and ovoids applicators . mikell et al . conducted a retrospective assessment of the impact of heterogeneities on ct - based , conventional manchester system hdr ir treatment plans for 26 patients using acurosbv in brachyvision v.8.8 software . reporting d w , m , they found minor changes in point a and b doses , and in d2cc for rectum , bladder , and sigmoid , with all dose parameters for individual patients differing from tg-43 values by < 5% . larger differences of up to ~10% observed at locations within the imaging volume were shown to be attributable to three factors : radiation source modelling and patient boundary , applicator modelling , and tissue heterogeneity . a similar retrospective study also reporting d w , m by hyer et al . comparing eight hdr ir plans created with brachyvision v.8.9 using both conventional and volume - optimization methods reported that heterogeneity corrections had only a small impact on tg-43 calculated dosimetric parameters . cohort - averaged parameters including point a dose , icru rectum dose , and icru bladder dose for conventional planning , and clinical target volume ( ctv ) d90 and d2cc for rectum , bladder , and sigmoid for volume - optimized planning , were reduced by 2.6% and often , by 2% . the authors estimated that attenuation in the titanium applicator walls contributed ~1.3% to these reductions . also studied conventional , ct - based tandem and ovoids hdr ir treatment plans that incorporated stainless steel shielding in the ovoids , using brachyvision v.10.0.26 in a retrospective study involving 24 patients . using the same dose parameters and heterogeneity factors employed in their earlier study and again reporting d w , m , the authors found reductions relative to tg-43 of up to 3.8% , 11.9% , 7.2% , and 9.3% for point a dose , d2cc rectum , d2cc bladder , and d2cc sigmoid , respectively . some inconsistencies in applicator properties modelled in the brachyvision applicator library and obtained from radiographic measurements were noted , although these were deemed not to be of clinical concern . recalculated hdr ir treatment plans for nine cervix patients delivered with plastic tandem and ring applicators , for which applicator models were not available , using acuros bv in brachyvision v.10.0 . based on reporting d w , m , the authors observed only a very small dosimetric impact , with d90 and v100 for high - risk ctv reduced by < 0.5% , and d2cc and d0.1cc for organs at risk reduced by < 2% . zourari et al . compared tg-43 , mc , and acurosbv ( reporting d w , m in brachyvision v.8.8 ) hdr ir dose calculations for a voxelized mathematical phantom resembling an interstitial breast brachytherapy patient , as well as for an actual patient . for the phantom , which had a ptv volume of 7.25 cm , ptv coverage was similar for all dose calculation methods . however , tg-43 increasingly overestimated dose relative to the other methods with increasing distance from the ptv ( typically by > 5% at 2 cm distance ) due to the combined effect of the lung heterogeneity and the phantom boundary . furthermore , while perhaps not of clinical concern , tg-43 underestimated the dose within the volume of the flexible catheters by more than 25% , likely as a result of the dose extrapolation algorithm employed by the tps . for the patient , who had a ptv volume of 45.9 cm , similar trends were observed . in particular , tg-43 overestimated dose to lung by up to 10% , and dose to breast skin by up to 20% . acurosbv agreed with mc within 2% , except for small volumes close to the source mostly inside the catheters . for a cohort of 38 patients who received accelerated partial breast irradiation ( apbi ) via multi - catheter interstitial hdr ir brachytherapy treatment , zourari et al . compared ace ( d m , m ) and tg-43 dosimetry using oncentra brachy v.4.4 . an analysis of clinically relevant dose - volume parameters for ptv , breast , lung , heart , rib , and skin revealed statistically significant differences for all parameters , except for heart . however , ptv differences were relatively small ( < 1% for coverage ) , with tg-43 overestimating only slightly . larger differences for rib ( 4% for dmax ) , lung ( 5% for v10gy ) , and skin ( ~6% for d10cc ) were correlated with target location . the authors concluded that although the mbdca appeared to improve dosimetric accuracy , differences from tg-43 did not warrant changing the dose prescription or the treatment protocol . more recently , ma et al . compared ace ( d m , m ) and tg-43 dosimetry using oncentra brachy v.4.5 for an apbi hdr ir breast treatment delivered using 7-channels of a savi applicator . they reported tg-43 ptv parameters v100 , d90 , and d50 to be ~2% higher , v150 to be 5% higher , and v200 to be 18% higher . all the ace - calculated parameters agreed to < 1% with reference values calculated using mc . however , ace disagreement with mc observed in the 3d dose distributions , both in near - source high - dose regions and scatter - dominated low - dose ( 10% of the prescribed dose ) regions , was deemed to deserve further evaluation . using acurosbv ( calculating d w , m ) for ten patients treated with flexible plastic catheters , and by thrower et al . using ace ( calculating d m , m ) for 50 patients treated with a savi or contura device . these studies found dose differences for the ctv and oars relative to tg-43 to be consistent with those of earlier investigations , insofar as direct comparisons were possible . also compared ace ( d m , m ) and tg-43 dosimetry for a 17-catheter hdr ir prostate implant . ptv parameters v100 , d90 , and d50 were found to be < 1.8% higher for tg-43 , v150 was 13% higher , v200 was 48% higher , and rectum ( air - filled to present a worst - case scenario ) d2cc was 12% higher . relative to mc reference values , all ace parameters were lower by no more than 1.3% , with the exception of ptv v150 ( 4% lower ) and v200 ( 16% lower ) . the underestimation of v200 is consistent with the observation made by the authors for the savi breast treatment that ace overestimates dose in the near - source region , considering that the v200 volume is more tightly bound to the catheters for the prostate implant than for the breast treatment . it was further noted by comparison to mc that ace distinctly underestimated the low dose in pelvic bone , possibly because its scatter kernels are generated in water and the current implementation is unable to account for the different energy spectra of scattered photons in bone vs. water . other hdr ir treatment sites for which ace or acurosbv have been studied include esophagus , chest wall , lung , and head and neck . although clinical results for the hybrid monte carlo algorithm in the newer radiance tps have yet to be reported , a comparison of tg-43 and tg-186 dosimetry ( both d m , m and d w , m were calculated using a public - domain mc code ) for 7 breast irradiation patients treated using a low energy electronic brachytherapy source provides some insight into what might be expected . the interested reader is referred to these publications for details . our center is conducting an experimental verification of ace for a multi - channel vaginal applicator and , in collaboration with elekta brachytherapy , is involved in ongoing work examining the application of ace to eye plaque treatments with i sources . selected findings from these works in progress are presented below . this material has been included solely to provide a glimpse of potential future developments for commercial mbdcas ; full accounts will be reported elsewhere . we compared the surface dose calculated by ace to radiochromic film measurements for hdr ir irradiation using a 35-mm diameter multi - channel vaginal cylinder ( mcvc ) ( elekta , stockholm , se , part # 110.761 ) with a vaginal tube ( part # 101.002 ) . the applicator has eight peripheral channels ( figure 1a ) and a central channel provided by the vaginal tube , and is modeled in the applicator library of oncentra brachy v.4.5 . fixation of the applicator is achieved by attaching a perineal bar to two 5 mm deep grooves on the outside ( figure 1b ) . we routinely employ fixation for pdr treatments , but not for hdr treatments . for the latter , a dose of 5 gy was specified and geometrically optimized to 240 points placed uniformly on the applicator surface over a length of 70 mm , using 20 dwell positions in the central channel . dose was then recalculated with hace and sace for the same dwell times . for sace , the applicator surface falls within the region of the calculation grid having 2 mm resolution . for ace calculations , the applicator was placed in a 30 cm virtual water box and the two grooves on the outside of the applicator were filled with air . uncertainties for the tg-43 and ace calculations were estimated to be 3.4% and 5% , respectively [ 13 , 16 , 46 ] . measurements were made with gafchromic ebt3 film ( ashland specialty ingredients , wilmington , de , usa ) wrapped around the outside of the applicator and held in place with an acrylic sleeve . irradiations were performed in a 30 cm water tank according to the tg-43-based plan for two scenarios : with water in the applicator grooves , achieved by placing the applicator in the tank prior to assembly ( water - in - grooves set - up ) , or with air in the grooves , achieved by placing a condom over the assembled applicator , film and sleeve prior to placement in the tank ( air - in - grooves set - up ) . the dose was delivered using a hdr ir microselectron v.3 afterloader ( elekta , stockholm , sweden ) . uncertainties in the film measured doses follow from the uncertainty analyses reported by chiu - tsao et al . and morrison et al . the lengthwise - averaged dose at the surface of the applicator measured by film and calculated with ace and tg-43 is plotted in figure 2 as a function of azimuthal angle for the air - in - grooves set - up . the film measurements revealed a dose increase above the grooves of 11 4% ( k = 1 ) of the mean surface dose , which was not seen for the water - in - grooves set - up . a 6 4% ( k = 1 ) increase in dose was observed for the hace calculation , but no increase was seen for the sace calculation . apparently , the unadapted 2 mm grid size used for sace at the applicator surface does not permit resolution of the applicator - air and air - water interfaces , sufficient for accurate dose calculation there . implementation of an intelligent dose calculation grid for sace that can adapt to the applicator surface could mitigate this issue . the film measurements also revealed a gradual variation in average measured dose around the applicator , seen as higher doses near 50 degrees and lower doses near 200 degrees . this is most likely caused by off - center positioning of the 0.9 mm diameter source in the 2.5 mm diameter central channel . image - based verification of source positions during treatment could enable this geometric uncertainty to be identified directly . lengthwise - averaged dose on the surface of the mcvc applicator as a function of azimuthal angle for the air - in - grooves set - up with the central channel loaded . dose was calculated using sace and hace for a single set of dwell times designed ( using tg-43 ) to deliver 500 cgy ( specified dose , rx ) to points on the surface of the applicator . dose was measured using radiochromic film a recommended dosimetry protocol for eye plaque therapy involves augmenting tg-43 calculations with tg-186 calculations that account for plaque materials , but assume all patient tissues are water equivalent , as tg-43 calculations can overestimate the dose by > 20% in front of the plaque . in the absence of a mbdca for low - energy sources , this can be done using look - up tables of tg-186 doses along the plaque central axis ( cax ) , or by applying correction factors [ 49 , 50 , 51 ] to tg-43 calculations as implemented in plaque simulator software ( eye physics llc , los alamitos , ca , usa ) . in collaboration with elekta brachytherapy , we introduced a 12 mm coms plaque ( see figure 3 inset ) into oncentra brachy v.4.5.2 by creating 3d cad models of the plaque backing ( modulay ) and silastic insert , and adding these to the applicator library . material compositions and densities reported in tg-129 were used for the applicator model . a nucletron selectseed ( elekta brachytherapy p.n.130.002 ) i source model for ace was created solely for research purposes from primary - scatter separated kernel data generated by the clrp group [ 52 , 53 ] . treatment plans were made for three source / plaque configurations located at the center of a 30 cm water box : 1 ) a single seed alone ; 2 ) a single seed in the plaque central slot ( ss - coms ) ; 3 ) a fully loaded plaque ( fl - coms ) . percentage dose differences along the plaque cax between ace and mcnp6 for the ss - coms and fl - coms plans ( % diff = ( doseace - dosemcnp6)/dosemcnp6 * 100% ) ) . inset : front view of the 12 mm coms plaque showing the eight seed slots and the orientation of the central dose calculation plane for the single seed in water , a dose of 5 gy was specified at 1 cm from the seed center on the transverse axis and the corresponding dwell time determined using tg-43 calculations . the dose distribution was then recalculated with hace using a dose calculation grid size of 0.5 mm , which was used for all calculations reported here . for the ss - coms plan , a dose of 5 gy was specified at 7.4 mm from the center of the seed on the plaque cax ( 5 mm from the inner sclera of a standard - sized spherical eye with 12.3 mm radius and 1 mm scleral thickness ) , the dwell time was determined using tg-43 , and dose was recalculated . the same procedure was followed for the fl - coms plan , but with 70 gy specified at 7.4 mm from the central seed . for all three configurations , dose data were exported from a 60 mm region of interest ( roi ) centered on the central seed and having 0.5 mm voxels . for comparison , mcnp6 simulations were performed with 5 x 10 starting particles per seed in mode p and dose was scored using the f6 and * fmesh tallies . the seed air kerma strength was determined in a separate simulation and scaled to match that used in oncentra brachy . for the single seed in water , average dose differences within the roi between ace and tg-43 , tg-43 and mcnp6 , and ace and mcnp6 were 0.78 2.3% , 3.7 3.0% , and 4.4 2.1% , respectively ( mean standard deviation ) . the largest differences were noted for the tg-43 data near the seed end - welds . the ace data within oncentra brachy exhibits differences from more recent tg-43 monte carlo data for selectseed ( obtained independently by our group and the clrp group , which agreed on average within 1% ) , which is likely the cause of some of the differences seen between tg-43/ace and mcnp6 . for the plaque plans , ace was able to predict the decrease in dose relative to tg-43 along the plaque cax ; dose differences between ace and mcnp6 averaged over a length of 27 mm were 4.1 4.2% for ss - coms , and 2.3 2.3% for fl - coms . the percent differences along the cax between ace and mcnp6 for both plans the poorer agreement observed at distances < 5 mm from the inner sclera is the subject of ongoing investigation . percent dose differences between ace and mcnp6 in the central plane of the plaque are shown in figure 4 for the ss - coms and fl - coms plans . the largest clinically relevant differences are seen in the plaque penumbrae , and likely arise from simplifications made in radiation source modelling and angular discretization of photon transport in ace . the combined effect can be seen as single high and low percentage difference streaks near the plaque lip for ss - coms , and multiple streaks ( due to multiple seeds ) for fl - coms . within the standard eye model volume directly in front of the plaque , average percent dose differences are 1.5 6.7% and 2.1 6.8% for ss - coms and fl - coms , respectively . thus , overall agreement is good within this volume , however due to streak artifacts in the penumbrae , further analysis is required to determine how accurately ace can calculate dose throughout . this is important because tissues at risk ( optic nerve , macula , fovea ) might be located near the plaque edge , depending on the position of the plaque on the eye . as noted for the mcvc results presented in the preceding section , an applicator - based adaptive dose calculation grid could merit investigation . percentage dose differences between ace and mcnp6 in the central plane ( see figure 3 inset ) of a 12 mm coms plaque for the ss - coms plan ( left ) , and the fl - coms plan ( right ) ( % diff = ( doseace - dosemcnp6)/dosemcnp6 * 100% ) ) ; pixels containing plaque materials have been greyed out the tg-43 formalism provides a standardized approach to brachytherapy dose calculation based on the superposition of single - source dosimetry in water medium that is simple to use , but lacks accuracy to varying degrees in many clinical circumstances . emergent commercial mbdcas whose correct application is addressed in tg-186 are ideally capable of both closely reproducing tg-43 dosimetry in water and closely approximating monte carlo reference dosimetry in any clinical situation . this enhanced capability comes at the additional cost of adequately modelling the geometry and material composition of the patient in treatment position ( as determined from imaging ) , and the radiation source and treatment applicator ( vendor - supplied ) for dose calculation purposes . evaluation of a mbdca s adequacy by investigators and clinical users alike needs to be done on a source , applicator , and treatment site specific basis . it is well underway for hdr ir sources and the intrabeam xrs-4 source , has recently begun for i seeds , and will follow the implementation timetables of tps vendors for other brachytherapy sources and applicators . accordingly , the transition from tg-43 to tg-186 based dosimetry will necessarily occur over an extended period of time . the enhanced dose calculation accuracy that mbdcas can provide is contingent on the geometric accuracy of the treatment model used for calculation . uncertainties in 1 ) source positions and orientations ; 2 ) applicator position , orientation , and description ; 3 ) patient anatomical structure segmentation , and 4 ) patient anatomy variations over the course of the irradiation period can potentially reduce the accuracy of calculated dose estimates . therefore , geometric uncertainties need to be well understood and , if necessary , mitigated in order to take full clinical advantage of the potential of mbdcas . this observation is borne out in several of the selected experiences presented here in the clinical experience section . coincidentally , the physics workshop on treatment verification held in conjunction with the 2016 world congress of brachytherapy meeting included reports on several different technologies in various stages of commercial development that can help minimize geometric uncertainties in the treatment model . likewise , vendor - supplied applicator material compositions and user - selected clinical mappings of patient images to tissue types , bear careful scrutiny prior to clinical use . within the past decade , the international study on mri - guided brachytherapy in locally advanced cervical cancer and related retroembrace study have clearly demonstrated that image - guided adaptive brachytherapy can substantially improve disease outcome and reduce treatment - related morbidity . could the use of mbdcas serve to facilitate similar improvements in treatment techniques and outcomes at other treatment sites , for which tg-43 dosimetry is demonstrably inaccurate ? despite new challenges associated with mbdca familiarization , commissioning , clinical implementation , and quality assurance , the extent to which these can be identified and realized will depend in large part on how well practical challenges are met and solutions shared by commercial mbdca vendors , investigators , and users alike .
### Summary: : model - based dose calculation algorithms ( mbdcas ) have recently emerged as potential successors to the highly practical , but sometimes inaccurate tg-43 formalism for brachytherapy treatment planning . so named for their capacity to more accurately calculate dose deposition in a patient using information from medical images , these approaches to solve the linear boltzmann radiation transport equation include point kernel superposition , the discrete ordinates method , and monte carlo simulation . in this overview , we describe three mbdcas that are commercially available at the present time , and identify guidance from professional societies and the broader peer - reviewed literature intended to facilitate their safe and appropriate use . we also highlight several important considerations to keep in mind when introducing an mbdca into clinical practice , and look briefly at early applications reported in the literature and selected from our own ongoing work . the enhanced dose calculation accuracy offered by a mbdca comes at the additional cost of modelling the geometry and material composition of the patient in treatment position ( as determined from imaging ) , and the treatment applicator ( as characterized by the vendor ) . the adequacy of these inputs and of the radiation source model , which needs to be assessed for each treatment site , treatment technique , and radiation source type , determines the accuracy of the resultant dose calculations . although new challenges associated with their familiarization , commissioning , clinical implementation , and quality assurance exist , mbdcas clearly afford an opportunity to improve brachytherapy practice , particularly for low - energy sources .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the annual nucleic acids research web server issue presented here , along with the annual database issue also published by nar , continues to be an invaluable resource for the scientific community . the 2010 web server issue highlights the latest web servers and open access bioinformatic tools available online to guide and enable research in any number of life science domains . the complete listing of urls cited in the 2010 web server issue can be accessed online at the nucleic acids research website , http://nar.oxfordjournals.org/ , as well as at http://bioinformatics.ca / links_directory / narweb2010/. in partnership with nucleic acids research since 2005 , the bioinformatics links directory ( http://bioinformatics.ca/links_directory/ ) has collected and organized all of the web server issue s published links in its comprehensive public repository ( 15 ) . the directory is organized by biological subject with subcategories of common tasks relevant to each subject listed . all entries in the directory contain a short description of the tool s function , as well as the accompanying pubmed citation and web server url . such information facilitates easy browsing of tools relevant for a particular biological subject , as well keyword searches to locate tools that suit a user s research needs . this year s web server issue introduces an additional 115 web servers , plus 7 server updates ( table 1 ) . the 2010 nucleic acids research web server update brings the total number of servers and tools listed in the bioinformatics links directory close to 1500 unique links . since community input continually adds new links and non - functional links are removed , the list of web servers in table 1 and online is in constant flux . the up - to - date complete listings accessible through the bioinformatics links directory , including the nucleic acids research 2010 web servers , can be accessed online at http://bioinformatics.ca / links_directory/. table 1.historical summary ( 200610 ) of the number of web servers listed in each subcategory of the bioinformatics links directoryname20062007200820092010computer related bio- * programming tools2020202018 c / c++33332 databases22235 java44444 linux / unix1211111110 perl55555 php31111 statistics99999 web development62222 web services6771017 workflows3dna annotations3856576271 gene prediction3233343737 mapping and assembly1415151720 phylogeny reconstruction3743464953 structure and sequence feature detection118142145150161 sequence polymorphisms3239414244 sequence retrieval and submission2630323230 tools for the bench5563657176 utilities1920232425education bioinformatics related news sources99999 community1924232318 courses , programs and workshops55554 directories and portals1515151518 general1514141414 tutorials and directed learning resources999910expression cdna , est , sage2936444849 gene regulation96119120128138 transcript expression and microarrays7589101108121 protein expression89172223 splicing1619192122 networks81216 gene set analysis1124human genome annotations3137383946 ethics78886 genomics4331019 health and disease1419232729 other resources2529292931 sequence polymorphisms2533363846literature goldmines66665 open access resources22234 search tools1012121314 text mining1115223031model organisms fish1111111111 fly1617171721 general resources2327282932 microbes3138455360 mouse and rat3235353642 other organisms1821212122 other vertebrates1010101011 plants1619212528 worm999910 yeast1518181821other molecules carbohydrates66667 metabolites34712 small molecules366913 compounds2612protein 2-d structure prediction5158606365 3-d structural features53707585100 3-d structure comparison3545505971 3-d structure prediction4859607083 3-d structure retrieval , viewing4551525658 biochemical features3740414646 do - it - all tools for protein88131415 domains and motifs86112115121124 annotation and function3544475357 interactions , pathways , enzymes668894107125 localization and targeting3038383941 molecular dynamics and docking1921273440 phylogeny reconstruction3644455354 presentation and format1314141414 protein expression8881010 proteomics2527333739 sequence data7891010 sequence comparison71417 sequence features2531333846 sequence retrieval2729293129rna functional rnas1419263237 general resources1010101011 motifs1921222325 sequence retrieval111011119 structure prediction , visualization , and design3847545862sequence comparison alignment editing and visualization2021212325 analysis of aligned sequences4359606264 comparative genomics2633353748 multiple sequence alignments3850565765 other alignment tools1111111112 pairwise sequence alignments2223263335 similarity searching3147474950a complete listing of all urls listed in the nucleic acids research 2010 web server issue can be accessed online at : http://bioinformatics.ca/links_directory/narweb2010 historical summary ( 200610 ) of the number of web servers listed in each subcategory of the bioinformatics links directory a complete listing of all urls listed in the nucleic acids research 2010 web server issue can be accessed online at : http://bioinformatics.ca/links_directory/narweb2010 as this list of bioinformatic tools , web servers and databases expands alongside new research technologies , data types and research ideas , there is a growing need for training and educational tools to enable and empower a wider and more varied audience of users . the bioinformatics links directory is only useful if accompanied by user guidelines and training assistance . the challenge then is to provide this training in a manner that addresses both the diversity of research arenas requiring bioinformatics training , and the increasing complexity of data sets and research questions . below , we discuss some education ideas and initiatives that take aim at these challenges . most new applications and bioinformatic tools are posted with supporting readme documentation that contains useful tips on how to navigate within and use a given tool . however , such documentation is often unread , and usually does not contain practical information on how the tool may be applied in research . brief tutorials or case examples offer a mechanism to enhance the uptake of new computational tools by showing potential users how to perform simple to advanced analyses with the tool or how to use a tool for a given research problem . good examples of applications with tutorials include many of the tools available through the national center for biotechnology information ( ncbi ; http://www.ncbi.nlm.nih.gov/guide/training-tutorials/ ) , the ucsc genome browser ( http://genome.ucsc.edu/training.html ) and ensembl ( http://uswest.ensembl.org/info/website/tutorials/index.html ) to name a few . with the increasing number and diversity of research fields needing specific computational applications to address their research problem , there are an increasing number of researchers realizing the need for some level of bioinformatic skills training . conferences offer an ideal venue for hosting a discipline - specific bioinformatics training program , since a large number of researchers from a particular scientific field are already gathered . the international society for computational biology ( iscb ) education outreach task force has recognized this opportunity to empower potential users in applications relevant to their research and has initiated traveling road shows to accompany field - specific conferences with the aim to offer three to five workshops per year . similarly other larger institutions offer traveling road shows for any of their applications [ e.g. ncbi , european bioinformatics institute ( ebi ) , etc . ] , although these are typically on a cost recovery basis . online lists or repositories of available educational training materials similarly enable users and potential new users to access and acquire computational skills in a particular application or computational work flow at their own pace and to suit their own research needs . such lists are an invaluable source of information , and are often the starting point for many researchers . the bioinformatics links directory ( http://bioinformatics.ca/links_directory/ ) maintains an education category and lists numerous education - related resources including courses , programs and workshops and tutorials and directed learning resources . several of the links located in this directory redirect the user to open access , full content bioinformatics training workshops ( e.g. canadian bioinformatics workshops , http://bioinformatics.ca ) and self - directed tutorials ( e.g. openhelix , ( http://www.openhelix.com ) . effort must be made to continually improve education and training in bioinformatics , to keep pace with the rapid development of novel computational applications and the research communities needs . suggestions for new links or updates and corrections to existing links may be submitted through email directly to links@bioinformatics.ca . most new applications and bioinformatic tools are posted with supporting readme documentation that contains useful tips on how to navigate within and use a given tool . however , such documentation is often unread , and usually does not contain practical information on how the tool may be applied in research . brief tutorials or case examples offer a mechanism to enhance the uptake of new computational tools by showing potential users how to perform simple to advanced analyses with the tool or how to use a tool for a given research problem . good examples of applications with tutorials include many of the tools available through the national center for biotechnology information ( ncbi ; http://www.ncbi.nlm.nih.gov/guide/training-tutorials/ ) , the ucsc genome browser ( http://genome.ucsc.edu/training.html ) and ensembl ( http://uswest.ensembl.org/info/website/tutorials/index.html ) to name a few . with the increasing number and diversity of research fields needing specific computational applications to address their research problem , there are an increasing number of researchers realizing the need for some level of bioinformatic skills training . conferences offer an ideal venue for hosting a discipline - specific bioinformatics training program , since a large number of researchers from a particular scientific field are already gathered . the international society for computational biology ( iscb ) education outreach task force has recognized this opportunity to empower potential users in applications relevant to their research and has initiated traveling road shows to accompany field - specific conferences with the aim to offer three to five workshops per year . similarly other larger institutions offer traveling road shows for any of their applications [ e.g. ncbi , european bioinformatics institute ( ebi ) , etc . online lists or repositories of available educational training materials similarly enable users and potential new users to access and acquire computational skills in a particular application or computational work flow at their own pace and to suit their own research needs . such lists are an invaluable source of information , and are often the starting point for many researchers . the bioinformatics links directory ( http://bioinformatics.ca/links_directory/ ) maintains an education category and lists numerous education - related resources including courses , programs and workshops and tutorials and directed learning resources . several of the links located in this directory redirect the user to open access , full content bioinformatics training workshops ( e.g. canadian bioinformatics workshops , http://bioinformatics.ca ) and self - directed tutorials ( e.g. openhelix , ( http://www.openhelix.com ) . effort must be made to continually improve education and training in bioinformatics , to keep pace with the rapid development of novel computational applications and the research communities needs . suggestions for new links or updates and corrections to existing links may be submitted through email directly to links@bioinformatics.ca . funding for open access charge : the open access publication charge for this paper has been waived by the oxford university press , in recognition of the work on behalf of the journal .
### Summary: : the links directory at bioinformatics.ca continues its collaboration with nucleic acids research to jointly publish and compile a freely accessible , online collection of tools , databases and resource materials for bioinformatics and molecular biology research . the july 2010 web server issue of nucleic acids research adds an additional 115 web server tools and 7 updates to the directory at http://bioinformatics.ca/links_directory/ , bringing the total number of servers listed close to an impressive 1500 links . the bioinformatics links directory represents an excellent community resource for locating bioinformatic tools and databases to aid one s research , and in this context bioinformatic education needs and initiatives are discussed . a complete list of all links featured in this nucleic acids research 2010 web server issue can be accessed online at http://bioinformatics.ca / links_directory / narweb2010/. the 2010 update of the bioinformatics links directory , which includes the web server list and summaries , is also available online at the nucleic acids research website , http://nar.oxfordjournals.org/.
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : neuroendocrine tumors ( net ) are a group of nonhomogeneous malignancies from different organs that share in common the ability to secrete a wide range of peptides . these cells were formerly named amine precursor uptake and decarboxylation ( apud ) cells , and tumors originating from these cells were called carcinoids or apudomas . at present this cellular system is called diffuse neuroendocrine system ( dnes ) cells , and the tumors originating from them are collectively called neuroendocrine tumors . the lungs and the gastrointestinal tract are the major sites for emergence of these neoplasms . nicholls , in 1902 , reported the first tumor of this type , an islet cell carcinoma of pancreas . since then pancreatic net , either nonfunctional or capable of secreting insulin , glucagon , somatostatin , gastrin and vasoactive intestinal peptide ( vip ) have been reported . secretion of hormones not native to pancreatic endocrine system , such as calcitonin , adrenocorticotropic hormone ( acth ) and parathyroid hormone - related peptide ( pthrp ) have also been reported during the last 30 years . herein , we present the case of a young iranian woman who had a pancreatic net during pregnancy , and was diagnosed at postpartum because of severe hypercalcemia and mental confusion . to the best of our knowledge , there is only one case presentation in the literature , whose pregnancy was associated with pancreatic net . we have also reviewed the clinical and laboratory data of the reported cases of this unusual disease in literature . a 35-year - old gravida one para one , pregnant woman was admitted to hospital because of nausea and vomiting . she was in her 37 week of pregnancy , and had had nausea and vomiting since her second trimester . she also felt that fetal movements had decreased since two to three days before admission . she had had no serious problems until three months earlier when gestational diabetes was diagnosed and successfully treated with insulin . the patient was admitted to hospital and underwent an immediate cesarean section because of nonreactive non stress test ( nst ) . the baby was a girl with an apgar score of 10 , imperforated anus and tracheoesophageal fistula . routine laboratory evaluation of the neonate showed a serum calcium level of 17 mg / dl . neonatal hypercalcemia prompted us to check the mother s calcium , which was found to be 16.3 and 17 mg / dl on two consecutive measurements . serum phosphorus levels were 2.1 and 2.6 and 2.8 mg / dl on three separate occasions . she had no history of excessive consumption of dairy products , calcium carbonate , nonabsorbable antacids or vitamin d preparations . serum levels of calcitonin , -fetoprotein and carcinoembryonic antigene ( cea ) were within normal ranges . treatment started with normal saline , furosemide and calcitonin . despite aggressive hydration and continuous intake of furosemide and calcitonin , the patient s condition gradually deteriorated during the next 48 hours with aggravation of hypercalcemia and deterioration of mental status . therefore , 90 mg pamidronate , which resulted in gradual decrement of serum calcium level , was prescribed . ultrasonographic evaluation of the abdomen revealed a 150 mm lobulated mass in the upper part of abdomen which was confirmed by ct scan ( figure 1 ) . the patient underwent surgery , during which a large , lobulated , hard , hypervascular and irregular mass occupying the body and tail of the pancreas was observed . immunohistochemistry ( ihc ) staining , done in iran , was positive for synaptophysin , alpha 1 antitrypsin and vimentin . michael hospital , toronto , ontario , canada , disclosed cytoplasmic immunopositivity for pthrp ( figure 2 ) , somatostatin , calcitonin , serotonin and chromogranin . abdominal computed tomography scan showing the pancreatic tumor immunohistochemical staining showing positivity for parathyroid hormone related protein . after one week , because of paresthesia and serum calcium concentration of 7.1 mg / dl , calcium carbonate and calcitriol were prescribed followed by chemotherapy with etoposide and vp16 . the neonate was also operated on by a team of pediatric surgeons ; however , unfortunately she expired the day after the surgery . present case is unique because of the large invasive tumor spanning whole length of pregnancy , severe post partum hypercalcemia , and birth of a baby with above - mentioned malformations secondary to a pancreatic net . the annual incidence is 2 - 3/100,000 and 30 - 50% of the tumors are functional . pancreatic net presenting with hypercalcemia secondary to pthrp production constitute a small minority of these tumors . because of the similarity of the clinical picture with multiple endocrine neoplasia type 1 ( men1 ) , the pathogenesis of hypercalcemia in patients with pancreatic net was a real challenge . indeed , hypercalcemia of first series of patients was presumed to be due to concomitant primary hyperparathyroidism , and based on this untoward assumption , at least three patients underwent unnecessary parathyroidectomy . since albright s novel statement in 1941 about the humoral nature of tumor hypercalcemia , many efforts have been made to prove the secretion of either ectopic pth or a substance that has functional similarity to pth . the enthusiasm and the ensuing hard work led to the discovery of pthrp in 1988 , which was a turning point in the correct interpretation of tumor hypercalcemia . in an extensive review of the literature we could find 42 patients with pancreatic net and hypercalcemia . clinical and laboratory data of the reviewed cases as well as the present case are shown in table 1 . the patients are 20 men and 22 women with a mean age of 45 years ( age range 8 - 77 years ) . the largest size of the tumor was 3.9 - 18 cm with a mean of 10.2 cm . all patients were hypercalcemic with serum calcium concentrations ranging from 10.6 - 26.4 mg / dl with a mean of 15.5 mg / dl . serum concentrations of pth were low or undetectable in 31 cases , and within normal range in 11 cases . of 25 patients whose serum pthrp had been measured , 24 had elevated levels ranging from 2.3 - 40 pmol / l with a mean of 10.8 pmol / l , which was about 10 times the upper limit of normal range . data for ihc , available for 17 patients , showed positivity for pthrp in all except for two cases . chromogranin ( cga ) , synaptophysin ( syn ) , neuron specific enolase ( nse ) , somatostatin ( so ) and calcitonin ( cal ) were positive in varying combinations in all cases except two . moreover , ki 67 in those who were analyzed was less than 10% , which was in agreement with the low growth rate and long survival of those patients . however , complete removal of the tumor could be done in only seven cases because of multiple liver metastasis , local invasion and hypervascularity of the tumors . indeed multiple liver metastases were seen in 80 % of the patients . in these cases , their alleviating effects on hypercalcemia as well as their potential anti tumor effects have also been reported . in last couple of years , sandostatin lar or similar analogues have been used in almost all cases in which complete surgical removal of the tumor has been impossible . it should be noted that anti proliferative effects of the drug is weak , and in some cases the tumor has progressed with time . a previous study , reported that it was effective in reducing serum calcium and maintaining normocalcemia for a period of six months . apparently it did have no effects on tumor growth in a limited number of patients in whom the drug had been advised . chemotherapy has also been advised in all cases in which surgery has not been successful . partial improvement in patients ' condition and stabilization of serum calcium has been reported by some researchers . liver transplantation was done in a limited number of patients , especially in whom metastasis to the liver was established . the transplantation seems promising in such patients and the five year survival after transplantation has been reported . hepatic arterial embolization and external radiation have been used in limited numbers of patients with minimal clinical benefits . concerning the outcome , it should be noted that in accordance with other studies , functional pancreatic nets seems to have an indolent behavior and a more favorable prognosis . while 80% of the patients had liver metastasis , eight lived for more than five years and 11 lived for more than three years . having an invasive large pancreatic carcinoma during pregnancy is quite unusual because , and as a rule , pregnancy occurs in females with an optimum health status . indeed , we do not know whether the patient had the tumor before pregnancy , or the cancer developed during pregnancy . whatever the course of events , it was quite unusual to proceed to full - term pregnancy with such a big tumor . the finding is also in accordance with the slow growth rate of the tumor during pregnancy . there was no a sign or symptom that could be attributed to the abdominal mass or hypercalcemia , and postpartum detection of high serum calcium level in the mother was a result of accidental finding of hypercalcemia in the neonate during routine laboratory evaluations . clinical and laboratory data of 42 patients with pancreatic neuroendocrine tumor and hypercalcemia cal : calcitonin , cga : chromogranine a , cyk : cytokeratin , l : low , na : not available , nl : normal , nse : neuron specific enolase , so : somatostatin , syn : synaptophisin , u : undetectable , pth : parathyroid hormone , pthrp : parathyroid hormone related peptide , ihc : immunohistochemistry . serum calcium reference range=8.5 - 10.3 mg / dl ; pthrp , reference range : < 1.3 pmol / l aggravation of our patient s hypercalcemia in the immediate postpartum period , which resulted in the deterioration of the patient s mental status , was due to the elimination of the fetoplacental unit that worked as a buffer to alleviate hypercalcemia in prepartal period . indeed a substantial amount of mother 's calcium transfers to fetus during pregnancy . while this passage of calcium ameliorates mother 's hypercalcemia ; undoubtedly has some deleterious effects on the neonate . in this case we do not know if we could attribute the neonate s problems such as imperforated anus and tracheoesophagal fistula to severe and longstanding hypercalcemia during pregnancy . we could not find any report about the association of these complications and maternal hypercalcemia , however , the association of complications such as intrauterine growth retardation , low birth weight , preterm delivery , intrauterine fetal demise and postpartum neonatal tetany with maternal hypercalcemia have been reported . regarding limitations of the study , measurement of serum levels of pthrp and 1 - 25(oh)2 vitamin d3 was not available to us , and due to the unaffordability of long acting somatostatin analogue we could not use the drug for our patient . our presented case was unique as neuroendocrine pancreatic tumor - induced hypercalcemia was presented during pregnancy . the findings suggest that in the case of hypercalcemia in postpartum state , the possibility of tumor induced hypercalcemia should be kept in mind .
### Summary: : parathyroid hormone - related protein producing pancreatic neuroendocrine tumors have been infrequently reported . herein , we report a case of an iranian woman who had such a tumor during pregnancy , and gave birth to a female neonate with esophago - tracheal fistula and imperforated anus . hypercalcemia was diagnosed at postpartum because of elevated serum calcium levels in the neonate and neurologic deterioration of the mother . extensive literature review revealed 42 cases with pancreatic neuroendocrine tumors and hypercalcaemia . the clinical and laboratory findings of such patients are reviewed in this manuscript .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the idea that neurons can synthesize , store , and release only a single substance became known as dale 's principle , although dale never explicitly suggested this ; rather , he speculated that the same neurotransmitter would be stored and released from all the terminals of a single sensory neuron . however , there were hints in the literature that the one nerve / one transmitter principle might not be universally true and this led to my commentary introducing the cotransmitter hypothesis in 1976 . there is a substantial body of evidence to show that atp is a cotransmitter with classical transmitters in most nerves in the peripheral nervous system and central nervous system ( cns ) , although the proportions vary between tissues and species and in different developmental , physiological and pathophysiological circumstances [ 2 - 4 ] . there was early evidence that atp was released together with acetylcholine ( ach ) from cholinergic nerves in various tissues - for example , the electric organ of elasmobranch fish , frog neuromuscular junction and phrenic nerve endings in rat diaphragm . however , it was not recognized at the time as a cotransmitter , but was considered rather as a molecule involved in the vesicular uptake and storage of the neurotransmitter ach . later it was shown that in neuromuscular junction early development , released atp acted on p2x receptor ion channels as a genuine cotransmitter with ach acting on nicotinic receptors , while in mature animals atp no longer acted as a cotransmitter , but rather as a modulator at pre- and postjunctional sites . atp was first shown to be released from sympathetic nerves supplying the guinea - pig taenia coli . soon after , the possibility that atp might be co - released with noradrenaline ( na ) from the hypogastric nerve to the guinea - pig seminal vesicle was raised , and that the substantial residual non - adrenergic , non - cholinergic ( nanc ) responses of cat nictitating membrane following depletion of na by reserpine might be due to the release of atp from sympathetic nerves . the most extensive evidence for sympathetic cotransmission came from studies of the vas deferens , initially by dave westfall and colleagues . sympathetic purinergic cotransmission has also been clearly demonstrated in many blood vessels , although the proportion of na : atp is extremely variable in different vessels . parasympathetic nerves supplying the urinary bladder utilise ach and atp as cotransmitters , in variable proportions in different species and , by analogy with sympathetic nerves , atp acts through p2x ionotropic receptors , whereas the slow component of the response is mediated by a metabotropic muscarinic receptor . there is also evidence to suggest that there is parasympathetic purinergic cotransmission to resistance vessels in the heart and airways . the early work of pamela holton showing atp release during antidromic stimulation of sensory collaterals taken together with the evidence for glutamate in primary afferent sensory neurons suggests that atp and glutamate may be cotransmitters . calcitonin gene - related peptide and substance p are well established as coexisting in sensory - motor nerves and , in some subpopulations , atp is also likely to be a cotransmitter . concurrent release of atp and substance p from guinea - pig trigeminal ganglionic neurons in vivo has been described . three major cotransmitters are released from these nerves : atp producing fast inhibitory junction potentials ; nitric oxide also producing inhibitory junction potentials , but with a slower time course ; and vasoactive intestinal polypeptide producing slow tonic relaxations . the proportions of these three transmitters vary considerably in different regions of the gut and in different species . purinergic inputs of myenteric origin come from neurons utilising ach and atp as cotransmitters in presynaptic fibres . in the heart , subpopulations of intrinsic nerves in the atrial and intra - atrial septum have been shown to contain atp as well as nitric oxide , neuropeptide y , ach and 5-hydroxytryptamine . the spectrum of physiological signalling variations offered by cotransmission has been discussed more recently . for example , atp released as a cotransmitter can act as a prejunctional modulator of transmitter release or as a postjunctional modulator , synergistically enhancing the action of the cotransmitter . evidence for purinergic cotransmission in the cns has lagged behind that presented for purinergic cotransmission in the periphery . however , in the past few years several such studies have been reported . release of atp from synaptosomal preparations and slices from discrete areas of the rat and guinea - pig brain , including cortex , hypothalamus , medulla , and habenula , has been measured . earlier papers reported that in cortical synaptosomes , a proportion of the atp appeared to be co - released with ach , and a smaller proportion with na . there is also evidence for co - release of atp with catecholamines from neurons in the hypothalamus and locus coeruleus . purinergic and adrenergic agonist synergism for vasopressin and oxytocin release from hypothalamic supraoptic neurons is consistent with atp cotransmission in the hypothalamus . co - release of atp with -aminobutyric acid ( gaba ) has been demonstrated in the rabbit retina and in dorsal horn and lateral hypothalamic neurons . p2x and gaba receptors are also colocalised in subpopulations of rat postnatal dorsal root ganglion neurons and their central terminals laminae i - iii . the intracellular loop of gabab subunits and the carboxy - terminal domain of p2x(2/p2x3 receptors are necessary for cross - talk between atp and gaba - gated channels . there is evidence for co - release of atp with glutamate in the hippocampus as well as widespread and pronounced modulatory effects of atp on glutamatergic mechanisms . a recent study has shown that in central neuronal terminals , atp is primarily stored and released from a distinct pool of vesicles and that the release of atp is not synchronized with the cotransmitters gaba or glutamate . colocalisation of functional nicotinic and ionotropic nucleotide receptors has also been identified in isolated cholinergic synaptic terminals in midbrain , and interactions between p2x2 and both 34 and 32 nicotinic receptor channels have been shown in oocyte expression studies . there is indirect evidence supporting the possibility that dopamine and atp are cotransmitters in the cns . after cerebellar lesions in rats producing axotomy of mossy and climbing fibre systems , nitrergic and purinergic systems were activated with similar time courses on pre - cerebellar stations . it has been speculated that postsynaptic selection of co - released fast transmitters is used in the cns to increase the diversity of individual neuronal outputs and achieve target - specific signalling in mixed inhibitory networks . there have been significant recent advances in the development of sensitive assays for real - time assessment of atp release from individual cells ( for example , see ) . there has also been much emphasis recently on neuron - glial interactions , including co - release of transmitters ( glutamate and atp ) from glial cells , as well as from neurons . one of the questions still to be resolved concerns the physiological roles of the many neuropeptides colocalised with small molecule neurotransmitters in nerves . this is particularly so in the enteric nervous system , where careful immunohistochemical studies of the ' chemical coding ' of different populations of enteric nerves showed that some neurons contain up to five neuropeptides . for example , dogiel type 1 neurons contain bombesin , vasoactive intestinal polypeptide , cholecystokinin , galanin and enkephalin , as well as its primary transmitter ach . some of the released peptides appear to play neuromodulatory roles , others long - term ( trophic ) roles , but for others their roles remain a mystery . there are well - established examples in the periphery ( for example , sympathetic cotransmission to the vas deferens ) where cotransmitters have synergistic postjunctional actions . however , few studies of the synergistic actions of cotransmitters in the cns have been carried out . for example , it would be interesting to see if atp potentiates the long - term potentiation action of glutamate on hippocampal neurons and the responses of na on hypothalamic neurons . finally , although the drug evaluation authorities have always focused on single therapeutic agents , perhaps the presence of cotransmitters will encourage the development of multiple therapeutic agents for some conditions .
### Summary: : atp is a cotransmitter with classical transmitters in most nerves in the peripheral nervous system and central nervous system , although the proportions vary between species and tissues and in different developmental , physiological and pathophysiological conditions . atp is released together with noradrenaline and neuropeptide y from sympathetic nerves . it is released as a cotransmitter with acetylcholine from parasympathetic nerves supplying the bladder , developing skeletal neuromuscular junctions and some neurons in the brain . it is also released with nitric oxide and vasoactive intestinal polypeptide from non - adrenergic inhibitory enteric nerves , with glutamate from primary afferent sensory nerves and in the hypothalamus , and with dopamine and 5-hydroxytryptamine from some neurons in the central nervous system . cotransmission offers subtle , local variations in neurotransmission and neuromodulation mechanisms .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the ventricular system , subarachnoid space , and basal cisterns are then seeded via the choroid plexus . various therapeutic modalities include antihelminthic medication , microneurosurgical removal , ventriculoperitoneal shunt , and endoscopic treatment . endoscopic management of intraventricular ncc has shown encouraging results ; however , the literature regarding the use of this modality in the treatment of recurrent intraventricular ncc is scanty . there is no reported case in the literature of recurrent intraventricular ncc after a complete endoscopic removal . a 42-yera old man resident of delhi previously operated for intraventricular ncc presented with the headache for a fortnight that was holocranial , moderate not associated with any vomiting . fundus examination showed blurring of disc margins in both eyes . on examination , patient 's higher mental functions were normal . lab investigations showed haemoglobin ( hb)-13.8 gm / dl , pack cell volume ( pcv)-36 , total leucocytes counts ( tlc)-6000 cells / mm , n77l20e0m3 , serum creatinine-0.6 mg / dl , bt and ct-230 and 5 , respectively . mri showed a well - defined , nonenhancing mass in the lateral ventricle near the region of foramen of monroe bulging into both the lateral ventricles [ figures 1 and 2 ] . mri axial view showing the hypointense cyst in the third ventricle extending into lateral ventricles . the eccentric scolex is clearly visible ( arrow ) mri sagital section shows well - defined hypointense lesion in lateral ventricle ( arrow ) past history : patient had been operated previously 21/2 years back when endoscopic removal of third ventricular neuro cysticercus cyst along with endoscopic third ventriculostomy ( etv ) was done . during the previous admission patient had presented in altered sensorium with decerebrate posturing . biopsy specimen of the cyst removed after first surgery histopathology showed typical larvae of taenia solium , collagenous cyst wall without surrounding reactive changes . after the procedure patient was symptom free , albendazole 400 mg bd for a period of 1 month and tab carbamazipine 400 mg three times a day . his follow - up mri showed no residual or recurrent cyst for 2 years . in view of the previous operation , provisional diagnosis of recurrent intraventricular neurocysticercus cyst there is no evidence of second recurrence in 16 months follow up after the second surgery [ figure 4 ] . the follow up mri after the second surgery with no evidence of cyst or hydrocephalus human cysticercosis is caused by the ingestion of food contaminated with the ova of taenia solium . the occurrence of the encysted larva in the brain , spinal cord , meninges , and eyes is known as neurocysticercosis ( ncc ) . regarding parasite localization , four different patterns of infection have been described , that is , parenchymal , subarachnoid , intraventricular , and mixed . occlusions of the csf pathways from an intraventricular cyst , ependymitis , or basilar arachnoiditis are responsible for elevation in intracranial pressure . intraventricular cystic lesions are usually isodense with csf on ct imaging and thus are generally not discernible without the administration of the ventricular contrast . however , mri is the preferred imaging modality to visualize the lesions . the optimum treatment selected from the following therapeutic modalities depends on several factors , including the patient 's condition , location of the cysts , the intensity of the inflammatory reaction and evolutional stage of the cysts : 1 ) emergency ventriculostomy ; 2 ) placement of a vp shunt ; 3 ) endoscopic or open extirpation of obstructing cysts ; 4 ) antihelmintic medications ( albendazole and praziquantel ) ; 5 ) steroid therapy ; and 6 ) antiepileptic medications . acute hydrocephalus usually requires ventriculostomy and subsequent resection of the cysts obstructing csf flow , particularly those in the fourth ventricle.[179 ] the indications for excision of the viable cyst(s ) include the following : 1 ) significant mass effect ; 2 ) obstruction of csf flow ; 3 ) shunt placement precluded by the cyst ; and 4 ) uncertain diagnosis . fourth ventricular viable cysts should typically undergo extirpation because they may cause brainstem compression even after insertion of a vp shunt . the use of anthelmintic drugs in conjunction with shunts has been advocated to eradicate viable cysts and to decrease the rate of shunt failures . there are some who do not advocate antihelminthic drugs after cyst removal with limited follow up the recurrence of isolated intraventricular ncc has not yet been reported in the published literature . it was surprising that the cyst had recurred within ventricular system without the evidence of any parenchyma cyst , forcing us to think whether there was any incomplete removal or an additional cyst that remained invisible during first surgery as well as in follow up radiology . at the same time , one can not rule out re infection particularly in the endemic area . endoscopy can offer safe removal circumventing the need of vp shunt ; however , one should be careful in ensuring that there is no residual cyst . it would be advisable that antihelimenthic should be given postoperatively , even in the absence of parenchymatous cyst . it is also recommended to follow these cases with mri every 6 months till at least 21/2 years .
### Summary: : a rare case of a 42-years old man presented with repeated hydrocephalus due to the neurocysticercosis cyst ( ncc ) in the lateral ventricle . patient was operated previously 2 years back for a similar lesion at same site . both times he was treated endoscopically with removal of the cyst . interestingly there was no parenchymatous lesion at any stage of follow up . isolated recurrent intraventricular ncc is a rare condition that has never been reported in the literature .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the use of light - activated resin composites in restorative dentistry has grown dramatically in recent years . there are currently a range of photo - polymerization techniques which have advantages and disadvantages with respect to the properties of the final restoration and of the long - term status of the restored teeth . inadequate polymerization has been associated with loss of biocompatibility , color change , retention loss , breakage , excessive wear , and restoration softness . the relationship between the spectral distribution of the output from the light curing sources and the maximum absorption of the photoinitiator is expected to have effects on the physical properties of the cured composite . in addition , some dental composites are not convenient to light - emitting diode ( led ) curing technology . the spectra of the led light curing units ( lcus ) differ from those of halogen units . the photoinitiator systems of some composites need to be adjusted to the spectra of these new light sources.[24 ] halogen lcus are currently the most commonly used for curing of dental composites , but this technology has several drawbacks . halogen bulbs have a limited lifespan , and with passage of time , the bulbs , reflectors and filters degrade due to their high operating temperatures resulting in a reduction of their curing effectiveness . to overcome these shortcomings , led technology has been proposed for the use of light curing dental materials.[57 ] the spectral output of blue leds falls conveniently within the absorption spectrum of the camphorquinone photoinitiator ( 400500 nm ) , and so no filters are required when led lcus are used . furthermore , led lcus have an expected lifetime of several thousand hours without significant degradation of light flux . led units generate minimal heat and so do not require cooling fans which have associated noise and power consumption . the efficiency of conversion of electrical energy to useable curing energy is higher for blue leds than for conventional halogen lamps ( 14% vs. 1% , respectively ) . in halogen lamps , up to 70% of the input power is converted to heat , with only 10% resulting in visible light . of this visible light , a further 90% ultimately , their blue light output makes up only 1% of the total energy input.[911 ] hardness evaluation is a widely used test for the investigation of composite curing and of the efficiency of light sources.[21214 ] comparative measurements of arrays composed of different leds and conventional halogen lamps enable the determination of the operating conditions required for equivalent or superior hardness result.[1517 ] our first hypothesis was that the two led lcus can have a better curing performance than halogen lcus . our second hypothesis was that the type of the curing units affects the depth of cure . the aims of this study were to evaluate the performances of two led curing lights and to compare them with those of two conventional halogen lights according to determine the microhardness and depth of tooth colored restoratives . the restorative materials investigated in this study were a compomer ( dyract extra ; dentsply detrey , konstanz , germany ) , a resin - modified glass ionomer ( vitremer ; 3 m espe , seefeld , germany ) , a packable composite ( sculpt it ; jeneric / pentron inc . , wallingford , ct , usa ) , an ormocer ( admira ; voco , cuxhaven , germany ) , a hybrid composite ( tetric evoceram ; ivoclar vivadent , schaan , liechtenstein ) , two microhybrid composites ( miris ; coltene / whaledent , switzerland , and clearfil photo posterior ; kuraray medical inc . , kurashiki , okuyama , japan ) , and a nanofil composite ( filtek supreme ; 3 m espe st . all the samples ( n = 320 ) were prepared in a cylindrical stainless steel mold ( 4 mm and h 10 mm ) placed on a dark polyvinyl chloride ( pvc ) background covered with a celluloid matrix strip . the top of the mold was covered with a celluloid matrix strip and the excess material was removed by pressing a glass slide against the strip . then , the glass plate was removed and the light tip of the curing unit was positioned concentrically within the cavity in the mold , 0.5 mm above the sample . the curing units used in the polymerizations of the restorative materials were two conventional halogen lights ( hilux plus , benlioglu dent . , illinois , usa ) and two led lcus ( elipar freelight 2 , 3 m espe , and smart lite , dentsply ) . a2 color shade composite from vitapan classical tab was chosen for all the tested materials to standardize the polymerization . light intensity was checked with a handheld digital radiometer ( dental hilux curing light meter , dental benlioglu , inc . , the outputs of the curing lights were found to be 450 mw / cm ( hilux ) , 470 mw / cm ( elipar freelight ) , 460 mw / cm ( smart lite ) , and 450 mw / cm ( vip ) . the curing time used for each led and halogen lcu was 40 s. for each curing unit , 10 samples of each material were tested . the curing depth was determined using a scraping test based on iso 4049:2000 . in the scraping test , each sample was removed from the mold , 1 minute after the end of the irradiation and the soft uncured material at the bottom of the sample was gently scraped off with a plastic spatula . the length of the remaining material was measured with a micrometer ( mitutoyo 551 - 201 - 20 , mitutoyo corp . , kawasaki , japan ) with a reading accuracy of 0.001 mm and the result divided by two . each material was measured three times and the mean value of these readings was accepted as resulting value of the curing depth . measurements of the vicker 's surface microhardness were carried out at the top of the cured samples using zwick 3212 hardness tester ( zwick , ulm , germany ) . each specimen was subjected to three indentations under a 50 g load for 30 s at randomly selected locations and the average of these three measurements was calculated . statistical analysis of the data was performed using one - way analysis of variance ( anova ) post - hoc pairwise multiple comparisons , bonferroni test and the kolmogorov - smirnov test . the mean values and standard deviations of the curing depth and microhardness of restorative materials and lcus are summarized in tables 1 and 2 , respectively . no statistically significant differences were found with the scraping test between the two led curing units for dyract extra , miris , sculpt it , and tetric evoceram ( p > 0.05 ) . for elipar and smart lite , significantly higher microhardness values were achieved compared to halogen lcus ( p < 0.05 ) . the nanofil composite , filtek supreme , showed the best curing depth values with all of the tested light curing systems . when polymerized with the vip and hilux light curing units , dyract extra , vitremer , and miris were found to exhibit significantly lower microhardness than the other materials ( p < 0.05 ) . the best microhardness results were obtained with led light curing units , and filtek supreme and tetric evoceram exhibited higher hardness values than the other materials . mean curing depth values of restorative materials polymerized with different light curing units ( mm ) mean microhardess values of restorative materials for different light curing units ( vicker 's hardness , vhn ) the depth of cure and microhardness of the resin composite materials were assessed as these are considered to be the essential physical properties . microhardness evaluation is widely used for testing the assessment of composite curing , and thus , the efficiency of light sources . oberholzer reported that the results for the microhardness of restorations are significantly lower for halogen lights than for led units . hubbezoglu examined the surface microhardness of four kinds of resin composites with various fillers and resin matrices of the materials tested . the nanofilled resin composite was found to exhibit the highest microhardness values for each curing regime . our results coincide with those of the study by hubbezoglu , which support our findings , and highest microhardness values were obtained with filtek supreme . koupis reported that the reduction of the curing depth for shade a4 compared to a2 depends quantitatively on the formulation of the material . in this study , restorative materials of a2 shade our first hypothesis was that the two led lcus can have a better curing performance than halogen lcus . in this study , the halogen lamps were found to exhibit irradiance near 460 nm and the led lcus at approximately 470 nm , which better matches the most efficient wavelength for activation of the camphorquinone present in the resin . the scraping depth results can be explained by relating the emission wavelengths of the curing source to the absorption spectrum of camphorquinone , which has its peak absorption near 470 nm . it must be noted that the scraping depth results are dependent on the specific excitation peak of camphorquinone . in addition to the standard visible light photoinitiator , camphorquinone , some manufacturers use a co - initiator that absorbs light at shorter wavelengths . our second hypothesis was that the type of the curing units affects the depth of cure . of all the materials tested , filtek supreme produced the greatest values of curing depth , while the highest microhardness values were obtained with tetric evoceram and filtek supreme . filtek supreme has a high translucent filler content that allows superior transmission of light through the matrix . the findings supported our hypothesis . increasing the filler eventually leads to increase in the surface microhardness of the composite . since the compomer and polyacid modified composites have much lower filler contents of a different type , they produce lower surface microhardness after curing . we conclude that led lcus are found to be more successful than the halogen units with respect to both curing depth and microhardness properties . led lcus could be the best alternative light curing device for microhardness and depth of cure on the dental composite polymerization .
### Summary: : aim : light - emitting diode light curing units ( led lcus ) have become more popular than halogen lcus in routine dental restorative treatment . the aim of the study was to compare the effects of two conventional halogen ( hilux plus and vip ) and two led ( elipar freelight 2 and smart lite ) light curing units on the depth of cure and the microhardness of various esthetic restorative materials.materials and methods : the curing depth and microhardness of a compomer ( dyract extra ) , a resin - modified glass ionomer ( vitremer ) , a packable composite ( sculpt it ) , an ormocer ( admira ) , a hybrid composite ( tetric ceram ) , two microhybrid composites ( miris and clearfil photo posterior ) and , a nanofil composite ( filtek supreme ) were determined using a scraping method and a hardness tester . a total of 320 samples were prepared using the eight different materials ( n = 10 samples for each subgroup ) . the scraping test was based on iso 4049:2000 . vicker 's microhardness testing was carried out using hardness tester ( zwick 3212 ) . data were analyzed using one - way analysis of variance ( anova ) , bonferroni and the kolmogorov smirnov tests.results:best microhardness results were obtained with the led light curing units and tetric evoceram and filtek supreme achieved the highest hardness values . the nanofil composite , filtek supreme , showed the best curing depth results in all the tested light curing systems.conclusions:the leds were found to be more successful than the halogen units with respect to both curing depth and microhardness properties .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : brown tumour is a non - neoplastic giant cell lesion caused by increased circulating levels of parathyroid hormone ( pth ) . it may be primary , secondary or tertiary forms.1 primary hpt results from increased pth secretion resulting from adenoma or hyperplasia or carcinoma of gland . secondary hpt is characterised by increased pth secretion in response to low serum calcium levels . secondary hpt may be caused by low vitamin d levels acting as a direct stimulus for increased pth secretion or chronic renal failure . tertiary hpt is associated with renal failure and autonomous functioning of glands in long - standing secondary hpt cases.2 we report a case of brown tumour of maxilla occurring in a female patient with chronic renal failure . a 42-year - old female patient reported to us with a chief complaint of swelling in upper jaw of 2-months duration . extraoral examination revealed gross facial asymmetry with a well - defined swelling involving the middle third of the face on the right side . there was obliteration of nasolabial fold on involved side of face [ figure 1 ] . intra - oral examination revealed a well - defined solitary swelling measuring about 4 4 cm on the right side of hard palate not crossing midline . extraoral photograph showing solitary well - defined swelling on middle third of the face intraoral photograph showing lesion involving the anterior palate occlusal radiograph revealed well - defined solitary radiolucent lesion involving the right side of anterior hard palate . loss of lamina dura in relation to 21 , 22 and 23 region was seen [ figure 3 ] . panoramic radiograph ( opg ) showed findings consistent with occlusal radiograph although the lesion is superimposed with ghost image of spine . opg also revealed generalised loss of lamina dura and thinning / loss of cortices of inferior border of mandible , walls of maxillary antrum and inferior alveolar canal suggestive of generalised rarefaction of jaw bones [ figure 4 ] . occlusal radiograph revealed hypodense solitary radiolucent lesion involving the right side of anterior hard palate opg revealed generalised loss of lamina dura and thinning of cortices of inferior border of mandible , walls of maxillary antrum and inferior alveolar canal suggestive of generalised rarefaction of jaw bones coronal ct showed a solitary hypodense mass in the maxillary anterior region measuring approximately 3 4 cm , spherical shaped and encroaching the nasal fossa / cavity [ figure 5 ] . the patient was then subjected to incisional biopsy and gross examination revealed multiple friable soft tissue bits that were brown in colour . coronal ct showing mass involving the anterior maxilla histopathological examination revealed numerous multinucleated giant cells set in a background of fibro - cellular connective tissue stroma showing numerous blood vessels , blood - filled spaces , suggestive of central giant cell lesion [ figure 6 ] . h & e section ( 10 ) showing numerous multi - nucleated giant cells . inset showing giant cells in view of the radiological and histological evidence of giant cell lesion , the patient was further subjected to blood examination which included estimation of pth , serum calcium , alkaline phosphatase and renal functional test . blood examination revealed abnormally elevated pth levels of 1810.9 pg / ml , increased alkaline phosphatase 431 u / l , increased serum creatinine 2.5 mg / dl , elevated blood urea nitrogen[bun ] 35 gm / dl , increased serum phosphatase levels 7.5 mg / dl , decreased serum calcium 7.6 mg / dl , decreased haemoglobin 9 gm% . based on clinical , radiographical , histopathological and lab findings the patient was diagnosed as brown tumour resulting from secondary hpt due to underlying chronic renal failure . bone involvement is a late manifestation of hpt and includes classic skeletal lesions such as bone resorption , bone cysts , brown tumours and generalised osteopenia.3 brown tumour is a kind of giant cell lesion and is so named because of its friable red - brown appearance resulting from vascularity , haemorrhage and haemosiderin deposits.4 they usually present as painless enlargement with slow growth rate occurring with the frequency of 4.5% in primary hpt and 1.5% to 1.7% in case of secondary hpt with overall incidence of 0.1%.5 the commonly involved sites are facial bones , clavicle , ribs , pelvis and femur.6 they are more common in mandible compared to maxilla and are three times more frequent in women aged over 50 years . hypocalcemia , hyperphosphatemia may be significant in chronic renal failure and may stimulate increased pth secretion , which in turn alters intra and extracellular calcium ratio thereby causing increased bone resorption , decreased bone density as seen in the present case . the histopathological features of brown tumour are suggestive but not sufficient enough to establish the diagnosis or differentiation from other giant cell lesion such as central giant cell granuloma , giant cell tumour , etc . in the present case the histopathological features resembled central giant cell granuloma but the diagnosis of brown tumour associated with secondary hpt was established in view of the clinical , radiographical and laboratory reports . they are often asymptomatic as in the present case and sometimes may be , the first impending sign of an underlying previously undiagnosed endocrine disorder . treatment should commence with treatment of underlying hpt which in turn results in complete resolution . although rare , brown tumours of jaws should be considered in the differential diagnosis of giant cell lesions of bone and the dental surgeon should be aware of oral manifestations associated with underlying systemic disease and need for careful clinical , radiological , serological examination can not be over - ruled .
