text stringlengths 1 3.05k | source stringclasses 4
values |
|---|---|
there are two settings under which you can get $ o ( 1 ) $ worst - case times. if your setup is static, then fks hashing will get you worst - case $ o ( 1 ) $ guarantees. but as you indicated, your setting isn't static. if you use cuckoo hashing, then queries and deletes are $ o ( 1 ) $ worst - case, but insertion is o... | https://api.stackexchange.com |
yes, there bwa - mem was published as a preprint bwa - mem ’ s seed extension differs from the standard seed extension in two aspects. firstly, suppose at a certain extension step we come to reference position x with the best extension score achieved at query position y.... secondly, while extending a seed, bwa - mem t... | https://api.stackexchange.com |
i would ignore answers that say the surface area is ill - defined. in any realistic situation you have a lower limit for how fine a resolution is meaningful. this is like a pedant who says that hydrogen has an ill - defined volume because the electron wavefunction has no hard cutoff. technically true, but practically n... | https://api.stackexchange.com |
short answer intermittent locomotion can increase the detection of prey by predators ( e. g. rats ), while it may lead to reduced attack rates in prey animals ( e. g., rats and chipmunks ). it may also increase physical endurance. background rather than moving continuously through the environment, many animals interrup... | https://api.stackexchange.com |
i'm going to break up my answer into three parts. profiling, speeding up the python code via c, and speeding up python via python. it is my view that python has some of the best tools for looking at what your code's performance is then drilling down to the actual bottle necks. speeding up code without profiling is abou... | https://api.stackexchange.com |
##list : a b - tree implementation of a list, very fast for inserting, indexing, and moving the internal nodes of a list pandas : data frames ( or tables ) very fast analytics on the arrays. pytables : fast structured hierarchical tables ( like hdf5 ), especially good for out of core calculations and queries to large d... | https://api.stackexchange.com |
suppose that i have a conv layer which outputs an $ ( n, f, h, w ) $ shaped tensor where : $ n $ is the batch size $ f $ is the number of convolutional filters $ h, w $ are the spatial dimensions suppose the input is fed into a conv layer with $ f _ 1 $ 1x1 filters, zero padding and stride 1. then the output of this 1x... | https://api.stackexchange.com |
apparently you're not the first person to notice this ; in 1895, a german nose specialist called richard kayser found that we have tissue called erectile tissue in our noses ( yes, it is very similar to the tissue found in a penis ). this tissue swells in one nostril and shrinks in the other, creating an open airway vi... | https://api.stackexchange.com |
i doubt we know the precise number, or even anywhere near it. but there are several well - supported theorised colonisations which might interest you and help to build up a picture of just how common it was for life to transition to land. we can also use known facts about when different evolutionary lineages diverged, ... | https://api.stackexchange.com |
clock methods, heckman et al., 2001 ) that plants must have left the ocean separately to fungi, but probably relied upon them to be able to do it ( brundrett, 2002 - see note at bottom about this paper ). next, simple animals... arthropods colonised the land independently ( pisani et al, 2004 ), and since nematodes div... | https://api.stackexchange.com |
##ystem. review of palaeobotany and palynology 90 : 249 – 262. wang dy, kumar s, hedges sb. 1999. divergence time estimates for the early history of animal phyla and the origin of plants, animals and fungi. proc biol sci 266 : 163 – 171. watanabe y, martini jej, ohmoto h. 2000. geochemical evidence for terrestrial ecos... | https://api.stackexchange.com |
while you do spend some body energy to keep the book lifted, it's important to differentiate it from physical effort. they are connected but are not the same. physical effort depends not only on how much energy is spent, but also on how energy is spent. holding a book in a stretched arm requires a lot of physical effor... | https://api.stackexchange.com |
