|
|
--- |
|
|
license: openrail |
|
|
--- |
|
|
DEEPBIND v0.11 |
|
|
-------------- |
|
|
|
|
|
The deepbind command-line executable can be used to score DNA/RNA sequences |
|
|
according to any RBP/TF model listed in the DeepBind web repository: |
|
|
|
|
|
http://tools.genes.toronto.edu/deepbind |
|
|
|
|
|
For each input sequence, the deepbind executable scores each subsequence |
|
|
of a pre-determined length (e.g. 20) and returns only the maximum or the |
|
|
average over these per-position scores. |
|
|
|
|
|
Larger scores indicated stronger binding. The scores themselves are on an |
|
|
arbitrary scale, and vary from model to model due to variation in the |
|
|
quality of training data for different proteins. |
|
|
|
|
|
|
|
|
EXAMPLE |
|
|
------- |
|
|
|
|
|
To generate predictions with DeepBind, you need two things: |
|
|
|
|
|
1) a list of model IDs, and |
|
|
2) |
|
|
3) a list of DNA/RNA sequences. |
|
|
|
|
|
The file example.ids contains 4 example model IDs, one |
|
|
on each line, reproduced here: |
|
|
|
|
|
* D00210.001 # RBFOX1 (RNAcompete) |
|
|
* D00120.001 # MBNL1 (RNAcompete) |
|
|
* D00410.003 # GATA3 (SELEX) |
|
|
* D00328.003 # CTCF (SELEX) |
|
|
|
|
|
The file example.seq contains 4 example sequences, which |
|
|
were chosen such that the nth sequence scores highly for |
|
|
the nth model. The file example.seq is reproduced here: |
|
|
|
|
|
* AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC |
|
|
* AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU |
|
|
* GAGGTTACGCGGCAAGATAA |
|
|
* TACCACTAGGGGGCGCCACC |
|
|
|
|
|
To generate 16 predictions (4 models, 4 sequences), run |
|
|
the deepbind executable as follows: |
|
|
|
|
|
% deepbind example.ids < example.seq |
|
|
|
|
|
|D00210.001| D00120.001| D00410.003| D00328.003| |
|
|
| :----:| :----: | :----: |:----: | |
|
|
| 7.451420 | -0.166146 | -0.408751| -0.026180| |
|
|
| -0.155398 | 4.113817 | 0.516956| -0.248167| |
|
|
| -0.140683 | 0.181295 | 5.885349| -0.026180| |
|
|
| -0.174985 | -0.152521 | -0.379695| 17.682623| |
|
|
|
|
|
To see details of each ID, use the --dump-info flag: |
|
|
|
|
|
% deepbind --dump-info example.ids |
|
|
|
|
|
|ID | Protein | Type | Species | Family | Class Experiment | |
|
|
| :----:| :----: | :----: |:----: | :----: | :----: | |
|
|
| D00210.001 |RBFOX1 |RBP |Homo sapiens |RRM |RNAcompete | |
|
|
| D00120.001 |MBNL1 |RBP |Homo sapiens |Znf |RNAcompete | |
|
|
| D00410.003 |GATA3 |TF |Homo sapiens |GATA |SELEX | |
|
|
| D00328.003 |CTCF |TF |Homo sapiens |C2H2 ZF |SELEX | |
|
|
|
|
|
|
|
|
|
|
|
CHANGES v0.1 -> v0.11 |
|
|
--------------------- |
|
|
|
|
|
- Fixed bug where last position in input sequence was |
|
|
not evaluated for a score; suggested by Irene Kaplow. |
|
|
|
|
|
- Added --window-size and --average flags based on feedback. |
|
|
|
|
|
|
