text stringlengths 1 3.05k | source stringclasses 4
values |
|---|---|
the perfect number $ 28 = 1 + 2 + 4 + 7 + 14 $ provides a solution : $ $ \ frac1 { 28 } + \ frac1 { 14 } + \ frac17 + \ frac14 + \ frac12 = \ frac { 1 + 2 + 4 + 7 + 14 } { 28 } = 1 \ ;. $ $ if they ’ ve been doing unit ( or ‘ egyptian ’ ) fractions, i ’ d expect some to see that since $ \ frac16 + \ frac13 = \ frac12 $... | https://api.stackexchange.com |
can write $ $ \ frac1 { 36 } + \ frac1 { 18 } + \ frac1 { 12 } = \ frac { 1 + 2 + 3 } { 36 } = \ frac6 { 36 } = \ frac16 \ ;, $ $ and we get another ‘ nice ’ solution, $ $ \ frac12 + \ frac13 + \ frac1 { 12 } + \ frac1 { 18 } + \ frac1 { 36 } \ ;. $ $ | https://api.stackexchange.com |
there is an explanation to this that can be generalized, which dips a little into quantum chemistry, which is known as the idea of pairing energy. i'm sure you can look up the specifics, but basically in comparing the possible configurations of $ \ ce { nb } $, we see the choice of either pairing electrons at a lower e... | https://api.stackexchange.com |
from say a p - subshell, you would get 3 k, for each pair, while from this example : from a $ \ ce { d ^ 6 } $, you would get 10 k ( for each unique pair, and none for the opposite spin e - ) this k is quantifiable as well ( and like the repulsion energy is unique for each atom ). thus, the combination of these two ene... | https://api.stackexchange.com |
if you have some experience with python ( or even not ), i would recommend using the python scientific software that is available ( scipy, pandas ),... ) together with matplotlib. being a programming environment, you have full control over your data flows, data manipulations and plotting. you can also use the " full ap... | https://api.stackexchange.com |
to really understand this you should study the differential geometry of geodesics in curved spacetimes. i'll try to provide a simplified explanation. even objects " at rest " ( in a given reference frame ) are actually moving through spacetime, because spacetime is not just space, but also time : apple is " getting old... | https://api.stackexchange.com |
the apple than the elapsed coordinate time ( the time of the apple is slower than the time in the reference frame from which we are observing the apple ). so in this frame, the " speed through time " of the apple is more than the speed of light ( $ \ frac { dt } { d \ tau } > 1 $ ), but the speed through space is also ... | https://api.stackexchange.com |
my problem with expression templates is that they are a very leaky abstraction. you spend a lot of work writing very complicated code to do a simple task with nicer syntax. but if you want to change the algorithm, you have to mess with the dirty code and if you slip up with types or syntax, you get completely unintelli... | https://api.stackexchange.com |
the correct pullup resistance for the i2c bus depends on the total capacitance on the bus and the frequency you want to operate the bus at. the formula from the atmega168 datasheet ( which i believe comes from the official i2c spec ) is - - $ $ \ text { freq } < 100 \ text { khz } \ implies r _ { \ text { min } } = \ f... | https://api.stackexchange.com |
i think it's a great question, and enjoyed it very much when i grappled with it myself. here's a picture of some of the forces in this scenario. $ ^ \ dagger $ the ones that are the same colour as each other are pairs of equal magnitude, opposite direction forces from newton's third law. ( w and r are of equal magnitud... | https://api.stackexchange.com |
there are many ways to see that your result is the right one. what does the right one mean? it means that whenever such a sum appears anywhere in physics - i explicitly emphasize that not just in string theory, also in experimentally doable measurements of the casimir force ( between parallel metals resulting from quan... | https://api.stackexchange.com |
+ o ( \ epsilon ^ 3 ) } { ( 1 + \ epsilon / 2 + \ epsilon ^ 2 / 6 + o ( \ epsilon ^ 3 ) ) ^ 2 } $ $ you see that the $ 1 / \ epsilon ^ 2 $ leading divergence survives and the next subleading term cancels. the resulting expansion may be calculated with this mathematica command 1 / epsilon ^ 2 * series [ epsilon ^ 2 sum ... | https://api.stackexchange.com |
he had a good intuition and the derivation could be turned into a modern physics derivation, too. we will work with two sums, $ $ s = 1 + 2 + 3 + 4 + 5 + \ dots, \ quad t = 1 - 2 + 3 - 4 + 5 - \ dots $ $ extrapolating the geometric and similar sums to the divergent ( and, in this case, marginally divergent ) domain of ... | https://api.stackexchange.com |
i do not think mine will be a complete answer, but i'll offer what i know and since this is a community edited site, i hope somebody will give a complimentary answer soon : ) adaptive thresholding methods are those that do not use the same threshold throughout the whole image. but, for some simpler usages, it is someti... | https://api.stackexchange.com |
