Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
referring to fig1 an imaging / quantitative ultrasonic device 10 includes a housing 12 having a generally upward opening footwell 14 sized to receive a human foot . at the toe end of the footwell 14 on the upper surface of the housing 12 is a display / touch panel 16 allowing data to be entered into or received from an internal computer ( not shown in fig1 ). flanking the footwell 14 near the heel end of the footwell is an ultrasonic transmitter unit 18 and an ultrasonic receiver unit 20 supporting at their opposed surfaces compliant bladders 22 holding a coupling fluid such as water . the bladders 22 serve to communicate ultrasonic energy from the contained transducers of the transmitter unit 18 through a patient &# 39 ; s foot inserted into the footwell 14 and back out to the contained transducer of the receiver unit 20 . referring now to fig2 and 4 , the receiver unit 20 may include a piezoelectric sheet 24 of circular outline positioned normal to a transmission axis between the receiver unit 20 and transmitter unit 18 . the piezoelectric sheet 24 is divided into a number of transducer elements 26 defined by electrodes 28 placed on opposite surfaces of the piezoelectric sheet 24 . rear electrodes 28 b are deposited by vacuum metallization and may be squares centered at the interstices of a rectangular grid to fall in rectilinear rows and columns . a solid continuous electrode 28 a is positioned on the opposite side of the piezoelectric sheet 24 . the center of each rear electrode 28 b is separated from its neighbor by less than one - half centimeter and the front electrode 28 a is connected to a common reference voltage . the piezoelectric sheet 24 may be constructed polyvinylidene fluoride ( pvdf ). in manufacture , the piezoelectric sheet 24 is polarized to create its piezoelectric properties by heating and cooling the sheet in the presence of a polarizing electric field according to methods well understood in the art . in the preferred embodiment , the entire sheet is thus polarized , however it may be advantageous to ‘ spot polarize ’ the sheet where only the areas under the metalization are piezoelectric providing for better cross talk isolation according to polarization methods well known in the art . mechanical forces operating on the piezoelectric sheet 24 create a voltage between electrodes 28 a and 28 b . attached to the front of the piezoelectric sheet 24 in the direction of received ultrasonic energy is a matching plate 30 constructed of an acoustically transmitting material , such as a polyester , having a speed of sound near that of water and the piezoelectric sheet 24 to provide for improved matching between the two . the thickness of the matching plate 30 is arbitrary but chosen to be many times the operating wave length of the ultrasound so as to delay any reverberation effects that may occur due to acoustic impedance mismatches , and to be sufficiently thick so as to withstand reasonable pressure from water on its front side , as will be described , mechanical shock to which the imaging / quantitative ultrasonic device 10 may be subjected , and the combined pressure of connector springs , also to be described . in the preferred embodiment , the matching plate 30 is generally planar , however , lens shaped plates providing a focusing of acoustic energy may also be used . referring again to fig2 the piezoelectric sheet 24 and matching plate 30 are attached together with an adhesive and fit within a retainer ring 32 that provides a point of attachment for the receiver unit 20 to the housing 12 . the retainer ring 32 also provides a flange on its front surface holding a compliant silicon bladder 33 filled with water to provide a coupling path for ultrasonic energy from the heel of the patient through the matching plate 30 to the piezoelectric sheet 24 . ports in the retainer ring 32 ( not shown ) allow inflation of the bladder before use and deflation of the bladder for storage . referring still to fig2 and 4 , a spring holder 36 is positioned behind the piezoelectric sheet 24 opposite the matching plate 30 . the spring holder 36 is comprised of an insulating disk such as a plastic and having a plurality of axial holes 38 , each aligned with one electrode 28 b , and each hole sized to hold a helical compression springs 40 . the springs 40 may be loaded into the holes 38 of the spring holder 36 by a vibratory feeder or other assembly technique and held in position for assembly by the introduction of a volatile liquid such as alcohol , which acts to retain the springs 40 by surface tension . each spring 40 is otherwise free to move axially within the holes 38 . behind the spring holder 36 is a circuit board 42 which may be an epoxy glass material well known in the art . the front surface of the circuit board 42 has a number of terminal pads being part of plate through holes 44 passing through the circuit board 42 . each of the plate through holes 44 aligns with one of the axial holes 38 and with an electrode 28 b so that the spring 40 may provide a path from electrode 28 b to a plate through hole 44 . the circuit board 42 is held adjacent to the piezoelectric sheet 24 by the retainer ring 32 in a manner such that there is an air space between the front surface of the spring holder 36 and the rear surface of the piezoelectric sheet 24 so as to reduce the conduction of ultrasonic energy out of the piezoelectric sheet 24 into the spring holder 36 . springs 40 , while not as light as aluminized mylar , provide an acceptably reduced conduction of ultrasonic energy away from piezoelectric sheet 24 . the plate through hole 44 provides a conduit , shown in fig3 conducting electrical energy to the rear side of the circuit board 42 where it may be connected to the lead of a multiplexer 50 , the latter soldered onto a terminal or trace on the rear of the printed circuit board according to techniques well known in the art . referring to fig4 the multiplexers 50 allow selective connection of one or more transducer element 26 at a time to an output lead 52 . this selective connecting may read , in a scanning process , the voltage at each electrode 28 b . referring now to fig5 an imaging / quantitative ultrasonic device 10 incorporating the receiver unit 20 provides an internal bus 46 allowing a computer 48 having a processor 50 and memory 53 to communicate both with the transmitter unit 18 and the receiver unit 20 . in this way , the transmitted wave may be controlled according to a program held in memory 53 and the received wave may be processed according to the program in memory 53 . the bus 46 also communicates with the display / touch panel 16 which allows inputting of data to the computer 48 and outputting data from the computer 48 during execution of the program in memory 53 . the bus 46 also allows communication between the computer 48 and the mechanical subsystems 54 such as pumps for inflating the bladders 33 prior to use or deflating the bladders 33 for storage . during operation of the program held in memory 53 , the computer 48 energizes the ultrasonic transmitter unit 18 to produce a generally planar wave 62 for imaging purposes . the computer 48 scans the multiplexers 50 through the transducer elements 26 of the receiver unit 20 to collect and process image data . this image data may consist of attenuation data such as broadband ultrasonic attenuation ( bua ) or speed of sound measurements ( sos ), a combination of both , or some other acoustic parameter , mapped to a gray scale value and a spatial location in the image corresponding to the location of each transducer element 26 in the ultrasonic receiver unit 20 . the image may be displayed on the display / touch panel 16 . it is specifically intended that the present invention not be limited to the embodiments and illustrations contained herein , but that modified forms of those embodiments including portions of the embodiments and combinations of elements of different embodiments also be included as come within the scope of the following claims .	1
referring to fig1 - 4 together , the temperature monitoring device of a first embodiment of the invention comprises a movable subassembly of parts 10 - 18 and 30 - 36 working together with a fixed subassembly comprising parts 20 - 28 which comprises a fixed reaction member . the major parts of these subassemblies are movable disc 10 and a fixed disc 20 which define two opposing walls of a device package . the fixed wall 20 may be adhered to the wall of the blood bag or other package for refrigerated material and the movable wall 10 is visible to an observer . the movable wall 10 has raised islands 12 , 14 , 16 and 18 ( islands 12 , 14 and 16 being indicated by right hand section ) which are movable therwith and also comprises transparent window portions 13 and 15 which are also movable therewith . the fixed wall 20 comprises raised islands 22 , 24 and 26 indicated with left hand sectioning and which remain fixed therewith . the movable subassembly further comprises an alloy wire 3 which has an end secured in fixed island 22 , the opposite end being free and having an intermediate portion bendable around island 24 . the movable subassembly further comprises a cam 32 mounted on island 24 and pivotable about said island and having itself , a raised section 34 which is engageable with island 14 of movable wall 10 to drive the cam counter clockwise when the wall 10 is rotated counter clockwise about island 24 which serves as a pivot therefor . the cam 32 further comprises a cutout 36 which is engageable with fixed island 26 to lock cam 32 as shown in fig2 and 3 . a visual indicator of positioning history is provided by a colored dot ( e . g ., blue ) 33 mounted on cam 32 and another colored bead ( e . g ., red ) 35 mounted on wire 30 . a portion of a blood bag is indicated at b in fig4 and fixed wall 20 may be adhesively bonded to the blood bag wall or otherwise secured thereto in well bonded , thermally conducting relation . after setting the blood bag into cold storage , the parts of the temperature monitoring device has the relative positioning shown in fig1 . the operator grasping the periphery of wall 10 rotates wall 10 and its attached parts 12 , 13 , 14 , 15 , 16 and 18 , counterclockwise and thereby drives cam 32 and wire 30 to the positions shown in fig2 . the device is then set by slot 36 of cam 32 engaging locking island 26 . the operator then rotates wall 10 back clockwise to establish the positioning of parts shown in solid lines in fig3 - 4 ( ignoring the chain line configuration 30 &# 39 ;). window 13 is then aligned with dot 33 to show that the temperature monitor has been set and window 15 is then prepared to receive bead 35 if the preset temperature is exceeded . cam 32 is locked in its upper position . if during the course of transport and / or storage , the critical temperature is exceeded , wire 30 will uncurl to the position shown on 30 &# 39 ; putting head 35 in the position shown at 35 &# 39 ; within the window 15 . it can then be determined from inspection at the end of the transportation and / or storage period that excessive temperature occurred at some time during such period . referring now to fig5 - 6 a second embodiment of the invention , incorporating a different temperature sensing and indicating module , is illustrated . the module comprises a flat base disc 120 adhered or otherwise bonded to the item to be monitored , a rotatable upper disc 110 ( a rim portion and lands of which are shown in the sectional views of fig5 and 6 ), a wire 130 and a screw 125 with its threads engaged in a central land portion 124 of part 110 and its head bearing on the under side of disc 120 to hold the module together . alternatively , the discs may be held together by a rivet . fixed disc 120 has islands 103 and 133 thereon to serve as first and second location markers , islands 112 and 116 as first and second stops , island 122 as a wire support and a ramp guide 134 . movable disc 110 has downwardly extending islands 114 to serve as a wire pusher and has first and second windows 113 and 115 . the windows are , preferably transparent circles in an opaque background of disc 110 . the initial position of parts is as drawn in fig5 and the temperature monitoring position is established by a 180 ° counterclockwise twist to the fig6 position without a return twist . in the fig5 position , window 113 exposes marker 103 and the end of wire 130 is not visible through any window . upon setting the device for monitoring ( fig6 ) window 115 exposes market 133 , wire 130 is wrapped around the island 124 and is not visible , and window 115 is at the original site of the free end of wire 130 . if the transition of temperature of wire 130 is exceeded , its free end will snap to window 115 to provide a visual indication of overtemperature . in the course of movement from its fig5 to fig6 positions , island 114 pushes wire 130 until island 114 rides over cam 134 to get clear of wire 130 and leave it free to expand back to window 115 . stops 112 and 116 provide limits to movement of pusher 114 , and accordingly limit movement of disc portion 110 as a whole . a further preferred embodiment of the invention is now described in connection with fig7 a and 8 showing , respectively , unset and set positions of the apparatus with setting and over - temperature indicating positions of the wire indicated in phantom in fig8 . the embodiment and equivalents are characterized by minimizing strain induced in the martensitic transformation wire in the course of working from the first configuration to the second configuration to allow reliable linear response and is further characterized by a minimum of parts for simplicity and economy and comprises a first subassembly ( disc ) 210 which is bonded to the article whose thermal history is to be monitored and the second movable subassembly ( upper disc ) 220 with knurled or otherwise graspable sidewalls indicated at 229 and a face label 228 containing a window 227 and a temperature indicia 226 . a fixed post 211 which serves as a fixed reaction member is mounted on subassembly 210 and the wire 230 is mounted from a supporting post 222 carried on movable subassembly 220 . the movable subassembly comprises a stop post 223 which engages fixed post 211 to limit rotation of 210 in the clockwise direction and a post 221 for aligning parts in production of the device . the movable subassembly 220 comprises indicia of temperature 226 thereon including a linear degree scale which can be calibrated for each production run of thermal monitoring devices . a floating reaction member 240 is placed between wire 230 and fixed reaction member 211 and preferably comprises a polygonal disc preferably a hexagon as indicated at 240 . the post 221 helps to properly position member 240 in the device as initially manufactured . the operation of the embodiment can now be described . the movable subassembly 220 is rotated clockwise from the rest position shown in fig7 and carries support 222 clockwise so that the unsupported free end of wire 230 is bent by reaction of fixed member 211 , via floating member 240 , to form it ( the wire 230 ) into a bow shape , as shown in fig7 a . in the course of such bow shape formation , the intermediate reaction member 240 moves through what is formed as an increasing and then decreasing spacing between fixed reaction member 211 and the free end of wire 230 by sequential sliding of faces 241 , then 242 , then 243 along reaction member 211 . this effects an initial deflection of wire 230 to the position shown in fig7 a and in phantom ( fig8 ) at 231 and then if and when exposed to temperature rise relaxation to the position of wire 230 shown in solid in fig8 or other . if the temperature of the device to be monitored and of the temperature monitoring assembly rises above the transition temperature of the wire material , it deflects ( i . e ., its free end deflects ) to one of the positions indicating in phantom ( fig8 ) at 232 , or therebetween , depending on the amount of temperature rise and the scale 226 can be utilized to indicate the extent of temperature rise because of the linear nature of the deflection . it will be noted from fig7 a and 8 that the floating reaction member has no room to move back to a point below fixed pin 211 even if movable subassembly 220 is rotated back counterclockwise ; i . e ., the temperature monitoring device cannot be reset and a permanent record of overtemperature exposure , if any , of contents monitored thereby is maintained . since the extent , as well as the fact of , temperature rise can be measured , it becomes possible to reconsider rejection of many marginal items and to salvage many more items which might have been exposed to a modest temperature excursion . it also becomes possible to save on refrigeration costs by imposing more modest refrigeration requirements , given this greater degree of control . while the floating reaction member 240 is shown as a hexagon , in fig7 - 8 , it will be appreciated that it can be made of other polygonal forms or even of circular or cammed curving forms . further , the floating reaction members 240 could be integrated with wire 240 as a cammed extension thereof , or alternatively , the cammed extension could be provided on fixed reaction member 211 . relative movement of wire 230 with respect to reaction member 211 can be achieved by many means other than relative rotation of two opposing discs , including , for instance , a flexible roof which would allow direct manipulation of wire 230 . the length of martensitic transformation material can be in ribbon or other elongated forms other than a straight wire shown in fig1 - 8 . it is evident that those skilled in the art , once given the benefit of the foregoing disclosure , may now make numerous other uses and modifications of , and departures from the specific embodiments described herein without departing from the inventive concepts . consequently , the invention is to be construed as embracing each and every novel feature and novel combination of features present in , or possessed by , the apparatus and techniques herein disclosed and limited solely by the scope and spirit of the appended claims .	6
a preferred embodiment of the present invention and its advantages can be understood by referring to the present drawings . in the present drawings , like numerals are used for like corresponding parts of the accompanying drawings . fig2 illustrates an electronic circuit block diagram shown generally by reference numeral 20 , for an ethernet switch according to one embodiment of the present invention . the circuit consists of an ethernet media access controller ( mac ) block 21 with integrated packet and address memory which provides a plurality of communications ports each adhering to the rmii ( reduced media independent interfaces ) signaling specification as put forth by the version 1 . 2 of the rmii consortium . such a block 21 may be implemented using marvell 88e6050 or a galileo gt48350 . these rmii ports interface to a multi - port physical layer device 22 , referred to as a phy , which converts the rmii signals to differential transmit and receive signal pairs in accordance with the ieee 802 . 3 10baset and or 100basetx standards . the phy portion of the circuit can be implemented by an amd ( advanced micro devices ) am79c875 quad phy device which is capable of industrial grade ( i . e . − 40 to 85 ° c .) operating temperature . for 10 mbps operation the differential 10baset signal pairs interface to a 10baset - to - 10basefl conversion block 23 which will convert the 10baset differential signal pairs to current drive signals capable of driving fiber optical led transmitters 24 and interfacing to led fiber optical receivers 24 with outputs as low as 2 m vp - p and a dynamic range of 55 db . a micro linear ml4669 or ml6651 may implement the 10baset - to - 10basefl conversion block . versions of these components are available which will operate at industrial grade temperatures . the output signals of the 10baset - to - 10basefl conversion block interface directly to the fiber optical transmitter and receiver pairs 24 . these may be implemented by agilent technologies ( trade mark ) hfbr - 2416 and hfbr - 1414 receiver and transmitter component pair . these components are capable of industrial grade operating temperatures . for 100 mbps operation the phy devices 22 chosen for the present embodiment of the invention are capable of directly interfacing 23 b to 100 mbps fiber optical transceivers 24 with pseudo emitter coupled logic ( pecl ) interfaces that are compliant with the 100basefx version of the ieee 802 . 3u standard . the 100 mbps fiber optical transceivers may be implemented using agilent technologies hfbr - 5903 ™ or other similar fiber optical transceiver . it should be appreciated that by using a fiber optical communications medium that the system is no longer susceptible to electrical transients and electromagnetic interference being coupled into the device as is the case with the twisted pair copper cables 8 of fig1 . regulated dc voltages , suitable for operating the electronics , are supplied to the system via dual redundant power supplies 26 . transient suppression 26 a for power supply block # 1 26 b is provided at the inputs . the same transient suppression 26 d is provided for power supply block # 2 26 c . referring now to fig3 . a detailed schematic diagram of the transient suppression circuit 26 a , 26 d used in the present embodiment of the invention is shown generally by reference numeral 30 . voltage transients entering via the external power connector 31 having a positive power line + vdc , a negative power line − vdc and an earth ground line gnd are filtered back to their source by capacitors 35 a , 35 b and 35 c which provide a high frequency bypass for both differential and common mode noise transients . to ensure that transients with high voltage levels do not exceed the ratings of components such as the bypass capacitors 35 a , 35 b and 35 c , transzorbs 33 a , 33 b and 33 c and metal oxide varistors ( movs ) 34 a , 34 b and 34 c are used to clamp both differential and common mode high - voltage transients to acceptable levels . these components must be rated with high instantaneous peak - power dissipation capacity . this capacity may be provided by st microelectronic &# 39 ; s transil components or general semiconductor industries inc . transzorb ™ for a uni - directional zenerdiode or un - directional solid state transient voltage suppressor components which are capable of dissipating 400 w to 1 . 5 kw for a period of 1 ms . suitable mov components may be selected from harris corporation &# 39 ; s za series . it should be appreciated that the present embodiment of the invention allows for either transzorbs 33 or movs 34 as a voltage clamping device depending on what type of failure mode is desired for these components . transzorbs will 33 “ fail short ” when parameters are exceeded while movs 34 will “ fail open ” ( i . e . open circuit ) when parameters are exceeded . failing open allows the system to continue functioning but now leaves the remaining circuitry in its path unprotected . failing short will halt the remainder of the system and typically cause the short circuit fuse 32 to blow thereby isolating the system 30 from any further damaging transients . the blocking rectifier diode 37 is used to prevent the application of a reverse polarity voltage source at the input power connector 1 . capacitor bank 36 provides further differential mode filtering while common mode choke 38 provides further common mode filtering of any remnants of noise or harmful electrical transients which have made it passed the initial bypass capacitors 36 and the transzorb 33 or mov 34 clamping devices . suitable values for the capacitor bank 36 capacitors are 680 nf / 100v ceramic capacitors manufactured by kemet . suitable values for the common mode choke are 1 . 2 mh per leg as manufactured by epcos . preferably , the transient suppression circuit 30 shown in fig3 is sufficient to pass the electrical transients type tests as defined by the following standards : 1 . surge withstand capability as per ansi / ieee c37 . 90 . 1 ( 1989 ) standards . 2 . surge immunity as per iec 610004 - 5 ( 1995 level 4 ) standards . 3 . high frequency noise disturbance as per iec 60255 - 22 - 1 ( 1988 class iii ) standards . 4 . fast transient disturbance as per iec 60255 - 224 ( 1992 class iv ) standards . 5 . high voltage impulse test as per iec 60255 - 5 : 1977 standard . referring back to fig2 , the outputs of power supply block # 1 26 b and power supply block # 2 26 c are electrically or - ed via the or - ing diodes block 26 e . the system 20 has been designed such that should power supply block # 1 fail then all of the required current to drive the system will be provided by power supply block # 2 and vice - versa . at the core of each of the power supply blocks is a high efficiency dc - dc converter such as that provided by artesyn &# 39 ; s exb30 which has an operating efficiency of 92 % and an operating temperature of − 40 to 85 ° c . the high efficiency ensures heat dissipation within the system &# 39 ; s enclosure is minimal . it should be appreciated that the use of dual redundant power supply blocks in the system 20 improves the system reliability and availability . cooling for components requiring cooling to maintain their case temperatures below the manufacturer &# 39 ; s recommended operating limit is accomplished via the thermoelectric cooling block 27 . the cooling block 27 comprises a thermoelectric cooler ( tec ) 27 a , which is controlled by an electronic control block 27 b , and a temperature sensor 27 c is mounted on the components requiring cooling . the control block 27 b performs the function of measuring the ambient temperature inside the enclosure of the operating unit via the temperature sensor 27 c , comparing it to predefined limit such as 70 ° c . and upon the ambient temperature reaching the limit the control block 27 b applies power to the tec . a control block of this type can be implemented via a national semiconductor lm26 factory preset thermostat designed to be mounted on printed circuit boards for use in microprocessor thermal management systems . the lm26 integrates the temperature sensor 27 c and the measurement and control block 27 b in a package capable of operating over a temperature range of − 55 to 110 ° c . beyond this predetermined range , or other ranges , the control block 27 b applies a current to the tec 27 a . fig4 shows a diagram of the application of tec 43 to an electronic component such as a microprocessor on a printed circuit board 45 . the tec itself 43 is mounted in between the component 44 and the heat sink 1 via layers of thermal epoxy 42 a , 42 b . a dc current to power to the tec 43 is delivered via wired leads 46 and controlled via the tec control block 27 b of fig2 . a plurality or tecs 43 may be applied in the present embodiment of the invention to components requiring cooling . it should be appreciated that by eliminating the need for cooling fans and thus rotating mechanical parts typically found in cooling fans , the reliability and thus the applicability of the system has been improved . fig5 illustrates use of a tec 53 , according to a further embodiment , to an electronic component using an extended heat sink 51 a with an external surface 51 b . in some embodiments of the invention the heat sink 51 a is mounted on the tec 53 via thermal compound 52 a and the external surface 51 b extends outside of the metallic enclosure 57 b . it should be appreciated that this heat sink arrangement allows heat to be conducted outside of the enclosure 57 c and dissipated via convection to the outside ambient environment . utilizing the present invention will permit data packets to be transmitted reliably even in harsh . in other words . the environmentally hardened switch according to the present invention provides for zero packet loss even in environments in which other ethernet switches would not function . this permits the ethernet switch of the present invention to function for substantial periods of time without losing any data , which increases the efficiency and robustness of the entire system . it will be understood that , although various features of the invention have been described with respect to one or another of the embodiments of the invention , the various features and embodiments of the invention may be combined or used in conjunction with other features and embodiments of the invention as described and illustrated herein . although this disclosure has described and illustrated certain preferred embodiments of the invention , it is to bc understood that the invention is not restricted to these particular embodiments . rather , the invention includes all embodiments , which are functional , electrical or mechanical equivalents of the specific embodiments and features that have been described and illustrated herein .	7