### Summary: : brown tumour is a non - neoplastic giant cell lesion resulting as a complication of hyperparathyroidism ( hpt ) . hpt usually results from increased secretion of parathyroid hormone ( pth ) . we present a rare case of brown tumour of anterior maxilla presenting as a first sign of previously undiagnosed secondary hpt , to emphasise that giant cell lesions of jaw bones should routinely be screened for pth levels to rule out underlying endocrine abnormalities and oral manifestation is the earliest manifestation of many systemic diseases and careful evaluation of oral cavity by physician gives information to underlying systemic pathology .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : since the year 1872 , when arnold demonstrated that the process of angiogenesis utilizes the striae of intracellular cement for neovascularization ( nv ) formation in the cornea , the results of new research examining the process of new vessel formation in the cornea have been published [ 2 , 3 ] . recent research has focused on understanding the mechanisms that keep the cornea avascular under homeostatic conditions and that provide an avascular healing process . these studies agree that corneal angiogenic privilege includes several active cascades and therefore is not a passive process [ 47 ] . corneal nv is the pathological ingrowth of vessels to the cornea from the limbal vascular plexus . other reasons for the formation of pathological vessels in cornea are corneal infections , trauma , and immunological processes . corneal nv can be asymptomatic , but more often it results in severe visual disorders , and in some cases in practical blindness because of unfavorable corneal opacification . common available therapy is limited to removing the primary cause of new vessel formation in the cornea , local application of corticosteroids , laser photocoagulation of bigger vessel strains , and corneal transplantation in extreme cases . factors from the vascular endothelial growth factor ( vegf ) family were shown to be the primary mediators of this process . vegf was originally identified as a stimulator of vascular permeability ( called vpf ( vascular permeability factor ) ) but subsequently has been shown to be a mitogen and angiogenic factor , especially for endothelial cells . after vegf isolation , further isolated factors from the vegf family were named vegf - b , vegf - c , and vegf - d . the original form is currently called vegf - a . vegf factors are a part of the vegf / pdgf ( platelet - derived growth factor ) supergene family [ 6 , 9 , 10 ] . vegf - a binds to the vegfr-1 and vegfr-2 receptors and its expression is strictly regulated . increased production of vegf - a was observed in cases of hypoxia and during inflammation . overproduction of vegf - a was observed in tumor cell proliferation , similarly to corneal neovascularization formation . vegf - a sustains several steps of angiogenesis including proteolytic activity , vascular endothelial cell proliferation , and migration and capillary lumen formation [ 10 , 12 ] . the importance of vegf - a in corneal angiogenesis was demonstrated experimentally on animal models by inhibiting nv after stromal application of an anti - vegf - a antibody . bevacizumab ( avastin , roche ) is an antibody that acts against all isoforms of vegf . this molecule inhibits the interactions between vegf and its receptors , blocking any vegf activity . bevacizumab is currently approved for the treatment of colorectal carcinoma , mamma carcinoma , non - small - cell lung carcinoma , and renal carcinoma . it is widely used off label for the treatment of choroidal neovascularization secondary to age related macular degeneration . the case series was performed at the ophthalmology department of the 3rd medical faculty and university hospital kralovske vinohrady , from december 2007 to june 2011 . off label use of bevacizumab for the treatment of corneal nv in both application forms was approved by the local ethics committee of university hospital kralovske vinohrady . the tenets of the declaration of helsinki were followed and all patients gave their informed consent before enrolling . the patient groups included 66 eyes from 62 patients , 35 women and 27 men , aged from 19 to 84 years . the aim of this study was to evaluate the antiangiogenic effect of the subconjunctival and topical application of anti - vegf antibody bevacizumab on several diseases related to corneal neovascularization . patients were divided into groups a and b according to the means of application of bevacizumab . patients in group a received a single - dose injection of 0.20.5 ml of bevacizumab subconjunctivally using an insulin syringe after applying topical anesthetic eye drops ( oxybuprocaine 0.4% , tetracaine 0.1% ) for 15 minutes . the concentration of the bevacizumab solution used for group a was 25 mg / ml . group a included 28 eyes from 27 patients , 17 women and 10 men , with a mean age of 60 years ( 2784 ) . the concentration of the bevacizumab solution used for group b was 2.5 mg / ml . group b included 38 eyes from 35 patients , 18 women and 17 men , with a mean age of 63.5 years ( 1979 ) . the reason for dividing patients into 2 groups was the fact that we started using bevacizumab subconjunctivally the first year but continued to use eye drops topically in order to improve patient 's comfort , while maintaining the same efficiency . the patients were further divided into 4 subgroups according to the primary cause of corneal nv . subgroup 1 included patients with pterygium ; subgroup 2 included patients with nv on a donor disc after penetrating keratoplasty ; subgroup 3 included patients with other ocular pathology ( corneal leucoma after alkali burns , vascularized scars after corneal ulcers , nv after herpetic keratitis , and stevens - johnson syndrome or corneal nv of another etiology ) ; and subgroup 4 included patients under preparation for high - risk penetrating keratoplasty ( table 1 ) . patients in subgroup 4 had a shorter follow - up time because of following surgery maximum 3 months after treatment . all patients underwent a standard slit lamp ophthalmologic examination of the anterior and posterior segments of the eye . the follow - up examinations were performed in both groups the first , third , and sixth months after the treatments were started . changes in corneal neovascularization were documented on digital photographs during each visit ( sony dxc-950p , 3ccd color video camera , japan ) . we used a special pattern to evaluate the extent of and change in corneal nv . these details were attached to the digital photograph of the cornea of each patient ( figure 1 ) . the total diameter of the pattern was 12 mm with a central 6 mm zone . it consisted of 96 triangular segments of identical size , 72 peripheral segments ( ps ) , and 24 central segments ( cs ) . the extent of corneal nv was expressed in the number of segments containing blood - filled vessels . we evaluated the number of corneal segments affected by nv , cdva , and the incidence of complications and subjective complaints related to the treatment . repeated treatment was not indicated before the first month following the first application of bevacizumab . we decided to repeat the treatment in the case of either a positive response to the first application , in order to achieve further regression of the nv , or a recurrence of corneal nv . using the spss statistics program ( version 19.0 ; spss , inc . , chicago , il , usa ) , a one - way anova was performed for the purpose of statistical analysis . the mean number of affected peripheral segments and of central segments before the treatment that was initiated in group a was 30.37 ( 23.40)42.18% and 4.26 ( 5.92)17.75% , respectively . the mean corrected distance visual acuity ( cdva ) before the treatment was 0.26 ( 0.35 ) . one month after the first bevacizumab subconjunctival injection , the mean number of affected peripheral segments and of central segments was reduced to 25.65 ( 20.4)35.63% ( p = 0.003 ) and 3.42 ( 5.44)14.25% ( p = 0.001 ) , respectively . the mean number of repeated bevacizumab injections in group a was 2.07 ( 14 ) . at six months after initiation of the treatment , the mean count of the peripheral segments and of the central segments was 23.81 ( 17.80)33.07% ( p = 0.000 ) and 3.85 ( 5.92)16.04% ( p = 0.000 ) , respectively . the results of the separate subgroups are summarized in table 2 and figure 4 . the number of segments affected by corneal neovascularization at the one - month and six - month follow - ups compared with the number of segments before the treatment was statistically significantly lower . almost all of the patients tolerated the injection without any complaints , with the exception of patients who had experienced a chemical burn . chemical - burn patients reported that the subconjunctival injection was very painful , even after the repeated application of anesthetic eye drops ( oxybuprocaine 0.4% , tetracaine 0.1% ) . we did not notice the progression of nv immediately after the injection in any of the patients in group a. we observed progression of nv in three eyes after initial regression . the mean number of affected peripheral segments and of central segments before the initiation of the treatment in group b was 27.94 ( 20.29)38.81% and 2.97 ( 4.88)12.38% , respectively . the mean corrected distance visual acuity ( cdva ) before treatment was 0.55 ( 0.42 ) . one month after the topical application of the bevacizumab solution , the mean number of affected peripheral segments and of central segments reduced to 24.5 ( 19.3)34.07% ( p = 0.000 ) and 1.97 ( 3.59)8.2% ( p = 0.000 ) , respectively . the mean number of repeated topical bevacizumab treatments in group b was 1.16 ( 1 - 2 ) . at six months after initiation of the treatment , the mean count of peripheral segments and of central segments was 21.60 ( 18.21)30% ( p = 0.000 ) and 1.84 ( 3.79)7.67% ( p = 0.000 ) , respectively . statistical analysis shows significant differences between the results at one - month and six - month follow - ups , compared with the number of affected segments before initiation of the treatment . we noticed progression of nv immediately after the topical treatment in one patient with nv after a herpetic corneal ulcer . one month after discontinuing topical treatment , the nv regressed dramatically compared with the pretreatment level . in six eyes , we repeated the treatment three months after initiation because of repeated progression of corneal nv . all patients in subgroup b1 ( pterygium ) showed significant improvement in subjective complaints , that is , itching , a sense of the presence of a foreign body , cosmetically annoying redness of the eye . we detected a systemic complication in only one patient from group a. it manifested itself 12 hours after the subconjunctival injection in overall weakness , headaches , and upper extremity paresthesia . these symptoms corrected themselves without any intervention , and we attributed them to a panic attack on behalf of the patient as a reaction to the treatment . due to the patient 's excellent local response to the treatment , we decided to continue the treatment of subconjuntival bevacizumab injections . as for local complications , we observed tiny epithelial corneal defects in three patients in both groups a and b. the defects were completely healed after intensification of lubrication therapy . we detected hypersensitivity reactions in two patients from group b. in both cases , this reaction appeared on the third day after the initiation of the treatment . it manifested itself in eyelid edema and conjunctival hyperemia with a papillary reaction . within two days , this condition was resolved in both cases by discontinuing the bevacizumab eye drops and replacing them with a treatment of fluorometholone acetate . we did not indicate any further treatment of bevacizumab eye drops in these two cases . the most current knowledge with regard to understanding the mechanism of ocular nv has led to the identification of new pharmacological goals . as vegf plays a crucial role in the creation of corneal nv , its treatment with anti - vegf antibodies seems to be the right method [ 7 , 16 , 17 ] . both subconjunctival injections [ 18 , 19 ] and the topical use of bevacizumab [ 2023 ] were experimentally used with promising results in treatment of herpetic keratitis [ 24 , 25 ] , recurrent pterygium [ 23 , 26 ] , corneal transplant rejection , and stevens - johnson syndrome . the publications referred mostly to a small series of patients who had not undergone a uniform treatment scheme . some authors reported the excellent effects of the anti - vegf bevacizumab antibody in inhibiting and regressing corneal nv [ 18 , 22 , 24 , 27 ] . no regression of corneal vascularization was observed in 2 studies involving cases of recurrent pterygium and corneal transplant rejection , after penetrating keratoplasty [ 28 , 29 ] . other studies proved some degree of regression of vessels from the affected cornea [ 19 , 23 , 30 ] . complications were described in only a few studies , and always as superficial epithelopathy , tiny epithelial defects , or progressions of corneal thinning . the reason for these adverse effects may be the fact that vegf supports the growth of neural fibers and its blocking reduces the reparation of corneal nerves . in our series we observed improvements immediately following the initiation of the treatment in the majority of patients and a stabilization of findings in all patients for a minimum of three months ( figures 2 and 3 ) . treatments using the anti - vegf antibody bevacizumab provided statistically significant results . in all patients , we observed either an improvement in or stabilization of the corneal neovascularization . in both groups , mean visual acuity at the final follow - up had improved compared with the initial one . if there was any recurrence , we indicated another application of the bevacizumab treatment . with this regimen , we have been successful in keeping all monitored patients free of complaints for a long time . according to the particular cases with a longer follow - up ( up to 15 months ) and to the average number of retreatments in both study groups , the effect of the topical treatment seems to be more stable , without the need to repeat the treatment . since the study was noncomparative , it is necessary to prove the hypothesis by means of a comparative study and on a larger group of patients . we are convinced , based on the results of our study that the use of bevacizumab in the treatment of active corneal neovascularization could be beneficial . it may also be useful in high - risk keratoplasty , with regard to preoperative preparation and postoperative care . thanks to the anti - vegf antibodies , the blood vessels which can lead to corneal graft rejection are held beyond the corneal graft border . our experience has shown that the use of bevacizumab seems to benefit the complex treatment of pterygium by reducing subjective complaints and delaying surgical intervention . while in some cases retreatment was necessary due to the temporary worsening of local findings , retreatment led to improvement . however , treating corneal nv with the anti - vegf antibody bevacizumab does have some limits . it is only a symptomatic treatment of corneal nv that does not cure the cause of the disorder and in some cases it is necessary to repeat the treatment to maintain its positive effect over a period of time . in addition , its effect on deep vascularization is lower in contrast to superficial and active vascularization , in which clear regression is observed . another possible limiting factor is the fact that anti - vegf antibodies affect only one group of angiogenic agents . it is clear that the maintenance of the avascular cornea is an active process that requires an accurate balance between angiogenic and antiangiogenic mechanisms . the use of other antiangiogenic factors or angiogenic inhibitors has been investigated using in vitro and experimental animal research . for example , the use of anti - pdgf antibodies seems to be an excellent supplementary therapy for anti - vegf antibodies or the strong antiangiogenic factor pedf . the use of bevacizumab seems to be an effective and safe method in the treatment of corneal neovascularization , either in a subconjunctival or topical application form . the minimal incidence of complications and negative side effects promise the future evolution of the treatment as well as its adoption into broader clinical practice . other clinical studies are necessary in order to evaluate the drug 's efficacy , dosage , and safety in every case of corneal neovascularisation .
### Summary: : purpose . to evaluate antiangiogenic effect of local use of bevacizumab ( anti - vegf antibody ) in patients with corneal neovascularization . methods . patients were divided into two groups . all patients suffered from some form of corneal neovascularization ( nv ) . patients in group a received 0.20.5 ml of bevacizumab solution subconjunctivally ( concentration 25 mg / ml ) in a single dose . group a included 28 eyes from 27 . patients in group b applied bevacizumab eye drops twice daily ( concentration 2.5 mg / ml ) for two weeks . group b included 38 eyes from 35 patients . we evaluated the number of corneal segments affected by nv , cdva , and the incidence of complications and subjective complaints related to the treatment . the minimum follow - up period was six months . results . by the 6-month follow - up , in group a the percentage reduction of the affected peripheral segments was 21.6% and of the central segments was 9.6% ; in group b the percentage reduction of the central segments was 22.7% and of the central segments was 38.04% . in both groups we noticed a statistically significant reduction in the extent of nv . conclusion . the use of bevacizumab seems to be an effective and safe method in the treatment of corneal neovascularization , either in the subconjunctival or topical application form .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : both epidemiological and clinical studies have demonstrated that the serum levels of high - density lipoprotein ( hdl ) cholesterol are inversely correlated with the risk of atherosclerosis [ 13 ] . hdl protects against atherosclerosis and cardiovascular disease by mediating reverse cholesterol transport , protecting vascular endothelium , and exerting antioxidant , anti - inflammatory , and antithrombotic effects [ 4 , 5 ] . in humans , a 1 mg / dl ( 0.03 mmol / l ) increase in baseline hdl is associated with a 6% decrease in the risk of death from coronary disease . therapy with the hdl mimetic apoai phospholipid may result in regression of atherosclerosis , and these mimetic peptides may also influence the vascular biology of the vessel wall and protect against other acute and chronic inflammatory diseases . functional integrity of hdl is equally important for its antiatherogenic properties , as one study showed that patients with normal or elevated but functionally abnormal hdl suffered from atherosclerosis . hdl takes up and transports surplus cholesterol from the peripheral tissues to the liver for disposal in bile , a process mediated by the hdl cell surface receptors on hepatocytes . two receptor types have been identified , one is a high affinity receptor scavenger receptor class b type i ( sr - bi ) and the other is an endoreceptor sr - bi binds to hdl with a high affinity and may mediate selective cholesterol uptake of hdl in hepatocytes . sr - bi overexpression may significantly change plasma hdl levels , possibly reducing the incidence of arteriosclerosis [ 1216 ] . furthermore , sr - bi - knockout models show an increased rate of arteriosclerosis [ 1719 ] . sr - bi is relatively nonspecific , as it binds to ldl , oxidized ldl , and very low density lipoprotein in addition to hdl . atpase - b1 is also involved in hdl catabolism , as it triggers hdl and apoai internalization in hepatocytes . atp synthase is an enzymatic complex ( about 600 kda ) responsible for atp synthesis in mitochondria , prokaryote membranes , and chloroplasts . mitochondrial atp synthase is composed of two domains : an extramembranous catalytic domain ( f1 ) and a transmembrane domain ( f0 ) that functions as a proton channel . the mammalian atp synthase consists of at least 16 different subunits : f1 : , , , , and +if1 ; f0 : a g , f6 , a6l , and andoligomycin - sensitivity conferring protein . it has also been found on the cell surface of endothelial cells , adipocytes , hepatocytes , and tumor cells using immunofluorescence or cell surface biotinylation techniques [ 2428 ] and may be involved in neovascularization , hypertension , cell proliferation , and cytotoxicity [ 2430 ] , although the mechanism leading to its ectopic expression is still unknown . the f1 domain of atpase contains the catalytic site for atp synthesis and hydrolysis and the binding sites for atp and adp . in endothelial cells , apoa - i binding to atpase - b1 causes atp synthase to hydrolyze atp into adp and inorganic phosphate . adp then stimulates apoa - i and hdl uptake into the cell and transendothelial transport of initially lipid - free apoa - i and hdl via activation of the p2y12 receptor . in the present study , we investigated whether overexpression of atpase - b1 increases dii - hdl uptake in primary hepatocytes of wild - type ( wt ) or sr - bi - knockout ( sr - bi/ ) mice . we also sought to determine the effect of exogenously added atpase - b1 cdna on plasma hdl - c in sr - bi/ mice . to further determine the role of atpase - b1 in hdl metabolism , we transferred human atpase - b1 cdna into an adenovirus vector , with a v5-tag on the carboxy terminal end for detection . increased expression of atpase - b1mrna ( figure 1(a ) ) and protein ( figure 1(b ) ) was confirmed in hek293a cells infected with ad - atpase - b1 compared with the control ( ad - gfp ) vector . to study whether atpase - b1 affects hdl uptake , primary hepatocytes infected with ad - atpase - b1 showed significantly higher levels of immunodetectable atpase - b1 expression compared to the control vector ( figure 2 ) . to further investigate how different quantities of atpase - b1 affect its cellular expression , we infected hepg2 cells with various concentrations of ad - atpase - b1 and ad - gfp . increased moi corresponded to increased atpase - b1 protein ( figure 3(a ) ) and mrna expression ( data not shown ) . atpase - b1 can be expressed on the surface of endothelial cells , adipocytes , hepatocytes , and tumor cells [ 2428 ] . in order to determine moi yielding the highest expression of ad - atpase - b1 , we infected primary hepatocytes ( wt and sr - bi/ mice ) with a range of different mois . while mrna expression of ad - atpase - b1 was highest at 100 mois in the wt mice ( figure 3(b ) ) , atpase - b1 mrna expression was highest at 30 mois in sr - b1/ mice . therefore , we used 30 mois ad - atpase - b1 for the remainder of our study . unlike the hepg2 cells ( figure 3(a ) ) , wt and sr - bi/ hepatocytes showed slightly higher protein expression in response to higher mois ( figure 3(c ) ) we next investigated the effect of ad - atpase - b1 overexpression on dii - hdl uptake . as shown in figure 4(a ) , apoa - i ( 1 mg / ml ) as the standard , the concentration of isolated hdl was 1 mg / ml , and dii - hdl was 0.25 mg / ml . freshly isolated primary hepatocytes were examined by fluorescence microscopy . figure 4(b ) showed dii - hdl uptake was significantly higher in ad - atpase - b1 infected wt and sr - bi/ hepatocytes compared to their respective controls ( p < 0.01 ) . although the dii - hdl uptake is significantly higher in infected wt hepatocytes compared to the sr - bi/ counterparts ( p < 0.01 ) , ad - atpase - b1 infection increased dii - hdl uptake similarly in both groups ( table 1 ) , suggesting that the lack of sr - bi does not affect atpase - b1 function . ectopic atpase - b1 has been characterized as an apoa - i receptor , triggering hdl internalization in hepatocytes . to further assess the role of liver atpase - b1 in hdl metabolism , we injected wt and sr - bi/ ( 1 10 pfu ) mice with either ad - atpase - b1 or ad - gfp via tail vein . liver atpase - b1 mrna level increased significantly in both groups ( figure 5(a ) ) ; however , mrna expression was significantly higher in the transfected sr - bi/ mice ( p < 0.001 ) compared to wt mouse . atpase - b1 protein was detected in the livers of both wt and sr - bi/ mice ( figure 5(b ) ) . plasma total cholesterol and hdl - c were 2.5 and 3 times higher , respectively , in sr - bi/ mice before infection ( figures 6(a)6(c ) ) . sr - bi/ mice infected with ad - atpase - b1 showed lower plasma total cholesterol ( ~18% ) and hdl - c ( ~12% ) compared to sr - bi/ mice infected with the control adenovirus ( figures 7(a)-7(b ) ) , but plasma triglycerides were not different between the groups ( figure 7(c ) ) . atpase - b1 infection did not affect plasma total cholesterol , hdl - c , or triglycerides in wt mice ( figures 7(a)7(c ) ) . analysis of lipoprotein profiles in the pooled plasma sample revealed lower hdl - cholesterol ( figure 8) in the ad - atpase - b1 mice compared to ad - gfp mice . however , ad - atpase - b1 treated mice showed a significant increase in vldl / cm - associated tg compared to ad - gfp mice ( figure 8(a ) ) . in this study , we set out to determine whether overexpression of atpase - b1 affects plasma lipoprotein levels and whether this effect is mediated by sr - bi . a previous study showed that the surface -chain is an apoa - i / hdl receptor , and the complex has been found on the cell surface of endothelial cells , adipocytes , hepatocytes , and tumor cells by immunofluorescence or after biotinylation of the cell surface [ 2428 ] . recently , new research has shown that knock - down of abca1 , abcg1 , and sr - bi diminishes , but does not completely block , the transport of apoa - i or hdl through the endothelium [ 32 , 33 ] . the ectopic presence of atpase - b1 on the surface of endothelial cells was confirmed by cell surface biotinylation . to investigate the effect of atpase - b1 on hdl metabolism , we constructed an adenovirus containing the whole length of human atpase - b1 and successfully transfected this ad - atpase - b1 into hek293a cells ( figures 1(a ) and 1(b ) ) and hepg2 cells ( figure 2(a ) ) . to further validate the role of atpase - b1 on hdl metabolism , we measured dii - hdl uptake after infecting primary hepatocytes with ad - atpase - b1 . we demonstrate that overexpression of hepatic atpase - b1 by adenovirus infection increases dii - hdl uptake ( figure 4(b ) ) in cultured primary hepatocytes and decreases plasma total cholesterol and hdl - c ( figure 7 ) in sr - bi/ mice . these findings agree with previous studies demonstrating that significant amounts of immunodetectable -chain protein were present on the hepg2 cell surface and increased hdl uptake . although the infected wt hepatocytes had a greater absolute dii - hdl uptake compared to the sr - bi/ mice ( p < 0.01 ) , the difference in uptake between atpase - b1 and gfp - infected mice was similar in both mouse models , suggesting that atpase - b1 does not interact with sr - bi in increasing dii - hdl uptake . previous research in sr - bi/ mice showed that plasma total cholesterol , hdl , and hdl volume were double that of a normal mouse [ 34 , 35 ] . atpase - b1 overexpression also decreased plasma total cholesterol ( ~18% ) and hdl - c ( ~12% ) ( figures 7(a)-7(b ) ) and showed a depletion of hdl - c lipoprotein profiles ( figure 8) . however , our atpase - b1 adenovirus is not specifically located in the cell membrane . therefore , our infection procedure may not fully reflect the function of atpase - b1 in hdl metabolism in vivo . constructing an adenovirus specifically located in the cell membrane will help us understand the role of atpase - b1 in hdl metabolism more clearly . previous research in hepatocytes shows that the -chain functions as an apoa - i receptor and triggers hdl endocytosis . upon binding of apoa - i , atp synthase hydrolyzes atp into adp and inorganic phosphate , and adp stimulates hepatic hdl uptake by activating the purinergic receptor p2y13 through the small gtpase rhoa and its effector rock i [ 28 , 36 ] . however , whether this pathway is altered in sr - bi/ mice is still unknown . many genes participate in hdl and apoa - i metabolism , such as atp - binding cassette transporter a1 ( abca1 ) , atp - binding cassette transporter g1 ( abcg1 ) [ 3840 ] , and sr - bi . however , whether atpase - b1 interacts with them in hdl endocytosis is still unclear . coinhibition experiments in endothelial cells suggest that abca1 , abcg1 , sr - bi , and atpase - b1 interact in a series of events rather than on independent parallel processes . future studies should aim to measure plasma apoa - i levels and determine whether there is an interaction among atpase - b1 , abca1 , abcg1 , sr - bi , and apoa - i and the potentially downstream signaling pathway involved . in summary , the present study demonstrated that overexpression of atpase - b1 increased dii - hdl uptake in primary hepatocytes and reduced plasma hdl - c and total cholesterol in sr - bi/ mice and that atpase - b1 increased hdl uptake independently of the presence of sr - bi . future research should investigate the effect of atpase - b1 on plasma apoai and characterize the signaling events and downstream targets for hdl endocytosis . hepg2 and hek293a cells were obtained from the american type culture collection ( atcc , manassas , va ) and maintained in dmem containing 10% fbs ( gibco , california , usa ) supplemented with 100 u / ml penicillin g and 100 g / ml streptomycin sulfate at 37c in a humidified atmosphere of 95% air , 5% co2 . for adenovirus infection experiments , cells were seeded in six - well plates at a density of 2 10 cells per well and incubated in dmem containing 5% fbs . cells were infected with either ad - atpase - b1 or the control vector ad - gfp . sr - bi/ mice and wt mice were fed standard rodent chow and water ad libitum in sterile cages with a 12 h light / dark cycle . two hundred microliters of a 0.9% sterile solution containing 1 10 pfu of either ad - atpase - b1 or control ad - gfp adenovirus was injected into the tail vein . mice were fasted for 4 h and 200 l aliquots of orbital venous blood were collected after anesthesia into heparin - coated capillary tubes at 0 and 7 days . plasma was collected by centrifuging samples at 4000 rpm for 10 min at 4c and subsequently stored at 80c . after 7 days , mice were anesthetized by intraperitoneal injection of pentobarbital , and tissue and blood were collected . plasma levels of tg and cholesterol were determined using thermo infinity tg and cholesterol reagents ( thermoelectron , melbourne , australia ) . plasma hdl - c levels were extracted using peg precipitation and then determined using thermo infinity cholesterol reagents . the plasmid was linked to cmv using the restriction enzymes bg and sph , with a v5-tag added to the c - terminal for detection purposes . the recombinant virus ad - atpase - b1 was plaque - purified , expanded , and purified on cscl gradients as described by kozarsky et al . . the control adenovirus ad - gfp was constructed using the same procedure but without the transgene expression cassette . the portal vein was cannulated , and the liver was perfused with krg buffer ( ph 7.4 ) containing 120 mm nacl , 480 mm kcl , 120 mm mgso4 , 120 mm kh2po4 , and 50 mm egta . after perfusing at a rate of 1 ml / min at 37c for 20 min , 50 ml collagenase buffer containing 1 mm cacl and iv collagenase was added and perfusion continued for an additional 20 min . cells were filtered to remove undigested fragments , centrifuged for 4 sec at 50 g , and washed twice in cold culture medium to remove damaged and nonliver cells . isolated cells were seeded on six - well plates at a density of 3 10 cells per well in dmem medium containing 10% fbs . the plated cells were infected with ad - atpase - b1 ( titer : 8 10 pfu / ml ) in 1 ml of fresh dmem at 37c for 36 h at 30 multiplicities of infection ( mois ) . parallel experiments were conducted using the control adenovirus vector ( ad - gfp , titer : 1 10 pfu / ml ) to infect the cells at the same moi dose to determine the effect of adenovirus alone on the cells . human hdl ( 1.063 < d < 1.21 ) was isolated from serum using density gradient centrifugation according to redgrave et al . . to remove kbr buffer , the isolated hdl was dialyzed with pbs containing egta - na2 and stirred at 4c for 48 h. the hdl was labeled with the fluorescence probe dii ( beyotime ) according to pitas et al . and was also dialyzed . hdl and dii - hdl showed no differences in apoprotein composition on 12% sds - page . briefly , the infected cells were cultured for 48 h and then incubated with 25 g dii - hdl ( 0.25 mg / ml ) at 37c for 2 h in dmem medium containing 5% fbs . cells were then washed three times with pbs and fixed with 4% paraformaldehyde for 20 min at room temperature . atpase - b1 expression was analyzed using a mouse - anti - v5 monoclonal antibody ( 1 : 2000 ) , primary antibody , and a goat - anti - mouse igg - hrp ( 1 : 5000 ) secondary antibody . gapdh ( 1 : 1000 dilution for the primary antibody and 1 : 5000 dilution for the secondary antibody ) was used as an internal control . total rna extracted from cells and livers was reverse - transcribed using 10 units of m - mlv reverse transcriptase ( promega ) following the standard procedure . real - time pcr was performed using quantitect sybr green pcr reagents ( life technologies , california , ca ) . atpase - b1 ( tggtggtgctggagttgg , gcctgggtgaagcgaaag ) transcription levels were normalized to -actin ( cgtgggccgccctaggcacca , ttggccttagggttcagggggg ) . plasma aliquots ( 250 l ) were pooled from a group of mice and applied to tricorn high - performance superose s-6 10/300 gl columns using a fast - protein liquid chromatography system ( amersham biosciences ) , followed by elution with pbs at a constant flow rate of 0.25 ml / min . eluted fractions ( 500 l ) were assayed for tg and cholesterol concentrations using the tg and cholesterol kits ( biosino , china ) . freshly isolated primary hepatocytes grown on cover slips were pretreated with ad - atpase - b1 ( a ) and ad - gfp ( b ) ( moi = 30 ) for 48 h. after three pbs washes , cells were fixed with 4% paraformaldehyde at room temperature for 5 min . after washing with pbs , the cells were immunostained with an antibody against v5-tag ( life technologies , california , ca ) ( 5 mg / ml ) in pbs-1% bsa and alexafluor 596-conjugated goat anti - mouse igg ( 5 mg / ml ) ( molecular probes ) and analyzed using confocal microscopy ( leica sp5 , germany ) .
### Summary: : hdl cholesterol is known to be inversely correlated with cardiovascular disease due to its diverse antiatherogenic functions . sr - bi mediates the selective uptake of hdl - c . sr - bi knockout diminishes but does not completely block the transport of hdl ; other receptors may be involved . ectopic atp synthase -chain in hepatocytes has been previously characterized as an apoa - i receptor , triggering hdl internalization . this study was undertaken to identify the overexpression of ectopic atp synthase -chain on dil - hdl uptake in primary hepatocytes in vitro and on plasma hdl levels in sr - bi knockout mice . human atp synthase -chain cdna was delivered to the mouse liver by adenovirus and gfp adenovirus as control . the adenovirus - mediated overexpression of -chain was identified at both mrna and protein levels on mice liver and validated by its increasing of dil - hdl uptake in primary hepatocytes . in response to hepatic overexpression of -chain , plasma hdl - c levels and cholesterol were reduced in sr - bi knockout mice , compared with the control . the present data suggest that atp synthase -chain can serve as the endocytic receptor of hdl , and its overexpression can reduce plasma hdl - c .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : ovarian neoplasms are very uncommon in children representing a very small proportion of all ovarian tumors.1234 the infrequent nature of childhood ovarian tumors and their structural complexity have made it difficult to categorize these tumors.5 there is little information available on the relative frequency of benign and malignant ovarian tumors in nigerian children.2 malignant neoplasms of the ovary in childhood are extremely rare and far less common than the benign ovarian tumors.6 majority of earlier studies on childhood ovarian tumors were based on case reports on the specific patient ovarian neoplasm.578 in general , most ovarian studies on children also included other age groups.2591011 this is a retrospective study of 24 cases of ovarian neoplasms in children < 15 years over a 22 years period . all histologically confirmed cases of primary and metastatic neoplasms of the ovary seen at the university college hospital , ibadan between january 1991 and june 2013 were retrieved . thereafter , those ovarian tumors in children < 15 years of age were used for this study . the demographic data and clinical history of these cases were obtained from the case notes , surgical daybooks , surgical pathology request forms , postmortem records , and cancer registry data . the hematoxylin and eosin ( h and e ) stained histopathology slides were retrieved and where necessary , new paraffin sections were made and stained with h and e. all cases whose slides and paraffin blocks could not be retrieved were excluded from the study . all cases were classified according to 2003 world health organization histological classification of tumors of the ovary.12 the data obtained were subjected to statistical analysis using statistical package for social sciences version 20 . continuous variables were compared using the student 's t - test and discrete variables were compared using the chi - squared test , with level of significance set at p < 0.05 . ethical clearance for the study was approved by the joint university of ibadan / university college hospital ethical review committee according to declaration of helsinki . twenty - four ( 2.8% ) of childhood ovarian neoplasms were seen between the age group 0 and 14 years ( < 15 years of age ) . majority ( 50% ) were seen in the right ovary , 9 ( 37.5% ) were found in the left ovary , and 3 ( 12.5% ) were bilateral . fourteen ( 58.3% ) cases of childhood ovarian neoplasms were benign , and 10 ( 41.7% ) were malignant . twenty ( 83.3% ) cases of childhood ovarian neoplasm were primary constituting 2.3% of all ovarian tumors , and 4 ( 16.7% ) were secondary constituting 0.5% of all ovarian tumors . of primary childhood ovarian neoplasms , germ cell tumors were the most common 16 ( 80% ) and comprising 66.7% of total childhood ovarian neoplasm . sex cord stromal tumors were seen in 4 ( 20% ) cases with 16.7% of total childhood ovarian neoplasms . mature cystic teratoma occurring in 13 ( 54.2% ) was the most common childhood ovarian neoplasm and was most prevalent between 10 and 14 years of age . burkitt lymphoma was the most common 4 ( 40% ) malignant childhood ovarian tumor and prevalent between 5 and 14 years of age . there was no case of malignant childhood ovarian neoplasm between 0 and 4 years of age . four cases ( 16.7% ) of childhood ovarian tumor were found between 0 and 4 years , 6 ( 25% ) between 5 and 9 years , and 14 ( 58.3% ) between 10 and 14 years . the frequency of occurrence of the childhood ovarian tumors increased with increasing age , with the highest 14 ( 58.3% ) occurring between 10 and 14 years age group [ table 1 ] . childhood ovarian neoplasms constituted 2.8% of total ovarian neoplasms in the age group 014 years ( < 15 years ) of age . the incidence was lower compared to what was reported by mohammed et al . from zaria , northern nigeria where childhood ovarian tumors accounted for 8.6% of all cases of ovarian tumors using age group of 015 years1 and norris and jensen from the usa , where childhood ovarian tumors accounted for 6% of total ovarian tumors in the age group 019 years ( < 20 years).5 lower age group 014 years in this study could account for the lower incidence of childhood ovarian tumors . burkitt 's lymphoma was the commonest malignant childhood ovarian tumor accounting for 40% followed by dysgerminoma similar to results of junaid from ibadan2 and mohammed et al . from zaria,1 nigeria . norris and jensen reported higher frequency of malignant germ cell tumor specifically malignant teratoma followed by dysgerminoma.5 la vecchia et al . found dysgerminoma as the most common malignant childhood tumour.4 yolk sac tumor and juvenile granulosa cell tumor were equally found as the most common primary malignant childhood tumors compared to findings of other studies113 whereas , dysgerminomas was the most common primary malignant childhood ovarian tumor . in the current study , mature cystic teratoma was the most common benign childhood ovarian tumor accounting for 92.9% of benign childhood ovarian tumors and 54.2% of total childhood ovarian tumors similar to results of some studies.1213 the second most common childhood germ cell tumor seen in this study was yolk sac tumor similar to results of some studies.13 this contrasts with findings from other centers which showed that dysgerminoma was the second most common germ cell tumor seen in children.1 the sex cord - stromal tumors of the ovary in children constituted 16.7% of childhood ovarian tumors with juvenile granulosa cell tumor being the most common similar to findings of other studies.113 surface epithelial tumors of the ovary were not seen in childhood in this study , and this is similar to a study done by junaid.2 however , low frequency of childhood surface epithelial tumors was seen in other studies.1613 this study showed that the frequency of occurrence of the childhood ovarian tumors increased with increasing age , with the highest 14 ( 58.3% ) occurring in the age group of 1014 years similar to other studies.514 this study has revealed the occurrence of primary and secondary malignant ovarian neoplasms in younger age groups in our environment . therefore , this study emphasizes that in young females with ovarian masses , the possibility of malignancies of both primary and secondary types should be considered .
### Summary: : background : childhood ovarian neoplasms are very rare . little information is available on the relative pattern and frequency of these tumors in nigerian children . earlier study done in ibadan involved ovarian neoplasms in children and adolescents . the aim of this study is to review cases of ovarian neoplasms in children < 15 years over a 22 years period.materials and methods : this was a retrospective study . twenty - four cases of childhood ovarian neoplasms were seen in patients < 15 years of age . these cases were classified using the current world health organization histological classification of ovarian tumors.results:childhood ovarian neoplasms accounted for 2.8% of all cases of ovarian tumors seen in this period . fourteen ( 58.3% ) cases of childhood ovarian neoplasms were benign , and 10 ( 41.7% ) were malignant . mature cystic teratoma occurring in 13 ( 54.2% ) was the most common childhood ovarian neoplasm and was most prevalent between 10 and 14 years of age . burkitt lymphoma was the most common 4 ( 40% ) malignant childhood ovarian tumor and prevalent between 5 and 14 years of age.conclusion:mature cystic teratoma remains the single most common childhood ovarian neoplasms , and burkitt 's lymphoma is the most malignant childhood ovarian tumor in ibadan , south - western nigeria .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : osteosarcoma ( os ) , an aggressive malignant neoplasm , is the most common primary bone cancer mainly in adolescents and young adults . though the survival state has been improved after the introduction of neoadjuvant chemotherapy , the 5-year survival rate of os patients with metastases at diagnosis is less than 30% . thus , it is significant that identifying potential therapeutic targets in the insights of molecular mechanisms . as the high - throughput microarray experiments have been used in many fields , detection of expression level is an efficient approach to find useful genomic alteration in os patients . recently , it has been reported that there are many important differently expressed genes ( deg ) and pathways in os [ 58 ] . critical to implicating novel genes is the identification of core modules containing dysregulated pathways and complexes . a straightforward way was performed with identification and comparison of modules across normal and cancer tissue conditions by integrating ppi map and gene expression data . detecting deregulated pathways between disease and normal groups appears to be hotspot in recent years . the method individualized module aberrance score ( imas ) is designed to compare the expression profiles of a single patient with cohort data to detect molecular aberrances that are particular to the disease . we use imas on account of the comparison of one os patient with a lot of accumulated normal samples ( ans ) . this is a biologically intuitive guideline to interpret an individual disease that even lacks vast data , which is absolutely different from the traditional gene expression analysis . the new method covers 4 steps : data processing , gene - level statistics , imas and a significance test . it could capture biological and clinical information in a sensible , valid and useful way for colorectal cancer and lung cancer . we used imas to explore modules in os samples in order to distinguish differences from the control group . in this study , we introduced a pipeline that identified modules from ppi network in individuals of os . after narrowing down the number of correlated modules by support vector machine ( svm ) , we used imas to distinguish differences in individuals . we hope that this will served as therapy - targeting markers and benefit individualized medical treatment of os . the transcription profile was obtained from embi - ebi arrayexpress . gene expression profiling of 99 tissues were collected from e - geod-33382 and e - geod-28974 to study the behavior of genes and their modules in individuals . samples were used from 15 controls and 84 os patients . the platform used was illumina human-6 v2.0 expression beadchip ( using nuids as identifier ) . the linear models for microarray data ( limma ) was then used to preprocess data . background adjustment and quantile data normalization were performed by robust multi - array average ( rma ) . to protect against outlier probes we used a robust procedure , median polish , to estimate model parameters . the average value of a gene symbol with multiple probes was calculated and 23 214 genes were obtained . the human protein - protein interaction ( ppi ) map was collected from the retrieval of interacting genes ( string ; v 9.0 ) , including 1 048 576 ppi sets . filtering repeated ones , ppi sets were gathered in the condition of the combine score < 0.8 . then we constructed a ppi subnet after getting intersection with 23214 genes and ppi network , which contained 37381 ppi sets and 6665 nodes . ( jinan , china ) . using the human subnet as a backbone , we inferred a re - weighted ppi network with expression and mutation profiles of normal and os . every side of the constructed ppi network was assigned with absolute value of spearman correlation coefficient of every interaction according to gene expression data . based on clique - merging , a module - identification algorithm was used to identify modules from os ppi networks . we identified the set c of all maximal cliques of size at least k in the ppi network using a fast depth - first search with pruning - based algorithm ( cliques ) by tomita et al . next , we calculate its weighted interaction density score ( c ) as , we ranked these cliques in descending order of their score ( c ) . the modules were gathered by merging highly overlapping cliques . the individualized module aberrance score ( imas ) for the personalized identification of modules was performed in os , making special use of accumulated normal samples ( ans ) . ans was obtained from the gene expression omnibus ( geo ) database of ncbi ( www.ncbi.nlm.nih.gov/geo/ ) . for individual os cases , as quantile normalization was performed after combining the single os data . zn ) represents the expression state of a module , where zi denotes the standardized expression value of i - th gene and the number of genes existing in the module is n. module statistics of every module : zi represents the standardized gene level statistics of 1-i gene and the number of genes existing in the module is n . module statistics from os and normal sample tissues were tested in pairs with wilcoxon test . since the test might induce false - positive results , we adjusted the raw p - values into false discovery rate ( fdr ) to circumvent the problem . the fdr<0.05 and |log fold change ( fc)|>1 were used as the cut - off criteria . gene ontology ( go ) analysis has been used frequently in functional studies of large - scale genomic data . to functionally classify modules , we performed biological process ontology using bingo of cytoscape version 3.2.0 , which is able to reveal enriched go terms . a p - value less than 0.01 was considered statistically significant . support vector machine ( svm ) was supervised computational methods used for classification and regression tasks that originated from statistical learning theory . this measure is defined as the total number of good classifications over the total number of available examples . svm is widely used in computational biology due to its high accuracy , ability to deal with high - dimensional databases , and strong flexibility in modeling diverse sources of data . we used c - classification to test the consistency of distribution results between os modules and expression data . the expressing data of genechips were randomly grouped in experimental and test groups by the proportional 6 : 4 . the classified test points can be divided into 4 categories : true - positives ( tp ) , true - negatives ( tn ) , false - positives ( fp ) , and false - negatives ( fn ) . sensitivity and specificity describe how well the classifier discriminates the positive and the negative classes , respectively . the transcription profile was obtained from embi - ebi arrayexpress . gene expression profiling of 99 tissues were collected from e - geod-33382 and e - geod-28974 to study the behavior of genes and their modules in individuals . samples were used from 15 controls and 84 os patients . the platform used was illumina human-6 v2.0 expression beadchip ( using nuids as identifier ) . the linear models for microarray data ( limma ) was then used to preprocess data . background adjustment and quantile data normalization were performed by robust multi - array average ( rma ) . to protect against outlier probes we used a robust procedure , median polish , to estimate model parameters . the average value of a gene symbol with multiple probes was calculated and 23 214 genes were obtained . the human protein - protein interaction ( ppi ) map was collected from the retrieval of interacting genes ( string ; v 9.0 ) , including 1 048 576 ppi sets . filtering repeated ones , ppi sets were gathered in the condition of the combine score < 0.8 . then we constructed a ppi subnet after getting intersection with 23214 genes and ppi network , which contained 37381 ppi sets and 6665 nodes . using the human subnet as a backbone , we inferred a re - weighted ppi network with expression and mutation profiles of normal and os . every side of the constructed ppi network was assigned with absolute value of spearman correlation coefficient of every interaction according to gene expression data . based on clique - merging , a module - identification algorithm was used to identify modules from os ppi networks . we identified the set c of all maximal cliques of size at least k in the ppi network using a fast depth - first search with pruning - based algorithm ( cliques ) by tomita et al . next , we calculate its weighted interaction density score ( c ) as , we ranked these cliques in descending order of their score ( c ) . the individualized module aberrance score ( imas ) for the personalized identification of modules was performed in os , making special use of accumulated normal samples ( ans ) . ans was obtained from the gene expression omnibus ( geo ) database of ncbi ( www.ncbi.nlm.nih.gov/geo/ ) . for individual os cases , as quantile normalization was performed after combining the single os data . z= ( z1 , z2 , , zn ) represents the expression state of a module , where zi denotes the standardized expression value of i - th gene and the number of genes existing in the module is n. module statistics of every module : zi represents the standardized gene level statistics of 1-i gene and the number of genes existing in the module is n . module statistics from os and normal sample tissues were tested in pairs with wilcoxon test . since the test might induce false - positive results , we adjusted the raw p - values into false discovery rate ( fdr ) to circumvent the problem . the fdr<0.05 and |log fold change ( fc)|>1 were used as the cut - off criteria . gene ontology ( go ) analysis has been used frequently in functional studies of large - scale genomic data . to functionally classify modules , we performed biological process ontology using bingo of cytoscape version 3.2.0 , which is able to reveal enriched go terms . a p - value less than 0.01 was considered statistically significant . support vector machine ( svm ) was supervised computational methods used for classification and regression tasks that originated from statistical learning theory . this measure is defined as the total number of good classifications over the total number of available examples . svm is widely used in computational biology due to its high accuracy , ability to deal with high - dimensional databases , and strong flexibility in modeling diverse sources of data . we used c - classification to test the consistency of distribution results between os modules and expression data . the expressing data of genechips were randomly grouped in experimental and test groups by the proportional 6 : 4 . the classified test points can be divided into 4 categories : true - positives ( tp ) , true - negatives ( tn ) , false - positives ( fp ) , and false - negatives ( fn ) . sensitivity and specificity describe how well the classifier discriminates the positive and the negative classes , respectively . we identified 83 modules containing 2084 genes from ppi network used clique - merging . among them , 61 modules were significantly different with wilcoxon test ( p<0.01 ) . in the go analysis , 1568 biological processes were obtained from 61 modules . cluster analysis of os using the imas technology on beer s data distinguished 5 modules clusters ( shown by 15 in figure 2 ) . , 15 normal samples are clustered together with red color , and blue color represents the differentiation status of os . it claimed that impartial clustering - based imas was highly sensitive to gather crucial correlation with os disease . from module clusters of figure 2 , m1 , m2 , and m5 module cluster m3 and m4 are relatively weak in distinguishing the differences between os samples and ans . basically , in most os samples , modules can detect differences from ans . therefore , imas is clinically useful in individualized medical treatment of os . we used svm to test distribution results of normal and os group with screened modules . the classifier mainly judged the test set true - positive and true - negative exactly . specificity=1.00 and sensitivity=1.00 prove the distribution outcomes of screened modules were mainly consistent with that of total data , which suggested the efficiency of 61 modules . it proved modules could take the place of vast numbers of genes to distinguish differences in distribution results of os patients and normal samples . we identified 83 modules containing 2084 genes from ppi network used clique - merging . among them , 61 modules were significantly different with wilcoxon test ( p<0.01 ) . in the go analysis , 1568 biological processes were obtained from 61 modules . cluster analysis of os using the imas technology on beer s data distinguished 5 modules clusters ( shown by 15 in figure 2 ) . , 15 normal samples are clustered together with red color , and blue color represents the differentiation status of os . it claimed that impartial clustering - based imas was highly sensitive to gather crucial correlation with os disease . from module clusters of figure 2 , m1 , m2 , and m5 module cluster m3 and m4 are relatively weak in distinguishing the differences between os samples and ans . basically , in most os samples we used svm to test distribution results of normal and os group with screened modules . the classifier mainly judged the test set true - positive and true - negative exactly . specificity=1.00 and sensitivity=1.00 prove the distribution outcomes of screened modules were mainly consistent with that of total data , which suggested the efficiency of 61 modules . it proved modules could take the place of vast numbers of genes to distinguish differences in distribution results of os patients and normal samples . dealing with clinical data can be problematic since the available data is usually high - dimensional and heterogeneous , which means vast numbers of features and different types of data . the high accuracy and flexibility of svm are suitable to the distribution problem proposed in this paper . we used svm to assess the efficiency of modules and found their distribution outcomes were mainly consistent with the original data , with high accuracy of 100 . therefore , screened modules could take the place of vast numbers of genes to perform individualize therapy in os . we suggest that screened modules need to be checked in new studies and receive further modification . module analysis has become a common choice for extracting and explaining the underlying biology for high - throughput molecular measurements . identification of differentially expressed modules in a single patient is significant to aid in personalized medicine , which may present fruitful strategies for os therapy . therefore , we employed the imas to analyze the personalized identification of modules , taking advantage of vast amounts of normal data . proved that the average z equation could efficiently reveal noticeable aberrance in expression profiles and clinical significance , which sufficed to confirm the best averaged validation rate and distinguish a known survival - relevant pathway statistically . furthermore , ans data is expected to be available in more fields of medicine along with the rapid advances of high - throughput databases . in this study , the imas was used to calculate module statistics of every module and average z method was selected for modification of existing module analysis methods . there were 61 modules with p<0.01 after adjustment of fdr , which were screened to be the most significant modules . the majority of them were clustered in m1 , m2 , and m5 ( figure 2 ) . based on our results , we present a novel pipeline that identified the dysregulated modules in individuals with os . imas provides a sensitive measure for clinical features of patients and can be useful in analysis of individual medical treatment in os . the constructed process is expected to aid in personalized health care , which may present fruitful strategies for medical therapy .
### Summary: : backgroundosteosarcoma ( os ) , an aggressive malignant neoplasm , is the most common primary bone cancer mainly in adolescents and young adults . differentially expressed modules tend to distinguish differences integrally . identifying modules individually has been crucial for understanding os mechanisms and applications of custom therapeutic decisions in the future.material/methodssamples came from individuals were used from control group ( n=15 ) and os group ( n=84 ) . based on clique - merging , module - identification algorithm was used to identify modules from os ppi networks . a novel approach the individualized module aberrance score ( imas ) was performed to distinguish differences , making special use of accumulated normal samples ( ans ) . we performed biological process ontology to classify functionally modules . then support vector machine ( svm ) was used to test distribution results of normal and os group with screened modules.resultswe identified 83 modules containing 2084 genes from ppi network in which 61 modules were significantly different . cluster analysis of os using the imas method identified 5 modules clusters . specificity=1.00 and sensitivity=1.00 proved the distribution outcomes of screened modules were mainly consistent with that of total data , which suggested the efficiency of 61 modules.conclusionswe conclude that a novel pipeline that identified the dysregulated modules in individuals of os . the constructed process is expected to aid in personalized health care , which may present fruitful strategies for medical therapy .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : in this issue of critical care , de matos and colleagues report a case series of 51 patients with early severe acute respiratory distress syndrome ( ards ) treated with the so - called maximum recruitment strategy ( mrs ) . the authors found sustained improved oxygenation and reduction of collapsed lung tissue , which were suggestive of high degrees of alveolar recruitability . the concept of alveolar recruitment and maintenance of high levels of positive end - expiratory pressure ( peep ) was proposed 20 years ago . however , experimental as well as clinical results are still controversial and the why , how , and when of recruitment and peep settings are still under debate . recent studies have questioned the concept of lung recruitability in severe ards in general and reported high variability of potentially recruitable lung tissue as well as an association with patient response to peep . although three prospective randomized clinical trials could not show decreased mortality with lung protective mechanical ventilation aiming at alveolar recruitment and the application of higher peep levels , better oxygenation and improvement in a relevant secondary endpoint ( namely less need for rescue therapies ) have been achieved [ 4 - 6 ] . furthermore , a recent meta - analysis suggested a survival benefit for protective mechanical ventilation at higher levels of peep in patients with severe ards . on the other hand , according to the same analysis , patients with less severe ards did not show improved survival and even needed more time to be extubated . thus , it is crucial to define the right patient population ( severe versus mild ards ) , the right time ( early versus late ards ) , and the right method to achieve and maintain alveolar recruitment without causing structural damage to the lungs or compromising hemodynamics . there are numerous ways to achieve alveolar recruitment , and so far there is no gold standard to set peep , to recruit previously atelectatic lung regions in a standardized fashion , or even to define adequate alveolar recruitment . sustained inflation ( that is , a continuous level of high pressure applied to the airways ) is the most popular recruitment maneuver . however , it has a major impact on hemodynamics and has been shown to worsen lung damage and inflammation in experimental acute lung injury in comparison with smoother maneuvers . also , sustained inflation has been applied with different airway pressures and durations but without objective endpoints . compared with other methods , the mrs is a well - protocolized alternative targeted at well - defined endpoints . it consists of an initial recruitment phase with stepwise increase of peep ( beginning , for example , at 20 cm h2o ) and a fixed inspiratory driving pressure ( for example , 15 cm h2o ) until either the lungs are fully recruited , as measured by gas exchange or computed tomography , or peak airway pressures reach 60 cm h2o ( at a peep of 45 cm h2o ) . the recruitment phase is followed by a decremental peep trial aiming at defining the optimal peep ( that is , one step above the peep level at which closing of lung areas could be obtained ) , which is an important part of the concept . the mrs has been used in patients , yielding significant and long - lasting improvement of lung function . however , it has been criticized , mainly because of the potential for deterioration of hemodynamics at increased levels of peep . first , inspiratory plateau pressures in their patient population far exceeded the 28 cm h2o safety limit , which had been associated with increased inflammatory response in a previous study , and even the 30 cm h2o cutoff proposed by the ards network . in fact , it is almost certain that the inspiratory plateau pressure of approximately 40 cm h2o ( on average ! ) measured after mrs resulted in high degrees of stress / strain in those patients . however , given the severity of disease , mortality rates were not higher than expected , and no significant pulmonary or extrapulmonary complications were reported . second , the potential for recruitability was much higher than the average of approximately 13% , as reported in a randomized clinical trial . strain is a relative measurement that takes into account the initial length / volume of a material with elastic properties . in the case of the lungs , the product of strain and intrinsic elastance yields stress , which can be translated as transpulmonary pressure . however , such calculations assume a homogeneous distribution of volume . it has been known since 1970 that neighbor lung zones with non - homogeneous elastic properties undergo higher stress . thus , the mrs may contribute to homogenize the stress distribution across the lungs , decreasing local stress . in other words , less ( inspiratory plateau pressure ) can be also more ( local stress / strain ) in a non - homogeneous lung . or is the dynamic stress / strain , which is closer to the driving pressure , what counts more ? the higher degree of lung recruitability in the study by de matos and colleagues could be ascribed to a highly efficient recruitment maneuver that was used early in the course of ards , as compared with a maneuver that consisted of cyclic change of between 5 and 45 cm h2o and that was used later in the course of disease . obviously , the observational study by de matos and colleagues does not imply that a change in clinical practice is necessary . currently , the routine use of recruitment maneuvers in ards is not recommended , but higher peep levels are indicated in cases that are more severe . however , this study challenges the paradigm that inspiratory plateau pressures should not exceed 30 cm h2o in patients with ards , especially when the dynamic stress / strain ( that is , driving transpulmonary pressure ) can be reduced and despite higher levels of peep . the question of whether lung recruitment maneuvers should always be used , banned definitively , or individualized ( and to which targets ) in ards remains unanswered . ards : acute respiratory distress syndrome ; mrs : maximum recruitment strategy ; peep : positive end - expiratory pressure .