edit : inspired by the comment to this answer. there is one more way i know of to work around uneven lighting conditions. i will write here about bright objects on a dark background, but the same reasoning can be applied if the situation is reverse. threshold the white top - hat transform of the image with a constant t... | https://api.stackexchange.com |
a cholesky factorization makes the most sense for the best stability and speed when you are working with a covariance matrix, since the covariance matrix will be positive semi - definite symmetric matrix. cholesky is a natural here. but... if you intend to compute a cholesky factorization, before you ever compute the c... | https://api.stackexchange.com |
backsolves on triangular systems. | https://api.stackexchange.com |
the discrete fourier transform ( dft ) and discrete cosine transform ( dct ) perform similar functions : they both decompose a finite - length discrete - time vector into a sum of scaled - and - shifted basis functions. the difference between the two is the type of basis function used by each transform ; the dft uses a... | https://api.stackexchange.com |
use 10 kω, it's a good value. for more detail, we have to look at what a pullup does. let's say you have a pushbutton you want to read with a microcontroller. the pushbutton is a momentary spst ( single pole single throw ) switch. it has two connection points which are either connected or not. when the button is presse... | https://api.stackexchange.com |
say your micro is specified for 1 µa maximum leakage on its digital input pins. since the pullup has to keep the line high, the worst case is assuming the pin looks like a 1 µa current sink to ground. if you were to use a 1 mω pullup, for example, then that 1 µa would cause 1 volt accross the 1 mω resistor. let's say t... | https://api.stackexchange.com |
doesn't matter in this example, but if this were a digital bus line you wanted to run at 200 khz data rate it wouldn't work. now lets look at the other competing consideration, which is the current wasted when the switch is pressed. if this unit is running off of line power or otherwise handling substantial power, a fe... | https://api.stackexchange.com |
" i am thinking of a number which is either 0 or 1. is the sum of our numbers greater than 2? " | https://api.stackexchange.com |
part of the issue is that the frequentist definition of a probability doesn't allow a nontrivial probability to be applied to the outcome of a particular experiment, but only to some fictitious population of experiments from which this particular experiment can be considered a sample. the definition of a ci is confusin... | https://api.stackexchange.com |
are useful, but you need to choose the right interval for the question you actually want to ask. if you want an interval that admits an interpretation of a 95 % ( posterior ) probability of containing the true value, then choose a credible interval ( and, with it, the attendant conceptualization of probability ), not a... | https://api.stackexchange.com |
d ) = 1 / 2 $. so in this case the frequentist confidence interval is clearly not a 75 % credible interval as there is only a 50 % probability that it contains the true value of $ \ theta $, given what we can infer about $ \ theta $ from this particular sample. yes, this is a contrived example, but if confidence interv... | https://api.stackexchange.com |
gradient descent maximizes a function using knowledge of its derivative. newton's method, a root finding algorithm, maximizes a function using knowledge of its second derivative. that can be faster when the second derivative is known and easy to compute ( the newton - raphson algorithm is used in logistic regression ).... | https://api.stackexchange.com |
this good non - scholarly article covers some of the usual advantages ( rest / regeneration ). one of the research papers they mentioned ( they linked to press release ) was conservation of sleep : insights from non - mammalian model systems by john e. zimmerman, ph. d. ; trends neurosci. 2008 july ; 31 ( 7 ) : 371 – 3... | https://api.stackexchange.com |
where is the sugar? when you freeze a dilute aqueous sugar solution pure water freezes first, leaving a more concentrated solution until you reach a high concentration of sugar called the eutectic concentration. now you have the pure water that's frozen out, called proeutectic water, and the concentrated eutectic sugar... | https://api.stackexchange.com |
there are many ways to control for variables. the easiest, and one you came up with, is to stratify your data so you have sub - groups with similar characteristics - there are then methods to pool those results together to get a single " answer ". this works if you have a very small number of variables you want to cont... | https://api.stackexchange.com |
