| | --- |
| | license: openrail |
| | --- |
| | DEEPBIND v0.11 |
| | -------------- |
| |
|
| | The deepbind command-line executable can be used to score DNA/RNA sequences |
| | according to any RBP/TF model listed in the DeepBind web repository: |
| |
|
| | http://tools.genes.toronto.edu/deepbind |
| |
|
| | For each input sequence, the deepbind executable scores each subsequence |
| | of a pre-determined length (e.g. 20) and returns only the maximum or the |
| | average over these per-position scores. |
| |
|
| | Larger scores indicated stronger binding. The scores themselves are on an |
| | arbitrary scale, and vary from model to model due to variation in the |
| | quality of training data for different proteins. |
| |
|
| |
|
| | EXAMPLE |
| | ------- |
| |
|
| | To generate predictions with DeepBind, you need two things: |
| |
|
| | 1) a list of model IDs, and |
| | 2) |
| | 3) a list of DNA/RNA sequences. |
| |
|
| | The file example.ids contains 4 example model IDs, one |
| | on each line, reproduced here: |
| |
|
| | * D00210.001 # RBFOX1 (RNAcompete) |
| | * D00120.001 # MBNL1 (RNAcompete) |
| | * D00410.003 # GATA3 (SELEX) |
| | * D00328.003 # CTCF (SELEX) |
| |
|
| | The file example.seq contains 4 example sequences, which |
| | were chosen such that the nth sequence scores highly for |
| | the nth model. The file example.seq is reproduced here: |
| |
|
| | * AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC |
| | * AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU |
| | * GAGGTTACGCGGCAAGATAA |
| | * TACCACTAGGGGGCGCCACC |
| |
|
| | To generate 16 predictions (4 models, 4 sequences), run |
| | the deepbind executable as follows: |
| |
|
| | % deepbind example.ids < example.seq |
| |
|
| | |D00210.001| D00120.001| D00410.003| D00328.003| |
| | | :----:| :----: | :----: |:----: | |
| | | 7.451420 | -0.166146 | -0.408751| -0.026180| |
| | | -0.155398 | 4.113817 | 0.516956| -0.248167| |
| | | -0.140683 | 0.181295 | 5.885349| -0.026180| |
| | | -0.174985 | -0.152521 | -0.379695| 17.682623| |
| |
|
| | To see details of each ID, use the --dump-info flag: |
| |
|
| | % deepbind --dump-info example.ids |
| | |
| | |ID | Protein | Type | Species | Family | Class Experiment | |
| | | :----:| :----: | :----: |:----: | :----: | :----: | |
| | | D00210.001 |RBFOX1 |RBP |Homo sapiens |RRM |RNAcompete | |
| | | D00120.001 |MBNL1 |RBP |Homo sapiens |Znf |RNAcompete | |
| | | D00410.003 |GATA3 |TF |Homo sapiens |GATA |SELEX | |
| | | D00328.003 |CTCF |TF |Homo sapiens |C2H2 ZF |SELEX | |
| |
|
| |
|
| |
|
| | CHANGES v0.1 -> v0.11 |
| | --------------------- |
| |
|
| | - Fixed bug where last position in input sequence was |
| | not evaluated for a score; suggested by Irene Kaplow. |
| |
|
| | - Added --window-size and --average flags based on feedback. |
| |
|
| |
|