the micro implement as shown in fig1 a has structure being installed the micro payload in fig1 b by inserting bottom end of the micro payload into the appropriate orifice on an upper surface of the stem holder 4 to fix the micro payload . since the micro payload is integrated of the micro head 2 having the sharp tip 1 of triangular pyramidal or rectangular pyramidal on top with made from drug mixed saccharide and the micro stem 3 shaped triangular or rectangular column with made from pure saccharide under the micro head , the micro implement cab be released in medication as shown in fig2 b . in addition , the micro implement allows to level target depth in skin such as coneeous layer 6 , dermal layer 7 , and organs under skin 8 by adjusting length of the micro stem . furthermore , plural pieces of the micro implements are able to stand on a substrate . the micro implement installed the micro payload made from maltose or the other saccharide materials allows to painlessly insert into skin and keep inserting to enough as deep level as touching stem holder and then leave only the micro payload in skin by releasing from the stem holder as shown in fig3 b , after the micro implement is pulled out from skin at enough insertion as shown in fig3 a . almost all the micro payload is inserted from tip to body in skin at complete insertion , though the bottom end of the micro stem fixed into the orifice of the stem holder is exposed in skin surface . since the micro payload is constructed of the micro head mixed drug in the upper part and the micro stem in lower part , the micro head is completely inserted in skin . the micro head of the micro payload disappears with dissolving and releasing drug in skin water in a few minutes like 3 minutes after insertion 9 , 10 as shown in fig3 c , resulting that all drug is diffused in skin to generate infiltration region 11 and 100 % bioavailability is achieved as stable drug deliver condition and quantity conservation . drug delivery specification is clear . the saccharide micro payload of short micro stem is targeted at only skin as shown in fig4 a and the micro payload for deep target as shown in fig4 b can deliver drug to deeper region than 1 mm at shallowest . the deep micro payload allows us to treat immune disease with vaccine and diabetes disease needed whole body circulation with insulin . furthermore , the long micro implement itself becomes volume increase and up to 50 mm cube with expected sufficient amount drug , ranging in delivery amount at mile gram unit weight as equivalent to as treating the immune reaction and the insulin drug . the micro payload integrated of the micro head 2 and the micro stem 3 is formed by the method of forming the micro head from maltose or saccharides in condition of heating melt and cooling harden in the first process with the micro mold for the micro head , the micro stem in the same condition as the micro head in the second process with the micro mold for the micro stem , and by the method of identically connecting the base of the micro head and the upper surface of the micro stem with assembling both the micro mold in highly precise positioning . the formed product of the micro head mixed drug with a sharp tip is obtained by detaching from the molds after the three processes . the half shell cone 14 in fig5 a and the half shell bullet 15 in fig5 b is formed by the same processes and assembly . furthermore , the payload product of the half shell cone or half shell bullet is obtained with integrating half shell column 16 by the same process and assembly as shown in fig6 a or fig6 b respectively . here , the half shell cone is defined half fragmental solid cut through top of the cone and the half shell bullet is defined as well as the half shell cone . the two half shell cones are assembled to makes a cone . the conical micro head can have a combining solid of the micro head of half shell cone 14 with contained drug and the micro head of half shell cone 17 without drug as shown in fig7 . the conical micro head keeps well inserting function supported by half shell cone without drug , even if the half shell cone with drug becomes malfunction due to softening by drug mixture . in the other case , the conical micro head can have two kinds of drugs in the half shell cone with a drug and another half shell cone with another drug . in addition , the conical micro head 18 can duplicate drug amount by assembling two of the same half shell micro head with drug as shown in fig8 a and the duplicated bullet shaped micro head 19 is formed as well as shown in fig8 b . the micro payload installed the conical micro head with integrated the column micro stem 20 as shown in fig8 c . the micro payload installed the bullet shaped micro head is formed as well as shown in fig8 d . in extension , the micro payload contained a drug chip inside the bullet shaped micro head is formed as shown in fig9 or becomes the micro the pentagonal pyramidal micro head by combining triangular pyramid and rectangular pyramid as shown in fig1 . in conventional microneedles , needles are directly connected to substrate and needle roots are left after only half tip side of needles are inserted in medication , resulting in bioavailability of less than 70 % but more than 30 % is lost as waste potion . in the micro implement with preferred embodiment of the invention having the micro payload mixed drug inlayed in the micro stem , drug in the micro payload is completely carried into skin , resulting in 100 % bioavailability . though conventional transdermal microneedles are unstable in bioavailability due to changeable volume of microneedles inserted into skin every medication , the micro payload with preferred embodiment of the invention is stable because the micro payload is completely released from the stem holder with the micro stem . then , bioavailability is directly equaled to the volume and shape of the micro payload and is constant every medication with repeatability . though conventional microneedles are shorter than 1 mm and do not reach deep region under skin at all , the micro implement with preferred embodiment of the invention installed the micro payload with length of more than 1 mm can be manufactured by the micro mold delivers drug to far deep region under skin and the length itself increases the volume with increasing drug amount , resulting in effective treatment for immune disease and diabetes , which cannot be treated by conventional microneedles . conventional microneedle , which is obtained from substrate by processing , is needed to manage waste after medication with heavy works due to residual substrate having residual part of needles . in the micro implement with preferred embodiment of the invention , the micro payload is completely transported into skin with released from the stem holder , leaving only substrate and stem holder after medication . the residual waste , which is substrate of saccharides without touching skin , does not need a special waste management meaning effective cost reduction . in the case of all saccharide stem holder and substrate , waste of the micro implement after medication becomes dissolvable completely , solving environmental issues . micro payload installed in the micro implement is an integration of drug mixing amorphous maltose micro head with shaped a variety of pyramids like triangular or quadrangular and adhered on a column micro stem made from pure maltose for depth adjustment . in case of treating shallow region in skin like coneeous layer , micro stem is not needed and the micro head itself works as a micro payload . in deep treatment under skin , the micro payload is an integration of the micro head and the micro stem . the micro head is any pyramidal shape having identical base to the upper surface shape of the micro stem with a sharp tip in less than 0 . 01 mm at external radius and 0 . 01 mm to 5 mm length . the micro stem is a column at length from 0 . 2 mm to 5 mm for the depth adjustment and has sectional external radius from 0 . 01 mm to 0 . 5 mm . in the micro implement form , the micro payload installed into an orifice on the upper surface of the stem holder is integrated a various pyramidal shaped micro head with a sharp tip and a micro stem for depth adjustment , the micro payload functions a microscopic medical device to insert into skin such as microneedles for percutaneous drug delivery . drug is mixed in amorphous maltose or other saccharide and the micro implement made from the maltose or the saccharide dissolves by the water in skin or body just like a micro drug capsule . the micro payload with installed a drug mixed maltose or saccharide micro head completely comes out from the holder orifice in medication or insertion , staying in skin and then the dissolving micro head releases the drug in the skin by diffusion and infiltration . in any case of vitamins , hyaluronic acid or collagen is selected as a drug , the micro implement , which is integrated amorphous maltose or other saccharide micro head with mixed drug at concentration from 10 % to 90 % on a pure micro stem installed in the orifice of the stem holder , is manually inserted into skin . then the micro payload comes out from the holder and the micro head perfectly inserts in the skin like a bullet , allowing the whole drug to stay in skin . the micro head with mixed anything of vitamins , hyaluronic acid or collagen is optimally formulated so that the head dissolves and disappears in body internal water with delivering it into skin at 100 % bioavailability . the micro implement is a dermal drug delivery device characterized by mixing drug in the micro head . the principal ingredient mixing in the maltose micro head are pullulan , polysaccharide , collagen , hyaluronic acid or the complex . the tip of the head sizes less than 0 . 01 mm at external radius . the length of the head sizes from 0 . 02 mm to 5 mm . the base of the head sizes external radius from 0 . 02 mm to 5 mm . the head shapes any pyramid , quadrangular pyramid , a half - shell cone , a half - shell bowling - pin , polygonal pyramid , or a cone or bullet by matching half - shells manufactured with micro molds . drug chip containing micro head has a form like shown in fig9 . the micro stem , which is the lower part of micro payload of micro implement , is aimed at inserting the micro head in skin deeply and systemic drug like insulin , hormone , or prostaglandin is useable . the material is preferably identical to the micro head so that maltose , pullulan , other saccharide , hyaluronic acid , collagen , or the complex is appropriate . any other material in vivo affinity dissolved safely in skin like chitin and chitosan , or biodegradable materials like poly lactic acid is usable as the candidate . regarding shape of micro - mold of the micro - head , the tip size of the micro - head is the most important for medication or insertion function to deliver percutaneous drug and forming the micro - head mold 28 to sharpen a micro - head tip is important too . method of sharpening the tip of a pyramidal micro - head is principally optimized to derive the minimum size of intersection 27 from cross cutting among three planes of the first plane 24 , the second plane 25 and the third plane 26 . the micro head pyramid is a replica released from the identical dint opened in the micro mold . the tip 1 of the pyramid is originated from the tip 29 of the pyramidal dint by the method with a preferred embodiment of the present invention and the dint tip is touched on the upper surface of the mold . there are three planes in the dint of the micro - mold to form the three planes of the pyramid of the micro - head , corresponding the first plane and the second plane of micro - head to two sides in the dint of the micro - mold and corresponding the third plane of the micro - head to open triangle on the upper surface of the micro - mold . the optimized manufacturing method with a preferred embodiment of the present invention is making planarization of melted maltose poured into the dint as the third plane by sweeping to make the third plane and sharpen the tip of the micro - head . regarding the micro implement manufacturing method with preferred embodiment of the invention having the micro head or the micro payload with mixed drug , while the case of triangular pyramidal micro head is assumed , the mold 28 , having the dint of lied triangular pyramid or more than 2 the pyramidal dints identical to inversed the pyramidal micro head opened in stainless cuboid mold fitting the base arranged onto the mold sidewall and upper surface of pyramidal dint is coincided to the upper surface of the cuboid , is prepared . drug mixed viscous maltose softened by heating or drug mixed poly saccharides in dilution is poured into the dints in the mold , which has open bases of the triangular pyramidal dints in side wall of the mold and the open bases are closed with the hold 30 attached to the sidewall of the mold . the two surfaces of triangular pyramidal micro head are corresponding to the two surfaces of the pyramidal dint in the mold and the upper surface of the mold head is processed by sweeping over flowing maltose and surface planarization to level the surface at the upper surface of the mold in heating . after processing , the micro head is cooled down in the mold to be hardened and is pulled out from the mold to be formed . in the case of using the micro head as a micro payload without micro steam , the micro head is precisely moved to the lateral direction by 0 . 001 mm unit digital control to remove and the pyramidal micro payload is made as shown in fig1 b . in the case of forming the micro payload integrated the drug mixed micro head and the micro stem , the micro head is held after its formation in the first process and is connected the base of the micro head to the end of the micro stem in the second process with heating or wetting , after the micro stem is formed with the micro mold 31 in fig1 for the micro stem 32 in fig1 in the second process . the micro payload is sequentially is detached with the precise mechanism from the micro mold for micro stem and from the micro mold for micro head . here , the precise removing is defined as form of micro processing technology which functions to shake up and down , right and left and forth and back in three dimensional degree of freedom in order to detach the micro head from the micro mold with precise adjustment at 0 . 001 mm pitch . in addition , an easy detachment is obtainable if necessary vibration or ultrasonic waves are applied to both the micro molds by appropriate power ranged from 1 w to 10 w . in addition , the two micro molds as shown in fig1 is allowed to drive with flexibility of three directions by 0 . 001 mm unit and be heated and cooled simultaneously . furthermore , the manufacturing method allows to make the micro implement of any long stem like short stem in fig1 or that of long stem in fig1 . the micro implement with preferred embodiment of the present invention allows to include pure solid medicine , complex medicine mixed the material of the micro head , micro capsule included medicine , and micro capsule included micro magnetic granule or micro electromagnetic granule as drug chip 33 in the micro head 34 in fig1 . the drug chip forms ellipsoid , rectangular or polygonal pyramid of the material selectable from the following materials : vitamins , collagen , hyaluronic acid , protein , dna , medical agent , nutrient , supplement , cosmetic material , antibody test agent , pigment , metal , metal oxide , or the mixture , or that of mixture selected from the upper materials in weight ratio from 10 % to 90 %. the stem holder , which installs the micro payload in the micro implement with preferred embodiment of the present invention , is fulcrum having orifice inserted the base of the micro payload i . e . the base of the micro stem . the micro stem is stably inlayed onto the orifice of the stem holder in store and has to be completely released from the orifice when the micro payload is inserted into skin . then , the micro stem is appropriately installed in the stem holder by slightly pushing it into the orifice in 3 % smaller than the base of the micro payload with application of vibration or ultrasonic waves ranged in 1 khz to 10 khz . in addition , the long stem holder shaped like a stick is easy to handle in the case of a micro payload . multiple of the micro payloads are lined up in array or a pin support and multiple of the stem holders form standing on the substrate in fig2 . since material of the holder is touched the skin at insertion of the micro payload but is taken off after use , the material doesn &# 39 ; t require safety as strictly as in vivo residue . any of saccharide , paper , wood , resin , metal , maltose , pullulan , hyaluronic acid , cellulose , solid protein , silk or bio material or the complex can be the material . saccharide , however , is preferable in perspective of reducing the waste disposal cost . the following non - limiting examples are provided for illustrative purposes only in order to facilitate a more complete understanding of the disclosed subject matter . these examples are intended to be a mere subset of all possible contexts in which the percutaneous implement may be utilized . thus , these examples should not be construed to limit any of the embodiments described in the present specification , including those pertaining to the various percutaneous implements and / or methods and uses thereof . accordingly , the practical examples explained hereinafter do not limit the invention . a micro implement was installed a micro payload . the payload was integrated of a 0 . 003 mm tip sized , 0 . 7 long and 0 . 25 mm bottom side quadrangular pyramidal micro - head in up part and a 0 . 5 mm long and 0 . 25 mm wide cubic micro - stem in down part . the micro - head is made of amorphous maltose with mixed 17 % sodium ascorbic acid and rhodamine 6b . the micro - stem is made of pure maltose . in human skin medication by using 100 pieces micro implements arrayed on a substrate by 10 rows and 10 columns , 100 % the drug was transferred into skin by recognizing the color of rhodamine 6b . the bio availability 100 % resulted . by using bullet shaped micro - head of 1 mm length and 0 . 2 mm bottom diameter including two 50 k - 100 k molecular weight hyaluronic acid 0 . 01 mm side long cubic chips with impregnated rhodamine 6b , the chip was inserted and completely transferred into skin . skin surface region around the inserted chip became swollen . micro implement sample installed micro head with mixed lidocaine , one of local anesthetic drug , was made by a metal micro mold having 20 hollows of a triangular pyramidal micro - head of 1 mm length in a side line of stainless metal . the sample was used for animal test . rat was administrated and blood plasma was sampled in leg , arm , stomach , back , and neck , resulting that 0 . 003 - 0 . 01 mg lidocaine was detected in the plasma . 0 . 01 mg insulin was obtained in a micro implement installed in a 3 mm stem holder having a micro payload integrated a pyramidal micro head of 3 mm length with mixed 50 % insulin from bovine pancreas in maltose and 2 mm length maltose micro - stem . 1 mg insulin was transferred into body with a 100 micro implements by 10 rows and 10 columns in a medication . 1 mg insulin is equaled to 26 iu . a diabetes patient who needs 60 iu in a day is three times provided enough in morning , noon and night with 80 micro implements in a cassette , while 60 iu is equivalent to 2 . 3 mg . 1 mg insulin including micro implement deserves diabetes medical treatment . a sample of micro payload integrated a 1 mm length conic micro - head with drug and 2 mm length micro - stem without drug was injected in rat . the conic micro - head was matched a half - shell maltose cone mixed 1 mg alprostadil derived from prostagladin and a half - shell maltose cone mixed rhodamine 6b . the color of rhodamine 6b was recognized in rat whole body with 20 mmhg hypotension indicating vasodilation from alprostadil . a sample of 2 mm length micro implement installed a bullet shaped micro - head contained a 2 mg hyaluronic acid chip mixed 1 mg collagen extracted collagen solution from human fibroblasts was used for an animal trial with rat . 50 % collagen was transferred into skin . aggregating collagen was recognized in intercellular matrix from 1000 times of magnified microscopic view of skin cross section figure . 64 micro implements are arranged in a substrate . the micro implement is installed just a half - shell cone micro - head of 0 . 5 mm length and bottom diameter 0 . 2 mm made from anhydrous and amorphous maltose contained 5 % cosmetic material of 50 % white titanium oxide and 50 % brown iron oxide . micro implement medication 0 . 3 mm depth into skin for facial stain displayed stain reduction and brighter skin seemed recognized around the region . quadrangular pyramidal micro - head of 0 . 7 mm length and 0 . 1 mm bottom side length was contained anhydrous and amorphous oblate spheroidal maltose chip of 0 . 02 mm length and 0 . 01 mm diameter . the chip was made from mixing material of 50 % maltose and 50 % hyaluronic acid included 30 % albumen which was non - heat resistance limited in 70 degree centigrade . three micro - heads were installed in three lengths of micro implements of 1 mm , 2 mm , and 3 mm . these were used for animal tests of rat , resulting in albumin aggregation in skin . the three aggregation depths were corresponded to the three length respectively . albumin resisted temperature of the micro implement forming process . triangular pyramidal maltose micro - head of 0 . 5 mm length and 0 . 1 mm bottom side length included steel oxide particles in size of average 0 . 003 mm diameter . the micro - head was installed in 1 mm length micro implement and inserted into skin . 1 mg magnetic field was exposed around the particles inserted skin region . the particles were magnetized . bioactivity around the region was recognized by detecting the magnetic field originated from the particles in skin . the micro implement with preferred embodiment of the invention and the manufacturing method are useful in medical treatment and beauty treatment . the method belongs to only low cost mechanical field with processing a sharp tip as fine as 0 . 001 mm at largest and includes elements of three dimensional process but does not include a fine process of vacuum process and lithography , which have been used as a fine technologies . the method can be carried to mass production . in closing , regarding the exemplary embodiments of the present invention as shown and described herein , it will be appreciated that a percutaneous implement and method for manufacturing are disclosed . because the principles of the invention may be practiced in a number of configurations beyond those shown and described , it is to be understood that the invention is not in any way limited by the exemplary embodiments and is able to take numerous forms to do so without departing from the spirit and scope of the invention . it will also be appreciated by those skilled in the art that the present invention is not limited to the particular geometries and materials of construction disclosed , but may instead entail other functionally comparable structures or materials , now known or later developed , without departing from the spirit and scope of the invention . certain embodiments of the present invention are described herein , including the best mode known to the inventor ( s ) for carrying out the invention . of course , variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventor ( s ) expect skilled artisans to employ such variations as appropriate , and the inventor ( s ) intend for the present invention to be practiced otherwise than specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described embodiments in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . groupings of alternative embodiments , elements , or steps of the present invention are not to be construed as limitations . each group member may be referred to and claimed individually or in any combination with other group members disclosed herein . it is anticipated that one or more members of a group may be included in , or deleted from , a group for reasons of convenience and / or patentability . when any such inclusion or deletion occurs , the specification is deemed to contain the group as modified thus fulfilling the written description of all markush groups used in the appended claims . unless otherwise indicated , all numbers expressing a characteristic , item , quantity , parameter , property , term , and so forth used in the present specification and claims are to be understood as being modified in all instances by the term “ about .” as used herein , the term “ about ” means that the characteristic , item , quantity , parameter , property , or term so qualified encompasses a range of plus or minus ten percent above and below the value of the stated characteristic , item , quantity , parameter , property , or term . accordingly , unless indicated to the contrary , the numerical parameters set forth in the specification and attached claims are approximations that may vary . at the very least , and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims , each numerical indication should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques . notwithstanding that the numerical ranges and values setting forth the broad scope of the invention are approximations , the numerical ranges and values set forth in the specific examples are reported as precisely as possible . any numerical range or value , however , inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements . recitation of numerical ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate numerical value falling within the range . unless otherwise indicated herein , each individual value of a numerical range is incorporated into the present specification as if it were individually recited herein . use of the terms “ may ” or “ can ” in reference to an embodiment or aspect of an embodiment also carries with it the alternative meaning of “ may not ” or “ cannot .” as such , if the present specification discloses that an embodiment or an aspect of an embodiment may be or can be included as part of the inventive subject matter , then the negative limitation or exclusionary proviso is also explicitly meant , meaning that an embodiment or an aspect of an embodiment may not be or cannot be included as part of the inventive subject matter . in a similar manner , use of the term “ optionally ” in reference to an embodiment or aspect of an embodiment means that such embodiment or aspect of the embodiment may be included as part of the inventive subject matter or may not be included as part of the inventive subject matter . whether such a negative limitation or exclusionary proviso applies will be based on whether the negative limitation or exclusionary proviso is recited in the claimed subject matter . the terms “ a ,” “ an ,” “ the ” and similar references used in the context of describing the present invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . further , ordinal indicators — such as “ first ,” “ second ,” “ third ,” etc .— for identified elements are used to distinguish between the elements , and do not indicate or imply a required or limited number of such elements , and do not indicate a particular position or order of such elements unless otherwise specifically stated . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein is intended merely to better illuminate the present invention and does not pose a limitation on the scope of the invention otherwise claimed . no language in the present specification should be construed as indicating any non - claimed element essential to the practice of the invention . specific embodiments disclosed herein may be further limited in the claims using consisting of or consisting essentially of language . when used in the claims , whether as filed or added per amendment , the transition term “ consisting of ” excludes any element , step , or ingredient not specified in the claims . the transition term “ consisting essentially of ” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic ( s ). embodiments of the present invention so claimed are inherently or expressly described and enabled herein . all patents , patent publications , and other publications referenced and identified in the present specification are individually and expressly incorporated herein by reference in their entirety for the purpose of describing and disclosing , for example , the compositions and methodologies described in such publications that might be used in connection with the present invention . these publications are provided solely for their disclosure prior to the filing date of the present application . nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason . all statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents . while aspects of the invention have been described with reference to at least one exemplary embodiment , it is to be clearly understood by those skilled in the art that the invention is not limited thereto . rather , the scope of the invention is to be interpreted only in conjunction with the appended claims and it is made clear , here , that the inventor ( s ) believe that the claimed subject matter is the invention .	0
making reference to the drawing views and in particular to fig1 to 4 , this ski boot incorporating a flex adjusting device comprises a cross band element , generally designated with the reference numeral 1 , which is associated with the bottom face of the front quarter at forward portion of the quarter overlapping the instep covering portion 3 of the boot shell with an overlapping surface portion thereof . the band 1 extends crosswise to the user &# 39 ; s foot main direction , essentially at the foot instep . the cross band 1 is supported at its end on the quarter , being secured thererto by screw fastener means 5 engaging in end eyes 6 provided at the band end and being connected to threaded seats 7 defined on the quarter . provided on the face of the band 1 facing toward the overlapping surface portion of the front quarter are ribs 8 which engage in corresponding seats 9 provided in said overlapping portion to join together the cross band 1 and front quarter 2 . with its bottom face , i . e . the remote one from that having the ribs 8 , the band 1 acts by contact against the instep covering portion 3 of the boot shell . by operating the screws 5 , the cross band 1 , which is supported on the front quarter 2 , is practically pressed to a greater or lesser extent against the shell 3 so as to change the characteristics of the contact area to make rotation of the quarter 2 relatively to the shell 3 more or less easily performed , thereby adjusting the amount of flex . it may be appreciated that by applying a pull to the cross band 1 , i . e . by tightening the screws 6 , the cross band 1 is pressed with increased force against the shell 3 , thereby increasing the frictional coefficient which resists the mutual rotation of the quarter 2 and shell 3 . by loosening the screws , the pull force on the cross band 1 is , of course , decreased , and accordingly , the oscillatation of the quarter with respect to the shell favored . as shown in fig5 and 6 , an oscillating band 11 is provided overriding the instep portion 3 of the boot shell and which is hingedly connected with its ends to the side portion of the front quarter , again indicated at 2 . the oscillating band 11 is provided , at its upper portion , with a pair of ears 12 which engage with a threaded bar 13 journalled at its ends on the lower portion , i . e . the portion concealed from view of the front quarter 2 . a ring nut 14 , which can be reached through a small window 15 through the outside of the quarter 2 , engages with the threaded bar 13 at the area included between the ears 12 , thereby manipulating the ring nut 14 , the bar 13 can be rotated to produce a translation of the ears 12 relatively to the bar 13 , which is converted into an oscillatory or pivotal movement of the oscillating band 11 about its hinge connection points on the front quarter 2 . the oscillation of the oscillating band 11 brings about either an increase or decrease of the contact areas between the oscillating band 11 and shell , and consequently a change in the frictional force developed between the band and shell , thereby the effort required to effect the swinging movement between the quarter and shell . shown in fig7 to 9 is a device which comprises a pair of side bands 20 associated at the bottom face , i . e . the face of the front 2 which is concealed from view and again indicated at 2 , which side bands 20 have one of their ends , indicated at 21 , hingedly connected to the front quarter 2 , at side regions thereof . each band 20 has , at its other end , a means adapted to generate the rotation of the band 20 with respect to the end 21 . in a preferred embodiment , such means includes a plate or strip 22 with parallel slots , which engages with a worm screw 23 carried rotatably on the quarter , thereby the rotation of the worm screw 23 results in a translation of the slotted strip and consequent oscillation of each side band relatively to the front quarter , with attendant variation of the contact area between said side band 20 and the shell 3 . as shown in fig9 the band 20 is positioned in a recess 30 defined by the bottom face of the front quarter 2 , and has on the front a stopper projection indicated at 31 . also in this case , by causing the side bands to swing on their ends journalled to the front quarter , the contact area between the side bands and shell can be varied , and hence , the friction conditions can be changed which affect the flexing of the front quarter relatively to the shell . it may be appreciated from the foregoing that the invention achieves its objects , and in particular the fact should be enhanced that a device is provided which allows the contact conditions between one part rigid with the front quarter and the boot shell to be varied , thereby increasing or decreasing the mutual frictional coefficient and varying , as a result , the boot amount of flex . in practicing the invention , the materials used , while best results are to be obtained through the use of plastic materials , as well as the dimensions and contingent shapes , may be any selected ones to meet individual requirements .	0