tetrahedral complexes let's consider, for example, a tetrahedral $ \ ce { ni ( ii ) } $ complex ( $ \ mathrm { d ^ 8 } $ ), like $ \ ce { [ nicl4 ] ^ 2 - } $. according to hybridisation theory, the central nickel ion has $ \ mathrm { sp ^ 3 } $ hybridisation, the four $ \ mathrm { sp ^ 3 } $ - type orbitals are filled ... | https://api.stackexchange.com |
is $ \ mathrm { sp ^ 3d ^ 2 } $ hybridisation. but all the $ \ mathrm { 3d } $ orbitals are already populated, so where do the two $ \ mathrm { d } $ orbitals come from? the $ \ mathrm { 4d } $ set, i suppose. the points raised above for tetrahedral case above still apply here. however, here we have something even more... | https://api.stackexchange.com |
works well for " other compounds. " that is really not always the case, though. for simple compounds like water, etc. there are already issues associated with the standard vsepr / hybridisation theory. superficially, the $ \ mathrm { sp ^ 3 } $ hybridisation of oxygen is consistent with the observed bent structure, but... | https://api.stackexchange.com |
and we should be careful not to use a model in a context where it is not valid. hybridisation theory is not valid in the context of transition metal complexes, and should not be used as a means of explaining their structure, bonding, and properties. | https://api.stackexchange.com |
the " roiling boil " is a mechanism for moving heat from the bottom of the pot to the top. you see it on the stovetop because most of the heat generally enters the liquid from a superheated surface below the pot. but in a convection oven, whether the heat enters from above, from below, or from both equally depends on h... | https://api.stackexchange.com |
the answers are no and no. being dimensionless or having the same dimension is a necessary condition for quantities to be " compatible ", it is not a sufficient one. what one is trying to avoid is called category error. there is analogous situation in computer programming : one wishes to avoid putting values of some da... | https://api.stackexchange.com |
the names and symbols of which may, but need not, be used in expressions for other si derived units, as is convenient ", thus eliminating the class of supplementary units. the desire to maintain a general rule that arguments of transcendental functions must be dimensionless might have played a role, but this shows that... | https://api.stackexchange.com |
to the best of my knowledge, most physicists don't believe that antimatter is actually matter moving backwards in time. it's not even entirely clear what would it really mean to move backwards in time, from the popular viewpoint. if i'm remembering correctly, this idea all comes from a story that probably originated wi... | https://api.stackexchange.com |
continue to move to the right ( $ + q \ times + v $ ) ; either way, you wind up with the net positive charge flow moving to the right. by the way, optional reading if you're interested : there is a very basic ( though hard to prove ) theorem in quantum field theory, the tcp theorem, that says that if you apply the thre... | https://api.stackexchange.com |
what type of solder is safest for home ( hobbyist ) use? this advice is liable to be met with doubt and even derision by some - by all means do your own checks, but please at least think about what i write here : i have cited a number of references below which give guidelines for soldering. these are as applicable for ... | https://api.stackexchange.com |
liable to damage your health but not due to the effects of lead. the vapor pressure of lead at 330 °c ( very hot for solder ) / 600 kelvin is about 10⁻⁸ mm of mercury. lead = " pb " crosses x - axis at 600k on lower graph here. these are interesting and useful graphs of the vapor pressure with temperatures of many elem... | https://api.stackexchange.com |
small jobs and i try to remember to use a fume extractor for larger ones. ( added july 2021 ) note that there are many documents on the web which state that lead solder is hazardous. few or none try to explain why this is said to be the case. soldering precautions sheet. they note : potential exposure routes from solde... | https://api.stackexchange.com |
##e are used in conjunction with tel — these agents form volatile lead ( ii ) bromide and lead ( ii ) chloride, respectively, which are flushed from the engine and into the air. in engines this process occurs at far higher temperatures than exist in soldering and there is no intentional process which produces volatile ... | https://api.stackexchange.com |