### Summary: : recruitment maneuvers and the application of high levels of positive end - expiratory pressure combined with lung protective mechanical ventilation strategies have been proposed to improve pulmonary function in patients with severe acute respiratory distress syndrome . however , the optimal way to achieve and maintain alveolar recruitment is still under debate .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : an in - house database of over 300 fungal secondary metabolites , encompassing a diverse range of structural classes such as polyketides , terpenoids , and peptides , had been assembled , recording the chromatographic retention times , uv / vis data , full - scan hrms , and ms / ms spectra in both positive and negative electrospray ionization ( esi ) modes . once extracts were analyzed , these data were processed utilizing the acd intellixtract software , which scans the data and reports molecular ions that match the database . the matches were investigated further by comparing the fragmentation pattern of the sample to that of the standard . however , for this study , there were two slight differences . first , the original database was built using collision - induced dissociation ( cid ) with a normalized collision energy ( nce ) of 30 on an ltq orbitrap xl , thereby generating low - resolution fragmentation data ; at the time , that presented a more efficient way to process the data . in contrast , this study used a qexactive plus and therefore used high - energy collision dissociation ( hcd ) with an nce of 35 , which had the benefit of having high - resolution fragmentation . although the resulting fragments were mostly similar between hcd and cid , there were some differences , making it important to rerun the standards using hcd . second , the qexactive plus has the ability to perform polarity switching , thus allowing for the collection of both positive and negative ionization modes in a single run . the use of the qexactive plus also provided increased sensitivity and the option of higher resolution ( 140 000 vs 100 000 ) as compared to the ltq orbitrap xl . initially , a representative 10% of the compounds from the fungal library were spotted on teflon - coated slides and sampled via the droplet although our traditional drug discovery projects focus on metabolites soluble in organic solvents ( such as chcl3meoh ) , a droplet comprising 50:50 meoh ms systems and had the added benefit of mimicking the typical extraction process ; ch3cn worked in an equivalent manner . also , an equal volume of h2o was added to maintain droplet formation and integrity , as reported previously . polyketides , cyclic peptides , terpenoids , and peptides , as well as commonly dereplicated compounds , such as equisetin ( 20 ) , aerofusarin ( 23 ) , and alternariol analogues ( table s1 ) , were all readily detected . for each standard , the hrms , ms / ms , uv / vis data , and retention times were all reacquired and recorded to account for any changes to the retention times and fragmentation patterns due to the droplet complications of extraction and ionization were not observed with any of the compounds ( table s1 , supporting information ) , suggesting that it would work for the entirety of the library . subsequently , 12 fungi ( table s1 ) were selected that were known to biosynthesize those standards from traditional natural product studies , and each was dereplicated readily from cultures on petri dishes using the droplet lmj ssp ( table s1 ) . fungal culture g100 and the structures of the identified metabolites using the droplet lmj briefly , the first fungus selected for dereplication via the droplet lmj ssp was a culture identified as clohesyomyces aquaticus ( pleosporales , dothideomycetes , ascomycota ) and coded g100 ( figure 2 ) . phomopsinone a ( 1 ) and three other metabolites ( compounds 24 ) were all detected and identified by their retention time , uv / vis data , hrms , and ms / ms data ( figure 3 ) . ms / ms was used to sample fungus g100 , thereby generating ( a ) the total ion chromatogram and ( b ) the uv / vis ( 190500 nm ) chromatogram ( 0.08 min delay between pda and ms ) . at 4.35 min , ( c ) the hrms spectrum , ( d ) the hcd fragmentation pattern , and ( e ) the uv / vis spectrum can be observed , all corresponding to 1 . the mass accuracy of 1 was 0.6 ppm ( 225.1120 observed vs 225.1121 calculated for [ c12h16o4 + h ] ) . ssp was its tolerance of diverse fungal topographies and its ability to analyze specific features of a fungal culture , such as guttates ( i.e. , liquid droplets ) . while many fungi produce guttates , ambient techniques , such as desi and nanodesi , have reported the difficultly of analyzing such liquids on a culture s surface . previously , guttates on the surface of a fungus were explored using desi ms . this required imprinting the culture onto teflon - coated slides and analyzing with desi ssp was able to extract liquid droplets off the surface of a fungal culture without any sample preparation . to showcase this ability , the droplet ssp sampled both a guttate and the outer mycelium on a fungal culture of g100 . the antifungal compound 1 was observed in significantly larger amounts ( over two magnitudes ) on the guttate than on the outer edge of the fungus ( figure s1 ) . this interesting observation would be impossible with a standard natural products protocol that extracts the entire sample . moreover , it allows us to now postulate and test questions about where , when , and why this fungus concentrates an antifungal compound in guttates . ssp over other ambient ionization techniques is the ability to differentiate between isomers using lc . ion mobility has tried to alleviate this issue but has several limitations , such as decreased sensitivity , low ion mobility resolution , and requiring a mass spectrometer that has ion mobility capabilities . currently , ion mobility works best as a complementary technique with lc , rather than as the sole source of separation . the separation that lc provides has a greater ability to resolve compounds due to the abundance of chemically diverse columns and chromatographic conditions available . moreover , chromatography is likely more familiar to most specialists in natural products chemistry . coded g87 ( figure 4 ) , was reported previously to biosynthesize two sets of isomeric resorcylic acid lactones ( compounds 5/6 and 7/8 ) . ssp , the fungus was sampled in a petri dish and had three peaks with an accurate match ( 5 ppm ) for m / z 381.1099 ( figure 5 ) . standards were analyzed for compounds 5 and 6 , and these displayed matching retention times ( 4.03 and 4.21 min , respectively ) , hrms , and ms / ms fragmentation patterns ( figure s2 ) for two of the peaks . fungal culture g87 and the structures of the identified metabolites using the droplet ( b ) the xic of m / z 381.1099 ( 5 ppm ) displays matching retention times ( boxed ) for compounds 5 , and 6 and a potential analogue . the full - scan ms at ( c ) 4.03 and ( d ) 4.21 min and the tandem ms of 381.11 at ( e ) 4.03 and ( f ) 4.21 min match the standards for compounds 5 and 6 , respectively . interestingly , none of the previously isolated compounds from g87 matched the peak on the extracted ion chromatogram ( xic ) at 3.46 min . this was perplexing at first given its relative abundance , but upon further inspection , the mass was identified as a loss of water on the precursor ion at 399.1204 ( figure s3 ) . this observation further highlights two important benefits to sampling a fungal culture directly with the droplet lmj first , the chromatographic separation allows for the assignment of multiple adducts , such as assigning [ m + h ] , [ m h2o + h ] , and [ m + na ] to a compound . with ambient ionization techniques that directly infuse into the mass spectrometer , it is difficult to differentiate whether observed masses ( i.e. , 399.1204 and 381.1098 ) are analogues that differ by 18 amu or if one of them is a loss of water from the other ( i.e. , [ m + h ] and [ m without chromatography , the two isomers ( 5 and 6 ) may have been presumed to be [ m h2o + h ] to the mass at 399.1204 , rather than the presence of three unique metabolites . by gaining chromatographic separation , adducts can be differentiated from analogues , eliminating this concern . second , because the proposed metabolite that eluted at 3.46 min ( figure s3 ) was not encountered in the original study , which identified 14 new resorcylic acid lactones , its detection with the droplet when grown on rice in solid - phase culture , the fungus might have biosynthesized it only early in the growth of the fungus , or the compound decomposed during the initial extraction / isolation processes . performing a microextraction of the culture directly from the petri dish , such as afforded by the droplet lmj ssp , four secondary metabolites ( 912 ) from a fungal strain , coded msx19583 ( figure 6 ) , had been isolated , characterized , and added to the dereplication database . however , when a regrowth of this culture was requested in order to identify its genus and species via its sequencing , it was discovered that there was a contaminant in fungal strain msx19583 ( figure s4 ) . to identify which fungus was the contaminant and which one biosynthesized the isolated metabolites , the xic of masses for the four previously isolated metabolites were compared for each fungus against the pure standards . matches of retention time , accurate m / z match ( 5 ppm ) , and tandem ms for compounds 911 were present in the green - colored fungus ( figures 7 , s5 , and s6 ) , while the matches for these compounds were not observed in the purple - colored fungus . initially , compound 12 appeared to be detected in the green - colored fungus . however , the retention time and ms / ms data demonstrated that this was a spurious observation and not the same compound ( figure 8) , further exemplifying the benefits of mutually supportive data afforded by the droplet culture msx19583 and the contaminant were later identified as aspergillus sydowii ( green ) and a chaetomium sp . matches in retention time can be observed by comparing the xic of 249.1485 5 ppm from ( a ) the fungal culture and ( b ) the standard . furthermore , the hrms data for ( c ) the fungus and ( e ) the standard both matched , and the ms / ms spectra for ( d ) the fungus and ( f ) the standard have matching fragmentation patterns . a difference in retention time can be observed by comparing the xic of 235.1693 5 ppm from ( a ) the green - colored fungal culture and ( b ) the standard . the ms spectra display the difficulties of solely using ms for this metabolite identification . the hrms spectrum for ( c ) the fungus and ( e ) the standard both matched [ c15h23o2 h2o + h ] within a 5 ppm mass tolerance , but the ms / ms spectra showed differences between ( d ) the fungus and ( f ) the standard in fragmentation patterns . similar to msi , the droplet lmj ssp also has the ability to map the relative intensities of selected molecular ion peaks . the fungus coded msx19583 was used to map the location of two of the key metabolites , compounds 9 and 10 . as mentioned earlier , initially , the impure culture was analyzed , mapping a straight line from the contaminant ( purple ) to the desired fungus ( green ) and back to the contaminant ( figure 9 ) . it was observed that compound 9 was detected primarily on the body of the fungus , while compound 10 was predominantly exuded into the surrounding media . this experiment was repeated on another culture of msx19583 , once the contaminant ( purple ) was removed . the results were the same , showing that compound 9 remained on the body of the fungus while compound 10 was exuded into the surrounding media ( figure s7 , supporting information ) . this was an important observation , as we initially pondered if the purple fungus had either been responsible for the biosynthesis of 10 or stimulated its biosynthesis by the green - colored culture . these sorts of measurements are impossible with extracted cultures , as all spatial information would be lost in the context of the entire extract . moreover , sampling the agar region could be challenging in other msi experiments , as we observed the formation of divots from the gas and spray pressure when attempting a similar experiment with a desi source . ( greenish - gray ) with the contaminant ( purple ) ; crosshairs illustrate location of sampling points . ( b ) heat map of compound 9 as sampled from the contaminant to the culture . ( c ) heat map of compound 10 as sampled from the contaminant to the culture . ( d ) the color scale and diameter of the spot indicate the relative amount of signal detected for the given analytes . there are many questions and challenges that one could envision for the utilization of the droplet lmj first , there were concerns about whether the fungal culture would absorb the droplet rather than forming a liquid microjunction between the fungus and the syringe . in working with 12 cultures , significant droplet loss was an issue for two fungi , coded g87 and msx59553 ( figure 10 ) . interestingly , visual inspection of the fungus was not an adequate predictor of droplet loss . for example , g100 and g87 ( figures 2 and 4 ) were similar looking and covered in mycelia ( i.e. , a hair - like surface ) , yet g100 permitted droplet liquid microjunction formation readily , while g87 would absorb the droplet . a possible explanation of this could be due to the presence of hydrophobins that are often contained in the conidia / spores . strains that produce conidia / spores on the surface of aerial mycelium tend to be hydrophobic ( i.e. , g100 ) , while aerial mycelium that lack conidia / spores are more hydrophilic ( i.e. , g87 ) . additionally , msx59553 and msx57715 ( table s1 ) resembled each other with flat , spore - covered surfaces , yet msx59553 would absorb most of the droplet and msx57715 would not . for the challenge concerning msx59553 , the droplet lmj ssp still recovered some of the solvent from the sampled area . in this case , it was enough to generate data for dereplication , but would result in poor spatial resolution ( 35 mm ) for mapping . fortunately , these challenges for g87 and msx59553 could be alleviated by resampling the same position several hours later . after the suboptimal sampling area dried , a hardened surface was created that was amenable to liquid microjunction formation . by resampling this area , the droplet was recoverable and multiple extractions could take place with the single droplet ( i.e. , sampling three or more times before injecting into the uplc pda comparison of the topography of fungal cultures that resembled each other superficially , but either had challenges ( i.e. , g87 and msx59553 ) or were amenable ( g100 and msx57715 ) with the droplet lmj ssp . besides absorbency issues , occasionally a droplet was simply unrecovered . this typically happened in one of the following instances : ( 1 ) when sampling cultures with steep topography or ( 2 ) if repeated sampling eventually resulted in considerable droplet loss . ms , the steep topography was surprisingly not a prevalent issue , but could occur in a few instances , particularly with fungi covered in mycelia . it was also not a consistent issue , as immediately resampling the same steep location would often result in a successful microextraction . for repeated sampling with the droplet ssp , droplet loss could be minimized by utilizing three or less microextraction cycles , with the exception of the fungal cultures with absorbent surfaces , as noted above . when working with solid - phase cultures for isolation studies , our typical protocol involves an overnight extraction , largely out of convenience . thus , another concern that arose was the amount of material a microextraction could absorb via a 4 l droplet during the two seconds of contact with the culture . this was addressed by repeating the microextraction three times with the same droplet before injecting the sample into the uplc this gave the droplet a higher concentration of fungal metabolites , while minimizing the risk of losing the droplet to the fungal surface . as previously reported , several short microextractions were more effective for this application than a single long extraction . in fact , when designing the experiments , a qexactive plus ( with enhanced resolution ) was used with this concern in mind . however , after experimenting , a less sensitive instrument should also suffice . with the various types of structural classes tested ( table s1 ) , limitations were not encountered with this method for secondary metabolite detection for both pure standards and direct fungal culture analysis . a question that arose during peer review was how this process compared to rapid plug extractions , which were first described in the late 1990s . in this , a 6 mm plug is excised by hand from the fungal culture ( including agar ) in the petri dish . the entire plug is extracted , and the effluent can then be analyzed by hplc . while that method has corollaries with some of the droplet lmj ssp benefits ( such as sampling across a culture , the space between cocultures , etc . ) the possibilities for in situ analysis are not quite the same , particularly in a temporal manner , as those afforded by the droplet ssp , which has the added benefit of automation and integrated heat mapping capabilities . nevertheless , rapid plug extractions likely probe the chemistry of fungal cultures in a similar manner . ssp is that the fungal culture survives the analysis , except in the immediate area of the microextraction ( typically 1 mm ) . ssp is examining the timing of secondary metabolite biosynthesis , particularly for the optimization and eventual scale up of drug leads . one concern , particularly from the mycologist on our team , was contamination from fungal spores in the air that could arise when the petri dish was exposed repeatedly . in sampling dozens of fungal cultures , this occurred in only one instance . approximately a week after the culture g87 was sampled , a contaminant appeared in the petri dish . for the purposes of dereplication and heat mapping experiments , this was not an issue , as the cultures were analyzed immediately after opening . indeed , our current protocol involves first opening a plate in a laminar flow hood , such that fungi that sporulate prolifically do not contaminate the ms facility and instruments ; for nonsporulating fungi ( i.e. , hyphal / mycelia forms ) this is not a major concern . moreover , the plates are exposed only immediately prior to analysis . since the droplet lmj ssp is a separate instrument from the lc ms , a possible solution if contamination ( either of the sample or of the facility ) was a serious concern would be to place the droplet ssp in a laminar flow hood , coupling the instruments together with longer tubing . finally , although heat mapping experiments obtain a large amount of information , they are not a replacement for ms imaging experiments . for instance , heat mapping experiments take a longer period of time due to the addition of chromatography . more importantly , the resolution ( 0.71.0 mm ) of the current droplet lmj ssp is not as high as it is for other imaging techniques ( 20200 m ) that must be considered when looking for precise changes in distribution of secondary metabolites or biomarkers in other matrices . however , the droplet lmj ssp has the ability to map the spatial distribution of isomers , something not currently possible with other imaging platforms . also , because heat mapping is not a continuous flow , it has the ability to readjust to the various topographies that are encountered , which is a particular challenge with routine sampling of fungal cultures . additionally , heat mapping provides semiquantitative results , as its true potential as an analytical technique has been neither evaluated nor optimized due to challenges , such as consistency in droplet recovery . thus , ms imaging and heat mapping experiments should be viewed as complementary techniques , rather than a substitution for one another . in conclusion , coupling a droplet lmj ssp with a uplc pda hrms ms / ms system advances ambient ionization techniques with the inclusion of chromatography . secondary metabolites were characterized with more confidence due to the mutually supportive data that were obtained . furthermore , cultures were dereplicated directly , with no time spent on sample preparation , seamlessly integrating the current database of retention times , pda , hrms , and ms / ms at the level of the extract . the robustness and simplicity of using the droplet lmj ssp make it a powerful and effective tool for natural products research . besides our immediate needs in natural products drug discovery , we can envisage applications to probe questions of biosynthesis and chemical ecology . ssp capabilities were acquired via collaboration with the organic and biological mass spectrometry group at oak ridge national laboratory , who assisted in the conversion of a ctc / leap htc pal autosampler ( leap technologies inc . ) into an automated droplet extractions were performed using fisher optima lc / ms grade solvents consisting of 50:50 meoh h2o . variations of tested solutions included 30:70 ch3cn h2o , 50:50 ch3cn h2o , 30:70 meoh there was no discernible difference in metabolite extraction between the ch3cn and meoh mixtures ; therefore all experiments proceeded with 50:50 meoh higher organic ratios often resulted in unsuccessful liquid microjunction formation , as previously reported . droplets of 4 l were dispensed onto the surface of the sample at a rate of 2 l / s , held on the surface for 2 s , and withdrawn back into the syringe at the same rate . this extraction process was repeated a total of three times for a single spot prior to injection into the uplc ssp was coupled with a waters acquity ultraperformance liquid chromatography ( uplc ) system ( waters corp . ) to an ms . ssp on fungal cultures was coupled to an ab sciex tripletof 5600 + at oak ridge national laboratory , but the majority of the analyses was performed on a thermo qexactive plus ms ( thermofisher ) at uncg . the qexactive plus was adjusted to collect data from 150 to 2000 m / z at a resolution of 70 000 . the voltage for both positive and negative ionization modes was set to 3.7 kv , with a nitrogen sheath gas set to 25 arb , and an auxiliary gas set to 5 arb . the s - lens rf level was set to 50.0 with a capillary temperature at 350 c . the flow rate of the uplc was set to 0.3 ml / min using a beh c18 ( 2.1 50 mm 1.7 m ) equilibrated at 40 c . the mobile phase consisted of fisher optima lc ms grade ch3cn h2o ( acidified with 0.1% formic acid ) , starting at 15% ch3cn and increasing linearly to 100% ch3cn over 8 min . it was held at 100% ch3cn for 1.5 min before returning to starting conditions for re - equilibration . the pda was set to acquire from 200 to 500 nm with 4 nm resolution . for the identification of strains used in this study , the internal transcribed spacers ( its ) region and a portion of the 28s rrna gene of the nuclear rna operon were sequenced . its2 region were generated using primers its1f / its5 and its4 , and 28s rrna gene sequence data were obtained for the first two divergent domains ( d1/d2 ) using primers lror and lr3 . the its region was used for barcoding of fungal species by searching against nblast with the refseq database as well as the regular ncbi database ; uncultured / environmental sequences were excluded from the blast search . the its region was used for species identification , while a portion of the 28s was used for phylogenetic analysis . images of each culture were acquired using an epson perfection v370 scanner controlled by dropletprobe premium . the location of the sampling area and the scanned images were calibrated to correlate the x and y coordinates , and dropletprobe premium automatically marked the scanned images with a crosshair at the spots where extraction sampling occurred . the creation of heat maps was also performed using the dropletprobe premium software by correlating the intensities of specified molecular ions ( 5 ppm ) and retention times to the selected spots on the scanned images . acd ms manager with add - in software intellixtract ( advanced chemistry development inc . ) a customized tray was designed using sketchup make ( trimble navigation limited ) , sliced using simplify3d ( simplify3d llc ) , and printed out of poly(lactic acid ) using an f306 3d printer ( fusion3 design llc ) . the design held a small or large size petri dish and a solvent vial and had a needle block position ( figure s8 , supporting information ) .
### Summary: : ambient ionization mass spectrometry techniques have recently become prevalent in natural product research due to their ability to examine secondary metabolites in situ . these techniques retain invaluable spatial and temporal details that are lost through traditional extraction processes . however , most ambient ionization techniques do not collect mutually supportive data , such as chromatographic retention times and/or uv / vis spectra , and this can limit the ability to identify certain metabolites , such as differentiating isomers . to overcome this , the droplet liquid microjunction surface sampling probe ( droplet lmj ssp ) was coupled with uplc pda hrms ms / ms , thus providing separation , retention times , ms data , and uv / vis data used in traditional dereplication protocols . by capturing these mutually supportive data , the identity of secondary metabolites can be confidently and rapidly assigned in situ . using the droplet lmj ssp , a protocol was constructed to analyze the secondary metabolite profile of fungal cultures without any sample preparation . the results demonstrate that fungal cultures can be dereplicated from the petri dish , thus identifying secondary metabolites , including isomers , and confirming them against reference standards . furthermore , heat maps , similar to mass spectrometry imaging , can be used to ascertain the location and relative concentration of secondary metabolites directly on the surface and/or surroundings of a fungal culture .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : worldwide , head and neck squamous cell carcinoma ( hnscc ) is the sixth most common type of cancer.1 as last reported in 2010 , there is an estimated 600,000 cases of hnscc reported each year around the globe.2 unfortunately , only 4050% of these patients will survive more than five years.3 based on epidemiological projections , head and neck human papillomavirus - positive ( hpv+ ) cancers are estimated to comprise over 25% of all known hnscc.4 these data suggest that approximately 150,000 new cases are affected by hpv+ head and neck cancer around the world each year . currently , a subset of hnscc , oropharyngeal squamous cell carcinoma , accounts for approximately 10% of all hnscc worldwide.2 in the united states alone , hpv+ cancers represent around 63% of all oropharyngeal cancers.5 however , some reports also speculate that hpv and hnscc could be as large as 90% in some demographics.2 there are approximately 40,250 new cases of cancer of the oral cavity and pharynx diagnosed each year , as reported by the american cancer society in 2012.6 additionally , according to the north american association of central cancer registries and from data collected by the national cancer institute s seer program and the cdc s national cancer registries during the 19992008 period , the incidence rates of hpv+ oropharyngeal cancer have increased dramatically by 4.4% per year , particularly among white males.6 in recent publications , it has been postulated that the overall decreasing incidence of oral cavity / pharyngeal cancer may reflect reductions in smoking and alcohol consumption among all race / sex groups . but decreases in smoking - related hnscc are offset by the trend of rising hpv+ cancers among other demographics , which may reflect changes in sexual practices since the mid-1960s , particularly among white males.7 mounting evidence suggests increased radiosensitivity of hpv+ hnscc.8 because of the changing demographics of hpv+ hnscc , some clinical investigators , including our group , have now proposed that it is feasible to lower radiation dose in patients with hpv+ cases . a phase ii trial is currently underway that seeks to identify patients with hpv+ oropharyngeal cancer . early evidence suggests that patients with hpv - associated hnscc may not require the full radiation dose given in a standard regimen of intensity - modulated radiation therapy ( imrt).9 in this study , 46 patients had a complete clinical response with a lower - than - standard radiation dose , at 54 gy,9 with standard treatment doses being 6670 gy . a reduction in radiation dose could potentially reduce late - term morbidity of radiation therapy in some cases and could change the standard of treatment for patients with hpv+ hnscc.8 nevertheless , it is still too early to determine the correct dose to apply in radiation therapy or the appropriate imaging follow - up just from a single small study . typical numbers for a phase ii trial would be between 100 and 300 patients.10 because of the small number of participants in the ecog trial ( n = 46 ) , it appears that studying this population may be challenging . in an age where there is shrinking funding for clinical trials and research , we also believe that coordination , planning , and informatics support could help achieve greater effect in future clinical trials . we are inspired by several targets that , despite the attempts of some evidence - based services , remain unmet in the status quo.11 these unmet challenges in literature management and informatics include the failure to recognize an information need , physicians not being prepared for where a particular field may be heading and a preference for choosing the most convenient clinical paths rather than most appropriate choices . users are further hindered by the excessive time and effort required to find answers to appropriate questions from resources , the difficulty of navigating overwhelming bodies of literature , and the inadequacy of current literature search technologies . our goal is to construct a literature informatics management education system ( limes ) for implementation in an academic teaching hospital . unfortunately , organization and knowledge collection , such as what we are attempting to do with our limes , are unfortunately often relegated to cinderella roles , assumed to be automatic to perform and often difficult to measure . thus , we have chosen to focus on a small but emergent literature set , for which our case includes the use and role of imaging for hpv head and neck cancers , which is the primary interest and expertise of our institution . the proposed limes not only archives the articles , but also employs a newly recommended technique to systematically summarize and categorize content in a digital repository that is semantically mineable . another compounding challenge is the organization of information across different departmental clinical teams ( eg , diagnostic radiology , radiation therapy and otorhinolaryngology ) . the idea is to lay down what is considered as known and what is not known in the current published literature on hpv - hnscc imaging and have multiple disciplines represented in the literature management process . because of physician time constraints , we also seek to potentially share the burden of search , summarization , categorization , and organization with medical trainees . unfortunately , to our knowledge , the study / discussion of data collection by individuals is often not , if ever , described in published literature . yet , the process of reading and reviewing in research , as well as learning how best to do these things , is often a very cumbersome process . for example , ely has described how there appears to be a trend of increasing time demands on clinicians and less time to find literature resources.12 coumou and meijman have described systematic methods by which primary care physicians search for answers to clinical questions.13 they describe how physicians often first choose to consult colleagues whom they know well.13 this practice of asking colleagues has not changed much in recent years , despite the proliferation of electronic publications made available worldwide . physicians in the past had limited options for finding answers , sometimes reduced to only the use of an intermediary person such as a librarian.13 in this work , we propose , and have tested , a structured approach that generates clinical roadmaps and potential pearls from abstract information found in hpv head and neck cancer literature , using what we have called information service oriented architecture ( isoa ) . essentially , we use an isoa to break down the application functions of a large organization into a set of interoperable services . in our case , trainees , ie , medical school or premedical school students , will evaluate and structure the elements into our content management system ( cms ) prior to review by attending physicians . much of the focus on automated content extraction from literature management centers is on natural language processing ( nlp).14,15 nlp methods are most effective when they have a wide body of open literature to train on . in medicine , a successful nlp - based program was able to examine electronic clinical notes in women with early - stage incident breast cancers and identify whether and when recurrences were diagnosed . this was performed on clinical notes from 1,472 patients in which the nlp - based system correctly identified 92% of recurrences.16 the area of medical informatics that implements nlp has strong roots in the domains of knowledge engineering and management . knowledge engineering has been defined as the process of building tools for programing automation , including advances in machine learning , data analysis , rule induction , and analytic learning algorithms.17 in our isoa , our focus has been on collection from trainees and oversight by the attending physician . we have considered four primary concerns : ( 1 ) content management , ( 2 ) classification , ( 3 ) summarization , and ( 4 ) evidence - based tools . however , because of the numerous effort and ubiquity of proposed automated tools , we aim to incorporate the use of automated tools once they can achieve consistent results that approach 90% precision and recall.18 cmss are technologies that support the collection and management of published content . for literature , cmss are used to store adobe systems portable document format ( pdf ) files and potentially share this software . this includes both free and commercial packages such as endnote , ref - manager , mendeley , qiqqa , and quosa among many more reference management software.19 the first two , endnote and refmanager , have roots in desktop software and are purchasable by those who have financial resources . mendeley , qiqqa , and quosa are supported by premium options , such as space , sharing requirements , and/or are advertisement driven , and have a concern in the social sharing and citing of articles . all the above systems are superb for the management of content ( pdfs ) and highlighting . these tools are designed mainly for managing large libraries of resources , but currently do not have sufficient summarizing and classification / indexing tools within and across articles that we seek to achieve in our limes . in informatics , classification can usually be referred to as indexing.20 medline indexers are employees who are required to have at least a bachelor s degree in a biomedical science.21 a few university centers and the national library of medicine among others have put efforts into nlp tools for indexing . hliaoutakis , in 2009 , was able to demonstrate algorithmic improvements over the mmtx indexing package in speed and accuracy , using a c - value / nc - value method with the amtex package.22 however , both these software programs rely heavily on the publically available packages , such as metamap , medline and other important umls libraries.15 moreover , the nlm has been tasked to and continues to improve their own indexing tools23 on a daily basis and continues to surpass many other indexing engines in the medical domain to our knowledge . text summarization ( ts ) methodology includes work by luhn going as far back as 1958.24 more recently , ts has been applied successfully to the medical field.23,25,26 some additional current research in biomedical domains includes investigative work using abstractive - oriented and extractive paradigms.26 presently , evidence- based clinical services such as upto - date are all that attending physicians have available to them for current evidence - based reviews . these services provide clinical topical reviews written by recognized physicians who provide evidence - based reviews with recommendations . there continues to be daily proliferation of new journal articles and internet digests that describe emergent health issues . unfortunately , physicians and researchers have limited ways to ensure that they remain up to speed on this changing information . in the past , this was strictly done by browsing abstracts . however , current methods of updating their knowledge include google searching and/or the use of evidence - based services . all the three methods ( browsing abstracts , google searching , and evidence - based services ) while having some benefits for searching also have some pitfalls . we have provided a limited review of the literature on automation , as it in large part motivates our design . if one could create a mineable limes service , then other clinical investigators could build upon that work . however , we are focused on the isoa as a method to provide a systematic support for literature management . automation , while having the potential of extreme benefit , has only partial or limited efficiency in terms of language processing ; extracting medical problems from narrative text still continues to evolve . regardless , human experts still have to rank and rate automation services as well as provide training data even to evaluate the efficacy of automation . we believe that the development and use of this isoa can assist in the education of our medical trainees . we are inspired by several targets that , despite the attempts of some evidence - based services , remain unmet in the status quo.11 these unmet challenges in literature management and informatics include the failure to recognize an information need , physicians not being prepared for where a particular field may be heading and a preference for choosing the most convenient clinical paths rather than most appropriate choices . users are further hindered by the excessive time and effort required to find answers to appropriate questions from resources , the difficulty of navigating overwhelming bodies of literature , and the inadequacy of current literature search technologies . our goal is to construct a literature informatics management education system ( limes ) for implementation in an academic teaching hospital . unfortunately , organization and knowledge collection , such as what we are attempting to do with our limes , are unfortunately often relegated to cinderella roles , assumed to be automatic to perform and often difficult to measure . thus , we have chosen to focus on a small but emergent literature set , for which our case includes the use and role of imaging for hpv head and neck cancers , which is the primary interest and expertise of our institution . the proposed limes not only archives the articles , but also employs a newly recommended technique to systematically summarize and categorize content in a digital repository that is semantically mineable . another compounding challenge is the organization of information across different departmental clinical teams ( eg , diagnostic radiology , radiation therapy and otorhinolaryngology ) . the idea is to lay down what is considered as known and what is not known in the current published literature on hpv - hnscc imaging and have multiple disciplines represented in the literature management process . because of physician time constraints , we also seek to potentially share the burden of search , summarization , categorization , and organization with medical trainees . unfortunately , to our knowledge , the study / discussion of data collection by individuals is often not , if ever , described in published literature . yet , the process of reading and reviewing in research , as well as learning how best to do these things , is often a very cumbersome process . for example , ely has described how there appears to be a trend of increasing time demands on clinicians and less time to find literature resources.12 coumou and meijman have described systematic methods by which primary care physicians search for answers to clinical questions.13 they describe how physicians often first choose to consult colleagues whom they know well.13 this practice of asking colleagues has not changed much in recent years , despite the proliferation of electronic publications made available worldwide . physicians in the past had limited options for finding answers , sometimes reduced to only the use of an intermediary person such as a librarian.13 in this work , we propose , and have tested , a structured approach that generates clinical roadmaps and potential pearls from abstract information found in hpv head and neck cancer literature , using what we have called information service oriented architecture ( isoa ) . essentially , we use an isoa to break down the application functions of a large organization into a set of interoperable services . in our case , trainees , ie , medical school or premedical school students , will evaluate and structure the elements into our content management system ( cms ) prior to review by attending physicians . much of the focus on automated content extraction from literature management centers is on natural language processing ( nlp).14,15 nlp methods are most effective when they have a wide body of open literature to train on . in medicine , a successful nlp - based program was able to examine electronic clinical notes in women with early - stage incident breast cancers and identify whether and when recurrences were diagnosed . this was performed on clinical notes from 1,472 patients in which the nlp - based system correctly identified 92% of recurrences.16 the area of medical informatics that implements nlp has strong roots in the domains of knowledge engineering and management . knowledge engineering has been defined as the process of building tools for programing automation , including advances in machine learning , data analysis , rule induction , and analytic learning algorithms.17 in our isoa , our focus has been on collection from trainees and oversight by the attending physician . we have considered four primary concerns : ( 1 ) content management , ( 2 ) classification , ( 3 ) summarization , and ( 4 ) evidence - based tools . however , because of the numerous effort and ubiquity of proposed automated tools , we aim to incorporate the use of automated tools once they can achieve consistent results that approach 90% precision and recall.18 cmss are technologies that support the collection and management of published content . for literature , cmss are used to store adobe systems portable document format ( pdf ) files and potentially share this software . this includes both free and commercial packages such as endnote , ref - manager , mendeley , qiqqa , and quosa among many more reference management software.19 the first two , endnote and refmanager , have roots in desktop software and are purchasable by those who have financial resources . mendeley , qiqqa , and quosa are supported by premium options , such as space , sharing requirements , and/or are advertisement driven , and have a concern in the social sharing and citing of articles . all the above systems are superb for the management of content ( pdfs ) and highlighting . these tools are designed mainly for managing large libraries of resources , but currently do not have sufficient summarizing and classification / indexing tools within and across articles that we seek to achieve in our limes . in informatics , classification can usually be referred to as indexing.20 medline indexers are employees who are required to have at least a bachelor s degree in a biomedical science.21 a few university centers and the national library of medicine among others have put efforts into nlp tools for indexing . hliaoutakis , in 2009 , was able to demonstrate algorithmic improvements over the mmtx indexing package in speed and accuracy , using a c - value / nc - value method with the amtex package.22 however , both these software programs rely heavily on the publically available packages , such as metamap , medline and other important umls libraries.15 moreover , the nlm has been tasked to and continues to improve their own indexing tools23 on a daily basis and continues to surpass many other indexing engines in the medical domain to our knowledge . text summarization ( ts ) methodology includes work by luhn going as far back as 1958.24 more recently , ts has been applied successfully to the medical field.23,25,26 some additional current research in biomedical domains includes investigative work using abstractive - oriented and extractive paradigms.26 presently , evidence- based clinical services such as upto - date are all that attending physicians have available to them for current evidence - based reviews . these services provide clinical topical reviews written by recognized physicians who provide evidence - based reviews with recommendations . there continues to be daily proliferation of new journal articles and internet digests that describe emergent health issues . unfortunately , physicians and researchers have limited ways to ensure that they remain up to speed on this changing information . in the past , this was strictly done by browsing abstracts . however , current methods of updating their knowledge include google searching and/or the use of evidence - based services . all the three methods ( browsing abstracts , google searching , and evidence - based services ) while having some benefits for searching also have some pitfalls . we have provided a limited review of the literature on automation , as it in large part motivates our design . if one could create a mineable limes service , then other clinical investigators could build upon that work . however , we are focused on the isoa as a method to provide a systematic support for literature management . automation , while having the potential of extreme benefit , has only partial or limited efficiency in terms of language processing ; extracting medical problems from narrative text still continues to evolve . regardless , human experts still have to rank and rate automation services as well as provide training data even to evaluate the efficacy of automation . we believe that the development and use of this isoa can assist in the education of our medical trainees . hpv - hnscc is an emerging field that was brought to our attention by several of our attending physicians . dr . alleman is the bob g. eaton chair in radiological sciences and is boarded by both the american board of radiology and american board of otolaryngology as well as serves on several national radiation therapy oncology group ( rtog ) trials . dr . chance matthiesen is an assistant professor of medicine and radiation oncologist at the university of oklahoma health sciences center and serves as a scientific reviewer for various national journals . gynecological cancer is a prime concern in oklahoma , and the university of oklahoma has five board - certified gynecologic oncologists and currently in a national cancer institute endorsed clinical trial site . to obtain the medical articles for our research , hpv head and neck cancer as our search terms , which gave us 2187 articles . because we wanted to focus on the imaging of hpv+ hnscc , we added imaging to our original search criteria and ended up with an initial of 22 articles that matched our search . one of these articles was not currently available in english and the other focused on hpv+ head and neck cancer in animals . note , however , that as of may 2014 , performing the same search now produces 37 results that could be potentially useful for a second study . our first goal was to find appropriate trainees because they were essential to the task . medical students are extremely busy studying for board examinations and other tests , and there is very little time to work on research projects . our team felt that , as time was limited , the limes system would be easier to implement with less - formalized training and could be performed more on - the - job . for example , learning mesh terms and controlled vocabulary would likely go beyond the time commitments possible for physicians to manage and potentially for the trainees to perform . our early estimate was a time commitment of about 1020 hours per attending physician and about a 2040 hours commitment for students to perform this work . both may seem to be small numbers for researchers , but in reality had to fit into an academic hospital schedule of practicing clinical physicians . for this project , we employed one medical student and one pre - medical student . we assessed their ability to understand a selected set of 20 medical articles about hpv - hnscc imaging . to evaluate the performance of the isoa we defined an item in each cell of a spreadsheet ( it represents one block of text ) . additionally , topic accuracy ( multi ) is when there are multiple topics for a single item . the trainees each created a chart for each of the 20 articles . within each tab , the trainee placed information extracted from each article that they deemed to be of significance , as well as rewriting the text they extracted from the article into simpler terms and then categorizing this information using our clinical classification schema ( fig . 1 ) . the attending physicians graded the work of the trainees using these spreadsheets and the information provided in table 2 . this table represents the 12 specific questions the attending physicians used to grade the trainees work . the items that the table refers to are specific cells within the spreadsheets that relate to the 12 questions the attending physicians used for their grading . the 12 questions are broken down into three different categories : ( 1 ) item - level questions , ( 2 ) topic - level questions , and ( 3 ) article - level questions . . this could be the actual text that was extracted directly from the article or the condensed version of that same text . the attending physicians graded the trainees in the five classification areas : classification accuracy , sub - classification accuracy , multiple classification accuracy , classification introduction ( adding a new classification to our clinical classification schema ) , and classification educational value . these questions relate to each article , specifically determining their importance toward improving the knowledge of hpv - hnscc literature and the educational benefit for trainees . finally , for the entire project , attending physicians would then select the most relevant clinical pearls27 among the abstracted text from both an instructional and those having informatics value . pearls that could be used to help future clinicians / researchers follow the field . our clinical pearls represent the data that were extracted from the 20 original articles and found to be important by the trainees . the attending physicians , when reviewing the articles , narrowed these pearls into a smaller expert opinion pearl list . represent key information that is deemed helpful by physicians for other physicians toward the demographics , role of imaging , and key therapeutic information . as seen , our two trainees scored an average of 4 ( top 20% ) on the eight questions that were numerically based . questions 8 and 9 were qualitative , not quantitative , so there was no statistical information to collect . since questions 11 and 12 were answered once per article , their statistical data are not of value . figure 3 illustrates trends from several of the questions , revealing visible relationships between trainees 1 and 2 . we noted that there appeared on average some reasonable agreement at least on the item level ; this seems to become much weaker at the classification level of questions ( classification - level assessment appears to be less consistent than item - level assessment ) . finally , because of the low number of trainees and physician mentors , only one of the instrument questions appeared to have a low statistical correlation value of 0.2254 . alleman from diagnostic radiology and matthiesen from radiation oncology ) who are managing real medical trainees to curate and create a resource on hpv and head and neck cancer . this work is less concerned with the significantly more complex task of reducing the textual extraction to automation tools . this isoa relies on a small group of early career professionals and trainees , overseen by senior attending physicians , to collect , manage , and organize this information . we believe that our isoa is a feasible solution , as we have shown it to work successfully within the confines of a clinical environment . additionally , it is mainly resourced by medical students and attending physician experts who do not require extensive technical training . however , based on the feedback from our attending physicians , we have already considered future steps . our physician reviewers provided these actual responses prior to the entire team finally assembling to reflect and summarize our results as a community . alleman shared the following : the area of hpv and hnscc and imaging is a very dynamic body of literature that is diversified between radiology , head and neck , radiation therapy , and with ties to gynecological cancer , epidemiology , and even immunology . so , this is a diverse and dynamic body of literature that is difficult for a single individual to assimilate . alleman , is exposure and training for informatics provided to medical students and pre - medical students . according to our radiation oncologist expert , dr . matthiesen , the student summarizations were accurate and of use , but the selection of information to include in the summary needs work . however , the project showed the students often struggled to grasp the main concepts of many articles . i would attribute this likely to lack of general knowledge of the disease and lack of exposure . because of this , more advanced radiation oncology residents or fellows might be better suited as test subjects in a future project for the categorization portion of the isoa . in summary , we have concluded that initiating a repository with pre - medical students and medical students is feasible at the item level . summary accuracy for each item is consistent and accurate enough to be useable by our attending physicians . however , more experienced students , or additional preparation or training , may be needed prior to the second phase . perhaps , a second phase could include integration with medical residents / fellows who can also benefit from this exercise . in the long run , we sought to engage critical thinkers on the topic of hpv and head and neck cancer and prioritized efforts to recruit these physicians to participate in the mentorship of students . however , physician time is understandably focused on the direct care of patients , and this fact limited the participation of a large number of mentors in this project . we do believe that an isoa could be designed to fit even the hectic schedules of physicians due to its simplicity and the large amounts of potential users . additionally , we hope such a tool can better communication of information between different departments such as radiation oncology and the radiology . this work has the potential to be extended not just at single institution , but also to provide a training method for future generations of medical professionals in this emerging issue . we are limited by our focus on emergent literature , and so may not necessarily provide a method that is targeted for research involving large numbers of publications , but we feel that it is timely and necessary to plan and implement a multicenter trial . because of the low overall prevalence of hpv - hnscc case studies , such tools may be helpful for greater efficiency of clinical trial design . both physicians and our team agree that the creation of enduring content is one of the biggest benefits , as it is a snapshot in time that can be built upon by future informatics and knowledge workers , whether they expand this directly in their medical practice or organize these data as training material for future automatic processes in natural language processing constructs .
### Summary: : this work examines the feasibility and implementation of information service - orientated architecture ( isoa ) on an emergent literature domain of human papillomavirus , head and neck cancer , and imaging . from this work , we examine the impact of cancer informatics and generate a full set of summarizing clinical pearls . additionally , we describe how such an isoa creates potential benefits in informatics education , enhancing utility for creating enduring digital content in this clinical domain .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : although regional anesthesia offers advantages for intraoperative and postoperative pain relief , it is not without complications.1,2 the majority of complications associated with peripheral nerve blocks are due to local anesthetic toxicity after inadvertent intravascular injection.3 however , there are many other well known complications . the increasing use of ultrasound guidance for , eg , intraneural or intravascular injections , may reduce some of these risks , although not completely eliminate them . postoperative management of peripheral nerve blocks , and cohesive standardized steps to prevent complications have received little attention . a case of a significant burn injury after splint placement it is our hope that this case alerts physicians and others involved in the management of postoperative patients to the challenges of managing a blocked extremity after thermal cast placement . a 62-year - old woman weighing 61 kg presented for an elective modified right mcbride bunionectomy , right first metatarsal osteotomy , and right second hammertoe correction . she previously underwent the same surgery for a left hallux valgus deformity , and did very well without complications under regional and general anesthesia . preoperatively , at approximately 11:40 am on the day of surgery , popliteal and saphenous nerve blocks were administered for postoperative analgesia . the skin was anesthetized with 5 ml of 1% lidocaine . under ultrasound guidance , a 22-gauge 3.5-inch spinal needle was inserted , and 40 ml of 0.25% bupivacaine with 1:200,000 epinephrine was injected incrementally , with aspiration every 5 ml , 30 ml in the popliteal region , and 10 ml in the saphenous region . the surgery went as planned , with no complications , and the total tourniquet time was approximately 120 minutes . at the conclusion of surgery at approximately 2:30 pm , a soft padded bulky jones dressing was placed over the lower extremity with a plaster posterior splint ( bsn medical specialist ) . the temperature of the water was noted to be warm , but no exact temperature was recorded . the splint was folded over slightly at the edge of the splint near the posterior knee . her stay in the postanesthesia care unit was uneventful until approximately 3:30 pm , when she complained of 6/10 pain in her foot . it was noted in the nurse s notes that she had difficulty localizing the pain and was given hydromorphone 0.4 mg . when this did not relieve her pain , the anesthesiologist was called , and it was decided to touch up her block . at 1605 , popliteal nerve and saphenous nerve blocks were performed using the aforementioned technique , with 20 ml and 10 ml of 0.25% , respectively . she developed adequate analgesia and was discharged from the postanesthesia care unit at 5:24 pm with 0/10 pain . she presented to the orthopedic clinic on postoperative day 3 with severe pain in the lower extremity . the splint and dressing were removed to reveal a partial third degree burn on the posterior lower leg ( figure 1 ) which eventually required a skin graft ( figure 2 ) . follow - up with the patient after her recovery from the second surgery revealed no further problems or long - term pain conditions . it decreases postoperative mortality caused by thromboembolic disease and myocardial infarction , improves postoperative analgesia , decreases the incidence of early postoperative cognitive dysfunction , and allows shorter recovery times.1,2 however , there are well known complications , including local anesthetic toxicity , infection , hematoma , nerve damage , and , depending on the area blocked , pneumothorax , hemothorax , and respiratory failure.5 certain situations and surgeries bring additional challenges to regional anesthesia , such as thermal cast placement applied to a blocked extremity . cast application techniques are known to prevent burn injuries4,6 but , as with any procedure , mistakes still occur . internal temperatures can reach > 50c with a fast curing plaster cast , and it has been found that > 49c is enough to cause significant burn injuries.6 unfortunately , the pain of a burn injury from a thermal cast can be masked in a patient with a blocked extremity . peripheral nerve blocks for orthopedic procedures are now becoming commonplace , so increasing awareness of this possible complication to prevent such injuries is needed . for patient safety , our institution focuses on leg elevation , moving noninjured digits of the affected limb , and monitoring pulse oximetry to test perfusion of the extremity , but little temperature related . one study measured the internal temperature using a simple temperature sensor ( temp sensor thermistor 400 series ; tyco healthcare , harrisburg , pa ) and found it to be adequate for evaluating the skin under plaster cast burns.7 this may be a simple technique to evaluate a blocked extremity with a cast . subjective evaluation of the temperature of the cast by touching or measuring the external temperature is open to individual interpretation , and could introduce too much variability and inaccuracy based on the layering present and type of cast used . any complaint of pain should be thoroughly investigated by the nursing staff in the postoperative anesthesia care unit , with special consideration given to avoiding thermal injuries , and temperature measurements of the skin should be done prior to the administration of opioids . the anesthesiologist should be notified early about pain in these patients , should participate in the evaluation , and be mindful of the possibility of thermal burns occurring in the setting of postoperative regional blockade . it may be necessary to alert the surgeon , and strong consideration should be given to possible removal of the plaster material to assess for thermal injury . this case is illustrative of the fact that , even in the setting of regional blockade , there may be other reasons for what could be perceived as a failed regional blockade , and additional opioids and/or touch up nerve blocks should not be done without a thorough evaluation of the plaster cast and underlying skin . while this case involves a competent , awake adult female , it does prompt consideration of the possibility that other patient populations may be at greater risk for this complication due to inability to provide appropriate feedback and communicate possible breakthrough thermal - mediated pain . these patient populations include children and the elderly , who may not be able to communicate , and patients who have been heavily sedated . the risk - benefit of performing regional blockade should be assessed prior to undertaking this procedure . regarding the casting material used , in this case the bsn medical specialist synthetic splint ( bsn medical distribution ltd , brierfield , uk ) , there are generalized precautions that include the warning to the patient that the splint may feel warm . there are no published precautions regarding the use of this material in conjunction with peripheral nerve blocks.8 it is not known with certainty if the cast used in our patient was too hot , too thick , or if it was adequately padded . the patient certainly complained of increased pain in the postanesthesia care unit which resulted in an additional block leading to this poor outcome . there were no indicators that the patient failed to receive adequate blockade , so this breakthrough pain was likely related to unrecognized ongoing thermal injury . communication with nursing staff , as well as other anesthesiology colleagues , is important when a cast is placed on a blocked extremity to alert those involved in caring for the patient with a splint or cast of the possibility of thermal injury . the best method to assess for possible thermal injury is not known , but certainly the evaluation should begin early , and involve both the anesthesiologist and the surgeon . this could save patients from the debilitating complication of a burn injury , and improve our postoperative strategies .
### Summary: : although regional anesthesia offers advantages for intraoperative and postoperative pain relief , it is not possible without complications . a case of a significant burn injury after splint placement is described after a peripheral nerve block was performed for postoperative pain management . it is our hope that this case alerts physicians and others involved in the management of postoperative patients to the challenges of managing a blocked extremity after thermal cast placement and offers solutions that can be standardized .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : conventional cancer treatments , such as tumor - targeting radiotherapy and systematic chemotherapy , mainly target the observable mass of tumor cells . however , the origin of cancer , that is , the origin of the first tumor cell and the subsequent sustained tumor growth and renewal , remains elusive . the two main models that have been proposed for cancer development are the stochastic model , and the hierarchical model ( figure 1 ) . in theory , cscs follow the latter model , which suggests that tumors are hierarchical in structure and heterogeneous in nature . in this model , a subpopulation of cells ( cscs ) are said to exhibit high self - renewal capacity and differentiation potential , giving rise to daughter cells with less potential , hence sustaining tumor development . the core stem cell - like properties commonly recognized among cscs in different types of cancer include the ability to self - renew , the potential to differentiate and give rise to daughter cells , the capacity to sustain tumor propagation in serial transplantation , and the exhibition of drug resistance , , . these stem cell - like biological features suggest that cscs are likely to be responsible for the initiation , propagation , and dissemination of metastatic tumor cells and the survival and relapse of tumors . the tumor - initiating role of cscs also makes them remarkable targets for cancer therapy research . since the identification of cscs in leukemia , there has been a plethora of studies on identifying cscs in solid tumors , such as ovarian cancer , renal carcinoma , head and neck squamous cell carcinoma , and bladder cancer . direct evidence of tumor regeneration from csc populations has been demonstrated in studies using genetic tracing , and linear tracing . a considerable number of publications have also been published on csc research in npc . tumors arise from an event , such as a mutation , in a certain cell that enables the cell to out - grow other subpopulations , which leads to clonal selection . b , however , the hierarchical model suggests that there is heterogeneity among the cells and that only subpopulations with high clonogenic potential are able to develop into a tumor mass with the same parental composition . the hierarchical model and the stochastic model may not necessarily be contradictory , as mutations and clonal selection may still occur within the hierarchical model . c , the concept of cscs follows the hierarchical model in that only a certain subpopulation of cells possesses sufficient potential to propagate and give rise to a tumor with the original composition . in the past few years , numerous studies have sought to identify and characterize the csc subpopulation in ebv - associated npc cell lines and primary tumors . a variety of conventional approaches used to examine npc cscs were examined in these studies . the expression of potential csc and embryonic stem cell ( esc ) markers in the cell lines and primary tumors were analyzed by multiparameter flow cytometry and immunohistochemical staining , respectively , . the anchorage - independent sphere - forming tumor cells or sphe - roids were isolated as a functional subpopulation with csc properties , . these experimental methods aimed to determine whether the target tumor cell population exhibited the commonly recognized properties of a csc population . by using fluorescence - activated cell sorting ( facs ) based on the hoechst 33342 efflux , wang et al . were the first group to demonstrate the existence of a csc side population ( sp ) in npc cell lines . however , sp cells were detected in 0.7%-6.8% of ebv - negative npc cell lines whereas the ebv - positive c666 - 1 cells contained only a scant amount of sp cells ( 0.1% ) . because the ability of sp cells to efflux out of cells is based on the atp - binding cassette ( abc ) subfamily g , member 2 ( abcg2 ) , the low expression of abcg2 in cscs may be responsible for the sparse sp in the ebv - associated npc cell line . our recent study showed that there was an absence of abcg2 up - regulation in either the cd44 or sphere - forming cells in c666 - 1 cells . in 2 npc cases , immunohistochemical staining showed relatively higher abcg2 expression in recurrent tumors than in corresponding primary tumors . nevertheless , this study did not provide sufficient evidence of the usefulness of abcg2 as a csc marker in npc . a strategy for using the sp approach to enumerate and isolate cscs in ebv - associated npc is still needed to further elucidate a panel of primary tumors . cscs in various solid tumors were successfully isolated and characterized using cell surface markers , such as cd24 , cd44 , cd90 , cd117 , and cd133 . among these markers , cd44 is a prominent antigen found in cscs in ebv - positive npc . as a hyaluronan receptor , cd44 was shown to be a csc marker in head and neck squamous cell carcinoma and has been shown to be an important molecule for anti - metastasis therapy . in the ebv - positive npc cell line c666 - 1 , the cd44 cscs in npc were demonstrated to have the exclusive ability to self - renew , differentiate , and initiate tumors in vivo and were shown to have higher resistance to 5-fluorouracil ( 5-fu ) treatment , . these findings provide solid evidence for the existence of cancer stem cells in ebv - associated npc . using flow cytometry analysis , approximately 8%-20% cd44 cells were detected in c666 - 1 cells and patient - derived xenografts . because identifying the precise csc subpopulation is crucial for further characterizing their properties and developing effective csc - targeting therapies , cd44 alone may not be sufficient to define this specific subpopulation . accordingly , a combination of cd44 with esc transcription factors may help to delineate the precise csc subpopulation . to elucidate the role of esc transcription factors in npc cscs , the expression of multiple esc transcription factors was examined in sphere - forming cells and the cd44 subpopulation . transcription factors such as octamer - binding transcription factor 4 ( oct4 ) and nanog are essential for maintaining the pluripotent phenotype of escs . these esc cd44 npc cscs were found to be enriched in transcription factors oct4 , nanog , and sex - determining region y ( sry)-box 2 ( sox2 ) . sox2 was found expressed mostly in cd44 cells , whereas less than 5% of cd44 cells expressed sox2 . sox2 is a member of the sry - related high mobility group transcription factor family and is crucial for promoting and maintaining pluripotency in embryonic and adult tissue - specific stem cells . the enriched expression of sox2 in cd44 npc cells suggests this subpopulation of cells possesses pluripotent potential . furthermore , human npc primary tumor cells expressing esc markers were also shown to be able to form secondary tumors in mouse models . cscs expressing the esc markers sox2 , oct4 , nanaog , and nestin were also found located at the invasive front in npc , which were associated with the disease aggressive behavior ( t , n , m classification and clinical stage ) and patient survival . aldehyde dehydrogenase isoform 1 ( aldh1 ) is another recognized marker of cscs , such as those in breast cancer . in our study on sphere - forming cells , significant enrichment of aldh1 expression notably , the aldh1 cells isolated from the c666 - 1 cell line demonstrated csc properties . coincidentally , strong aldh1 expression was detected at the npc invasive front , which was associated with the expression of epithelial - to - mesenchymal transition ( emt)-related biomarkers . in addition , aldh1-expressing cscs demonstrated strong association with npc tumor budding , disease aggressiveness , and poor patient survival . in addition to these markers , several cell surface markers including c - c chemokine receptor type 7 ( ccr7 ) and cd109 were found to be highly up - regulated in the sphere - forming cells using a microarray assay . ccr7 is a chemokine receptor that mediates cell migration in response to its ligand ccl21 , whereas cd109 is a glycosyl - phosphatidylinositol - anchored glycoprotein that inhibits tumor growth factor-1 ( tgf-1)-induced growth . the enrichment of the ccr7 and cd109 cell populations in the sphere - forming cells was confirmed by flow cytometry . importantly , the sphere - forming ability of npc cells was abolished after treatment with the ccr7-blocking antibody . the role of ccr7 as a new surface marker of npc cscs is currently being validated . the complex interplay between ebv and genetic aberrations in nasopharyngeal epithelial cells during tumor initiation and progression poses great challenges to npc research . our earlier studies demonstrated that several genetic aberrations were involved in the initiation of npc , which were suggested to predispose these npc cells to subsequent ebv infection . in ebv - associated npc and precancerous lesions , the persistence of the clonal ebv genome indicated that ebv latent infection facilitated tumor initiation and the transformation of nasopharyngeal epithelial cells , . recent studies have suggested that ebv - encoded proteins could induce stem cell - like properties in epithelial cells. in some precancerous lesions , it was also noted that ebv - infected cells only occur in or immediately adjacent to the basal layer of the nasopharyngeal epithelia . it has been speculated that npc originates from clonal ebv - infected basal stem cells . therefore , modulating or maintaining the stem cell properties may be a critical function of ebv in npc initiation . the significant increase in the copy number of ebv dna and the expression of ebv latent genes in isolated npc cscs further support this hypothesis . all ebv - infected npc cells exhibit type ii latency , with the expression of epstein - barr virus nuclear antigen 1 ( ebna1 ) , lmp1 , lmp2a , epstein - barr virus - encoded small rnas ( ebers ) , barts , and a number of ebv - encoded micrornas ( mirnas ) , . among these latent genes , lmp1 encodes a viral oncoprotein , which is responsible for altering multiple cellular mechanisms and signaling pathways in host cells . there is increasing evidence that lmp1 plays a role in acquiring the properties of stem cell - like or progenitor - like cells in npc . it is well known that lmp1 induces emt via twist family bhlh transcription factor 1 ( twist ) or snail family zinc finger 1 ( snail ) in npc cells . recently , kondo et al . demonstrated that lmp1-mediated emt induced the cd44 cd24 phenotype and the self - renewal properties of nasopharyngeal epithelial cells . furthermore , the special at - rich binding protein 1 ( satb1 ) up - regulated by lmp1 may contribute to cancer stemness by mediating the proper stem cell differentiation and negatively regulating the pluripotent genes . in an early study , lmp1 was proposed to induce a cancer progenitor cell ( cpc)-like rather than a csc - like phenotype due to the lack of induction of pluripotent stem cell - like genes ( e.g. , oct4 and nanog ) in lmp1-expressing nasopharyngeal epithelial cells . however , a recent study reported the induction of a sp and some csc markers such as oct4 , nanaog , b - cell - specific moloney murine leukemia virus insertion site 1 ( bmi-1 ) , and sox2 in the ebv - negative npc cell line expressing lmp1 as shown in figure 2 , lmp1 gene is highly expressed in a small subpopulation of cells in most ebv - positive npc cell lines and primary tumors . to clarify whether lmp1 induces the csc or cpc phenotypes , in addition to lmp1 , lmp2a is suspected to induce cscs in ebv - positive npc due to its function in altering the notch and hedgehog ( hh ) signaling pathways . the predominant lmp2a expression at the invasive tumor front also suggests that it plays a role in promoting tumor invasion and recurrence . demonstrated that lmp2a expression up - regulated the stem cell markers bmi1 , nanog , and sox2 and increased the size of the sp in ebv - negative npc cell lines . notably , the overexpression of lmp2a induced emt and stem - like characteristics in these cells . furthermore , the predominant expression of lmp2a at the invasive tumor front also suggested its role as a marker of csc and for predicting npc progression . ebv , epstein - barr virus ; lmp , latent membrane protein ; ccr7 , c - c chemokine receptor type 7 ; oct4 , octamer - binding transcription factor 4 ; sox2 , sex - determining region y ( sry)-box 2 ; abc , atp - binding cassette ; abcg2 , atp - binding cassette subfamily g , member 2 ; abcc3 , atp - binding cassette subfamily c , member 3 ; abcc11 , atp - binding cassette subfamily c , member 11 . in addition to the ebv latent genes , several stem cell - related pathways such as the notch and hh pathways were found to be involved in the survival and functioning of npc cscs . the notch signaling pathways are not only important in normal development , cell fate determination , and stem cell renewal , they also play a crucial role in tumorigenesis and contribute to the csc functioning in various cancer types . in npc , an early study demonstrated that a subpopulation of npc cells in primary tumors co - expressing sox2 and oct4 were involved in an activated notch1 pathway , with increased expression of the downstream effector molecule hes1 . in our study , notch3 was found to be consistently overexpressed in npc tumor cells and to be responsible for cisplatin resistance . the silencing of notch3 in npc demonstrated the suppression of stem cell - like properties such as oct4 expression , spheroid formation , and in vivo tumorigenicity . this finding implies that notch3 is a potential therapeutic target for the depletion of cscs in npc . the antitumor effects of notch receptor - specific antibodies and recombinant notch3 peptides have been demonstrated in multiple studies. integrating these targeting agents into the current therapeutic strategies may greatly enhance the outcomes for npc patients . notch4 has been identified as a crucial regulator in breast cscs , and its inhibition was shown to abolish tumor initiation . however , the functional roles of notch4 in npc cscs have yet to be elucidated . the hh signaling pathway is implicated in the maintenance of stem cells and is commonly dysregulated in ebv - associated npc . unlike notch3 signaling , the hh signaling pathway is activated by ebv through autocrine induction of the sonic hedgehog ( shh ) ligand . port et al . demonstrated that the ebv - encoded lmp1 and lmp2a proteins induced the expression of various stemness - related gene products ( bmi1 and sox2 ) and stem cell surface markers ( cd44v6 and cd133 ) via activation of the hh signaling pathway . consistent with these findings , our study also noted that the expression of gli family zinc finger 1 ( gli1 ) , an effector of the hh signaling pathway , and the ebv latent genes were enriched in npc cscs . these findings reveal the detailed mechanisms of ebv - induced csc phenotypes in npc . in npc , lymph node metastasis according to the csc theory , metastasis involves the migration of cscs from the original site to a distant organ . for chemotaxis of cells to occur , chemokine receptors are required to be present on chemotactic cells along with chemokines in the microenvironment . among the plethora of chemokines , ccr7 was shown to be related to lymph node metastasis in several types of cancers. as mentioned above , the up - regulation of ccr7 expression was found in npc cscs and may mediate cell migration in response to its ligand ccl21 in lymph nodes , . in addition to enhancing lymph node metastasis , ccr7 is crucial for the survival of cscs . we found that the blocking of this receptor with a neutralizing antibody resulted in a significant reduction in the sphere - forming ability of c666 - 1 cells . in addition to ccr7 , we noted that the chemokine ( c - x - c motif ) ligand 8 ( cxcl8 ) was highly up - regulated in the csc subpopulation . using the inhibitor of cxcl8 or its receptor cxcr2 , the contribution of cxcl8 and cxcr2 in the tumor sphere - forming properties via the phosphatidylinositol 3 kinase ( pi3k)/akt signaling pathway in npc c666 - 1 cells was determined . these findings indicate the important roles that chemokine - mediated signaling plays in the maintenance of cscs in npc . aberrant mirna expression is a key post - transcriptional regulatory mechanism in the tumorigenesis process . it has been reported that mir-200a contributes to the epithelial - mesenchymal to stem - like transition in npc cells via the targeting of zinc finger e - box - binding homeobox 2 ( zeb2 ) and catenin ( cadherin - associated protein ) , beta 1 ( ctnnb1 ) . the inhibitory effect of mir-200a expression on the properties of stem - like cells , including tumor sphere formation and in vivo tumorigenicity , and on stem cell marker expression was demonstrated in ebv - positive c666 - 1 cells . using the microrna microarray , we also noted the significant repression of multiple stemness - repressing mirnas , such as mir-96 and mir-183 , in the sphere - forming cells ( unpublished finding ) . these findings suggest that mirnas play a functional role in regulating the properties of cscs in ebv - associated npc . the failure to eradicate drug - resistant cscs has been proposed to be the core reason for tumor relapse after treatment , . the drug - resistant properties of cscs have been shown to be due to the overexpression of abc transporters , which are responsible for the efflux of therapeutic drugs , . abc transporters have been shown to be overexpressed in other cscs , such as abcb5 in hepatocellular carcinoma ( hcc ) cscs . in npc cscs , several abc transporters , such as atp - binding cassette subfamily c , member 3 ( abcc3 ) and abcc11 , were found to be highly up - regulated . furthermore , the cd44 npc cscs , which are resistant to cisplatin and doxorubicin , exhibited overexpression of abcc3 and abcc11 . these findings suggest that the overexpression of these abc transporters is responsible for the drug resistance in npc cscs . notably , abcc11 directly induces resistance to 5-fu , which is a main chemotherapeutic drug for treating npc patients . the overexpression of abcc11 in npc cscs may reduce the survival of this subpopulation during 5-fu treatment and lead to future tumor relapse . the resistance of npc cscs to radiotherapy was demonstrated in a study on the therapeutic potential of a mutant vesicular stomatitis virus ( vsv51 ) for treating ebv - positive npc . the vsv51 effectively eradicated the sphere - forming cells in multiple ebv - positive npc models and greatly enhanced their sensitivity to treatment with ionizing radiation . interestingly , depletion of the stem cell - associated gene bmi-1 was also found to significantly sensitize npc cells to radiation . furthermore , the aberrant signaling pathways ( e.g. , notch3 and pi3k / akt ) may promote the survival of the csc subpopulation in npc . because cscs resist the conventional treatments for npc , the development of novel therapies targeting cscs may provide an efficient strategy for improving patient outcomes . although few studies have investigated the targeting of the cscs in ebv - positive npc , the encouraging findings demonstrate its potential as a new clinical intervention for npc patients . as mentioned above , notch3 inhibition and the vsv51 treatment greatly enhanced the efficiency of chemotherapy and radiotherapy , respectively , in the in vitro and in vivo ebv - positive npc models , , . at13387 , a heat shock protein 90 ( hsp90 ) inhibitor , is currently undergoing clinical trials for treating various human cancers . a recent study demonstrated its potential effect in targeting the csc subpopulation in ebv - positive npc . the at13387 treatment effectively inhibited the formation of tumor spheres , reduced the expression of csc markers , and suppressed in vivo tumorigenicity of c666 - 1 cells . recently , short hairpin rna ( shrna ) approach has been used to target bmi-1 and enhance the radiotherapy sensitivity of cd44 npc cscs . thus , a similar shrna approach can be used to suppress csc - related makers and signaling molecules. notably , the loss of phosphatase and tensin homolog deleted on chromosome ten ( pten ) gene can lead to the emergence and proliferation of csc clones and reveal the potential of therapeutic targeting of tumors that lack pten expression . a similar treatment strategy can be used for npcs showing reduced ib kinase ( ikk ) expression . these findings provide preclinical evidence supporting the use of csc - targeting agents as novel drugs for the systematic treatment of npc . further elucidation of the inhibitors of the signaling pathways associated with cscs , such as the notch , wnt , and hh signaling pathways , or shrna targeting csc markers , including ccr7 and cd44 , are necessary for the development of efficient therapeutic approaches for treating npc . the application of antisense strategies for npc therapeutics has been of particular interest , especially the potential therapeutic approach in targeting ebv genes in npc . studies have demonstrated that the suppression of lmp1 in c666 - 1 cells resulted in the inhibition in tumor cell motility , adhesion , and transmembrane invasion ability , whereas the suppression of lmp2a in c666 - 1 cells resulted in the inhibition in cell proliferation and colony formation . these findings further confirmed that ebv - encoded lmps are potential therapeutic targets for ebv - associated malignancies . a recent study demonstrated that the radiosensitivity of npc was increased by using dnazyme 1 ( dz1 ) , a deoxyribozyme that was specifically designed to target lmp1 mrna . dnazyme is a small , in vitro selected dna enzyme that targets on rna substrates . shed light on the clinical use of targeting lmp1 by dnazyme in treating npc patients . ebv latent infection is not only a critical molecular event in the initiation of non - keratinizing tumors . its appearance in all tumor cells suggests that it also plays an essential role during the development of npc . the identification of the cscs in ebv - associated npc cell lines reveals that their phenotype is distinct from that in ebv - negative cell lines . the involvement of csc properties in nasopharyngeal epithelial cells by ebv - encoded lmp1 and lmp2a proteins implies that the induction and maintenance of the csc subpopulation is an important role of ebv in npc tumorigenesis . nevertheless , the precise role of ebv in cscs still needs to be demonstrated in more ebv - positive npc models or primary tumors . in most npc cases , lmp1 and lmp2a characterizing the csc properties of the subpopulations with high expression of lmp1 and lmp2a proteins may provide direct evidence of the role of ebv . furthermore , in addition to unveiling the unique features of cscs in npc , studies demonstrated that the targeted csc subpopulation have the potential to greatly enhance the efficiency of conventional radiotherapy and chemotherapy in the in vitro and in vivo models . however , only a few preclinical studies on csc - targeting agents have been conducted for ebv - associated npc . more therapeutic agents or inhibitors targeting the csc - associated signaling pathways need to be elucidated in preclinical studies and clinical trials involving npc patients . we envision that collaboration between clinicians and scientists in the fields of ebv , npc , and stem cell biology will facilitate the quest for a complete cure of npc .