reference will now be made in detail to the subject matter disclosed , which is illustrated in the accompanying drawings . it will be readily understood that the components of the various embodiments as generally described and illustrated in the figures herein may be arranged and designed in a wide variety of different configurations in addition to the described exemplary embodiments . thus , the following detailed description of the various embodiments , as represented in the figures , is not intended to limit the scope of the disclosure as claimed but rather is merely representative of the various embodiments . furthermore , the described features , structures , or characteristics may be combined in any suitable manner in one or more embodiments . in the following description , numerous specific details are provided to give a thorough understanding of embodiments of the invention . however , one skilled in the relevant art will recognize that the various embodiments can be practiced without one or more of the specific details and / or can be practiced with other methods , components , materials , etc . in other instances , well - known structures , materials , or operations are not shown or described in detail to avoid obscuring aspects of the various embodiments . the various embodiments described herein will be best understood by reference to the drawings . the following description is intended only by way of example and simply illustrates certain selected exemplary embodiments as claimed herein . the flowchart and block diagrams in the drawings illustrate the architecture , functionality , and operation of possible implementations of systems , methods , and computer program products in accordance with various embodiments . in this regard , each block in the drawings may represent a module , segment , or portion of code , which comprises one or more executable instructions for implementing the specified logical function ( s ). it should also be noted that , in some alternative implementations , the functions noted in the block may occur out of the order noted in the drawings . for example , two blocks shown in succession may be executed substantially concurrently , or the blocks sometimes may be executed in the reverse order , depending upon the functionality involved . moreover , each block of the block diagrams and / or flowchart illustrations , and combinations of blocks in the block diagrams and / or flowchart illustrations , may be implemented by special purpose hardware - based systems that perform the specified functions or acts or by combinations of special purpose hardware and computer instructions . fig1 provides a block diagram of an exemplary computing system 100 that comprises a dynamic instrumentation system in accordance with an exemplary embodiment . the computing system 100 may comprise a general purpose computer 101 . as can be appreciated , the computing system 100 may comprise a number of computing devices , including but not limited to a desktop computer , a laptop , a server , a portable handheld device ( e . g ., a pda , a mobile phone , etc . ), or any other electronic device capable of performing computation . the various embodiments described herein will be discussed in the context of the general purpose computer 101 . the computer 101 may comprise a processor 102 , memory 104 coupled to a memory controller 106 , one or more input and / or output ( i / o ) devices 108 , 110 ( or peripherals ) that are communicatively coupled via a local input / output controller 112 , and a display controller 114 coupled to a display 116 . a conventional keyboard 122 and mouse 124 may be coupled to the input / output controller 112 . furthermore , the computing system 100 may comprise a network interface 118 for coupling the computing system 100 to a network 120 . the network 120 may transmit and receive data between the computer 101 and external systems . the memory 104 may store instructions that can be executed by the processor 102 . the instructions stored in memory 104 may comprise one or more separate programs , each of which may comprise an ordered listing of executable instructions for implementing logical functions . as illustrated in fig1 , the instructions stored in the memory 104 may comprise a suitable operating system ( os ) 126 . the operating system 126 may control the execution of other computer programs and may provide scheduling , input - output control , file and data management , memory management , and communication control and related services . the processor 102 may be configured to execute the instructions stored within the memory 104 , to communicate data to and from the memory 104 , and to generally control operations of the computer 101 pursuant to the instructions when the computer 101 is in operation . the processor 102 may be any custom made or commercially available processor , a central processing unit ( cpu ), an auxiliary processor among several processors associated with the computer 101 , a semiconductor based microprocessor ( in the form of a microchip or chip set ), a microprocessor , or any other device for executing instructions . the processor 102 may execute the instructions of a dynamic instrumentation system 128 . the dynamic instrumentation system 128 may be stored in the memory 104 ( as shown in fig1 ), may be executed from a portable storage device ( e . g ., cd - rom , diskette , flash drive , etc .) ( not shown ), and / or may be run from a remote location , such as from a central server ( not shown ). generally , the dynamic instrumentation system 128 may collect data ( e . g ., performance data of a program of the computer 101 ). such data may be collected from a kernel address space ( while running in the kernel mode ) and a user address space . the dynamic instrumentation system 128 may collect the data non - disruptively and without recompiling or rebuilding the application . fig2 illustrates the dynamic instrumentation system 128 in further detail in accordance with an exemplary embodiment . the dynamic instrumentation system 128 may comprise one or more modules and data stores . as can be appreciated , the modules may be implemented as a combination of software , hardware , firmware , and / or other suitable components that provide the described functionality . moreover , the modules shown in fig2 may be combined and / or further partitioned to similarly collect data from the kernel address space and the user address space . in this example , the dynamic instrumentation system 128 comprises a breakpoint setup module 130 and a breakpoint execution module 132 . the breakpoint setup module 130 may receive as inputs an instrumentation request 133 , address data 134 , kernel mode data 136 , and user mode data 138 . the instrumentation request 133 may be generated based on a user request to instrument an original instruction stream ( e . g ., a program ) with a breakpoint . the address data 134 may comprise the text address of an original instruction within the original instruction stream . the kernel mode data 136 may comprise a kernel breakpoint handler 154 ( which may be an input to the breakpoint execution module 132 , as illustrated in fig2 and discussed below ) or kernel instrumentation codes that are executed in the kernel mode . the user mode data 138 may comprise a user breakpoint handler 146 ( which may be an input to the breakpoint execution module 132 , as illustrated in fig2 and discussed below ) or user instrumentation codes that are generally executed in the user mode . based on the inputs , the breakpoint setup module 130 may configure the original instruction stream by inserting a breakpoint instruction . the breakpoint setup module 130 may interface with a process address space 140 associated with the address data 134 . the process address space 140 generally stores code , data , and a stack . when the instrumentation request 133 is received , the breakpoint setup module 130 may allocate a page 142 of the process address space 140 to store breakpoint instrumentation information . the allocation of the page 142 of the process address space may be achieved by mapping the page 142 to the process address space 140 , and such mapping may be facilitated via map data 143 . the breakpoint setup module 130 may store in the page 142 the user mode data 138 and trampoline data 144 representing a trampoline . the trampoline data 144 may comprise a copy of the original instruction ( originaunstruntion_copy ), a set of one or more instructions for saving register states and stack data of the original instruction ( save_registers ( )), a set of one or more instructions for performing a call to the user breakpoint handler 146 ( call_user_breakpoinchandler ( )), a set of one or more instructions for restoring the register states and the stack data of the original instruction ( restore_registers ( )), and a set of one or more instructions for performing a jump to the next instruction following the original instruction in the original instruction stream ( jump_nexclnstruction ). the breakpoint setup module 130 may define the trampoline data 144 based on the instruction data stored in the process address space 140 . the breakpoint setup module 130 may replace the original instruction with the breakpoint instruction via breakpoint data 148 . moreover , the breakpoint setup module 130 may generate a registration request 150 to register the kernel breakpoint handler 154 for the breakpoint instruction . the registration of the kernel breakpoint handler 154 may associate the trampoline data 144 and other kernel mode data 136 with the breakpoint instruction . the breakpoint execution module 132 may receive as inputs an incoming instruction 152 , the kernel breakpoint handler 154 , the trampoline data 144 , and the user breakpoint handler 146 . the incoming instruction 152 indicates the instruction to be processed . when the incoming instruction 152 is a breakpoint instruction , the breakpoint execution module 132 may execute the kernel breakpoint handler 154 that is registered for the breakpoint instruction . the kernel breakpoint handler 154 may modify an instruction pointer to point to the trampoline in the page 142 of the process address space 140 . the kernel breakpoint handler 154 may return after modifying the instruction pointer . the breakpoint execution module 132 then may execute the trampoline by , for example , saving the register states and the stack data of the original instruction , executing the user breakpoint handler 146 , restoring the register states and the stack data of the original instruction , executing the original instruction , and jumping to the next instruction following the original instruction in the original instruction stream . with reference to fig3 - 6 and with continued reference to fig2 , methods will be described that can be performed by the dynamic instrumentation system 128 of fig2 in accordance with an exemplary embodiment . the methods may involve an original instruction in an original instruction stream . as can be appreciated in light of the disclosure , the order of operation within the methods is not limited to the sequential execution as illustrated in fig3 - 6 , but rather may be performed in one or more varying orders as applicable and in accordance with the present disclosure . furthermore , one or more steps of the methods may be added or removed without altering the spirit of the methods . fig3 illustrates a method that can be performed by the dynamic instrumentation system 128 of fig2 in order to prepare for instrumentation involving the original instruction in accordance with an exemplary embodiment . the process may begin at block 300 . the inputs may be monitored for an instrumentation request , and at block 310 it may be determined whether an instrumentation request has been received . when an instrumentation request is received at block 310 , a breakpoint may be set up at block 320 , as will be further discussed herein in the context of fig4 . subsequently , it may be determined at block 330 whether the breakpoint setup is successful . if the breakpoint setup is successful , then the process may end at block 350 . conversely , if the breakpoint setup is not successful , then an error message may be sent ( e . g ., sent to the user ) at block 340 before the process ends at block 350 . once the process ends , subsequent instructions in the original instruction stream may be processed in accordance with an instrumentation method further discussed herein in the context of fig5 . fig4 illustrates a breakpoint setup method that may be performed by the breakpoint setup module 130 of fig2 in accordance with an exemplary embodiment . the process steps performed in accordance with this method further define the breakpoint setup step previously presented with respect to block 320 of the method illustrated in fig3 . the process may begin at block 400 . the address data ( text address ) 134 of the original instruction may be obtained at block 405 , the kernel mode data 136 may be obtained at block 410 , and the user mode data 138 may be obtained at block 415 . at block 420 it may be determined whether the obtained address data 134 is valid . if it is determined that the obtained address data 134 is invalid , then an error message may be sent ( e . g ., sent to the user ) at block 425 , and the process then may end at block 455 . conversely , if it is determined that the obtained address data 134 is valid , then at block 430 additional memory of the process address space 140 may be allocated in the form of the page 142 . the memory allocation may be achieved by mapping the page 142 to the process address space 140 . subsequently , a trampoline may be created and stored in the page 142 at block 435 . as previously discussed with reference to fig2 , the trampoline may be represented by the trampoline data 144 and may comprise a copy of the original instruction . the user breakpoint handler 146 may be copied to the page 142 at block 440 . the kernel breakpoint handler 154 may be registered at block 445 , and a breakpoint ( i . e ., breakpoint instruction ) may be inserted at block 450 . as previously mentioned , the registration of the kernel breakpoint handler 154 may associate the trampoline data 144 with the breakpoint instruction . the inserted breakpoint instruction may replace the original instruction . thereafter , the process may end at block 455 . it should be noted that an existing breakpoint may be removed as desired using a process analogous to the process described above . fig5 illustrates an instrumentation method in accordance with an exemplary embodiment . the process may begin at block 500 . an incoming instruction 152 in the original instruction stream may be received at block 510 . then , it may be determined whether the incoming instruction 152 is a breakpoint instruction at block 520 . that is to say , it may be determined whether a breakpoint hit that causes a breakpoint exception has occurred . if at block 520 it is determined that the incoming instruction 152 is not a breakpoint instruction ( i . e ., there is no breakpoint hit ), then the process may end at block 560 . conversely , if it is determined that the incoming instruction 152 is a breakpoint instruction ( i . e ., there is a breakpoint hit ), then the kernel breakpoint handler 154 may be called at block 530 in order to handle the breakpoint exception . at block 540 , the value of the instruction pointer may be modified by means of the kernel breakpoint handler 154 to point to the trampoline stored in the page 142 that is mapped to the process address space 140 . subsequently , the trampoline may be executed at block 550 , as will be further discussed herein in the context of fig6 . thereafter , the process may end at block 560 . fig6 illustrates a trampoline execution method that may be performed by the breakpoint execution module 132 of fig2 in accordance with an exemplary embodiment . the process steps performed in accordance with this method further define the trampoline execution step previously presented with respect to block 550 of the instrumentation method illustrated in fig5 . the process may begin at block 600 . the trampoline may save the registers ( including the register states ) and the thread stack of the original instruction at block 610 . the trampoline may execute the user breakpoint handler at block 620 . once the user breakpoint handler is executed , the trampoline may restore the registers and the thread stack of the original instruction at process block 630 . subsequently , the trampoline may execute the original instruction at block 640 and then may jump to the next instruction after the breakpoint instruction ( i . e ., the next instruction following the original instruction in the original instruction stream ) at block 650 . thereafter , the process may end at block 660 . one or more aspects of the various embodiments described herein may be included in an article of manufacture ( e . g ., one or more computer program products ) comprising a computer readable medium . the computer readable medium may comprise computer readable program code for providing and facilitating the capabilities of the present disclosure . the article of manufacture may be included as a part of a computer system or may be provided separately . additionally , at least one program storage device readable by a machine , tangibly embodying at least one program of instructions executable by the machine to perform the capabilities of the present disclosure , may be provided . a computer usable or computer readable medium may be utilized , or any combination of computer usable or computer readable media may be utilized . the computer usable or computer readable medium may be , for example , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a non - exhaustive list ) of the computer readable medium include an electrical connection having one or more wires , a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , a portable compact disc read - only memory ( cdrom ), an optical storage device , a transmission media such as those supporting the internet or an intranet , or a magnetic storage device . note that the computer usable or computer readable medium may be paper or another suitable medium upon which the program is printed , as the program may be electronically captured , via , for instance , optical scanning of the paper or other medium , then compiled , interpreted , or otherwise processed in a suitable manner , if necessary , and then stored in a computer memory . in the context of this disclosure , a computer usable or computer readable medium may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer usable medium may include a propagated data signal with the computer usable program code embodied therewith , either in baseband or as part of a carrier wave . the computer usable program code may be transmitted using any appropriate medium , including but not limited to wireless , wireline , optical fiber cable , rf , etc . computer program code for carrying out operations of the various embodiments described herein may be written in any combination of one or more programming languages , including an object oriented programming language such as java , smalltalk , c ++, or the like and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may execute entirely on a user &# 39 ; s computer , partly on a user &# 39 ; s computer , as a stand - alone software package , partly on a user &# 39 ; s computer and partly on a remote computer , or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to a user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). while exemplary embodiments have been described herein , it should be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the disclosure first described . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . the corresponding structures , features , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the disclosure has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the various embodiments in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the various embodiments . the exemplary embodiments have been chosen and described in order to best explain the principles of the various embodiments and the practical application , and to enable others of ordinary skill in the art to understand the various embodiments . the various embodiments may include various modifications as are suited to the particular use contemplated .	6
while the invention will be described in connection with preferred embodiments , it will be understood that it is not intended to limit the invention to those embodiments . on the contrary , it is intended to cover all alternatives , modifications , and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims . the present invention is known to be effective for inactivation of parainfluenza type 3 and rhino type 2 virus . the composition has three main active ingredients fumaric acid , benzoic acid , and “ irgasan ® dp 300 ”. the denatured ethyl alcohol is a another active ingredient that is transient in its effectiveness . ingredient % by weight denatured ethyl alcohol sda - 40 - 2 84 . 0 fumaric acid u . s . p . 3 . 0 benzoic acid u . s . p . 0 . 2 “ irgasan ® dp 300 ” 0 . 3 “ klucel mf ” 1 . 0 “ dermacryl ®- 79 ” 1 . 0 isostearyl alcohol 8 . 0 “ elefac ® i - 205 ” 2 . 0 fragrance 0 . 5 100 . 0 as the concentration of any of the ingredients is altered the concentration of the ethyl alcohol should be modified to compensate for the alteration to the composition . the fumaric acid can have a concentration between about 2 % by weight to about 3 % by weight , anything greater than 3 % by weight has a tendency to precipitate out of solution . benzoic acid can have a concentration between about 0 . 1 % by weight to about 0 . 5 % by weight , any concentration greater than 0 . 5 % by weight the composition tends to becomes irritating to the skin . the concentration of the “ irgasan ® dp 300 ” is between about 0 . 1 % by weight and about 0 . 5 % by weight , the concentration of the “ klucel mf ” is between about 0 . 75 % by weight and about 2 % by weight , the concentration of the “ dermacryl ®- 79 ” is between about 1 % by weight and about 2 % by weight , the concentration of the isostearyl alcohol is between about 7 % by weigh and about 12 % by weight , and the concentration of the “ elefac ® i - 205 ” is between about 2 % by weight and about 5 % by weight . another preferred embodiment of my invention includes a method for preparation of the germicidal composition . the method includes several steps : heating denatured ethyl alcohol to a temperature having a range from 27 - 30 ° to increase its capability as a solvent ; adding “ klucel mf ” while mixing continuously until mixture is clear and semi - gel is obtained ; combining together in another vessel , isostearyl alcohol and “ elefac ® i - 205 ” at room temperature using light mixing for approximately five minutes ; and adding to the two mixtures together at high - speed mixing for approximately five to ten minutes . “ klucel mf ” is to be added after the fumaric acid , benzoic acid and “ irgasan ® dp 300 ”. this is important because “ klucel mf ” is a compound which gels the mixture , and thus it is difficult to dissolve the aforementioned ingredients if the “ klucel mf ” is added first . compounds : the present composition , sda alcohol 40 - 2 representing the base solvent used for putting the composition into solution . cells and viruses : a human carcinoma of the lung cell line , a - 549 cells ( american type culture collection , ( atcc ); mannassas , va . ), was used to propagate rhino type 2 virus ( strain hgp , atcc ) as well to titer the virus . embryonic african green monkey cells ( ma - 104 cells , biowhittaker , inc . ; walkersville , md .) were used to propagate and titer parainfluenza type 3 virus ( strain c243 , atcc ). the cells were grown in minimal essential medium ( mem , gibco - brl , gaithersburg , md .) supplemented with 0 . 1 % nahco 3 and 10 % fetal bovine serum ( fbs , hyclone laboratories , logan , utah ). when titering the viruses in the cell lines , serum was reduced to 2 % and 50 μg / ml gentamicin ( sigma chemical company , st . louis , mo .) was added to the medium . a plastic petri dish was evenly coated with the composition at 2 . 0 mg / cm 2 from side to side as the plate was rotated at a tilted angle . another plate was coated with the alcohol base ( 2 . 0 mg / cm 2 ) in the same manner . a third petri was not coated . the two liquids were allowed to air dry for 30 minutes , 8 hours , or 3 days in their respective plates . virus lysates , diluted by a factor of two in minimal essential medium ( mem ), were then added to each plate , including the plate receiving no chemical . enough volume was added to cover the surface of the plate . the time of virus exposure to the plate surfaces was 5 minutes at room temperature . samples of virus lysate were removed and surviving virus was assayed by cytopathic effect assay ( cpe ) assay in ma - 104 cells . treatment with the composition dried for 30 minutes resulted in complete inactivation of parainfluenza virus and rhinovirus ( table 1 ). when the composition was dried for 8 hours or 3 days , both viruses were almost completely inactivated . at these two drying times , virus cytopatic effect was only detected in one well of the first dilution when either virus lysate was assayed for infectious particles following exposure to the composition . there was some apparent cytotoxicity detected in cells receiving virus and the composition in the first two dilutions when the compound was only air dried for 30 minutes . this cytotoxicity was visually different from the virus cytopathic when observed by light microscopy . it was not detected after the 8 hour or three - day exposure to air . the composition was found to have potent virucidal activity against an enveloped virus , parainfluenza virus , even after a three - day “ drying ” time of the composition .	0
referring initially to fig1 a system for focussed web crawling is shown , generally designated 10 . in the particular architecture shown , the system 10 includes a digital processing apparatus , such as a computer 12 , which accesses the world wide web via the internet 13 . in one intended embodiment , the computer 12 may be a personal computer made by international business machines corporation ( ibm ) of armonk , n . y . as shown , or the computer 12 may be any computer , including computers sold under trademarks such as as400 , with accompanying ibm network stations . or , the computer 12 may be a unix computer , or os / 2 server , or windows nt server , or ibm rs / 6000 250 workstation with 128 mb of main memory running aix 3 . 2 . 5 ., or an ibm laptop computer . the computer 12 includes a focussed crawler 14 which may be executed by a processor within the computer 12 as a series of computer - executable instructions . these instructions may reside , for example , in ram of the computer 12 , and may be programmed as a c ++ odbc application . alternatively , the instructions may be contained on a data storage device with a computer readable medium , such as a computer diskette 16 shown in fig1 . as show , the diskette 16 includes a data storage medium 18 holding computer program code elements a - d . or , the instructions may be stored on a dasd array , magnetic tape , conventional hard disk drive , electronic read - only memory , optical storage device , or other appropriate data storage device . in an illustrative embodiment of the invention , the computer - executable instructions may be lines of compiled c ++ compatible code . as yet another equivalent alternative , the logic can be embedded in an application specific integrated circuit ( asic ) chip or other electronic circuitry . fig1 also shows that the system 10 can include peripheral computer equipment known in the art , including an output device such as a video monitor 20 and input devices such as a computer keyboard 22 and mouse 24 . other output devices can be used , such as printers , other computers , and so on . likewise , input devices other than the keyboard 22 can be used , e . g ., trackballs , keypads , touch screens , and voice recognition devices . as described in detail below , the focussed crawler 14 accesses scheduler controls 26 that control when the focussed crawler 14 executes its logic . accordingly , the scheduler controls 26 are referred to below as a “ watchdog module ”, and the focussed crawler is from time to time referred to as a “ worker thread ” or threads 27 . indeed , in the preferred embodiment the watchdog module controls multiple worker threads 27 . additionally , the focussed crawler 14 accesses a topic analyzer 28 ( also referred to herein as “ hypertext classifier ”). the topic analyzer 28 compares the content of a web page with a predefined topic or topics and generates a response representative of how relevant the web page is to the topic . a relevant web page is referred to as a “ good ” web page . details of one preferred topic analyzer are set forth in co - pending u . s . patent application ser . no . 09 / 143 , 733 , filed aug . 