' s wrong. why is it wrong? we have failed to control for a variable that effects the outcome and the exposure. it's a binary variable, make it anything you please - gender, smoker / non - smoker, etc. now run this model : lm ( outcome ~ exposure + covariate ) this time you should get coefficients of intercept = 2. 00,... | https://api.stackexchange.com |
knapsack problem is $ \ sf { np \ text { - } complete } $ when the numbers are given as binary numbers. in this case, the dynamic programming will take exponentially many steps ( in the size of the input, i. e. the number of bits in the input ) to finish $ \ dagger $. on the other hand, if the numbers in the input are ... | https://api.stackexchange.com |
the quoted text in the question is a case of using bandpass sampling or undersampling. here, to avoid aliasing distortion, the signal of interest must be bandpass. that means that the signal's power spectrum is only non - zero between $ f _ l < | f | < f _ h $. if we sample the signal at a rate $ f _ s $, then the cond... | https://api.stackexchange.com |
to understand the difference between sets and types, ones has to go back to pre - mathematical ideas of " collection " and " construction ", and see how sets and types mathematize these. there is a spectrum of possibilities on what mathematics is about. two of these are : we think of mathematics as an activity in which... | https://api.stackexchange.com |
{ $ n $ is an even prime larger than $ 3 $ } \ } $ $ and $ $ \ { m \ in \ mathbb { n } \ mid \ text { $ m $ is an odd prime smaller than $ 2 $ } \ } $ $ are equal because they have the same elements. note that type theory is not about syntax. it is a mathematical theory of constructions, just like set theory is a mathe... | https://api.stackexchange.com |
the first time i tried to do the current calculation for a circuit similar to the previous circuit on a simulator, the program complained about not having a ground and " floating voltage sources ". your simulator wants to be able to do its calculations and report out the voltages of each node relative to some reference... | https://api.stackexchange.com |
earth ground ( and partially isolated from it ) to minimize the possibility that currents flowing through the earth ground wires will disturb measurements of the important signals. another question : since the ground is at unknown potential, wouldn't there be current flowing to or from ground to the circuit? remember, ... | https://api.stackexchange.com |
as we cannot resolve arbitrarily small time intervals, what is'' really'' the case cannot be decided. but in classical and quantum mechanics ( i. e., in most of physics ), time is treated as continuous. physics would become very awkward if expressed in terms of a discrete time : the discrete case is essentially untract... | https://api.stackexchange.com |
in the original paper that proposed dropout layers, by hinton ( 2012 ), dropout ( with p = 0. 5 ) was used on each of the fully connected ( dense ) layers before the output ; it was not used on the convolutional layers. this became the most commonly used configuration. more recent research has shown some value in apply... | https://api.stackexchange.com |
my recommendation in terms of text books is rick lyons's understanding dsp. my review of the latest edition is here. i, and many others from the $ { \ tt comp. dsp } $ community and elsewhere, have helped rick revise parts of the text since the first edition. for self - study, i know of no better book. as an on - line,... | https://api.stackexchange.com |
i think that mere touching does not bring the surfaces close enough. the surface of a metal is not perfect usually. maybe it has an oxide layer that resists any kind of reaction. if the metal is extremely pure and if you bring two pieces of it extremely close together, then they will join together. it's also called col... | https://api.stackexchange.com |
samtools merge merged. bam *. bam is efficient enough since the input files are sorted. you can get a bit faster with sambamba and / or biobambam, but they're not typically already installed and io quickly becomes a bottleneck anyway. | https://api.stackexchange.com |
you have to take images for calibration from different points of view and angles, with as big difference between angles as possible ( all three euler angles should vary ), but so that pattern diameter was still fitting to camera field of view. the more views are you using the better calibration will be. that is needed ... | https://api.stackexchange.com |
that depends both on the processor ( not just the processor series, it can vary from model to model ) and the operating systems, but there are general principles. whether a processor is multicore has no direct impact on this aspect ; the same process could be executing on multiple cores simultaneously ( if it's multith... | https://api.stackexchange.com |
##lb is consulted before lookups in physically - addressed caches, to determine the physical address quickly when possible ; the processor may start the cache lookup before the tlb lookup is complete, as often candidate cache lines can be identified from the middle bits of the address, between the bits that determine t... | https://api.stackexchange.com |