in significant quantity by soldering would go a long way to establishing the assertions. finding negative evidence is, as ever, harder. there is no question about the dangers from lead based paints, whether form airborne dust from sanding, children sucking lead painted objects or surface dust produced - all these are e... | https://api.stackexchange.com |
lead in the blood very easily ( it requires one drop of blood ) and it's probably worth doing. internet diagnosis is, as i'm sure you know, a very poor substitute for proper medical advice. that said here is mayo clinic's page on lead poisoning symptoms & causes. and here is their page on diagnosis and treatment. mayo ... | https://api.stackexchange.com |
a quick search on web of science yields " polyphasic wake / sleep episodes in the fire ant, solenopsis invicta " ( cassill et al., 2009, @ mike taylor found an accessable copy here ) as one of the first hits. the main points from the abstract : yes, ants sleep. indicators of deep sleep : ants are non - responsive to co... | https://api.stackexchange.com |
okay, this is not so much of an answer as it is a summary of my own progress on this topic after giving it some thought. i don't think it's a settled debate in the community yet, so i don't feel so much ashamed about it : ) a few of the things worthy of note are : the bond energy found by the authors for this fourth bo... | https://api.stackexchange.com |
it has to be so common a question that the answer is actually given in various places on dupont's own website ( dupont are the makers of teflon ) : “ if nothing sticks to teflon®, then how does teflon® stick to a pan? " nonstick coatings are applied in layers, just like paint. the first layer is the primer — and it's t... | https://api.stackexchange.com |
edit : this is now in sympy $ isympy in [ 1 ] : a = matrixsymbol ('a ', n, n ) in [ 2 ] : b = matrixsymbol ('b ', n, n ) in [ 3 ] : context = q. symmetric ( a ) & q. positive _ definite ( a ) & q. orthogonal ( b ) in [ 4 ] : ask ( q. symmetric ( b * a * b. t ) & q. positive _ definite ( b * a * b. t ), context ) out [ ... | https://api.stackexchange.com |
first, a note : while oxygen has fewer allotropes than sulfur, it sure has more than two! these include $ \ ce { o } $, $ \ ce { o _ 2 } $, $ \ ce { o _ 3 } $, $ \ ce { o _ 4 } $, $ \ ce { o _ 8 } $, metallic $ \ ce { o } $ and four other solid phases. many of these actually have a corresponding sulfur variant. however... | https://api.stackexchange.com |
question. | https://api.stackexchange.com |
pick your poison. i recommend using homebrew. i have tried all of these methods except for " fink " and " other methods ". originally, i preferred macports when i wrote this answer. in the two years since, homebrew has grown a lot as a project and has proved more maintainable than macports, which can require a lot of p... | https://api.stackexchange.com |
interfere with os upgrades. disadvantages : installing ports tends to require an entire " software ecosystem ". compilers don't include debugging symbols, which can pose a problem when using a debugger, or installing petsc. ( sean farley proposes some workarounds. ) also requires changing path. could interfere with hom... | https://api.stackexchange.com |
i apologize in advance for the length of this post : it is with some trepidation that i let it out in public at all, because it takes some time and attention to read through and undoubtedly has typographic errors and expository lapses. but here it is for those who are interested in the fascinating topic, offered in the... | https://api.stackexchange.com |
take a limit " or " let $ n $ go to $ \ infty $ ", we would conclude correctly that all frequencies reduce to $ 0 $. but if we simply draw a histogram of the frequencies, without paying any attention to how its axes are labeled, we see that the histograms for large $ n $ all begin to look the same : in some sense, thes... | https://api.stackexchange.com |
$ n $, the average of values in the box, and some measure of spread of those values - - but on nothing else - - so that regardless of what is in the box, the limit is always the same. ( this universality property is amazing. ) specifically, that limiting area is the area under the curve $ y = \ exp ( - z ^ 2 / 2 ) / \ ... | https://api.stackexchange.com |