### Summary: : although the epstein - barr virus ( ebv ) has spread to all populations in the world , ebv - associated nasopharyngeal carcinoma ( npc ) is prevalent only in south china and southeast asia . the role of ebv in the malignant transformation of nasopharyngeal epithelium is the main focus of current researches . radiotherapy and chemoradiotherapy have been successful in treating early stage npc , but the recurrence rates remain high . unfortunately , local relapse and metastasis are commonly unresponsive to conventional treatments . these recurrent and metastatic lesions are believed to arise from residual or surviving cells that have the properties of cancer stem cells . these cancer stem - like cells ( cscs ) have the ability to self - renew , differentiate , and sustain propagation . they are also chemo - resistant and can form spheres in anchorage - independent environments . this review summarizes recent researches on the cscs in ebv - associated npc , including the findings regarding cell surface markers , stem cell - related transcription factors , and various signaling pathways . in particular , the review focuses on the roles of ebv latent genes [ latent membrane protein 1 ( lmp1 ) and latent membrane protein 2a ( lmp2a ) ] , cellular micrornas , and adenosine triphosphate ( atp)-binding cassette chemodrug transporters in contributing to the properties of cscs , including the epithelial - mesenchymal transition , stem - like transition , and chemo - resistance . novel therapeutics that enhance the efficacy of radiotherapy and chemoradiotherapy and inhibitors that suppress the properties of cscs are also discussed .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the demons - meigs syndrome should usually be evoked in case of presence of a typical triad : abdominopelvic mass , ascites and hydrothorax . a 32-year - old woman presented in april 2012 to the emergency department of our maternity unit ( general hospital , thiers , france ) with an abdominal distension mimicking the symptoms of a pregnancy at term . physical examination revealed a voluminous painful abdominopelvic mass , extended from the pelvis to the upper abdomen with a large right pleural effusion . ultrasound and computed tomography showed it was a tumor measuring more than 300 mm in diameter with a right hydrothorax . cytologic analysis of the pleural effusion did n't show any malignant cells . in this study , a laparoscopico - laparotomic management permitted an aspiration of 23 liters of a brownish liquid and an unilateral adnexectomy after pleural paracentesis was performed . the postoperative course was uneventful . serum ca-125 level was normal at the time of the reoperation and 24 months after the initial surgery . the preoperative recognition of a demons - meigs syndrome or a demons pseudosyndrome is essential to avoid useless surgical procedures . the demons - meigs syndrome should usually be evoked in case of presence of a typical triad : abdominopelvic mass , ascites and hydrothorax . demons was the first , between 1887 and 1902 , who indicated that removal of the tumor ( benign ovarian cyst , solid ovarian tumor , fibroma of the broad ligament ) was essential for the patient to be cured from effusions ( 1 , 2 ) . in 1937 however , the physiopathology of the ascites and the hydrothorax still remain obscure ( 1 ) . hydrothorax is present in only 1% of the cases and is mostly unilateral right - sided ( 2 , 3 ) . ascitic and pleural fluids are similar in nature ( exudative or transudative ) . the circumstances of discovery are variable and can be related to the consequences of the triad syndrome ( weight gain , abdominal pain , respiratory distress ) the serum ca-125 level is not specific and does not always increase ( 6 ) . preoperative biologic ( chemistry and cytologic study ) and radiologic findings ( ultrasound , computed tomography scan and magnetic resonance imaging ) can be highly accurate in diagnosis ( origin of the mass , no signs of distant metastases ) and surgical management strategy ( 47 ) . this preoperative recognition should be considered in the differential diagnosis and appears essential to prevent the realization of unnecessary surgical procedures . final histologic findings which exclude malignancy and complete and definitive remission after surgery confirm this particular syndrome . for brun , demons syndrome should include benign genital tumors , the demons - meigs eponym must be reserved for the description of ovarian fibromas and granulosa cell tumors , and the demons pseudosyndrome for all other entities ( 1 ) . in this case report , the large ovarian tumor with right hydrothorax and elevated serum ca-125 level indicated a demons - meigs syndrome . the final histologic findings demonstrated demons pseudo - syndrome which is an unusual situation when it 's related to a borderline ovarian tumor ( 8) . surgical management consisted of a bilateral salpingo - oophorectomy with hysterectomy in postmeno - pausal women or unilateral ( salpingo- ) oophorectomy in young patients with desire for pregnancy ( 1 , 4 ) . a 32-year - old - woman was referred in april 2012 to the emergency departement of our maternity unit ( general hospital of thiers , france ) for probable pregnancy at term with beginning of labor . the condition staretd 9 months before by the occurrence of progressive abdominal distension , dyspnea and secondary amenorrhea . physical examination revealed a voluminous painful abdominopelvic mass , diffuse , extending from the pelvis to the upper abdomen and large right pleural effusion ( figure 1 ) . on vaginal examination , it was difficult to relate the mass to any obstetrico - gynecologic origin . ultrasound showed a liquid predominant tumor measuring more than 300 mm in diameter and no pregnancy . thoraco - abdominal ct - scan showed a right hydrothorax , confirmed the abdominopelvic mass which filled all the peritoneal cavity without signs of distant metastases or lymphadenopathy ( figures 24 ) . serum ca-125 was 289 u / ml and ace was normal . given the importance of dyspnea , pleural paracentesis ( 250 ml ) was performed preoperatively . the chemistry and cytologic study of the pleural effusion was in favor of an exsudate without any suspected malignant cells . the aspiration of 15 liters of a brownish liquid permitted a midline laparotomy of limited size , under and above the umbilicus . the aspiration was completed ( 23 liters ) and a right ovarian cyst was identified ( figures 5 , 6 ) . the uterus , the controlateral ovary , the bladder and the pelvic peritoneum were macroscopically normal . a right adnexectomy was performed and a frozen section pathologic exam demonstrated benign mucinous cystadenoma . the postoperative course was uneventful and the patient was discharged 5 days after the procedure . the final histologic examination objectified intracystic intestinal type ovarian mucinous borderline tumor which corresponded to a demons pseudosyndrome . after multidisciplinary consultation , the patient was re - operated a month later for a staging surgery . the exploration did n't reveal any suspected lesions and multiple biopsies , an appendectomy and an omentectomy were performed by laparoscopy . serum ca-125 level was normal at the time of the re - operation and 24 months after the initial surgery . preoperative appearance of the abdominal distension scout view of the abdominopelvic mass thoracic axial ct - scan showing a right pleural effusion abdominal axial ct - scan showing a voluminous ovarian cyst ( white arrow ) extraction of the abdominopelvic mass macroscopic view of the ovarian tumor an abdominopelvic mass associated to ascites , hydrothorax and elevated ca-125 serum level can imitate an advanced ovarian cancer . nevertheless , a demons - meigs syndrome or a demons pseudo - syndrome should be suspected when faced with a negative cytologic analysis of the ascitic and pleural effusion and no peritoneal implant on ct - scan .
### Summary: : backgroundthe demons - meigs syndrome should usually be evoked in case of presence of a typical triad : abdominopelvic mass , ascites and hydrothorax . its diagnosis appears crucial to prevent the realization of unnecessary surgical procedures.case presentationa 32-year - old woman presented in april 2012 to the emergency department of our maternity unit ( general hospital , thiers , france ) with an abdominal distension mimicking the symptoms of a pregnancy at term . physical examination revealed a voluminous painful abdominopelvic mass , extended from the pelvis to the upper abdomen with a large right pleural effusion . ultrasound and computed tomography showed it was a tumor measuring more than 300 mm in diameter with a right hydrothorax . serum ca-125 level was 289 u / ml . cytologic analysis of the pleural effusion did n't show any malignant cells . in this study , demons - meigs syndrome was recognized . a laparoscopico - laparotomic management permitted an aspiration of 23 liters of a brownish liquid and an unilateral adnexectomy after pleural paracentesis was performed . frozen section demonstrated benign mucinous cystadenoma . the final histologic findings objectified intracystic intestinal type ovarian mucinous borderline tumor . after multidisciplinary consultation , the patient was re - operated one month later . the exploration did n't reveal any suspected lesions and appendectomy and omentectomy were performed . the postoperative course was uneventful . serum ca-125 level was normal at the time of the reoperation and 24 months after the initial surgery.conclusionthe preoperative recognition of a demons - meigs syndrome or a demons pseudosyndrome is essential to avoid useless surgical procedures .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the common cold ( gn mo ) or common acute upper respiratory tract infection , is an acute viral infectious disease of the upper respiratory tract caused by rhinovirus , human coronavirus , parainfluenza virus , adenoviruses , respiratory syncytial virus , etc . symptoms which often appear , such as sore throat , stuffy or runny nose , cough , and malaise , are usually worse in 13 days and can last 710 days , and sometimes as long as 3 weeks . the disease affects adults approximately two to three times / year and children under the age of 2 years , approximately six times / year . it is estimated that direct medical costs in the united states , including physician visits , secondary infections , and medications for colds , were an estimated $ 17 billion / year in 1997 . indirect costs from missed work for illness or to look after a sick child were an estimated $ 25 billion / year . because there are no effective antivirals to cure the common cold and few effective measures to prevent it , treatment should focus on symptom relief . the most commonly used treatments include over - the - counter antihistamines , decongestants , cough suppressants , and expectorants . treatment of the common cold in traditional chinese medicine ( zhng y ; tcm ) is based on pattern differentiation . according to the tcm theory , the common cold is considered as an exterior syndrome , which can be further divided into the wind - cold type ( fng hn xng ) , the wind - heat type ( fng r xng ) and the summer heat dampness type ( sh r xng ) . the most common type of common cold often caught in winter and spring is the wind - cold type . for thousands of years , chinese people have treated the wind - cold type common cold with natural herbs , some of which were quite simple , effective , widely used by folk ordinary people , and were called folk prescriptions . however , physical conditions of patients with the wind - cold type are different , i.e. , some are normal and others are weak . therefore , treatment should be chosen inaccordance with the patient 's individuality according to the tcm theory . this article introduces some chinese folk prescriptions ( zhng gu mn jin ch fng ) for the wind - cold type common cold with in patients with normal and weak physique . the typical wind - cold type common cold with normal physique , which is the majority of the wind - cold type common cold , is characterized by a history of catching cold , feeling cold , and nasal congestion with clear snivel ( b s li qng t ) . treatment for the wind - cold type common cold with normal physique includes expelling wind dispersing cold ( q fng sn hn ) and relieving exterior syndrome by diaphoresis ( f hn ji bio ) . the following are some recommended chinese folk prescriptions , many of which contain ginger ( shng jing ) , an acrid and warm herb relieving exterior syndrome in tcm and also an edible food in china . ginger combined with scallion stalk ( cng bi ) and brown sugar ( hng tng ) : 30 g of sliced ginger , 10 g of scallion stalk , and approximate 200 ml of water are put into a pot . then , the pot is heated softly by a fire until the decoction inside the pot is boiled . after that , add 100160 g of brown sugar into the decoction for a better taste . drink the warm decoction ( shu jin f ) two to three times daily until the cold is cured . scallion stalk and ginger : 10 g scallion stalks and 10 slices of ginger are put into a pot , immersed in water , and boiled for a while . drink the warm decoction and lie down with covered with a quilt until sweating ( ch hn ) . ginger and brown sugar : three slices of ginger and an appropriate amount of brown sugar are put into a cup and stewed with boiling water . alternatively , 15 g ginger and 30 g brown sugar are put into a pot , immersed in water , and decocted . the warm decoction can be drunk frequently . garlic ( d sun ) and ginger : 15 g garlic and 15 g ginger are processed and taken in by the same way mentioned above for scallion stalk and ginger . fermented soybean ( du ch ) stewed with scallion stalk and ginger : scallion stalks with roots ( di x cng bi ) 30 g , three ginger slices , and 10 g fermented soybean are put into a pot , immersed in water , and boiled . then , 30 g yellow wine ( hung ji ) is poured into the pot . pepper ( h jio ) and scallion stalk : half a pepper and three grams scallion stalks are processed by the same way mentioned for scallion stalk and ginger . orange peel ( j p ) , ginger , and brown sugar : orange peel and ginger , both 15 g , are processed by the same way mentioned above for scallion stalk and ginger . ginger , tea ( ch ) , brown sugar , and vinegar ( c ) : two pieces of ginger , 3 g tea , 10 g brown sugar , and 10 ml vinegar are put into a cup , and then brewed with boiling water for 5 minutes . the upper liquid can be drunk three times daily . hot noodle soup with white pepper ( bi h jio ) powder and scallion stalk : a bowl of hot noodle soup is cooked , and appropriate amounts of white pepper powder and scallion stalk are added to it . eat the noodle while it is hot and lie down covered with a quilt . after sweating , the cold is cured . simple decoction 1 : radix saposhnikoviae ( fng fng ) , schizonepeta ( jng je ) , peucedanum praeruptorum ( qin h ) , radix bupleuri ( chi h ) , rhizoma et radix notopterygii ( the rhizome and root of notopterygium incisum ting ex h.t . chang or notopterygium forbesii boiss ; qing hu ) , platycodon grandiflorum ji gng ) all 10 g , fructus aurantii ( the unripe fruits of citrus aurantium l. ; zh sh ) 5 g , and ligusticum wallichii ( chun xin ) 3 g are decocted together with water . simple decoction 2 : schizonepeta 10 g , perilla leaf ( z s y ) 10 g , tea 6 g , and ginger 6 g are decocted together with water . the decoction can be used to treat the wind - cold type common cold especially characterized by headache , fever , and a stuffy nose . simple decoction 3 : the mixture , which consists of honey ( fng m ) and ginger juice at a ratio of 1:1 , can be taken to treat the common cold without type differentiation according to the author 's opinion . however , honey and ginger are warm heat ( wn r ) according to tcm , so the mixture is actually more suitable to treat the wind - cold type cold . in weak patients with the wind - cold type common cold , their syndrome includes poor appetite ( sh y b zhn ) , fatigue ( f l ) , spontaneous sweating ( z hn ) , fear of wind ( wi fng ) , and recurring cold besides the syndrome mentioned in the beginning of the last part . treatment for the wind - cold type common cold with weak physique are relieving the exterior syndrome by replenishing qi ( y q ji bio ) , and supplement vacuity by support right ( f zhng b x ) . dietary therapies ( sh lio ) are often added to the treatment . here several decoctions are recommended . jade wind - barrier powder ( yupingfeng powder ; y png fng sn ) : yupingfeng powder is a well - known ancient prescription invented by wei shilin , a famous physician in the yuan dynasty . the prescription including radix astragali ( hung q ) , atractylodes macrocephala koidz ( bi zh ) , and radix saposhnikoviae was also used to treat weak patients with the wind - cold type common cold . radix astragali - crucian decoction ( hung q j y tng ) : the decoction is composed of crucian 150 g , radix astragali 15 g , atractylodes macrocephala 6 g , and radix saposhnikoviae 3 g. radix astragali , atractylodes macrocephala , and radix saposhnikoviae , which are actually three components of yupingfeng powder mentioned above , are decocted together , then crucian is added into the decoction and decocted until boiling . after that , scallion and ginger are added and decocted with soft fire until the fish is cooked . debility in old age ( nin lo t shui ) , with the wind - cold type common cold will be cured . purple perilla ( z s ) porridge : 50 g of rice are put into a pot , with water added , and cooked . when the porridge is nearly cooked , 10 g of perilla leaves are added . the purple perilla porridge is specified for weak patients with the wind - cold type common cold . scallion stalk porridge : three to five scallion stalks and 100 g of rice are stewed together to cook porridge . eat the porridge when it is warm . the porridge is suitable for aged weak people with the wind - cold type common cold . for thousands of years , chinese folk prescriptions ( zhng gu mn jin ch fng ) for the common cold ( gn mo ) , as complementary and alternative medicine ( cam ; b chng y t di y xu ) , have been proven to be effective . similarly , cam products such as andrographis paniculata ( kalmcold ; chun xn lin ) , echinacea purpurea , and pelargonium sidoides ( geranium ) extract ( umcka coldcare ) were reported effective for the common cold in adults . they are also convenient , cheap , and most importantly , safe ; some of them are even daily edible foods such as ginger , scallion stalk , and porridge , i.e. , there are no obvious untoward reactions compared with the abovementioned treatments like over - the - counter drugs . chinese folk prescriptions for the wind - cold type common cold are quite suitable for general practitioners or patients with the wind - cold type common cold to treat the disease . of course , their pharmacological features and mechanisms of action need to be further studied .
### Summary: : although self - limiting , the common cold ( gn mo ) is highly prevalent . there are no effective antivirals to cure the common cold and few effective measures to prevent it , however , for thousands years , chinese people have treated the common cold with natural herbs , according to the traditional chinese medicine ( tcm ) theory ( zhng y l ln ) , the common cold is considered as an exterior syndrome , which can be further divided into the wind - cold type ( fng hn xng ) , the wind - heat type ( fng r xng ) , and the summer heat dampness type ( sh r xng ) . since the most common type of common cold caught in winter and spring is the wind - cold type , the article introduced some chinese folk prescriptions for the wind - cold type common cold with normal and weak physique , respectively . for thousands of years , chinese folk prescriptions for the common cold , as complementary and alternative medicine ( cam ; b chng y t di y xu ) , have been proven to be effective , convenient , cheap , and most importantly , safe . the chinese folk prescriptions ( zhng gu mn jin ch fng ) for the wind - cold type common cold are quite suitable for general practitioners or patients with the wind - cold type common cold , to treat the disease . of course , their pharmacological features and mechanisms of action need to be further studied .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : mycoses of the glabrous skin are predominantly triggered by dermatophytes , while members of the trichophyton genus , including trichophyton rubrum , are among the most commonly diagnosed fungal pathogens in poland . raubitschekii are usually found in africa , southeast asia , australia and south america [ 1 , 2 ] . in recent years , however , there have been a few cases in germany and italy ; hence , the pathogen should be considered as undoubtedly present in europe [ 3 , 4 ] . to date , there has been no described case of an infection caused by this pathogen in poland . a 34-year - old polish caucasian male was admitted to the dermatology clinic of the poznan university of medical sciences due to the presence of an erythematous , exfoliating , clearly distinct lesion located on the index finger of the right hand , spreading onto surrounding areas ( figs . 1 , 2).fig . 1side of the index finger hospital admission datefig date of the second sample acquisition during the follow - up appointment at the department of medical mycology , poznan university of medical sciences side of the index finger date of the second sample acquisition during the follow - up appointment at the department of medical mycology , poznan university of medical sciences the first signs of the disease had appeared in august 2012 , after a contact with raw fish the patient is a cook . due to a suspicion of erysipeloid , the patient underwent an antibiotic therapy ( intravenous clindamycin , 2 600 mg daily , for the period of 5 days ) coupled with steroids administered topically . a swab for bacteriological , skin biopsy for histopathological and a sample for mycological examinations were acquired . other examinations , such as the mycological culture and histopathology , were awaited for during the stay of the patient at the clinic . due to the lack of significant improvement , the patient was discharged , while any further procedures were performed on an outpatient basis at the dermatology counseling service of the clinic . the results of the histopathological examination indicated a widened , swollen epidermis with a thickened stratum granulosum and a thick stratum corneum , in which there were numerous , round , fungal spores of 2.5 m in diameter ( figs . 3 , 4 ) . due to discrepancies in the results , a second sample for mycological examination was acquired during a follow - up appointment . 3a thickened , swollen epidermis . a thick stratum corneum with numerous pathogenic fungi . moderate , mixed inflammatory infiltrates present in the dermis . hematoxylin and eosin stain , objective lens magnification : 10fig . hematoxylin and eosin stain , objective lens magnification : 60 a thickened , swollen epidermis . a thick stratum corneum with numerous pathogenic fungi . hematoxylin and eosin stain , objective lens magnification : 10 numerous spores in the stratum corneum . hematoxylin and eosin stain , objective lens magnification : 60 itraconazole ( daily dose 100 mg ) was administered orally . the mycological cultures were maintained for 20 days at 25 c on two kinds of media : sabo sabouraud dextrose agar with chloramphenicol and sabo sabouraud dextrose agar with chloramphenicol and actidione . a fungal colony with a reddish brown color and a brownish reverse , strongly furrowed , suede - like surface and a raised center 6 ) . a urease test , carried out on christiansen s medium , and dermatophyte test medium examination were both positive . since the strain matched the original description , it was identified as t. rubrum var . a 20-day - old colony grown on sabouraud agar mediumfig . 6 trichophyton rubrum var . raubitschekii . microscopic image ( magnification 400 , lactophenol cotton blue ) . raubitschekii . microscopic image ( magnification 400 , lactophenol cotton blue ) . numerous macro- and microconidia the following 3 weeks brought a further improvement in the dermatological status ( fig . it was decided to continue the itraconazole treatment while the topical drug was switched to a pyridinone derivative . the patient received itraconazole for a period of 2 months , yet due to low tolerance to the topical drug , the pyridinone derivative was no longer administered . afterward , the patient showed no signs of the infection.fig . 7 top of the right hand after 3 weeks of itraconazole treatment top of the right hand after 3 weeks of itraconazole treatment in order to reassess the diagnosis , we analyzed a ribosomal rna genomic fragment and the urease gene of this isolate as described by hiruma et al . . because the isolate ceased to grow on any new media , we isolated its dna from a plate deposited for long - term storage at our clinic . one hundred and twenty milligrams of the colony was acquired from the deposited agar plate and ground in liquid nitrogen . dna was isolated with the use of the column - based genematrix plant & fungi dna purification kit ( eurx , poland ) that includes both rnase a and proteinase k. firstly , we analyzed a fragment containing partial 18s rrna gene , its1 , 5.8s rrna gene , its2 and partial 28s rrna gene with the use of common its1 and its4 primers for pcr and sequencing . pcr was performed with the following ingredients : 25 pmol of its1 and its4 primers each , 0.5 l of faststart taq dna polymerase ( 2.5 u , roche ) , 10 l of 5 gc - rich solution , 5 l of 10 pcr buffer with 20 mm mgcl2 , 1 l of dntps ( 10 mm each ) , 5 ng of dna sample , all in a volume of 50 l . pcr was performed with the following program : pre - denaturation4 min , 95 c ; amplification35 [ denaturation : 1 min , 95 c ; annealing : 1 min , 55 c ; elongation : 1 min , 72 c ] ; cooling : 1 min , 40 c . gel electrophoresis and paired - end sequencing revealed a 692-bp - long fragment , presenting a 100 % coverage with multiple genbank t. rubrum entries and with our own t. rubrum reference strain . secondly , urease gene fragment was amplified by pcr with the following ingredients : 25 pmol of trure1s and trure1r primers each , 0.5 l of faststart taq dna polymerase ( 2.5 u , roche ) , 10 l of 5 gc - rich solution , 5 l of 10 pcr buffer with 20 mm mgcl2 , 1 l of dntps ( 10 mm each ) , 0.5 l of dmso , 5 ng of dna sample , all in a volume of 50 l . touchdown pcr was performed with the following program : pre - denaturation4 min , 95 c ; amplification35 [ denaturation : 1 min , 95 c ; annealing 1 min , 6963 c , step size 0.5 c , step delay 0 ; elongation : 1 min , 72 c ] ; cooling1 min , 40 c . gel electrophoresis revealed that the product was approximately 330 bp long , suggesting a urease - positive t. rubrum rather than t. rubrum var . , the genomic sequence of a raubitschekii urease amplicon should also include a 68-bp intron and a 9-bp - long coding insertion ( ddbj ab719058 , cbs 100084 ) . this analysis revealed a sequence of 329 bp ( including primers ) presenting a 100 % coverage with xm_003233873 ( t. rubrum cbs 118892 urease ( terg_05790 ) mrna ) and with the corresponding genomic sequence ( nw_003456423.1 , gene i d : 10376003 ) . both the 68-bp intron and the 9-bp insertion , specific to the cbs 100084 raubitschekii strain , were missing . based on these results , it is more likely that the isolate was , in fact , a urease - positive t. rubrum.fig . 8gel electrophoresis of the urease gene pcr amplicon . left lane approximately 329-bp fragment , right lane puc19 dna / mspi marker ( fermentas ) gel electrophoresis of the urease gene pcr amplicon . left lane approximately 329-bp fragment , right lane puc19 dna / mspi marker ( fermentas ) initially , it had been described as a separate species trichophyton raubitschekii [ 5 , 9 ] , yet molecular studies revealed it to be a variant of t. rubrum [ 4 , 8 ] . it was described to differ from other t. rubrum variants by a limited growth , reddish brown color , the presence of numerous macro- and microconidia and the ability to produce urease [ 5 , 8 , 10 ] . noteworthy , the polish taxonomic key in operation states that the urease activity is the criterion for differentiation between t. rubrum var . the characterization of urease - positive t. rubrum that are distinct from t. rubrum var . raubitschekii has clearly complicated the diagnostic process [ 2 , 7 ] . the vast majority of t. rubrum var . raubitschekii cases originate in asia , africa and south america [ 1 , 2 , 12 ] . furthermore , he did not claim contacts with anyone traveling to these regions , nor with people showing lesions that might be mycotic . furthermore , brasch et al . described a different german case , involving a 32-year - old male cameroonian student with well distinct , erythematous , exfoliating lesions located on the abdomen as well as on both hands . a culture grown on sabouraud medium at 26 c and a urease test led to the diagnosis of t. rubrum var . both the cameroonian and the described polish patients responded well to their oral itraconazole treatments . to date , there have been eight described cases in central europe . the described polish case is exceptional , as it appears not to be linked with africa in any way . cultures and urease tests were performed on samples originating from different parts of the skin of 95 greek and 10 bulgarian patients . the pathogen originated from lesions of tinea manuum ( one case ) , tinea corporis ( one case ) , tinea cruris ( one case ) and tinea unguium ( three cases ) . the group originated from and resided in greece and bulgaria at the time of the study . they all had not traveled to the aforementioned endemic regions nor abroad for the past 6 months . raubitschekii will probably become the method of choice for distinguishing between the quite alike urease - positive t. rubrum and t. rubrum var . the procedure is straightforward and can easily be modified for probe or melting curve assays . for the time being , it has to be approached with caution as only one t. rubrum var . raubitschekii isolate ( cbs 100084 ) has been analyzed in this way so far . at the moment , public whole genome sequencing projects include multiple t. rubrum and two t. rubrum var . the results of these projects may answer the question whether the urease allele of the cbs 100084 strain is the specific marker of all t. rubrum var . raubitschekii isolates , as suggested by hiruma et al . in the meantime , we encourage other researchers to reassess their t. rubrum var . rubrum , there seems to be a necessity of including both into the polish and other central european diagnostic schemes , as their identification obviously poses a challenge at the moment . moreover , it is noteworthy that the histopathological examination turned out to be very useful , if not necessary , in the diagnostic process . it enabled the adequate treatment to be implemented even before the results of the mycological cultures and molecular studies were available .
### Summary: : we report a case of a 34-year - old polish caucasian male who was diagnosed with tinea manuum caused by trichophyton rubrum var . raubitschekii . it would be the first described case of a dermatophytosis caused by this fungus in poland and one of a few cases in central europe described so far . admittedly , it would be the first case in central europe with no evidence pointing to african origin . the clinical condition improved after administering itraconazole ( daily dose 100 mg orally ) supplemented with a topical treatment , while the patient was totally cured after 2 months . the histopathological examination turned out to be highly useful in the diagnostic process . the genetic analysis of the urease gene pointed to a urease - positive t. rubrum rather than t. rubrum var . raubitschekii .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the drosophila melanogaster genome contains 15%20% of transposable elements ( tes ) ( hoskins et al . , 2002 ; kaminker et al . , uncontrolled activity of tes triggers defects in genome integrity due to dna breaks , insertional mutagenesis , and illegitimate recombination ( levin and moran , 2011 ; slotkin and martienssen , 2007 ) . this is particularly evident in the germline , where tes have evolved to be especially active but are suppressed by the pirna pathway . the pirna pathway is a small rna silencing system that is defined via the involvement of piwi family proteins bound to 2231 nt piwi - interacting rnas ( pirnas ) ( malone and hannon , 2009 ; siomi et al . , 2011 ) . defects in the pirna pathway allow overall development to occur , but emerging animals are sterile , presumably due to damage of their germ cell genomes ( klattenhoff et al . , 2007 ) . similar to other small rna pathways , the central players in the pirna pathway are argonaute proteins bound to small rnas that provide target specificity ( ghildiyal and zamore , 2009 ) . however , in contrast to the sirna and the mirna pathways , whose molecular frameworks are well described , nearly all aspects of the pirna pathway are poorly understood . in flies , most pirnas are derived from pirna clusters , large loci that contain high proportions of te sequences ( brennecke et al . , 2007 ) . pirna cluster transcripts are believed to be exported to the cytoplasm where numerous factors participate in the processes of pirna biogenesis and pirna loading into piwi proteins . most identified pirna biogenesis factors are enriched in distinct foci that are in proximity to the nuclear envelope ( yb - bodies in ovarian somatic cells and nuage in germline cells ) ( siomi et al . , 2011 ) . yb - bodies and nuage are tightly associated with mitochondria , and the essential pirna biogenesis factor zucchini is integrated into the outer mitochondrial membrane ( ipsaro et al . , 2012 ; after formation of pirna - induced silencing complexes ( pi - riscs ) , the identity of the involved piwi protein defines their respective fates . piwi - pirna complexes are transported into the nucleus , where they guide transcriptional silencing ( sienski et al . , 2012 ; wang and elgin , 2011 ; le thomas et al . , 2013 ; the two other family members , aubergine ( aub ) and ago3 , remain in the cytoplasm and are engaged in the ping - pong cycle , a pirna amplification loop that requires complementary rnas from tes and pirna clusters ( brennecke et al . the drosophila ovary contains two major cell types : germline cells derived from primordial germ cells and somatic support cells of mesodermal origin . both cell types silence tes by the pirna pathway , but the respective pathways differ considerably ( senti and brennecke , 2010 ; siomi et al . , 2011 ) . while somatic support cells express only piwi , germline cells also express aub and ago3 . ping - pong amplification and many factors involved in it are thus restricted to germline cells ( li et al . , 2009 ; malone et al . , motivated by the gaps in our understanding of the pirna pathway , we performed a genetic screen in the drosophila ovary for factors involved in the somatic pirna pathway . many identified genes could be grouped into functional categories , and these indicate the identification of key factors acting at all steps of the pathway , ranging from pirna cluster expression to cluster transcript export to pirna biogenesis and loading and finally to pirna - mediated silencing . our work will therefore serve as a key resource for the genetic and mechanistic dissection of this conserved genome defense pathway . the drosophila ovary consists of two major cell types ( somatic support cells and germline cells ) that harbor different pirna pathway versions ( figures 1a1c ) . though strong similarities exist between both pathways , it is unclear how distinct their genetic makeup is . having an effective transgenic rnai assay system for somatic pirna pathway activity at hand ( olivieri et al . , 2010 ) , we screened the set of genes expressed in somatic support cells for uncharacterized pirna pathway factors . we took advantage of a reporter construct that expresses -galactosidase ( -gal ) under control of the gypsy ltr ( figures 1d and 1e ; sarot et al . , 2004 ) . many pirnas isolated from ovaries or from cultured ovarian somatic cells ( oscs ) are complementary to this region and guide efficient reporter silencing in wild - type flies ( flamenco restrictive ) . flies harboring a functional pirna pathway but lacking the ability to produce gypsy complementary pirnas ( flamenco permissive ) exhibit strong reporter desilencing . similarly , knockdown of somatic pirna pathway components such as armitage ( armi ) , zucchini ( zuc ) , or vreteno ( vret ) in a flamenco restrictive background results in near loss of gypsy - derived pirnas and reporter desilencing ( handler et al . , 2011 ; olivieri et al . , 2010 ; saito et al . as the gypsy - lacz reporter assays the endpoint of the pirna pathway ( namely pirna - mediated silencing in trans ) , the screen should capture factors involved at all steps of the pirna pathway ( pirna cluster biology , pirna biogenesis , and pirna - mediated silencing ) ( figure 1c ) . to filter for genes with possible functions in the somatic pirna pathway , we determined the gene expression profile of oscs by rna - seq . oscs were derived from a somatic stem cell population of the germarium and express a functional pirna pathway ( niki et al . , 2006 ; saito et al . , 2009 ) . at a conservative cutoff ( 1 read per kilobase per 1 million sequenced reads [ rpkm = 1 ] ) , oscs express 7,257 genes , and all known somatic pirna pathway factors were well above this cutoff ( figure 1f ) . we used the collection of transgenic rnai lines from the vienna rnai center ( vdrc ) ( dietzl et al . , 2007 ) and screened two lines per expressed gene . for the primary screen , this resulted in a total of 12,804 crosses for 6,818 genes ( 94% of expressed genes ) . per cross , genes with at least one line exhibiting detectable reporter derepression were retested with all vdrc lines available for this gene ( figure 1 g ) . dissected ovaries from the secondary screen were mounted on glass slides , and -gal activity was determined using a classification scheme with six values ranging from strong to weak ( representatives shown in figure 1h ) . this resulted in 144 genes where at least one knockdown line led to detectable -gal activity ( table s1 ) . in addition to reporter activity , we classified overall ovarian morphology as wild - type , distorted , or rudimentary ( figure 1h ; table s1 ) . for an overall evaluation of the screen , we considered three questions : ( 1 ) what is the false negative rate ? ( 2 ) what is the false positive rate ? ( 3 ) how well does the gypsy - lacz reporter mirror derepression of endogenous tes ? the number of known genes acting in the somatic pirna pathway is limited ( n = 8) and not well suited for a false negative estimation . to determine the efficacy of vdrc rnai lines , we evaluated the ovarian morphology resulting from knockdowns of genes encoding for ribosomal proteins ( n = 83 ) . defective ribosome biogenesis results in a rudimentary ovary phenotype , and based on this , 83% of vdrc lines elicit efficient target knockdown ( figure 2a ) . as we typically tested two independent lines per gene , this resulted in a 92% positive rate at the gene level . consequently , the set of 663 genes resulting in rudimentary ovaries upon knockdown was highly enriched in basic cellular processes ( figure 2b ) . we observed a correlation between the rudimentary ovary phenotype and gene expression levels , with knockdowns of nearly 40% of the 700 most highly expressed genes preventing ovary development ( figure 2c ) . we conclude that transgenic rnai is potent in knocking down genes with very high mrna levels . as we also tested 358 genes below the rpkm cutoff of 1 , we can estimate that off - target effects are not prevalent in this screen , as only 0.8% of lines targeting these nonexpressed genes resulted in altered ovarian morphology . eight genes have been assigned to the somatic pirna pathway , and with the exception of the tdrd12 member soyb ( the available vdrc line is nonfunctional ) , all of these were identified among the top scoring candidates ( figure 2d ) ( haase et al . , 2010 ; handler et al . , 2011 ; malone et al . , 2009 ; olivieri et al . , 2010 , 2012 ; preall et al . , 2012 ; qi et al . , 2011 ; saito et al . , 2010 ; sienski et al . , 2012 ; zamparini et al . , we conclude that the screen identified most somatic pirna pathway factors whose knockdown results in analyzable ovaries . the false positive rate depends on the extent of the gypsy - lacz sensor being influenced only by the pirna pathway and also on the extent of screen artifacts such as off - targets . remarkably , only 2% ( 144 genes ) of all tested genes showed any -gal activity , and only 0.7% ( 49 genes ) showed activity in the range of known pathway members ( figure 2e ) . also , for the positive genes , we observed a correlation with expression levels ( figure 2f ) . this was , however , less pronounced compared to the morphology results ( figure 2c ) . importantly , very few of the weakly expressed genes and none of the 358 tested nonexpressed genes derepressed the reporter upon knockdown . to more , 2011 ) to reassess the screening results with independent knockdowns ( figure 2 g ) . out of 26 lines that could be analyzed ( four lines resulted in rudimentary ovaries ) , 21 ( > 80% ) confirmed the screen result . considering that not all shrna lines will be functional , rnai off - target effects can be considered to be very low in the screen . we performed rt - qpcr experiments on ovarian rna after knocking down each positively scoring gene in somatic follicle cells . we measured steady - state rna levels of -gal as well as of the endogenous retro - elements zam and gypsy , which are under control by the somatic pirna pathway . in all cases , the classification of -gal reporter activity correlated highly with the measured rna levels ( figure 2h ; table s2 ) . taken together , our analyses indicate a very high sensitivity and specificity of the screen . the existence of distinct pirna pathways in the ovarian soma and germline poses the question about their genetic similarities . we therefore tested the identified candidates from the soma screen for their involvement in germline te repression . we depleted screen candidates in the germline by transgenic rnai based on the nanos gal4 driver coupled to uas - dcr2 and vdrc lines ( handler et al . , 2011 ; wang and elgin , 2011 ) . to monitor pirna pathway integrity in germline cells this reporter expresses nuclear -gal under control of the nanos promoter and harbors a target sequence for burdock pirnas in its 3 utr ( figure 3a ) . the retro - element burdock is a prototypic germline te , as ovarian pirnas exhibit a pronounced ping - pong signature and are specifically found in germline cells but not in oscs ( figures 3a and 3b ) . burdock pirna levels are sensitive to loss of various germline pirna pathway factors ( figure 3c ) , and knockdown of pathway factors as diverse as ago3 , vreteno , and armitage strongly derepressed the sensor ( figure 3d ) . this suggested that the burdock sensor is a valid tool to monitor germline pirna pathway integrity . knockdown of any known major germline pirna pathway factor led to robust sensor activation ( figure 3e ) . even knockdown of candidates with moderate impacts on te silencing ( tudor , hen1 , cg9925 ) ( handler et al . , 2011 ; horwich et al . , 2007 ; nishida et al . , 2009 ) derepressed the sensor , albeit to lesser extents ( figure 3e ) . of note , every tested vdrc line targeting a validated germline pirna pathway factor was highly efficient in this system . we conclude that the germline knockdown system is very robust , allowing meaningful conclusions about the tissue specificity of identified pirna pathway factors . based on the burdock - lacz sensor , 26 factors scoring at least weak - intermediate in the screen also scored in the germline ( figure 3e ) . remarkably , 30 genes scored specifically in the somatic pirna pathway only . among these were some of the strongest scoring screen candidates , and several were validated via independent shrna lines ( figure 2 g ) . our results strengthen large similarities between the soma and the germline pirna pathways but also pinpoint significant differences . to substantiate the validity of burdock - lacz as an accurate proxy for germline pirna pathway integrity , we measured steady - state rna levels of the two germline - specific tes , het - a and burdock . we observed strong correlations with the burdock - lacz results ( figure 3f ; table s3 ) . knockdown of candidates strongly scoring in the germline derepressed endogenous tes to an extent that was highly similar to knockdowns of established germline pirna pathway factors . on the other hand , no significant changes in endogenous te levels were seen upon knockdown of factors that scored in the soma but not in the germline . taken together , our results define the set of common factors acting in the somatic and germline pirna pathways and provide genetic entry points to dissect the differences between the two pathways . reaching a similar status for the class of germline - specific factors would require a targeted germline screen as presented in the accompanying manuscript by hannon and colleagues ( czech et al . a comparison of all 144 screen hits to the set of 6,818 tested genes in respect to tissue gene expression profiles ( flyatlas , http://www.flyatlas.org ; chintapalli et al . , 2007 ) indicated that the expression of scoring genes was higher in ovaries and to a lesser extent in the larval cns compared to whole flies ( figure 4a ) . these results are in agreement with the pirna pathway acting specifically or preferentially in gonads . the set of 144 candidate pirna pathway genes was highly enriched for several functional gene ontology ( go ) terms ( figure 4b ) . 23% of all screen hits ( 38 genes ) could be annotated as mitochondrial proteins ( figure 4c ) . all of these derepressed the gypsy - lacz sensor only moderately and impacted ovarian morphology to varying degrees . based on rt - qpcr results , knockdown of identified mitochondrial factors increased the expression level of endogenous tes moderately but significantly ( figure 4d ) . as many other factors whose knockdown impaired oogenesis did not result in sensor activation , we conclude that mitochondrial integrity is important for full pirna pathway activity . interestingly , the essential pirna biogenesis factor zuc is an integral protein of the outer mitochondrial membrane , and pirna biogenesis is proposed to occur in close proximity to mitochondria . we note that knockdown of mitochondrial genes in the germline generally did not result in measurable burdock - lacz sensor derepression , suggesting that the somatic pirna pathway is more sensitive to mitochondrial malfunction . many of the significantly enriched categories ( figure 4e ) were linked to rna biology , nucleo - cytoplasmic transport , or chromatin biology . in combination with manual annotations , we propose the involvement of several functionally or genetically related gene groups in the pirna pathway ( figure 4f ) . in the cytoplasm , several factors required for pirna biogenesis ( yb , armi , vret , shu ) are enriched in yb - bodies , which are in direct vicinity of mitochondria ( szakmary et al . , 2009 ) . three factors with relationships to processing bodies ( gawky , pacman , patr-1 ) suggest a connection between the pirna pathway and p - bodies . notably , several pirna pathway factors colocalize with p - bodies in so - called pip - bodies in mouse male germ cells ( aravin et al . , 2009 ) , and yb - bodies have been observed in proximity to p - bodies in drosophila follicle cells ( olivieri et al . , 2010 ) . more intriguingly , we identified several factors with a nuclear function or that act at the interface between nucleus and cytoplasm . in each category , at least one factor was among the strongest - scoring candidates , and independent shrna lines validated several factors in each category . the two core exon junction complex ( ejc ) ( tange et al . , 2004 ) factors mago and tsunagi / y14 as well as the ejc accessory factors rnps1 and acinus scored strongly in the assay . the third core factor , eif4aiii , could not be analyzed due to a rudimentary ovary phenotype . all identified ejc factors also classified as essential pathway factors in the germline ( figure 3e ) , strongly implicating the ejc in pirna pathway biology . the central rna export factors small bristles ( nxf1 ) and nxt1 strongly derepressed the sensor . these factors are implicated in general mrna export , and ovarian morphology was distorted in the respective knockdowns . nevertheless , the extent of sensor and te derepression upon knockdown of these factors hints at a direct involvement of this protein complex , potentially at the level of pirna cluster transcript export . interestingly , nxf2 and nxf3 are specifically expressed in ovaries ( but not in oscs ) , and their knockdown in the germline results in te silencing defects ( unpublished observations ) , strongly substantiating the central importance of rna export processes in the pirna pathway . four nuclear pore complex factors ( nup54 , nup58 , cg11092 , nup214 ) and one accessory factor ( cg14749 ) scored in the screen . the two fg repeat proteins nup54 and nup58 were among the strongest - scoring candidates , and given that ovarian morphology was normal in the respective knockdowns , we postulate that an intricate and specific connection exists between the nuclear pore complex and pirna biology . all of these factors appear to be specifically involved in the soma pirna pathway ( figure 3e ) . our finding might relate to a recent study in germline cells that found pirna cluster loci specifically at nuclear pores to allow for specific and/or efficient coupling of pirna cluster transcription / export to the perinuclear pirna biogenesis machinery ( zhang et al . , 2012 ) . several strongly scoring factors are annotated to be involved in aspects of rna polymerase ii biology . for example , the identified factors atu , cg3909 , cg9915 , cg40228 , and tfiis are either annotated paf1 complex members or are linked to tfiis , a key factor required to rescue backtracked rna pol ii ( sims et al . , 2004 ) . these proteins might be involved in piwi - mediated transcriptional silencing . however , the group of factors with links to pol ii did not score in the germline . as piwi - mediated te silencing is unlikely to differ between somatic and germline cells , we favor the hypothesis that factors ensuring efficient pol ii activity are important for aspects of pirna cluster biology . flamenco , for example , is a locus that spans at least 180 kb of repetitive sequence , and all evidence suggests that it is transcribed from a single promoter . productive transcription through such a large locus might well require factors that reactivate backtracked polymerase . the soma - specific requirement of these factors suggests that transcription of germline pirna clusters differs from that of flamenco . this might relate to their bidirectional transcription and the specific requirement for rhino and cutoff for their transcription / processing ( klattenhoff et al . piwi - mediated silencing of tes occurs predominantly at the transcriptional level ( sienski et al . , 2012 ; wang and elgin , 2011 ; le thomas et al . , 2013 ; rozhkov et al . , , we identified several factors with chromatin - associated functions that might participate in this process . among these are the histone variant his2av , the histone chaperone asf1 , the h3k9 methyltransferase eggless and its cofactor windei , as well as others . of note , many genes identified in the screen do not belong to a functional category . among these , we chose cg2183 and cg9754 , two uncharacterized genes , for follow - up studies . knockdown of either gene in somatic follicle sells resulted in strong gypsy - lacz sensor derepression ( figure 5a , left ) as well as in derepression of the endogenous tes gypsy and zam ( figure 5a , right ) . the extent of te derepression was comparable to knockdowns of armi , an essential pirna biogenesis factor . we confirmed these findings with independent shrna transgenes ( figure 2 g , not shown ) . in oscs , sirna - mediated knockdown of cg2183 or cg9754 led to strong increases in rna levels of gypsy and mdg1 , both of which are pirna targets in this cell line ( figure 5b ) . both genes classified also as essential pirna pathway factors in germline cells . we based this on the burdock - lacz sensor results and rt - qpcr analyses of the germline - repressed tes het - a and blood ( figure 5c ) . overall , knockdown of these two genes resulted in highly similar defects in te repression . however , when analyzing the central effector protein piwi as well as pirna levels , clear differences between the two factors emerged . while depletion of cg2183 in follicle cells or germline cells resulted in a near loss of piwi , depletion of cg9754 had no detectable impact on piwi levels or localization ( figures 5d and 5e ) . multiple pirna biogenesis pathways feed into the three piwi family proteins in ovaries , complicating analyses of pirna biogenesis . we therefore probed for an involvement of cg2183 or cg9754 in pirna biogenesis in oscs , which exhibit only primary pirna biogenesis . judged by northern analysis , levels of mature pirnas were reduced to 25% upon cg2183 depletion but were unchanged upon cg9754 depletion ( figure 5f ) . this confirmed a 4-fold reduction of pirnas originating from annotated tes , as well as those originating uniquely from the flamenco cluster or from the traffic jam 3 utr ( figure s1 ) . cg9754 , on the other hand , is to our knowledge most probably an uncharacterized factor essential for the piwi - mediated silencing process . cells depleted for cg9754 exhibited nuclear piwi loaded with pirnas , yet the piwi - risc was not able to elicit efficient te silencing . in support for this , gfp - cg9754 localized to the nucleus ( where piwi - mediated silencing occurs ) while gfp - cg2183 localized to the cytoplasm ( where pirna biogenesis occurs ) both in oscs as well as in ovaries ( figures 5 g and 5h ) . both gfp transgenes include the respective endogenous regulatory regions . the gfp fusion proteins were clearly detectable in ovarian somatic and germline cells ( gfp - cg2183 was more abundant in germline cells ) in support of both proteins being essential pirna pathway factors in both pathways . the subcellular localization of gfp - cg2183 was highly reminiscent of mitochondrial patterns and of the reported zuc localization ( saito et al . , 2010 ) . in fact , ectopically expressed zuc - gfp and yfp - cg2183 in oscs exhibited an indistinguishable pattern that nearly fully overlapped with mitochondria ( figure 6a ) . also , in ovaries , zuc - gfp and gfp - cg2183 colocalized significantly with mitochondria ( figure s2 ) . when analyzing the zuc and cg2183 polypeptides with tmhmm ( sonnhammer et al . , 1998 ) , a prediction tool for transmembrane ( tm ) helices , a significant tm helix was predicted for the zuc n terminus ( saito et al . , 2010 ) and the cg2183 c terminus ( figure s2 ) . deletion of the respective tm helices resulted in a uniform distribution of both proteins in oscs ( figure 6b ) . this indicated that cg2183 is a transmembrane protein like zuc , most probably of the outer mitochondrial membrane . indeed , knockdown of cg2183 in the germline resulted in a loss of piwi , no change in aub localization , and a mild delocalization of ago3 from nuage , a pattern indistinguishable from the effects reported upon zuc knockdown ( figure 6c ) ( olivieri et al . , 2010 ) . to extend this analysis , we sequenced small rnas from ovaries with cg2183 germline knockdown and compared pirna populations to control as well as to zuc or armi knockdowns ( figure 6e ) . if compared to the respective control libraries ( normalized to mirna levels ) , pirna populations ( 2330 nt small rnas ) were reduced to 25% , 20% , or 23% upon knockdown of cg2183 , zuc , or armi , respectively . pirna populations mapping to the major germline pirna cluster 42ab collapsed nearly entirely in all three knockdowns ( figure 6e ) , while pirnas derived from the soma - specific flamenco cluster were essentially unchanged , in agreement with the knockdown being germline specific . the similarities in pirna populations from cg2183 , zuc , or armi knockdowns extended to te pirna profiles . highly similar patterns of pirna losses were seen in all three cases ( figure 6f ) . zuc and armi are required for primary pirna biogenesis but not for ping - pong - mediated pirna biogenesis per se and have been classified as type i pirna biogenesis factors ( olivieri et al . , 2012 ) . loss of either factor has a highly stereotypical impact on pirna populations . while pirnas mapping to most tes are severely reduced , a handful of tes exhibit nearly unchanged pirna levels , and these appear to be almost exclusively produced via ping - pong based on a strong increase in the 10 nt overlap of sense / antisense pirnas . a detailed ping - pong analysis indicated that cg2183 classifies as a third type i biogenesis factor . adenosine levels at position 10 of sense pirnas ( an indicator of ping - pong pirna biogenesis ) were increased to almost identical levels in all three knockdowns ( figure 6 g ) . similarly , ping - pong signatures were elevated for the same subset of tes in cg2183 or zuc knockdowns ( figure 6h ) . the two prototypical tes f - element ( increased ping - pong ) and i - element ( collapsed pirna profile ) exemplify the differential impact of loss of type i biogenesis factors on pirna populations ( figure s2 ) . taken together , cg2183 classifies as a type i pirna biogenesis factor like zuc and armi , and its subcellular localization on mitochondria hints at an intricate connection to the endonuclease zuc . protein blast searches identified orthologs of cg2183 in mammals , and intriguingly , the mouse ortholog gasz ( germ cell protein with ankyrin repeats , sterile alpha motif , and leucine zipper ) has been linked to pirna biogenesis ( ma et al . , based on the overall sequence identity of 26% , a similar domain organization ( five ankyrin repeats and a sterile alpha motif ) , a predicted c - terminal transmembrane domain in both proteins , and a demonstrated colocalization of gasz with mitochondria , we termed cg2183 drosophila gasz . ankyrin repeats and sterile alpha motifs often mediate protein - protein interactions . given the localization of gasz and the endonuclease zuc on mitochondria , we speculated that gasz might serve as an adaptor to recruit other biogenesis factors to mitochondria . we first verified that gasz and zuc localize to mitochondria independent of each other , as would be predicted for two proteins harboring tm domains ( figure s3 ) . we then tested whether any of the known pirna biogenesis factors showed altered subcellular localization upon loss of gasz . in follicle cells as well as in cultured oscs , the biogenesis factors yb , armi , vret , and shu are cytoplasmic and are enriched in perinuclear yb - bodies that depend on the rna helicase yb . yb - bodies are in close association with mitochondria and are hypothesized to be the sites of primary pirna biogenesis . we generated clones of cells expressing either gasz or zuc dsrna hairpins in the follicular epithelium and stained for known biogenesis factors ( figures 7a and 7b ) . as reported previously , cells with zuc knockdowns exhibited significantly enlarged yb - bodies ( evidenced by the accumulation of armi and vret ) . this likely results from a clustering of mitochondria into one or two perinuclear spheres per cell ( figure 7b ) ( olivieri et al . , 2010 , 2012 ) . cells depleted for gasz showed no defects in yb - body localization of yb , armi , or vret . vret levels were elevated in yb - bodies , but armi levels were not , indicating no general enlargement of yb - bodies and presumably also no clustering of mitochondria ( figure 7a ) . the enlarged yb - bodies in zuc mutant cells also stain positive for piwi , indicating that presumably unloaded piwi is recruited to yb - bodies / mitochondria and can not be released in the absence of zuc ( olivieri et al . , 2010 ; interestingly , loss of gasz also resulted in piwi accumulation in yb - bodies , albeit to a lesser degree , probably because of no apparent mitochondrial clustering ( figures 7c and 7d ; figure s4 ) . these results once more highlighted the similarities between zuc and gasz , yet they did not provide any clues toward the molecular function of gasz . drosophila somatic ovarian cells are special , as here pirna biogenesis depends on the soma - specific rna helicase yb , the defining factor of yb - bodies ( szakmary et al . , 2009 ) . we hypothesized that localization of biogenesis factors to yb - bodies might not be the relevant assay to test whether gasz serves as an adaptor to recruit biogenesis factor(s ) to the mitochondrial surface . we therefore analyzed the localization of pirna biogenesis factors in germline cells ( which lack yb - bodies but do perform primary pirna biogenesis ) upon depletion of zuc or gasz . striking differences were observed for the rna helicase armi . in wild - type nurse cells , clouds , which colocalized with mitochondria ( figure 7e ) . remarkably , armi accumulated even more in areas of mitochondrial clusters upon knockdown of zuc but was evenly dispersed and lacked mitochondrial colocalization in cells depleted for gasz ( figures 7f and 7 g ) . given that piwi accumulated around mitochondrial clusters in zuc - depleted but not in gasz - depleted cells ( figure s5 ) , we propose that gasz serves as the adaptor protein that recruits an armi - piwi complex to mitochondria , where the endonucleolytic activity of zuc generates the 5 end of pre - pirnas that will be loaded into piwi . our results define a second mitochondrial transmembrane protein in primary pirna biogenesis and provide evidence that gasz couples biochemical reactions occurring at the mitochondrial surface ( e.g. , zuc - mediated cleavage ) with the upstream sorting of pirna precursors . the mechanistic understanding of the pirna pathway is very limited , and systematic studies are hampered due to its gonad - restricted activity . therefore , our in vivo rnai screen provides an invaluable entry point into the dissection of this silencing system . in the following , we critically assess two key aspects that are relevant to this work . transgenic rnai screens based on the expression of long dsrna hairpins must be rigorously evaluated in terms of their false negative and false positive rates . the false negative rate is influenced by the availability of vdrc lines ( 94% for this screen ) , by the number of genes that can not be evaluated due to overall defects in ovarian development ( 10% for this screen ) , and by the knockdown efficiency of the vdrc lines toward their respective target genes ( estimated to be 90% if two lines per gene were tested ) . based on this , we conservatively estimate that our screen captured up to 80% of the key factors involved in the somatic pirna pathway . we point out that the gypsy - lacz sensor faithfully recapitulates defects at all levels of the pirna pathway , such as flamenco mutations , pirna biogenesis defects , or defects in pirna - mediated silencing . our screen is relatively blind toward genes that are essential for cellular viability and that therefore could not be evaluated . it is clear that at some point pirna - specific processes will connect to more general cellular biology . for example , the key heterochromatin protein su(var)205 ( hp1 ) is likely to be important for pirna - mediated silencing ( wang and elgin , 2011 ) , but it could not be evaluated as its knockdown in follicle cells prevented ovarian development . this set includes ( 1 ) true positives , ( 2 ) factors with indirect impact on the pathway , and ( 3 ) rnai artifacts . considering that the gypsy - lacz sensor picks up even moderate defects in te silencing for example , at least 38 factors can be clearly assigned to aspects of mitochondrial metabolism . as expected for such we note that the identification of processes or factors that impact the pirna pathway indirectly might still be valuable . for example , mitochondrial integrity and/or number likely influence te silencing , as at least two pirna biogenesis factors are mitochondrial transmembrane proteins . mitochondrial function is diminished upon aging . as aging has been linked to increased mobility of tes , it is tempting to speculate that aspects of this might be linked to modulations of pirna pathway activity . they stem from off - target effects of generated sirnas but can also arise from gain - of - function conditions of genes located in the vicinity of the vdrc transgene insertion . both aspects , first , the set of core factors acting in the pathway is unlikely to exceed 3040 genes , making off - target effects less likely . second , the screen was based on manual evaluation of a transgenic reporter assay , a highly specific phenotype . and third , only very few genes ( if any ) will impair te silencing if overexpressed . these arguments are strongly supported by an experimental validation of nearly all of the 30 tested candidates by an independent rnai line . taken together , our screen represents a highly enriched set of somatic pirna pathway genes . we speculate that 30 factors are either core factors of the somatic pirna pathway or have direct impact on its function . this testifies to the remarkable complexity of the pirna pathway compared to the sirna or mirna pathways . at least two key differences distinguish the pirna pathways in somatic or germline cells of the drosophila ovary . first , expression of aub and ago3 as well as the process of secondary pirna biogenesis is germline specific ( li et al . most of the germline - specific pirna pathway factors listed in figure 3e are involved in either of these two aspects . these are aub / ago3 and ping - pong factors such as spindle - e or vasa on the one side and rhino and cutoff on the other side ( klattenhoff et al . , 2009 ; li et al . , 2009 ; malone et al . primary pirna biogenesis and piwi - mediated transcriptional silencing are much more likely to be similar between the two cell types , consistent with the literature ( handler et al . , 2011 ; olivieri et al . , 2012 ; common factors acting in both cell types are likely to classify into one of these two categories , including gasz ( primary biogenesis ) or cg9754 ( silencing ) . considering this , it was surprising to find numerous genes with strong involvement in the somatic pathway that were seemingly dispensable for te silencing in the germline . many of these soma - specific factors can be grouped into three major processes : nuclear rna export , the nuclear pore complex , and transcriptional elongation . we believe that these processes are either carried out by related factors in germline cells ( e.g. , nxf2 and nxf3 are germline - specific rna export factors ) or that they are indeed required specifically in somatic cells . all in all , the identified somatic pirna pathway factors and the established genetic and cell - biological tools will advance investigations on the drosophila pirna pathway . given that several of the key processes and involved factors are conserved in vertebrates shrna lines were cloned into the valium-20 vector ( ni et al . , 2011 ) modified with a white selection marker and integrated into the attp2 landing site reported in groth et al . , 2004 . small rna cloning and sequencing was performed as in jayaprakash et al . , 2011 . -piwi , -aub , and -ago3 ( rabbit ) were described in brennecke et al . , 2007 ; -armi , -vret , and -yb ( rabbit ) were described in handler et al . , 2011 ; -piwi and -armi ( mouse ) if staining of ovaries and oscs was done as in olivieri et al . , 2010 . total rna was isolated from respective knockdowns and separated on a 15% urea - paa gel . oscs were cultured as described as in niki et al . , 2006 and transfected with cell line nucleofector kit v ( amaxa biosystems ; program t-029 ) .