there was a story in my days about a physical chemist who was asked to explain some effect, illustrated by a poster on the wall. he did that, after which someone noticed that the poster was hanging upside down, so the effect appeared reversed in sign. undaunted, the guy immediately explained it the other way around, ju... | https://api.stackexchange.com |
to achieve ( at least some of ) your goals, i would recommend the variant effect predictor ( vep ). it is a flexible tool that provides several types of annotations on an input. vcf file. i agree that exac is the de facto gold standard catalog for human genetic variation in coding regions. to see the frequency distribu... | https://api.stackexchange.com |
although a pca applied on binary data would yield results comparable to those obtained from a multiple correspondence analysis ( factor scores and eigenvalues are linearly related ), there are more appropriate techniques to deal with mixed data types, namely multiple factor analysis for mixed data available in the fact... | https://api.stackexchange.com |
julia, at this point ( may 2019, julia v1. 1 with v1. 2 about to come out ) is quite mature for scientific computing. the v1. 0 release signified an end to yearly code breakage. with that, a lot of scientific computing libraries have had the time to simply grow without disruption. a broad overview of julia packages can... | https://api.stackexchange.com |
composibility in type generic algorithms, people have by now gone and built entire array type libraries. bandedmatrices. jl and blockbandedmatrices. jl are libraries which define ( block ) banded matrix types which have fast lu overloads, making them a nice way to accelerate the solution of stiff mol discretizations of... | https://api.stackexchange.com |
. julia's broadcast system generates fused kernels on the fly which are overloaded by array types to give a lot of the features mentioned above. cudanative. jl allows for compiling julia code to gpu kernels. modelingtoolkit. jl automatically de - sugars asts into a symbolic system for transforming mathematical code. ca... | https://api.stackexchange.com |
you just google it with. jl or julia and it'll show up. then there's a few things to keep in mind on the horizon. packagecompiler is looking to build binaries from julia libraries, and it already has some successes but needs more development. makie. jl is a whole library for gpu - accelerated plotting with interactivit... | https://api.stackexchange.com |
there are some other application - specific journals to list : such as journal of computational physics or computer physics communications, that accept articles both about algorithms as well as the software used to implement them. if you're in the chemistry field, journal of chemical theory and computation might be ano... | https://api.stackexchange.com |
tl ; dr fluorine is electronegative and can support the extra negative charge that is dispersed on the six x atoms in $ \ ce { sx6 } $, whereas hydrogen cannot. first, let's debunk a commonly taught myth, which is that the bonding in $ \ ce { sf6 } $ involves promotion of electrons to the 3d orbitals with a resulting $... | https://api.stackexchange.com |
electrons in its σ orbitals. i've also neglected the π contribution to bonding, so the fluorine lone pairs don't appear in the diagram. you'll see that, for a total of six $ \ ce { s - f } $ bonds, we only have four pairs of electrons in bonding mos. the other two pairs of electrons reside in the $ \ mathrm { e _ g } $... | https://api.stackexchange.com |
more stable. alternatively, if you want to stick to the mo description, the idea is that in $ \ ce { sh6 } $, the relatively high energy of h1s compared to f2p will lead to the nonbonding $ \ mathrm { e _ g } $ orbitals being relatively higher in energy. all things being equal, it's less favourable for a higher - energ... | https://api.stackexchange.com |
the resistor can be on either side of the led, but it must be present. when two or more components are in series, the current will be the same through all of them, and so it doesn't matter which order they are in. i think the way to read " the resistor must be connected to the anode " as " the resistor cannot be omitte... | https://api.stackexchange.com |
computers are used in several steps of sequencing, from the raw data to finished sequence : image processing modern sequencers usually use fluorescent labelling of dna fragments in solution. the fluorescence encodes the different nucleobase ( = “ base ” ) types ( generally called a, c, g and t ). to achieve high throug... | https://api.stackexchange.com |
genome at hand. often, this is the case. for instance, there is a high - quality “ reference sequence ” of the human genome and since all the genomic sequences of all humans are ~ 99. 9 % identical ( depending on how you count ), you can simply look where your reads align to the reference. read mapping this is done to ... | https://api.stackexchange.com |