29 , 1998 , for an invention entitled “ method for interactively creating an information database including preferred information elements , such as preferred - authority , worldwide web page ”, owned by the same assignee as is the present invention and incorporated herein by reference . or , the following references provide topic analyzers : chakrabarti et al ., “ enhanced hypertext categorization using hyperlinks ”, sigmod acm , 1998 , and chakrabarti et al ., “ scalable feature selection , classification , and signature generation for organizing large text databases into hierarchical taxonomies ”, vldb journal , invited paper , august , 1998 . as disclosed below , it is the purpose of the system 10 to generate a database that contains information on only web pages that pertain to the topic or topics of interest , i . e ., a focussed database . this database is depicted in fig1 as a crawl database 30 . as shown , the crawl database 30 includes a web page (“ crawl ”) table 32 that includes corresponding link tables 34 each of which is an edge table relative to the web page table 32 . also , the database 30 includes example web page tables 35 a and taxonomy tables 35 b . a user can search the database 30 efficiently for web pages of interest , i . e ., for only web pages relating to the topic on which the database 30 is focussed . advantageously , web document meta data such as the data in present tables is stored in a relational database , and more preferably in the database referred to as db2 / udb , made by the present assignee . as shown in fig1 the web page table 32 includes plural fields , each having at least a name , a data type , and , for disclosure purposes , a field description . more specifically , the web page table 32 includes a uniform resource locator ( url ) field 36 , having a variable character data type , that represents a web page url . also , the web page table 32 includes various other fields associated with the url , including an oid field 38 that is an eight character , 64 bit hash of the url , and a num_tries field 40 that is a count of how many times the web page associated with the url has been considered by the crawler 14 , both as a “ new ” page and as an “ old ” page as described below . furthermore , the web page table 32 includes a priority field 42 that represents how often the web page is to be revisited by the crawler 14 , as determined in consonance with the topic analyzer 28 , to determine whether any changes in the web page have occurred , and to “ refresh ” the entry in the web page table 32 as appropriate therefor . in addition , the preferred web page table 32 includes various administrative fields , including an integer ip address field 44 representing the address of the web server from which the web page represented by the url field 36 was acquired . also , three time stamp fields are provided , namely , a “ found ” field 46 , indicating the date and time when the page was initially found , an “ indexed ” field 48 , indicating the date and time when the page was last indexed in the table 32 , and a “ modified ” field 50 , indicating the date and time the web page was last modified by the provider of the content of the page . moreover , a relevance filed 51 indicates the relevance of the web page as more fully disclosed below , and a category id (“ cid ”) field 51 a indicates the topic category of the page . it is to be understood that information pertaining to a “ seed ” set of web pages is initially stored in the web page table 32 . the seed set can be gathered from , e . g ., the temporary internet file directories of the employees of a company or from some other group that can be expected to have shared interests and that , consequently , can be expected to have collectively downloaded web pages that are related to a limited number of predefined topics . thus , the seed set does not define a comprehensive , universal set of all topics on the web , but rather a relatively narrow topic or range of topics that are of interest to the particular source ( e . g ., employee group ) from which the seed set is derived or otherwise defined . as but one example , a seed set of web pages might all be related to the topic “ mining ”. the topic itself can be defined by a user or by considering the seed set using the topic analyzer 28 , including an associated classifier trainer 28 a , to derive the predefined topic or topics from the seed set in the example tables 35 a and from data in the taxonomy tables 35 b , but in any case , only web pages relating to the topic are contained in the database 30 . once derived , the target topic is stored in a category model data structure 35 c . the link table 34 is an edge table ( e . g ., graph edge ) associated with the url field 36 . it includes an eight character source field 52 , representing the source of the hyperlink that was followed by the crawler 14 to initially consider the web page represented by the url field 36 . such links are referred to as “ inlinks ”, because they lead in to the web page represented by the url field 36 . similarly , an eight character target field 54 represents any links to other web pages contained in the web page represented by the url field 36 . such links are referred to as “ outlinks ” because they lead to web pages other than the web page represented by the url field 36 . a “ type ” field 56 that is a short integer string is also included in the link table 34 . the type field 56 indicates the type of outlink in the target field 54 , e . g ., whether the link is to a subdirectory of the directory in which the url 36 resides , or in another directory ( a “ cross directory ”) in the same server , or on another web site altogether , or whether the link redirects the user to back to the url 36 . with the above overall architecture in mind , a user can generate a query for information using the keyboard 22 or mouse 24 , and in response a conventional browser or searcher 58 associated with the computer 12 accesses the crawl database 30 to retrieve a list of relevant web pages therefrom in accordance with well - known principles . it will readily be appreciated that the database 30 does not contain a listing of web pages unrelated to the predefined topic , but only relevant web pages . consequently , the browser 58 will quickly respond to the query when the query is related to the predefined topic ; otherwise , for queries unrelated to the topic , no response will be available from the database 30 . under such a circumstance , the browser 58 can access a conventional crawler database . if desired , a conventional quality rating system 60 can evaluate the quality of web sites in the database 30 for relevancy to a user &# 39 ; s query . fig2 shows the overall logic of the present invention . starting at state 100 , the seed set of example web pages is received from the user . moving to block 102 , the seed set is mapped to appropriate nodes in the taxonomy by invoking a classification program such as taper or hyperclass on each document in the seed set . proceeding to block 104 , frequently occurring seed set categories in the taxonomy are highlighted , and these categories are marked or otherwise indicated as being “ good ” categories at block 106 . next , at block 108 , starting with the seed set the url of each page is selected based on its num_tries field 40 ( fig1 ) and its relevancy field 51 . alternatively , the priority field 42 can be used . initially , the relevance and priority fields can have default values . from block 108 the process moves to block 110 to tokenize the url to identify its textual content and out - links . proceeding to block 112 , the relevance and priority of the document are determined as follows . to determine the relevance of a document , it is assumed that the category taxonomy imposes a hierarchical partition of web documents . categories in the taxonomy tree , also referred to as nodes , are denoted “ c ”. the predicate good ( c ) denotes whether a node “ c ” has been marked as good . by definition , for any document “ d ”, the probability that it was generated from the category c 0 corresponding to the root node , denoted pr [ c 0 \| d ], is one . in general pr [ c \| d ]= pr [ parent ( c )\| d ] pr [ c \| d , parent ( c )]. pr [ parent ( c )\| d ] is computer recursively , whereas pr [ c \| d , parent ( c )] is computed using bayes rule as pr [ c \| parent ( c )] pr [ d \| c / σ c pr [ c &# 39 ;\| parent ( c &# 39 ;)] pr [ d \| c &# 39 ;], where the sum ranges over all siblings c &# 39 ; of c . finally , the probability that a page is relevant is σ good ( c ) pr [ c \| d ]. this quantity , denoted r ( d ), is typically very small , so the logarithm of r ( d ) can be stored if desired . to model the way a document is generated by a category the following bernoulli document model for text is used . first select a category for the document and pick a length for the document . notionally associated with each category is a many - sided coin . each face of the coin represents a word ; the probability that the face comes up corresponds with the probability that the corresponding word occurs in a document of this particular category . this coin is repeatedly tossed ( figuratively ) to write out the document until the length is reached . the category taxonomy is represented in a relational table as follows : where kcid is the id of the current node (“ kid ” class id ), pcid is the id of the parent class , kcname is the textual name , and good is a bit set to express whether the node is good for the current focus . the document table has two fields coupling it with the taxonomy table : relevance , which is set to log σ good ( c ) pr [ c \| d ], and cid , which represents the best matching leaf for the class . the priority with which a particular page is revisited can then be directly correlated to its relevance . moreover , the priority of a document not only can be determined by determining its relevance , but also by determining its “ popularity ”, a measure of the quality of the document . based on the recall precision trade - off of the application and the availability of disk and network resources , a suitable threshold μ on relevance is defined , e . g ., 10 %- 20 % of the pages fetched in the current crawl , only those pages exceeding the threshold are selected as candidate “ authorities ”. any page pointing to at least one “ authority ” is a candidate “ hub ”. “ hubs ” are not thresholded . next , an edge set e is constructed using only those links that are between pages on different sites . unlike the conventional hits algorithm , the present invention have weights ; edge ( u , v ) has three associated numbers : the relevance score of “ u ” called r [ u ], the number of distinct pages on the same server as “ u ” that point to “ v ”, called h &# 39 ;[ u , v ], and the number of distinct pages on the same server as “ v ” to which “ u ” points , called a &# 39 ;[ u , v ]. iterations of the following form can then be performed using the edge weights r [ u ]/ h &# 39 ;[ u , v ] while computing a [ v ] and r [ u ]/ a &# 39 ;[ u , v ] while computing h [ u ], with the authority assignment being changed to only consider pages that pass the relevance bar : r [ x ]& gt ; ρ : a [ v ]← σ ( u , v ) εe h [ u ] and h [ u ]← σ ( u , v ) εe a [ v ] interspersed with scaling h [ ] and a [ ] to sum to unity . from block 112 the logic moves to block 114 . at block 114 the present logic uses a “ soft ” or “ hard ” crawl to insert outlinks into the appropriate portion of the crawl database 30 . as recognized by the present invention , during early stages of a focused crawl , when there is ample storage and many pages to fetch , the crawl should be biased away from refreshing or retrying pages and toward seeking new pages . when little progress can be subsequently made because the disks are full or the topic is nearly entirely crawled , the priority should switch in favor of revisiting pages . the priority and relevance fields permit two types of crawl policies , i . e ., the above - mentioned “ soft ” and “ hard ” crawl policies . for the “ hard ” crawl policy , the classifier 28 is invoked as described above on a web page , and when it returns the best matching category path , the out - links of the page are entered into the crawl database 30 if and only if some node on the best matching category is marked as “ good ”. fig5 shows the details of such a “ hard ” crawl policy . as recognized herein , however , such a policy can lead to crawl stagnation , preferred solutions to which are addressed in fig5 and 6 . alternatively , a “ soft ” policy can be implemented in which all out - links are entered into the crawl database 30 , but their crawl priority is based on the relevance of the current page . a batch of unvisited pages ( typically , a few dozen per thread ) are selected in lexicographic order of ( num_tries , relevance desc , priority asc , bytehash ), where “ asc ” means ascending “ desc ” means descending , and bytehash is a random number to resolve ties without loading any particular server . each url from the group is downloaded and classified , which generally leads to a revision of the relevance score . the revised relevance score is also written into the new records created for unvisited out - links . as recognized herein , however , the above - described “ soft ” policy can lead to crawl diffusion , i . e ., acquiring less and less relevant pages . human intervention / evaluation can be used to determine whether diffusion is taking place . blocks 116 - 120 are performed asynchronously with the above - described process to update the relevance and / or priority fields mentioned previously . at block 116 , the priority of outlinks gathered above is determined using previously described principles or using the above - mentioned hits algorithm . at block 118 , pages and links are revisited at a frequency based on their priority . moving to block 120 , quality rating is periodically invoked using the quality rater 60 ( fig1 ) to rate the crawl and , if desired , add new example pages to the seed set . fig3 and 4 show a particular implementation of the overall logic shown in fig2 . commencing at block 62 , the logic sleeps and periodically awakens to check the lengths of the work queues in the worker threads . at decision diamond 66 it is determined , based on the queue lengths , whether any worker threads are idle or near - idle , and if not , the process prints crawl diagnostic information at block 68 , and then loops back to the sleep state at block 62 . on the other hand , when a worker thread is idle or near - idle , the logic moves to block 70 to determine how many new web pages ( that is , pages associated with outlinks in the link table 34 ) to evaluate and how many old web pages ( that is , pages already listed by url in the web page table 32 ) to evaluate for potential changes to the old pages that might have occurred since the last time the old pages were considered by the system 10 . the numbers of new and old pages generated at block 70 depends on , e . g ., the amount of old pages already listed in the crawl database 30 . for example , if the database 30 is relatively full , more old pages will be checked for changes than new pages considered , whereas when the crawl database is relatively empty , more new pages will be evaluated than old pages checked for changes . the logic then moves in parallel to blocks 72 ( for new pages ) and 74 ( for old pages ). at block 72 , the logic sorts the outlinks in the link table 34 in order of the respective num_tries fields in the associated source web page entries in the web page table 32 , with entries having the same value of num_tries then being sorted in order their respective priority fields . likewise , at block 74 old pages are sorted in order of the respective num_tries fields in the web page table 32 , with entries having the same value of num — tries then being sorted in order their respective priority fields . the top “ n ” old pages and top “ m ” new pages are then selected in order from the sorted lists for insertion into worker thread queues as described below . moving from block 72 to decision diamond 76 , it is determined whether more new pages exist for evaluation in this cycle . if all new pages listed for consideration ( evaluation ) have been considered ( generally after several iterations ), the process loops back to the sleep state at block 62 . similarly , moving from block 74 to decision diamond 78 , it is determined whether more old pages exist for evaluation in this cycle . if all old pages listed for consideration have been considered , the process loops back to the sleep state at block 62 . on the other hand , when it is determined at decision diamonds 76 / 78 that more new / old pages must be considered ( as will happen for at least the first iteration per cycle through fig3 ), the process moves to block 80 to select a worker thread with a relatively low workload . at block 82 the work ( i . e ., the task to check an old page for changes or evaluate a new page for relevancy ) is inserted into the queue of the worker thread selected at block 80 . proceeding to block 84 the num_tries entry for the assigned page , if an old page , is incremented . for a new page , a num_tries entry is provisionally set to unity , pending evaluation of the page for relevancy as discussed below . the logic then proceeds to decision diamonds 76 and 78 to determine whether more pages require processing . fig4 shows the logic of a worker thread in considering pages assigned to it from the watchdog module . from a sleep state at block 86 the worker thread awakens when work is inserted into its queue to extract the work at block 88 . also at block 88 , using communication protocols known in the art the worker thread contacts the web server that is associated with the page inserted at block 88 . moving to decision diamond 90 the worker thread determines whether the assigned page is a new page or an old page . if the page is an old page the logic moves to block 92 to retrieve only the modified portions , if any , of the page , i . e ., the portions that the associated web server indicates have changed since the last time the page was considered by the system 10 . accordingly , at decision diamond 94 it is determined by the system 10 whether in fact the old page has been changed as reported by the associated web server , and if the page has not been changed , the process loops back to the sleep state at block 86 . in contrast , if the page is an old page that has been determined to have changed at decision diamond 94 , or if the page is determined to be a new page at decision diamond 90 , the logic moves to block 96 to retrieve the entire page from the associated web server . at block 98 , a checksum representative of the page &# 39 ; s content is computed , and this checksum establishes the oid field 38 ( fig1 ) of the associated entry in the web page table 32 . moving to decision diamond 100 , when the page under test is an old page the checksum computed at block 98 is compared against the previous value in the associated oid field 38 to again determine , at a relatively fine level of granularity , whether any changes have occurred . if the checksum comparison indicates that no changes have occurred , the process loops back to sleep at block 86 . if the checksum comparison at decision diamond 100 indicates that new data is being considered , however , the logic proceeds to block 102 to tokenize the web page , that is , to separate from each other and , e . g ., alphabetize or otherwise categorize the various terms in the web page in accordance with means known in the art , to facilitate subsequent evaluation of the page . then , the page is classified at block 104 using the topic analyzer or classifier 28 , and at decision diamond 106 it is determined whether the page is “ good ” in terms of relevancy to the predefined topics established by the seed set of web pages mentioned previously , also using the topic analyzer 28 . further details of the process shown at steps 104 and 106 are discussed below in reference to fig5 . when the process determines that the page under test is not relevant to the predefined topic , the process moves to block 108 to update the web page table 32 entries for the page under test ( if the page is an old page ), and then to return to block 86 . it is to be understood that only the page under test is recorded at block 108 , and that the outlinks of the page under test are not entered into the link table 34 . also , if the page under test is a new but irrelevant page , it is not added to the page table 32 at block 108 . thus , from one aspect , the page under test is pruned at block 108 , in that its outlinks are not stored by the system 10 and the page itself is not stored if the page is a new but irrelevant page . one of the entries that is updated is the revisitation priority field 42 in the web page table 32 , which is undertaken based on the relevancy evaluation by the topic analyzer 28 . the more relevant the page , the higher the priority for revisitation to check for subsequent changes . if the page under test is determined to be relevant to the topic , however , the process moves to block 110 , wherein entries are generated for the link table 34 for all outlinks of the page . in other words , the page is expanded in that its outlinks are recorded at block 110 . these entries are inserted into the link table at block 112 , and then the process updates the web page table 32 entries for the page under test at block 108 . it is to be understood that if the page under test is a new page , new table 32 entries are made . further details of the page processing logic is shown in fig5 . commencing at block 114 , the current page is classified relative to its topics , using the topic analyzer 28 ( fig1 ), and then the page is evaluated for relevancy to the predefined topic at decision diamond 116 . the logic at steps 114 and 116 has been previously shown at steps 104 and 106 in fig4 . as explained previously , when the page is a “ good ” page the logic expands the outlinks of the page at block 110 of fig4 . when the page is not a good page , the logic prunes the page at block 108 of fig4 but fig5 shows that prior to pruning , in the preferred embodiment the logic moves to decision diamond 118 to determine whether the rate of gathering pages is below a panic threshold . if desired , the test can compare the rate of gathering only relevant new pages to a threshold . other tests for determining whether to enter a “ panic ” mode can be used . when the gathering rate is not below the threshold , the logic prunes the page as described in fig4 . otherwise , the logic determines that it is in a “ panic ” situation , in that its processing is not resulting in the addition of many or any new pages to the crawl database 30 . when the logic is in the “ panic ” mode , the logic attempts to increase the scope of the search . one method to do this envisioned by the present invention is shown at block 120 , wherein all outlinks and inlinks to the page under test are collected . moving to block 122 , the topic of the page under test is broadened to also include any additional topics that might be contained in inlinks and outlinks to the page under test . alternatively , the logic can move to block 124 to relax the matching criteria , i . e ., to broaden the definition of “ relevancy ” used by the topic analyzer 28 . further details of the process shown at block 124 are described below in reference to fig6 . as yet another alternative , the logic can move to block 126 of fig5 to undertake a “ backwards crawl ”, i . e ., to query the web server associated with the web page under test for sibling links to the page under test , and then to proceed to block 122 as described . “ sibling links ” are links to other web pages that are pointed to from an inlink of the page under test . from block 122 the logic moves to decision diamond 128 to once again determine whether the page is “ good ” in terms of relevancy , using the expansions at blocks 120 , 124 , 126 as appropriate . if the page is good , the logic expands the page as described above in fig4 . otherwise , the logic moves to block 130 to find the number of good pages that have been found at the web site of the web page under test , and at decision diamond 132 it is determined whether many ( e . g ., ⅔ of site pages tested ) of the pages at the site have been evaluated as being “ good ”. if the test is positive at decision diamond 132 , the logic moves fig4 to “ expand ” the page as described ; otherwise , the logic moves to fig4 to prune the page under test . fig6 shows the details of relaxing the match criteria step at block 124 of fig5 . at block 134 in fig6 the page under test is classified as described , and then at block 136 the least common ancestor of the page classification with respect to the desired classification ( i . e ., predefined topic ) is found . for example , suppose the desired topic is “ database mining ” and the page under test includes a classification “ database generation ”. the least common ancestor ( lca ) topic contained in the page under test in this example is “ database ”. moving to decision diamond 138 , it is determined whether it is feasible to consider web pages as being “ good ” if they match the lca . that is , at decision diamond 138 it is determined whether relaxing , ( i . e ., expanding , the topic definition against which web pages are tested ) would result in an excessively high number of pages being classified as “ good ” and , thus , would result in a loss of focus in the database 30 . the currently preferred way to make this determination is to estimate a size of the set of web pages satisfying the expanded topic definition , and then relaxing the topic definition when the estimated size is at or below a size threshold . this estimating can be done by undertaking a search on the lca using a conventional comprehensive search engine such as yahoo ® and comparing the number of returned documents to a threshold . the threshold itself can vary depending on the processing power of the system 10 and the time available to build the database 30 . when the decision at diamond 138 is positive and the web page classification is sufficiently close to the lca , the web page is expanded at block 140 ; otherwise , it is pruned at block 142 . while the particular system and method for focussed web crawling as herein shown and described in detail is fully capable of attaining the above - described objects of the invention , it is to be understood that it is the presently preferred embodiment of the present invention and is thus representative of the subject matter which is broadly contemplated by the present invention , that the scope of the present invention fully encompasses other embodiments which may become obvious to those skilled in the art , and that the scope of the present invention is accordingly to be limited by nothing other than the appended claims .	8
fig1 illustrates an in - sink dishwasher 10 mounted in a traditional cabinet fixture 12 having doors 14 providing access to the cabinet interior where the lower portion of the in - sink dishwasher 10 is located . the in sink dishwasher 10 is illustrated in the environment of a double - bowl sink 16 comprising a first bowl 18 and a second bowl 20 , with each bowl having a bottom wall 25 and a peripheral side wall 19 , 27 , respectively . the first bowl 18 performs the function of a traditional sink bowl and includes a drain opening 21 . the second bowl 20 performs the dual function of a traditional sink bowl while also forming a portion of the housing for the in - sink dishwasher . the first and second bowls 18 , 20 are spaced from each other to define an intervening flange portion 22 that intersects a peripheral flange 24 surrounding both of the bowls 18 , 20 . preferably , the double - bowl sink is made from stainless steel . a traditional water faucet 28 is located in the peripheral flange 24 of the double - bowl sink and provides water to either of the first and second bowls 18 , 20 . referring to fig1 and 2 , the in - sink dishwasher 10 comprises a wash chamber 30 that is defined by the second bowl 18 , which has an open top . a lid 32 is hingedly mounted to the peripheral flange 24 of the double - bowl sink 16 and is movable between an opened position as shown in fig1 and a closed position as shown in fig2 . a drain 34 along with a water inlet 36 are provided in the bottom of the second bowl 20 and provide for the draining and introduction of water from and into the wash chamber 30 . the drain 34 serves as a drain during the use of the bowl 20 as a traditional sink and when used as a wash chamber 30 for the in - sink dishwasher 10 . fig3 schematically illustrates the major components of the in - sink dishwasher 10 , which include a rack 40 comprised of multiple wire segments for holding various dishes and utensils . the exact shape and configuration of the rack 40 is not germane to the invention and is preferably made similar to those found in automatic dishwashers . a spray arm 42 is preferably mounted to the bottom of the rack 40 such that the spray arm is free to rotate relative to the rack 40 and is removed from the wash chamber when the rack is removed . the spray arm 42 couples with the water inlet 36 when the rack 40 is positioned within the second bowl 20 . the drain 34 has one outlet that is fluidly coupled to an in - line water heater 44 . the output of the water heater 44 is received as input to a recirculation pump 46 , whose output is sent to a valve 48 forming part of the water inlet 36 . the drain 34 , water inlet 36 , in - line water heater 44 , recirculation pump 46 , valve 48 , and spray arm 42 collectively form a recirculation system for recirculating wash liquid throughout the wash chamber 30 . the drain 34 has another outlet that is fluidly connected to a drain pump 52 . the output of the drain pump 52 is fluidly connected to the traditional drain line for the second bowl 20 . the drain pump 52 provides for a positive draining of liquid from the wash chamber 30 , such as , for example , when it is no longer desire to recirculate the wash liquid with the recirculation system . a controller 54 , preferably a microprocessor - based controller , is electronically coupled to the in - line heater 44 , recirculation pump 46 , and drain pump 52 to control their respective operation . if the valve 48 is an actuated valve , such as a solenoid - actuated valve , instead of a check valve , then the controller 54 can also be connected to the valve 48 and control its operation . the controller 54 operates the in - line heater 44 , recirculation pump 46 , and drain pump 52 to implement a wash cycle . preferably , the wash cycle is one of many well - known wash cycles stored in the memory of the microprocessor . a user interface 58 is located adjacent the second bowl 20 and is electronically coupled to the controller 54 . the user interface 58 permits the user to select the desired wash cycle from the multiple wash cycles stored in the memory of the microprocessor and enter any necessary or optional operating data or parameters for the wash cycles . referring to fig4 the top of the lid is shown in greater detail and comprises an upper surface 62 having a generally planar contour and in which is formed a recess 64 . the recess has an outer periphery 65 that is substantially rectangular and extends laterally across the upper surface 62 . preferably , the recess does not extend all the way to the peripheral edge of the lid . a series of longitudinally extending projections or ribs 66 are located in the recess 64 and effectively divide the recess 64 into multiple or sub - recesses 68 . the ribs 66 are preferably of a height such that they do not extend beyond the plane defined by the upper surface 62 . referring to fig2 and 5 , a cutting board 70 can be positioned on the lid 32 when the lid is in the closed position . the cutting board is preferably sized such that at least a portion 71 of the cutting board spans the space between the first and second bowls . preferably the distal edge of the cutting board terminates at the first bowl and does not substantially overlie the first bowl . the cutting board is preferably made from wood . however , the material of the cutting board is not germane to the invention . other suitable materials such as plastic and stone can also be used for the cutting board . referring to fig5 the cutting board 70 comprises a lower surface 72 having a generally planar contour and from which extends a projection 74 whose outer periphery 75 is complementary to the outer periphery 65 of the lid recess 64 . multiple longitudinal grooves 76 are formed in the projection 74 to effectively sub - divide the projection 74 into multiple projections or sub - projections 78 . preferably , the grooves 76 are located in the projection 74 such that they correspond to the same relative location as the ribs 66 in the recess 64 , resulting in each of the sub - projections 78 having a generally longitudinal shape that corresponds and is complementary to one of the sub - recesses 68 . the cutting board further includes a portion 82 that overlies the flange 22 separating the bowls 18 , 20 when the cutting board is mounted to the lid . the portion 82 preferably terminates in an edge 84 that aligns with the peripheral side wall 19 when the cutting board is mounted to the lid . while it is within the scope of the invention for the cutting board to be of a length such that the edge 84 of the portion 82 is suspended over the bowl 18 , it is preferred that the edge 84 terminates at the plane of the side wall to maximize the usable area of the bowl 18 . referring to fig6 and 7 , the projection 74 of the cutting board and the recess 64 of the lid collectively form a releasable coupling 80 that secures the cutting board 70 to the lid 32 to limit the relative movement between the cutting board 70 and lid 32 . the nesting or mating of the projection 74 within the recess 64 results in the corresponding peripheral edges 65 , 75 , respectively , interacting to limit the movement of the cutting board relative to the lid in two dimensions defined by the arrows a and b in fig2 . arrow b corresponds to the most common direction that a user of the cutting board will apply a force to the cutting board . the receipt of the ribs 66 within the grooves also interact to provide an additional structure that limits the relative movement of the cutting board in the direction of the arrow b . to mount the cutting board 70 to the