many applications. ( many people would choose something like a median absolute deviation from the median, for instance. ) why does the sd appear in such an essential way? consider the formula for the limiting histogram : who would have expected it to take such a form? it says the logarithm of the probability density is... | https://api.stackexchange.com |
by any predetermined value $ k $, where evidently $ k $ is one of $ - n, - n + 2, \ ldots, n - 2, n $. but because vanishingly small errors will disappear in the limit, we don't have to count precisely ; we only need to approximate the counts. to this end it suffices to know that $ $ \ text { the number of ways to obta... | https://api.stackexchange.com |
\ cdots + j \ right ) - \ frac { 2 } { 3 ( m + 1 ) ^ 3 } \ left ( 1 ^ 3 + 2 ^ 3 + \ cdots + j ^ 3 \ right ) = - \ frac { j ^ 2 } { m } + o \ left ( \ frac { j ^ 4 } { m ^ 3 } \ right ). $ $ because the error in approximating this sum by $ - j ^ 2 / m $ is on the order of $ j ^ 4 / m ^ 3 $, the approximation ought to wo... | https://api.stackexchange.com |
no need to use taylor series, this can be derived in a similar way to the formula for geometric series. let's find a general formula for the following sum : $ $ s _ { m } = \ sum _ { n = 1 } ^ { m } nr ^ { n }. $ $ notice that \ begin { align * } s _ { m } - rs _ { m } & = - mr ^ { m + 1 } + \ sum _ { n = 1 } ^ { m } r... | https://api.stackexchange.com |
{ align * } added note : we can define $ $ s _ m ^ k ( r ) = \ sum _ { n = 1 } ^ m n ^ k r ^ n. $ $ then the sum above considered is $ s _ m ^ 1 ( r ) $, and the geometric series is $ s _ m ^ 0 ( r ) $. we can evaluate $ s _ m ^ 2 ( r ) $ by using a similar trick, and considering $ s _ m ^ 2 ( r ) - rs _ m ^ 2 ( r ) $.... | https://api.stackexchange.com |
a byte of data is eight bits, there may be more bits per byte of data that are used at the os or even the hardware level for error checking ( parity bit, or even a more advanced error detection scheme ), but the data is eight bits and any parity bit is usually invisible to the software. a byte has been standardized to ... | https://api.stackexchange.com |
i myself was always confused why $ \ ce { h3o ^ + } $ is so well - known and yet almost nobody talks of $ \ ce { h4o ^ 2 + } $. i mean, $ \ ce { h3o ^ + } $ still has a lone pair, right? why can't another proton just latch onto that? adding to the confusion, $ \ ce { h4o ^ 2 + } $ is very similar to $ \ ce { nh4 + } $,... | https://api.stackexchange.com |
tugs the electrons of the $ \ ce { h2o } $ molecule, but they attract and the system is slightly stabilised. the attraction gets stronger as the lone proton approaches. however, there is also a repulsive interaction, between the lone proton and the nuclei of the other atoms in the $ \ ce { h2o } $ molecule. at large di... | https://api.stackexchange.com |
\ ce { h4o ^ 2 + } $ in the gas phase was calculated to be endothermic by $ \ mathrm { 248 \ kj \ mol ^ { - 1 } } $ ( that is, the proton affinity of $ \ ce { h3o ^ + } $ is $ \ mathrm { - 248 \ kj \ mol ^ { - 1 } } $ ), but once formed, it has a barrier towards decomposition ( the activation energy towards release of ... | https://api.stackexchange.com |
claim the results to be quantitatively correct. $ $ \ begin { array } { lllll } \ text { species } & \ ce { ch4 } & \ ce { ch5 + } & \ ce { ch6 ^ 2 + } & \ ce { ch7 ^ 3 + } & \ ce { ch8 ^ 4 + } \ \ \ text { stable in gas phase? } & \ text { yes } & \ text { yes } & \ text { yes } & \ text { yes } & \ text { no } \ \ \ ... | https://api.stackexchange.com |
ions listed here with more than four hydrogens, appears to be a true hypercoordinate species. del bene et al. indicate a five - coordinate square pyramidal structure with delocalized nitrogen - hydrogen bonds. $ $ \ begin { array } { lllll } \ text { species } & \ ce { h2o } & \ ce { h3o + } & \ ce { h4o ^ 2 + } & \ ce... | https://api.stackexchange.com |
\ text { stable in gas phase? } & \ text { yes } & \ text { yes } & \ text { no } \ \ \ text { approximate proton affinity } \ ( \ mathrm { kj \ mol ^ { - 1 } } ) & 204 & n / a & n / a \ \ \ end { array } $ $ notes : $ \ ce { ne } $ is a notoriously unreactive noble gas, but it too will react exothermically with a bare... | https://api.stackexchange.com |