### Summary: : summarythe pirna ( piwi - interacting rna ) pathway is a small rna silencing system that acts in animal gonads and protects the genome against the deleterious influence of transposons . a major bottleneck in the field is the lack of comprehensive knowledge of the factors and molecular processes that constitute this pathway . we conducted an rnai screen in drosophila and identified 50 genes that strongly impact the ovarian somatic pirna pathway . many identified genes fall into functional categories that indicate essential roles for mitochondrial metabolism , rna export , the nuclear pore , transcription elongation , and chromatin regulation in the pathway . follow - up studies on two factors demonstrate that components acting at distinct hierarchical levels of the pathway were identified . finally , we define cg2183/gasz as an essential primary pirna biogenesis factor in somatic and germline cells . based on the similarities between insect and vertebrate pirna pathways , our results have far - reaching implications for the understanding of this conserved genome defense system .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : deep brain stimulation ( dbs ) has been a widely accepted treatment modality for advanced parkinson 's disease ( pd ) for more than a decade . dbs could significantly improve the cardinal symptoms of pd , including tremor , rigidity and akinesia . however , in the pd patients with axial symptoms , the selection of dbs targets is still challenging . to date , the pedunculopontine nucleus ( ppn ) has been introduced as a potential dbs target due to the failure of globus pallidus internus ( gpi)-dbs and subthalamic nucleus ( stn)-dbs to improve postural instability or gait dysfunction . a basic research experiment revealed that lesions of the ppn could produce akinesia in rats and cats and that ppn stimulation increased locomotor activity6 ) . moreover , the low frequency stimulation of the ppn increased motor activity in a monkey model of pd11 ) . clinically , ppn - dbs showed the amelioration of medically intractable akinesia and gait abnormalities13,19 ) . more recently , both open - label and blinded studies involving a series of pd patients treated with ppn - dbs have shown promising results4,14,22 ) . we report a case whose primary symptoms were freezing of gait ( fog ) and postural instability . a 61-year - old male with complaints of falling , gait instability and difficulty walking was admitted to the neurology ward . he started having mild difficulty walking and using small steps to walk 2 years ago , and his symptoms have gradually deteriorated . three months before admission , sudden freezing during gait and turns led him to fall frequently . the neurological examination revealed bradykinesia , rigidity , postural instability , and a mild resting tremor . a cranial mri revealed mild atrophy , which was slightly more prominent in the cerebral peduncle . the administration of both levodopa and dopamine agonists improved his appendicular motor symptoms but did not change the fog and postural instability . therefore , the patient was referred to our institution . based on his symptoms and previous medications , the standard stn or gpi dbs would not be sufficient to improve his chief complaints . 4 dbs leads ( 3389 , medtronic , minneapolis , mn , usa ) were implanted into the bilateral stn and ppn using mri - based stereotactic targeting . the coordinates of the targets were refined by microelectrode recording ( mer ) and clinical tests . the stereotactic frame ( leksell g , elekta inc . , usa ) was fixed to the patient 's head , and preoperative mr images were obtained target the stn and ppn . zrinzo et al.26 ) previously published the position of the ppn relative to the anterior commissure - posterior commissure line , the midcomissural point and the ventricular floor line . the mer proceeded from 10 mm above the target and extended 5 mm below the target ( leadpoint , medtronic ) to refine both of the targets . the electrode locations of the stn and ppn were verified by a postoperative brain mri ( fig . 1 ) . then , we conducted a test stimulation trial for one week to determine which target had a better clinical effect . the ipg was implanted in stage 2 . in the week of trial stimulations , bilateral ppn or stn stimulation the parameters were adjusted daily . for the ppn , the parameters ranged from 1 to 4 v in voltage , 25/60 hz in frequency , and 60 s in pulse width ; for the stn , from 1 to 4 v in voltage , 130 to 180 hz in frequency , and 90 s in pulse width . nevertheless , we found that 60 hz was more effective than 25 hz . the final parameters were as follows : 2 v , 60 hz , and 60 s . during the programming , the patient did not complain of diplopia , ataxia , or pyramidal signs with the different settings . . we also tried combination of stn and ppn stimulation , but the patient complained intolerable dizziness even in low parameters ( table 2 ) . to measure the severity of the patient 's symptoms , we used a variety of different scales ( table 2 ) , including the unified parkinson 's disease rating scale ( updrs ) iii , updrs ii items 13 ( falling ) and 14 ( freezing ) , updrs iii items 28 ( posture ) , 29 ( gait ) , and 30 ( postural instability ) , the freezing of gait questionnaire ( fog - q ) and the gait and falls questionnaire ( gf - q)9,10 ) . during the trial , the stn - dbs resulted in a moderate improvement in the updrs iii score ( on / off stimulation , 22/37 ) but failed to improve the fog and postural instability . in contrast , the ppn - dbs was better in ameliorating the problems with gait , postural instability , falling and fog , although the posture score did not change . during the follow - up , the effectiveness of the ppn - dbs was stable . updrs 3 showed moderate improvement ( on / off stimulation , 21/37 ) at 1 , 3 and 6 months after surgery . moreover , his posture was also improved at 12 months ( on / off stimulation , 1/2 ) after surgery . the patient exhibited significant improvement in gait stability , reduced episodes of fog and reduced falls . these observations were mirrored in the improved fog - q and gf - q scores when the ppn stimulation was on . although we had doubted the diagnosis because of he started the fog ( sudden short - lasting episodes of breaks in motion and inhibition when executing a complex movement or switching from one movement to another8 ) ) , falling and bradykinesia , he had a relative good response to levodopa , which could relieve his rigidity and mild tremor . drug - resistant fog and postural instability are the most crippling symptoms in approximately 10% of patients diagnosed with pd7 ) . these axial symptoms are usually disabling in patients with advanced pd16 ) . in our patient because our patient did not appear to be suitable for the standard dbs procedure , we put the ppn - dbs into practice based on its potential benefits that were reported previously . however , the patient 's symptoms also included rigidity and mild tremor , which might respond well to levodopa , and thus we decided to try a standard dbs target to ensure the efficacy . the standard targets of dbs for pd include the stn and gpi . the effectiveness of both targets has been confirmed in numerous studies . although the updrs iii scores are not significantly different between stn - dbs and gpi - dbs , stn - dbs is more advantageous . the post - operative decrease in the medication dosage was more prominent , and the stimulation voltage was lower , thereby increasing the life of ipg and reducing the cost of the dbs5 ) . moreover , stn - dbs showed a trend toward better motor improvement in the early stage of post - surgery compared with gpi - dbs15 ) . the results of the trial stimulation showed that the changes in the updrs iii scores after the stn - dbs and ppn - dbs were similar ( 40.5% vs. 43.2% , respectively ) but that the ppn - dbs was better in ameliorating the problems with gait , postural instability , falling and fog . the axial symptoms were the patient 's most prominent symptoms . with the parameters of 2 v , 60 hz , and 60 s stn - dbs may provide some benefits with respect to walking and postural instability25 ) given that our patient 's gait and falling scores improved ( on / off stimulation 3/4 and 2/3 , respectively ) . however , in a large cohort of pd patients , the stn - dbs - mediated impact on the limb signs appeared to be more obvious than on the gait20 ) . a recent meta - analysis showed that both stn - dbs and gpi - dbs improved postural instability or gait dysfunction early on but that by 2 years post - operatively , the posture and gait problems were worse than they were before the operation in patients with stn - dbs . five years after dbs , the posture and gait problems worsened , regardless of whether stn - dbs or gpi - dbs was adopted21 ) . another 5-year follow - up of stn - dbs12 ) documented that there was some degree of deterioration in the stn - dbs - mediated impact on the axial signs and akinesia . it might play a role in the initiation and maintenance of locomotion and in motor modulation3 ) . it receives inputs from the substantia nigra pars reticulate ( snr ) , stn , and gpi18 ) and projects into the stn , substantia nigra pars compacta , gpi , cerebellum , spinal cord and supplementary motor area ( sma , an important region for bipedal motion)2,18 ) . analyses of ppn local field potentials and eegs in patients have demonstrated that ppn activity changes during movement preparation and execution24 ) . neuron loss in the ppn has been correlated with the severity of pd symptoms27 ) . although both experimental8,17 ) and clinical4,13,14,19,23 ) studies suggest that ppn - dbs is beneficial for pd patients , there are many questions left to be addressed in the future . first , all of the previous studies reported that effective stimulation is obtained at low frequencies ( 10 - 80 hz ) ; here , we used 60 hz in our patient . aravamuthan et al.1 ) noted the ppn is dominated by inhibitory oscillatory input from the snr in the parkinsonian brain . low frequency stimulation excites the ppn and thus may disrupt this pathological process and attenuate the effects of the excessive inhibitory input to the ppn in pd . second , most of the clinical studies have utilized bilateral ppn - dbs , but unilateral stimulation was also shown to be beneficial to pd patients14 ) . which of these stimulation types is better remains unknown . third , a small open - label study by stefani et al.22 ) revealed that the combination of stn and ppn stimulation proved more effective than the stimulation of either target alone and that the combination might further improve the control of the axial signs . this evidence supports the selection of previous stn - implanted patients for additional ppn stimulation . however , we did not applied the combined stimulation because of the intolerable dizziness in the patient . to date , the available data suggest that ppn - dbs may be considered relatively safe and may improve motor function . this special case suggests that ppn - dbs may have a unique role in ameliorating the locomotor symptoms and has the potential to provide improvement in fog .
### Summary: : deep brain stimulation ( dbs ) of the pedunculopontine nucleus ( ppn ) is a novel therapy developed to treat parkinson 's disease . we report a patient who underwent bilateral dbs of the ppn and subthalamic nucleus ( stn ) . he suffered from freezing of gait ( fog ) , bradykinesia , rigidity and mild tremors . the patient underwent bilateral dbs of the ppn and stn . we compared the benefits of ppn - dbs and stn - dbs using motor and gait subscores . the ppn - dbs provided modest improvements in the gait disorder and freezing episodes , while the stn - dbs failed to improve the dominant problems . this special case suggests that ppn - dbs may have a unique role in ameliorating the locomotor symptoms and has the potential to provide improvement in fog .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : diagnostic imaging technologies play a vital role in reducing the morbidity and mortality associated with heart failure , cardiac ischemia , and infarction . the assessment of regional left ventricular ( lv ) function is currently used as a major diagnostic and prognostic indicator in patients with cardiovascular disease [ 14 ] . single photon emission computed tomography ( spect ) and positron emission tomography ( pet ) are commonly used for evaluation of cardiovascular disease and can allow for not only evaluation of perfusion , but with gated acquisitions these nuclear images can also be used to evaluate global cardiac function measures like ejection fraction ( ef ) and regional function measures such as wall motion and myocardial wall thickening . local wall motion and thickening remain the most common methods used for evaluation of lv regional wall function in the clinical setting . deformation in the form of wall strain represents a direct measurement of tissue elongation and contraction . these measures provide more information on the functional health of cardiac tissue than regional wall motion [ 58 ] , allowing for earlier and more exact diagnoses to be made . there has been growing interest in the use of deformable image registration methods for automated segmentation [ 9 , 10 ] and deformation measurement of the left ventricle directly from low resolution spect images [ 1113 ] . it has been suggested that these types of models can provide accurate quantitative measures of cardiac function ( ef , deformation , strain ) [ 1113 ] in order to evaluate cardiac function . hyperelastic warping is a deformable image registration method that can determine deformations directly from the analysis of clinical medical imaging modalities such as mri [ 14 , 15 ] , ultrasound , and micropet imaging . the objective of the following study was to perform an initial comparison of strain predictions provided by hyperelastic warping of clinical pet images with strain predictions provided by the analysis of tagged mri images from the same individuals . additionally , a series of studies were conducted to evaluate the sensitivity of the warping analysis to changes in image intensity level , the addition of noise to the images , and changes in the assumed underlying lv fiber structure . in hyperelastic warping , the fe representation of the lv is deformed during the registration process . the forces responsible for the registration deformation are derived from the differences in image intensity of two volumetric image data sets . the first of these image data sets is the reference image , known as the template ( t ) . this is the starting point in the analysis and represents the geometry upon which the fe model is based upon . the forces responsible for deforming the fe model are functions of the differences in image intensity between the template image and one or more target images ( s ) . a brief description of the theory underlying hyperelastic warping image registration follows . the deformation map of the registration of the fe model representation of the template image with the target image is defined as (x ) = x = x + u(x ) , where x represents the current ( deformed ) coordinates corresponding to x , the undeformed coordinates , and u(x ) is the displacement field . f(x ) is the deformation gradient which is a function of this deformation map : ( 1)f(x)=(x)x . the image based forces responsible local registration of the discretized template image ( t ) with a target image ( s ) [ 18 , 19 ] is defined by an energy term as follows : ( 2)u(x,)=2(t(x)s())2 , where is a penalty parameter that enforces alignment of the template model with the target image . this energy functional consists of the total hyperelastic strain energy w from the material model and the image based term ( 2 ) . the total energy takes the form : ( 3)e()=w(x , c)dvju(t(x),s())dvj , where j = det(f ) is the jacobian and c = ff is the left cauchy - green deformation tensor . the first term in ( 3 ) is the hyperelastic strain energy which serves to regularize the registration process . the first variation of this term gives the weak form of the momentum equations for nonlinear solid mechanics , while the first variation of the functional u in ( 3 ) gives rise to the following image - based force term : ( 4)du(x,)=[(t(x)s())s() ] . this term drives the discretized template deformation based on the pointwise differences in image intensity ( force magnitude ) and the gradients ( force direction ) . complete details of this formulation can be found in the following work [ 21 , 22 ] as well as its application to the analysis of cardiac imaging [ 14 , 17 , 23 , 24 ] . hyperelastic warping assumes that a hyperelastic material model defines the behavior of the material depicted in the images . in this manner , the fe model serves a dual purpose : first it is a discretized representation of the template image used in the generation of the warping forces described previously . it also represents the lv depicted in the images due to the realistic constitutive model and material property definitions defined in the lv model . for this work , the lv was defined as a transversely isotropic material [ 17 , 2426 ] in order to define the passive mechanics of the lv . details of the passive material model and its implementation in the warping algorithm may be found in the following . transversely isotropic constitutive models are commonly used in modeling the left ventricle . in order to register the lv from the end - diastolic starting point to the end - systolic state , a physiologically realistic time varying elastance active contraction model [ 28 , 29 ] constitutive model was utilized to contract the template fe model . the total cauchy stress tensor t in the fiber direction ( unit vector a ) is defined as the sum of the active stress tensor t ( a a ) and the passive stress tensor generated by the passive material model t as follows : ( 5)t = t(p)+t(a)(aa ) . the active fiber stress tensor t is defined as ( 6)t(a)=tmaxca02ca02+eca502ct , where tmax is the intracellular calcium concentration and ct governs the shape of the activation curve and is based on literature values . the length dependent calcium sensitivity eca50 is governed by the following equation : ( 7)eca50=(ca0)maxexp[b(ll0)]1 , where ( ca0)max = 4.35 m is the peak intracellular calcium concentration , b = 4.75 m governs the shape of the peak isometric tension - sarcomere length relation , l0 = 1.58 m is the sarcomere length at which no active tension develops , and l is the sarcomere length which is the product of the fiber stretch ~ and the unloaded length lr = 2.04 m . rather than rely on literature values for the active contraction , a subject specific active contraction methodology was developed and applied to globally align the lv model with end - systolic image . the amount of active contraction applied to the models was governed by the amount of intensity mismatch in the images themselves . this average difference in image intensity was used to define ct in ( 8)t(a)=tmaxca02ca02+eca502act . the average image intensity difference given in ( 9 ) was used to define the shape of the active contraction curve for all of the elements representing the lv wall . a is a penalty parameter that enforces alignment of the template model with the target image as follows : ( 9 ) ct=1numelemsi=1numelems(t(x,)s(x, ) ) , where numelems is the number of elements comprising the lv . this formulation using the average difference in image intensities was used rather than the local differences in image intensities such as is applied in warping forces , in order to produce a uniform transmural contractile stress t. in this manner , the warping contractile forces are controlled by the overall registration of the model to the target image producing subject specific contraction . two 3d test cases were used for this initial evaluation of hyperelastic warping for determining systolic deformations using pet images . two , mid - twenty , male volunteers were sequentially imaged , with pet and tagged mri . the gated pet data were acquired on a cti / siemens ecat exact hr scanner in list mode format using f - fluorodeoxyglucose ( fdg ) . acquisition of emission data was begun approximately 40 minutes after injection of the isotope to allow clearance from the blood pool , and acquisition continued for 20 to 60 minutes . a retrospective respiratory and cardiac double gating procedure was used to reconstruct the images into 40 msec intervals . to simplify the analysis , the resulting images were resampled into standard short axis orientations with dimensions 100 100 42 voxels ( 1.5 1.5 3.5 mm ) . this scan was combined with a 60 min blank scan to correct for the effects of attenuation . a normalization file was then used to correct the emission , transmission , and blank data on a bin - by - bin basis . a 1.5 t siemens scanner was used to obtain the mri tagged data of the same patients . spatial modulation of magnetization ( spamm ) was used to create the tags and acquire data in short - axis planes with each image slice being synchronized to the r wave of the ekg signal , and sequential images were acquired at 40 ms intervals . image data were formatted into 256 256 pixel matrices with a 378 fov and 10 mm slice separation . the mri image data sets were manually coregistered to the corresponding pet images using rigid body rotations and translations of the images . the tagged mri image data sets were analyzed using the commercially available harmonic phase ( harp ) software package ( diagnosoft harp , http://www.diagnosoft.com ) . each short axis slice of the image data sets was analyzed using 2d harp analysis . epicardial , midwall , endocardial , circumferential , and radial strain measurements were determined for 4 regions ( anterior , posterior , septal , and lateral ) , resulting in 12 radial and 12 circumferential strain measurements per image slice . the fe based warping models were given subject specific geometries for the two hearts using methodology described previously [ 17 , 31 ] . briefly , the 3d finite element meshes were created using surfaces based upon semiautomatic segmentation of the end - diastolic pet images ( template ) . the models were assigned realistic material properties [ 26 , 32 ] using the material model components described previously . the fiber distributions used in the fe models were defined as 82 epicardial to 80 endocardial . the end - diastolic pet image data set was used as the template image , and the end - systolic pet image was used as the target image for each case . these time points were chosen in order to match the tagged mri data used in the harp analyses . these times do not represent the actual time over the cardiac cycle , rather they represent the end - points of the analysis time over which the analysis of the images is made . the time allows for control of the application of the active contraction stresses ( 8) as well as control over the local warping forces in ( 4 ) during the analysis . for the global alignment phase , the active contraction warping was applied using a linearly increasing penalty a in ( 8) through 2/3 of the analysis ( 6.7 seconds ) after which it was held constant until the end of the analysis . the warping penalty in ( 9 ) and ( 11 ) was defined as linearly increasing over the course of the entire analysis [ 17 , 31 ] . qualitative assessment of the registration between the warping epi- and endocardial surfaces and the tagged mri image data sets was performed . the surfaces were superimposed upon both the pet and tagged mri image data sets using the warplab software ( http://www.mrl.sci.utah.edu/software/warplab ) . warplab is a freely distributed finite element postprocessing program that was designed to simultaneously display the fe models and the corresponding images , allowing for the visual evaluation of the deformation and registration results . a quantitative assessment of the methodologies was made by comparing the warping radial and circumferential strain predictions with the harp based strain measurements for the same locations . the comparisons were made using the point strains at each location for each methodology without any averaging being made . the coefficient of determination ( r ) between the two measurements was determined by correlating the strains determined by mri with the strains predicted by warping . a bland - altman analysis was conducted on these strain predictions to assess the amount of agreement between the methodologies as well as to identify possible bias in the warping predictions . a regression analysis was performed on the bland - altman error data in order to identify trends in the warping predictions . the percent root mean squared errors ( % rmse ) was used to compare the tagged mri strain data with the strains predicted by hyperelastic warping using the tagged mri data as the gold standard ( 10 ) . , tagged represented the strain value in the tagged analysis , warp was the predicted strain value for the node corresponding to this location in the warping analysis , and nnodes was the total number of nodes in the elements representing the myocardial wall . additionally , paired student 's t - tests were used to assess statistical differences in the means of the strain predictions . a series of sensitivity studies were conducted in order to evaluate the sensitivity of the strain predictions from warping to the addition of noise to the images being analyzed using methodology demonstrated in our previous studies [ 24 , 34 ] . an independent additive noise model was used to modify the original template and target images . the intensities of the original template and target images were considered true images s(i , j ) , where i and j represent pixel coordinates . random noise n(i , j ) was added to the true images to create the noisy image i(i , j ) : ( 11)i(i , j)=s(i , j)+n(i , j ) . the noise was defined by the standard deviation ( n ) of a zero mean normal probability distribution for noise image intensities , and i was the standard deviations of the image intensities for the template and target images . the signal to noise ratio ( snr ) was defined as ( 12)snr=in . images having snr values of 8 , 4 , 1 , 0.5 , and 0.1 were evaluated ( figure 2 ) . coefficients of determination and % rmse were determined for the warping analysis of these images . the intensities of nuclear based images represent the relative uptake of the tracer , in this casefdg , by the tissue . as the relative uptake of tracer can vary widely for nuclear imaging studies , a series of studies were carried out to determine how changes in the image intensities of the images would affect the warping strain distributions . the intensities ( counts ) of the template and the target image data sets were both reduced by 10% , 20% , and by 40% ( figure 3 ) . each case the active contractile component of warping is responsible for the global alignment of the lv model with the target image . in order to determine the contribution of the active contraction component of hyperelastic warping to the overall accuracy of the strain predictions , currently , it is extremely difficult to determine the fiber distribution of the lv for a living human subject or animal model noninvasively . therefore , it is valuable to determine the relative sensitivity of warping to variations in the transmural fiber distribution , given that the fiber distribution used in the models will likely be based upon literature values . in order to study the effects of changes in the fiber distribution , the baseline transmural inclination angles of 82 , 0 , 80 ( epi- , mid- , endocardial wall ) used in the validation study were increased and decreased by 5% . this resulted in distributions of 86 , 0 , 84 and 78 , 0 , 76 . the circumferential and radial strains were compared with the tagged mri strains as described previously . the effect of changes in the fiber distribution on the active contraction component alone was made by evaluating the snr 0.1 image data sets while altering the model fiber distributions . the snr 0.1 images contain virtually no image information being completely made up of guassian noise ( figure 2 , far right panel ) . the differences in image intensities , in this case random noise will , on the element basis , create small image based forces . the lack of coherent image gradients means that these image based forces will be randomly oriented and will not contribute to changing the configuration of the fe lv model leaving only the active contraction to alter the lv model . using these models , the effect of changes in the fiber distribution on the active contraction component alone was evaluated by increasing and decreasing the inclination angles for the snr 0.1 analysis by 5% as described previously . the strain predictions from these cases were compared with the validation study and the snr 0.1 analysis with the normal fiber distribution . the visual comparison of the registered warping epi- and endocardial surfaces with the end - systolic tagged mri images indicated that the analyses achieved excellent image registration for both hearts . the model epi- and endocardial surfaces for both models show very good correspondence with these surfaces in the tagged mri images ( figures 4(c ) and 5(c ) ) . the fe model epi- and endocardial surfaces are displayed with the pet images used in the analysis ( figures 4(a ) , 4(b ) , 5(a ) , and 5(b ) ) . the comparison of the warping strain predictions with the results of tagged mri analysis indicated good agreement between the analysis methods ( figure 6 ) with r values of 0.78 to 0.83 . bland - altman analyses ( figure 7 ) of these results indicated that the warping strain predictions were lower than the tagged mri analysis for both the radial and circumferential directions . in the radial direction there appears to be a tendency towards greater underestimation at higher strain values . the results of the sensitivity studies ( tables 1 and 2 ) indicate that alterations in fiber distribution , moderate decreases in image intensity , and the addition of noise down to an snr 4 for heart 1 and snr 1 for heart 2 had little effect on the warping predicted strains . the results indicated that there was little change in the r values and the % rmse for these cases . the error values for the snr 1 case of heart 1 and snr 0.5 for heart 2 displayed a marked degradation of the strain predictions resulting in large increases in the error measures and decreases in the r values from the addition of image noise . the removal of the active contraction from the analysis led to regions of severe misregistration of the fe models with the end - systolic images . there were several locations of misregistration on the epicardial surfaces for each short axis slice . the endocardial surfaces of the model simply did not register the corresponding surfaces shown in the end - systolic tagged mri images . the effect upon the strain predictions were also pronounced with increases in the % rmse as well as a degradation in the r values for both hearts ( tables 1 and 2 ) . the effect of changes in the fiber distribution on the strain predictions was significant when active contraction was the only loading on the fe models . the error measures ( % rmse ) increased in magnitude in the circumferential direction for heart 1 with changes in fiber distribution . however , the % rmse showed little change for the radial direction for heart 1 compared with the normal fiber snr 0.1 results ( table 3 ) . the r values for heart 1 cases showed slight decreases for both of these strain measures . in contrast , the active contraction fiber distribution analysis for heart 2 showed increased % rmse for both the circumferential and radial directions compared with the normal fiber snr 0.1 case . the qualitative and quantitative evaluations of this initial validation study indicated that warping analysis of clinical pet images can provide point strain predictions consistent with those determined by tagged mri analysis . the warping strain estimates showed a slight tendency towards underestimation for the circumferential direction compared with the tagged mri analysis results as indicated by the slope of the regression lines being less than 1.0 in figure 6 . this tendency was more pronounced for the radial direction predictions where the amount of underestimation increased as indicated by the slopes of the regression lines being smaller than the values for the circumferential direction . the radial strain results were not surprising as there are only two to three tags across the wall ( figures 4(c ) and 5(c ) ) . two to three tags provide a relatively low resolution for the prediction of the radial strains , and this tends to homogenize the radial strain results ( figures 6 and 7 ) . in the warping analysis there are 10 sample points spread transmurally across the wall where the images are sampled . these are spaced approximately 0.51.5 mm apart depending upon where in the mesh the elements are located thus providing a substantially higher spatial resolution . the sensitivity studies indicate that warping was relatively insensitive to changes in the fiber distribution as well as being insensitive to modest decreases in image intensities . the addition of moderate amounts of additive noise also showed little effect upon the predicted strains . however , a snr level of 1 for heart 1 and 0.5 for heart 2 produced large increases in % rmse . however , as more noise was introduced ( lower snr values ) , the error measures improved due to the decrease and elimination of the intensity gradients in the images . these high snr cases resulted in the magnitude of the image forces being decreased , but more importantly , the forces become randomly oriented leaving the active contraction as the primary loading on the models . these results also suggest that using a realistic material model can provide a reasonable strain distribution within regions where little image intensity information is available . the extreme example of this situation was the snr 0.1 cases where no image information depicting the lv was left in the images . the analysis of the snr 0.1 image data sets allowed for the evaluation of the active contraction component without any other loading on the models . as expected , the effects of the fiber distribution were pronounced in these cases ( table 3 ) as all of the loading responsible for lv deformation is transmitted along the fibers . these results were in contrast to the sensitivity study where the fiber distribution was altered for the analysis of the validation image data sets . these studies indicated that alterations in fiber distribution produced little change in the error measures ( tables 1 and 2 ) . taken together , these results suggest that the active contraction forces only provide enough contraction to approximately align the lv model with the end - systolic image data set , and it is local warping forces that produce the deformations necessary for registration of the fe model with the target image . the work presented in this paper is the first time point strain predictions were evaluated using clinical pet images compared with clinical tagged mri image data sets . for example , warping analysis of cine - mri images of the lv compared well with tagged mri image analysis for regional strains ( average septal , lateral , posterior , and anterior ) in the same patient . a comparison of warping strain predictions for the medial collateral ligament ( mcl ) undergoing flexion based upon the analysis of cine mri images showed excellent agreement with strain surface marker measurements . a previous , nonclinical , validation study for the use of warping with cardiac micropet imaging indicated that warping analysis strain predictions showed excellent agreement with the lv strains predicted by a forward finite element model that was used to create a set of synthetic target micropet image data sets used in the analysis . limitations . obtaining deformation information from nuclear based images presents problems that are unique to these imaging modalities . pet and spect images are based upon the uptake in tissue of nuclear tracers imaged over relatively long periods of time ( up to 60 minutes for these studies ) resulting in average geometric or spatial representations of the myocardium . patient movement , gating errors during pet acquisition and changes in heart rate during this time span could all contribute to uncompensated blurring that might affect surface representations . furthermore , the images themselves have relatively low spatial resolutions compared with other modalities such as the tagged mri images used for comparison in the present study . one might expect that the geometries portrayed in the images and the relatively low spatial resolution of pet would compromise the image registration . resolution and distortions due to motion issues would then manifest in the inability of the warping methodology to produce registered models that correspond to the geometry portrayed in the higher resolution mri images . however , the present study demonstrated that warping could produce good image registration ( figures 4 and 5 ) without the introduction of obvious artifacts that would have had a negative effect upon the strain predictions . another possible source of error in the analysis of clinical pet images is that the relative uptake of tracer documented in the images will vary from patient to patient . in the present study , the histograms for the images ( figure 9 ) indicate that the dynamic range of the images of heart 1 was far greater than that of heart 2 . the images of heart 1 had a substantially higher mean intensity value as well as a greater standard deviation for the full 3d image data set than those of heart 2 . these differences in dynamic range did not appear to affect warping strain predictions compared to the tagged mri analysis . pet based image intensity distributions may also vary over the cardiac cycle . the template image of heart 1 had a mean intensity value of 91.2 for the histogram compared with the mean intensity histogram value in the target of 86.4 ( figure 10 ) . in contrast , the images of heart 2 had mean image intensity values of 14.5 in the template image and 12.9 for the target image , so an approximately 10% decrease in image intensity . the analysis results do not show any effect of the change in image intensity over the cardiac cycle . these results confirm those of our previous work where intensity differences between the template and target image data sets did not affect the strain predictions . these results support the idea that systolic contraction brightening due to partial volume effects may have little or no effect on the strain predictions . warping can produce 3d greene - lagrange strain fields , rather than just the in - plane strain predictions as was provided by the tagged mri analysis used in the present study . one of the primary limitations of 2d , in - plane , analysis methods is that it neglects to account for the effects of through plane motion of the heart . in a given image plane , the tissue seen and being analyzed at the reference configuration ( end - diastole ) is not the same tissue that is seen in this same image plane at end of the analysis ( end - systole ) . as the base moves toward the apex , the tissue moves through the image plane . through plane motion one of the primary limitations of the present study was that only two image data sets were available for analysis . a larger number of image data sets would have allowed for greater confidence in the results . however , even with just the two image data sets , the results suggest that the point strain predictions made from the warping analyses were consistent with those obtained using tagged mri analysis . the analysis of cardiac pet images with perfusion defects from ischemia or infarction has direct clinical relevance for the use of this technology . this being the case , a possible problem with hyperelastic warping would be that the active contraction component could cause an underestimation of the strains within regions having moderate perfusion defects . this would be the case where the average intensity difference in the images ( 12 ) , that drives the active contraction component of warping , would be the primary loading on the elements within the defect rather than the forces derived from the local differences in image intensity ( 11 ) . first , the active contraction penalty value used to approximately register the model with the target images was the minimum that provided reasonable alignment as subjectively judged by the user . second , the analysis of images that contain one or more low perfusion regions will likely require use of additional methods in order to obtain accurate strain predictions within these segments . this would involve the identification of the elements that are within the perfusion defect(s ) in order to alter the analysis parameters . software has been developed that can be used to directly identify the elements that lie within a perfusion defect . the material properties of these elements can then be altered , such that no active contraction is applied within these regions . the noise component added to the images for the snr analyses did not represent the type of noise found in pet imaging . additionally , the additive noise model that was applied to the validation pet images was overly simplistic , as there are numerous sources for noise in pet imaging , including the noise associated with the numerous corrections that are applied ( randoms , attenuation , etc . ) as well as the noise associated with the image reconstruction process itself ( e.g. , filter back projection ) . each of these sources of noise introduces its own noise distribution to the overall noise in the images . it would have been difficult in the present study to reproduce the complex processes associated with the noise generation found in pet imaging . the present study has indicated that hyperelastic warping was able to provide reasonable strain predictions through the analysis of clinical pet images depicting systolic contraction that were consistent with those obtained using the harp analysis of tagged mri images . the sensitivity studies indicated that the methodology was relatively insensitive to moderate alterations in image intensity and image noise as well as alterations in the assumed fiber structure . warping analysis of pet images appears to be able to provide a relatively robust method to obtain estimates of wall strains in the human lv .
### Summary: : the objectives of the following research were to evaluate the utility of a deformable image registration technique known as hyperelastic warping for the measurement of local strains in the left ventricle through the analysis of clinical , gated pet image datasets . two normal human male subjects were sequentially imaged with pet and tagged mri imaging . strain predictions were made for systolic contraction using warping analyses of the pet images and harp based strain analyses of the mri images . coefficient of determination r2 values were computed for the comparison of circumferential and radial strain predictions produced by each methodology . there was good correspondence between the methodologies , with r2 values of 0.78 for the radial strains of both hearts and from an r2 = 0.81 and r2 = 0.83 for the circumferential strains . the strain predictions were not statistically different ( p 0.01 ) . a series of sensitivity results indicated that the methodology was relatively insensitive to alterations in image intensity , random image noise , and alterations in fiber structure . this study demonstrated that warping was able to provide strain predictions of systolic contraction of the lv consistent with those provided by tagged mri warping .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : radiography has the most important role in dental implantology.[14 ] conventional tomography , cone - beam computed tomography ( cbct ) , and spiral computed tomography ( ct ) can provide convenient cross - sectional images to recognize the vital anatomical structures and dimensions of the mandible . accurate dimensions , not overlapping , and evaluation of feasible bucco - lingual dimension are considered as their advantages . however , high cost and dosage of x - ray exposure are disadvantages of ct . in comparison with periapical radiography with rectangular collimation and f - speed film , the x - ray exposure of conventional tomography is 0.20.6 per each slice times less , whereas of cbct and spiral ct are 442 and 25800 times more respectively . therefore , it was aimed to find an alternative technique with maximum advantages of ct but with less cost and x - ray exposure . when a few number of implants are needed and the anatomical variation is minimal , conventional tomography is the technique of choice.[6811 ] conventional tomography provides an image with an error less than 1 mm , and two or three cross - sectional tomographic slices are enough for each implant position . in several studies the mean value of differences in measurement of the bone height has been reported in a range of 1 mm;[81114 ] however , it was also reported to be 2.5 mm in another study using linear tomography . in images of the posterior mandibular region , , we tried to transfer the shadow of ramus from the center of the tomographic focal plane to let the measurements be more realistic . the mandibular and alveolar bone and also teeth of the posterior mandibular region have a lingual inclination for 16 ; we tilted the mandible buccally for 8 , to omit the ramus shadow , taking true cross - sectional images . in previous studies the effect of rotating , but not tilting , the mandible was examined . in this experimental study , we used 10 dry human edentulous mandibles without any turous , exostosis , or defect . metallic balls ( 1 mm in diameter ) were fixed by sculpture paste on a point 20 mm distal to mental foramen of both sides of each mandible , and also , a metal ball was fixed on mandibular midline ( to facilitate correct mandibular positioning ) . while the lower borders of mandibles were parallel to the horizontal plane and midlines were in the direction of device 's guide , panoramic images with a magnification of 1.5 and tomographic images with the same magnification in four sections with 4 mm of thickness were taken . to compensate the lingual inclination of posterior mandibular bone and fixtures toward the alveolar ridge , the mandibles were tilted buccally for 8 and tomographic images were taken again with the same manner . among the images of each sample , the sharpest with better view of metallic ball ( mostly in a complete circle shape ) was chosen . the height of bone on images , considering the magnification of 1.5 , and also on dry mandible was measured twice with a 2-week interval by a radiologist . the thickness of bone at the half - height point and the distance between buccal and lingual cortical plates were measured on the images of both tomography techniques and on dry mandible . all the measurements on images and dry mandible were done with a 0.1 precision caliper . the sharpness of the contour of mandibular canal , were graded as 0 , 1 , and 2 , for nondetectable , detectable , and sharp respectively . panoramic radiographs ( with regular cassette ) and tomographic images ( with medium cassette ) were taken by cranex tome ( sordex oy , tuusula , finland ) . panoramics and tomograms were taken at minimum x - ray factors ( respectively [ 19 s , 10 ma , 57 kvp ] and [ 46 s , 1 ma , 57 kvp ] ) . radiographs were processed using an automatic processor ( optimax2010 , germany ) , with processing solutions ( champion , iran ) at 33c , 1.5 minutes . based on interclass coefficient correlation , the reliability of the two of measurement was more than 93% . measurements of height of the bone showed a mean value of 17.323.1 mm for standard tomography , 17.613.27 mm for tilted tomography , and 18.273.33 mm for dry mandible . the analysis of data revealed no significant difference between the mean values of height of bone on the two different tomographic images ( p=0.158 ) , but significant differences between dry bone and both images were seen ( p<0.001 ) . in both methods , underestimating was more than overestimating ( 0.8 mm to 2.7 ) [ figure 1 ] . the heights of bone ( crest - to - lower border of mandibule ) in two tomographic methods and in dry mandible , h : height of crest - to - mandibular lower border / ta : standard tomography / tb : tilted tomography / m : dry mandible , hta - hm : subtraction of hta and hm / htb - hm : subtraction of htb and hm the mean values of buccolingual thicknesses of bone at the half - height point on standard and tilted tomographs , and dry mandible were 9.271.32 mm , 8.911.40 mm , and 9.581.58 mm , respectively . data analysis showed a significant difference in the thickness of bone between three measurements ( p<0.001 ) [ figure 2 ] . this difference was mainly between tilted tomography and both standard tomography and dry mandible ( p<0.001 ) , while there was no significant difference in measurements between standard tomography and dry mandible ( p=0.11 ) . the alveolar ridge 's buccolingual thicknesses in half - height of alveolar crest - to - mandibular lower border in two tomographic methods and in dry mandible , w : thickness in half - height of alveolar crest - to - mandibular lower border / ta : standard tomography / tb : tilted tomography / m : dry mandible wta - wm : subtraction of wta and wm / wtb - wm : subtraction of wtb and wm the sharpness of the image of mandibular canal was not significantly different between two tomographic methods ( p=0.166 ) [ figures 3 and 4 ] ; however , in 60% of tilted ( 12 cases ) , but in 35% of standard tomographic images ( 7 cases ) the contour of canal was completely sharp . canal counters sharpness in standard tomography , non - detectable canal counters ( 0)/detectable canal counters ( 1)/sharp canal counters ( 2 ) canal counters sharpness in tomography with tilt , nondetectable canal counters ( 0)/detectable canal counters ( 1)/sharp canal counters ( 2 ) numerous studies have shown different accuracy of panoramic , periapical , and spiral tomographic images in implantology.[8162125 ] many studies have expressed that the ct is better than conventional tomography in determining the position of mandibular canal , height , and thickness of bone ; however , conventional tomography , with lower cost and less exposure of radiation , is more acceptable . main reasons of controversies between different studies are based on patients positioning , proper exposure factors to achieve better contrast , spiral or hypocycloidal movements , image layer thickness , mandibular positioning , and observers experiences . in several studies , different amounts of overestimating ( 03 mm ) and underestimating ( 03.7 mm ) have been reported . lindh mentioned that sometimes artifacts or bone marrow space are considered as the canal and this leads to overestimation . mahdizade and dalili believed another cause of overestimation that was referred to the radiologists experience in interpreting the tomographic images . in our study it might be related to the avoidance of overestimating to minimize the risks during surgery . serhal presented the curve of spee as the cause of overestimating . in spiral tomography , the mean value of differences ( md ) in measurements of the bone height has been reported in a range of 1 mm[81114 ] and 2.5 mm . estimating the height of bone we found the results of standard tomography ( md : 0.9 mm ) less accurate than those of tomography with tilted mandible ( md : 0.6 mm ) . perhaps tilting the mandible eliminates the shadow of ramus from the image of the crest which makes it sharper and lets it be measured more accurately ; this is the probable reason of the difference between two methods . to improve the quality of images and views of mandibular canal , dalili suggested to have the lower border of mandibule horizontal . naitoh studied the effect of the angle of the objective plane on the quality of image of linear tomography and suggested a range of 4.2 ( 2.5 to -1.7 ) . dabbaghi et al . , who had studied the role of mandibular rotation for 10 on the quality of images of spiral tomography , suggested the zero angle ( factory suggested position ) and because of significant differences , the researcher rejected the negative angles . estimating the buccolingual thicknesses of bone at the half - height point we found the standard tomography ( md : 0.3 mm ) more accurate than tomography with tilted mandible ( md : 0.67 mm ) . apparently , transferring the shadow of ramus to the mandibular external border by tilting the mandible and consequently reduced sharpness of this region makes it difficult to estimate the thickness of bone . in the case of the sharpness of the mandibular canal images serhal believes that the cross - sectional images of the second and third molar regions can be distorted and be more oval rather than circular because of the patient 's bad position . we found no significant difference between the sharpness of canal in two tomographic methods , although in 60% of tilted and 35% of standard tomographic images , the contour of canals were completely sharp , which is also explicable with the hypothesis of eliminating the shadow of ramus from the region . therefore further studies with more samples are suggested . finally , it can be concluded that 8 buccal tilt of mandible , seemingly by eliminating the shadow of ramus , improves the estimation of the bone height and sharpness of the image of mandibular canal , but it is not helpful in estimating the bone thickness . in other words , buccal tilt is recommended when accurate bone height estimating is more important but routine standard tomography is preferred when the bone thickness is requested .
### Summary: : background : accurate measurement of the height and buccolingual thickness of available bone has a significant role in dental implantology . the shadow of ramus on the mandibular second molar region disturbs the sharpness of conventional tomographic images . the aim of this study was to evaluate the effect of transferring the shadow of ramus from the center of the focal plane , by changing the position of mandible , on the sharpness of the posterior mandibular region.materials and methods : in this experimental study , we used 10 dry human mandibles . three metal balls were mounted on the midline and mandibular second molar regions bilaterally . standard panoramic and tomographic images were taken . then , the mandible was tilted buccaly for 8 compensating the normal lingual inclination of the mandibular ridge and teeth on this region and tomographic images were taken again . the height and thickness of bone were measured on the images and then compared with the real amounts measured directly on mandibles . also , the sharpness of mandibular canals was compared between the two tomographic methods . findings were analyzed with repeated measured anova test ( p<0.05).results : the height of mandibular bone , on the images of the tilted tomography technique was more accurate compared to standard ( p<0.001 ) , but standard tomography had more accuracy in estimating the buccolingual thickness at the half - height point . regarding the sharpness of mandibular canals , we found no significant differences between two tomographic methods.conclusion:buccal tilting is recommended when measuring the bone height is more important , but routine standard tomography is preferred when the thickness is requested .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : oral cavity harbors billions of microorganisms , some of these contribute to the development or progression of systemic diseases such as cardiovascular disease , diabetes mellitus , etc . antibiotic resistance , adverse effects and toxicity to modern medicines has prompted scientists to research on natural products . it came into lime light and popularity by dr f karach.3 , 4 the present article reviews the role of oil pulling in maintaining oral hygiene . oil pulling is mentioned in the ayurvedic text charak samhita and sushruta samhita as kavala graha or kavala gandoosha.4 , 7 in gandoosha mouth is completely filled with oil such that gargling is impossible whereas in kavala graha comfortable lesser quantities of oil is used such that gargling is possible.6 , 8 in oil pulling , a tablespoon full of oil is swished around the mouth in the early morning before breakfast and in empty stomach for about 20 min . in case of children greater than five years of age , pulled and forced in between all the teeth by swishing it all around the mouth . at the end of this activity if the procedure is done correctly , the viscous oil will become milky white and thinner . then it is spit out and mouth is thoroughly washed with clean warm saline water or tap water and teeth are cleaned with fingers or routine tooth brushing is performed . if the jaw aches , then the procedure can be done just for 510 min . the oil should not be spit into the sink as the oil can cause clogging of the pipes . instead , the oil should be spit into a trashcan or on a paper towel . oil pulling should be ideally performed daily morning on empty stomach before brushing teeth and care should be taken that oil is not swallowed.4 , 10 , 11 swallowing of oil during oil pulling should be avoided as the oil contains bacteria and toxins . it can be practiced thrice daily in empty stomach before meals to fasten the healing effects . it is contraindicated for children below 5 years due to risk of aspiration.14 , 15 the practitioner should take care not to aspirate the oil while performing rigorous oil pulling . in cases of oral ulcers , fever , vomiting tendency , asthma and in conditions where brushing is difficult and sometimes contraindicated , oil pulling can be advantageously used to maintain oral hygiene . ayurveda hypothesizes that tongue is connected to various organs such as kidneys , heart , lungs , small intestine , spine , etc . oil pulling is believed to help in the excretion of toxic heavy metals by saliva . oil pulling activates salivary enzymes which absorb toxins such as chemical toxins , bacterial toxins and environmental toxins from the blood and removed from the body through the tongue.9 , 16 , 18 , 19 thus oil pulling detoxifies and purifies the entire human body . however it is argued that since oral mucosa is not a semipermeable membrane , toxins of the body from the blood can not pass through it . organic oils such as sunflower oil , sesame oil , and coconut oil are of benefit especially if it is cold pressed , though refined oil also works in pulling the bacteria , viruses and protozoa from the oral cavity . since trans fats are absent in cold pressed oils when compared to commercial oils which are extracted from strong petroleum based solvents ; oil pulling is ideally performed with cold pressed oils . oil pulling using olive oil , milk , extracts of gooseberry and mangoes is also documented . also polyunsaturated fatty acids present in sesame oil reduces free radical injury occurring in oral cavity . these oils will attract the lipid layer of bacterial cell membranes , and cause it to stick or get attracted , and pulled to the oil . during oil pulling , the oil gets emulsified and surface area of the oil gets increased . this oil will coat the teeth and gingiva and inhibits bacterial co - aggregation and plaque formation . thus plaque building bacteria responsible for dental caries , gingivitis , periodontitis and bad breath are removed from the oral cavity . oil pulling is also of help to resolve symptoms of dry mouth / throat and chapped lips . also teeth become whiter ; breath becomes fresher ; oral cavity muscles and jaws become stronger with excellent achievement of oral hygiene.9 , 23 oil pulling prevents dental caries , gingivitis , oral candidiasis and periodontitis from occurring , helps to reduce tooth pain , fixes mobile teeth and achieves vigorous oral hygiene.5 , 9 , 13 , 24 oil pulling when practiced regularly is believed to freshen and stimulate the mind and strengthen the senses . it is also beneficial in sore throat , dry face , impaired vision , taste loss and anorexia . it contains lauric acid which can react with alkalis present in saliva such as sodium hydroxide and bicarbonates to form sodium laureate - soap like substance , which reduces plaque adhesion and accumulation , and possesses cleansing action.3 , 4 , 12 lauric acid has antimicrobial , anti - inflammatory properties , prevents dental caries and is beneficial to oral health . in addition to this it also has a pleasant taste.4 , 25 coconut oil has antimicrobial activity and is effective against streptococcus mutans and candida albicans in an in vitro biofilm model . coconut oil also has anti - septic properties and can be safely used as emollient and moisturizer . coconut oil does not have adverse effects produced by chlorhexidine such as brown staining and altered taste sensation . it also contains plant phenolic compounds , squalen , phytosterols ; vitamin a , e and k. these constituents have antimicrobial , immunomodulatory and antioxidative effect . almond oil containing mouth rinse is suggested to result in low gingival scores whereas olive oil based mouth rinses is believed to inhibit plaque formation and inhibition . sesame oil contains sesamin , sesamolin and sesaminol and has detoxification , antioxidant , and antibiotic actions . monolaurin in coconut oil is effective against microorganisms such as staphylococcus aureus , candida spp . it is hypothesized that monolaurin causes bacterial death by altering bacterial cell wall , penetrating and disrupting cell membranes and inhibiting enzymes related to energy production and nutrient transfer . monolaurin also has virucidal activity by dissolving lipids and phospholipids in the viral envelope ; leading to disintegration of virus . sucrose monolaurate of coconut has anti - caries properties due to reduction in glycolysis and sucrose oxidation by s. mutans and thus prevents the formation of dental plaque . however it should be kept in mind that oil pulling does not reverse the existing dental caries and hence regular visits to dentists are still required . in addition to maintaining oral hygiene it has been claimed to have systemic health benefits and cure systemic diseases . oil pulling is also supposed to increase the metabolism of the body , heal the cells , tissues and organs of the body and improve longevity in human beings . an improvement in oral hygiene is noticed within two weeks of practicing correct method of oil pulling . sunflower oil is observed to decrease both plaque and gingival indices after using it for oil pulling for period of forty five days . anand et al in their study observed 20% reduction in bacterial count upon 40 days of oil pulling using sesame oil . sesame oil was observed to possess moderate antimicrobial activity against s. mutans and l. acidophilus . they mentioned that toxins and bacteria from the body may be removed through the tongue and get trapped in oil and thrown out from the body . four researchers in their study involving 60 adolescents of age 1618 years with plaque induced gingivitis , observed statistically significant reduction of plaque and gingival indices upon oil pulling using coconut oil . subjects performed oil pulling in early morning at empty stomach in addition to their routine oral hygiene measures such as brushing and flossing . modified gingival index and plaque index by sillness and loe were measured at baseline and on days 1 , 7 , 15 and 30 . the study observed 50% decreases in gingival and plaque indices after four weeks which is comparatively similar to results produced by chlorhexidine . they concluded that oil pulling with coconut oil is helpful in decreasing plaque formation and plaque induced gingivitis . in a study conducted by jauhari d et al on children aged 612 years , the authors observed no significant reduction in s. mutans count using oratest and dentocult sm strip mutans kit after two weeks of oil pulling twice daily using sesame oil . however the result may probably be due to the fact that oil pulling may take atleast four weeks to show its effect . sesame oil is more palatable when compared to other refined edible oils . in an in vitro study on oral biofilm model , sesame oil was observed to possess antibacterial activity against s. mutans ; sunflower oil had antibacterial activity against c. albicans ; and coconut oil was active against both s. mutans and c. albicans . a group of researchers compared oil pulling method using sesame oil with chlorhexidine mouthwash for two weeks on twenty adolescent subjects . there was statistically significant reduction in the s. mutans count in the plaque samples of oil pulling group after one and two weeks . also there was reduction in the mean scores of salivary s. mutans count after two weeks . however the study noted that the reduction in s. mutans count is more in chlorhexidine group than oil pulling group . three authors assessed the effect of oil pulling on plaque , gingivitis and also its safety on oral hard and soft tissue . asokan et al in their in vitro study observed that benefits of sesame oil on oral health are due to saponification , emulsification and mechanical cleansing action . singla et al observed significant reduction in the mean s. mutans and lactobacillus count in saliva , and also in the plaque scores and gingival scores in 32 subjects upon gum massage using sesame oil , olive oil and coconut oil . the subjects massaged their gums around all the teeth with the 2 ml oil for 10 min every day after tooth brushing using index finger in circular motion for a period of three weeks . dani n et al assessed the antiplaque effect of oil pulling using sesame oil in a randomized controlled trial . also the effect of sesame oil pulling on plaque induced thereafter randomly 20 subjects were instructed to perform oil pulling for 14 days ; remaining 20 subjects were given chlorhexidine mouth wash for 14 days . plaque index scores , gingival index scores and total colony counts of aerobic bacteria were reduced in oil pulling group after 14 days . kuroyama et al reported two cases of exogenous lipoid pneumonia in patients who habitually practiced oil pulling with sesame oil . the symptoms of exogenous lipoid pneumonia are fever , weight loss , cough , dyspnea , chest pain , and hemoptysis . if the aspirated oil is microorganism rich , then it may result in manifestation of lipoid pneumonia . oral malodor is due to the proteolytic activity of three bacterial species porphyromonas gingivalis , tannerella forsythia and/or treponema denticola . volatile sulfur compounds like hydrogen sulphide , methyl mercaptan and dimethyl sulphide are responsible for oral malodor . sood et al in their three week randomized controlled trial involving sixty subjects observed that oil pulling with sesame oil was equally efficient when compared with chlorhexidine mouthwash in reducing oral malodor and the causative microorganisms . the researchers noted that sesame oil reduces volatile sulfur compounds and mean anaerobic bacterial count in the oral cavity and hence resulting in reduced mean objective and subjective organoleptic scores . one hindrance for oil pulling noted was the long duration of time required to perform the procedure . five researchers in a randomized controlled pilot trial involving 20 adolescent subjects concluded that oil pulling with sesame oil is as effective as chlorhexidine to reduce halitosis and microorganisms associated with it . the subjects performed oil pulling once daily for 1015 min before tooth brushing for 14 days . modified gingival index score , plaque index score , organoleptic breath assessment score , self assessment of breath score and bana test scores from tongue coating samples reduced in both chlorhexidine and oil pulling groups . in a randomized controlled triple blind study involving 20 age matched adolescents , the effect of sesame oil pulling on plaque induced gingivitis and its efficiency when compared to 0.12% chlorhexidine mouth wash was evaluated for a period of ten days . oil pulling was performed everyday for 1 min in the morning after tooth brushing . plaque index scores and modified gingival index scores were recorded at the baseline and after ten days . plaque samples were collected to evaluate the microorganisms present and to calculate the total colony count of aerobic microorganisms after ten days . the study found statistically significant reduction in the pre- and post - values of the plaque and modified gingival index scores in both groups . three authors carried out a microbiological study on the effect of sesame oil pulling on plaque , gingivitis and colony forming bacteria . twenty subjects of the study performed oil pulling for 1520 min daily for a period of forty five days . the study observed that oil pulling resulted in statistically significant decrease in plaque , gingival scores and bacterial counts . plaque scores , gingival scores and number of bacterial colonies increased after forty five days in the twenty subjects of the control group who practiced routine oral hygiene practices . the authors concluded that oil pulling with sesame oil is an effective preventive oral hygiene method when practiced daily . sesame oil does not have side effects like staining , lingering aftertaste , and allergy . oil pulling has also been claimed to cure several diseases such as arthritis , allergies , asthma , migraine headaches , nerve paralysis , kidney and heart disorders etc , though it is not scientifically proven.9 , 24 however it certainly has positive benefits on oral health . care should be taken that oil is not swallowed as it is heavily loaded with toxic microorganisms . however if accidently small amounts of oil is swallowed , there is nothing to worry as the same is removed from the body through feces . oil pulling is observed to bring improvement in oral hygiene when practiced correctly and regularly . limited available research on effect of oil pulling on oral hygiene shows promising benefits of oil pulling procedure on oral cavity . however oil pulling does not replace dental therapy and is currently not recommended by american dental association . extensive research on the role of this traditional , cheap and valuable remedy should be encouraged without bias . based on currently available research it can be concluded that oil pulling when performed as recommended , can be safely used as an adjunct to maintain good oral hygiene and health along with the routine tooth brushing and flossing with promising positive results .