lid 32 , the cutting board is oriented such that the lower surface 72 of the cutting board 70 faces towards upper surface 62 of the lid 32 and aligns the cutting board 70 such that the projection 74 extending from the lower surface of the cutting board 70 is received within the recess 64 on the upper surface 62 of the lid 32 . since the grooves 76 and the projection 74 of the cutting board 70 are spaced such that they correspond to the ribs 66 within the recess 64 of the lid 32 , the ribs 66 will be received within the grooves 76 when the cutting board is nested or mated with the lid . the complementary grooves 76 and ribs 66 will also locate and align the cutting board 70 relative to the lid 32 . it is preferred , but not necessary , that the grooves 76 extend all the way across the projection 74 in contrast to the ribs 66 that do not extend all way across the recess 64 . the extra length associated with the grooves 76 will aid the user in laterally aligning the projection 74 of the cutting board with respect to the recess 64 and the lid 32 . as is seen in fig6 and 7 , when the cutting board 70 is nested or mated with the recess 64 of the lid 32 , the ribs 66 of the lid 32 are received within the grooves 76 such that the apex of the ribs 66 are closely adjacent to or touch the bottom of the corresponding grooves 76 . also , the peripheral edge of the projection 74 is closely adjacent to or in abutting relationship with the peripheral edge of the recess 64 . the close relationship or abutting contact between peripheral edges 65 , 75 of the projection and recess along and in combination with the close relationship or abutting contact between the ribs and the corresponding grooves defined a releasable coupling that limits the relative movement of the cutting board in the plane of the upper surface of the lid . while it is preferred to use both the peripheral edges of the projection and recess and the complementary ribs and grooves to form the releasable coupling , it is not necessary to use both . while it is preferred that there be little gap between the peripheral edges 65 , 75 when the projection 74 is inserted with the recess 64 to thereby minimize the amount of “ play ” or limited relative movement between the cutting board 70 and the lid 32 , it is not necessary to prevent all relative movement . other types of releasable coupling can also be used to limit the relative movement of the cutting board and the lid . for example , the cutting board could be provided with a series of point - like discrete projections , such as a stud , in combination with a corresponding opening , instead of the ribs and grooves . fig8 - 10 illustrate a second embodiment of a cutting board connected to the lid by a releasable coupling according to the invention . the second embodiment comprises a cutting board 90 having a planar lower surface 92 , which does not include a projection like the first embodiment . instead , multiple feet 94 are located on the lower surface 92 of the cutting board 90 . preferably , there are four feet , with each foot being located corresponding to a corner of the recess 64 , although more or less feet can be used . the feet 94 are can made from rubber and have a frusto - conical shape with a lower end 96 and upper end 98 , which are connected by a tapered peripheral side wall 100 . the angle of the taper is preferably complementary to the angle of the bevel 65 of the recess 64 so that the peripheral side wall 100 contacts the bevel 65 for most of its length . the lower end 96 is countersunk to define a shoulder 102 and an fastener opening 104 . a fastener , such as screw 106 , mounts the foot to the cutting board . the head of the screw 106 abuts the shoulder 102 and the threaded end of the screw extends through the fastener opening 104 and is threaded into the cutting board through the lower surface 92 . when the cutting board 90 with the feet 94 is coupled to the lid 32 , the feet 94 are located at each corner of the recess 64 . the peripheral side wall 100 of each foot preferably contacts the corresponding portion of the bevel 65 . the multi - point contact with the bevel 65 prevents the cutting board from being moved laterally . the feet 94 and the corresponding portion of the bevel 65 of the recess 64 form a releasable coupling . the feet preferably have height such that the lower surface 92 of the cutting board 92 just makes contact with , or is slightly above , the upper surface of the lid 32 and the lower end 96 of the feet contact the bottom of the recess 64 . the contact of the bottom of the recess 64 by the feet provides another interference coupling , in the form of a frictional interference , between the feet 94 and the lid 32 to retard the lateral movement of the cutting board and lid . while the invention has been specifically described in connection with certain specific embodiments thereof , it is to be understood that this is by way of illustration and not of limitation , and the scope of the appended claims should be construed as broadly as the prior art will permit . for example , although the preferred sink configuration is a double - bowl sink , the in - sink dishwasher can also be used in a single - bowl sink .	0
in fig1 , the pressure chamber device as a whole is denoted by reference numeral 1 . the device 1 comprises a pressure chamber 2 , which is in this case formed by a pressure vessel and is provided with an opening , which can be closed by a cover 3 , for mounting an electric motor 7 with pump 9 in the pressure vessel . there is also a pipe system 5 with a feed 5 a and a discharge 5 b . an electric motor 7 is disposed in the pressure chamber 2 . a pump 9 is mounted on the motor output shaft 8 of the electric motor 7 . the pump 9 , which is formed for example by a centrifugal pump with an impellor , is in this case mounted directly on the motor shaft 8 . the pump 9 is accommodated in a pump casing 10 which comprises an inlet 11 and an outlet 12 . the outlet 12 is connected to the discharge 5 b . the pressure chamber device shown may be incorporated as a second pressure chamber in a high - pressure circuit with a first pressure chamber for treating a substrate . the electric motor 7 , which is shown in more detail in fig2 and 3 , comprises motor windings 20 which are insulated by an insulation material that is able to withstand a treatment medium that is specifically to be used , comprising co 2 , n 2 o , lower alkanes , such as ethane and propane , or mixtures thereof . the insulation material preferably consists of polyester . tests have shown that this is an eminently satisfactory material . other materials , such as kapton or nomex , are also possible . furthermore , the electric motor 7 comprises bearings 21 for the motor output shaft 8 . the bearings 21 are of the lubrication - free type , i . e . no greases or oils are required for the bearings to function correctly . the bearings 21 may comprise ceramic balls or a peek or bronze ball cage . it is advantageous for the bearings 21 to comprise a self - lubricating contact layer , for example in a groove in the bearings . the self - lubricating contact layer is preferably formed by a carbon - nitride layer . it has been found that such a material is well able to withstand the treatment medium ( in particular supercritical co 2 ), while sufficient lubrication of the bearings 21 is also achieved . the bearings 21 are mounted in bearing blocks 23 , which also form a type of covers for a motor casing 24 surrounding the electric motor 7 . the bearing blocks 23 are made from a corrosion - resistant material , for example stainless steel or anodized aluminium . through - flow openings 26 ( cf . fig3 ) are provided in the bearing blocks 23 of the motor casing 24 . this means that the electric motor 7 is of an open type and the treatment medium is free to circulate through the interior of the electric motor 7 . this ensures successful cooling of the motor windings 20 and has the advantage that the motor casing 24 can be of more lightweight design , since the pressure inside the motor casing 24 is substantially equal to the pressure outside it . furthermore , there is no need for any cooling fins , on account of the thermal properties of the treatment medium , and the motor shaft does not have to be passed through the motor casing 24 in such a manner as to be sealed with respect to the treatment medium at the supercritical process pressure . the electric motor 7 is supplied with power via an electrical connection 27 , which is provided with insulation material that is able to withstand the treatment medium , for example nomex , aramid paper , kapton , polyester film and / or yarns . the electrical passage of the connection 27 through the wall of the pressure chamber 2 is provided with a tensile stress reliever which is able to withstand the treatment medium , for example a buna - n ring or potting resin . during operation , treatment medium is fed to the pressure chamber 2 via the feed 5 a , and the electric motor 7 with the pump 9 is set in operation . some of the treatment medium flows freely through the motor casing 24 , where it has a cooling action , is sucked in by the pump 9 via the inlet 11 and is pumped by the mechanical action of the pump 9 to the outlet 12 or discharge 5 b , leaves the pressure vessel 2 and enters another ( first ) pressure chamber ( not shown ), where the pieces of substrate are located , where it carries out a treatment on the pieces of substrate . after it has left the first pressure chamber , the treatment medium is fed back to the feed 5 a , via an associated pipe . after the treatment medium which is circulating in this way has been able to act on the pieces of substrate for a desired time , the electric motor is stopped and the treatment medium is discharged from the system until the system is at ambient pressure , and then the treated pieces of substrate can be removed from the first pressure chamber again . the pressure across the pump casing 10 in which , for example , an impellor of the pump is rotating is at most equal to the boost pressure provided by the pump 9 , and is therefore advantageously only a few bar , while the treatment medium in the pressure chamber 2 may be at a high pressure . fig4 shows a variant , in which identical components are denoted by the same reference numerals . the pressure chamber 2 is now provided with a feed 30 which is connected to an inlet 31 of the pump casing 10 . there is also a discharge 32 which is in direct , open communication with the pressure chamber 2 . furthermore , through - flow openings 33 are now provided in the peripheral wall of the motor casing of the electric motor 7 . during operation , the treatment medium flows via the feed 30 and the inlet 31 into the pump casing 10 and from there flows partly through the electric motor 7 and partly around it into the pressure chamber 2 and then back out via the discharge 32 . fig5 shows an application in which an electric motor 40 and a drum 41 driven by it are positioned together in the same pressure chamber 42 . treatment medium can be fed to and discharged from the pressure chamber 42 ( pipes not shown ). the electric motor 40 is provided with through - flow openings 44 , while the abovementioned measures according to the invention are preferably once again taken for the motor windings and the bearings used . the pressure chamber 42 is provided with a cover 43 which can be opened in order for pieces of substrate that are to be treated to be put into and taken out of the drum 41 . the drum 41 can be used both for washing and for dyeing . fig6 shows a cylindrical pressure vessel 50 which is provided at both ends with feed openings which can be closed off by covers 51 , 51 a and 51 b . both the pressure chamber for the electric motor with actuator and the pressure chamber for the pieces of substrate are integrated in this pressure vessel 50 . the cover 51 a can be opened in order for a rolled - up piece of textile substrate 53 to be introduced into the pressure chamber on a perforated tube 52 . the cover 51 b is provided with a feed 55 and a discharge 56 for treatment medium . a pump casing 58 , in which an electric motor 59 and a vane pump 60 are jointly accommodated , is directly connected to the feed 55 . the pump casing 58 holding the electric motor 59 and the vane pump 60 can be mounted in the pressure vessel 50 when the cover 51 b is open . the vane pump 60 is advantageously disposed upstream of the electric motor 59 , which contributes to better flow of the treatment medium past and if desired through the electric motor 59 , resulting in better cooling . from the pump casing 58 , the treatment medium can flow via an outlet 62 into the tube 52 and from there , via the holes , through the substrate 53 that is to be treated , performing its treating action on the substrate . finally , the treatment medium can leave the pressure chamber 50 again via the discharge 56 . on account of the fact that the treatment medium has been laden with dye outside the pressure chamber 50 , it is in this way possible to dye the textile substrate . the pressure drop across the textile substrate is approximately 1 bar . in a preferred use , the treatment medium is supplied to the pressure chamber of the above - described devices at a pressure and temperature which are such that the treatment medium is in a supercritical or near - supercritical state . the entire pressure chamber , including the “ open ” electric motor , is then at the pressure and under the influence of the supercritical or near - supercritical treatment medium . surprisingly , it has been found that this does not present any problems , in particular if the motor windings are insulated with insulation material that is able to withstand the treatment medium and if the bearing is of a lubrication - free type . for co 2 as treatment medium , the supercritical state is reached at a pressure of at least 73 bar and a temperature of at least 31 degrees . in a variant , the treatment medium is supplied to the pressure chamber of the above - described devices at a pressure and temperature which are such that the treatment medium is at least partially in a liquid phase . the “ open ” electric motor is then preferably submerged in the liquid treatment medium . surprisingly , this too has been found not to present any problems , in particular if the motor windings are insulated with insulation material that is able to withstand the treatment medium and if the bearing is of a lubrication - free type . in addition to the embodiments shown , numerous variants are possible . for example , it is also possible for other types of actuators in addition to the pump and the drum to be used to move the substrate and the medium with respect to one another , for example a propeller , an agitator or a stirring mechanism . in addition to washing or dyeing pieces of a textile substrate , the device can advantageously also be used to treat other types of substrate or to treat a substrate in another way , for example clean or degrease it . examples of articles which can also be suitably treated using the device and the use according to the invention include fabrics , such as woven and nonwoven fabrics formed from materials such as cotton , wool , silk , leather , rayon , polyester , acetate , glass fibre , fur , etc . these fabrics may be formed into pieces , such as clothing , work gloves , cloths , leather goods ( for example handbags and briefcases ), etc . the present device and the use can also be used to treat , in particular wash , clean or degrease , other items , such as semiconductors , micro - electromechanical systems , opto - electronics , fibre optics and machined or cast metal components . it is also possible to treat foodstuffs and contaminated soil using the device and the use according to the invention . therefore , the invention provides a user - friendly , efficient device which allows an electric motor that can be of simple and inexpensive design to be positioned within the sphere of influence of a specific , aggressive type of treatment medium under various conditions of use in a pressure chamber .	3
for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . referring to fig1 and 2 , there is illustrated a chart and file holder 20 which includes a support panel 21 , curved clip 22 , stiffening rib 23 , generally rectangular open area 24 and mounting holes 25 . the support panel is a generally rectangular , substantially flat , integral member whose outer edge 29 is slightly thicker than the center panel portion 30 between edge 29 and rib 23 in order to provide strength and rigidity to the holder . the curved clip is injection molded integral with the panel . in the forming and molding process , the clip 22 is joined along its bottom edge to the remainder of the panel coincident with the lower edge of open area 24 ( see fig2 and 3 ). the clip 22 is shaped and curved , the contour of which is best illustrated by the side elevational view of fig3 . rib 23 is spaced very slightly from the edges of open area 24 except for the lower edge of area 24 which is integral and coincident with the attaching edge of clip 22 . rib 23 does not extend along the lower edge of the open area . although there are a number of raised features on the front surface of support panel 21 , the rear or back surface is substantially flat thereby enabling the holder to be mounted to any substantially flat surface such a : a wall or door , as is illustrated in fig4 . the four mountie holes 25 are provided exclusively for such mountings , though it is also envisioned that the holder will be mounted using double - sided adhesive tape . a further mounting option is & amp ; o apply to the rear surface an adhesive - backed magnetic strip . once the adhesive side is applied to the rear surface of the holder , the holder is then able to be mounted lo any magnetic - attractive metal surface . as illustrated in fig3 curved clip 22 is of a substantially uniform thickness and is configured with three sections 34 , 34a and 34b . section 34 curves outwardly and upwardly from bottom ; edge 31 and is configured with a smoothly curved concave inner surface 36 and convex outer surface 37 . section 34a is a substantially flat portion extending inwardly and upwardly from section 34 and ending at inside corner 39 . the top section 34b which is substantially flat extends outwardly and upwardly from corner 39 to top edge 38 . outside corner ( edge ) 40 provides a pressure point for clip 22 which presses against any article placed in holder 20 . it is the shape of clip 22 which provides both an open cavity 41 to receive files and charts , a lower support surface via surface 36 and a pressure point via edge 40 . the outwardly flared top edge 38 is spaced slightly from support panel 21 and thereby creates a channel 42 which opens upwardly and is the point of initial entry of any chart or file placed in holder 20 . in the exemplary embodiment , the plane of edge 40 extends slightly into open area 24 and is thus substantially coincident with the plane of the support panel , though this configuration can be varied by the molding process . the farther edge 40 extends toward or into the plane of support panel 21 the greater the spring tension on articles placed in the holder by the clip . the inherent spring tension which is molded into the clip and its attachment to panel 21 provides flexibility and allows edge 40 to pivot outwardly . as is illustrated in fig4 holder 20 may be mounted on a door 46 and files placed in the holder . in the illustrated example , the file is somewhat longer than the width of the holder and thus the ends of the file extend beyond both sides of clip 22 . file 47 is arranged laterally for better balance and although the clip 22 is wide , its width is substantially less than the length of the files thus allowing the outer edges of the files to remain accessible and easily grasped in order to remove the file , chart , computer printout or the like from the holder . clip 22 presses against file 47 causing the outer edges to flex forward for easier grasping . referring to fig5 and 6 , there is illustrated another holder according to the present invention . holder 60 includes support panel 61 , curved clip 62 , stiffening rib 63 , open area 64 and support holes 65a - 65f . holes 65a - 65f are arranged into two groups or patterns . the first group includes the top two holes 65a and 65b . these holes are used if the holder 60 is mounted to a flat surface such as a vertical wall or door . if holder 60 is to be used on a table or countertop , then holes 65c , 65d , 65e and 65f are used to attach snap - on legs 66 and 67 ( see fig6 and 7 ). one or more of the holes 65c - 65f may also be used with holes 65a and 65b when holder is 60 is mounted to a wall or door . holes 65a and 65b are configured with a keyhole shape and while the other four holes have this same shape in part , these other four holes also include a lateral slot 71 as illustrated in the detail of fig5 a . it is to be understood that holder 60 is virtually identical to holder 20 as to the general shape and configuration , including the shape of the curved clip 62 . the most significant differences between the two holders include the snap - on legs as a mounting option , side panels 72 and 73 and a series of ridges 74 disposed at the base 75 of the clip where it is joined to and integral with the support panel 61 . support panel 61 is generally rectangular and substantially flat and is integrally molded with clip 62 and with tapered and curved side panels 72 and 73 . stiffening ribs 63 surrounds the three sides of open area 64 and provides strength and rigidity to the support panel 61 . side panels 72 and 73 each extend from a point slightly below the top edge 78 of panel 61 and flare downwardly and outwardly to a convex outer curved portion that generally coincides with the shape of the lower part of clip 62 . clip 62 includes a lower curved portion 79 which has a concave inner surface 80 which in combination with the outer or front surface of panel 61 defines a receiving cavity 81 . extending between inside corner 83 and portion 79 is a substantially flat portion 79a . extending between inside corner 83 and outer , upper edge 82 is substantially flat lip 86 which includes outer surface 84 and inner surface 85 . the corner or edge opposite to corner 83 provides the pressure point for clip 62 . the outwardly flared nature of lip 86 provides channel 87 which is the initial point of entry for printed literature which is placed in holder 60 . fig6 is a perspective view of holder 60 as viewed from the left side and fig7 is a side elevational view taken from the right side . these two views are important in order to adequately and completely illustrate the nature of side panels 72 and 73 and to show the nature and attachment of snap - on legs 66 and 67 . as is intended to be illustrated , legs 66 and 67 each include a pair of aligned buttons 68 with enlarged heads 68a which are sized and spaced to fit into holes 65c - 65f . as is intended to be illustrated and described , the stem of the buttons on legs 66 and 67 are of a smaller size such that the enlarged head of each button must be first placed in the large circular opening 71a of each hole and as pushed into position the stem of each button aligns with the lateral slot 71 allowing the stem of the button to be received in the slot and the head of the button extending over and beyond the slot edges so as to function as a locking means . leg 66 is attached via holes 65c and 65e and leg 67 is attached by hole 65d and 65f . once the buttons are fitted into their respective holes and slide laterally into corresponding slots 71 , the legs are locked to the back surface of support panel 61 . one function of side panels 72 and 73 is to provide lateral support and control of whatever printed literature may be placed in the holder . these particular side panels are spaced so as to be substantially parallel to each other and are set at a width which is only slightly greater than the width of the printed material which the holder receives . although larger holders can support any size material which is smaller than the lateral spacing in the side wall , the most attractive appearance and use of holder 60 is to have the width between side panels substantially the same as , though slightly larger , the width of the material received therein . another function provided by the two side panels is a way to interlock adjacent holders together . the outer surface of side panel 72 includes a recessed area 91 which tapers slightly from the front of the area to the rear . a matching and complementary raised boss 92 is disposed on the outer surface of side panel 73 . the raised boss 92 tapers slightly from the front to the rear and its size and shape match the recessed area 91 such that adjacently disposed holders can be interlocked by locking the raised boss of one holder into the recessed area of the adjacent holder . in order to enhance the interlocking configuration , the recessed area and the raised boss are formed with angled and cut top and bottom edges similar to what would be described as a dovetail fit . although the present invention has been generally described as having a selective or predetermined spacing between the side panels , it is anticipated that standard sizes will accommodate most of the printed literature which may be disposed in holders such as this . a full - size holder will typically be used for full - size material such as that material having an approximate 81 / 2 inch width . since the 81 / 2 inch width generally coincides with regular size letters , stationery and brochures , it is anticipated that this size will accommodate a wide range of publications . for placement of such items as pamphlets and folded brochures in the holder , these particular items are typically half - sized with a width in the range of 4 to 41 / 4 inches . consequently , another standard size for holder 60 will be one which has a spacing between side panels 72 and 73 set slightly larger than the 41 / 4 inch anticipated width . if the full - size and half - size holders are designed with a 2 : 1 size relationship , then it will be possible to create a mixture of both full size and half - size holders all interlocked together in a wide variety of arrangements , one of which is illustrated in fig8 . the point to be stressed though is that one full size holder can be replaced by two half - sized holders due to their uniformity of a 2 : 1 size relationship . consequently , it is important that the recessed area 91 and raised boss 92 of every holder regardless of whether it is full - sized or half - sized be maintained the same so that full - size and half - size holders can interlock with each other . also illustrated in fig8 is another feature of the present invention wherein the top edge of the support panel is configured with two raised portions 95 . the bottom edge of the support panel includes an aligned pair of recessed portions 96 . this particular pattern allows holders to be aligned with one another in a top - to - bottom stack and although the nature of these raised and recessed portions does not provide the same dovetail interlock as was available with the side panels , it does enable a tight engagement and a self - aligning feature so that a series of holders can be arranged to cover some portion of a wall or door . the interlocking feature of the side panels can also be used when the holders are supported by the legs on a horizontal surface , though in that particular configuration it is not anticipated that the alternating raised and recessed portions along the top and bottom edges will be utilized . the combination of interlocked holders diagrammatically illustrated in fig8 includes two full - size holders 60 which are interlocked side by side and four half - size holders 97 which are interlocked side by side and the two groups are engaged by means of their top and bottom edges . the features of the holders has been eliminated for drawing clarity since the role of fig8 is to show only the edge - to - edge engagements . in use , the clip 62 puts a slight arch in the printed material which is placed within the holder and this arch serves to support the material and have it remain upright . the arch does not allow the material to slide down and the bottom edge curl upwardly . another feature which aids in the retention of literature in an upright fashion are the ridges 74 in the base of the clip . the bottom edges of the material which is placed in the holder will contact and abut these ridges and the material is precluded from drooping or curling . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .	8