has been detected in milder ( though still superacidic! ) conditions than $ \ ce { h4o ^ 2 + } $. the larger size and lower electronegativity of $ \ ce { s } $ once again are shown to be important ; the hypercoodinate $ \ ce { h5s ^ 3 + } $ appears to exist, while the oxygen analogue doesn't. | https://api.stackexchange.com |
bcftools has sample / individual filtering as an option for most of the commands. you can subset individuals by using the - s or - s option : - s, - - samples [ ^ ] list comma - separated list of samples to include or exclude if prefixed with " ^ ". note that in general tags such as info / ac, info / an, etc are not up... | https://api.stackexchange.com |
one major problem with using uracil as a base is that cytosine can be deaminated, which converts it into uracil. this is not a rare reaction ; it happens around 100 times per cell, per day. this is no major problem when using thymine, as the cell can easily recognize that the uracil doesn't belong there and can repair ... | https://api.stackexchange.com |
mathematical explanation when examining the linear combination of atomic orbitals ( lcao ) for the $ \ ce { h2 + } $ molecular ion, we get two different energy levels, $ e _ + $ and $ e _ - $ depending on the coefficients of the atomic orbitals. the energies of the two different mo's are : $ $ \ begin { align } e _ + &... | https://api.stackexchange.com |
nucleus attraction. if you go with method 2 ( remember that the $ \ sigma ^ * _ \ text { 1s } $ mo has a node between the two nuclei ), the nuclei feel each other's repulsive forces more strongly. further information i highly recommend the following book, from which most of the information above stems : peter atkins an... | https://api.stackexchange.com |
oscilloscopes usually require significant power and are physically big. having a chassis that size, which would include exposed ground on the bnc connectors and the probe ground clips, floating would be dangerous. if you have to look at waveforms in wall - powered equipment, it is generally much better to put the isola... | https://api.stackexchange.com |
for computing three - dimensional delaunay triangulations ( tetrahedralizations, really ), tetgen is a commonly used library. for your convenience, here's a little benchmark on how long it takes to compute the terehedralization of a number of random points from the unit cube. for 100, 000 points it takes 4. 5 seconds o... | https://api.stackexchange.com |
because " pixel " isn't a unit of measurement : it's an object. so, just like a wall that's 30 bricks wide by 10 bricks tall contains 300 bricks ( not bricks - squared ), an image that's 30 pixels wide by 10 pixels tall contains 300 pixels ( not pixels - squared ). | https://api.stackexchange.com |
great question! note that from a prescriptive standpoint, the terms pipeline and workflow don't have any strict or precise definitions. but it's still useful to take a descriptive standpoint and discuss how the terms are commonly used in the bioinformatics community. but before talking about pipelines and workflows, it... | https://api.stackexchange.com |
to replace gnu make for numerous languages in a variety of contexts. the most popular in bioinformatics seems to be snakemake, which provides a nice balance of simplicity ( through shell commands ), flexibility ( through configuration ), and power - user support ( through python scripting ). build scripts written for t... | https://api.stackexchange.com |
let's try this wittgenstein's ladder style. first let's consider this : simulate this circuit – schematic created using circuitlab we can calculate the current through r1 with ohm's law : $ $ { 1 \ : \ mathrm v \ over 100 \ : \ omega } = 10 \ : \ mathrm { ma } $ $ we also know that the voltage across r1 is 1v. if we us... | https://api.stackexchange.com |
frequencies ( lower right ), the capacitor looks like a large resistor. r5 is very much bigger than r4, so here we will measure a very large voltage, almost all of the input voltage, that is, the input voltage has been attenuated very little. so high frequencies are attenuated, and low frequencies are not. sounds like ... | https://api.stackexchange.com |
you can use the python builtin ctypes module as described on fortran90. org. it is pretty straight forward and doesn't require any external dependencies. also, the ndpointer arg type helper is very handy. | https://api.stackexchange.com |