### Summary: : oil pulling is a traditional folk remedy practiced in ancient india . it is believed to cure more than thirty systemic diseases when practiced regularly and as directed . due to occurrence of side effects to modern medicines and oral hygiene products , people are increasingly attracted towards complementary and traditional practices . oil pulling in addition to offering several oral health benefits has also beneficial effects on overall health . the present article attempts to review and discuss this ancient practice .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : antibiomania , a term used to describe antibiotic - induced manic episodes , is a rare but genuine side effect of some antimicrobials . clarithromycin is among those more commonly associated with psychosis , with few reported cases involving amoxicillin . onset of these symptoms typically occurs within 7 days of medication initiation and resolution of symptoms occurs 2448 h after medication cessation . we report the case of a 49-year - old male without any previous psychiatric history who developed acute psychosis after starting triple therapy for helicobacter pylori with return of mental status to baseline after discontinuation of the regimen . the widely popular triple therapy that includes a proton pump inhibitor ( ppi ) , amoxicillin and clarithromycin is most commonly prescribed for patients infected with h. pylori . after an extensive review of the literature it was found that acute psychotic episodes in patients undergoing this treatment regimen have been reported , with clarithromycin as the probable culprit . a 49-year - old male with a history of gastroesophageal reflux disease and recently diagnosed h. pylori gastritis was brought to the emergency by his wife who had noted strange behavior in the patient 4 h prior at home . the wife initially had found the patient on the toilet non - verbal and unresponsive with a blank stare . the patient abruptly stated he felt as if he was leaving the planet , followed by cat - like screeching and movements . in the emergency room , the patient was noted to have bilateral upper extremity jerky movements , which resolved after 10 s without any medical intervention . no lip or tongue bites , bowel or urinary incontinence , foaming from the mouth or post - ictal confusion was witnessed . upon further inquiry , the patient did not have any history of previous seizures , stroke or transient ischemic attack . he was an emergency room attending physician maintaining his usual daily activities several hours prior to admission . there was no recent head trauma , subjective fevers , drug allergies , headaches , nausea or vomiting . the patient 's only medication was omeprazole 40 mg of 6 years duration daily for gastroesophageal reflux disease , and he had recently started on triple therapy for h. pylori gastritis , which included lansoprazole 30 mg twice daily , amoxicillin 1 g twice daily and clarithromycin 500 mg twice daily 5 days prior to presentation . vital signs at presentation were remarkable for a pulse rate of 108 bpm . on physical examination initial investigations included a finger stick glucose of 100 mg / dl along with a complete blood count , comprehensive metabolic panel , urinalysis , urine toxicology screen , and thyroid - stimulating hormone that were within normal limits . an electrocardiogram was significant for sinus tachycardia at 106 bpm , however acute coronary syndrome was ruled out with two consecutive negative sets of cardiac enzymes . the patient was admitted to the medical intensive care unit for further exploration of his acute psychosis and altered mentation . he underwent extensive testing to find an organic cause of this psychotic episode , including magnetic resonance imaging of the brain , magnetic resonance angiogram of the cranial vessels and a 24-hour electroencephalogram ( eeg ) , which failed to show any pathologies or irregularities . during inpatient hospitalization , symptoms began to subside within 24 h with complete resolution within 36 h. the patient became oriented and returned to his baseline mental status with no administration of antipsychotics . with no evidence of metabolic disturbances , neurologic illness , infection or organ failure , onset of symptoms days after initiation of treatment with rapid resolution of psychosis after discontinuation of medications verified amoxicillin , clarithromycin , lansoprazole or a combination of these drugs to be the likely trigger . the term antibiomania refers to manic episodes that occur after a patient starts taking antibiotics . according to the world health organization , the food and drug administration and the published literature , it was found that clarithromycin and ciprofloxacin are those most commonly linked to antibiomania . our report describes a patient who was being treated for h. pylori with triple therapy , which included the antimicrobials amoxicillin and clarithromycin , in addition to a ppi ( lansoprazole ) . h. pylori is a gram - negative bacterium that is found in the stomach of humans and which may lead to complications such as chronic gastritis , peptic ulcer disease and , more severely , gastric carcinoma . treatment duration lasts between 7 and 14 days with re - testing for h. pylori to verify eradication . although the incidence of antibiomania as a side effect of antimicrobials is low , it should still be recognized as a risk for patients undergoing treatment . the side effect profile of triple therapy is extensive with more common reactions relating to the gastrointestinal tract . commonly reported adverse reactions to ppis include nausea , vomiting , diarrhea , abdominal pain , dizziness and fatigue . adverse effects of penicillins , specifically amoxicillin , are typically related to allergic reactions as well as gastrointestinal symptoms including severe colitis . unlike with ppis , there have been several reported cases of central nervous system ( cns ) side effects and psychiatric consequences due to amoxicillin and clarithromycin . based on our review of the literature , acute psychosis from acid suppression therapy has not been well documented . a case of acute mania in a 60-year - old woman has been described secondary to use of ranitidine ( a histamine h2-receptor antagonist ) with resolution of symptoms after discontinuation of the offending medication . despite this report , our research lacked support of acute psychotic episodes secondary to acid suppression therapy via proton pump inhibition . in our patient , a history of long - term ppi use disqualified this element of triple therapy from being the likely trigger of acute psychosis . a review of the literature linking acute psychosis to amoxicillin yielded a few reported cases . reported a patient with mania and psychosis 10 days after initiation of amoxicillin for a urinary tract infection with complete resolution of these symptoms 12 days after discontinuation of the antibiotic . similarly , a patient prescribed amoxicillin - clavulanate for suspected pneumonia developed agitation and bizarre behavior with visual hallucinations and delusions within 2 h of administering antibiotics . another two reports described visual and auditory hallucinations within 12 days of starting amoxicillin in patients with no underlying psychiatric disorders [ 6 , 7 ] . all of these cases showed complete resolution of acute psychiatric symptoms upon cessation of amoxicillin . uses of this antibiotic include treatment of respiratory tract infections , infections due to mycobacterium avium complex ( m. avium or m. intracellulare ) and h. pylori . in addition to gastrointestinal complaints , clarithromycin may also produce symptoms of confusion , insomnia , dizziness , and lightheadedness . cns side effects including psychosis and depersonalization have also been reported , more so than with amoxicillin . a number of these cases presume drug interactions as the trigger for psychosis when a patient is receiving two or more medications . clarithromycin is metabolized via the cyp3a pathway , specifically via cytochrome p450 isoenzyme by oxidation and demethylation [ 9 , 10 ] . many occurrences of clarithromycin - induced psychosis can be explained in patients receiving other drugs also metabolized through this same mechanism . clarithromycin occupies and inhibits the p450 enzyme during metabolism , resulting in accumulation of the co - administered drug(s ) , leading to toxic levels . pollak et al . reported fluoxetine toxicity in a patient who had been on fluoxetine for 16 months and experienced psychosis within 1 day of starting clarithromycin . there are also reports of patients with hiv on highly active antiretroviral therapy in whom neuropsychiatric reactions are described upon initiation of clarithromycin . corticosteroids are a known trigger for psychotic episodes , and there have been studies revealing a correlation between dose of the steroid and prevalence of psychosis [ 13 , 14 ] . finkenbine and frye report psychosis in a patient on prednisone and clarithromycin , likely due to decreased clearance of prednisolone . transient carbamazepine overdose as a result of delayed metabolism [ 16 , 17 ] and serotonin syndrome with psychosis caused by intake of both clarithromycin and paroxetine have also been described . in the aforementioned cases , onset of symptoms on average occurred within 15 days of initiating therapy . in all cases , symptoms resolved upon cessation of clarithromycin , mostly within 13 days . gomez - gil et al . described two middle - aged females without any past psychiatric history who presented with bizarre behavior and an inability to comprehend after initiation of clarithromycin therapy for h. pylori infection . the onset of symptoms occurred within 7 days in each patient , similar to our patient ; however amoxicillin was not included in their regimen . similarly , a 65-year - old female undergoing treatment with clarithromycin and omeprazole developed a manic episode 3 days after initiation of this antimicrobial with resolution of symptoms occurring 2 days after medication was stopped . clarithromycin has been known to cause acute psychiatric episodes in the treatment for various infections in addition to h. pylori . vicente de vera et al . described a patient with no previous psychiatric history who developed agitation and delirium 3 days after starting clarithromycin treatment for a community - acquired pneumonia with complete resolution of symptoms after removing treatment . clarithromycin used for treatment of m. avium complex triggered reversible mania in two patients with aids not on highly active antiretroviral therapy . a trial of azithromycin , another macrolide antibiotic , did not induce psychotic episodes in these patients . a group of elderly patients ( n = 13 , mean age 70 years ) with chronic mycobacterial lung disease without hiv were monitored after receiving clarithromycin monotherapy . common side effects included bitter taste and nausea , with 7 of the 13 patients experiencing confusion and insomnia . a 52-year - old female being treated for acute bronchitis with clarithromycin twice daily developed acute psychosis with symptoms of disorganized behavior , paranoid ideation , anxiety , confusion and depersonalization 24 h after initiation of therapy . there are several other reports in the literature describing mania after starting clarithromycin monotherapy with extinction of symptoms within several days ( average 35 days ) of discontinuing this drug [ 25 , 26 , 27 , 28 , 29 ] . neurotoxicity of clarithromycin leading to non - convulsive status epilepticus ( ncse ) has also been associated with this antibiotic . reported the first case of clarithromycin - induced delirium due to ncse in a 74-year - old woman being treated for bronchitis with clarithromycin . among previously reported cases of clarithromycin - induced neurotoxicity , only 6 patients were evaluated with an eeg , with 5 showing no evidence of epileptic activity . an eeg was performed in our patient excluding the possibility of epileptiform activity induced by clarithromycin . eeg is an important tool in working up a patient presenting with acute psychosis suspected to be secondary to an antimicrobial because with ncse there is response to treatment with benzodiazepines in addition to drug cessation . a commonly accepted theory with polypharmacy includes the suppression of cytochrome p450 by clarithromycin with a resultant accumulation of clarithromycin and/or the associated drug(s ) . clarithromycin alone may be directly toxic to the cns via its lipid - soluble active metabolite 14-hydroxyclarithromycin . clarithromycin and its metabolite have also been known to alter cortisol and prostaglandin metabolism , and interact with glutaminergic and -aminobutyric acid pathways possibly leading to cns side effects [ 1 , 12 ] . though these are all plausible explanations , how clarithromycin causes neurotoxicity remains a matter of debate requiring further research . acute psychosis in patients without previous psychiatric illness entails a wide differential requiring extensive investigation . initial workup should focus on causes secondary to infectious processes , along with both toxic and metabolic etiologies , however medications must be thoroughly reviewed . antibiomania is an infrequent but valid consequence of antimicrobials and must be included in the differential as a trigger for acute psychosis . in our patient , amoxicillin and clarithromycin had been started several days prior to the onset of psychosis for eradication of h. pylori . after ruling out other possible causes of psychosis , it was concluded that either amoxicillin or clarithromycin were the likely triggers . based off an extensive literature review , clarithromycin was the likely agent responsible for symptoms . clinicians should be cognizant of the psychiatric side effects secondary to clarithromycin and discontinuation should be prompt for rapid recovery of mental status .
### Summary: : the term antibiomania refers to manic episodes that occur after a patient starts taking antibiotics . we report the case of a 49-year - old male who developed acute psychosis secondary to initiation of triple therapy for helicobacter pylori eradication . unlike with proton pump inhibitors , there have been several reported cases of central nervous system side effects and psychiatric consequences due to amoxicillin , however evidence points to clarithromycin as the likely culprit . on average onset of symptoms occurred within 15 days of initiating therapy . in all cases , symptoms resolved upon cessation of clarithromycin , mostly within 13 days . unfortunately , the mechanism through which clarithromycin causes neurotoxicity remains unclear . clinicians should be cognizant of psychiatric side effects secondary to clarithromycin , and discontinuation should be prompt for rapid recovery of mental status .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : approval for the study was obtained from the hospital 's ethical committee and followed the tenets of the declaration of helsinki . study participants gave informed consent before initiation of any study - related procedures , and the study was conducted in compliance with informed consent regulations . enrolled patients were men or women of at least 18 years of age with a clinical diagnosis of poag or ntg , who were uncontrolled on a single or a double medication other than the eye drops to be studied . patients using ocular hypotensive drugs completed a washout of all drugs of appropriate duration before study entry ( 6 weeks for prostaglandin analogs , 4 weeks for topical beta - blockers , and 2 weeks for adrenergic agents or carbonic anhydrase inhibitors ) . active ocular disease other than poag / ntg that would interfere with study outcomes ; sensitivity or allergy to any component of either study drug ; pregnancy , planning a pregnancy , or breastfeeding ; functionally marked visual field loss ; ocular surgery within the last 3 months ; concomitant usage of ocular drugs ( except intermittent use of artificial tears ) ; and active systemic disease or plans to change ongoing systemic treatment that might affect iop . after meeting all inclusion criteria and completing a washout of any ocular hypotensive agents , patients were randomized using a computer - generated randomization into two groups to receive either bt or dt twice daily . although the investigators ( authors ) were not blinded to the randomization , the multiple iop measurements were done by different fellows and residents who were not aware of the study nature . patients were evaluated at baseline , 2 weeks , and 1 , 2 , and 3 months . iops were measured 3 times at 10:00 and another 3 times 18:00 at each study visit using goldman applanation tonometry , and an average was taken for each eye ( 3 time points measurements were not feasible at our hospital ) . the recorded average iops were compared between the 2 groups and further analyzed in terms of age and gender . baseline and follow - up visits ' evaluations included medical and ophthalmic history and a complete ophthalmic examination ( visual acuity , external exam , slit - lamp biomicroscopy , and measurement of iop ) . patients were asked about adverse events and compliance , and their responses recorded at each follow - up study visit . score 3 was given for the best tolerability with no ocular discomfort felt by the patients ; score 2 was given if the patients felt ocular discomfort in the form of burning or stinging sensation ; score 1 was given for ocular discomfort plus ocular pain ; finally , score 0 was given for ocular discomfort plus ocular pain plus blurred vision . a patient was considered clinically successful if the investigator , after considering iop - lowering efficacy , tolerability , and any adverse events , continued the patient on his or her study drug at 3 months . the primary outcome measures were the mean change in iop and the mean percentage of drop of iop from baseline at each visit by applanation tonometer . secondary outcome measures included the incidence of adverse events and tolerability of the used drug . data were statistically described in terms of mean standard deviation ( sd ) , frequencies ( number of cases ) , and percentages when appropriate . since numerical data were not violating normal assumption , comparison between the study groups was done using student 's t - test for independent samples . within group , comparison was done using repeated measure anova followed by paired t - test as a post hoc two group comparisons . for comparing categorical data , all statistical calculations were done using statistical package for the social science ( spss ; spss inc . , power analysis was done for the change in iop over the study period as the primary outcome of this study . student 's t - test for independent samples was chosen to perform the analysis ; the -error level was fixed at 0.05 , and the sample size was entered to be 36 participants for each group . to be most conservative , the intragroup sd was set at the highest recorded one . accordingly , the power of our statistical results was 98.3% , 92.6% , 92.7% , and 89.8% at 2 weeks and 1 , 2 , and 3 months , respectively . calculations were done using ps power and sample size calculations software , version 2.1.30 for ms windows ( william d. dupont and walton d. vanderbilt , usa ) . active ocular disease other than poag / ntg that would interfere with study outcomes ; sensitivity or allergy to any component of either study drug ; pregnancy , planning a pregnancy , or breastfeeding ; functionally marked visual field loss ; ocular surgery within the last 3 months ; concomitant usage of ocular drugs ( except intermittent use of artificial tears ) ; and active systemic disease or plans to change ongoing systemic treatment that might affect iop . after meeting all inclusion criteria and completing a washout of any ocular hypotensive agents , patients were randomized using a computer - generated randomization into two groups to receive either bt or dt twice daily . although the investigators ( authors ) were not blinded to the randomization , the multiple iop measurements were done by different fellows and residents who were not aware of the study nature . patients were evaluated at baseline , 2 weeks , and 1 , 2 , and 3 months . iops were measured 3 times at 10:00 and another 3 times 18:00 at each study visit using goldman applanation tonometry , and an average was taken for each eye ( 3 time points measurements were not feasible at our hospital ) . the recorded average iops were compared between the 2 groups and further analyzed in terms of age and gender . baseline and follow - up visits ' evaluations included medical and ophthalmic history and a complete ophthalmic examination ( visual acuity , external exam , slit - lamp biomicroscopy , and measurement of iop ) . patients were asked about adverse events and compliance , and their responses recorded at each follow - up study visit . score 3 was given for the best tolerability with no ocular discomfort felt by the patients ; score 2 was given if the patients felt ocular discomfort in the form of burning or stinging sensation ; score 1 was given for ocular discomfort plus ocular pain ; finally , score 0 was given for ocular discomfort plus ocular pain plus blurred vision . a patient was considered clinically successful if the investigator , after considering iop - lowering efficacy , tolerability , and any adverse events , continued the patient on his or her study drug at 3 months . the primary outcome measures were the mean change in iop and the mean percentage of drop of iop from baseline at each visit by applanation tonometer . secondary outcome measures included the incidence of adverse events and tolerability of the used drug . data were statistically described in terms of mean standard deviation ( sd ) , frequencies ( number of cases ) , and percentages when appropriate . since numerical data were not violating normal assumption , comparison between the study groups was done using student 's t - test for independent samples . within group , comparison was done using repeated measure anova followed by paired t - test as a post hoc two group comparisons . for comparing categorical data , all statistical calculations were done using statistical package for the social science ( spss ; spss inc . , power analysis was done for the change in iop over the study period as the primary outcome of this study . student 's t - test for independent samples was chosen to perform the analysis ; the -error level was fixed at 0.05 , and the sample size was entered to be 36 participants for each group . to be most conservative , the intragroup sd was set at the highest recorded one . accordingly , the power of our statistical results was 98.3% , 92.6% , 92.7% , and 89.8% at 2 weeks and 1 , 2 , and 3 months , respectively . calculations were done using ps power and sample size calculations software , version 2.1.30 for ms windows ( william d. dupont and walton d. vanderbilt , usa ) . power analysis was done for the change in iop over the study period as the primary outcome of this study . student 's t - test for independent samples was chosen to perform the analysis ; the -error level was fixed at 0.05 , and the sample size was entered to be 36 participants for each group . to be most conservative , the intragroup sd was set at the highest recorded one . accordingly , the power of our statistical results was 98.3% , 92.6% , 92.7% , and 89.8% at 2 weeks and 1 , 2 , and 3 months , respectively . calculations were done using ps power and sample size calculations software , version 2.1.30 for ms windows ( william d. dupont and walton d. vanderbilt , usa ) . seventy - three eyes of 73 patients were originally enrolled in this study ; 37 patients ( 37 eyes ) in bt group and 36 patients ( 36 eyes ) in dt group . there were no statistically significant differences between the two treatment groups in patient demographics ; mean patients ' age were bt = 19.94 50.73 ( 7218 ) and dt = 18.41 52.61 ( 7218 ) ( p = 0.677 ) , and sex ratios were 1:1 for both groups . baseline characteristics : rate of hypertension showed no significant difference ( bt = 10 , dt = 14 , p : 0.072 ) ; however , there was significant difference regarding the rate of diabetes ( bt = 13 , dt = 6 , p = 0.042 ) . in the bt , there were 13 ( 35.1% ) diabetic patients ; type i diabetes mellitus ( dm ) was in 3 ( 23.1% ) and type ii dm in 10 ( 76.9% ) . in the dt , there were 6 ( 16.7% ) diabetic patients ; type i dm was in 2 ( 33.3% ) and type ii dm in 4 ( 66.6% ) . however , subgroup analysis was not possible due to the small sample size . at the baseline visit , there were statistically significant between - group differences in mean iop ; 24.14 4.49 mmhg ( range : 1435 mmhg , median = 25.00 mmhg ) and 29.53 5.99 mmhg ( range : 1844 mmhg , median = 30.00 mmhg ) for bt and dt , respectively ( p < 0.001 ) . the repeated measure of anova for the mean iop values within each group showed provided statistically significant reductions of baseline iop at all study visits ( p < 0.001 ) . the mean iop for dt was lower than bt at all visits and was significant only at 2 weeks ( p = 0.037 ) , with no significant difference at all other follow - up visits [ fig . 1 ] . mean intraocular pressure for brinzolamide / timolol and dorzolamide / timolol at baseline and follow - up visits there was a statistically significant higher percentage of iop reduction for dt than bt at all study visits [ fig . 2 ] . comparison between the percentage intraocular pressure reduction in dorzolamide / timolol and brinzolamide / timolol group there was complete ocular comfort without any ocular adverse effects in 31 patients ( 81.1% ) in the dt group and 11 patients ( 29.7% ) in the bt group ( p < 0.001 ) . ocular discomfort and ocular pain were experienced by patients from both groups , but it was unexpectedly higher in the bt group . ocular discomfort was found in 9 patients ( 24.3% ) in the bt group and only in 4 patients ( 11.1% ) in the dt group ( p < 0.001 ) . ocular pain was found in 9 patients ( 24.3% ) from the bt group and in 1 patient ( 2.8% ) from the dt group ( p < 0.001 ) . blurred vision in 8 patients ( 21.6% ) only in the bt and it was not found in the dt ( p < 0.001 ) [ table 1 ] . tolerability of brinzolamide / timolol and dorzolamide / timolol fixed combinations the rate of clinical success was significantly different between each treatment group . in the bt group , 86.5% of patients ( 32/37 ) were considered clinically successful , compared with 94.4% of patients ( 34/36 ) in the dt group , which was statistically significant ( p < 0.001 ) . the repeated measure of anova for the mean iop values within each group showed provided statistically significant reductions of baseline iop at all study visits ( p < 0.001 ) . the mean iop for dt was lower than bt at all visits and was significant only at 2 weeks ( p = 0.037 ) , with no significant difference at all other follow - up visits [ fig . 1 ] . mean intraocular pressure for brinzolamide / timolol and dorzolamide / timolol at baseline and follow - up visits there was a statistically significant higher percentage of iop reduction for dt than bt at all study visits [ fig . 2 ] . comparison between the percentage intraocular pressure reduction in dorzolamide / timolol and brinzolamide / timolol group there was complete ocular comfort without any ocular adverse effects in 31 patients ( 81.1% ) in the dt group and 11 patients ( 29.7% ) in the bt group ( p < 0.001 ) . ocular discomfort and ocular pain were experienced by patients from both groups , but it was unexpectedly higher in the bt group . ocular discomfort was found in 9 patients ( 24.3% ) in the bt group and only in 4 patients ( 11.1% ) in the dt group ( p < 0.001 ) . ocular pain was found in 9 patients ( 24.3% ) from the bt group and in 1 patient ( 2.8% ) from the dt group ( p < 0.001 ) . blurred vision in 8 patients ( 21.6% ) only in the bt and it was not found in the dt ( p < 0.001 ) [ table 1 ] . the rate of clinical success was significantly different between each treatment group . in the bt group , 86.5% of patients ( 32/37 ) were considered clinically successful , compared with 94.4% of patients ( 34/36 ) in the dt group , which was statistically significant ( p < 0.001 ) . more than 50% of glaucoma patients will need more than one drug to reach their target iop . reducing the amount of drops by including more than one medication in a fixed combination will reduce the side effects and increase compliance . although the tolerability is identified as a barrier to compliance , the issue of efficacy needs to be carefully investigated first before investigating patients ' drug tolerability . there are limited published data regarding the iop - reducing power comparison between bt and dt as most of the studies were more concerned with tolerability rather than the efficacy of the drug . the purpose of our study was to compare the ocular hypotensive effect of bt versus dt in a hospital - based population with poag or ntg as the primary outcome with patients ' tolerability as secondary outcome . regarding the efficacy of these drugs , only 2 head to head study reports have found that the efficacy of bt is similar to dt . other studies measuring bt efficacy alone showed similar efficacy to that of dt reported in the earlier literature . however , in our study , we found that both bt and dt significantly reduced the iop at all study visits , but there were lower mean iops for dt than bt at all study visits that was statistically significant at 2 weeks . there was also a statistically significant higher percentage of iops reduction with dt than bt at all study visits . compared the efficacy and tolerability of bt and dt ; data were collected from 437 cases of open - angle glaucoma and ocular hypertension . they found that iop reductions ranged from 7.2 to 9.2 mm hg for bt and from 7.4 to 8.9 mm hg for dt . although a similar overall safety profile was observed between the 2 treatment groups , bt showed significantly less ocular irritation ( 2.7% vs. 10.6% ; p = 0.0009 ) than bt . found the iop reductions with bt ranged from 6.42 to 9.74 mmhg ( 26.0937.46% ) , whereas dt produced mean iop reductions ranging from 8.16 to 12.41 mmhg ( 31.1941.44% ) ( p > 0.05 ) . showed the iop - reducing power of the bt ( 33% ) and dt ( 30% ) were to be similar . reported that bt provided an approximately 3033% iop reduction from the untreated baseline iop of 2527 mmhg and concluded that bt is similarly effective but better tolerated than the dt . regarding the tolerability of the drug , because the beta - blocker component of the two carbonic anhydrase inhibitor containing fixed combination products is identical , any dissimilarity in tolerability is likely due to differences in ph between brinzolamide and dorzolamide . dt is formulated at an acidic ph of 5.65 whereas bt has a near physiologic ph of 7.2 . the main difference between these two ocular hypotensive agents lies in their safety profile , with dt causing more ocular discomfort to appear while installing ( burning and stinging ) . we used a scoring system to evaluate tolerability ranging from 0 ( worst tolerability , with severe ocular discomfort ) to 3 ( best tolerability , with no ocular discomfort ) . unexpectedly , we found that there was a significant difference in the tolerability of both fixed combinations with better tolerability in the dt group . in the bt group , we found that eight eyes ( 21.6% ) suffered from ocular irritation in the form of stinging and burning sensation associated with ocular pain and blurred vision ; these eyes was given score 0 . while eleven eyes ( 29.7% ) did not suffer from any ocular discomfort and was given score 3 . while in the dt , no eyes suffered from severe ocular discomfort , and thirty - one eyes ( 86.1% ) did not suffer from any ocular discomfort ( p < 0.001 ) . the difference in the results could be related to the different sample size of each study which is considered one of the limitations of our study as we have a small sample size . the different scoring system to evaluate the tolerability could be another factor affecting the results . for example , firat et al . in 2012 used the ocular surface disorder index , as well as performing schirmer test , tear breakup time and ocular impression cytology to test the tolerability of the drug . lanz and rabert in 2011 judged the tolerability by being positive or negative tolerability ; they found high satisfaction rating in 93.4% from a total of 14,025 eyes . another scoring system was adopted by vold et al . , in 2008 , where ocular discomfort score was judged by a score ranged from 0 ( none ) 4 ( very severe ) ; they found very severe ocular irritation in < 5% of the cases . mundorf et al . in 2008 performed their study on 127 patients ; there was an ocular discomfort scale ranging from 0 ( no discomfort ) to 9 ( significant discomfort ) . ocular discomfort scores were significantly higher with dt than bt ( 2.9 vs. 1.4 , respectively ; p < 0.0001 ) . they found significantly more patients reported ocular pain and discomfort after dt instillation and transient blurred vision than after bt instillation . in our study , although the patients were randomly assigned to received dt and bt , the baseline mean iops were significantly higher in the dt group than the bt group . however , despite starting at significantly higher mean iops , the dt group had lower mean iops at each visit which was statistically significant at 2 weeks and a statistically significant higher percentage of iop reduction by dt at 2 weeks and 3 months . the difference in structure between both brinzolamide and dorzolamide could lead to a different synergy of each drug with timolol . that is , the fixed combination does not usually have a power equals to the exact algebraic addition of each of its component drugs ' powers when used alone . thus , a fixed combination of each with timolol might have a different iop - lowering power despite both ( brinzolamide and dorzolamide ) reported to have a similar efficacy when each was compared alone head to head . the results of the present study suggest that bt and dt provide effective iop - lowering in patients with poag in this sample of a hospital population . mean percentage of iop reductions from baseline were clinically and statistically greater , and patients were more likely to achieve and maintain low target pressures with dt than with bt . these findings suggest that dt is a more appropriate therapeutic choice for iop lowering than bt for patients in need of more than eye drop . we do believe that future studies will confirm that dt is a stronger ocular hypotensive drop than bt . however , a large multicenter expansion of the present study is needed to further evaluate this wide gap we found between both medications .
### Summary: : purpose : to compare the efficacy and tolerability of brinzolamide / timolol ( bt ) and dorzolamide / timolol ( dt ) fixed combinations on intraocular pressure ( iop ) reduction.methods:patients with primary open angle glaucoma or normal tension glaucoma were randomized to receive either bt or dt . iops were measured at baseline , 2 weeks , and 1 , 2 , and 3 months . the primary outcome measures were the mean change in iop from baseline at each visit . secondary outcome measures included the tolerability of each fixed combination.results:seventy-three patients ( 73 eyes ) were included ; 37 eyes in bt group and 36 eyes in dt group . baseline mean iop were 24.14 4.5 and 29.53 6 mmhg for bt and dt , respectively ( p < 0.001 ) . both bt and dt provided statistically significant mean iop reductions from baseline values within each group at all study visits ( p < 0.001 ) . dt provided greater mean iop reductions from baseline than bt at each visit which was statistically significant at 2 weeks ( p = 0.037 ) . mean percentage of iop reduction was 24.35% and 46.33% at 2 weeks ( p < 0.001 ) , and 24.65% and 47% at 3 months ( p < 0.001 ) for bt and dt , respectively . patients ' tolerability appeared to be better for dt than for bt with complete ocular comfort without any ocular adverse effects in 31 patients ( 81.1% ) in dt group and 11 patients ( 29.7% ) in bt group ( p < 0.001).conclusion : both drops provide effective iop reduction which was greater , and patients were more likely to achieve lower target pressures with dt than with bt .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : multiple cutaneous piloleiomyomas are associated with uterine fibroids in women ( reed 's syndrome ) and it is a marker of a condition called hereditary leiomyomatosis and renal cell cancer ( hlrcc ) . cutaneous leiomyomas originate from the skeletal muscle of the arrector pili , muscle of the hair follicle ( piloleiomyoma ) , tunica dartos of the scrotum , mamillary muscle of the nipple ( genital leiomyoma ) , and the smooth muscle of the blood vessels ( angioleiomyoma ) . in women , calcium channel blocker like nifedepine , phenoxybenzamine , and gabapentine have been used to control pain.[46 ] a 25-year - old unmarried man presented with generalized multiple painful tumors of 8 years duration . lesions begun as small pea - sized , skin - colored papules over right lower limb . as it was asymptomatic , gradually , the lesions over the right lower limb increased in size to 4 - 6 centimeters . for the past 4 years , multiple new lesions started appearing over trunk , left lower limb , and upper limb . multiple soft to firm tumors of varying in size from 5 mm to 5 cms were seen over the entire length of right lower limb [ figures 1 and 2 ] . few tumors were also seen over left lower limb , upper limb , upper chest , and back [ figure 3 ] . histopathology revealed normal epidermis and dermis showing interweaving bundles of spindle - shaped cells of dermal smooth muscle , which were strongly eosinophilic [ figures 4 and 5 ] . large tumors of more than 3 centimeters were excised under local anesthesia , as they were very painful and cosmetically disfiguring . piloleiomyoma : multiple skin - colored shiny tumors of varying size seen over entire right lower limb piloleiomyoma : close - up view of the tumor . note telengiectatic vessels over the surface of the tumor piloleiomyoma : small tumors seen over upper chest piloleiomyoma : epidermis normal , dermis showing interweaving bundles of spindle - shaped cells of dermal smooth muscle , which are strongly eosinophilic ( h and e , 100 ) piloleiomyoma : high power view of the interweaving bundles of spindle cells ( h and e , 400 ) piloleiomyoma , angioleiomyoma , and genital leiomyoma are the 3 distinct types of cutaneous leiomyomas described . . they may be solitary or multiple and present as skin - colored to erythematous papulonodules over the extensor surface of the extremities , trunk , face , and neck . the arrector pili muscle , from which the piloleiomyomas originate , attaches proximally to the hair follicle and distally to the multiple attachment points within the papillary and reticular dermis and basement membrane zone . the characteristic feature in most of the patients with multiple leiomyomas is pain , which may be induced by cold , tactile , or emotional stimuli , but it can also be spontaneous . it may be due to the local pressure exerted by the tumor on cutaneous nerves ; otherwise , the infiltrating mast cells may play some role . others have suggested that muscle contraction may play a role in the induction of pain . hence , calcium channel blockers have a role in relieving pain associated with cutaneous leiomyoma . since they often develop in papillary dermis , they are fixed to skin ; however , they can be moved easily over the deeper subcutaneous tissues . several conditions ban be associated with piloleiomyomas like reed 's syndrome ( associated with uterine leiomyoma ) , erythrocytosis / polycythemia , and visceral involvement ( gastrointestinal tract and retroperitoneal area ) . the gene responsible for reed 's syndrome has been localized to chromosome 1q42.3 - 43 , encoding for fumarate hydratase enzyme . therefore , a detailed history , examination , and appropriate investigations should be carried out in patients with multiple piloleiomyomas . various drugs have been tried with variable results , calcium channel blockers like nifedepine , a - adrenoreceptor blockers ( phenoxybenzamine ) , nitrates , analgesics , antidepressants , and gabapentin . multiple cutaneous piloleiomyoma can also present without any risk of renal cell cancer in a young male . surgical excision of large lesions will provide relief from pain and improve quality of life .
### Summary: : cutaneous piloleiomyoma is a rare benign tumor of skin originating from skeletal muscle of arrector pili attached to hair follicle . it can be single or multiple , solitary piloleiomyoma are common over genitalia . multiple cutaneous piloleiomyomas are rare and they can cause pain on exposure to cold or with emotional disturbance . the prognosis of cutaneous piloleiomyomas after surgical excision is good . here , we present a rare case of generalized multiple cutaneous piloleiomyoma in a young male .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : it is known that dna hypomethylation results in chromosomal instability as a result of changes in chromatin structure and that dna hypermethylation of cpg islands silences tumor - related genes in cooperation with histone modification in human cancers [ 15 ] . the incidence of dna methylation alterations is generally high in cancers of various organs , and particular dna methylation profiles are significantly associated with poorer tumor differentiation , tumor aggressiveness , and poor prognosis [ 68 ] . moreover , unlike alterations of mrna and protein expression , which can be easily affected by the microenvironment of cancer cells , dna methylation alterations are stably preserved on dna double strands by covalent bonds and can be detected using highly sensitive methodology . therefore , alterations of dna methylation can become optimal diagnostic markers of cancers and prognostic indicators for affected patients . with regard to pancreatic carcinogenesis , we have reported that accumulation of dna methylation of tumor - related genes is associated with overexpression of dna methyltransferase ( dnmt ) 1 , the major dnmt , even in peripheral pancreatic duct epithelia with an inflammatory background , in comparison with normal peripheral pancreatic duct epithelia . ductal adenocarcinomas of the pancreas frequently develop after chronic damage due to pancreatitis , and at least a proportion of peripheral pancreatic duct epithelia with an inflammatory background are at the precancerous stage . the average number of methylated tumor - related genes and the incidence of dnmt1 overexpression increase progressively with the progression of another precancerous lesion , pancreatic intraductal neoplasia , to well - differentiated ductal adenocarcinoma , and finally to poorly differentiated ductal adenocarcinoma , suggesting that dna methylation alterations participate in multistage pancreatic carcinogenesis [ 9 , 10 ] . however , even though we and other groups have examined the dna methylation status of several specific tumor - related genes [ 9 , 1317 ] , only a few previous studies have employed recently developed array - based technology for analysis of dna methylation in ductal adenocarcinomas of the pancreas [ 18 , 19 ] . to our knowledge , no diagnostic criteria have yet been established for pancreatic cancers on the basis of such genome - wide dna methylation profiling . in the present study , in order to obtain diagnostic markers and prognostic indicators of ductal adenocarcinomas of the pancreas , we performed bacterial artificial chromosome ( bac ) array - based methylated cpg island amplification ( bamca ) [ 2022 ] , which is a technique suitable for overviewing the dna methylation tendency of individual large regions among all chromosomes [ 23 , 24 ] , in samples of normal pancreatic tissue obtained from patients without ductal adenocarcinomas ( c ) , noncancerous pancreatic tissue obtained from patients with ductal adenocarcinomas ( n ) , and cancerous tissue ( t ) . ninety - one t - samples were obtained from surgically resected specimens from patients with ductal adenocarcinomas who underwent pancreatectomy at the national cancer center hospital , tokyo , japan , between 2003 and 2008 . from 33 of the 91 patients microscopic examination of the histological specimens taken from a region immediately adjoining that from which n - samples had been obtained revealed various degrees of chronic pancreatitis , but no contaminating cancer cells . fifteen c - samples were obtained from patients without ductal adenocarcinomas who underwent pancreatectomy for metastasis of renal cell carcinoma ( 1 patient ) , adenocarcinoma of the gallbladder ( 3 patients ) , adenocarcinoma of the papilla of vater ( 6 patients ) , serous cystadenoma ( 1 patient ) , mucinous cystadenoma ( 1 patient ) , solid - pseudopapillary neoplasm ( 1 patient ) , endocrine tumor ( 1 patient ) of the pancreas , and lymphoplasmacytic pancreatitis ( 1 patient ) . the total samples were randomly divided into a learning cohort ( 8 c- , 17 n- , and 46 t - samples ) and a validation cohort ( 7 c- , 16 n- , and 45 t - samples ) . in the learning cohort , patients from whom c- , n- , and t - samples were obtained comprised 5 men and 3 women with a mean age of 69.6 8.1 ( mean sd ) years , 6 men and 11 women with a mean age of 67.6 10.1 years , and 28 men and 18 women with a mean age of 64.2 10.8 years , respectively . in the validation cohort , the patients from whom c- , n- , and t - samples were obtained comprised 3 men and 4 women with a mean age of 62.9 18.2 years , 11 men and 5 women with a mean age of 65.0 8.7 years , and 27 men and 18 women with a mean age of 64.6 9.7 years , respectively . the clinicopathological parameters of patients who provided t - samples in both the learning and validation cohorts are summarized in table 1 . this study was approved by the ethics committee of the national cancer center , tokyo , japan , and was performed in accordance with the declaration of helsinki , 1995 . high - molecular - weight dna from fresh frozen tissue samples was extracted using phenol - chloroform , followed by dialysis . dna methylation status was analyzed by bamca using a custom - made array ( mcg whole genome array-4500 ) harboring 4361 bac clones located throughout chromosomes 1 to 22 , x and y , as described previously [ 23 , 26 , 27 ] . briefly , a mixture of normal pancreatic tissue dna obtained from 8 c - samples in the learning cohort was used as a reference for all analyses of test dna samples in both the learning and validation cohorts . five - microgram aliquots of test or reference dna were first digested with 100 units of methylation - sensitive restriction enzyme sma i ( neb , ipswich , ma ) and subsequently with 20 units of methylation - insensitive xma i ( neb ) . adapters were ligated to xma i - digested sticky ends , and polymerase chain reaction ( pcr ) was performed with an adapter primer set . test and reference pcr products were labeled by random priming with cy3- and cy5-dctp ( ge healthcare , buckinghamshire , uk ) , respectively , and precipitated together with ethanol in the presence of cot - i dna ( invitrogen , carlsbad , ca ) . the mixture was applied to array slides and incubated at 43c for 63 h. arrays were scanned with a genepix personal 4100a ( molecular devices , sunnyvale , ca ) and analyzed using genepix pro 5.0 imaging software ( molecular devices ) and acue 2 software ( mitsui knowledge industry , tokyo , japan ) . the signal ratios were normalized in each sample to make the mean signal ratios of all bac clones 1.0 . the reproducibility of bamca data was confirmed in representative samples by the duplicate study ( data not shown ) . bac clones whose signal ratios obtained by bamca differed significantly between the groups of samples were identified by wilcoxon test . survival curves of patient groups were calculated by the kaplan - meier method , and the differences were compared using the log - rank test . the cox proportional hazards multivariate model was used to examine the prognostic impact of dna methylation status , surgical margin status ( r0 versus r1 or r2 ) and lymph node metastasis . figure 1 shows representative examples of scanned array images and scattergrams of the signal ratios ( test signal/ reference signal ) for a c - sample , a n - sample , and the corresponding t - sample . in all c - samples , the signal ratios of 97% of the bac clones were between 0.67 and 1.5 ( red lines in figure 1(b ) ) . therefore , in n- and t - samples , dna methylation status corresponding to a signal ratio of less than 0.67 and more than 1.5 was defined as dna hypo- and hypermethylation of each bac clone relative to c - samples , respectively , as in our previous studies [ 23 , 26 , 27 ] . in n - samples , in t - samples , more bac clones showed dna hypo- or hypermethylation , and the degree of dna hypo- or hypermethylation , that is , deviation of the signal ratio from 0.67 or 1.5 , was increased in comparison with n - samples ( figure 1(b ) ) . wilcoxon test ( p < .01 ) revealed that the average signal ratios of 331 bac clones ( supplementary table si available at doi:10.1155/2011/780836 ) in t - samples differed significantly from those in both c- and n - samples . figure 2(a ) shows scattergrams of the signal ratios for representative examples of the 331 bac clones : rp11 - 88p10 and rp11 - 424k7 were able to discriminate t - samples from both c- and n - samples with 100% specificity ( the ratio of the number of true negatives to the number of true negatives and false positives ) using cutoff values of 0.86 and 1.29 ( dotted lines in figure 2(a ) ) , respectively , ( specificity was calculated as the ratio of the number of c- and n - samples showing signal ratios of 0.86 or more than 0.86 and 1.29 or less than 1.29 relative to the total number of c- and n - samples , resp . ) . the cutoff values of the signal ratios and sensitivities ( the ratios of the number of true positives to the number of true positives and false negatives ) of 12 bac clones for which such discrimination was performed with 100% specificity are shown in table 2 . a histogram showing the number of bac clones satisfying the criteria listed in table 2 in 8 c - samples , 17 n - samples , and 46 t - samples in the learning cohort is shown in figure 2(b ) . based on this histogram , we finally established the following criteria : when tissue samples satisfied the criteria in table 2 for 1 or more bac clones , they were judged to be ductal adenocarcinomas , and when tissue samples did not satisfy the criteria for any bac clone , they were judged not to be ductal adenocarcinomas . based on these criteria , both the sensitivity and specificity for diagnosis of t - samples in the learning cohort as ductal adenocarcinomas were 100% ( sensitivity was calculated as the ratio of the number of t - samples satisfying the criteria in table 2 for 1 or more bac clones to the total number of t - samples , and specificity was calculated as the ratio of the number of c- and n - samples not satisfying the criteria in table 2 for any bac clone relative to the total number of c- and n - samples ) . to confirm these criteria , 68 additional tissue samples in the validation cohort were analyzed . forty - five samples satisfying the criteria listed in table 2 for 1 or more bac clones were all t - samples , and the other 23 samples not satisfying the criteria listed in table 2 for any bac clone were all c- or n - samples ( figure 2(c ) ) . our criteria enabled diagnosis of t - samples in the validation cohort as ductal adenocarcinomas with 100% sensitivity and specificity . to establish criteria for prognostication , 21 patients who had not undergone adjuvant chemotherapy with gemcitabine in the learning cohort were divided into two groups : 4 patients who had not suffered relapse for more than 4 years after pancreatectomy and 17 patients who had suffered relapse within 18 months after pancreatectomy were defined as the no - relapse group and early - relapse group , respectively . the period covered ranged from 215 to 1,846 days ( mean , 823 days ) . wilcoxon test ( p < .05 ) revealed that the average signal ratios of 64 bac clones differed significantly between t - samples obtained from the no - relapse group and those from the early - relapse group . figure 3(a ) shows scattergrams of the signal ratios for representative examples of the 64 bac clones : rp11 - 165b11 and rp11 - 92a14 were able to discriminate t - samples from patients belonging to the early - relapse group from those belonging to the no - relapse group with 100% specificity ( the ratio of the number of true negatives to the number of true negatives and false positives ) using cutoff values of 1.29 and 1.03 ( dotted lines in figure 3(a ) ) , respectively , ( specificity was calculated as the ratio of the number of t - samples from patients belonging to the no - relapse group showing signal ratios of 1.29 or more than 1.29 and 1.03 or less than 1.03 relative to the total number of t - samples from patients belonging to the no - relapse group , resp . ) . the cutoff values of the signal ratios and sensitivities ( the ratios of the number of true positives to the number of true positives and false negatives ) of 11 bac clones for which such discrimination was performed with 100% specificity are shown in table 3 . a histogram showing the number of bac clones satisfying the criteria listed in table 3 in 4 t - samples from the no - relapse group and 17 t - samples from the early - relapse group in the learning cohort is shown in figure 3(b ) . based on these criteria ( 2 or more bac clones versus less than 2 bac clones listed in table 3 ) , both the sensitivity and specificity of discrimination of patients belonging to the early - relapse group from those belonging to the no - relapse group in the learning cohort were 100% ( sensitivity was calculated as the ratio of the number of t - samples from patients belonging to the early - relapse group satisfying the criteria in table 3 for 2 or more bac clones relative to the total number of t - samples from patients belonging to the early - relapse group , and specificity was calculated as the ratio of the number of t - samples from patients belonging to the no - relapse group satisfying the criteria in table 3 for less than 2 bac clones relative to the total number of t - samples from patients belonging to the no - relapse group ) . to confirm these criteria , 34 additional t - samples obtained from patients who had not undergone adjuvant chemotherapy with gemcitabine after surgery in the validation cohort were analyzed . the period covered ranged from 92 to 2,274 days ( mean , 612 days ) . both the recurrence - free and overall survival rates of 29 patients satisfying the criteria listed in table 3 for 2 or more bac clones were significantly lower than those of 5 patients satisfying the criteria listed in table 3 for less than 2 bac clones ( figure 3(c ) , p = .0044 and p = .014 , resp . ) . moreover , multivariate analysis in all 91 patients with ductal adenocarcinomas revealed that satisfying the criteria listed in table 3 for 2 or more bac clones was a prognostic parameter for both recurrence - free and overall survival that was independent of surgical margin positivity ( r1 or r2 ) and lymph node metastasis at the time of surgery , which are known to have a prognostic impact [ 2933 ] ( table 4 ) . ductal adenocarcinoma of the pancreas , one of the most lethal of all human cancers , is now a common cause of cancer mortality in the united states and japan . due to its aggressive growth behavior with early local spread into the surrounding tissues mostly along neural sheaths , peritoneal dissemination , and liver and lymph node metastasis , surgical treatment still provides the only possibility of cure . although advances in preoperative diagnostic imaging have made it possible to detect tumors at an early stage when they are still resectable , diagnosis using pancreatic biopsy and/or specimens of pancreatic juice is indispensable before surgery . in general , pancreatic biopsy yields only a small amount of tissue , and in pancreatic juice specimens , the cellular morphology is not well preserved due to degeneration . therefore , molecular diagnosis is advantageous for supporting the histological and/or cytological assessment of such specimens . dna methylation profiles , which are stably preserved on dna double strands by covalent bonds , even after degeneration of cellular morphology , may become diagnostic markers in pancreatic biopsy and/or pancreatic juice specimens . we have previously established diagnostic criteria for cancers of the kidney , liver and urinary tract based on genome - wide dna methylation profiles using the bac array - based approach , bamca , which can assess dna methylation status not only on promoter regions of specific tumor - related genes but also on genomic regions in which dna hypomethylation affects chromosomal instability . moreover , during human carcinogenesis , dna methylation status is frequently altered in a coordinated manner , through processes such as long - range epigenetic silencing , in large chromosome regions . since bamca is suitable for overviewing the dna methylation tendency of individual large regions among all chromosomes [ 23 , 24 ] , we again employed this method to establish diagnostic criteria for ductal adenocarcinomas of the pancreas . the results of bamca for c - samples reflected the dna methylation profiles of normal peripheral pancreatic duct epithelia ( the origin of ductal adenocarcinomas ) , acinar cells and islet cells . in n - samples , bamca revealed dna hypo- or hypermethylation on many bac clones in comparison to c - samples ( figure 1(b ) ) . microscopic observation of n - samples revealed lymphocytes and fibroblasts associated with various degrees of chronic pancreatitis , which is considered to be one of the precancerous conditions for ductal adencarcinomas . our previous studies using microdissection and immunohistochemistry revealed accumulation of dna hypermethylation of tumor - related genes associated with dnmt1 overexpression , even in peripheral pancreatic duct epithelia at the precancerous stage [ 9 , 10 ] . therefore , the results of bamca for n - samples may reflect the dna methylation profiles of peripheral pancreatic duct epithelia at the precancerous stage , lymphocytes , fibroblasts , acinar cells , and islet cells . in order to diagnose ductal adenocarcinomas in tissue samples , cancer - specific dna methylation profiles should be discriminated from those of normal or precancerous peripheral pancreatic duct epithelia , lymphocytes , fibroblasts , acinar cells , and islet cells . therefore , we identified 12 bac clones whose dna methylation status was able to discriminate t - samples from both c- and n - samples . in both the learning and validation cohorts , the criteria combining the 12 bac clones were able to diagnose t - samples as ductal adenocarcinomas with a sensitivity and specificity of 100% . our criteria may be advantageous for supporting the histological diagnosis of tiny tissue samples obtained by pancreatic biopsy . discrimination of cancer cells from exfoliated noncancerous epithelial cells and lymphocytes using the 12 bac clones may be applicable for diagnosis using specimens of pancreatic juice . development of methodology for assessing dna methylation status on the 12 bac clones in fewer cells may be more advantageous for clinical application , as we have already established a methodology for quantification of dna methylation levels on specific cpg sites in a very small quantity of genomic dna for estimation of carcinogenetic risk in patients with chronic liver diseases ( unpublished data ) . development of this methodology means that if dna methylation alterations on the 12 bac clones are not observed in circulating blood cells , our criteria may become applicable for noninvasive diagnosis of pancreatic cancers based on serum markers that differ from the widely used carbohydrate antigen 19 - 9 , whose serum levels are also elevated in patients with chronic pancreatitis . even when resection with curative intent is performed for patients with pancreatic cancers , the rate of disease recurrence is high and the survival rate after surgery is poor . as surgical resection alone has limitations , development of nonsurgical treatments , including adjuvant therapy , is needed in order to improve the prognosis of patients with pancreatic cancers . although previous studies have suggested the efficacy of adjuvant chemotherapy , it should be carried out carefully , paying close attention to adverse reactions . in order to help decide the indications for such adjuvant chemotherapy after surgery the criteria listed in table 3 were able to discriminate the early - relapse group from the no - relapse group with 100% sensitivity and specificity in the learning cohort . significant correlation between dna methylation status on the 11 bac clones and the recurrence - free and overall survival rates of patients with ductal adenocarcinomas in the validation cohort validated the criteria . multivariate analysis revealed that our criteria were able to predict recurrence - free and overall patient outcome independently of parameters that had been reported to be significantly prognostic in many previous studies , such as surgical margin positivity ( r1 or r2 ) and lymph node metastasis . therefore , prognostication based on our criteria may be promising for supportive use during followup after surgical resection in patients with ductal adenocarcinomas of the pancreas . since histological heterogeneity is frequently observed even in a ductal adenocarcinoma of the pancreas from a single patient , the consistency of bamca data for multiple t - samples obtained from a single tumor should be carefully confirmed in a prospective validation study before clinical application of the prognostic criteria . criteria combining the dna methylation status on 12 bac clones were able to discriminate t - samples from both c- and n - samples and to diagnose t - samples as ductal adenocarcinomas , with 100% sensitivity and specificity in both the learning and validation cohorts . satisfying the criteria using 11 bac clones was able to predict the recurrence - free and overall survival of patients with ductal adenocarcinomas independently of surgical margin positivity ( r1 or r2 ) and lymph node metastasis . genome - wide dna methylation profiling may provide optimal diagnostic markers for pancreatic cancers and prognostic indicators for affected patients .
### Summary: : to establish diagnostic criteria for ductal adenocarcinomas of the pancreas ( pcs ) , bacterial artificial chromosome ( bac ) array - based methylated cpg island amplification was performed using 139 tissue samples . twelve bac clones , for which dna methylation status was able to discriminate cancerous tissue ( t ) from noncancerous pancreatic tissue in the learning cohort with a specificity of 100% , were identified . using criteria that combined the 12 bac clones , t - samples were diagnosed as cancers with 100% sensitivity and specificity in both the learning and validation cohorts . dna methylation status on 11 of the bac clones , which was able to discriminate patients showing early relapse from those with no relapse in the learning cohort with 100% specificity , was correlated with the recurrence - free and overall survival rates in the validation cohort and was an independent prognostic factor by multivariate analysis . genome - wide dna methylation profiling may provide optimal diagnostic markers and prognostic indicators for patients with pcs .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : with the increasing rate of morbid obesity in the united states , surgical methods to evaluate weight loss are being increasingly utilized . despite the recent approval in the united states of the lap - band device , the roux - en - y gastric bypass remains the surgical procedure of choice for morbid obesity . this minimally invasive laparoscopic approach to roux - en - y gastric bypass is becoming increasingly popular . although the complication rate has decreased and morbidity and mortality have now approached that of the open technique , a risk still remains of gastrojejunal leakage and subsequent death of approximately 3% and 1% , respectively . after performing 120 gastric bypass procedures with traditional laparoscopy , we incorporated robotics into the performance of laparoscopic gastric bypass procedures . our aim was to take advantage of the precision of the robotic instruments to duplicate or improve upon the results obtained with traditional laparoscopic gastric bypass methods . forty - one cases of laparoscopic gastric bypass were performed with robotics from august 2001 until february 2002 . the robotic instrument used was the da vinci robotic surgical system ( intuitive , mountain view , ca ) . we sought to calculate patient demographics ( table 1 ) , total operating time , setup time for the robotic system , and operating time for the robotic system . forty - one patients underwent a primary laparoscopic gastric bypass with robotics during a 7-month period . patient demographics , including accompanying comorbid conditions , are listed in tables 1 and 2 . the patient population was predominately female ( 37/4 ) , which is consistent with other series . the average body mass index ( bmi ) of 52.8 shows that the procedure was not limited to those patients more likely to have a routine surgical and postoperative course . the average time needed to incorporate the robotic system into the operative field averaged 14 minutes , but revealed a dramatic learning curve . three of the initial 9 cases required 30 minutes to introduce the robot , and 5 of the initial 9 cases required > 20 minutes for setup . however , 1 of the final 32 cases required 20 minutes to set up ( table 3 ) . operating times ( minutes ) the robotic work time also required a learning curve , although it was longer than the learning curve for the robotic setup time . the average time for the robotic system to perform the gastrojejunostomy was 62 minutes ; the last 6 cases took < 60 minutes to perform , and the last 3 took < 40 minutes . in comparison with the standard laparoscopic gastric bypass , which we performed , the patients in whom the laparoscopic gastric bypass was performed were similar to the patients who had the procedure done with the robot . the average length of time for the laparoscopic procedure was 174 minutes , which is less than the operative time with the robot . the gastrojejunal anastomosis was performed with an average time of 21 minutes , which again is less than that with the robot . the incidence of gastrojejunal leak with the robot was < 3% , which is the same as that with the laparoscopic approach . despite other surgical procedures for weight loss , the roux - en - y gastric bypass remains the surgical procedure of choice in the united states for the treatment of morbid obesity . it is obvious , therefore , that numerous attempts are being made by many surgeons to improve upon the technique of the procedure . the most obvious of these is the performance of the procedure in a laparoscopic fashion , which leads to decreased length of stay , easier patient recuperation , earlier return to work and activities of daily living , and improved cosmesis . the limiting factor in the performance of the roux - en - y gastric bypass is the construction of the gastrojejunostomy . this is even more magnified with the laparoscopic approach in which the usual 2-layered hand - sewn anastomosis performed during open gastric bypass is extremely difficult to perform . intracorporeal knot - tying , although essential in advanced laparoscopic techniques , is extremely difficult to learn , increases the time of the operation , and could lead to catastrophic consequences if not performed properly . this is especially true during performance of the gastrojejunostomy during roux - en - y gastric bypass where the size and body habitus of the patient could make the performance of the gastrojejunostomy difficult or impossible with intracorporeal tying . devices to assist the surgeon in knot tying have been developed , and although they have decreased the time needed to perform intracorporeal tying , they have the limitations of being less accurate , having limited suture type available , and limitations in the thickness of the tissues being sutured to be successful . the reason for the difficulty in performing intracorporeal suturing is many - fold : the movement of the instruments is limited by trocars fixed into the abdominal wall . this is made worse in the morbidly obese patient where only a small portion of the laparoscopic instrument is outside the abdominal wall , with most being in the deepened subcutaneous tissue , fat layer , and abdominal cavity . with such a small part of the instrument present externally , a small motion by the operator leads to exaggerated movements inside the abdominal cavity , thereby decreasing the precision of intracorporeal tying . the instruments are long and rigid and decrease the precision , dexterity , and tactile sensation of the operator . very limited degrees of freedom exist in the abdominal cavity for suturing with the present generation of laparoscopic instruments . after performing laboratory procedures and intracorporeal suturing on pigs with the da vinci robotic surgical system , we decided to attempt to incorporate the robotic technology into the performance of the gastrojejunostomy with robotic assistance during laparoscopic gastric bypass . the improved degrees of freedom provided by the da vinci robotic surgical system enabled our surgical team to perform the gastrojejunostomy with dexterity that more closely mimics that achievable during open gastric bypass than other intracorporeal techniques . the robotic arms and hands provide 6 degrees of motion for suturing , a vast improvement from the 4 degrees of freedom provided by conventional rigid laparoscopic instruments during intracorporeal tying . we also found that the increased magnification and 3-dimensional view afforded us improved visibility to achieve more precision in the placement of sutures during performance of the gastrojejunal anastomosis . in fact , the team of 3 attending surgeons felt that the view of the suture placement was better when compared with that in both conventional laparoscopy and open performance of the gastrojejunostomy . another improved feature offered by robotics is the improved ergonomics afforded to the surgeon during the procedure . advanced laparoscopic procedures can often place the surgeon in uncomfortable and awkward positions with the body , arms , and hand , which can lead to frustration , increased tiredness , and possible risk of operative misadventure . working at the surgeon console , sitting a short distance from the operative table , gives the surgeon an increased feeling of comfort , stamina , and control . we have successfully incorporated the use of robotics into the performance of laparoscopic gastric bypass . the advantages , as outlined above , have been previously noted in other surgical specialties currently using robotic surgery . we will attempt to expand the use of robotics in the performance of laparoscopic gastric bypass by not limiting its use to only the performance of the gastrojejunostomy , but by incorporating a larger portion of the procedures to be done robotically . the improved technology provided by present - day robotic systems is both fascinating and exciting . similar to the initial introduction of laparoscopic cholecystectomy , there will be some reluctance before robotic technology is universally performed in laparoscopic procedures . once the technology improves and these initial robotic devices are replaced by systems more portable , less cumbersome , and faster to incorporate into the operative field , the increased technology afforded by the robotic system will ensure that it will be used by surgeons interested in remaining on the cutting edge of surgical advances . the use of the robot in performance of gastric bypass did provide enhanced precision in performance of the gastrojejunal anastomosis , but it produced comparable complication results . the use of the robot offers no advantage in performing laparoscopic gastric bypass for morbid obesity . it increases both the cost of the operation and the time of the operation as well . until the robot is cheaper and more convenient to use we
### Summary: : to evaluate the theoretical increased precision offered by utilization of the robotic instrument , we attempted to determine whether incorporation of its use into traditional laparoscopic gastric bypass would duplicate or improve the success of the operation without increasing complications . the roux - en - y gastric bypass is the most commonly performed procedure for morbid obesity in the united states . we performed 120 gastric bypass procedures with traditional laparoscopy during a 30-month period . we began introducing the da vinci robotic surgical system into our laparoscopic gastric bypass procedure and evaluated its effectiveness .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : gingivitis is among the top general health problems in the world , especially in developing countries . meanwhile , it may be associated with pulmonary and cardiovascular diseases . in a qualitative study , we tried to identify the corresponding terminology to gingivitis in traditional persian medicine ( tpm ) and to explain its potential mechanisms , treatments , and prevention characteristics . in a literature review , 4 modern textbooks and 18 related articles , 2 traditional medical dictionaries and 12 traditional medical and 4 traditional pharmaceutical texts were assessed by a specific method . initially , traditional scripts were searched for signs and symptoms of gingivitis as well as related keywords such as bleeding , swollen and loosen gum , oral or gingival ulcers , teeth , or gingival pain . then the disease / s or disorder / s , which matched gingivitis in tpm , was appraised in details . finally , potential mechanisms , prevention and therapeutic protocols presented by tpm were collated and summarized . lasse - e - dmiyeh ( bleeding gum ) or khoon - reezi az goosht - e bon - e dandn ( bleeding from under teeth flesh ) was the main disease comparable to gingivitis . based on tpm , the leading etiologies are insufficient gum feeding mechanism , pouring and gathering of excessive fluid in the gum and accumulation of excessive blood in it or in the whole body . although there were remarkable similarities in the subjects of different tpm texts over the centuries , particularly in oral and teeth hygiene and overall approach to gingivitis , we faced notable differences in recipes ( herbal drugs ) that each text proposed . while there are overlapping terminologies to gingivitis in tpm , lasse - e - dmiyeh is the closest disease that relates to it . meanwhile , adjusting diet and lifestyle , having appropriate oral hygiene , obtaining a vast variety of herbal medications , cupping , phlebotomy , leech therapy , etc . are the different tpm modalities for the prevention and treatment of gingivitis that can be considered as therapeutic and/or research issues .