##gs from a mapped reads together ( but different algorithms are used ). again we use the property of the reads that they overlap. if you find two fragments which look like this : acgtcgatcgctagccgcatcagcaaacaacacgctacagcct atccccaaacaacacgctacagcctggcggggcatagcactgg you can be quite certain that they overlap like this... | https://api.stackexchange.com |
wheels are possible on the molecular level — bacterial flagella are rotating cores inside a molecular motor, but wheels larger than the flagellum have not really been found. defining a wheel as a freely rotating joint that can rotate indefinitely in one direction, a single animal with a wheel is an improbable * develop... | https://api.stackexchange.com |
of like saying that the random movement of water molecules might line up to run a stream uphill. its possible, but there's just such a strong path downwards, that the statistical chances of you seeing it happen are nil. this is a hypothetical case, but arguing this in a convincing way i think you would need to describe... | https://api.stackexchange.com |
the surface of two joints to synchronize them as they wind up like a circular spring. the gear itself is not living tissue, so the bug solves the problem of regenerating the gear by growing a new set when it molts ( i. e. gears that continually regenerate and heal are still unknown ). it also does not keep its gears th... | https://api.stackexchange.com |
it is not true. if the null hypothesis is true then it will not be rejected more frequently at large sample sizes than small. there is an erroneous rejection rate that's usually set to 0. 05 ( alpha ) but it is independent of sample size. therefore, taken literally the statement is false. nevertheless, it's possible th... | https://api.stackexchange.com |
no, this is not possible. there are a few reasons for that, but most important are that the only thing a mosquito injects is its own saliva, while the blood is sucked into the stomach where it is digested. to be able to infect other people hiv would need to be able to leave the gut intact and then also be able to repli... | https://api.stackexchange.com |
you should use box plots and pca plot. let's take a look at the ruv paper : before normalization and after uq normalization : libraries do not cluster as expected according to treatment.... for uq - normalized counts. uq normalization does not lead to better clustering of the samples... before normalization, the median... | https://api.stackexchange.com |
you have at least two options, depending on what problem you want to solve. if you want innocent readers of your code to not get the answers inadvertently, or you at least want to make it a bit difficult so that users are not tempted, you can encrypt the solutions and store the key as part of your code, perhaps a resul... | https://api.stackexchange.com |
could someone please convince me that there is something natural about the choice of the lagrangian formulation... if i ask a high school physics student, " i am swinging a ball on a string around my head in a circle. the string is cut. which way does the ball go? ", they will probably tell me that the ball goes straig... | https://api.stackexchange.com |
especially ). they are the most intuitive source i know for this material. read some of the many questions here in the lagrangian or noether tags. see if you can figure out their answers, then read the answers people have provided to compare. if you thought that the lagrangian approach was wrong, then you might want so... | https://api.stackexchange.com |
this is a very broad question and i am going to give you some things to think about ( some are already included in your post, but they are repeated here for completeness ). scope of problems you need to define the interface of how to specify problems. are you going to allow parameters that can be fixed or can vary for ... | https://api.stackexchange.com |
##lab examples to peruse. this is not unique. if you look at the book " numerical methods for unconstrained optimization and nonlinear equations " by dennis and schnabel, appendix b, " test problems ", you can see how they did it. after developing one of the most beautiful set of algorithms write ups i have ever seen, ... | https://api.stackexchange.com |
this is a subtle question. it takes a thoughtful person not to understand those quotations! although they are suggestive, it turns out that none of them is exactly or generally correct. i haven't the time ( and there isn't the space here ) to give a full exposition, but i would like to share one approach and an insight... | https://api.stackexchange.com |
##ometric measurements of subjects - - say, for simplicity, the three side lengths $ x $, $ y $, $ z $, surface areas $ s = 2 ( xy + yz + zx ) $, and volumes $ v = xyz $ of a set of wooden blocks. the three side lengths can be considered independent random variables, but all five variables are dependent rvs. the five a... | https://api.stackexchange.com |