yes, c + + is still useful in embedded systems. as everyone else has said, it still depends on the system itself, like an 8 - bit uc would probably be a no - no in my book even though there is a compiler out there and some people do it ( shudder ). there's still an advantage to using c + + even when you scale it down t... | https://api.stackexchange.com |
educated in their use to design correctly for this feature which is harder to accomplish in c because linkers don't always optimize dead code. he also demonstrated a feature of templates that could only be accomplished in c + + and would have kept the mars climate observer from crashing had nasa implemented a similar s... | https://api.stackexchange.com |
the assumption that the layers are all cylindrical is a good first approximation. the assumption that the layers form a logarithmic spiral is not a good assumption at all, because it supposes that the thickness of the paper at any point is proportional to its distance from the center. this seems to me to be quite absur... | https://api.stackexchange.com |
both sides. so either the inner surface was somehow compressed, or the outer surface was stretched, or both. i think the most realistic assumption is that both compression and stretching occurred. in reality, i would guess that the inner surface is compressed more than the outer surface is stretched, but i do not know ... | https://api.stackexchange.com |
cylinder with inner radius $ r $ and outer radius $ r $, missing only a segment of angle $ \ alpha $. the cross - sectional area of this is $ $ a _ 1 = \ left ( \ pi - \ frac { \ alpha } { 2 } \ right ) ( r ^ 2 - r ^ 2 ). $ $ we have a rectangular prism whose cross - sectional area is the product of two of its sides, $... | https://api.stackexchange.com |
) - \ frac h2 \ right ) \ arccos \ frac { r } { r + h } \ \ & = n ( r + r ) \ pi + ( n - 1 ) \ sqrt { ( 2r + h ) h } - \ left ( n ( r + h ) - \ frac h2 \ right ) \ arccos \ frac { r } { r + h }. \ end { align } one notable difference between this estimate and some others ( including the original ) is that i assume ther... | https://api.stackexchange.com |
##ot 100 \ pi \ approx 157079. 63267949, $ $ or about $ 157 $ meters, the same as in the example in the question. the remaining two terms yield \ begin { align } l - l _ 1 & = ( n - 1 ) \ sqrt { ( 2r + h ) h } - \ left ( n ( r + h ) - \ frac h2 \ right ) \ arccos \ frac { r } { r + h } \ \ & = 499 \ sqrt { 50. 1 \ cdot... | https://api.stackexchange.com |
##c { ( r + 2r ) \ sqrt2 } { 3 \ sqrt r } \ sqrt h. $ $ plugging in the values from the example, this evaluates to approximately $ - 3. 7267799625 $. if you really wanted the length of the idealized toilet roll to the nearest millimeter, but could tolerate an error of a few $ \ mu \ mathrm m $ ( for typical dimensions ... | https://api.stackexchange.com |
worst - case hardness of np - complete problems is not sufficient for cryptography. even if np - complete problems are hard in the worst - case ( $ p \ ne np $ ), they still could be efficiently solvable in the average - case. cryptography assumes the existence of average - case intractable problems in np. also, provin... | https://api.stackexchange.com |
let ’ s start with what they have in common : all three formats store sequence data, and sequence metadata. furthermore, all three formats are text - based. however, beyond that all three formats are different and serve different purposes. let ’ s start with the simplest format : fasta fasta stores a variable number of... | https://api.stackexchange.com |
##xa - eas1 _ s _ 7 : 5 : 1 : 817 : 345 gggtgatggccgctgccgatggcgtc aaatcccacc + iiiiiiiiiiiiiiiiiiiiiiiiii iiii9ig9ic @ 071112 _ slxa - eas1 _ s _ 7 : 5 : 1 : 801 : 338 gttcagggatacgacgtttgtattttaagaatctga + iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii6ibi fastq files are mostly used to store short - read data from high - throughp... | https://api.stackexchange.com |
instead, files are stored in bam format, which is a compact, gzipped, binary representation of sam. it stores the same information, just more efficiently. and, in conjunction with a search index, allows fast retrieval of individual records from the middle of the file ( = fast random access ). bam files are also much mo... | https://api.stackexchange.com |