### Summary: : background : gingivitis is among the top general health problems in the world , especially in developing countries . meanwhile , it may be associated with pulmonary and cardiovascular diseases . in a qualitative study , we tried to identify the corresponding terminology to gingivitis in traditional persian medicine ( tpm ) and to explain its potential mechanisms , treatments , and prevention characteristics.methods:in a literature review , 4 modern textbooks and 18 related articles , 2 traditional medical dictionaries and 12 traditional medical and 4 traditional pharmaceutical texts were assessed by a specific method . initially , traditional scripts were searched for signs and symptoms of gingivitis as well as related keywords such as bleeding , swollen and loosen gum , oral or gingival ulcers , teeth , or gingival pain . then the disease / s or disorder / s , which matched gingivitis in tpm , was appraised in details . finally , potential mechanisms , prevention and therapeutic protocols presented by tpm were collated and summarized.results:lasse-e-dmiyeh ( bleeding gum ) or khoon - reezi az goosht - e bon - e dandn ( bleeding from under teeth flesh ) was the main disease comparable to gingivitis . based on tpm , the leading etiologies are insufficient gum feeding mechanism , pouring and gathering of excessive fluid in the gum and accumulation of excessive blood in it or in the whole body . although there were remarkable similarities in the subjects of different tpm texts over the centuries , particularly in oral and teeth hygiene and overall approach to gingivitis , we faced notable differences in recipes ( herbal drugs ) that each text proposed.conclusion:while there are overlapping terminologies to gingivitis in tpm , lasse - e - dmiyeh is the closest disease that relates to it . meanwhile , adjusting diet and lifestyle , having appropriate oral hygiene , obtaining a vast variety of herbal medications , cupping , phlebotomy , leech therapy , etc . are the different tpm modalities for the prevention and treatment of gingivitis that can be considered as therapeutic and/or research issues .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : we used the methodology described by glenn and schable ( 2005 ) to construct a microsatellite - enriched library . the extraction of genomic dna was performed using the qiagen ( www.qiagen.com ) dneasy blood & tissue kit using approximately 25 mg of whole male and female biotype b whiteflies from a laboratory - reared population sampled from arizona . we then separately digested the dna with the restriction enzymes rsai and bstui ( new england biolabs , www.neb.com ) . digested fragments were ligated to the supersnx24 linker oligos and amplified with polymerase chain reaction ( pcr ) . following evidence of successful ligation , the linker - ligated dna from both digestions was pooled before enrichment . we enriched for microsatellite sequences using streptavidin - coated beads ( dynalbead ) and the following mix of 3-biotinylated probes : ( actg)4 , ( acct)4 , ( aaag)4 , ( aatc)4 , ( aatg)4 , ( aaac)4 , ( acag)4 , and ( actc)4 . those probes were selected to isolate tetranucleotides to minimize scoring errors and polymerase slippage . also , di- and trinucleotides were already available in the literature , and most did not cross - amplify successfully in other biotypes . a pcr of the enrichment using the supersnx primer was performed to recover sequences containing repeats . this pcr product was enriched again using the same mix of probes as above and again recovered with pcr . pcr products were inserted into a vector and transformed into escherichia coli using the topo ta cloning kit ( invitrogen , www.invitro gen.com ) . four cloning reactions were performed , and colonies were grown overnight . in total , 384 positive clones were then picked , cultured overnight , and pcr amplified using the m13 forward and reverse primers . a set of 194 clones seemed to have inserts of the appropriate size ( 3001,200 bp ) . pcr products from these clones were purified using exosap - it ( ge healthcare , www.gehealthcare.com ) and sequenced in the forward and reverse directions with the m13 primers and bigdye version 3.1 ( applied biosystems , abi , www.appliedbiosystems.com ) on an abi 3730 dna analyzer . of the clones sequenced successfully , 79 appeared to contain microsatellite sequences . primers were designed manually for the best 18 candidates ( see supp material [ online only ] ) and analyzed using the integrated dna technologies ( integrated dna technology 2007 . www.idtdna.com ) oligoanalyzer tool , resulting in 18 primer pairs that were synthesized by idtdna . the primer pairs were tested over a range of annealing temperatures and mgcl2 concentrations , and eight pairs that failed to amplify the expected loci were discarded and were not tested further . the remaining 10 loci were tested for variation by screening across two populations belonging to biotype b. for fragment analysis , microsatellite forward primers were synthesized and labeled with a fluorescent dye by applied biosystems ( table 1 ) . the pcr conditions were optimized to work across all 10 loci using a touchdown protocol . reactions were done in 10 l volumes using 1 l of genomic dna , 0.75 mm dntps mix , 0.5 m of each primer , 1 l of 0.1 mg / ml bovine serum albumin ( bsa , new england biolabs , www.neb.com ) , 1.25 l of 10 pcr buffer from applied biosystems ( 12.5 mm tris - hcl , ph 8.3 , 62.5 mm kcl ) , 0.751.125 mm mgcl2 ( abi ) ( table 1 ) , and 0.5 u of amplitaq gold dna polymerase ( abi ) . amplification of all loci was done using touchdown pcr with the following thermocycling conditions : 1 cycle of 95c for 10 min followed by 2 cycles of 94c for 1 min , 60c for 1 min , 70c for 35 s followed by 18 cycles of 45 s at 93c , 45 s at 59c ( lowering 0.5c each cycle ) , and 45 s at 70c . the final amplification step consisted of 20 cycles of 30 s at 92c , 30 s at 50c , and 1 min at 70c followed by a final extension step at 70c for 5 min . final pcr products were mixed with a cocktail of 48:1 hi - di formamide ( abi)/liz500 size standard ( abi ) ( 0.5 l of pcr product , 0.2 l of liz , and 9.3 l of formamide ) and were denatured at 95c for 5 min . fragments were run on an abi 3730 dna sequencer , and genotypic data were visualized and scored manually using the software genemapper version 4.0 ( abi ) . table 1.properties of nine polymorphic tetra- and pentanucleotide microsatellite loci cloned from bemisia tabaci biotype bmicrosatellite locus nameprimer sequence ( 53 direction)repeat motiffluorescent dye color ( applied biosystems)mgcl2 ( mm)accession numbersbiotypes ( other than b ) and haplotypes successfully cross - amplifiedwf1b11f : gcattgaacatttttctgcatgcgcg(cctga)12impned1jq436838a , h , k , l , m , ms , q , s , t , african , asian , australian , and new world haplotypesr : gcacacagctctccaaaagaaaggtcwf2c01f : atgataccgcacgaaaaagaggacg(gttt)11impned1jq436842l , m , q , african , asian , and new world haplotypesr : cttgaattacatcaaacgcagcagcwf2h06f : tattcgccaatcgattcctt(tttg)11ned0.75jq436844a , l , m , ms , q , african , new world , and yemen haplotypesr : cggcggaaatttcgataaawf1b06f : tctcatagaaaattttggagaaagaaa(actc)8pet0.75jq436837l , ms , q ( only spain q or q1 ) , african , new world , and yemen haplotypesr : tgcggaatctcagggtcatawf2e11f : tctccaaccataatttttaatctcg(gatt)27imppet1jq436843l , m , ms , q , african , new world , and yemen haplotypesr : gtctgggcaggaaaacgatwf1d04f : gttgttaggttacagggtttgtc(caaa)166-fam1jq436839a , s , t , african , and new world haplotypesr : gtctttacttctcttttcctccgwf1g03f : ctccaaaatgggacttgaac(gttt)8ned1.125jq436840h , k , m , ms , q , t , african , asian , australian , and new world haplotypesr : gtagaagccacacatactagcacwf2a05f : attgatcattttcggctaccttatc(caaa)12impned1.125jq436841r : cgacccttctgtaaatgatagactwf2a02f : gaagtgcataaaaacatcgtcgccg(cttt)10impned1jx853746r : caattgaaaggctagactccctggcimp , imperfect.locus name , primer sequences , repeat motif , fluorescent dye color used in fragment analysis , mgcl2 concentration , genbank accession numbers , and successful cross - amplification in non - b biotypes and haplotypes . properties of nine polymorphic tetra- and pentanucleotide microsatellite loci cloned from bemisia tabaci biotype b locus name , primer sequences , repeat motif , fluorescent dye color used in fragment analysis , mgcl2 concentration , genbank accession numbers , and successful cross - amplification in non - b biotypes and haplotypes . screening was done using 30 females from each population belonging to biotype b ( from cyprus and egypt ) . observed and expected heterozygosities , and allelic richness were calculated using genalex 6.1 ( peakall and smouse 2006 ) . deviation from hardy weinberg equilibrium and gametic linkage disequilibrium were tested using genepop ( raymond and rousset 1995 ) . an analysis for the presence of null alleles was carried out using the software microchecker ( van oosterhout et al . among the 10 loci that were examined , one was difficult to score , showing ambiguous peaks . we selected the remaining nine loci to report and use in subsequent analyses , which showed good amplification results in populations from both biotypes and were easily scored , with clear , reproducible peaks . the nine loci had 212 alleles in the tested populations , with observed heterozygosity ranging from 0.033 to 0.967 and expected heterozygosity ranging from 0.033 to 0.854 ( table 2 ) . there was no significant deviation from hardy weinberg equilibrium after correcting for multiple comparisons using the sequential bonferroni correction ( rice 1989 ; p < 0.05 ) , and no significant linkage disequilibrium was detected between loci ( p < 0.05 ) . however , one locus ( wf2co1 ) showed evidence for null alleles in the two populations ( table 2 ) . table 2.population-specific characteristics of the nine microsatellite loci tested in two populations from biotype b population testedcyprus biotype begypt biotype blocus nameallele size range ( bp ) ( na)f null allelesnho / heallele size range ( bp ) ( na)f null allelesnho /hewf1b11106193 ( 11)0.0137300.800/0.825106173 ( 8)0.0596300.700/0.808wf2c01150187 ( 10)0.1478300.567/0.838150187 ( 9)0.1662300.500/0.799wf2h06172196 ( 7)0.0235300.867/0.824172204 ( 8)0.0432300.867/0.789wf1b06158162 ( 2)0.0005300.033/0.033146162 ( 3)0.0305300.200/0.238wf2e11220260 ( 9)0.0459290.655/0.735199260 ( 12)0.0509300.667/0.756wf1d04124172 ( 12)0.0688300.967/0.840124164 ( 10)0.0114300.833/0.854wf1g03139162 ( 5)0.0077300.167/0.158158162 ( 2)0.0005300.033/0.033wf2a05141158 ( 4)0.0134230.217/0.201154158 ( 2)0.0724220.045/0.127wf2a02155159 ( 2)0.0028260.077/0.074155159 ( 2)0.001220.045/0.044loci with evidence for null alleles in this population after analysis in microchecker ( van oosterhout et al . 2004 ) are in bold.allele size range , na : number of observed alleles and n : number of individuals scored , estimated null allele frequency ( van oosterhout et al . population - specific characteristics of the nine microsatellite loci tested in two populations from biotype b loci with evidence for null alleles in this population after analysis in microchecker ( van oosterhout et al . allele size range , na : number of observed alleles and n : number of individuals scored , estimated null allele frequency ( van oosterhout et al . 2004 ) , and observed ( ho ) and expected ( he ) heterozygosity . of the loci reported here , seven were successfully amplified in non - b biotypes and haplotypes from worldwide mtcoi clades of b. tabaci as indicated in table 1 . this successful cross - biotype amplification may be attributed to the fact that tetranucleotides have a lower mutation rate compared with dinucleotides ( chakraborty et al . 1999 ) , and thus may be more useful in studies of sibling species species that are more closely related than any other pair of species but more genetically divergent compared with populations within a single species as seems to be the case of b. tabaci . this is the first study that reports the isolation and characterization of a number of tetranucleotides from b. tabaci and may prove particularly useful in subsequent studies of multiple biotypes . the loci reported here are being used to study the population genetic structure of worldwide biotypes within the b. tabaci species complex , to examine gene flow between mediterranean populations belonging to invasive biotypes b and q , and to study the invasion history of biotype q in the united states .
### Summary: : nine microsatellites were isolated from bemisia tabaci ( gennadius ) biotype b and screened across 60 individuals from two populations ( biotype b ) to examine polymorphism . two to 12 alleles were observed per locus . observed and expected heterozygosities ranged from 0.033 to 0.967 and 0.033 to 0.854 , respectively . there was no significant deviation from hardy weinberg equilibrium and no significant linkage disequilibrium between loci . one locus showed evidence for null alleles . these loci will be useful in future studies of the genetic structure of worldwide biotypes and gene flow analyses between and within biotypes of b. tabaci .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the term myositis ossificans is not used anymore because primary muscle inflammation is not a necessary precursor and ossification does not always occur in muscle tissue . periarticular ho is seen in patients with traumatic brain injury , tetanus , gullian - barre syndrome , poliomyelitis , prolonged mechanical ventilation , severe trauma , hip arthroplasty and burns . central nervous system tuberculosis ( cns tb ) comprises about 10% of all tb cases . tubercular meningitis ( tbm ) is the most common form of cns tb , a subacute disease with high morbidity and mortality if left untreated . in survivors of tbm , neurological sequelae are common which may include hydrocephalus , cranial nerve palsies , stroke and associated neurological deficits , seizures , mental retardation , spasticity and coma . these numbers are likely to rise due to an increase in drug resistance , increased use of immunosuppressive therapies , and increase in incidence of hiv . a 35-year - old right - handed male was admitted with diagnosis of tbm with hydrocephalus with left - sided hemiparesis . history revealed loss of consciousness 15 months back following complaint of low grade fever of long duration . the patient regained consciousness after 1 week but was unable to move his left upper and lower limb . six months later , the patient developed progressive limitation of left hip and knee movement . a month later he suffered left shoulder pain during a physical therapy session , after which the patient and his caretakers stopped giving any therapeutic exercises due to severe pain on movements . physical examination revealed contractures over his left shoulder , hip and knee [ figure 1 ] with ankylosis of left hip and knee [ figures 2 and 3 ] . the radiographic examination revealed ectopic bone deposition around , left hip [ figure 2 ] , left knee [ figure 3]and left shoulder [ figure 4 ] . mri of pelvic region showed early avascular changes in bilateral hip with altered signal intensity involving the muscles along left hip joint and upper part of shaft of femur with extension to overlying subcutaneous tissue anteriorly . ( a ) patient with tbm and left - sided hemiparesis , ( b ) left hand deformity , ( c ) left hip and knee deformity with ankle equinus x - ray of patient showing extensive heterotopic ossification around left hip with ankylosis of left hip x - ray of left knee showing heterotopic ossification around knee joint : ( a ) ap view ( b ) lateral view the patient was managed conservatively with antitubercular drugs , nsaids for ho as maturation was not observed , left abduction orthosis with dynamic cock up splint [ figure 4 ] , turn buckle splint for left knee with anklet skin traction with derotation bar for deformity correction at left hip and knee . rehabilitation program included exercise programs , activities of daily living ( adl ) training , speech therapy and wheelchair training for ambulation . x - ray of the left shoulder in pa view in adducted ( a ) and abducted ( b ) position showing heterotopic ossification , with left abduction orthosis with left dynamic cock - up splint ( c ) reported ho at right hip joint and bilateral sternoclavicular joint in a patient of tubercular meningoencephalitis . incidence of this finding has not been reported in a large series , however , a study in children suffering from tbm revealed 5 out of 10 children being affected by ho . in tbm , ho mostly occurs around hip involving psoas major , adductor longus , adductor magnus , and pectineus and iliacus muscle . very rarely ho around shoulder is observed . complications of ho include neurovascular entrapments , skin breakdown , loss of range of motion ( rom ) and joint ankylosis . a common cause of neurogenic ho is spinal cord injury , where incidence ranges between 1.3% and 57% and is usually seen in the first 6 months after injury . risk factors for ho include older age , neurological complete lesion , male gender , spasticity , venous thrombosis and pressure sores . only joints below the neurological level of injury will develop heterotopic bone with the most common location being the hips , followed by the knees , then shoulders . ho at the knee rarely causes complete ankylosis , and therefore surgical excision may not be performed . however , ho does decrease the rom which impairs function . in their series of 17 patients with neurological injuries who had excision of ho around the knee observed that surgical excision of ho of the knee is an effective procedure for increasing joint mobility and function . ippolito et al . , evaluated the results of excision of areas of ho in five patients of traumatic brain injury followed by optimum rehabilitation and observed that all patients could walk and all knees were pain free . all knees had more than functional arc of motion and there was no recurrence of ho in any of the knees . diagnosis can be suspected by early clinical findings which include warmth , tenderness , and soft tissue swelling . swelling progresses to more firm and localized area over several days and may present with decreased rom of affected joint . plain x - ray films detect ho in 7 - 10 days after onset of clinical signs , whereas triple phase bone scan can detect ho 1 week from onset and precedes x - ray by 7 - 10 days . bone scan returns to normal as ho matures in 6 - 18 weeks post injury . serum alkaline phosphatase levels increases at 2 weeks , usually exceeds normal levels at 3 weeks , peaks at about 10 weeks and returns to normal after ho matures . nonsteroidal anti - inflammatory drugs like indomethacin and ibuprofen have been used both for prophylaxis and treatment of ho . bisphosphonates has been shown to decrease the rate of new bone formation in patients with ho ; however , it has no effect on bone which has already been deposited . radiation therapy has been reported to possibly act by interfering with differentiation of pleuripotent mesenchymal cells into osteoblasts . it also decreases pain perception by suppression of tissue inflammation and ablation of pain receptors . extracorporeal shockwave therapy has shown favorable results as a supplementary treatment along with physiotherapy and rehabilitation . surgical excision should be reserved in patients with intractable pain , severely limited rom that causes functional limitations ( hip rom less than 50% ) provided there is the absence of local fever , swelling , erythema , normal serum alkaline phosphatase levels and return of bone scan findings to normal or near normal . this patient had rigorous massage and forceful stretching of joints leading to left shoulder joint dislocation and ho . in india , in rural areas , it is a common practice to do unsupervised rigorous massage and stretching exercises in all paralyzed patients . moreover , lack of skilled therapists , unawareness and underutilization of health services add to the problem . very few reports have been published in literature for association of ho with tbm with such extensive joint involvement which compels us to report this clinical association of tbm . this report is intended to create caution among physicians and other caregivers for this debilitating complication of tbm and in face of high prevalence of tuberculosis and tbm , employ methods for prevention , early diagnosis and treatment .
### Summary: : tubercular meningitis is a severe form of central nervous system tuberculosis with high morbidity and mortality . apart from neurological deficits , musculoskeletal involvement is also seen in very few cases in the form of heterotopic ossification around immobile joints . a 35-year - old male case of tubercular meningitis with left hemiparesis presented with multiple joint restriction of range of motion . on clinical examination , palpable firm masses around multiple joints with painful restriction of movements were seen . x - ray films of multiple joints revealed heterotopic ossification over left shoulder , hip and knee joint with bony ankylosis of left hip and soft tissue contractures . very few reports have been published in the literature for association of heterotopic ossification with tubercular meningitis with such extensive joint involvement which compels us to report this clinical association of tubercular meningitis . this report is intended to create caution among physicians and other caregivers for this debilitating complication of tubercular meningitis and in face of high prevalence of tuberculosis and tubercular meningitis , employ methods to prevent and treat .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the 7 patients were treated at our unit of infectious diseases and tropical medicine at the hospital universitario insular of las palmas ( gran canaria island , canary islands , spain ) . we defined the condition we call patera foot as all of the following : 1 ) acute ssti involving the feet or legs , 2 ) direct relation of the infection to sea journey by overcrowded patera under extreme conditions , and 3 ) good health status before travel . for this report , we excluded patients with diabetes , chronic arterial or venous leg disease , edema , or any other predisposing conditions . we performed the following basic interventions for all patients : registry of epidemiologic data ; complete clinical history and physical examination ; blood extraction for routine tests ; blood cultures ( if fever ) ; cleaning and debridement of the affected area ( if indicated by the vascular surgery team ) ; and acquisition of cultures from the affected area by syringe ( if abscess ) , skin punch ( if cellulitis only ) , or deep infected tissue ( if surgical debridement ) . amputation was carried out only after every effort was made to preserve the affected foot or leg . all 7 patients whose conditions met the classification criteria were young , black , sub - saharan men ( table ) . in all patients , we ruled out a defined immunodeficiency , specifically hiv infection ; use of immunosuppressive agents ; and indirect data suggesting primary immunodeficiency ( lymphopenia or immunoglobulin deficiency ) . organisms isolated from local specimens were gram - negative bacteria in all microbiologically positive cases . patient 7 , a 21-year - old man , was admitted to the intensive care unit because of shock secondary to severe ssti and intense dehydration with acute renal failure and rhabdomyolysis . bilateral painful enlargement of his lower extremities was evident , with disseminated round ulcers and serohemorrhagic , confluent blisters . the ulcers were covered with a fibrinoid , purulent exudate ( figure , panel a ) . after blood and skin samples were collected for culture , the patient began taking meropenem and linezolid . skin samples grew gram - negative rods , initially identified as s. putrefaciens by using the api 20e system ( biomrieux , marcy letoile , france ) . by using experimental work ( 35 ) that allows differentiation between shewanella species , we identified the organism as s. algae on the basis of its capacity to grow at 42c in 6.5% nacl and to produce beta - hemolysis . the organism displayed in vitro susceptibility to ceftazidime , meropenem , piperacilin / tazobactam , ciprofloxacin , aminoglycosides , trimethoprim / sulfamethoxazole and aztreonam but resistance to amoxicilin / clavulamate , cefotaxime , and , notably , to imipenem ( because s. algae is sensitive to other carbapenems i.e. , meropenem ) . four days after the patient was admitted to our unit , a large fluctuant area appeared on the dorsum of his left foot ; drainage from the area consisted of a grossly purulent , foul - smelling material . extensive debridement was necessary to control infection ( figure , panel b ) ; 1 month later , a skin allograft was implanted ( figure , panel c ) . progression of infection ( patera foot ) in case - patient 7 , a previously healthy 21-year - old immigrant from sub - saharan africa who reached spain by sea crossing on a small boat ( patera ) . a ) initial severe skin and soft tissue infection of the lower limbs ; b ) extensive debridement of the left foot ; c ) left foot after skin allograft . during sea crossing by patera , immigrants are exposed to extreme extrinsic conditions , such as cold weather and deficient hygienic conditions . intrinsic factors , such as limited skin compliance related to young age and possibly race , may play additional roles in the pathogenesis of this syndrome . black race may be an intrinsic factor because , to our knowledge , immigrants of other ethnic origin ( magreb countries ) have not developed this syndrome . the presence of gram - negative bacteria in all case - patients , especially s. algae in 1 , instead of gram - positive cocci , indicates a source of infection related to water and illustrates the specific pathogenesis of this syndrome . are ubiquitous gram - negative bacteria ; possible reservoirs include all types of water , oil emulsions , petroleum brines , protein - rich foods , and soil ( 57 ) . two shewanella species , s. algae and s. putrefaciens , have been found in clinical specimens . because automated systems are unable to distinguish between the 2 species , a number of infections attributed to s. putrefaciens probably correspond to s. algae ( 4 ) . s. algae is considered a rare opportunistic pathogen for humans , frequently involving immunocompromised hosts ( 6,8,9 ) , and are usually part of a polymicrobial infection ( 6,10,11 ) , which may mask its clinical importance . the presence of chronic leg ulcers in the context of peripheral vascular disease occurs commonly in adults with s. algae ssti ( 6,10,12,13 ) , and the affinity of s. algae for necrotic or ischemic tissues has been well described ( 12,14,15 ) . the following sequence may explain why these young , previously healthy men developed such aggressive sstis . we speculate that specific etiologic agents ( mainly gnb , including s. algae ) present in densely contaminated water enter through macerated skin , then reach deep tissues that have been submitted to subacute ischemia from overpressure and deficient venous drainage , both related to forced , prolonged sitting . the ensuing inner inflammation , expanding against a young skin with limited compliance , further aggravates the ischemia and leads to necrosis , probably by a compartmental - like mechanism . these cases appear to represent a new syndrome , with specific etiology , pathogenesis , clinical features , and response to treatment . gnb , including s. algae , are involved , and an ischemic mechanism may be crucial in the development of these destructive infections . the initial election of empirical therapy , always covering those pathogens , and early surgical evaluation are crucial in preventing major disability in these young people .
### Summary: : an unusual skin and soft tissue infection of the lower limbs has been observed in immigrants from sub - saharan africa who cross the atlantic ocean crowded on small fishing boats ( pateras ) . response to conventional treatment is usually poor . extreme extrinsic factors ( including new pathogens ) may contribute to the etiology of the infection and its pathogenesis .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : characteristically , the patients are normal at birth but progressively develop disease manifestations during childhood ( 1,2 ) . previously we have described the surgical procedure and management of the craniofacial region ( 3 ) . here the overgrown tissue was combined with vascular malformations , which in our patient were extremely thick . the patient suffered blood loss during the procedure , which is not commonly reported in these instances . in this report , we highlight potential pitfalls in the surgical treatment of dermal lesions . a 37-year - old woman presented with disproportionate enlargement of the right buttock . a small 5 mm tumour was first observed in the right buttock when she was 12 years of age . since then , the tumour gradually increased in size and the patient presented with a gigantic overgrowth of the right buttock , which extended significantly over the leg and toes . facial features were unremarkable and her family history was not deemed to be contributory . the patient had already undergone a hysterectomy and right ovariectomy at another hospital when she was 25 years of age , because tumours of the uterus and right ovary were found . at the time , she had not yet been diagnosed with proteus syndrome . on first examination of the patient there were multiple nevi , which were distributed predominantly over the right waist , buttock , and right leg . these epidermal nevi had a mosaic distribution , but their location was limited to the right side ( fig . 1 ) . using the proteus syndrome diagnostic criteria ( 4 ) , we diagnosed this patient as having proteus syndrome . note that the lesion is composed of lobules of mature fatty tissue with various sized vessels the patient had difficulty sitting on a chair , and could not wear trousers ; therefore , we sought to reduce the volume of the tumour . although the medial side of the middle area was removed , the lateral side was retained to cover the defect , and just thinning of the subdermal tissue . at the time of reduction surgery , the perforators , which are ordinarily observed under a loupe , were visible to the naked eye and resembled primary vessels . a significant degree of haemorrhaging occurred from these enlarged vessels , which required a considerable amount of time to ligate . finally , the reduction volume was chosen to achieve symmetry between the buttocks and femoral volume . in total , the reduction volume was 1350 g. appearance of the patient at 2-year follow - up in order to adequately cover the excised region , we then elevated the skin flap . for the upper area , the bilobed flap was designed at the left buttock and positioned over the area of the defect . for the middle area , to close the wound under slight tension , the baggy medial skin lesion was trimmed to avoid creating dead space . for the lower area , the v - y advancement flap was designed . in total , the operative time was 6 h 55 min . total bleeding amounted to 1914 ml , and therefore , a blood transfusion was given . , the patient was satisfied with the results , and was able to wear trousers and excrete easily ; her quality of life ( qol ) was also improved ( fig . proteus syndrome is a rare , complex , and variable disorder characterized by the overgrowth of multiple tissues including the connective tissue nevi , the epidermal nevi , and the craniofacial hyperostosis ( 1 ) . of the numerous case reports on proteus syndrome , most introduce clinical findings , and few describe surgical treatments for the disease ( 3,5,6 ) . for the gigantic extremities , however , to improve postoperative qol of the patients , we believe that volume reduction should be performed where possible . recent reports suggest that the most common histopathological features in proteus syndrome are not limited to altered connective tissue nevi , but may also include vascular anomalies and lipomas ( 7,8 ) . in our experience therefore , for operations including incomplete excision , massive bleeding is always a possibility ; therefore , the surgeons should be prepared for performing blood transfusions . furthermore , electrosurgical vessel sealing tools such as ligasure ( valleylab / covidien ) may be useful for the treatment of haemostasis , to fuse vessel walls and create a permanent seal , but also to shorten of the operative time ( 9 ) . in conclusion , we believe that publication of reports by attending surgeons in cases of proteus syndrome will allow for a comprehensive discussion of the disease , including the long - term course , preferred strategy for therapy , and an elucidation of the developmental mechanism .
### Summary: : proteus syndrome is a rare congenital hamartomatous condition that is characterised by a wide range of malformations . skin and skeletal developmental malformations are common and may manifest as significant physical anomalies . however , few reports have discussed surgical treatment.a 37-year - old woman presented with disproportionate enlargement of the right buttock , which required volume reduction . the overgrown tissue was combined with vascular malformations , which in our patient were extremely thick . the patient experienced massive blood loss during the procedure , due to which a blood transfusion was performed.pathological findings revealed partial lipohyperplasia with venous malformations . thus , during operations including incomplete excision , massive bleeding is always a possibility , but is not commonly described in these instances .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : hantaviruses are globally distributed enveloped rna viruses ( family bunyaviridae ) , carried by rodent or insectivore hosts ( 3 ) . hantaviruses are transmitted to humans via aerosols of virus - contaminated excreta ( urine , feces , saliva ) from chronically infected wild rodents ( 4 ) . hantavirus infections in rodents are typically asymptomatic and lifelong ( 4 ) . as earlier shown for puuv , hantavirus - infected bank voles can secrete the virus for several months after the infection , and the virus is infective for weeks outside the rodent ( 3 , 5 , 6 ) . recently , we showed that the secretion of puuv from wild bank voles in the wild is sometimes extremely long , probably lifelong ( 7 ) . hantaviruses are usually rodent host species - specific , most often infecting only a single rodent or insectivore ( soricomorpha ) species , although spillover infections have been described on several occasions ( 814 ) . puuv causes a milder form of hemorrhagic fever with renal syndrome ( hfrs ) named nephropathia epidemica ( ne ) and is the major causative agent of hantavirus - related clinical cases in europe ( 15 ) . despite its wide distribution in europe , approximately 90% of all ne cases in sweden are found in the puuv - endemic northernmost regions ( 16 ) . human cases outside of this region are most often found during the holiday season when southern residents visit more northern latitudes ( 16 ) . although the bank vole has been clearly identified as the main reservoir of puuv , other species have occasionally been found positive for puuv - specific antibodies in europe , for example , apodemus sylvaticus in belgium and moose in northern sweden ( 8 , 17 ) . tulv , shown to occasionally infect humans but not yet clearly associated to human disease , has never been described in sweden . analyses were conducted at the zoonosis science centre ( zsc ) at the department of medical biochemistry and microbiology , uppsala university , and the public health agency of sweden , stockholm , sweden . rodents were trapped from october 2009 to february 2010 in houses , garages , and storage areas by the house - owners ( all were employees at sva ) , using commercial snap - traps . the trapped animals were transported whole to sva in uppsala , on the morning following the trapping . the samples were assumed to have a dilution equivalent to serum dilution of approximately 1:25 . we used an in - house puuv elisa , essentially as described earlier ( 8 , 18 , 19 ) . briefly , elisa plates were coated with native puuv or bac - puuv n antigens , followed by post - coating ( 3% bsa in pbs ) . samples were diluted 1:16 ( equivalent to an approximate final serum dilution of 1:400 , see above ) and control sera were incubated at a dilution of 1:400 , followed by alkaline - phosphatase - conjugated goat anti - mouse antibodies ( jackson immunoresearch , suffolk , uk ) , and p - nitrophenyl phosphate substrate . all incubations were for 1 h at 37c , and the plates were washed four times between each step . ten out of 185 rodent samples were found clearly positive by the elisa ( table 1 ) . summary of elisa and frnt results od , optical density at 405 nm , adjusted to the positive control=1.00 human puuv convalescent and negative control sera microtus arvalis tulv control sera . to finally confirm the hantavirus reactivity and specificity , the 10 elisa - positive yellow - necked mice samples were examined by frnt against puuv , dobrava virus ( dobv ) , saaremaa virus ( saav ) , seoul virus ( seov ) , and tulv as previously described ( 2 ) . briefly , the samples were serially diluted and mixed with diluted viruses containing 3070 focus forming units/100 l . confluent vero e6 cell monolayers in 6-well tissue culture plates were used and incubated at 37c for 1 h after addition of the virus / antibody solution . agarose medium was subsequently added to the wells , and the plates were incubated for 710 days , depending on the hantavirus . to indicate virus - infected cells , monkey anti - puuv polyclonal serum ( 20 ) , followed by peroxidase - labeled goat antibodies to human igg ( biorad laboratories , hercules , ca ) , were added . 3 , 3 , 5 , 5-tetramethylbenzidine substrate ( sigma ) was used as substrate and foci were enumerated . eight of the 25 elisa - reactive samples were initially found frnt puuv - positive at dilution 1:50 , whereas two samples ( # 87 and # 183 ) only neutralized tulv . these 10 frnt - positive samples , all from apodemus flavicollis , were subsequently titrated and end - point titers determined ( table 1 and fig . they were further tested at 1:50 dilution with dobv , saav , and seov the three other hantaviruses known to circulate in europe . in some cases , a weak cross - reactivity was observed also against seov , dobv , and saav . in conclusion , all 10 yellow - necked mice samples showed a clear hantavirus specificity , several with an at least four - fold higher titer to tulv ( # 87 , # 89 , and # 183 ) , or puuv ( # 85 ) , whereas the remaining six showed similar titers , or just over the cutoff level ( 1:50 ) ( table 1 and fig . a hantavirus genus - specific - nested rt - pcr was applied as described earlier ( 21 ) . this is the first finding of hantavirus - infected rodents so far south of its known endemic area in northern sweden . to our best knowledge , until now , the southernmost reported occurrence of puuv in sweden has been from two bank voles trapped in munga ( outside tierp , 65 km north of uppsala ) and in mngelbo ( 35 km northwest of uppsala ) ( 22 ) , respectively . in the present study , we detected hanta - infected yellow - necked mice within central uppsala ( 5 km south of the castle in central uppsala ) and in vallentuna ( 40 km southeast of uppsala , 30 km from central stockholm ) . in 2003 , olsson and coworkers did a careful study on human hantavirus infections in sweden ( 23 ) . because approximately 90% of the human cases were reported from the four northernmost counties , they focused their study on norbotten , vsterbotten , jmtland , and vsternorrland counties . our present work indicates that a similar study is now justified also in more southern counties : gvleborg , uppsala , and stockholm . furthermore , hantavirus - specific antibodies were found in yellow - necked mice , a rodent species not previously reported for puuv or tulv infections in nature . the yellow - necked mouse is the well - studied natural reservoir for dobv , causing severe hfrs in southeastern europe ( 2 , 3 ) . however , none of our hantavirus - positive yellow - necked mice showed dobv - specificity . tulv is carried by microtus arvalis , m. rossiameridionalis , and m. agrestis in nature ( 1 , 3 , 24 ) . m. agrestis is the only microtus vole present in sweden but never shown to carry tulv . at present , we have no knowledge concerning a potential amplification and transmission of the hantaviruses infecting apodemus flavicollis in central sweden , or whether this rodent species is only a dead - end host , that is , does not allow any further virus transmission . because aerosols , contaminated by virus - infected bank - vole excreta , are the main source for human infection of hantaviruses , no physical contact between rodents and humans is required for disease transmission ( 4 ) . consequently , it may be difficult for both the infected humans and for medical specialists to suspect transmission of hantaviruses , especially if the transmission has occurred outside the known endemic area . therefore , disseminating information about the occurrence of hantavirus - infected rodents outside its traditional endemic areas has great importance for both medical workers and the general public . this information helps with disease transmission prevention and leads to faster determination of diagnoses by medical specialists . our new observations , together with a laboratory - confirmed ne case believed to have been infected in central uppsala , several suspected ne cases from hjo ( 5818n 1417 ) , and a laboratory - confirmed ne case from rebro ( 591626.2n 151248.1 ) ( our unpublished observations ) may indicate that there are still unknown hantaviruses circulating in sweden , and/or that the puuv endemic area in sweden is by far larger than earlier believed , which warrants further extended and detailed analyses . additional studies have now been initiated , for example , to trace the source of puuv- and tulv - like infections in apodemus flavicollis , that is , by investigating the circulation of puuv in the bank vole population , and search for tulv in field voles , in the uppsala / stockholm area , and by further viral genetic studies on hantavirus - infected yellow - necked mice . the authors have not received any funding or benefits from industry or elsewhere to conduct this study .
### Summary: : in sweden , human cases of puumala hantavirus ( puuv ) infections are reported from the northern endemic regions . we found hantavirus - specific antibodies in yellow - necked mice ( apodemus flavicollis ) trapped in human dwellings in the surroundings of the cities of uppsala and stockholm , which are situated far south from the traditional endemic areas of puuv . because the yellow - necked mouse is the most common rodent in human dwellings , hantaviruses in this rodent species may be important for the public health .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : body fat distribution assessment , especially visceral fat accumulation , is an important method to evaluate the association between obesity , cardiovascular diseases , and metabolic disorders.1 there have been various methods for body composition analysis . computed tomography is known to be the best method for evaluating visceral fat , but it is not used routinely for the diagnostic procedures of patients . magnetic resonance imaging is another alternative method ; however , factors such as high cost , morbid obesity , and claustrophobia in patients , or history of metal prostheses and pacemaker limit its utilization.2 bioelectric impedance analysis ( bia)is not so appropriate for a wide range of patients with cardiovascular diseases , including patients suffering from congestive heart failure ( chf ) , patients having extra body fluid , patients receiving serum therapy , and patients in post - operation condition.3 , 4 formerly , the waist - hip ratio was used to as a simple indicator of visceral fat volume , but it has been demonstrated that this ratio is unable to distinguish between subcutaneous and visceral fat volumes and is , therefore , a poor predictor of change in visceral fat volume.5 thus , there is a great need for a simple and appropriate method to estimate the amount of visceral fat in a clinical setting . the development of sonography has offered reliable distance measurement , especially for the assessment and distribution of fat tissues.6 in a study , leite reported that intra - abdominal thickness measured by sonography could predict cardiovascular diseases.7 the purpose of this study was to evaluate the distribution of subcutaneous and visceral fat volumes measured by sonography as a determinant risk factor for cardiovascular patients and compare its results with those via body mass index ( bmi ) and bia methods . this cross sectional study enrolled 106 patients ( 63 men and 43 women ) with coronary artery disease ( cad ) who were admitted to our hospital during a 3-month period . the patients , who had abdominal sonography for the evaluation of gastrointestinal or genitourinary problems , were given a complete description of the study . the study was approved by the ethics committee of the hospital , and informed written consent was obtained from all of them . patients older than 80 years were excluded from the study since their normal anatomy was impaired by old age . additionally , extra dehydrated ( more than 10% loss in total body water , documented by clinical and laboratory findings ) patients and those with severe edema ( more than 3 edema ) due to invalid information recorded by bia method as well as those with kidney abnormalities such as polycystic kidney , renal atrophy , or hydronephrosis were also excluded from the study . sonographic measurements were performed in all the patients with siemens sonoline g20 with a 35 mhz by a single operator ( md ) with 8 years of experience in abdominal sonography . the transducer was transversely positioned 1 cm above the umbilical scar on the abdominal midline , without exerting any pressure over the abdomen . the peri - renal fat was measured with a transducer longitudinally positioned on the axillary midline , with identification of the right kidney image . the peri - renal fat thickness was considered as the distance in millimeters between the lateral border of the kidney and the internal border of iliopsoas muscle surface adjacent to the middle third of the right kidney . measurement errors were avoided by performing three measurements for each patient and recording the mean value . the sonologist was blind to the measured bia and body mass index ( bmi ) indices . for bia , all the patients stood with their feet in contact with the foot electrode and grabbed the hand electrodes , and an eight - polar tactile - electrode ( model bios pace in body 720 , seoul , korea ) was utilized to carry out the measurements . the fat percent and fat mass , which were measured with the device , were recorded , and so were height and body weight to the nearest 0.1 cm and to the nearest 0.1 kg of the patients . bmi was calculated as weight divided by height squared ( kg / m ) ( normal range : 18.5 to 24.9 kg / m ) . all the statistical analyses were performed utilizing spss software ( version 13.0 ; spss , inc . , the pearson correlation coefficient and linear regression tests were used to assess the simple relation between the variables . this study recruited 106 patients , comprising 43 ( 41% ) women and 63 ( 59% ) men , with a mean age of 58.81.1 years . the mean values of fat percent and fat mass obtained by the electric - method were 31.070.81% and 22.120.68 kg , respectively . the respective mean values of subcutaneous and visceral fat obtained by the sonography method were 20.500.56 mm and 24.140.58 mm . the pearson correlation coefficients between bmi and the other variables in terms of age are shown in table 1 . a comparison of the correlations between the electrical and sonographic variables and bmi calculation demonstrated a significant relation between subcutaneous fat thickness ( mm ) and bmi and between fat mass volume ( kg ) and bmi ( kg / m ) . it was also shown that a measurement of subcutaneous fat and fat mass to predict bmi for the estimation of body fat volume resulted in almost similar values . the most significant correlation was between subcutaneous fat ( by sonography ) and bmi ( r = 0.848 , p value < 0.0001 ) , and between fat mass ( bia ) and bmi ( r = 0.834 , p value < 0.0001 ) . generally , correlations between different variables did not differ significantly in both genders , which means that sonographic prediction was valid in both sexes to almost the same extent . utilization of non - invasive and less expensive methods may facilitate the detection of high - risk patients and allow earlier interventions . estimation of body composition and body fat distribution by a method other than bmi calculation can be a great help for the detection of cardiovascular diseases . among techniques for the assessment of fat tissue distribution our results support the idea that this method is as useful as ultrasonography for identifying visceral fat . such findings are in agreement with those of some previous studies.810 similar to any other method , bia has some advantages and limitations : being inexpensive and non - invasive are some of its strong points , this method is highly sensitive and can easily be affected by changes in total body water and altered body temperature . moreover , its sensitivity for the placement of electrodes ( e.g. , tall patients ) limits its accuracy and utilization.3 , 4 some other simple methods , like waist - hip ratio were not accurate enough to differ subcutaneous from visceral fat and therefore , a poor predictor of change in visceral fat volume.5 ultrasonography has been proven to be a practical , effective , and low - cost method to measure body fat and its distribution.6 , 7 however , ultrasonography accuracy is operator - dependent and needs a thorough knowledge of anatomic landmarks and a proper scanning technique . our results suggest that both bioelectrical impedance and ultrasonography are useful for predicting the visceral and percutaneous fat volume . in conclusion , the accuracy and simplicity are factors that make ultrasonography one of the safest ( albeit not the most perfect ) methods in clinical practice for the measurement of body fat volume .
### Summary: : background : inappropriate body composition represents impaired energy and nutrient intake and can be a risk factor for many diseases , especially for cardiovascular disease . different methods have been suggested for the estimation of body fat volume and its distribution . however , they may be either expensive or hazardous for some groups of patients . sonography is a very accessible technique , which may be used for the evaluation of visceral and subcutaneous fat volume . the purpose of this study was to evaluate the sonographic prediction of body fat and its distribution in subcutaneous and visceral compartments.methods:during a three - month period , we conducted sonographic evaluations for visceral and subcutaneous fat in 106 patients who were admitted to our hospital . the subcutaneous fat was measured at the para - umbilical region and visceral fat was measured in the right para - renal space . the results were compared with the data obtained from the body mass index ( bmi ) and bioelectric impedance analysis.results:the mean age of the patients was 58.8 years , and the mean bmi was26.48 0.33 . the mean values of fat percent and fat mass obtained by the electric - method were 31.07 0.81% and 22.12 0.68 kg , respectively . the respective mean values of subcutaneous and visceral fat obtained by sonography were 20.500.56 mm and 24.14 0.58 mm . the correlation between bmi and subcutaneous fat was 0.85 ( p value < 0.0001 ) and the correlation between bmi and visceral fat was0.46 ( p value < 0.0001).conclusion : sonography is a reliable and available method for the estimation of body fat and its distribution in cardiovascular patients , in subcutaneous and visceral compartments .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : atopic diseases , including dermatitis and asthma , sharing genetic and environmental risk factors , have their prevalence increased in recent decades and now affect approximately 20% of the population in developed countries [ 1 , 2 ] . asthma is a disorder of the conducting airways , which contract too much and too easily both spontaneously and in response to a wide range of exogenous and endogenous stimuli . this airway hyperresponsiveness is accompanied by enhanced sensory irritability of airways and increased mucus secretion . the different clinical expressions of asthma involve a variety of environmental factors that interact with the airways to cause acute and chronic inflammation . several other factors contribute to this phenomenon , including smooth muscle contraction , edema , and remodeling of airways . classically , asthma is characterized by chronic airway inflammation and remodeling , hyperresponsiveness , and increase of t - helper cell 2 levels- ( th2- ) related cytokines . to antagonize this response , cannabinoids are components of the cannabis sativa ( marijuana ) plant and are known to exert potent anti - inflammatory , immunomodulatory , and analgesic effects through activation of cannabinoid-1 and cannabinoid-2 ( cb1 and cb2 ) receptors located in the central nervous system ( cns ) and immune cells , respectively . recently , a revision of burstein has shown the involvement of cbd in control receptors involved in controlling inflammatory response , expression , and genetic transcription and reposted also functional effects in various diseases , colitis , sepsis - related encephalomyelitis , and inflammatory lung diseases . it has also been demonstrated that cbd is well tolerated without significant effects even when chronically administered in humans . the treatment of asthma remains problematic and often involves a combination of drugs , including corticosteroids , bronchodilators , leukotriene modifiers , and more recently target - directed therapies such as anti - ige and anticytokines . all of such treatments have their strengths and limitations , such as the occurrences of side effects . moreover , the patients with uncontrolled or partially controlled asthma , despite intensive treatment , remain a challenge . thus , there is a clear need to explore new ways of managing and treating this respiratory disease . the two most important cannabinoids , 9-tetrahydrocannabinol ( 9-thc ) and cannabidiol ( cbd ) , were isolated and synthesized in the mid-1960s . cbd is the main nonpsychotropic cannabinoid and was shown to have beneficial effects in many pathological conditions , including neuropsychiatric disorders and brain inflammatory diseases , without having significant activity on cb1 and cb2 receptors . because of its beneficial effects in several pathologies and low toxicity in humans and other species , cbd represents a promising candidate for asthma treatment . in this regard , the present study was designed to evaluate the effects of cbd administration in inflammatory parameters ( assessed by cytokines levels ) in rats submitted to an asthma model . male adult wistar rats ( 8 weeks old ) were obtained from unesc ( universidade do extremo sul catarinense , cricima , brazil ) breeding colony . they were housed five per cage with food and water available ad libitum and were maintained on a 12 h light / dark cycle ( lights on at 7:00 am ) . all experimental procedures involving animals were performed in accordance with the nih guide for the care and use of laboratory animals , with the approval of ethics committee from universidade do extremo sul catarinense . injection of 10 g of chicken ovalbumin ( ova ) in 100 l of aluminum hydroxide ( alum ) or alum alone . seven days later , rats received aerosol challenges ( 30 min / for 3 d ) with 1% ova or saline . cbd ( thc pharm , frankfurt , germany , and sti pharm , uk ) was suspended in 2% of polyoxyethylenesorbitan monooleate ( tween 80 ) . the solutions were prepared immediately before use and were protected from light during the experimental session . once a day during the last two days of the ova challenge at the dose of 5 mg / kg . all treatments were administered in a volume of 1 ml / kg of cbd or vehicle . for this experiment , 21 rats were used , which were randomly divided into three groups : vehicle ( control ) ( n = 7 ) , ova + vehicle ( asthma control ) ( n = 7 ) , and ova + cbd ( asthma + treatment ) ( n = 7 ) . blood samples were obtained 24 hours after the last challenge by decapitation to determine the levels of cytokines . serum interleukins il-4 , il-5 , il-13 , il-6 , and il-10 and tnf- were assayed with the luminex xmap technology . briefly , the specific antibodies for each cytokine were immobilised within microspheres through covalent bonds . after the analytic sample binds to the capture antibodies located on the surface of microspheres , the end detection is done via a third fluorescent marker , phycoerythrin connected to the detection antibody . statistical comparisons between experimental groups are using one - way anova and post hoc newman - keuls tests . all statistical analyses were performed with the spss 17.0 ( spss , chicago , il ) . we determined the levels of 6 cytokines implicated in asthma , which can be divided by the response profiles th1 ( tnf- and il-6 ) and th2 ( il-4 , il-13 , il-10 , and il-5 ) . asthma induction resulted in an increase in all cytokines levels ( figures 1 and 2 ) when compared to control animals . cbd treatment was able to decrease both th1 and th2 cytokines ( figures 1 and 2 ) . we here demonstrate a protective effect of cbd upon inflammatory response in an animal model of asthma ; both th1 and th2 responses are blunted by cbd treatment . this finding is consistent with a recent study in which cbd was shown to have potent immunosuppressive and anti - inflammatory properties . therefore , we wonder whether cbd would be effective in controlling inflammation in a murine model of asthma as it has been reported in other models of inflammation . ribeiro and collaborators showed that treatment with cbd in a model of acute lung injury induced by lipopolysaccharide ( lps ) decreased total lung resistance and elastance and improved several markers of inflammation . however , inflammation associated with asthma is somewhat different from the observed in these models . rats are sensitized by a large number of antigens that are not normally exposed to the environment , including ova , which can elicit both th1 and th2 responses , which is different from lps - induced inflammation . cbd treatment significantly decreased the levels of cytokines involved in the immune response to an allergen , such as il-4 and il-5 . il-4 is responsible for the inhibition of th1 cells differentiation and for th2 cells differentiation and expansion and has an important role in ige production . il-4 was increased in patients with both atopic and nonatopic asthma [ 14 , 15 ] . in addition , il-4 seems to be a requisite for t lymphocytes to produce il-5 [ 1416 ] . il-5 is essential for the maturation of eosinophils , and it accumulates in the lung during the inflammatory process of asthma . mucus hypersecretion is an important characteristic of asthma , which contributes to the exacerbation of symptoms . il-6 levels are increased in sputum and systemic circulation in severe asthmatic patients , which can be responsible for the raise of c - reactive protein circulation in these patients . tnf- is a major mediator of severe asthma , and it is demonstrated that soluble tnfr and antibodies against tnf- [ 20 , 21 ] are effective in animal models of asthma and cbd reduced the levels of tnf- in our model . in humans , several attempts to decrease inflammatory response in asthma have been tested . anti - interleukin-4 and anti - interleukin-5 had been effective in reducing exacerbations and persistent eosinophilia in asthmatic patients . in addition , anti - interleukin-9 and anti - interleukin-13 decreased symptoms associated with asthma [ 23 , 24 ] . in this context , since cbd was used safely in humans , it is possible to suggest that a rapid transition to study its effects in humans is possible . until now , little was known about the effector cell of cbd in the immune system . they demonstrated that cbd was able to induce myeloid - derived suppressor cells , and these cells suppressed t cell proliferation ex vivo . additionally , this effect was dependent on the secretion of g - csf by mast cells . furthermore , cbd is able to directly suppress t cell secretion of il-2 and ifn - gamma . these effects seem to be consistent with our findings of a protective effect on a murine model of asthma . firstly , we do not have direct evidence of airways inflammation since we are not able to determine the effect of cbd in bronchoalveolar lavage fluid cytokines . secondly , we do not measure lung function ; thus we are not able to determine if cbd has any effect on flow obstruction in our model . despite great relevance this is the first evidence of a beneficial effect of cbd in an animal model of asthma . in addition , we measure several different cytokines , and all the results are consistent with a significant anti - inflammatory effect of cbd . in conclusion , we here demonstrate that the administration of cbd in an animal model of asthma could blunt the serum cytokine response to ova in sensitized animals . these effects suggest a potential for a new asthma treatment since cbd controls the exaggerated inflammatory response observed in this model .
### Summary: : asthma represents a public health problem and traditionally is classified as an atopic disease , where the allergen can induce clinical airway inflammation , bronchial hyperresponsiveness , and reversible obstruction of airways . studies have demonstrated the presence of t - helper 2 lymphocytes in the lung of patients with asthma . these cells are involved in cytokine production that regulates immunoglobulin synthesis . recognizing that t cell interaction with antigens / allergens is key to the development of inflammatory diseases , the aim of this study is to evaluate the anti - inflammatory potential of cannabidiol ( cbd ) in this setting . asthma was induced in 8-week - old wistar rats by ovalbumin ( ova ) . in the last 2 days of ova challenge animals received cbd ( 5 mg / kg , i.p . ) and were killed 24 hours after . the levels of il-4 , il-5 , il-13 , il-6 , il-10 , and tnf- were determinate in the serum . cbd treatment was able to decrease the serum levels of all analyzed cytokines except for il-10 levels . cbd seems to be a potential new drug to modulate inflammatory response in asthma .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : we earlier described a series of invasive non - typhi s. enterica isolates from blood cultures collected in 7 of the 11 provinces in the drc during 20072011 ( figure 1 ) ( 4 ) . in that study , a health care facility based survey was administered to persons who met the eligibility criteria of suspected bacteremia at time of presentation and patient age > 2 months . blood culture vials were shipped to kinshasa and processed according to standard identification procedures ( 4 ) . a total of 233 non - typhi s. enterica isolates were recovered , 184 ( 79% ) of which belonged to serotype typhimurium ( 4 ) . the serotypes for all s. enterica typhimurium isolates were determined locally and later confirmed at the institute of tropical medicine , antwerp , belgium . most ( 180/184 , 98.7% ) s. enterica typhimurium isolates were subsequently shipped to the pasteur institute , paris , france , for further analysis . provinces with sample collection sites in the democratic republic of the congo , 20072011(4 ) . the population structure of these 180 s. enterica typhimurium isolates was assessed by crispol typing . crispol is a recently developed high - throughput assay based on clustered regularly interspaced short palindromic repeat ( crispr ) polymorphisms ( 5 ) . this bead - based hybridization assay is designed to detect the presence or absence of 72 short variable dna sequences ( spacers ) from both crispr loci of s. enterica typhimurium . initially , 245 different crispol types ( cts ) were identified in a 2012 study that included 2,200 isolates ( 5 ) ; just before we conducted the study reported here , the crispol salmonella typhimurium database of the pasteur institute contained > 7,000 strains comprising > 750 different cts . a total of 174 ( 96.7% ) s. enterica typhimurium isolates from the drc belonged to the ct28 group , of which 163 ( 90.5% ) were ct28 . a total of 11 ( 6.1% ) isolates belonged to 7 other cts that were single - spacer variants ( loss of a single spacer ) , single - event variants ( loss of > 2 contiguous spacers ) , or double - event variants of ct28 ( figure 2 ) . ct28 had been associated with st313 in a multidrug - resistant dt56 s. enterica typhimurium isolate from senegal and in the d23580 st313 lineage ii genome ( 5 ) . in contrast , the analysis of raw pyrosequence data for genome a130 ( 3 ) , representative of st313 lineage i , corresponded to ct698 , distinct from the ct28 group . crispol is a recently developed high - throughput assay based on clustered regularly interspaced short palindromic repeats ( crispr ) polymorphisms . black squares indicate presence of the crispr spacer , detected by the corresponding probe ; white squares indicates absence of the spacer . the dendrogram was generated by using bionumerics version 6.6 software ( applied maths , sint - martens - latem , belgium ) as described ( 5 ) . the crispol types ( cts ) detected among the 180 isolates from the democratic republic of congo ( drc ) are labeled as drc in the source column . six common cts of the pasteur institute crispol database ( labeled as reference ) are also shown . these cts are from strains of serotype typhimurium 021800 ( ct34 , dt120 ) , 025270 ( ct21 , dt104 ) , lt2 ( ct41 , dt4 ) , 022561 ( ct46 , dt12 ) , 021749 ( ct7 , dt14 ) or its monophasic variant of antigenic formula 1,4,,12:i:- , 071777 ( ct1 , dt193 ) . for each distinct ct , the numbers of corresponding isolates , their sequence types ( sts ) , and their antimicrobial drug susceptibility testing ( ast ) data are indicated . for the st and ast columns , the numbers in parentheses refer to the number ( > 2 ) of tested isolates with such result . the resistance types were as follows : r1 , asktngsultmpc ; r2 , asktngsultmpcte ; r3 , ac ; r4 , assultmp ; r5 , assultmpc ; r6 , assultmpcnal ; r7 , assultmpcte ; r8 , asultmpc ; r9 , ssultmpc ; r10 , acrocazsktngsultmpcteazi ; and r11 , acrosktngsultmpctenaazi . abbreviations used in the descriptions of resistance types are as follows : a , amoxicillin ; cro , ceftriaxone ; caz ; ceftazidime ; s , streptomycin ; k , kanamycin ; t , tobramycin ; n , netilmicin ; g , gentamicin ; sul , sulfamethoxazole ; tmp , trimethoprim ; c , chloramphenicol ; te , tetracycline ; nal , nalidixic acid ; azi , azithromycin . to confirm the association of st313 to the ct28 group , we performed multilocus sequence typing ( mlst ) ( 6 ) on 12 isolates . a total of 3 isolates belonged to ct28 , and 1 isolate of each single - spacer , single - event , and double - event variant was tested , resulting in 10 isolates from the ct28 group . antimicrobial drug susceptibility has been studied with a limited panel of 7 drugs ( 4 ) . we performed additional susceptibility testing by disk diffusion with a panel of 32 antimicrobial agents ( bio - rad , marnes - la - coquette , france ) ( 7 ) . extended - spectrum -lactamase ( esbl ) phenotype was assessed by using the double - disk synergy method ( 8) . for all esbl - producing isolates , mics of ceftriaxone , ceftazidime , azithromycin , and imipenem were determined by the etest macromethod ( biomrieux , marcy l'etoile , france ) . results were interpreted according to break points defined by the antibiogram committee of the french society for microbiology ( www.sfm-microbiologie.org/ ) . susceptible strains were defined as having a ceftriaxone mic < 1 mg / l , ceftazidime mic < 4 mg / l , azithromycin mic < 16 mg / l , and imipenem mic < 2 mg / l . l , ceftazidime mic > 4 mg / l , azithromycin mic > 16 mg / l , and imipenem mic > 8 mg / l . the presence of macrolide resistance genes was assessed by pcr and sequencing as described elsewhere ( 7 ) . of the 174 ct28 group isolates , 167 ( 96% ) were resistant to ampicillin , chloramphenicol , and trimethoprim / sulfamethoxazole in combination with other drugs ( figure 2 ) ; the remaining isolates were resistant to 1 or 2 of these drugs . / l , ceftazidime mic 432 mg / l ) ; both contain the esbl blashv-2a gene ( 4 ) . we report that both isolates contain the mph(a ) gene encoding a macrolide 2-phosphotransferase that inactivates macrolides ( azithromycin mic 96128 mg all 6 non - ct28 group isolates were susceptible to all drugs tested ( figure 2 ) . our data are based on the analysis of s. enterica typhimurium isolates recovered from > 9,600 blood cultures collected during a 4-year period from distinct parts of the drc . we found that > 96% of the s. enterica typhimurium isolates belonged to the ct28 group . because of the strong association between ct28 group and st313 , our findings suggest high rates of st313 among invasive salmonellosis in the drc . of the 10 genomes from the drc isolated during 19881992 ( 3 ) , genetic lineages i and ii were identified at approximately equal rates . of the more recent isolates ( 20072011 ) described here , all st313 isolates belonged to the ct28 group , associated with lineage ii . a notable feature of lineage ii is chloramphenicol resistance resulting from a cat gene within a specific tn21-like element , carried by the virulence - associated plasmid pslt ( 3 ) . in the set described herein , we observed chloramphenicol resistance in > 97% of all isolates belonging to the ct28 group . the almost complete replacement of lineage i isolates by lineage ii isolates from kenya and malawi has also been reported ( 1,9 ) . our data are based on invasive s. enterica typhimurium isolates collected in a nonsystematic health care facility based approach and do not include noninvasive strains of s. enterica typhimurium . ( 10 ) recently cited unpublished data showing that st313 s. enterica typhimurium might be a common cause of gastroenteritis among immune - competent patients . a human reservoir for multidrug - resistant s. enterica typhimurium and enteritidis in kenya has been suggested because of the presence of similar strains in asymptomatic siblings and parents of index case - patients ( carriage prevalence 6.9% ) ( 11 ) . whole - genome sequencing of st313 strains has shown genome degradation , including pseudogene formation and chromosomal deletions as have been observed for human - restricted s. enterica typhi ( 12,13 ) , suggesting that st313 might be undergoing an evolution toward niche specialization or , more likely , human adaptation ( 1 ) . our results indicate very high rates of multidrug - resistant s. enterica typhimurium st313 among invasive non - typhi salmonella infections in the drc . infections will help determine whether st313 s. enterica typhimurium in central africa is an opportunist or a primary pathogen . systematic analyses of potential nonhuman and human reservoirs of s. enterica typhimurium might provide a better understanding of the transmission dynamics of this emerging pathogen .