following are more detailed description , in combination with the experimental results , of the abovementioned and other technical characteristics and advantages of this invention . fucoxanthin is extracted from a group of following algae : kelp , gulfweed , bladder - wrack , myosoton aquaticum , podocystis , chorda filum , undaria pinnatifida , bull - kelp , carrageen , sargassum kjellmanianum , saltwort , sargassum pallidum and diatom . the pharmaceutically acceptable excipients include any solvent , dispersion medium , coating material , sweetener , etc . said adjuvants specifically include but are not restricted within the following a group of substances : diluting liquids , adhesives , lubricants , dispersants , colorants , expanders , flavoring materials , sweeteners and other composite materials normally used for specific therapy , such as buffering agents and adsorbents . the said adjuvants are added into the composition using the conventional techniques in this field . the composition stated in this invention can be prepared as any kind of common preparation , such as tablets , capsules , medicinal granules , oral liquids , suspensions and emulsion . preferably , it can be prepared as hard - and soft capsules , medicinal granules and oral liquids . in this invention , appropriate ethanol water solution can be used to extract sea algae to obtain fucoxanthin extract , by adsorption of the fucoxanthins onto a separation medium , eluting with appropriate solvent , and subsequent concentration of the eluant , red fucoxanthin extract can be obtained . specific preparation method can be referred to the chinese patent application no . cn200810226391 . 3 ( a method for the purification of fucoxanthin ). after adding emulsifier , fucoxanthin thus obtained is emulsified uniformly , fucoidan and denaturated starch are subsequently added , stirred up , the mixture is spray dried . the spray dried powder is added with appropriate pharmaceutically accepted adjuvants , to prepare preparations for intestinal tract , including oral liquids , tablets , soft - and hard capsules and drop pills etc . by mixing fucoxanthin and tocotrienols evenly , added with edible oil or median chain triglyceride oil , it is also possible to produce soft capsules , or the mixture can be emulsified into oil - in - water emulsion , and then added denaturated starch with stirred up , and subsequently spray dried . the spray dried powder is added with appropriate pharmaceutically accepted adjuvants to prepare preparations for intestinal tract , including oral liquids , tablets , soft - and hard capsules and drop pills etc . the preparations may also be made by mixing fucoxanthin and tocotrienols evenly , the mixture is added with fucoidan and denaturated starch , stirred up , and subsequently spray dried . the spray dried powder is added with appropriate pharmaceutically accepted adjuvants to prepare preparations for intestinal tract , including oral liquids , tablets , soft - and hard capsules and drop pills etc . the preparations may also be made by mixing tween80 and peg 400 , stirred up thoroughly , the mixture is then added with vegetable oil or median chain triglyceride oil , and subsequently with fucoxanthin , tocotrienols , fucoidan and appropriate amount of thickener such as sodium carboxymethylcellulose , acacia gum and agar . the mixture is stirred up thoroughly and is then homogenized using a colloid mill or homogenizer . subsequently , soft capsules can be produced by using glutin and glycerol as capsule shell material according to the manufacture method of soft capsules . the preparations may also be made by dissolving fucoxanthin with organic solvents . the solution is added with an organic solution containing tocotrienols , subsequently fucoidan water solution and appropriate emulsifier , such as tween or span and denaturated starch water solution etc . the mixture is concentrated to a certain degree under reduced pressure and spray dried . the dried powder is added with silica and talcum powder , stirred up and milled thoroughly . this powder can be made into common preparations such as water - soluble beverages , medicinal granules and capsules according to the common procedures . following are further descriptions of this invention by examples . it should be understood that these examples are intended to exemplify the invention , not to restrict the protection range of this invention . test substances : formulations are prepared according to the ratios shown in table 4 formulations for feeding animals : high - fat feed is composed of 80 % basic feed , 10 % lard and 10 % yolk powder . grouping and treatment of the test animals : 80 grown - up male healthy sd clean grade rats ( body weight 180 - 210 g ) are adaptively fed with basic feed for a week , 10 are used as basic feed control , the rest are fed with high - fat feed . a month later , the group of rats fed with high - fat feed is randomly grouped into 7 groups according to their weights , 10 in each group : model control , fucoxanthin ( a ), tocotrienols ( b ), fucoidan ( c ), composition a + b + c , composition a + b and composition a + c . the group of basic feed keeps on feeding with basic feed , the rest groups are fed with high - fat feeds . the groups of basic feed and model control are intragastrically administrated with distilled water , the rest groups are intragastrically administrated with tested medicines , all administrated for 30 d . the groups of animals are raised in different cages in rooms with the temperature conditioned at ( 22 ± 2 ) ° c . and under natural illumination . the rats take food and water freely . each week , their body weights are measured and the amounts of food they take are observed and recorded . they are weighted after feeding for 30 d . statistical analysis : the variance from the data collected in this experiment is analyzed with sas package , dunnett &# 39 ; s t test is used to compare statistically the results from different groups , the results of p & lt ; 0 . 05 is decided as statistically significant . the results : according to the experimental results , the food - intake of the groups of rats did not change with the time they were administrated with medicines , thus no statistical significance is detected and this is no longer depicted later on . from table 5 it can be seen that when the experiment finished , the difference in weights of the animals in model control was statistically significant ( p & lt ; 0 . 05 ), this means that the modeling of rat obesity promotion model was successful . at the same time , weights of rats in a + b + c , a + b , a + c groups decreased further and differed from the model control ( p & lt ; 0 . 05 , p & lt ; 0 . 01 ), this means that the composition containing fucoxanthin ( a ) had weight reducing effect on obese rats , and the weight reducing effects of composition a + b + c , a + b , a + c were more significant than fucoxanthin ( a ) alone ( p & lt ; 0 . 01 ). the procedure was the same as in example 4 . the formulation is shown in table 6 . after feeding for 30 d and weighing , executing all the rats , the abdomen fat was peeled off and weighed accurately . statistical analysis was carried out as in example 4 the results : from table 7 it can be seen that body weights , weights of abdomen fat as well as the ratios of abdomen fat weight / body weight of the animals in model control groups were statistically significant ( p & lt ; 0 . 05 ) in comparison with the group fed with basic feed , this means that the modeling of rat obesity promotion model was successful . in the meantime , body weights , weights of abdomen fat as well as the ratios of abdomen fat weight / body weight of rats in a + b + c , a + b , a + c and a groups decreased further ( p & lt ; 0 . 05 ) and differed from the model control , this means that the composition containing fucoxanthin ( a ) had weight reducing effect on obese rats , and the weight reducing effects of composition a + b + c , a + c , a + b were more significant than fucoxanthin ( a ) alone . the procedure was the same as in example 4 . the formulation is shown in table 8 . after feeding for 30 days and weighing , executing all the rats , the fat pads around the testicles were peeled off and weighed accurately . statistical analysis was carried out as in example 4 . the results : from table 9 it can be seen that body weights , the ratios of fat pad weights around testicles / body weight of the animals in model control groups were statistically significant ( p & lt ; 0 . 05 ) in comparison with the group fed with basic feed , this means that the modeling of rat obesity promotion model was successful . at the same time , body weights , the fat pad weights around the testicles as well as the ratio of fat pad weight around the testicles / body weight of rats in a + b + c , a + b , a + c and a groups decreased ( p & lt ; 0 . 05 ) and differed from the model control , this means that the composition containing fucoxanthin ( a ) had weight reducing effect on obese rats , and the weight reducing effects of the composition were more significant than fucoxanthin ( a ) alone . the procedure was the same as in example 4 . the formulation is shown in table 10 . after feeding for 30 d and weighing , executing all the rats , the fat pads around the kidneys were taken out and weighed accurately . statistical analysis was carried out as in example 4 . the results : from table 11 it can be seen that body weights , the fat pad weights around the kidneys as well as the ratios of fat pad weights around the kidneys / body weight of the animals in model control groups were statistically significant ( p & lt ; 0 . 05 ) in comparison with the group fed with basic feed , this means that the modeling of rat obesity promotion model was successful . at the same time , body weights , the fat pad weights around the kidneys as well as the ratio of fat pad weight around the kidneys / body weight of rats in a + b + c , a + c , a + b and a groups decreased ( p & lt ; 0 . 05 ) and differed from the model control , this means that the composition containing fucoxanthin ( a ) had weight reducing effect on obese rats , and the weight reducing effects of the composition were more significant than fucoxanthin ( a ) alone . to examine the weight reducing effect of fucoxanthin composition by means of random control method , 20 eligible test subjects of the age of 20 to 50 were divided into 5 groups , a + b + c , a + c , a + b , a , b + c , with random figure table method . the number of the subjects in each group was n = 4 . the daily doses of the medicines taken by the subjects were according to table 12 . apart from being administrated with each of the different tested medicines at the breakfast time according to the set way of taking the medicine , other normal life style and dietetic habit of the subjects were not changed . no low - calorie food recipe was required , no restriction to the food and drink was executed and no extra physical training was carried out . to examining the effect of sampling of the medicine , the subjects were respectively examined before sampling of the medicine and 1 month , 2 and 3 months after the sampling . that is , the bodyweight , waist - and hiplines , blood sugar and blood fat were measured , abdomen ct scanning was carried out and so on . the subjects were periodically followed - up to find out the experiences and to supervise and guarantee compliance of the customers in taking the medicine . for the test , those suffered from serious metabolic diseases that need medicinal control and those taken other weight reducing products had been excluded . instrument : ct model pronto ; hitachi , japan . 120 kv , 175 ma layer thickness of the scanning : 10 mm scanning in the umbilical cross - section attenuation of the adipose tissue : − 250 ˜− 50 hu ( ct unit ) calculation of the fat areas : total abdomen fat , visceral - and subcutaneous fat ( mm 2 ) using ct scanning , total fat - as well as visceral fat areas were marked out across the umbilical cross - section , the areas were measured respectively , the area of subcutaneous fat was obtained as the difference of both areas . the changes of body weights , abdomen total fat areas , visceral fat areas as well as subcutaneous fat areas of the test subjects before and after clinic experiments are shown in tables 13 and 14 . the results of ct scanning showed that body weights , weights of total abdomen fat , the weights of visceral - and subcutaneous fat of rats fed with the composition containing fucoxanthin all decreased . the effect reduced body weight by the composition of fucoxanthin is correlated with the decrease of abdomen fat . the effects of a + b + c , a + c , a + b , and a groups are more significant than b + c group ( p & lt ; 0 . 05 ) and the weight reducing effects of compositions were more significant than fucoxanthin ( a ) alone . the indices of weight reducing effect of the a + b + c group is significantly superior to other groups , followed by the a + b group and followed by the a + c group . no abnormity has been found in blood routine examination , urine routine examination , liver function , blood pressure , heart rate and blood sugar . in the follow - up questionnaires , some questions were set up to find out the experiences as well as compliance of the customers in taking the medicine . the results of the questionnaire are as follows : no phenomena of restraining of appetite , nausea , vomiting , discomfort of stomach and intestines happened in the digestive systems of the customers . no phenomena of thirst , polyuria and frequent urination happened . no phenomena of dysphoria , insomnia and night sweat happened in the psychosis . no phenomena of rise of blood pressure and heart rate or heart - throb and dizziness happened . unlike traditional weight reducing products of the appetite restraining type functioning by means of the control of fat intake , the weight reducing effect of fucoxanthin composition is based on the fat metabolism and is not related to appetite , therefore , theoretically , unlike other weight reducing products that will cause the resumption of the appetite , and hence the body weight rebound after giving up taking the medicine , fucoxanthin compositions will exert continuous weight reducing effect and they can eliminate various unfavorable side effects . when the fucoxanthin compositions are stopped administering for a month , the body weight of subjects does not rebound and therefore it is unnecessary to change the life style , to resort to be on diet or clapped - out physical exercise . the medicines can be taken by way of single doses as well as multiple doses , this makes fucoxanthin preparations more convenient . therefore , the composition composed of fucoxanthin and fucoidan , of fucoxanthin and tocotrienol , and of fucoxanthin , fucoidan and tocotrienol are types of safe , effective and convenient ideal weight reducing product . fucoxanthin compositions have more significant weight reducing effect than fucoxanthin alone . it can be taken reassuringly by those populations taking health - care , reducing weight and taking other medicines in same time and the weight reducing effect is trustworthy . these weight reducing compositions can also be applied as food additives , foodstuffs , health products , and medicines . the above are preferable examples of this invention , which are intended to exemplify the invention , not to restrict the protection range of this invention . within the spirit and scope limited by the claims of the present invention , the person skilled in the art can make lots of change , modification , which should be fallen within the protection scope of the invention .	0
a first embodiment or the invention will be described with reference to fig1 and 2 . fig2 is a block diagram of an electronic circuit of an electronic musical instrument of the first embodiment . a keyboard 10 having a plurality of keys is connected via a keyboard interface 11 to a bus 8 . when a key of the keyboard 10 is depressed or released , the keyboard interface 11 detects a pitch of the key , a key depression or release , a speed of key depression or release , after - touch information , and the like , and supplies the detected data to the bus 8 . a pedal 12 is connected via a pedal interface 13 to the bus 8 . the pedal interface 13 detects the on / off states of a sustain pedal , a sostenuto pedal , and the like , and supplies the on / off data of each pedal to the bus 8 . a rom 14 , a ram 15 , a cpu 16 , a tone signal generator 50 , and a resonance signal generator 60 are also connected to the bus 8 . cpu 16 runs on the program stored in rom 14 , and controls the tone signal generator 50 and resonance signal generator 60 in accordance with key depression / release information from the keyboard interface 11 and pedal on / off information from the pedal interface 13 . the tone signal generator 50 has a plurality of tone signal forming channels 51 - 1 to 51 - n and an adder 52 . the tone signal generator 50 generates a tone signal having a pitch corresponding to a depressed key , and gives this tone signal a desired tone color and an amplitude envelope corresponding to the states of a key depression , a key release , and a sustain pedal . when a key is depressed , cpu 16 assigns one of the tone signal forming channels to this key for the generation of a tone signal corresponding to the depressed key . if all the tone signal forming channels are generating tone signals and a new key is depressed , generation of a tone signal having a longest time lapse after the key release or a tone signal most attenuated is stopped and its channel is assigned to the newly depressed key . this process is called a truncate process . an assigned tone signal forming channel 51 - i generates a tone signal having a pitch corresponding to the depressed key . each tone signal forming channel 51 - 1 to 51 - n is connected to the adder 52 . the adder 52 adds tone signals supplied from the tone signal forming channels 51 - 1 to 51 - n , and supplies the result to the resonance signal generator 60 . the resonance signal generator 60 adds a resonance signal to a tone signal inputted from the tone signal generator 50 , and supplies the result to a sound system 67 . the structure and operation of the resonance signal generator 60 will be later detailed . the sound system 67 converts a digital tone signal inputted from the resonance signal generator 60 into an analog tone signal and produces sounds including resonance sounds . fig1 is a block diagram of the resonance signal generator 60 shown in fig2 . an output of the tone signal generator shown in fig2 is supplied to an input terminal 9 . a signal used for generating a resonance signal is applied to an input terminal 9a . for example , this signal may be formed of noise components to be used when the sustain pedal is on . signals applied to the input terminals 9 and 9a are supplied via respective multipliers 5 and 4 to an adder 1 . an output of the adder 1 is supplied to a plurality of multipliers 21 - 1 to 21 - m . each multiplier 21 - 1 to 21 - m multiplies a tone signal supplied from the adder 1 by a predetermined coefficient , and supplies the result to a corresponding one of resonance signal forming channels 20 - 1 to 20 - m . the multipliers 21 - 1 to 21 - m are connected to a common resonance level controller 7 . the coefficient multiplied to a tone signal is supplied from the resonance level controller 7 in accordance with the pitch information of the tone signal . each resonance forming channel 20 - 1 to 20 - m forms a resonance signal specific to each string of a key . it is preferable therefore to provide resonance forming channels as many as the number of keys . if it is difficult to provide channels for all keys , resonance forming channels may be provided only for particular keys , as will be later detailed . for example , twenty four resonance forming channels may be provided for one octave at a high pitch range and another octave at a low pitch range . each resonance signal forming channel 20 - 1 to 20 - m is formed of a comb filter constituted by a circulating signal path including an adder 22 - 1 to 22 - m , a delay circuit 23 - 1 to 23 - m , a read controller 24 - 1 to 24 - m , and a multiplier 25 - 1 to 25 - m . the adder 22 - 1 to 22 - m is connected to the multipliers 21 - 1 to 21 - m and 25 - 1 to 21 - m , adds the tone signals from the multipliers , and supplies the result to the delay circuit 23 - 1 to 23 - m . the delay circuit 23 - 1 to 23 - m delays a tone signal supplied from the adder 22 - 1 to 22 - m by a predetermined delay time , and outputs it to the read controller 24 - 1 to 24 - m . the delay time is set so that the resonance signal forming channel 20 - m provides a resonance frequency specific to the string of the corresponding key . the read controller 24 - 1 24 - m reads the tone signal delayed by the predetermined delay time by the delay circuit 23 - 1 to 23 - m , performs an interpolation or phase correction of the read tone signal , and supplies the result to the multiplier 25 - 1 to 25 - m . the multiplier 25 - 1 to 25 - m multiplies the tone signal supplied from the read controller 24 - 1 to 24 - m by a predetermined coefficient , and supplies the result to the adder 22 - 1 to 22 - m . that is to say , the multiplier 25 - 1 to 25 - m provides a feedback gain of the comb filter . an output of the multiplier 25 - 1 to 25 - m is an output of the resonance signal forming channel 20 - 1 to 20 - m which is supplied to multipliers 26 - 1a and 26 - 1ma . the multipliers 26 - 1a and 26 - 1ma multiply a tone signal supplied from the resonance signal forming channel 20 - 1 to 20 - m by predetermined coefficients , and supplies the results to respective adders 2a and 2b . the multiplier 26 - 1a to 26 - 1ma forms a resonance signal for the left channel , and the multiplier 26 - 1ib forms a resonance signal for the right channel . by properly selecting the coefficients of the multipliers 26 - 1a and 26 - 1ma , a mix ratio of right and left channels , i . e ., orientation , can be independently set for each resonance signal of each string . the adders 2a and 2b are connected to the multipliers 28 - 1a to 26 - ma and to the multipliers 26 - 1b to 26 - mb , and adds the outputs of the respective multipliers , and supply the results to adders 3a and 3b . multipliers 6a and 6b multiply the tone signal applied to the input terminal 9 by predetermined coefficients , and supply the results to the adders 3a and 3b . the adder 3a adds a tone signal supplied from the multiplier 6a to a left channel resonance signal supplied from the adder 2a , to generate a left channel tone signal added with a resonance signal . the adder 3b adds a tone signal supplied from the multiplier 6b to a right channel resonance signal supplied from the adder 2b , to generate a right channel tone signal added with a resonance signal . the resonance level controller 7 generates each resonance signal control coefficient in accordance with the on / off states of the sustain pedal and sostenuto pedal and the key depression / release state of each key . the resonance signal control coefficient determines the intensity of a tone signal to be inputted to each resonance signal forming channel 20 - 1 to 20 - m . this coefficient is supplied to each multiplier 21 - 1 to 21 - m from which a tone signal is supplied to each resonance signal forming channel 20 - 1 to 20 - m . for example , when the sustain pedal is on , the resonance signal control coefficient is set to &# 34 ; 1 &# 34 ; for all the resonance signal forming channels 21 - 1 to 21 - m so as to generate resonance signals of strings of all keys . in this case , the coefficients may be changed in accordance with the distances between the depressed string and other resonating strings . when the sustain pedal is off , the resonance signal control coefficient of the resonance signal forming channel corresponding to a depressed key is set to &# 34 ; 1 &# 34 ;, and the other resonance signal control coefficients are set to &# 34 ; 0 &# 34 ;. in this manner , it becomes possible to generate a resonance signal only for the string of the depressed key . other settings of the resonance signal control coefficient may be made . for example , the coefficient is set to &# 34 ; 0 . 8 &# 34 ; for a depressed key , to &# 34 ; 0 &# 34 ; for a released key , to &# 34 ; 0 . 9 &# 34 ; for a depressed key with the sustain pedal being on , and to &# 34 ; 0 . 6 &# 34 ; for a released key with the sustain pedal being on . these coefficient values are not limitative . next , the operation of the electronic musical instrument and resonance signal generator shown in fig1 and 2 will be described with reference to fig6 to 8 . fig6 is a flow chart explaining the main routine . when a power is turned on , each circuit portion is initialized at step a1 . thereafter , a keyboard process at step a2 , a pedal process at step a3 , and other processes at step a4 are repetitively executed . fig7 is a flow chart explaining the keyboard process at step a2 shown in fig6 . when the keyboard process is activated from the main routine , a presence / absence of a key depression at a current cycle is detected at step b1 . if there is no key depression , the flow jumps to step b6 at which a judgement process of a key release presence / absence is performed . if there is a key depression at a current cycle , a tone signal generation process is executed at step b2 . at this tone signal generation process , cpu 16 assigns one tone signal forming channel 51 - j to the depressed key , and instructs the assigned tone signal forming channel 51 - j to generate a tone signal . next , at step b3 , an on / off of the sustain pedal is judged . if the sustain pedal is on , the dampers of all keys detach from the strings , entering the state of allowing resonance . the intensity of resonance becomes different depending upon whether a near key or a far key was struck . therefore , at step b5 , cpu 16 causes the resonance level controller 7 to set resonance signal control coefficients for the depressed key with the sustain pedal being on , to the multipliers ( hereinafter called resonance signal gates ) from which a tone signal is inputted to the resonance signal forming channels . typically , the resonance signal control coefficient associated with a particular key is set such that it is proportional to the distance between the particular key and the depressed . in this manner , in accordance with the depressed key , the resonance signal forming channels electronically generate resonance signals of strings when the sustain pedal is on . if the sustain pedal is off , the damper of only the depressed key detaches from the string , entering the state of allowing resonance . at step b4 , cpu 16 causes the resonance level controller 7 to set a resonance signal control coefficient for the depressed key with the sustain pedal being off , only to the resonance signal gate 21 - 1 corresponding to the depressed key . in this manner , the resonance signal forming channel electronically generate resonance signal of the depressed key when the sustain pedal is off . since the string of a key not depressed can also generate resonance a little , the resonance signal gates of the keys not depressed may be opened slightly . next , at step b6 , a presence / absence of a key release is checked . if there is no key release at a current cycle , the control returns to the main routine . if there is a key release at a current cycle , a tone signal extinguishing process is executed at step b7 . at this process , cpu 16 causes the tone signal forming channel 51 - 1 to 51 - n corresponding the released key to provide a tone signal extinguishing amplitude envelope . in this case , if the sustain pedal is on , the tone signal extinguishing process is not performed until the pedal becomes off . after the tone signal extinguishing process , an on / off of the sustain pedal is checked at step b8 . if the sustain pedal is on , at step b10 , cpu 16 causes the resonance signal level controller 7 to set a resonance signal control coefficient for the released key with the sustain pedal being on , to the resonance signal gate 21 - k corresponding to the released key among the resonance signal gates 21 - 1 to 21 - m . in this manner , the resonance signal forming channel 20 - 1 to 20 - m electronically generates a resonance signal of the key released while the sustain pedal is on . if the sustain pedal is off , at step b9 , cpu 16 causes the resonance level controller 7 to set a resonance signal control coefficient for the released key with the sustain pedal being off , to the resonance signal gate 21 - 1 to 21 - m corresponding to the depressed key . in this manner , the resonance signal forming channel 20 - 1 to 21 - m electronically generates a resonance signal of the released key when the sustain pedal is off . in this case , the resonance signal control coefficient may be set to &# 34 ; 0 &# 34 ; so as not to generate a resonance signal of the released key . after the completion of the keyboard process , the control returns to the main routine . fig8 is a flow chart explaining the pedal process . when the pedal process is activated from the main routine , it is checked at step c1 whether the sustain pedal is being depressed at a current cycle . if the sustain pedal is not depressed , the flow jumps to step c4 at which a judgement process of an on - off of the sustain pedal is executed . if the sustain pedal is being depressed at a current cycle , a sustain pedal on - state process is executed at step c2 . at this process , cpu 16 stores the on - state of the sustain pedal . at the sustain pedal on - state , the tone signal extinguishing process is not performed even if a key release is detected , until the sustain pedal becomes off . next , at step c3 , resonance signal control coefficients for the depressed key with the sustain pedal being on are set to the resonance signal gates corresponding to the depressed keys , and resonance signal control coefficients for the released key with the sustain pedal being on are set to the resonance signal gates corresponding to the released keys . in this manner , each resonance signal forming channel generates a resonance signal when the sustain pedal is on . next , it is checked at step c4 whether the sustain pedal has been released at a current cycle . if the sustain pedal is not released , the current state is maintained and the control returns back to the main routine . if the sustain pedal has been released at a current cycle , a sustain pedal off - state is executed at step c5 . at this process , cpu 16 stores the off - state of the sustain pedal , and at the same time the tone signal extinguishing process is executed for the key released while the sustain pedal is on . next , at step c6 , resonance signal control coefficients for the depressed key with the sustain pedal being off are set to the resonance signal gates corresponding to the depressed keys , and resonance signal control coefficients for the released key with the sustain pedal being off are set to the resonance signal gates corresponding to the released keys . in this manner , each resonance signal forming channel generates a resonance signal when the sustain pedal is off . if the resonance signal control efficient for the released key with the sustain pedal being off is set to &# 34 ; 0 &# 34 ;, a resonance signal forming channel corresponding to the released key stops generating a resonance signal . after the execution of the pedal process , the control returns back to the main routine . in the flow charts of fig7 and 8 , only the sustain pedal has been considered for the pedal process for the simplicity of description . when the sostenuto pedal is pushed down , the damper of a depressed key detaches from the string , providing the same condition as the sustain pedal is depressed . the following description takes the sostenuto pedal into consideration . when an on - state of the sostenuto pedal is detected at step a3 of the pedal process shown in fig6 cpu 16 stores this on - state . at the on - state of the sostenuto pedal , information of depressed keys is stored in a storage buffer . if a key release is detected , at step b8 of the tone signal extinguishing process shown in fig7 neither the tone signal extinguishing process nor a re - setting of a resonance signal control coefficient to the corresponding resonance signal gate is performed on condition that the released key information is being stored in the storage buffer . if the released key information is not stored in the storage buffer , the tone signal extinguishing process and a re - setting of a resonance signal control coefficient to a resonance signal gate are performed . in this manner , while the sostenuto pedal is on , the resonance signal forming channel generates the same resonance signal as a key is depressed , even if the key is released . when an off - state of the sostenuto pedal is detected at step a3 of the pedal process shown in fig6 cpu 16 stores this off - state . a tone signal extinguishing process is executed for a released key among the keys whose information is being stored in the storage buffer , and a resonance signal control coefficient is set to the resonance signal gate corresponding to the released key . at the same time , the storage buffer is cleared . in this manner , the resonance signal forming channel corresponding to the released key while the sostenuto pedal is on , stop generating a resonance signals . as described above , this embodiment can electronically generate a resonance signal of the string of a depressed key even if the sustain pedal is off . by properly selecting resonance signal control coefficients in accordance with the on / off state of the sustain pedal and the state of key depression / release , resonance sounds more like a natural musical instrument can be produced . consider for example the case where a key of c1 ( a tone pitch ) and a key of g1 ( another tone pitch ) are depressed at the same time . the frequency of a sound c1 is 32 . 