as far as i'm aware, the most accurate methods for static calculations are full configuration interaction with a fully relativistic four - component dirac hamiltonian and a " complete enough " basis set. i'm not an expert in this particular area, but from what i know of the method, solving it using a variational method... | https://api.stackexchange.com |
separation, and some which use vorticity which i think have application in magnetic or aromaticity studies. ) ( b3lyp, the functional some people love and some people love to hate, is a gga including a percentage of exact exchange. ) configuration interaction truncations : cis, cisd, cisdt, cisd ( t ), casscf, rasscf, ... | https://api.stackexchange.com |
more accurate you make your simulation by including more contributions and more complex formulations, the harder it is to actually do anything with. for example, spin orbit coupling is sometimes avoided solely because it makes everything more complicated to analyse ( but sometimes also because it has negligable effect ... | https://api.stackexchange.com |
there are a few industry approaches to this. the first is molded cables. the cables themselves have strain reliefs molded to fit a given entry point, either by custom moulding or with off the shelf reliefs that are chemically welded / bonded to the cable. not just glued, but welded together. the second is entry points ... | https://api.stackexchange.com |
i would suggest use ralee — rnalignment editor in emacs. it can get for you the consensus secondary structure, you can move left / right sequences and their secondary structures ( you can't do it in jalview! ), and more. it's an emacs mode, so could be a bit hard to start off, but just try, you don't have to use all em... | https://api.stackexchange.com |
people are skeptical because : no proof has come from an expert without having been rescinded shortly thereafter so much effort has been put into finding a proof, with no success, that it's assumed one will be either substantially complicated, or invent new mathematics for the proof the " proofs " that arise frequently... | https://api.stackexchange.com |
i recommend you to check scott aaronson's blog post on a proof of the incompleteness theorem via turing machines and rosser's theorem. his proof of the incompleteness theorem is extremely simple and easy to follow. | https://api.stackexchange.com |
i realize this question has been answered, but i don't think the extant answer really engages the question beyond pointing to a link generally related to the question's subject matter. in particular, the link describes one technique for programmatic network configuration, but that is not a " [ a ] standard and accepted... | https://api.stackexchange.com |
the hidden layers so those few rules set the number of layers and size ( neurons / layer ) for both the input and output layers. that leaves the hidden layers. how many hidden layers? well, if your data is linearly separable ( which you often know by the time you begin coding a nn ), then you don't need any hidden laye... | https://api.stackexchange.com |
to have excess ( i. e.,'prunable') nodes - - in other words, when deciding on network architecture, err on the side of more neurons, if you add a pruning step. put another way, by applying a pruning algorithm to your network during training, you can approach optimal network configuration ; whether you can do that in a ... | https://api.stackexchange.com |
i think i can attempt to clear this up. usb - 100ma usb by default will deliver 100ma of current ( it is 500mw power because we know it is 5v, right? ) to a device. this is the most you can pull from a usb hub that does not have its own power supply, as they never offer more than 4 ports and keep a greedy 100ma for the... | https://api.stackexchange.com |
places a termination resistance between d + and d -. i would like to copy out the chapter that explains it, but it is a secured pdf and i cannot copy it out without retyping it. summing it up you may pull 100ma from a computer port. you may pull 500ma after enumeration and setting the correct configuration. computers v... | https://api.stackexchange.com |
blood is not a good source of water. 1 liter of blood contains about 800 ml of water, 170 grams of protein and 2 grams of sodium ( calculated from the composition of lamb blood ). when metabolized, 170 grams of protein yields the amount of urea that requires 1, 360 ml of water to be excreted in urine ( calculated from ... | https://api.stackexchange.com |