what $ \ theta _ 1 $ or $ \ theta _ 2 $ might be. in advance, you created a set of $ k $ " bins " for the data. ( it may be problematic when the bins are determined by the data, even though this is often done. ) using these bins, the data are reduced to the set of counts within each bin. anticipating what the true valu... | https://api.stackexchange.com |
, those conditions have nothing to do with independence ( functional or statistical ), with numbers of " components " of the data, with the numbers of parameters, nor with anything else referred to in the original question. let me show you with an example. ( to make it as clear as possible, i'm using a small number of ... | https://api.stackexchange.com |
you have seen coming - - is that the correct df to use for computing the p - values depends on many things other than dimensions of manifolds, counts of functional relationships, or the geometry of normal variates. there is a subtle, delicate interaction between certain functional dependencies, as found in mathematical... | https://api.stackexchange.com |
matrix ( as. numeric ( cut ( x, bins ) ), nrow = n ), 2, tabulate, nbins = 4 ) expectations < - mapply ( function ( m, s ) n * diff ( pnorm ( bins, m, s ) ), m, s ) chisquared < - colsums ( ( counts - expectations ) ^ 2 / expectations ) # # plot histograms of means, variances, and chi - squared stats. the first # two c... | https://api.stackexchange.com |
this picture ( source ) should pretty much answer your question : the train's destination is not above the ground, but rather far away, and perspective means that the tracks appear not to be parallel but instead to converge to the vanishing point. the same applies to the beams of light above them. the sun is very far a... | https://api.stackexchange.com |
the only difference between cross - correlation and convolution is a time reversal on one of the inputs. discrete convolution and cross - correlation are defined as follows ( for real signals ; i neglected the conjugates needed when the signals are complex ) : $ $ x [ n ] * h [ n ] = \ sum _ { k = 0 } ^ { \ infty } h [... | https://api.stackexchange.com |
the discrete fourier transform ( dft ), commonly implemented by the fast fourier transform ( fft ), maps a finite - length sequence of discrete time - domain samples into an equal - length sequence of frequency - domain samples. the samples in the frequency domain are in general complex numbers ; they represent coeffic... | https://api.stackexchange.com |
##ties to this rule for the dft due to its finiteness in time coverage. specifically, the shift in your signal must be circular for the relation to hold ; that is, when you delay $ x [ n ] $ by $ d $ samples, you need to wrap the last $ d $ samples that were at the end of $ x [ n ] $ to the front of the delayed signal.... | https://api.stackexchange.com |
kernel is a way of computing the dot product of two vectors $ \ mathbf x $ and $ \ mathbf y $ in some ( possibly very high dimensional ) feature space, which is why kernel functions are sometimes called " generalized dot product ". suppose we have a mapping $ \ varphi \, : \, \ mathbb r ^ n \ to \ mathbb r ^ m $ that b... | https://api.stackexchange.com |
x _ 1 ^ 2, x _ 2 ^ 2, \ sqrt { 2 } x _ 1, \ sqrt { 2 } x _ 2, \ sqrt { 2 } x _ 1 x _ 2 ) $ and $ ( 1, y _ 1 ^ 2, y _ 2 ^ 2, \ sqrt { 2 } y _ 1, \ sqrt { 2 } y _ 2, \ sqrt { 2 } y _ 1 y _ 2 ) $, and $ \ varphi ( \ mathbf x ) = \ varphi ( x _ 1, x _ 2 ) = ( 1, x _ 1 ^ 2, x _ 2 ^ 2, \ sqrt { 2 } x _ 1, \ sqrt { 2 } x _ 2,... | https://api.stackexchange.com |
i would recommend steering clear of schwarzschild coordinates for these kind of questions. all the classical ( i. e. firewall paradox aside ) infinities having to do with the event horizon are due to poor coordinate choices. you want to use a coordinate system that is regular at the horizon, like kruskal - szekeres. in... | https://api.stackexchange.com |
i attended a talk by josh quick at porecampau 2017, in which he discussed some common barriers to getting both good sequencing yield and long read length. it mostly boils down to being more careful with the sample preparation. bear in mind that the minion will still sequence a dirty sample, it will just be at a reduced... | https://api.stackexchange.com |
##na sequencing run on minion produced over 15m reads in june 2020. we've since shifted over to doing cdna sequencing on promethion flow cell ( using a p2 solo ), and our best so far with that run was 89m reads. | https://api.stackexchange.com |
a first attempt using matlab : im = imread ('squares. jpg') ; im2 = rgb2gray ( im ) ; se = strel ('disk ', 15 ) ; for i = 1 : 16 ; t = 60 + i * 5 ; % try out a range of bw thresholds to see what works best labelled = bwlabel ( im2 > t ) ; % label regions in the bw image closed = imclose ( labelled, se ) ; % close small... | https://api.stackexchange.com |