7 hz , and that of a sound g1 is 49 hz . a frequency ratio is about 2 : 3 . a third harmonic sound of c1 is 98 hz , and a second harmonic sound of g1 is 98 hz , and both are generally equal . the string of c1 resonates at the second harmonicfold sound of g1 , fourth harmonic sound of g1 , and the like . in this embodiment , when the keys of c1 and g1 are depressed at the same time without depressing the sustain pedal , a resonance sound between the strings of c1 and g1 can be produced like a natural musical instrument . in the above embodiment , the resonance signal generator having resonance signal forming channel corresponding in number to the number of keys . provision of resonance signal forming channels as many as all keys complicate the circuit . in order to simplify the circuit , resonance signal forming channels may be provided for one octave at a high pitch range and another octave at a low pitch range . a second embodiment of the resonance signal generator will be described with reference to fig3 . fig3 is a block diagram of resonance signal forming channels for one octave at a high pitch range and another octave at a low pitch range . the resonance signal generator has twelve resonance signal forming channels 20 - 1 to 20 - 12 for a low pitch range and twelve resonance signal forming channels 20 - 13 to 20 - 24 for a high pitch range . the operation of inputting tone signals applied at the input terminals 9 and 9a to the adder 1 is the same as the resonance signal generator shown in fig1 . an output of the adder 1 is connected to multipliers 17a and 17b for the supply of a tone signal . the multipliers 17a and 17b supply a tone signal to resonance signal gates 21 - 1 to 21 - 12 for the low pitch resonance signal forming channels and to resonance signal gates 21 - 13 to 21 - 24 for the high pitch resonance signal forming channels . if a tone pitch generator is a stereophonic tone pitch generator , a left channel tone signal may be inputted to the resonance signal gates 21 - 1 to 21 - 12 for the low pitch resonance signal forming channels , and a right channel tone signal may be inputted to the resonance signal gates 21 - 13 to 21 - 24 for the high pitch resonance signal forming channels . this arrangement corresponds to piano strings for a low pitch at the left and piano strings for a high pitch at the right . the structure of a resonance signal gate 21 - 1 to 21 - m , a resonance signal forming channel 20 - 1 20 - m , and multipliers 26 - ia and 26 - 1b to 26 - mb is the same as the resonance signal generator shown in fig1 . an output of each multiplier 26 - 1a to 26 - ma , 26 - 1b to 26 - mb is supplied to respective adders 2a and 2b . the adders 2a and 2b supply a tone signal to multipliers 18a and 18b . adders 3a and 3b add the tone signals supplied from the multipliers 6a and 6b to corresponding resonance signals supplied from the multipliers 18a and 18b , to form and output a tone signal added with a resonance signal . a resonance signal level controller 7 generates resonance signal control coefficients in accordance with the on / off states of the sustain pedal and sostenuto pedal and the key depression / release state of the keyboard , and supplies them to the resonance signal gates of the low pitch resonance signal forming channels 20 - 1 to 20 - 13 and to the resonance signal gates of the high pitch resonance signal forming channels 20 - 13 to 20 - 24 . in the resonance signal generator shown in fig3 it occurs that a depressed key has no corresponding resonance signal forming channel . in this case , the resonance signal gates of the high pitch resonance signal forming channel and low pitch resonance signal forming channel , corresponding to a depressed key , are set with appropriate resonance signal control coefficients , to simulate a resonance signal of a depressed key . for example , consider that there are prepared the low pitch resonance signal forming channels for one octave from a sound c1 to b1 and the high pitch resonance signal forming channels for one octave from a sound c5 to b5 . the resonance signal control coefficient of each resonance signal gate can be adjusted in the following manner , in accordance with a depressed key . when a key corresponding to c1 is depressed , the resonance signal control coefficient of the resonance signal gate 21 - 1 of the low pitch resonance signal forming channel corresponding to c1 is set to &# 34 ; 1 &# 34 ;, and the resonance signal control coefficient of the resonance signal gate 21 - 13 of the high pitch resonance signal forming channel corresponding to c5 is set to &# 34 ; 0 &# 34 ;. conversely , when a key corresponding to c5 is depressed , the resonance signal control coefficient of the resonance signal gate 21 - 1 of the low pitch resonance signal forming channel corresponding to c1 is set to &# 34 ; 0 &# 34 ;, and the resonance signal control coefficient of the resonance signal gate 21 - 13 of the high pitch resonance signal forming channel corresponding to c5 is set to &# 34 ; 1 &# 34 ;. when a key corresponding to c3 is depressed , the resonance signal control coefficient of the resonance signal gate 21 - 1 of the low pitch resonance signal forming channel corresponding to c1 and the resonance signal control coefficient of the resonance signal gate 21 - 13 of the high pitch resonance signal forming channel corresponding to c5 are both set to &# 34 ; 0 . 5 &# 34 ;. when a key different from the above - described keys is depressed , it is preferable to adjust the ratio of the resonance signal control coefficients to be set to the resonance gates for the high and low pitch ranges , in order to produce an optimum resonance sound . as described above , the resonance signal generator of the second embodiment is not necessary to provide resonance signal forming channels as many as the number of keys , allowing the electronic circuit to be simplified . furthermore , by properly setting the resonance signal control coefficients for the high and low pitch ranges , it becomes possible to produce a resonance sound more like resonance sound of each key . next , a third embodiment will be described with reference to fig4 . a hammer of a piano strikes the string at the position about 1 / 7 to 1 / 9 of the string length from one end thereof . a standing wave having node at the position about 1 / 7 to 1 / 9 of the string length from one end thereof , is therefore difficult to be generated . this means that seventh to ninth harmonic sounds of the fundamental frequency of a string is difficult to be generated . in the third embodiment shown in fig4 each resonance signal forming channel is provided with a band - elimination or band - stop filter which stops the signal pass at the band corresponding to seventh to ninth harmonic sounds of the fundamental frequency of each string . the operation of inputting tone signals applied at the input terminals 9 and 9a to the adder 1 and to each resonance signal forming channel 20 - 1 to 20 - 24 is the same as the second embodiment shown in fig3 . a circulating signal path of each resonance signal forming channel 20 - 1 to 20 - m constituted by an adder 20 - 1 to 20 - m , a delay circuit 23 - 1 to 23 - m , a read controller 24 - m , and a multiplier 25 - 1 to 25 - m is the same as the second embodiment shown in fig3 . the different points reside in that an output of the multiplier 25 - 1 to 25 - m is supplied to the band - elimination filter 27 - 1 to 27 - m and that an output of this filter is an output of the resonance signal forming channel 20 - 1 to 20 - m . therefore , seventh to ninth harmonic sounds of the fundamental frequency of a string is prevented from being generated , allowing to generate a resonance sound more like a piano resonance sound . the above embodiment uses a band - elimination filter . instead , a low - pass filter stopping a frequency of seventh harmonic sound or higher may be used . outputs of the low pitch resonance signal forming channels 20 - 1 to 20 - 12 are added together and supplied to multipliers 28a and 28b . outputs of the high pitch resonance signal forming channels 20 - 13 to 20 - 24 are added together and supplied to multipliers 29a and 29b . outputs of the multipliers 28a and 29a are added by an adder 2a to form a left channel resonance signal . outputs of the multipliers 29a and 29b are added by an adder 2b to form a right channel resonance signal . in the second embodiment shown in fig3 an output of each resonance signal forming channel is separated into right and left channel resonance signals , and the right and left channel resonance signals are inputted to the adders 2a and 2b via the multipliers . in the third embodiment , outputs of the resonance signal forming channels are added and then inputted to the right and left channel multipliers . therefore , interference between the right and left resonance signal forming channels can be used . in addition , the number of multipliers can be reduced , simplifying the electronic circuit . a piano has strings for generating low pitch sounds on the left side , and strings for generating high pitch sounds on the right side . therefore , in separating resonance signals generated by the low pitch resonance signal forming channel into the right and left channels , it is preferable to raise the level of the left channel signal and lower the level of the right channel signal . on the other hand , in separating resonance signals generated by the high pitch resonance signal forming channel into the right and left channels , it is preferable to lower the level of the left channel signal and raise the level of the right channel signal . as in the third embodiment , the right and left channel signals are separated after the outputs of the low pitch resonance signal forming channels are added and the outputs of the high pitch resonance signal forming channels are added . by changing the levels of the right and left channel signals independently , an effective resonance sound can be produced . the present invention has been described in connection with the preferred embodiments . the invention is not limited only to the above embodiments . it is apparent to those skilled in the art that various modifications , improvements , combinations and the like can be made without departing from the scope of the appended claims . for example , an output of each resonance signal forming channel may be taken out from a desired point of the loop circuit , such as from an output of the adder 22 - 1 to 22 - m .	6
the following description of the invention taken in conjunction with the accompanying drawings is provided to further illustrate the invention and preferred embodiments in greater detail . the file of this patent contains at least one drawing executed in color . copies of this patent with color drawings ( s ) will be provided by the patent and trademark office upon request and payment of the necessary fee . fig1 a - 1b . space - filling model ( a , 34 ) and ribbon diagram ( b , 35 ) of gel a - ctd showing residues which interact with timp - 2 . a ) the residues which are thought to directly interact with timp - 2 are shown colored and labeled . residues which showed between a 2 - to 100 - fold loss in timp - 2 binding when mutated to alanine are colored cyan , while those which showed over 100 - fold loss in timp - 2 binding when mutated to alanine are colored dark blue . tbs - 1 and tbs - 2 regions are indicated by the dashed magenta boxes which cover their respective regions . b ) a ribbon diagram of gel a - ctd shows the canonical β - propeller fold . each blade of gel a - ctd is labeled with a roman numeral . the ca2 + ion is shown in red along the central axis of symmetry . the disulfide bond connecting blades i and iv is shown as are the n - and c - termini . residues which are thought to directly interact with timp - 2 are shown in magenta and are labeled . all the residues lie on blade iii , blade iv or the loop connecting the two blades . fig2 . competition assay of gela - ctd binding to timp - 2 . one hundred μl of solution containing 1 . 7 × 10 - 9 m of 125 i - labeled wt gela - ctd ( 10 8 cpm / μg ) and unlabeled purified recombinant wt or mutant of the gela - ctd at the indicated concentrations were incubated in timp - 2 ( 50 ng ) coated wells of microtiter plates and washed as described in methods . bound radioactivity was determined by counting individual wells in a gamma counter . after background subtraction the cpm retained in the wells was normalized to 1 . 00 and plotted versus the concentration of unlabeled , competing gel a - ctd for wild type (⋄, ki / kd = 1 ) or mutants gly 651 ( x , ki / kd = 3 ); lys 579 (□, ki / kd = 6 ); lys 604 ( δ , ki / kd = 25 ); and asp 615 (◯, ki / kd = 300 ) as indicated in the figure . the values for wild type self competition are the mean of 8 separate experiments and the error bars represent the standard error . the mutant values are the average of two determinations . computer generated theoretical curves were fitted to the data and the apparent kd for wt and ki for mutants were determined from the fit as shown in the figure by each solid curve . fig3 . molecular surface of gel a - ctd showing the timp - 2 binding site . a molecular surface of gel a - ctd was calculated and displayed using grasp . the timp - 2 binding site is colored magenta . the yellow labels denote some of the timp - 2 binding residues and their position with respect to the surface . the boundary residues described in the paper are shown in green and are seen to surround the timp - 2 binding site . fig4 a - 4b . comparison of molecular surface and electrostatic potential at surface of gel a - ctd and cli - ctd . the molecular surface of both ( 4a ) gel a - ctd and ( 4b ) cli - ctd are displayed . electrostatic potential for each was calculated and displayed with positive potential shown in blue and negative potential in red . the dashed magenta line conforms to the approximate timp - 2 binding site described in the text . tbs - 1 and tbs - 2 are shown and conform to the same regions described in fig1 . the tbs - 1 region of gel a - ctd displays a lot of positive potential , where as cli - ctd has much less positive potential and has a significant amount of negative potential across the tbs - 1 binding interface . the tbs - 2 regions of both molecules show differing potentials as well . the molecular surfaces of both molecules suggests that they would present significantly different van der waal contact surfaces . fig5 . sequence alignment of β - propeller blades iii and iv from c - terminal domains of mmp family members . the amino acid sequence of gela containing all the residues defining the timp - 2 binding site was aligned with other mmps . sequences which are found in blade iii or blade iv are beneath the underlined regions . gela residues which are part of the timp - 2 binding site and corresponding residues from other enzymes are bolded . those residues constituting the tbs - 1 region ( see text ) are bolded and underlined , while the remaining residues are part of tbs - 2 are merely bolded . an `*` marks residues whose effect on timp - 2 binding of gela - ctd were confirmed by mutagenesis . fig6 . inhibition of membrane dependent activation of gela by gela - ctd mutants . the 15 ng of purified gela were incubated in 25 mm hepes - koh buffer , ph 7 . 5 , containing 0 . 1 mm cacl 2 with 20 μg of plasma membrane protein from ht1080 cells for 2h at 37 ° c . in the presence of increasing concentration ( 1 - 6 ) of recombinant gela - ctd wt or mutants # 28 ( asp 569 ), # 31 ( lys 579 ), # 39 ( lys 604 ), # 41 ( asp 615 ), # 229 ( asp 576 ), # 234 ( arg 590 ), # 247 ( lys 646 ), # 250 ( trp 574 ), # 252 ( tyr 636 ), # 255 ( phe 650 ), # 257 ( gly 651 ), # 258 ( asp 656 ), # 259 ( asn 611 ) as indicated in each panel . the results of activation reaction were analyzed on zymogram as described previously ( 9 , 10 ). the images of resulting zymograms were acquired using flat bed scanner and converted to a negative . the colored areas in fig1 a and fig3 are shown in black and white copies as follows : fig1 a -- residues shown in dark blue are asp 656 , asp 615 , lys 646 , lys 576 , trp 574 and arg 590 . residues shown in cyan are gly 651 , phe 650 , tyr 636 , asn 611 , lys 579 and lys 604 . fig3 -- boundary residues shown in the green colored area are lys 649 , gln 641 , lys 578 , lys 633 , asp 608 and asp 618 . the red colored timp - 2 binding site shows residues asp 656 , phe 650 tyr 636 , asp 615 , asn 611 , lys 646 , lys 576 , trp 574 and lys 604 . in order to further illustrate the invention , the following detailed examples were carried out although it will be understood that the invention is not limited to these examples or the details described therein . ht1080 fibrosarcoma cells were grown in monolayer culture in rpmi 1640 media supplemented with 4 % fetal calf serum and 2 mm glutamine in the presence of 5 % co 2 and treated with 12 - o - tetradecanoyl - phorbol acetate ( tpa ) ( 50 ng / ml for 16 h ). isolation of plasma membranes from ht1080 cells was performed using discontinuous sucrose gradient as described ( 9 , 10 ). the gela expression plasmid p6r72hyg was transfected into e1a - expressing p2aht2a cells and gela was purified from conditioned medium of stably transfected cell line p2ah17212a as described ( 9 , 10 ) expression and purification of timp - 2 . recombinant timp - 2 was expressed in p2aht2a cells transfected with timp - 2 cdna in the p6rhyg expression vector and purified from serum free conditioned media of p2aht2at2 cells as described earlier ( 9 , 10 ) using reactive red - 120 - agarose ( sigma , r - 0503 ), q - sepharose ( pharmacia # 17 - 0510 - 01 ), cm - sepharose cl - 6b ( sigma # ccl - 6b - 100 ) and rp - hplc column chromatography . expression and purification of the flag gela - ctd fusion protein . expression vector pflag72ct was constructed by cloning a fragment from gela cdna ( 17 ) coding for leu 444 - cys 660 into e . coli secretion vector pflag1 ( ibi inc .). the resulting vector coding for the fusion protein flag - ct was transfected into an e . coli topp5 host ( stratagene ). protein was purified from a periplasmic fraction by chromatography on reactive red - 120 - agarose ( sigma , r - 0503 ) and m1 anti - flag antibody affinity column as described previously ( 9 , 10 , 27 ). each of the 50 mutants and wild type gela ct were purified using this procedure . mutagenesis of the flag gela - ctd fusion protein . expression vector pflag72ct was mutagenized directly using pcr mediated site directed mutagenesis . a pair of anti - parallel 33 base pair long primers was synthesized for each mutant . these primers containing a desired mutation were used in a pair of pcr reactions with either of two primers flanking the coding sequence . both resulting pcr products contained mutation . they were mixed , melted and annealed to generate a partial heteroduplex encompassing the whole coding sequence . the latter served as a template in a third pcr reaction primed by both of the flanking primers . each of the resulting pcr products was cloned back into the pflag72ct expression vector and subjected to a sequence analysis to confirm the presence of mutation . all resulting mutant proteins were purified and assayed for timp - 2 binding as described below . the sequence of mutants that had negative effect on timp - 2 binding was verified by sequencing of the entire coding region to exclude the appearance of secondary , pcr generated , mutations . secondary mutations , when present , were separated from the desired mutant by either a second round of pcr or using restriction enzyme mediated subcloning . the timp - 2 binding and competition assays were performed in 96 well modular plates ( costar ). timp - 2 coated plates were prepared by addition of 100 μl of loading buffer ( 20 mm tris hcl , ph 9 ) containing 50 ng of purified timp - 2 to each well and incubated for 1 h at rt . this solution was replaced with 200 μl of blocking buffer ( 0 . 5 % bsa and 0 . 02 % brij in pbs , ph 7 . 2 ) and incubated on at 4 ° c . for binding experiments increasing concentrations of competing cold ligand in 100 μl of binding buffer ( 1 mg / ml bsa and 0 . 01 % brij in pbs ) were added to timp - 2 or bsa ( control ) coated wells and incubated for 30 min prior to addition of 10 - 9 m of 125 i - gela - ctd ( between 6 , 5 × 10 7 and 1 × 10 8 dpm / μg ). incubation continued for 1 h , after which plates were washed 5 times with binding buffer and each well was counted to determine retained radioactivity . between 15 - 50 ng of the gela proenzyme was used for activation with plasma membranes ( 1 - 4 μg of plasma membrane protein ) in 10 μl final volume of 25 mm hepes - koh buffer , ph 7 . 5 , containing 0 . 1 mm cacl 2 . the reaction was incubated at 37 ° c . for 120 min , terminated by addition of the sample buffer and subjected to gelatin zymogram analysis as described ( 9 , 10 ). residues whose mutation to alanine caused a loss in timp - 2 binding were divided into those that most likely directly interact with timp - 2 and those whose effect on timp - 2 binding are most likely a result of indirect structural perturbations based on a detailed examination of the environment of each of the mutant . the set of residues which interact with timp - 2 are all confined to a single , contiguous surface of gela - ctd which is divided into two adjacent regions , tbs1 and tbs2 . using boundary residues which are near the timp - 2 binding residues but whose mutation to alanine had no effect on timp - 2 binding permitted us to defined the timp - 2 binding site as a molecular surface that includes residues not mutated in the analysis . gela - ctd and the c - terminal domain of interstitial collagenase ( cli - ctd ) were aligned along their respective c . sub . α atoms . the two structures aligned with an average root mean square difference in c . sub . α position of 3 . 7 å and were visualized using the graphics program o ( 28 ). the model of gelb - ctd was constructed using the modeling software , sybyl ( version 6 . 2 , tripos associates , st . louis , miss .). the gela - ctd structure provided the basic template for the structure and the coordinates of the c . sub . α atoms were preserved in regions of sequence identity . in these regions , the conformation of the sidechains were preserved as well . in regions with no sequence identity , the c . sub . α positions were held constant but the side chain conformation was chosen from a rotamer library set . steric clashes due to the insertion of gelb residues were relieved by moving either the neighboring atoms ( whether they be sidechain or backbone atoms ) or by moving the c 60 position of the substituted residue . regions requiring the insertion or deletion of residues in the sequence only occurred along loops or turns and were modeled by choosing a turn or loop from the brookhaven protein data bank that had a similar sequence and made the fewest van der waal contacts with nearby atoms . finally , the model was completed by minimizing van der waal contacts over the entire structure . the final gelb - ctd model was aligned with gela - ctd along their respective c . sub . α atoms . the gela - ctd coordinates are from a high resolution crystal structure ( resolution = 2 . 15 å ) with a low r - factor ( 18 . 8 %) and low average coordinate error (& lt ; 0 . 25 å )( 27 ), so the positions of the backbone and sidechain atoms are well determined . the structure includes all residues between leu 461 and cys 660 where the only residues with poorly defined positions are glu 529 and glu 530 . the overall structure of gela - ctd is best described as a four - bladed β - propeller ( fig1 ). the four ` blades ` are each composed of four strands of anti - parallel β - sheet . the β - sheet domains are twisted making the fourth , outer most strand form nearly an 80 ° angle with the inner most strand . each blade is arrayed about a central pseudo four - fold axis so that a 90 ° rotation about the axis positions one blade on top of another . a channel formed by the four blades , parallel to the rotation axis , contains a ca 2 + ion , a na + cl - ion pair and a number of stably bound water molecules . the inner most strands of each blade are all parallel and the ca 2 + ion protrudes from the n - terminal end of the channel . the regions between the four blades are composed of hydrophobic residues ( primarily phe , tyr and trp ) which are large enough to contact one another across such a wide interface . connecting loops lay across the hydrophobic interface and connect adjacent blades . blade iv is connected covalently to blade i via a disulfide bond between cys 469 and cys 660 . identification of the timp - 2 binding site in the gela - ctd by alanine scanning mutagenesis alanine scanning mutagenesis of solvent exposed amino - acid residues of gela - ctd was used to define its molecular surface that interacts with timp - 2 . the results were interpreted by examination of the location and environment of each point mutant in the crystal structure of gela - ctd ) ( fig1 ), so that only residues of gela - ctd which can directly interact with timp - 2 are identified . expression vector pflag72ct was mutagenized directly using pcr mediated site directed mutagenesis as described in methods . all fifty resulting mutant proteins were purified as described previously ( 9 , 10 ) and assayed for timp - 2 binding as described in methods . the sequence of mutants that had negative effect on timp - 2 binding was verified by sequencing of the entire coding region to exclude the appearance of secondary , pcr generated , mutations . to quantitate the timp - 2 binding affinity of the different gela - ctd mutants relative to wild type ( wt ) gela - ctd we developed timp - 2 binding and competition assay in 96 well modular plates . for binding experiments a solutions of 10 - 9 m of 125 i - gela - ctd containing increasing concentrations of competing cold ligand were added to timp - 2 or bsa ( control ) coated wells and retained radioactivity was determined by counting individual wells as described in methods . the apparent ki for each mutant was determined by a fit of computer generated series of curves to the data from the competition assay . a 25 % variation in apparent ki thus determined produced curves which were clearly less representative of the data . an example of the results of this analysis for wt gela - ctd and four mutants are shown in fig2 . the mutants presented in fig2 were chosen to illustrate the range of variation encountered . all the mutants that had an effect on timp - 2 binding ( ki / kd & gt ; 1 ) are summarized in table 1 . substitution of ala for one of the following amino acid residues lys 470 , arg 482 , arg 491 , arg 495 , asp 501 , glu 515 , glu 518 , lys 519 , glu 529 , lys 531 , glu 539 , glu 549 , arg 550 , asp 564 , arg 567 , lys 578 , asp 586 , lys 596 , asp 608 , asp 618 , lys 628 , lys 633 , lys 639 , glu 641 , lys 649 , leu 638 , gln 643 , and leu 548 did not affect the binding affinity of gela - ctd to timp - 2 ( kd = ki ) in this assay . single replacement of lys 519 with arg , ala 479 with thr , or leu 548 with arg also had no effect . among all the point mutants of gela - cd which show a loss in binding , only asp 569 is not considered part of the timp - 2 binding surface . the remaining mutants all lie within two adjacent areas of the gela - ctd shown as timp - 2 binding surface - 1 ( tbs - 1 ) and timp - 2 binding surface - 2 ( tbs - 2 ) in fig1 . the timp - 2 binding site of gela - ctd is divided into two regions in order to facilitate discussion of the different features seen in this broad binding site and to simplify comparison of these regions on related proteins . there is no physical basis for dividing the binding site into two regions , but we do so in order to discuss different features seen in the timp - 2 binding site . tbs - 1 is formed between blades iii and iv and includes a non - polar interface composed of large aromatic residues ( contacting trp 574 ) which pack between the two adjacent blades and form a small , hydrophobic cavity . surrounding this non - polar part of tbs - 1 are a number of positively charged residues which are contributed mostly from the second ( lys 576 , lys 579 ), third ( arg 590 ), and fourth ( lys 604 ) strands of blade iii as well as lys 646 which is on a large turn made between the third and fourth strands of blade iv . the non - polar cavity is bounded by a looping strand which lies across the cavity and connects blades iii and iv . this loop region , which contains asn 611 , is considered part of tbs - 1 but is adjacent to tbs - 2 and forms part of the putative timp - 2 binding surface of gela - ctd . tbs - 2 contains residues required for timp - 2 binding that are mostly located on blade iv . phe 650 and gly 651 are located on the fourth strand of blade iv . tyr 636 comes from the third strand of blade iv but forms an adjacent surface with phe 650 and gly 651 . asp 656 is located on a single . sup . α - helical turn at the end of blade iv . asp 615 is part of the loop section connecting blades iii and iv , but is positioned adjacent to tyr 636 . together , tbs - 1 and tbs - 2 make up the entire putative timp - 2 binding surface of gela - ctd . from fig1 it can be seen that residues whose mutation caused at least 100 - fold loss in timp - 2 binding are predominantly found in tbs - 1 in and about the cavity . asp 615 is the only residue from tbs - 2 which showed more 100 fold loss in timp - 2 binding when mutated to alanine . in modeling a timp - 2 binding surface of gela - ctd , it is possible to also make use of point mutations which had no effect on timp - 2 binding . some residues on gela - ctd near or adjacent to the putative binding region did not impact timp - 2 binding when mutated to alanine . these mutants are considered boundary residues because they help define the outer limits of the timp - 2 binding surface . they include lys 578 , asp 586 , asp 608 , asp 618 , lys 633 , lys 639 , glu 641 , gln 643 , and lys 649 . while the list is not an exhaustive one and does not completely surround the site , it is a considerable number , and as seen in fig1 they contribute greatly to determining the shape of the timp - 2 binding surface on gela - ctd . the effects of point mutations on gela - ctd binding of timp - 2 can be characterized as ` direct ` or ` indirect `. point mutations with direct effect presumably show a loss in binding due to direct interaction with timp - 2 since in the crystal structure these residues are almost entirely solvent exposed making no significant van der waals contact , salt bridges or hydrogen bonds with nearby sidechain or backbone atoms . those classed as ` indirect ` are point mutants of residues which are involved in such interactions with neighboring atoms . the effect of these mutants on timp - 2 binding may be either a result of loss of direct interaction with timp - 2 or due to a perturbation of the local structure as a result of the point mutation which ` indirectly ` causes a loss in timp - 2 binding . most of the point mutants which have an effect on timp - 2 binding are classed as ` direct ` including mutants of lys 576 , lys 579 , arg 590 , lys 604 , asn 611 , asp 615 , lys 646 , and phe 650 ( see table 1 ). tyr 636 may also be considered direct in that most of the ring including the hydroxyl group is solvent exposed and the van der waals interactions of its c . sub . δ 1 and c . sub . ε 1 atoms are not likely to significantly perturb local geometry . the residues classed as ` indirect ` are asp 569 , trp 574 , gly 651 , and asp 656 . the residues classed as ` indirect ` are asp 569 , trp 574 , gly 651 , and asp 656 . the entire timp - 2 binding site shown in fig3 represents a surface area of 1027 å 2 . the interior of the surface is defined by residues whose point mutants show a loss in timp - 2 binding . the boundary of the surface is defined by the outermost residues which show an effect on timp - 2 binding and by the boundary residues described above . in order to create the entire surface other residues for which mutations were not made needed to be included as part of the binding surface . these residues were selected by the criteria that they could have no atoms outside the boundary of the binding surface and must have surface accessible atoms within the interior of the surface . the non - mutated residues included as part of the timp - 2 binding surface are residues asn 577 , tyr 581 , phe 588 , ala 609 , trp 610 , ala 612 , lie 613 , pro 614 , leu 645 , and val 648 as well as the c . sub . ζ and c . sub . ε ring carbons of phe 602 . all the aromatic residues of this group as well as leu 645 contribute to form the non - polar cavity in tbs - 1 . ala 612 , ile 613 , and pro 614 are on the loop connecting blades iii and iv . ile 613 is unique in that only its backbone atoms are surface accessible . val 648 makes up part of the van der waal contact surface of tbs - 2 . the hole in the binding surface is present because leu 638 ( which is in a small depression between phe 650 and tyr 636 ) did not show a loss in timp - 2 binding when mutated to alanine . thus , the c . sub . γ , c . sub . δ 1 and c . sub . δ 2 atoms of leu 638 are not considered part of the timp - 2 binding surface . rationalizing the effects of these mutations on timp - 2 binding requires a broader description of the structural environment of these residues . as discussed above , a some of the residues included in the timp - 2 binding site of gela - ctd may be classed as ` indirect ` mutants including asp 569 , trp 574 , gly 651 , and asp 656 . here , we rationalize the effects of mutating them to alanine on timp - 2 binding given the fact that these residues also interact with other portions of the gela - ctd molecule . the o . sub . δ 1 of asp 569 forms a hydrogen bond with a backbone amide proton of gly 585 which is located on a tight turn formed between the second and third strands of blade iii . the asp 569 -& gt ; ala mutation causes only a small reduction in timp - 2 binding . strand three of blade iii contains a residue , arg 590 , whose mutation to alanine shows a large loss in binding (& gt ; 100 - fold ) and directly interacts with timp - 2 . also , asp 569 is away from the contiguous binding surface formed by the other point mutants which affect timp - 2 binding . while it is possible that timp - 2 directly interacts with asp 569 , the effect of the asp 569 -& gt ; ala mutation is most likely mediated by alteration of the position of arg 590 as a result of the loss of an important structural h - bond with gly 585 which constrains the conformation of the turn . trp 574 is one of a number of hydrophobic residues forming the pocket between blades iii and iv . it makes van der waals contact with a number of atoms from neighboring sidechains including tyr 581 and trp 610 . since only the c . sub . ζ 3 and c . sub . η 2 atoms of trp 574 are surface accessible , the large loss in binding of the trp 574 -& gt ; ala mutant is most likely not due to a loss in the interaction of these atoms with timp - 2 but to a rearrangement of neighboring residues as a result of the mutation . the most reasonable interpretation of the effect of the mutation is that timp - 2 makes van der waals contact with this pocket upon binding gela - ctd and that trp 574 -& gt ; ala disrupts timp - 2 binding by altering the van der waal surface presented by gela - ctd . so while the effect of the trp 574 -& gt ; ala mutation is ` indirect `, it is suggestive of direct binding of timp - 2 to surface atoms in the pocket . the gly 651 -& gt ; ala mutation has a moderate effect on timp - 2 binding . since alanine , by virtue of its c . sub . β , is sterically restricted in its allowable φ , ψ angles , it is possible that the effect on timp - 2 binding of the gly 651 -& gt ; ala mutation is the result of alteration in the protein backbone . alanine is more energetically restricted than glycine in the φ , ψ conformations it may adopt . however , since gly 651 is found in a well formed β - sheet of the outer most β - strand of blade iv and adopts phi psi angles ( φ =- 157 . 