### Summary: : infection with salmonella enterica serotype typhimurium sequence type ( st ) 313 is associated with high rates of drug resistance , bloodstream infections , and death . to determine whether st313 is dominant in the democratic republic of the congo , we studied 180 isolates collected during 20072011 ; 96% belonged to crispol type ct28 , which is associated with st313 .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : osteoma and fibrous dysplasia of bone are types of bone - derived benign tumors occurring in the paranasal and nasal cavities . however , these lesions rarely occur in the nasal cavity , and only seven cases of osteoma originating in the middle turbinate have been reported previously ( table 1).17 nasal osteomas occur with highest incidence from the second to fourth decade of life.8 we report the eighth case of middle turbinate osteoma , which occurred in a pediatric patient . this report is the first case of middle turbinate osteoma removed by gingival incision . and we have been obtained written informed consent about reproducing information and photographs appearing in this manuscript . the patient was a young boy who was examined at nine years for the main complaint of nasal obstruction , which had started four months earlier . a swelling in the middle turbinate computed tomography ( ct ) revealed a large , clearly defined mass in the left nasal cavity with a maximum diameter of 30 mm and similar radiolucency to bone ( fig . the mass was exerting outward pressure on the medial wall of the left orbit and the nasal septum was displaced to the right ( fig . the mass was considered to represent osteoma , and in accordance with the wishes of his parents , the patient was followed up by a local doctor . by 13 years , the nasal obstruction had worsened and the boy was again examined in our department . the mass in the left middle turbinate had increased in size compared to that at nine years . ct showed the mass had expanded to a maximum diameter of 41 mm ( fig . 2a ) . the interior of the left nostril was entirely occupied by the mass , which was pressing against the nasal septum ( fig . sinusitis sphenoidalis was observed . in accordance with the wishes of the patient and his parents , the procedure was attempted by endoscopy , but this had to be abandoned because the great size of the osteoma made it difficult to insert forceps and hemorrhage prevented a sufficient field of view under endoscopy . the procedure was changed to open surgery through a gingival incision and removal of the osteoma under direct vision . as en bloc resection could not be easily achieved , removal was done in a piecemeal fashion . histopathological examination of the resected specimen with hematoxylin and eosin staining revealed osteoblasts together with fibrous bone formation and peripheral calcification . in the stroma , hyperplasia was observed , with spindle - shaped cells showing spindle - shaped to elliptical nuclei ( fig . nasal obstruction was completely resolved following surgery , and no recurrence has been encountered as of more than 12 months postoperatively ( fig . osteomas are benign tumors that slowly increase in size . for the majority of patients , no subjective symptoms arise in the initial phase . when osteoma occurs in the paranasal cavity , an increase in the size of the mass may cause headache or chronic sinusitis . when they arise within the nose , the most common major complaint is nasal obstruction.6 the pressure exerted by the lesion may also give rise to symptoms such as diplopia , vision impairment , ophthalmalgia , and exophthalmos . middle turbinate osteoma has been reported to cause pneumocephalus after extending into the anterior cranial fossa.4 the main complaint of the present patient was also nasal obstruction . at the time of surgery when the patient was 13 years old osteoma is relatively easily diagnosed from plain x - rays and ct , and asymptomatic lesions are most often discovered incidentally during radiological examinations for other conditions . however , obtaining detailed information from plain x - rays is difficult . ct is useful for assessing relationships with neighboring structures such as the anterior cranial fossa , cribriform plate , and orbit , to consider surgical procedures.4,6 in the present case , ct clearly revealed that the osteoma was pressing on the lamina papyracea and nasal septum . osteoma should be followed up in the absence of symptoms , but surgery is the only treatment option when symptoms are present . surgical approaches are classified into external , endoscopic drill - out , and combined endoscopic and external procedures.9 small osteomas can be removed using a transnasal approach without cosmetic problems . lateral rhinotomy is an excellent procedure and suitable for osteomas involving the ethmoid region.8 external approach was used in the five , including 14-year - old girl , of seven reported cases originating in the middle turbinate . however , external approach has a cosmetic problem and leaves surgical scars on the face . hence , it is not suitable especially for children . as the present patient was 13 years old , endoscopic surgery was initially attempted , but was abandoned in view of the difficulty of inserting forceps and the problems obtaining a sufficient field of view because of hemorrhage . grabovac et al reported the inferior turbinate osteoma treated with sublabial approach through the upper mouth vestibule.10 the resection by gingival incision is useful because it does not have cosmetic problem , and the giant osteoma was removed under direct vision in the present case . given the maximum diameter of 41 mm , the tumor was removed in a piecemeal fashion . this procedure proved successful in relieving the main complaint of nasal obstruction , and no cosmetic problems arose . however , long - term follow - up is considered necessary for this young patient , for early identification of any recurrence .
### Summary: : only seven cases of osteoma arising in the middle turbinate have been reported to date . we report the eighth case , involving osteoma in the middle turbinate of a child . this young boy was initially examined at the age of nine for the main complaint of nasal obstruction . although a large osteoma with a maximum diameter of 30 mm was observed on computed tomography ( ct ) , the patient was only observed because of the wishes of the family . at 13 years , he was again examined , as a result of worsening of the nasal obstruction . ct revealed that the osteoma had enlarged to a maximum diameter of 41 mm . endoscopic surgery was attempted , but because of difficulties , the osteoma instead had to be removed under direct vision via a gingival incision . the final pathological diagnosis was osteoid osteoma . the nasal obstruction disappeared following surgery , with no recurrence after more than 12 months postoperatively .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : wrinkles consist of many multidirectional , superficial indentations of the skin , resulting from thinning of the dermis with age . creases which extend into dermis causing deeper furrows , which , in turn , extend into the subcutaneous tissue . facial rhytids have been categorized based on whether they are static or dynamic and whether they are caused by tissue redundancy or tissue loss . dynamic rhytids are common over the upper one - third of the face , especially the glabella and forehead . static rhytids are caused by exogenous sources such as gravity and environmental toxins such as smoke and ultraviolet radiation . static and dynamic rhytids are seen together around the eyes , forehead , and cheeks . hyperfunctional lines of the face , including glabellar and frontalis , frown lines , crow 's feet , and deep nasolabial grooves are common cosmetic deformities . excessively prominent facial lines are often interpreted as anger , anxiety , fatigue , fear , or melancholia . the hyperfunctional lines are a result of the pull on the skin of the underlying facial mimetic musculature . these include the corrugator supercilii for glabellar lines , frontalis for deep forehead lines , lateral aspect of the orbicularis oculi for crow 's feet , and the zygomaticus , levator superioris , levator labii superioris alaeque nasi , and the orbicularis oris for nasolabial fold . most facial rejuvenation techniques such as surgery and injection of collagen , silicone , or autogenous fat do not address the fact that these lines are functional , i.e. they do not target the cause of hyperfunctional lines : the underlying facial mimetic musculature . thus comes in the use of botulinum toxin a , isolated from the bacterium clostridium botulinum , which causes reversible , flaccid paralysis of the muscles . c. botulinum is an anaerobic , gram - positive , spore - forming bacillus , commonly found in the soil throughout the world and is responsible for food poisoning . the family of botulinum neurotoxins includes seven distinct subtypes identified as a , b , c , d , e , f , and g. the chemical paresis induced by botulinum toxin injections by blocking the release of the neurotransmitter , acetylcholine , is a relatively noninvasive and safe means of eliminating muscle contraction , which leads to dynamic wrinkles and furrows . although all types of neurotoxins are capable of interfering with acetylcholine release , they vary in their biosynthesis , size , and cellular mechanism of action . type a is the most powerful of the seven types and was the first to be developed for clinical use . short - acting toxins such as btx - e and btx - f may be of value post - surgically or after trauma . to determine the efficacy of the botulinum toxin type a injections in facial rejuvenation by eliminating hyperfunctional facial lines of the foreheadto determine the type of skin ideally suited for treatment with botulinum toxin type ato determine the rate of complications associated with botulinum toxin type a injections . to determine the efficacy of the botulinum toxin type a injections in facial rejuvenation by eliminating hyperfunctional facial lines of the forehead to determine the type of skin ideally suited for treatment with botulinum toxin type a to determine the rate of complications associated with botulinum toxin type a injections . to determine the efficacy of the botulinum toxin type a injections in facial rejuvenation by eliminating hyperfunctional facial lines of the foreheadto determine the type of skin ideally suited for treatment with botulinum toxin type ato determine the rate of complications associated with botulinum toxin type a injections . to determine the efficacy of the botulinum toxin type a injections in facial rejuvenation by eliminating hyperfunctional facial lines of the forehead to determine the type of skin ideally suited for treatment with botulinum toxin type a to determine the rate of complications associated with botulinum toxin type a injections a total of 25 patients with hyperfunctional facial lines of the forehead were treated with botulinum toxin a injections at the department of oral and maxillofacial surgery at coorg institute of dental sciences . among the 25 cases , the age group was further divided into three groups : 2535 years , 3645 years , and above 45 years . a detailed history was taken and examination of the facial lines was done ( proforma enclosed ) . pregnancy or active nursing : women who had inadvertently been treated with botox during pregnancy have had uneventful deliveries , and thus far , no teratogenicity has been attributed to botox . nevertheless , botox is classified as a pregnancy category c drug in that it is not firmly established whether it can cause fetal harm when administered to pregnant women . pre - existing neuromuscular conditions like myasthenia gravis , eaton - lambert syndrome and some medication , such as aminoglycosides , penicillins , quinine , and calcium channel blockers , can potentiate the effects of botox , and patients using them concomitantly were excluded from the study . patients with any degree of trepidation or patients with unrealistic goals and expectations are also poor candidates for botox therapy . patients younger than 12 years and patients with history of reaction to the toxin were excluded from the study . patient should be analyzed both in the static and dynamic positions . in the static analysis , the patients who would benefit from eyebrow lifting with botulinum toxin are those with a weak frontalis and strong depressors independent of age , the eyebrow has a low position , especially its lateral aspect , and fullness in upper eyelid . in addition , size of the forehead has to be considered , since larger areas need more injection points and consequently higher doses . the dynamic analysis should be done while talking to the patient , in order to categorize the patient as a kinetic , hyperkinetic , or hypertonic . horizontal lines in the forehead due to frontalis overconstriction can be easily seen and disappear easily when motionless . kinetic patients are those who may present the best result with complete static and dynamic line removal and a nice elevation of the whole eyebrow . hypertonic patients are difficult to treat and in them , treatment of the lateral brow might result in brow ptosis . the patients are classified according to the quality of their skin as follows : type 1 : thick , sebaceous skin ; wrinkling characterized by deep dermal scarringtype 2 : thin skin ; wrinkling characterized by deep dermal scarring , with hyperfunctional musclestype 3 : thick skin characterized by fine wrinkles aggravated by scowlingtype 4 : thin skin and fine wrinkles aggravated by scowlingtype 5 : wrinkling only with scowling . type 1 : thick , sebaceous skin ; wrinkling characterized by deep dermal scarring type 2 : thin skin ; wrinkling characterized by deep dermal scarring , with hyperfunctional muscles type 3 : thick skin characterized by fine wrinkles aggravated by scowling type 4 : thin skin and fine wrinkles aggravated by scowling type 5 : wrinkling only with scowling . the materials used for botulinum toxin treatment were the toxin itself , a standard freezer , sterile saline solution , alcohol swabs , and insulin syringes with small 30 gauge needles . the toxin was shipped from the manufacturer on dry ice and stored at 20c [ figure 1 ] . materials used for the study the patients were first evaluated with a thorough review of their medical history , medications , and prior injections of botulinum toxin or prior cosmetic surgery . physical examination concentrated on the patient 's hyperfunctional facial lines , skin condition and any scars and/or asymmetry , identification of prior facial surgical sites , assessment of the thickness of the skin , and the quality of the skin . in addition , the accentuation of hyperfunctional lines with muscle contraction , as well as the ability to smooth out these lines was noted with the spread test . a detailed discussion of the patient 's facial lines , the botulinum toxin technique , and the expected effect was then undertaken . standard photographs were taken of the patient 's face at rest and with activity at various time intervals , i.e. pre - injection , and at 2 weeks , 3 months , and 6 months post - injection . most authors recommend that all injections be at least 1 cm above an imaginary line drawn horizontally between the middle portions of the eyebrows . an imaginary vertical line was drawn passing through the pupil for a reproducible reference point . a triangle was first drawn with its apex at a central point between the medial brows . two points were drawn at a mid - pupillary position , 1 cm above the superior orbital rim . the first injection of 2.5 units was administered 1.5 cm above the superior bony orbital rim on this imaginary line . the second injection was given at a point 1.5 cm superior and 1.5 cm lateral to the first injection . the next injection was given 1.5 cm superior and 1.5 medial to the first injection , in effect , to create the letter v. then , depending on the number of lines , three or five more injection sites were chosen , each at a distance of 1 cm away from the other . the mid - pupillary line was never crossed nor was the lowermost line injected , as the purpose of the treatment is only to get rid of the unwanted lines and , at the same time , maintain facial expression . pregnancy or active nursing : women who had inadvertently been treated with botox during pregnancy have had uneventful deliveries , and thus far , no teratogenicity has been attributed to botox . nevertheless , botox is classified as a pregnancy category c drug in that it is not firmly established whether it can cause fetal harm when administered to pregnant women . pre - existing neuromuscular conditions like myasthenia gravis , eaton - lambert syndrome and some medication , such as aminoglycosides , penicillins , quinine , and calcium channel blockers , can potentiate the effects of botox , and patients using them concomitantly were excluded from the study . patients with any degree of trepidation or patients with unrealistic goals and expectations are also poor candidates for botox therapy . patients younger than 12 years and patients with history of reaction to the toxin were excluded from the study . patient should be analyzed both in the static and dynamic positions . in the static analysis , the patients who would benefit from eyebrow lifting with botulinum toxin are those with a weak frontalis and strong depressors independent of age , the eyebrow has a low position , especially its lateral aspect , and fullness in upper eyelid . in addition , size of the forehead has to be considered , since larger areas need more injection points and consequently higher doses . the dynamic analysis should be done while talking to the patient , in order to categorize the patient as a kinetic , hyperkinetic , or hypertonic . horizontal lines in the forehead due to frontalis overconstriction can be easily seen and disappear easily when motionless . kinetic patients are those who may present the best result with complete static and dynamic line removal and a nice elevation of the whole eyebrow . hypertonic patients are difficult to treat and in them , treatment of the lateral brow might result in brow ptosis . the patients are classified according to the quality of their skin as follows : type 1 : thick , sebaceous skin ; wrinkling characterized by deep dermal scarringtype 2 : thin skin ; wrinkling characterized by deep dermal scarring , with hyperfunctional musclestype 3 : thick skin characterized by fine wrinkles aggravated by scowlingtype 4 : thin skin and fine wrinkles aggravated by scowlingtype 5 : wrinkling only with scowling . type 1 : thick , sebaceous skin ; wrinkling characterized by deep dermal scarring type 2 : thin skin ; wrinkling characterized by deep dermal scarring , with hyperfunctional muscles type 3 : thick skin characterized by fine wrinkles aggravated by scowling type 4 : thin skin and fine wrinkles aggravated by scowling type 5 : wrinkling only with scowling . the materials used for botulinum toxin treatment were the toxin itself , a standard freezer , sterile saline solution , alcohol swabs , and insulin syringes with small 30 gauge needles . the toxin was shipped from the manufacturer on dry ice and stored at 20c [ figure 1 ] . the patients were first evaluated with a thorough review of their medical history , medications , and prior injections of botulinum toxin or prior cosmetic surgery . physical examination concentrated on the patient 's hyperfunctional facial lines , skin condition and any scars and/or asymmetry , identification of prior facial surgical sites , assessment of the thickness of the skin , and the quality of the skin . in addition , the accentuation of hyperfunctional lines with muscle contraction , as well as the ability to smooth out these lines was noted with the spread test . a detailed discussion of the patient 's facial lines , the botulinum toxin technique , and the expected effect was then undertaken . standard photographs were taken of the patient 's face at rest and with activity at various time intervals , i.e. pre - injection , and at 2 weeks , 3 months , and 6 months post - injection . most authors recommend that all injections be at least 1 cm above an imaginary line drawn horizontally between the middle portions of the eyebrows . an imaginary vertical line was drawn passing through the pupil for a reproducible reference point . a triangle was first drawn with its apex at a central point between the medial brows . two points were drawn at a mid - pupillary position , 1 cm above the superior orbital rim . the first injection of 2.5 units was administered 1.5 cm above the superior bony orbital rim on this imaginary line . the second injection was given at a point 1.5 cm superior and 1.5 cm lateral to the first injection . the next injection was given 1.5 cm superior and 1.5 medial to the first injection , in effect , to create the letter v. then , depending on the number of lines , three or five more injection sites were chosen , each at a distance of 1 cm away from the other . the mid - pupillary line was never crossed nor was the lowermost line injected , as the purpose of the treatment is only to get rid of the unwanted lines and , at the same time , maintain facial expression . most authors recommend that all injections be at least 1 cm above an imaginary line drawn horizontally between the middle portions of the eyebrows . an imaginary vertical line was drawn passing through the pupil for a reproducible reference point . a triangle was first drawn with its apex at a central point between the medial brows . two points were drawn at a mid - pupillary position , 1 cm above the superior orbital rim . the first injection of 2.5 units was administered 1.5 cm above the superior bony orbital rim on this imaginary line . the second injection was given at a point 1.5 cm superior and 1.5 cm lateral to the first injection . the next injection was given 1.5 cm superior and 1.5 medial to the first injection , in effect , to create the letter v. then , depending on the number of lines , three or five more injection sites were chosen , each at a distance of 1 cm away from the other . the mid - pupillary line was never crossed nor was the lowermost line injected , as the purpose of the treatment is only to get rid of the unwanted lines and , at the same time , maintain facial expression . a total of 25 patients with hyperfunctional facial lines of the forehead were treated at the department of oral and maxillofacial surgery at coorg institute of dental sciences . of the 25 patients , the age group was further divided into three groups : 2535 years , 3645 years , and 45 years above [ graph 1 ] . distribution of study subjects according to age and gender of the 25 patients , only 2 had history of systemic disease and 2 were diabetic . pregnant and nursing women , patients with neuromuscular disorders , and patients with excessive trepidation or unrealistic expectations were excluded from the study . all the 25 patients were injected with botulinum toxin injections into the forehead ; they were injected at six sites with 2.5 u per site . twenty - three patients showed satisfactory improvement of their hyperfunctional facial lines within 72 h , whereas four patients were not satisfied with the results and all four of them were males . the average facial wrinkle grading system results were calculated pre - injection , and at 2 weeks , 3 months , and 6 months post - injection separately , as recorded by patients verbal satisfaction grading . the satisfaction was similar in all three recordings ; the average improvement on the forehead was 84.0% , 84.0% , and 16.0% at 2 weeks , 3 months , and 6 months , respectively . this was statistically significant on comparing the pre - injection and post - injection results . maximum improvement was noted in the age group of 2540 years , with the older age group of 5065 years showing less improvement . eight patients had type 5 skin , six had type 4 skin , eight had type 3 skin , and three had type 2 skin [ graph 2 ] . thus , the maximum improvement was seen in type 5 skin , followed by type 4 and type 3 skin . distribution of study subjects according to type of skin on the forehead at 2 weeks , 3 months , and 6 months post - injection , there was 44.4% , 33.3% , and 22.2% satisfaction in type 2 skin , 38.1% , 42.9% , and 19.0% satisfaction in type 3 skin , 66.7% and 33 . 3% satisfaction in type 4 skin , and 66.7% and 33.3% satisfaction in type 5 skin . no adverse effects were noted in any case , except headache in one case and bruising in two cases . four male patients were not satisfied with the results because of the thicker musculature , and the p value was 0.080 , which is statistically insignificant . relationship between gender and skin difference table 2 shows the relationship between age and skin difference . maximum improvement was noted in the age group of 2545 years , with the older age above 45 years showing less improvement ; the p value was 0.023 , which is statistically significant . relationship between age and skin difference table 3 shows the post - treatment differences among different types of skin . the maximum improvement was seen in type 5 skin , followed by type 4 and type 3 skin . the p values were 0.00 , 0.001 , and 0.017 , which are statistically significant , and 0.199 , which is statistically not significant . botulinum toxin injections address the need for a short - term reversible therapy to touch up the aging face . a thorough knowledge of the pathophysiology of the neuromuscular junction has made it possible to harness a potentially lethal toxin and to use it paradoxically for the benefit of many , both for therapeutic and cosmetic purposes . the use of botulinum toxin has revolutionized the treatment of facial lines with an incomparable safety record over the past several years . most often , it does not replace surgery , skin resurfacing , soft tissue augmentation , or skin care . however , it has been shown to be quite useful when used alone or in conjunction with various treatment options , to give the cosmetic patient the most effective and comprehensive solution for a more youthful appearance . unwanted side effects can be minimized and beneficial effects maximized with a thorough understanding of the facial soft tissue anatomy , proper injection technique , proper patient selection , and administration of the lowest effective dosages with minimal volume of delivery . the specifics of the dilutions and the units per amount used for the different commercial forms of type a toxin available need to be understood fully and standardized together with the specific indications of botox as adjunctive therapy for specific facial surgical procedures , i.e. blepharoplasty , surgical brow lift , laser resurfacing , etc . finally , even though the anatomy of the facial musculature is well described , individual differences in men and women in different population groups , and in tissue qualities , such as turgor and elasticity , are important factors to be considered before undertaking botox injections . specific measuring devices such as digital imaging will further help define the use of botox for different muscle groups and facial aesthetic indications . in our study , most of the findings were in corroboration with the available literature as regards the efficacy of botulinum toxin in the treatment of hyperfunctional facial lines in the forehead . joseph conducted a study on 417 patients , who underwent 1085 treatment episodes with an estimated 17,000 injections . it was concluded that when following minimal guidelines , the use of botox for cosmetic facial applications is safe , predictable , and without serious complications and provides generalized patient satisfaction . the male sample size was less , i.e. only 10 ; yet , 4 of them were dissatisfied with the results . this guides us toward the inference that whereas the dosage of 2.5 u per site for six sites in the forehead was ideal for adult female patients , the thicker musculature in males required to be treated with a higher dosage of botulinum toxin . also of significance is the fact that maximum improvement was noted in the age group of 2540 years , with the older age group of 5065 years showing less improvement . skin with wrinkling only with scowling , i.e. type 5 , showed the best results , whereas thin skin , wrinkling characterized by deep dermal scarring , with hyperfunctional muscles , i.e. type 2 , showed the least improvement . effectivereversiblenonsurgical method to control facial musculature overactivity originating from either a congenital anomaly or intraoperative nerve injury , resulting in facial asymmetry , which is achieved by deliberate paralysis of functioning contralateral muscles until the injured nerve recoverspredictable and controlled paralysis . nonsurgical method to control facial musculature overactivity originating from either a congenital anomaly or intraoperative nerve injury , resulting in facial asymmetry , which is achieved by deliberate paralysis of functioning contralateral muscles until the injured nerve recovers predictable and controlled paralysis . expensivedisadvantageous to patients who would benefit from permanent paralysis , who otherwise need multiple injectionsdevelopment of resistance on long term use of high doses . disadvantageous to patients who would benefit from permanent paralysis , who otherwise need multiple injections development of resistance on long term use of high doses . viewed in a therapeutic context , two properties of botulinum toxin a have excited a great deal of interest : ( 1 ) its ability to pass from the gut into general circulation has raised the possibility that it might act as a carrier for oral medications and ( 2 ) its ability to bind with high affinity to cholinergic nerve endings and specifically block acetylcholine release has suggested that it might be useful in treating disorders of cholinergic transmission . these possibilities require profoundly different ways of converting a poison into a medicinal agent . to function as a carrier for oral medications , most notably , the ability to poison and some , such as the ability to penetrate membrane barriers , must be retained . to function as therapy for cholinergic disorders , just the opposite is required , i.e. the ability to poison must be retained and the ability to spread throughout the body must be diminished or abolished . further research is needed to study the general properties of botulinum toxin , including its ( 1 ) metabolism and catabolism , ( 2 ) the mechanisms of recovery from paralysis , ( 3 ) the target receptors , ( 4 ) the pharmacologic features of other serotypes , ( 5 ) antidotes and blocking techniques , ( 6 ) techniques to increase the specificity and duration of action , and ( 7 ) the stability and consistency of pharmaceutical preparations . effectivereversiblenonsurgical method to control facial musculature overactivity originating from either a congenital anomaly or intraoperative nerve injury , resulting in facial asymmetry , which is achieved by deliberate paralysis of functioning contralateral muscles until the injured nerve recoverspredictable and controlled paralysis . nonsurgical method to control facial musculature overactivity originating from either a congenital anomaly or intraoperative nerve injury , resulting in facial asymmetry , which is achieved by deliberate paralysis of functioning contralateral muscles until the injured nerve recovers predictable and controlled paralysis . expensivedisadvantageous to patients who would benefit from permanent paralysis , who otherwise need multiple injectionsdevelopment of resistance on long term use of high doses . disadvantageous to patients who would benefit from permanent paralysis , who otherwise need multiple injections development of resistance on long term use of high doses . viewed in a therapeutic context , two properties of botulinum toxin a have excited a great deal of interest : ( 1 ) its ability to pass from the gut into general circulation has raised the possibility that it might act as a carrier for oral medications and ( 2 ) its ability to bind with high affinity to cholinergic nerve endings and specifically block acetylcholine release has suggested that it might be useful in treating disorders of cholinergic transmission . these possibilities require profoundly different ways of converting a poison into a medicinal agent . to function as a carrier for oral medications , most notably , the ability to poison and some , such as the ability to penetrate membrane barriers , must be retained . to function as therapy for cholinergic disorders , just the opposite is required , i.e. the ability to poison must be retained and the ability to spread throughout the body must be diminished or abolished . further research is needed to study the general properties of botulinum toxin , including its ( 1 ) metabolism and catabolism , ( 2 ) the mechanisms of recovery from paralysis , ( 3 ) the target receptors , ( 4 ) the pharmacologic features of other serotypes , ( 5 ) antidotes and blocking techniques , ( 6 ) techniques to increase the specificity and duration of action , and ( 7 ) the stability and consistency of pharmaceutical preparations . thus , we conclude that botulinum toxin is a safe and efficacious method of nonsurgically eliminating hyperfunctional facial lines of the forehead in the aesthetic surgical patient for a period of 46 months . the dosage of 2.5 u per site at six or eight sites in the forehead was found to be ideal for female patients . males require a higher dosage of botulinum toxin , i.e. 4 u per injection site . maximum improvement was seen in type 5 skin , followed by type 4 and type 3 skin . no adverse effects were noted in any case , except headache in one case and bruising in two cases . thus , even though these are preliminary reports with a small sample size , we believe that this is the beginning of an era of pharmaceutical , nonsurgical control of facial muscles in selected patients . to conclude , though botulinum toxin is the most potent poison known to mankind , it definitely has potent and numerous clinical applications , as well as immense future scope .
### Summary: : background : in the 21st century , we live longer and a more active life . however , while our adult longevity continues to extend , society does not welcome a tired and aged appearance . we wish to continue to look as young as possible . most facial rejuvenation techniques such as surgery and injection of collagen , silicone , or autogenous fat do not address the fact that these lines are functional , i.e. they do not target the cause of hyperfunctional lines : the underlying facial mimetic musculature.aim:to find the efficacy of botulinum toxin for the treatment of hyperfunctional lines of the forehead.materials and methods : the present study consisted of 25 subjects in the age group of 2565 years with forehead wrinkles , who visited the department of oral and maxillofacial surgery , cids , virajpet . the materials used for botulinum toxin treatment were botulinum toxin a , a standard freezer , sterile saline solution , alcohol swabs , and insulin syringes with 30 gauge needles.results:of the 25 patients , 21 patients showed satisfactory improvement of their hyperfunctional facial lines within 72 h. maximum improvement was noted in the age group of 2540 years , while the older age group of 5065 years showed less improvement . maximum improvement was seen in type 5 skin , followed by type 4 and type 3 skin . type 2 skin showed the least improvement.conclusion:we conclude that botulinum toxin a is a safe and efficacious method of nonsurgically eliminating hyperfunctional facial lines of the forehead in the aesthetic patient for a period of 46 months .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : periodontitis represents a destructive chronic inflammatory disease with a bacterial infection resulting from the complex actions of a small subset of periodontal pathogens . from a pathological point of view , periodontitis can be defined as the presence of gingival inflammation at sites where there has been a pathological detachment of collagen fibers from the cementum and the junctional epithelium has migrated apically . the inflammatory response of the periodontal tissues to infection is influenced by environmental factors as well as by genetic factors . the primary microbial factor contributing to periodontitis is a shift in the content of the oral microflora , while the primary immunological factor is the destructive host inflammatory response . the microbiota associated with periodontal health and disease has been intensely studied for well over a century by several generations of skilled scientists and clinicians . oral microbiota is an enormously complex and dynamic entity that is profoundly affected by perpetually changing local environments and host - mediated selective pressures . the presence of a commensal microbiota , including potential pathogens , is essential for the proper development of mucosal immunity . the normal oral flora is hence in a balance between pathogens and commensals that requires regular cleaning to be maintained . a decrease in oral hygiene is quickly followed by the build - up of oral biofilms on tooth surfaces and , if left untreated , will progress to gingival inflammation and possibly periodontitis , alveolar bone loss , and loss of teeth . it is likely that differences in host - defense mechanisms , including antimicrobial protein profiles , determine whether bacterial colonization progresses to overt disease . recent data estimate that the oral cavity may contain up to 19 000 bacterial phylotypes , but each individual will only have a rate of the total numbers of pathogens . indeed , there is a substantial diversity in the content of the microflora between individuals and between different oral sites within the same individual . research has indicated that dietary changes combined with poor hygiene can cause a shift in the composition of the oral bacteria . moreover , some evidence in recent studies suggests that the oral microbiome changes as human beings age and the dysbiosis in the oral cavity can lead to periodontitis . several methods have been used for microbiological testing in periodontitis . however , many techniques have not been fully accepted due to low sensitivity or specificity ; moreover , sometimes they are slow , expensive , and laborious . in our laboratory ( lab srl , ferrara , italy ) , we developed a rapid and sensitive test to detect and quantify the three bacterial species more involved in periodontitis that constituted the red complex group : porphyromonas gingivalis , tannerella forsythia , and treponema denticola . both p. gingivalis and t. denticola occur concomitantly with the clinical signs of periodontal destruction . they appear closely linked topologically in the developing biofilm , shown an in vitro ability to produce a number of outer membrane - associated proteinases , and are considered the first pathogens involved in the clinical destruction of periodontal tissues . moreover , both of them and t. forsythia show an higher prevalence in disease than in health , suggesting that these bacterial are associated with the local development of periodontitis . the presence and the level of these pathogens can be effectively revealed by real - time polymerase chain reaction ( pcr ) analysis using bacterial species - specific primers and probes . our findings support the hypothesis that detection and quantification of red complex bacteria in crevicular fluid could be an appropriate tool for diagnosis and prognosis of periodontitis . a total of 307 individuals participated in the study , 127 were affected by chronic periodontitis , while 180 constituted the control group . a sample of the periodontal pocket microbiota was obtained from a single site by a paper probe . dna was extracted and purified using standard protocols that include two consecutive incubations with lysozyme and proteinase k , followed by spin - column purification . primers and probes oligonucleotides were designed basing on 16s rrna gene sequences of the human oral microbiome database ( homd 16s rrna refseq version 10.1 ) counting 845 entries . all the sequences were aligned in order to find either consensus sequence or less conservate spots . the first reaction quantified the total amount of bacteria using two degenerate primers and a single probe matching a highly conservated sequence of the 16s ribosomal rna gene . the second reaction detected and quantified the three red complex bacteria , i.e. , p. gingivalis , t. forsythia , and t. denticola , in a multiplex pcr . this reaction included a total of six primers and three probes that were highly specific for each species . oligonucleotide concentrations and pcr conditions were optimized to ensure sensitivity , specificity , and no inhibitions in case of unbalanced target amounts . the amplification profile was initiated by a 10-minute incubation period at 95c to activate polymerase , followed by a two - step amplification of 15 s at 95c and 60 s at 57c for 40 cycles . plasmids containing synthetic dna target sequences ( eurofin mwg operon , ebersberg germany ) were used as standard for the quantitative analysis . standard curves for each target were constructed in a triplex reaction , by using a mix of the same amount of plasmids , in serial dilutions ranging from 101 to 107 copies . there was a linear relationship between the threshold cycle values plotted against the log of the copy number over the entire range of dilutions ( data not shown ) . the absolute quantification of total bacterial genome copies in samples allowed for the calculation of relative amount of red complex species . to prevent samples and pcr contamination , the freeman - halton extension of fisher 's exact test was used to compute the ( two - tailed ) probability of obtaining a distribution of values in a 2 3 contingency table , given the number of observations in each cell . absolute bacteria amount were normalized against the total bacterial load , obtaining the relative bacteria amount ( rba ) . the one - way analysis of variance ( anova ) was used to determine whether there were any significant differences between the mean rba value of three patients group , i.e. , healthy , gingivitis , and periodontitis . primers and probes oligonucleotides were designed basing on 16s rrna gene sequences of the human oral microbiome database ( homd 16s rrna refseq version 10.1 ) counting 845 entries . all the sequences were aligned in order to find either consensus sequence or less conservate spots . the first reaction quantified the total amount of bacteria using two degenerate primers and a single probe matching a highly conservated sequence of the 16s ribosomal rna gene . the second reaction detected and quantified the three red complex bacteria , i.e. , p. gingivalis , t. forsythia , and t. denticola , in a multiplex pcr . this reaction included a total of six primers and three probes that were highly specific for each species . oligonucleotide concentrations and pcr conditions were optimized to ensure sensitivity , specificity , and no inhibitions in case of unbalanced target amounts . the amplification profile was initiated by a 10-minute incubation period at 95c to activate polymerase , followed by a two - step amplification of 15 s at 95c and 60 s at 57c for 40 cycles . plasmids containing synthetic dna target sequences ( eurofin mwg operon , ebersberg germany ) were used as standard for the quantitative analysis . standard curves for each target were constructed in a triplex reaction , by using a mix of the same amount of plasmids , in serial dilutions ranging from 101 to 107 copies . there was a linear relationship between the threshold cycle values plotted against the log of the copy number over the entire range of dilutions ( data not shown ) . the absolute quantification of total bacterial genome copies in samples allowed for the calculation of relative amount of red complex species . to prevent samples and pcr contamination , the freeman - halton extension of fisher 's exact test was used to compute the ( two - tailed ) probability of obtaining a distribution of values in a 2 3 contingency table , given the number of observations in each cell . absolute bacteria amount were normalized against the total bacterial load , obtaining the relative bacteria amount ( rba ) . the one - way analysis of variance ( anova ) was used to determine whether there were any significant differences between the mean rba value of three patients group , i.e. , healthy , gingivitis , and periodontitis . occurrence and amount of red complex bacteria from crevicular fluid were evaluated in 307 individuals . a single specimen from each patient was analyzed by quantitative real - time pcr , obtaining measures of total bacteria load and of three species involved in periodontitis , i.e. , p. gingivalis , t. forsythia , and t. denticola . here , we report a preliminary study focused mainly on prevalence of these three species among groups of patients with different diagnosis regardless of different clinical aspects that may describe severity of the disease in order to understand whether the presence of the red complex species and their relative amount may be considered predictive factors of periodontitis . prevalence of the three investigated species among healthy , gingivitis , and periodontitis patients is shown in figure 1 . each species was common among healthy patients ; however , the prevalence was roughly double in periodontitis group . intermediate values , but closer to healthy individuals , were observed among patients affected by gingivitis . prevalence of red complex bacterial species in healthy ( green ) , gingivitis ( yellow ) , and periodontitis ( red ) patients obtained data are detailed in table 2 . the freeman - halton extension of fisher 's exact test indicated that the prevalence of each red complex species is different among groups of patients with high degree of statistical significance , p. gingivalis ( p value = 2 10 ) , t. forsythia ( p value = 1 10 ) , and t. denticola ( p value = 2 10 ) . the higher level of association with periodontitis was observed for t. forsythia , indeed the observed odds ratio was 6.1 ( 95% c.i . , 3.1 - 11.9 ) when healthy individuals were compared to periodontitis patients , and 4.6 ( 95% c.i . , 2.6 - 7.9 ) when healthy and gingivitis groups where combined and compared to periodontitis patients . association analysis between red complex bacteria and periodontitis results of quantitative data indicated that the normalized amount of p. gingivalis significantly differs among patient groups f ( 2,304 ) = 7.77 , p value = 0.001 ; as well as for t. denticola f ( 2,304 ) = 7.47 , p value = 0.001 . on the contrary , it did not vary for t. forsythia f ( 2,304 ) = 1.41 , p value = 0.25 . plots represent the relative amount of each red complex bacterial species in the different group of patients the pcr is the most sensitive and rapid method to detect microbial pathogens in clinical specimens . in particular , the diagnostic value of pcr is significantly higher when specific pathogens that are difficult to culture in vitro or require a long cultivation period such as for anaerobic bacteria species are involved in periodontitis onset . a recent improvement of this technique is the real - time pcr that allow for quantitation of dna target using fluorogenic probes in a close setup . besides the opportunity to quantify target , the advantage to perform the assay is a closed system , in which the reaction tube is never opened after amplification , is of great value to prevent laboratory contamination and false - positive results . in addition , the need of a probe , in addition to the two pcr primers , further increases the specificity of the reaction . in the present investigation , we designed and tested the performance of a real - time pcr - based assay to detect and quantify the red complex bacteria involved in periodontal disease . in particular , we found that p. gingivalis , t. forsythia , and t. denticola were strongly related to periodontitis because their prevalence was higher among periodontitis patient . the presence of these bacterial species can significantly increase the risk to develop periodontitis , the or being comprised between 6.1 ( t. forsythia ) and 3.4 ( t. denticola ) . the results of quantitative data analysis indicated that the relative amount of p. gingivalis and t. denticola in periodontal pocket was sensibly higher in affected patients . this indicated that both the presence and relative amount of red complex bacteria is relevant data in periodontal disease diagnosis . molecular analysis of periodontal pocket microflora by real - time pcr represents an effective inexpensive method to rapidly detect and quantify red complex bacterial species . this test was performed in a large patient sample and results demonstrated that the test is a valuable tool to improve diagnosis of periodontal disease .
### Summary: : background : periodontitis is a disease that affects and destroys the tissues that support teeth . tissue damage results from a prolonged inflammatory response to an ecological shift in the composition of subgingival biofilms . three bacterial species that constitute the red complex group , porphyromonas gingivalis , tannerella forsythia , and treponema denticola , are considered the main pathogens involved in periodontitis.materials and methods : in the present study , a real - time polymerase chain reaction bases assay was designed to detect and quantify red complex species , then used to investigate 307 periodontal pocket samples from 127 periodontitis patients and 180 controls.results:significant higher prevalence of red complex species and increased amount of p. gingivalis and t. denticola were detected in periodontal pocket of periodontitis patients.conclusions:results demonstrated that the test is a valuable tool to improve diagnosis of periodontal disease .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : a review of the literature on stroke reveals that ischemic stroke may account for about 85% of all strokes . current strategies of acute ischemic stroke management include intravenous tissue plasminogen activator ( iv - tpa ) and endovascular intervention . the thrombolytic therapy in acute ischemic stroke has to be administered within 4.5 h after symptom onset . time from onset of stroke symptoms to treatment with thrombolysis is crucial for outcome after ischemic stroke . there are various factors which predict the outcome in acute stroke patients treated with iv alteplase therapy . the clinical characteristics of the patient , such as age , gender , severity of stroke , diabetes , hypertension , and cardiovascular comorbidities , are the known risk factors of stroke and predictors of poor outcome in untreated patients . the outcome is also determined by factors such as age , gender , stroke severity at the time of presentation as assessed by national institutes of health stroke scale ( nihss ) score . alteplase has been approved for treatment of acute stroke for the past two decades and has shown favorable outcome in stroke patient . however , this treatment modality has been introduced in our rural medical college only in the last year . there were studies which have shown higher in - hospital mortality in acute stroke patient receiving alteplase therapy and various independent predictors of the good outcome after the iv alteplase therapy in acute stroke patients has also been characterized . an extensive review of literature reveals paucity of data on studies predicting poor outcome after the iv alteplase therapy in acute stroke patients . therefore , the objective of the current analyses was to determine poor prognostic factors after iv alteplase for acute ischemic stroke patients . this prospective study was carried out among 31 stroke patients undergoing thrombolysis at a tertiary care center in a rural area of north - west india . for establishing inclusion in the study , all patients identified as presenting to or referred to emergency department with a suspected stroke underwent a computed tomography ( ct ) scan . out of these patients , those who had presented within the window period of 4.5 h and with no intracranial bleed were included in this study . the study participants were shifted to the intensive care unit of hospital and a protocol for thrombolysis was followed . a follow - up for these patients was established ( as detailed below ) for evaluation of poor outcome using nihss scoring . the study participants were thrombolysed with iv - tpa alteplase , provided free of cost to the patient by the state government . thrombolysis was done with iv - tpa alteplase after reconstitution as per the manufactures guideline at a dose of 0.9 mg / kg . ten percent of total dose was given intravenously as bolus over 1 min and the rest 90% was given as infusion with electronic injection perfuser over 1 h. the patient was monitored during the procedure for any adverse reaction and complication . vitals were monitored every 15 min during the procedure followed by every hour for 2 h and every two hourly for next 24 h. the data of these patients were entered in a pro forma for the purpose of evaluation . the presence of risk factors and comorbidities were determined for each patient from the data obtained . the various risk factors determined were age , gender , hypertension , diabetes , dyslipidemia , smoking , alcohol , history of stroke , coronary artery disease ( cad ) , and history of rheumatic heart disease ( rhd ) . in addition to details on risk factors , details regarding the knowledge about stroke , mean of transportation , treatment patient taking , time of onset , interventions , etc . , were also recorded in the pro forma . prehospital and in - hospital time delay in management of stroke patients was calculated for each patient . blood pressure , pulse rate , and its character , especially irregularity of pulse , and blood sugar at the time of presentation was determined . mean of transport from the site of the event to the hospital was determined for each patient . the time elapsed between deficits to hospital admission , between hospital admission and ct head , between hospital admission and thrombolysis , between deficit and start of thrombolysis , and between hospital admission and start of thrombolysis were determined for each patient . outcome was determined using modified rankin scale ( mrs ) score and nihss score at 3 months after treatment . good outcome was determined as mrs score 02 and poor outcome as mrs score 36 . the data summarized as proportions were compared using chi - square test and those presented as means were compared using the unpaired student 's t - test . this prospective study was carried out among 31 stroke patients undergoing thrombolysis at a tertiary care center in a rural area of north - west india . for establishing inclusion in the study , all patients identified as presenting to or referred to emergency department with a suspected stroke underwent a computed tomography ( ct ) scan . out of these patients , those who had presented within the window period of 4.5 h and with no intracranial bleed were included in this study . the study participants were shifted to the intensive care unit of hospital and a protocol for thrombolysis was followed . a follow - up for these patients was established ( as detailed below ) for evaluation of poor outcome using nihss scoring . the study participants were thrombolysed with iv - tpa alteplase , provided free of cost to the patient by the state government . thrombolysis was done with iv - tpa alteplase after reconstitution as per the manufactures guideline at a dose of 0.9 mg / kg . ten percent of total dose was given intravenously as bolus over 1 min and the rest 90% was given as infusion with electronic injection perfuser over 1 h. the patient was monitored during the procedure for any adverse reaction and complication . vitals were monitored every 15 min during the procedure followed by every hour for 2 h and every two hourly for next 24 h. the data of these patients were entered in a pro forma for the purpose of evaluation . the presence of risk factors and comorbidities were determined for each patient from the data obtained . the various risk factors determined were age , gender , hypertension , diabetes , dyslipidemia , smoking , alcohol , history of stroke , coronary artery disease ( cad ) , and history of rheumatic heart disease ( rhd ) . in addition to details on risk factors , details regarding the knowledge about stroke , mean of transportation , treatment patient taking , time of onset , interventions , etc . , were also recorded in the pro forma . prehospital and in - hospital time delay in management of stroke patients was calculated for each patient . blood pressure , pulse rate , and its character , especially irregularity of pulse , and blood sugar at the time of presentation was determined . mean of transport from the site of the event to the hospital was determined for each patient . the time elapsed between deficits to hospital admission , between hospital admission and ct head , between hospital admission and thrombolysis , between deficit and start of thrombolysis , and between hospital admission and start of thrombolysis were determined for each patient . outcome was determined using modified rankin scale ( mrs ) score and nihss score at 3 months after treatment . good outcome was determined as mrs score 02 and poor outcome as mrs score 36 . the data summarized as proportions were compared using chi - square test and those presented as means were compared using the unpaired student 's t - test . table 1 compares the risk factors and clinical character associated with the good and poor outcome . good outcome ( mrs score 02 ) was seen in 15 ( 48.4% ) patients with median age of ( 60 ) and poor outcome ( mrs score 36 ) was seen in 16 ( 51.6% ) patients median age of 75 years , which was statistically significant with the p = 0.002 . there were 21 males , 11 ( 52.4% ) had good outcome and 10 ( 47.1% ) had poor outcome , and out of 10 females , 4 ( 40% ) had poor outcome whereas 6 ( 60% ) had good outcome . there was not much difference in the body mass index ( bmi ) among the two groups with median bmi of 21.01 in good outcome and 22.3 in poor outcome group . there was not much difference in the risk factors such as hypertension , diabetes , dyslipidemia , smoking , alcohol intake , history of stroke , cad , and rhd among the two groups . effect of risk factors and outcome of thrombolysis the severity of stroke as assessed by nihss score at the time of presentation was significantly higher among the patients with poor outcome , with p = 0.01 . the basic parameters such as education , awareness , means of transportation , and blood pressure at the time of presentation of the patient at hospital was not significantly different between poor outcome group and good outcome group . the mean duration of deficit at the time of presentation to the hospital from the onset of deficit was 99 min in good outcome group and 87 min in poor outcome group [ table 2 ] . effect of time of presentation on outcome of thrombolysis moreover , mean duration of deficit at the time of start of treatment was 206 min and 202 min in good outcome group and poor outcome group . there are various factors which predict the outcome in acute stroke patients treated with iv alteplase therapy . the clinical characteristics of patient , such as age , gender , severity of stroke , diabetes , hypertension , and cardiovascular comorbidities , are the known risk factors of stroke and predictors of poor outcome in untreated patients . in the present study , we analyzed these risk factors and their relation with the outcome at 3 months after treatment , in patients with acute stroke treated with iv alteplase within 4.5 h of onset . studies have shown that every 10 years increase in age are associated with 3.6-fold decrease in the good outcome . our study also found that acute stroke patients with advanced age have poor outcome at 3 months after thrombolysis with alteplase . the findings are consistent with studies which showed that advanced age is an independent factor associated with the poor outcome . the time of treatment from the onset of deficit to start of treatment was inversely related to the outcome in an earlier study . however , we did not find any difference between the good and poor outcome in our study with respect to start of treatment . this may be because majority of our patients were thrombolysed within 34 h of stroke onset in our study . we have found that patients with higher nihss score at the time of treatment have poor outcome 3 months after treatment with iv alteplase therapy . these findings again are consistent with studies that showed that higher nihss score at the time of presentation is associated with the poor outcome and nihss score > 16 is associated with more probability of death or severe disability and score < 6 has good prognosis . from this study , a higher nihss score at the time of onset of stroke and advance age in acute ischemic stroke patients are independent predictors of poor outcome after thrombolysis with iv alteplase . patients with lower nihss score and of young were more likely to be benefited from therapy .
### Summary: : introduction : thrombolytic therapy in acute ischemic stroke has been approved for treatment of acute stroke for past two decades . however , identification of predictors of poor outcome after the intravenous ( iv ) alteplase therapy in acute stroke patients is a matter of research . the present study was conducted with the aim of identifying poor prognostic factors in patients of acute ischemic stroke patients.methods:the data of 31 acute stroke patients treated with alteplase were gathered to identify the factors that were independent predictors of the poor outcome . outcome was dichotomized using modified rankin scale ( mrs ) score and national institutes of health stroke scale ( nihss ) score at 3 months after treatment into good outcome mrs 02 and poor outcome mrs 36 . predictors of poor outcome were analyzed.results:good outcome ( mrs score 02 ) was seen in 15 ( 48.4% ) patients with median age of ( 60 ) and poor outcome ( mrs score 36 ) was seen in 16 ( 51.6% ) patients median age of 75 years , which was statistically significant with the p = 0.002 . the presence of risk factors such as hypertension , diabetes , dyslipidemia , smoking , alcohol intake , history of stroke , coronary artery disease , and rheumatic heart disease among the two groups did not seem influence outcome . the severity of stroke as assessed by nihss score at the time of presentation was significantly higher among the patients with poor outcome , with p = 0.01.conclusion:advance age and higher nihss score at the time of onset of stroke and are the independent predictors of the poor outcome after thrombolysis with iv alteplase treatment in acute ischemic stroke patients .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: : the severity of late normal tissue toxicity is a limiting factor during the administration of radiotherapy . it has become clear that interpatient variability in the incidence of late normal tissue toxicity could be partially due to individual patient sensitivity to radiation and the prediction of a patient 's radiosensitivity would facilitate improved patient treatment . the induction and repair of chromosomal damage in irradiated lymphocytes are thought to be promising predictors of individual patient sensitivity to ionizing radiation . since dna double - strand breaks ( dsbs ) are considered to be the critical lesion for dna damage , the lack of repair , or misrepair , can have severe repercussions . as such , it is important to be able to quantitate the induction and disappearance of dsbs . rogakou et al . in 1999 showed that h2ax ( an electrophoretic isoform of the histone h2a ) is phosphorylated ( h2ax ) at the sites of dsbs , and sedelnikova et al . in 2003 demonstrated that h2ax foci corresponded one to one with dsbs . these results mean that the number of dsbs induced can be measured by counting the number of h2ax foci . furthermore , by staining h2ax with a fluorochrome - labelled antibody , these individual foci can be visualized and enumerated by microscopy ( spot counting ) which is a sensitive but time - consuming method . alternatively , flow cytometry can measure the emitted fluorescence from the h2ax foci , which is a less sensitive method , however , it is one that provides good population statistics . in 2004 , olive and banth proposed that the expression of h2ax , as measured by flow cytometry , could be used as an indicator of tissue radiosensitivity . studied the h2ax response in mice and found that even minor impairments in dsb repair lead to excessive dna damage accumulation during fractionated irradiation and concluded that this may have a significant impact on normal tissue response in clinical radiotherapy . in addition to induction of repair as a potential indicator , menegakis et al . in 2009 investigated residual h2ax foci as potential indicators of clonogenic cells and found that after 24 hours , residual h2ax foci correlated with clonogenic survival . while a study by werbrouck et al . in 2010 found that scoring of h2ax foci in isolated t - lymphocytes was not predictive for late radiotoxicity , a study by chua et al . in 2011 comparing the efficiency of dsb repair and chromosomal radiosensitivity in ex vivo irradiated blood lymphocytes between radiosensitive and control patients found that residual foci measured 24 h after 4 gy were significantly higher in patients considered to be radiosensitive as compared to controls . a study by andrievski and wilkins in 2009 noted that lymphocyte subsets cd4 , cd8 , and cd19 had varied h2ax responses and proposed that investigating the in vitro response in lymphocyte subsets , cd19 in particular , might be proved to be a more sensitive assay . the goal of this project was to use flow cytometry methods to analyze the induction and residual of in vitro h2ax response in lymphocytes and lymphocyte subsets of patient classified as radiosensitive or nonsensitive ( control ) to radiation in order to determine if the lymphocytes or lymphocyte subsets yielded a more sensitive indication of radiation response . patients for this study were selected from an ongoing phase 3 clinical trial ( ott0101 , ohreb number 2001014 - 01h ) evaluating the optimal sequencing of radiation and 6 months hormonal of therapy in ct1-ct3 prostate cancer ( as described previously in beaton et al . ) . briefly , based on the rtog / eortc late toxicity scale , 10 patients who were identified with grade 3 late proctitis ( radiosensitive ) were matched with 20 grade 0 patients ( control ) . table 1 ( also published in ) provides a summary of the patients ' clinical characteristics . the study was approved by the ottawa hospital research ethics board and health canada 's research ethics board . the blood samples , drawn in lithium - heparin tubes ( becton , dickinson and co ( bd ) , mississauga on ) , were cultured 1 : 10 with sterile 15% complete media ( 86% rpmi 1640 ( invitrogen , burlington , on ) , 15% fbs ( sigma - aldrich , oakville , on ) , and 1% 2 mm l - glutamine ( sigma - aldrich , 100x ) ) and kept in a 25 cm vented culture flask ( vwr , mississauga , on ) . from the culture flask , the blood in media suspension was aliquoted into 19 samples of 1 ml into 5 ml flow tubes ( bd ) and placed on ice . these 19 samples included 6 dose points , 1 unstained control , 3 single - colour controls , 1 negative h2ax colour control , 1 positive h2ax colour control , and 7 full minus one ( fmo ) controls . at least 1 ml of blood was left in the lithium - heparin tube on a rocker to be used for the time course experiments . of this 1 ml , 100 l was removed and added to 900 l complete media before each of the 7 time point samples was irradiated . the blood samples were irradiated upright , on ice , in a cabinet x - ray ( x - rad320 , precision x - ray , north branford ct ) at 250 kv , 12.5 ma , with a 2 mm al filter and at 50 cm from the source . the dose rate was 1.7 gy / min calibrated using a radcal 9010 ion chamber ( radcal , monrovia , ca ) calibrated at nrc ( nk = 0.992 gy / gyreading at 250 kv ) . the dose course samples received the following doses : 0 , 2 , 4 , 6 , 8 , and 10 gy . the unstained , single - colour , negative h2ax , and negative fmo controls remained unirradiated . after irradiation , the samples were left to stand in a water bath at 37c , tightly capped , for 1 hour . the time course samples received 2 gy each and were placed in a 37c incubator , loosely capped for the following incubation times : 0 , 0.5 , 1 , 2 , 4 , 8 , and 24 h , with irradiations being staggered such that all time course samples were processed simultaneously . after incubation , the samples were fixed and permeabilized using a modified method from chow et al . . the samples were cold ( 0c ) centrifuged for 8 minutes at 300 g . 65 l of 10% formaldehyde , at room temperature ( rt ) , was carefully added and mixed immediately . the samples were incubated at rt for 10 minutes . 1 ml of cold triton - x in pbs ( 0.12% w / v triton - x 100 , sigma - aldrich ; 100% pbs ) was then added to each sample , which was again incubated for 30 minutes at rt . the samples were rinsed with 1 ml of cold wash buffer ( 96% pbs , 4% fbs ) , mixed , and cold centrifuged for 8 minutes at 300 g . the supernatant was aspirated , the pellet was resuspended , and 1 ml of cold methanol solution ( 70% meoh , 30% pbs ) was added dropwise while vortexing . the samples were maintained on ice , stored at 40c overnight , and processed within 2 days . from the freezer , the samples were resuspended and 1 ml of cold tbs was added and mixed . the samples were cold centrifuged for 5 minutes at 400 g , the supernatant was aspirated , and the pellet was resuspended . 1 ml of cold tst ( 96% tbs , 4% fbs , 0.1% triton - x 100 ) was added to each sample and mixed . the samples were incubated on ice for 10 minutes and then cold centrifuged for 5 minutes at 400 g . after aspirating the supernatant and resuspending the pellet , 1 l of h2ax - fitc ( millipore , etobicoke , on ) was added to the required samples and all of the samples were incubated on ice , in the dark , for 2 hours . thirty minutes prior to the end of incubation , the cd antibodies were also added to the required samples ( 10 l cd4-pe ( bd ) , 5 l cd8-apc ( bd ) , and 5 l cd19-pc7 ( beckman coulter , mississauga , on ) ) . following the 2-hour incubation , 1 ml cold tbs + 2% fbs solution was added to all the samples , and they were cold centrifuged for 5 minutes at 400 g . the supernatant was aspirated , and the pellet resuspended in 500 l of cold tbs + 2% fbs . the samples were stored in the dark on ice until they were run through the flow cytometer . a gate was drawn around the lymphocyte population based upon characteristic populations in the forward versus side scatter acquisition plots . the data was acquired without compensation on a facscalibur ( bd ) , and compensation and analysis were performed after acquisition using the software fcs express ( de novo software , los angeles , ca ) . in each of the two experiments ( dose course , time course ) , two status groups , sensitive and control populations , were compared . each experiment investigated the two groups with respect to four endpoints ( lymphocytes , cd4 , cd8 , and cd19 ) . in both of these experiments a two - factor analysis of variance model with randomized complete block design ( rcbd ) was applied , where patients were nested within each level of status . the two factors are status group ( sensitive , control ) and dose ( or time ) . the rcbd accounts for individuals blood samples tested at all dose groups or measured at each time point . the interest was investigating if there was a difference in the mean fluorescent intensity for the four endpoints between status groups , as well as if differences between status groups occurred at each dose group or time point . linear mixed effects models ( lmms ) were applied to model the outcome of the mean fluorescent intensity , where each individual sample was considered a random block nested within status group , to control for correlation between samples in various dose groups or at various time points . when the overall f test from the lmm for difference between status groups or the interaction between status group and dose or time was observed ( p < 0.05 ) , then multiple comparison tests were applied to compare the two status groups at each dose level or time point . bonferroni corrections were applied for pairwise comparisons in order to adjust the type i error rate to be less than 0.05 . the endpoints lymphocytes , cd4 , cd8 , and cd19 were analyzed separately . the assumptions for lmm were verified using the anderson - darling test for normality of residuals and bartlett 's test for homogeneity of variance across groups . when these assumptions were not satisfied then nonparametric statistics were used . table 2 presents the average and standard deviation of geometric mean fluorescent intensity for cd4 , cd8 , cd19 , and lymphocytes at each dose and status group in the dose course . figure 1 displays the results from the four endpoints cd4 , cd8 , cd19 , and lymphocytes in the dose course . as can be seen in table 2 and in figure 1 , average geometric mean fluorescent intensity was similar between the two status groups ( sensitive and control ) for each of the four endpoints . there were no significant differences observed between the two status groups at each of the respective dose groups ( p > 0.05 in all endpoints , see table 2 ) . table 3 presents the average and standard deviation of geometric mean fluorescent intensity for cd4 , cd8 , cd19 , and lymphocytes at each time point and status group in the time course . figure 2 displays the results from the four endpoints cd4 , cd8 , cd19 , and lymphocytes in the time course . as can be seen in table 3 and in figure 2 average geometric mean fluorescent intensity was similar between the two status groups ( sensitive and control ) for each of the four endpoints . as well there were no significant differences observed between the two status groups at each of the respective time points ( p > 0.05 in all endpoints , see table 3 ) . unfortunately , after fairly rigorous examination of the patient samples , with 6 dose points and 7 time points each , there was no significant difference found in either experiment . although it is not uncommon to normalize the data to the 0 gy or 0 h time point , it was decided that this could potentially skew the data as those points are just as susceptible to experimental error . it has been shown ( see lew 2007 for a detailed example ) that when there is a correlation between the data , as is the case in this study , the randomized block anova is more powerful than a one - way anova . despite this , no significant differences were found . in order to explore the data further absolute values of studentized residuals were generated for each patient at each dose and time point , and any greater than 2 were considered to be suspect . with some of the points identified as suspect , the statistical analysis was run on the ranks of the data and compared to the original data . by analyzing the ranks , the results were the same in each case , indicating that the possible outliers were not masking any differences between the two groups of patients . although menegakis et al . found a correlation between residual h2ax foci and clonogenic survival and chua et al . found a difference 24 h after a 4 gy dose , both performed their analyses by spot counting . while the results of this study were unable to detect any differences between the sensitive and control groups , this may have been a result of the methodology not being sensitive enough . even with increased counting statistics , the small differences between the groups could not be detected . it is also possible that the time and dose points used in this study were not ideal for detecting differences . chua detected a significant difference 24 h after 4 gy while our 24 h point was after 2 gy . it has previously been seen that differences in radiosensitivity become more apparent when larger amounts of damage have been induced in vitro ( beaton et al . ) . as the endpoints used in this study were not the same as those used by chua et al . , it is difficult to make a direct comparison . in conclusion , the sensitivity of conventional flow cytometry was insufficient to detect a difference between patients identified as sensitive or control , even when investigating lymphocyte subsets . further studies will investigate whether an imaging flow cytometer , with increased sensitivity due to imaging capabilities , will be capable of distinguishing between the two populations . this technology will combine the sensitivity of spot counting with the advantage of high throughput and better count statistics .
### Summary: : background and purpose . this project examined the in vitro h2ax response in lymphocytes of prostate cancer patients who had a radiosensitive response after receiving radiotherapy . the goal of this project was to determine whether the h2ax response , as measured by flow cytometry , could be used as a marker of individual patient radiosensitivity . materials and methods . patients were selected from a randomized clinical trial evaluating the optimal timing of dose escalated radiation and short - course androgen deprivation therapy . of 438 patients , 3% developed grade 3 late radiation proctitis and were considered to be radiosensitive . blood was drawn from 10 of these patients along with 20 matched samples from patients with grade 0 proctitis . dose response curves up to 10 gy along with time response curves after 2 gy ( 024 h ) were generated for each sample . the h2ax response in lymphocytes and lymphocyte subsets was analyzed by flow cytometry . results . there were no significant differences between the radiosensitive and control samples for either the dose course or the time course . conclusions . although h2ax response has previously been demonstrated to be an indicator of individual patient radiosensitivity , flow cytometry lacks the sensitivity necessary to distinguish any differences between samples from control and radiosensitive patients .
<s> [INST] <<SYS>> You a helpful assistant capable of providing accurate and concise responses. You will assist me in generating Summary.<</SYS>> [/INST] <s> ### Text: :
### Summary: : the pulmonary macrophagic system is critical to the defense of the lung , keeping the alveoli clean and sterile and responding on demand with an adaptive outpouring of new cells into the air sacs . under basal conditions alveolar macrophages , in common with other mononuclear phagocytes , are derived from the bone marrow . a population of macrophage precursors within the pulmonary interstitium provides a reserve pool capable of proliferation and delivery of phagocytes in response to unusually heavy loads of inhaled particles . this reserve system also produces macrophages when monocytic precursors in the bone marrow are depleted by diseases such as leukemia . the alveolar macrophage is destined to ingest particulate matter and to be eliminated along the mucociliary pathway ; clearance by lymphatics is of minor importance and macrophages probably do not recross the alveolar epithelium to reach the pulmonary interstitial compartment . although the protective role of the macrophage is dominant , this cell may participate , directly or indirectly , in the genesis of two major groups of chronic pulmonary disease , interstitial fibrosis and emphysema . such inappropriate responses involve interactions with fibroblastic cells and tissue injury initiated by proteases secreted by the macrophage.imagesfigure 3.figure 4.figure 6 . afigure 6 . bfigure 7.figure 8.figure 12.figure 13 . afigure 13 . bfigure 14.figure 15.figure 16.figure 17.figure 18.figure 19.figure 20 .