what you've implemented is a single - pole lowpass filter, sometimes called a leaky integrator. your signal has the difference equation : $ $ y [ n ] = 0. 8 y [ n - 1 ] + 0. 2 x [ n ] $ $ where $ x [ n ] $ is the input ( the unsmoothed bin value ) and $ y [ n ] $ is the smoothed bin value. this is a common way of imple... | https://api.stackexchange.com |
the impulse response and frequency response are two attributes that are useful for characterizing linear time - invariant ( lti ) systems. they provide two different ways of calculating what an lti system's output will be for a given input signal. a continuous - time lti system is usually illustrated like this : in gen... | https://api.stackexchange.com |
delta [ n ] $ is typically used. a system's impulse response ( often annotated as $ h ( t ) $ for continuous - time systems or $ h [ n ] $ for discrete - time systems ) is defined as the output signal that results when an impulse is applied to the system input. why is this useful? it allows us to predict what the syste... | https://api.stackexchange.com |
at the problem. a similar convolution theorem holds for these systems : $ $ y ( t ) = \ int _ { - \ infty } ^ { \ infty } x ( \ tau ) h ( t - \ tau ) d \ tau $ $ where, again, $ h ( t ) $ is the system's impulse response. there are a number of ways of deriving this relationship ( i think you could make a similar argume... | https://api.stackexchange.com |
the scaling factor to apply to the complex exponential at frequency $ f $ in the aforementioned linear combination. these scaling factors are, in general, complex numbers. one way of looking at complex numbers is in amplitude / phase format, that is : $ $ x ( f ) = a ( f ) e ^ { j \ phi ( f ) } $ $ looking at it this w... | https://api.stackexchange.com |
$, then it is straightforward to calculate the fourier transform of the system's output ; it is merely the product of the frequency response and the input signal's transform. for each complex exponential frequency that is present in the spectrum $ x ( f ) $, the system has the effect of scaling that exponential in ampl... | https://api.stackexchange.com |
hint $ $ there is a $ \ rm \ color { darkorange } { unique } $ denominator $ \ rm \, \ color { # 0a0 } { 2 ^ k } $ having maximal power of $ \ : \! 2, \, $ so scaling by $ \ rm \, \ color { # c00 } { 2 ^ { k - 1 } } $ we deduce a contradiction $ \ large \ rm \, \ frac { 1 } 2 = \ frac { c } d \, $ with odd $ \ rm \, d ... | https://api.stackexchange.com |
' s in the prior fractions are odd so they sum to fraction with odd denom $ \ rm \, d \, | \, 3 \ cdot 5 \ cdot 7 $. note $ $ said $ \ rm \ color { darkorange } { uniqueness } $ has easy proof : if $ \ rm \ : j \ : \! 2 ^ k $ is in the interval $ \ rm \, [ 1, n ] \, $ then so too is $ \, \ rm \ color { # 0a0 } { 2 ^ k ... | https://api.stackexchange.com |
there is a couple of points to consider here, which i outline below. the goal here should be to find a workflow that is minimally intrusive on top of already using git. as of yet, there is no ideal workflow that covers all use cases, but what i outline below is the closest i could come to it. reproducibility is not jus... | https://api.stackexchange.com |
or running your own lfs server ( there is a reference implementation, but i assume this would still be a substantial effort ) git annex is free, but it replaces files by links and hence changes time stamps, which is a problem for e. g. gnu make based workflows ( major drawback for me ). also, fetching of files needs to... | https://api.stackexchange.com |
the batch size defines the number of samples that will be propagated through the network. for instance, let's say you have 1050 training samples and you want to set up a batch _ size equal to 100. the algorithm takes the first 100 samples ( from 1st to 100th ) from the training dataset and trains the network. next, it ... | https://api.stackexchange.com |
this one by ramanujan gives me the goosebumps : $ $ \ frac { 2 \ sqrt { 2 } } { 9801 } \ sum _ { k = 0 } ^ \ infty \ frac { ( 4k )! ( 1103 + 26390k ) } { ( k! ) ^ 4 396 ^ { 4k } } = \ frac1 { \ pi }. $ $ p. s. just to make this more intriguing, define the fundamental unit $ u _ { 29 } = \ frac { 5 + \ sqrt { 29 } } { 2... | https://api.stackexchange.com |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.