at the moment, there is very little scientific literature about this, but i found two papers that address the problem and are fairly easy to understand. you can find them in the references. reference 1 is probably the most interesting and is the basis for this answer. edit : it is also interesting to read reference 2 o... | https://api.stackexchange.com |
virus in the lab, the design would usually start from a known virus backbone and then introduce logical changes ( for example, complete genes from other viruses ). this cannot be seen in the genome of the virus ; rather, you see randomly distributed changes throughout the genome coming from virus evolution and not dire... | https://api.stackexchange.com |
according to the docs, there is no in - place permutation method in numpy, something like ndarray. sort. so your options are ( assuming that m is a $ n \ times n $ matrix and p the permutation vector ) implementing your own algorithm in c as an extension module ( but in - place algorithms are hard, at least for me! ) $... | https://api.stackexchange.com |
the distinction between interpreted and compiled code is probably a fiction, as underlined by raphael's comment : the claim seems to be trivially wrong without further assumptions : if there is an interpreter, i can always bundle interpreter and code in one executable... the fact is that code is always interpreted, by ... | https://api.stackexchange.com |
$ s $ ( see also this document ). but i am not sure how this can be formalized properly ( and do not have time right now for it ). and impossible is a big word for an issue that is not formalized. futher remarks added after 36 hours. you may want to skip this very long sequel. the many comments to this question show tw... | https://api.stackexchange.com |
this is also the very situation of interpreters, as the first argument is the program to be executed, and is usually executed many times with different data ( or has subparts executed many times with different data ). hence it become a natural idea to specialize an interpreter for faster evaluation of a given program b... | https://api.stackexchange.com |
} \ simeq \ lambda d. \ varphi _ { i _ s } ( p _ s, d ). \, $ $ \ varphi _ { i _ s } $ may be seen as the execution of the interpreter $ i _ s $ on the hardware, i. e., as a black - box ready to interpret programs written in language $ s $. the function $ \ sigma $ may be seen as a function that specializes the interpr... | https://api.stackexchange.com |
precise understanding of how and why it is impossible. but building a proper formalization to express such a proof may be quite difficult. this said, even if a specific feature is not compilable, in the sense understood by engineers, standard compiling techniques can always be applied to parts of the programs that do n... | https://api.stackexchange.com |
one application of the hilbert transform is to obtain a so - called analytic signal. for signal $ s ( t ) $, its hilbert transform $ \ hat { s } ( t ) $ is defined as a composition : $ $ s _ a ( t ) = s ( t ) + j \ hat { s } ( t ) $ $ the analytic signal that we obtain is complex valued, therefore we can express it in ... | https://api.stackexchange.com |
it is true that, like any convention, the choice of 44. 1 khz is sort of a historical accident. there are a few other historical reasons. of course, the sampling rate must exceed 40 khz if you want high quality audio with a bandwidth of 20 khz. there was discussion of making it 48. 0 khz ( it was nicely congruent with ... | https://api.stackexchange.com |
number of legs in terrestrial vertebrates not only do mammals have four legs but actually all terrestrial vertebrates ( which include mammals ) have four legs. there are slight exceptions though as some lineages have lost their legs. typically snakes have no legs anymore. apesteguia and zaher ( 2006 ) discuss the evolu... | https://api.stackexchange.com |
that would be more efficient ( have higher reproductive success ). often going from one form to another may involve a " valley crossing " meaning that if several mutations are needed, intermediate forms may have low reproductive success and therefore a high amount of genetic drift ( stochasticity in reproductive succes... | https://api.stackexchange.com |
and are replaced by halteres, particularly easy to spot in craneflies ( see below picture ). in millipedes, the link between segmentation and legs is even more obvious ( see picture below ). you can have a look at the diversity of arthropoda here ( click on the branches ). pictures update 1 asking how likely it is for ... | https://api.stackexchange.com |
that it is hard for such trait to come to existence because 1 ) it needs many steps ( mutations ) and 2 ) it is hard to imagine how it could be selected for. for those reasons, there exist no vertebrates with 6 fully functional legs. well, let's assume it does and in consequence, after 200 generations or so, the whole ... | https://api.stackexchange.com |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.