9 , ψ =- 174 . 8 ) commensurate with an anti - parallel β - stand conformation , alanine is likely to adopt the same conformation at the site . thus , loss in timp - 2 binding for the alanine mutant is due to the addition of the c . sub . β atom on residue 651 which , by approximation , blocks interaction of timp - 2 with the c . sub . α of 651 . the double mutant , glu 641 -& gt ; ala / gly 651 -& gt ; arg shows & gt ; 100 - fold loss in timp - 2 binding . glu 641 is entirely solvent exposed and does not interact with neighboring atoms , and the single mutant , glu 641 -& gt ; ala shows no effect on timp - 2 binding . since glu 641 is entirely solvent exposed does not appear to interact with any neighboring atoms , the effects of the double mutant are not considered to be a result of cooperativity . thus , the effect of the double mutant is due exclusively to the gly 651 -& gt ; arg mutation . presumably , the gly 651 -& gt ; arg mutant covers a nearby surface on gela - ctd upon which timp - 2 normally binds . since arginine is much larger than alanine and is also charged , it is not surprising that it had a much more dramatic effect on timp - 2 binding than alanine . the fact that both gly 651 -& gt ; ala and gly 651 -& gt ; arg reduce timp - 2 binding suggests that timp - 2 contacts gela - ctd at the c . sub . α of gly 651 as well as surface residues near gly 651 . asp 656 is solvent exposed and forms an h - bond with the hydroxyl group of tyr 637 . the effect on timp - 2 binding of the asp 656 -& gt ; ala mutation may be a result of perturbation of the orientation of tyr 637 by loss of this h - bond . while it is possible that timp - 2 interacts with only tyr 637 , the simplest interpretation of the effect of the mutation is that asp 656 directly interacts with timp - 2 . this conclusion would partially explain the large loss in timp - 2 binding of the gly 651 -& gt ; arg mutation which puts a positive charge near asp 656 . also , asp 656 forms a contiguous surface with gly 651 , phe 650 , and tyr 636 ( other timp - 2 binding residues ). timp - 2 may interact with tyr 637 but that residue was not mutated in the study so it cannot explicitly be considered as part of the timp - 2 binding surface of gela - ctd . having defined a timp - 2 binding site on the surface of gela - ctd , it is instructive to compare the known structure of the c - terminal domain of interstitial collagenase ( cli - ctd ) ( 29 ) which does not bind timp - 2 to identify which structural features of the timp - 2 binding site are shared and which are divergent . it was surprising to find that many of the positively charged residues are conserved both in terms of sequence and structure . lys 579 , arg 590 , and lys 604 of gela - ctd are conserved in cli - ctd and adopt similar conformations in the structures ( fig3 and 4 ). furthermore , lys 646 in gela - ctd aligns with arg 453 in cli - ctd , so while the sequence is not identical , charge is conserved and the residues overlay well when their c . sub . α atoms are aligned . point mutants of arg590 and lys646 all show at least 100 - fold loss in timp - 2 binding in gela - ctd . lys576 , which also shows over a 100 - fold loss in timp - 2 binding when mutated to alanine , is not conserved in cli - ctd where it becomes a negatively charged asp residue . it is interesting to note that some of the charged residues , like arg590 and lys646 , which seem to make a large contribution to timp - 2 binding are also conserved in a cli - ctd which docs not bind timp - 2 . clearly , other features of gela - ctd , which are not found in cli - ctd , must be identified to account for its timp - 2 binding properties . further examination of the aligned structures reveals that the non - polar cavity in gela - ctd is covered by a number of negatively charged residues in cli - ctd . trp 574 , lys 576 , and ala 609 of gela - ctd align with negatively charged residues of cli - ctd . in cli - ctd , asp 385 is on the periphery of the pocket ; glu 383 protrudes from the pocket and glu 418 extends over the pocket . the effect of these negative charges on timp - 2 binding is still not known but their negative potential could shield the nearby positive charges from timp - 2 . alternatively , if timp - 2 does make van der waals contacts with the non - polar cavity of gela - ctd , the effect of all the charged groups in the cavity would be to block this interaction and in fact bury the negative charges inside the timp - 2 / gela - ctd binding interface . the negative potential in the cavity of cli - ctd is partially reduced by the presence of lys 452 which is leu 645 in gela - ctd . leu 645 is a non - polar residue which points into the hydrophobic cavity of tbs - 1 . fig3 shows the charge potentials of both gela - ctd and cli - ctd as calculated and displayed by grasp . comparison of the tbs - 1 regions of gela - ctd and cli - ctd suggests qualitatively that the pockets formed present different accessible surfaces . some residues in the pocket are conserved , notable exceptions are trp 610 and phe 588 of gela - ctd . other differences are seen in the loop connecting blades iii and iv . here , asp 615 becomes isosteric , but uncharged asn 424 in cli - ctd , while asn 611 , ala 612 , pro 614 of gela - ctd are changed to other residues in cli - ctd . only ile 623 is conserved but this residue has only backbone atoms which are surface accessible in the structure . clearly , gela - ctd and cli - ctd would present a very different charge distribution and contact surface along their connecting loops . comparison of tbs - 2 of the aligned molecules , reveals more subtle effects . phe 650 , which protrudes out into solvent in the gela - ctd , as well as tyr 636 , gly 651 and asp 656 are not conserved in cli - ctd . again , these changes create both a different contact surface and different surface potentials which would reduce the possibility of cli - ctd binding timp - 2 at this region . a sequence alignment of other mmp c - terminal domains was performed ( fig5 ) to see if features noted in the comparison of cli - ctd and gela - ctd held true for other mmp family members particularly those not known to bind timp - 2 . one of the most striking features of the alignment is how well conserved some of the residues necessary for full timp - 2 binding are throughout many members of the mmp family . just as in the comparison with cli - ctd , lys 579 , arg 590 , lys 604 and lys 645 are well conserved in many members of the family . gelb - ctd shows the least homology among this group of positively charged residues . also , the negative charges in cli - ctd , which occurred at trp 574 , lys 576 , and ala 609 in gela - ctd are also seen in many of the members of the mmp family . only gela , gelb and mt1 - mmp do not place negative charges in the cavity . further examination of the sequence alignment shows that gela - ctd has very little homology with other member in the region between ala 609 - pro 614 . these residues make up the loop region which connect blades iii and iv . other members show a lot of homology over the region and fit well to a dfpgix ( where x is either g , d , e or p ) consensus sequence . it is interesting to note that gela is only homologous in this region at ile 613 whose sidechain is buried in the structure and could not interact directly with bound timp - 2 . the alignment of residues from the tbs - 2 region shows that gela and gelb are most similar , although not identical , over this stretch . many of these residues , except for leu 645 and lys 646 , make up most of what is considered tbs - 2 in gela - ctd . asp 615 is also considered part of tbs - 2 and is homologous in gelb . mt1 - mmp and stromelysin - 3 are the next most similar with residues which are identical to or make conservative substitutions at asp 615 and asp 656 . a comparison of aligned structures made between gela - ctd and the model of gelb - ctd shows they share more homology over the timp - 2 binding surface than cli - ctd . as seen from the sequence alignment , residues in tbs - 2 were highly homologous . tyr 636 , val 648 , gly 651 , asp 615 and asp 656 from gela - ctd are structurally conserved in gelb - ctd . only one residue is significantly different , phe 650 becomes val 694 in gelb - ctd . the turn connecting the third and fourth strands of blade iv required rebuilding in gelb - ctd due to the insertion of residues . but for the most part , these residues were arranged similarly in both structures . the loop connecting the third and fourth strand of blade iv had to be rebuilt to accommodate the insertion of two residues . this increased the size of the loop , but still placed leu 688 and asn 689 of gelb - ctd near leu 645 and lys 646 of gela - ctd . so while no new charges are introduced , the contact surface in this region would be somewhat different in gelb - ctd . in contrast to tbs - 2 , tbs - 1 of the model of gel - ctd diverges dramatically from gela - ctd . a great number of changes have been made in the non - polar cavity residues . trp 574 , tyr 581 , phe 588 , phe 602 , and trp 610 are not conserved in gelb - ctd . the sequence changes make the cavity much deeper in gelb - ctd with a cavity floor defined by the contribution of non - polar atoms from leu 688 and met 653 . other residues conserved between the two in tbs - 1 are some of the positively charged residues which lie about the cavity . lys 579 and arg 590 of gela - ctd are conserved in gelb - ctd . gelb - ctd makes a conservative substitution at lys 576 where the positive charge is conserved . other positive charges , such as lys 604 and lys 646 of gela - ctd , become polar , but uncharged residues in gelb - ctd . overall , there are fewer positively charged residues in the tbs - 1 region of gelb - ctd than found in either gela - ctd or cli - ctd . the loop region connecting blades iii and iv in gelb - ctd , which shows intermediate homology to gela - ctd , required slight rebuilding due to the insertion of leu 659 in gelb - ctd . the insertion makes it impossible to model the c . sub . α positions of the loop residues identically , so it is modeled to have a different structure than either gela - ctd of cli - ctd . pro 614 of gela - ctd is conserved in gelb - ctd but does superimpose due to the rebuilding of the loop . asn 611 and ala 612 are different in gelb - ctd , but are identical to residues seen in the cli - ctd structure . mutants of gela - ctd that don &# 39 ; t inhibit membrane dependant activation of gela are clustered within the timp - 2 binding site interaction of the gela - ctd with cell surface is essential for activation of the pro - enzyme . consequently membrane dependent activation of gela is competitively inhibited in the presence of the recombinant gela - ctd ( see introduction and discussion ). the results we have reported earlier support the hypothesis that assembly of mmp / timp - 2 / gela - ctd complex promotes activation of gela and inhibition of gela activation in the presence of excess of gela - ctd is due to a direct competition with the binding of gela to the inhibitor timp - 2 in the complex . a direct approach to the question whether the assembly of this complex is indeed a prerequisite for gela activation is to determine whether activation inhibition and timp - 2 binding properties of gela - ctd can be separated . therefore we investigated the ability of all 50 gela - ctd mutants described above to inhibit membrane dependent activation of gela in vitro . increasing amounts of purified wt or mutant gela - ctd protein was added to membrane gela activation reaction and the amount of remaining proenzyme species , a measure of activation inhibition , was analyzed on zymograms . the results are presented in fig6 . most noticeable , is the fact that point mutations outside of the timp - 2 binding site have inhibited gela activation as did wt gela - ctd ( t2 + ai + phenotype ). furthermore , the only point mutations which showed a loss in activation inhibition were those found in the timp - 2 binding site described above . however , mutants that exhibited a dramatic loss of timp - 2 binding activity ( ki / kd & gt ; 100 ) segregated into two groups . mutants of lys 576 , arg 590 , and trp 574 completely failed to inhibit gela activation ( t2 - ai - phenotype ). mutants of asp 615 , and lys 646 were indistinguishable from wt , while mutant glu 641 + gly 651 . increment . arg shown only a slight loss of activation inhibition activity . mutants asp 656 and tyr 636 exhibited a significant loss of timp - 2 binding ( ki / kd = 10 ) and a comparable loss of activation inhibition activity . mutant lys 604 showed a considerable loss in timp - 2 binding ( ki / kd = 25 ) but had little or no effect on activation inhibition . all other mutants ( see table 1 and fig6 ) characterized by a very moderate loss of timp - 2 binding ( ki / kd & lt ; 10 ) and were indistinguishable from wt in the activation inhibition assay . thus point mutants of residues in the timp - 2 binding site do not always show a complete correlation between the degree of loss of timp - 2 binding and their respective loss of activation inhibition activity . mutants that do show such correlation are distributed between tbs1 and 2 . those with severe loss of both functions ( trp 574 , lys 576 , and arg 590 ) are clustered together in the tbs - 1 region of the timp - 2 binding site ( see fig1 ). two mutants with moderate effect on both functions ( asp 656 and tyr 636 ) are found in tbs2 . two mutants with the greatest disparity in effect on timp - 2 binding and activation inhibition ( asp 615 and lys 646 ) are found on the border between tbs1 and 2 . finally it is important to note an absence of the mutants with t2b + ai - phenotype . since gela - ctd displays pseudo four - fold symmetry , it is interesting to consider what structural features distinguish the timp - 2 binding site located roughly at the interface between blades iii and iv from similar sites which would be found at the interfaces between the three other blades . a grasp representation of the gela - ctd structure with electrostatic potentials displayed at the surface of the molecule shows that the interface between blades iii and iv is unique in having a high concentration of positive charge ( fig3 ) located near the interface . furthermore , the outermost strand of blade iv is unique in the gela - ctd ) structure in that it forms a regular anti - parallel β - strand with no β - bulges as seen in blades ii and iii . the fourth strand of blade i contains no β - bulges , but its backbone h - bonding pattern with the third strand is significantly distorted by the presence of cis proline , pro 506 . cis prolines are identified in the fourth strands of all the blades except iv . thus , the highly localized positive charge and a canonical β - strand conformation of an adjacent blade would , in part , create a unique binding surface which would not be found at related positions of this highly symmetrical molecule . having defined a timp - 2 binding site on gela - ctd , it is possible to look at known structures and sequences of related mmps and develop an idea of how binding and specificity are achieved . the two basic assumptions in such an analysis are that 1 ) all related mmp sequences adopt the same fold as described for gela - ctd and cli - ctd and 2 ) timp - 1 binds gel b - ctd in a manner comparable to the timp - 2 binding of gela - ctd . if these two assumptions are true than some interesting observations on the nature of timps binding to mmps may be credibly made and are discussed below . 1 ) the positively , charged residues in tbs - 1 of gela - ctd are required but not sufficient for binding timp - 2 . while the mutation studies show that these residues are clearly required for full timp - 2 binding activity , the fact that many of these charged residues are conserved in mmps which are not known to bind timp - 2 suggests that the presence of these residues is not sufficient for causing timp - 2 binding . timp - 2 has a negatively charged c - terminal tail sequence , efldiedp , which when removed shows a reduced binding kinetics profile similar to that of timp - 1 ( 30 ). timp - 1 does not have a negatively charged sequence at its c - terminus . since electrostatic forces often effect long range interactions between molecules , the positive charges may serve to draw the timp - 2 molecule near the binding site of gela - ctd prior to docking . once bound , the electrostatic interactions are maintained , but van der waal forces predominate in directing full , specific binding . it is possible that the negative charges described in the tbs - 1 region of other non - timp binding mmps reduce the effect of the long range interaction and also minimize the electrostatic interaction between the negatively charged timp - 2 sequence and the conserved positively charged residues of these mmps . it is also interesting to note that gel b , which specifically binds timp - 1 , has two fewer positively charged residues than gela in the timp - 2 binding surface . perhaps , these two residues , lys 604 and lys 646 , play a role in binding the negatively charge tail of timp - 2 . also , lys 595 and lys 597 , which were not mutated in this study , but are near the binding site , may interact with the timp - 2 tail . lys 597 is of particular interest since it is not conserved in any of the other mmps . 2 ) interaction with tbs - 1 is likely to contribute more than tbs - 2 to specificity of timp - 2 binding to gela - ctd . gela - ctd and gel b - ctd share considerable homology in the tbs - 2 region so specificity will most likely not be determined in that region . presumably , timp - 1 and timp - 2 will bind the tbs - 2 region similarly in both molecules . the region of the timp - 2 binding site that diverges the most between gela and b are found in tbs - 1 . here , gel b is missing two positively charged residues . also , sequence analysis and model comparison show the two would have different non - polar cavities . the gel b cavity is deeper and broader than that of gela . furthermore , the loop ala 609 - asp 615 connecting blades iii and iv of gela - ctd is different than that of gel b - ctd . the loop differs in both sequence and backbone structure by virtue of an insertion of a leu residue in the gel b sequence . 3 ) van der waal forces play a major role in timp - 2 binding and specificity . the timp - 2 binding site of gela - ctd represents a broad surface which is conservatively estimated to cover just over 1000 å 2 and is composed mainly of uncharged residues . of the charged residues in the binding site , many are found in the c - terminal domains of non - timp binding mmps suggesting that the presence of the charged residues alone is not enough to account for binding . likewise , the fact that gela - ctd shares so many charged residues in common with gel b - ctd suggests that specific binding of timp - 2 is not a result of simple electrostatic interactions . most likely , the strength and specificity of the binding comes as much from van der waal interactions as from electrostatic attraction . biochemical studies have show n that timp - 2 binding to gela - ctd is sensitive to low ph and ionic detergent but resistant to high salt ( 20 , 30 ). these results suggest that there is both a significant ionic and van der waal component to the timp - 2 binding of gela - ctd . the timp - 2 binding site of gela - ctd described in this paper represents a broad surface of approximately 1000 å 2 with a high positively charged region clustered about a hydrophobic cavity and an extended , mostly uncharged , van der waal contact surface . the charged region of the site accounts for the ph and ionic strength dependence of binding , while the cavity and broad , van der waal surface of the site accounts for the requirement of detergent to fully disassociate the complex . one of the most prominent sequence characteristics of non - timp binding mmps is their propensity to have negatively charged residues in or near the cavity in tbs - 1 . these charges were seen as potentially having a detrimental effect on timp - 2 binding . as noted earlier , besides gela and b , only mt1 - mmp is identified as not having negative charges at residues found in or near the cavity . furthermore , as seen in fig4 many of the sequence features shared by gela and b are also found in mt1 - mmp . pro 614 , asp 615 , and asp 656 residues of gela are conserved in mt1 - mmp as well . while there are still many sequence features among the timp - 2 binding site residues not shared by gela and mt1 - mmp , mt1 - mmp is by far the most homologous of the non - gelatinase mmps . taken together , these observations suggest that mt1 - mmp may be able to bind timp - 2 . in fact recent observations support this conclusion ( 25 , 26 ). interaction of inhibitors with pro - gelatinases is mediated by its c - terminal domain ( 20 - 22 ). the timp - 2 c - terminal domain is 67 residues long from cys 128 - pro 194 . it has six cysteines which , by analogy to timp - 1 , are assumed to form three disulfide bonds ( 31 ). thus , the c - terminal domain of timp - 2 is likely to be compact and globular . the c - terminal portion is separated from the n - terminal - domain by only a single residue , glu 127 , so the n - and c - terminal domains of timp - 2 must be located extremely close to one another in space . given the large surface area of the timp - 2 binding site of gela - ctd , it is possible that portions of the n - terminal domain of timp - 2 also participate in binding . since the n - terminal domains of timp - 1 and timp - 2 show greater homology ( 44 % identity ) than their respective c - terminal domains ( 27 % identity ) and the tbs - 2 sections of gela and b are far more similar than their tbs - 1 regions , it is possible that portions of the n - terminal domain of timp - 2 binds blade iv residues of gel - ctd . this would mean that tbs - 1 of gela - ctd is bound by the c - terminal portion of timp - 2 . as stated above , the c - terminal domain of timp - 2 contains a negatively charged sequence which is required for full binding activity . tbs - 1 has a lot of positively charged residues , particularly in gela , and based on sequence and model comparison of gela and b shows far less sequence and structural homology than in tbs - 2 . for this reason , it is likely that tbs - 1 of gela determines its specificity for timp - 2 as opposed to timp - 1 . furthermore , assuming the c - terminal domain of timp - 2 is not elongated , portions of tbs - 2 may in fact bind parts of the n - terminal domain of timp - 2 . gela is a multi - domain protein containing a catalytic domain , a domain with three type ii fibronectin - like repeats , and a c - terminal domain . the quaternary arrangement of these domains is still unknown . biochemical evidence from deletion studies and crosslinking experiments suggest that active gela is bound simultaneously at its catalytic and c - terminal domains by the n - terminal and c - terminal domains of timp - 2 . timp - 2 is a relatively small , globular protein ( mw = 21 kda ) whose n - terminal portion is compact , adopts an ob - fold ( 32 ), and competitively inhibits substrate cleavage by binding the catalytic domain of mmps . given the timp - 2 binding site described in the paper , it may be assumed that the active site of the catalytic domain is located relatively near the interface between blades iii and iv of the c - terminal domain when bound to timp - 2 . whether the domains of gela adopt a rigid conformation or tumble freely in solution has yet to be determined and is the subject of future study . the soluble mmp , gela , is recruited to the cell surface where it is activated in a mt1 - mmp dependent fashion ( reviewed 33 ). the initial mt1 - mmp dependent asn 37 - leu pro - peptide cleavage is inhibited by excess of timp - 2 and competitively inhibited by gela - ctd . accordingly , truncated gela that lacks its c - terminal domain is not activatable by this mechanism ( 13 ). thus compelling evidence supports the role of gela - ctd in recruitment of the proenzyme to the cell surface that is a prerequisite to its activation . the role of timp - 2 in this mechanism is more controversial . it is clear that the recombinant gela - ctd can interact with cell surface via binding to the activated mt1mmp / timp - 2 complex to form a tri - molecular complex of activated mt1 - mmp / timp - 2gela - ctd . it is also possible to demonstrate that carefully titrated amounts of timp - 2 can increase the efficiency of activation in cell membrane dependent , timp - 2 depleted system . these results support the hypothesis that assembly of mt1 - mmp / timp - 2 / gela - ctd complex promotes cell surface gela activation . conversely , it has become evident that soluble mt1 - mmp lacking its transmembrane domain can faithfully cleave gela propeptide at asn 37 - leu ( 26 ). in this soluble purified system , timp - 2 functions solely as a specific mt1 - mmp inhibitor . cleavage of the gela propeptide does not depend on the presence of its c - terminal domain and , contrary to membrane dependent gela activation , truncated gela is a substrate for soluble activated mt1 - mmp . thus it is essential to ascertain by other approaches whether the assembly of the mt1 - mmp / timp - 2 / gela complex on the cell membrane is indeed a prerequisite for gela activation . since inhibition of gela activation in the presence of excess of gela - ctd is due to a direct competition with the cell surface binding of gela , a powerful approach to the above question is to determine whether activation inhibition and timp - 2 binding properties of gela - ctd can be separated . our previous experiments using chemical and proteolytic modifications of gela - ctd failed to achieve such an effect ( 9 , 10 ). all manipulations of gela - ctd abolished both its timp - 2 binding and the inhibitory activity in the membrane activation assay . mutagenesis provides an infinitely better approach to address this question . a complete correlation between loss of activation inhibition function and the ability to bind timp - 2 can be a conclusive evidence that timp - 2 serves as a mediator of gela activation , provided that a sufficient number of the timp - 2 binding site mutants were analyzed . here , we investigate the ability of all fifty gela - ctd mutants described above to inhibit membrane dependent activation of gela in vitro . all mutants outside of the timp - 2 binding site inhibit gela activation as well as wt gela - ctd ( t2 + ai + phenotype ). mutants that exhibited a dramatic loss of timp - 2 binding activity ( ki / kd & gt ; 100 ) segregated into classes . mutants with alanine substitution of lys 576 , arg 590 , and trp 574 failed to inhibit gela activation ( t2b - ai - phenotype ). asp 615 , and lys 646 mutants were indistinguishable from wt , while a double with alanine substituting for glu 641 and arg for gly 651 shown only a slight loss of activation inhibition activity . other mutants in the timp - 2 binding site show moderate to no effect on activation inhibition . importantly no mutants with t2b + ai - phenotype were found . thus , although all ai - mutants are concentrated in the timp - 2 binding site , and no t2b + ai - mutants were isolated , the correlation between loss of timp - 2 binding and activation inhibition properties of gela - ctd mutants is not absolute . this inconsistency can be explained by differences in the assays used to measure the effects of the point mutations . for example , only a part of the timp - 2 binding site of gela - ctd described here actually interacts with timp - 2 bound to mt1 - mmp . this may be due to the nature of timp - 2 interaction with mt1 - mmp that exposes only a portion of timp - 2 c - terminal domain necessary to engage the entire gela - ctd binding site . thus only a fraction of mutants in the gela - ctd timp - 2 binding site loses the capacity to competitively inhibit activation ( t2b - ai -- ). in this case the assembly of mt1 - mmp / timp - 2 / gela complex is still a prerequisite for gela activation and the question remains how the mt1 - mmp occupied and inhibited by timp - 2 is able to cleave the gela propeptide . several explanations can be invoked for the mechanism of this reaction . an activation model can be proposed where mt1 - mmp / timp - 2 complex acts as a receptor for soluble gela and forms a trimolecular presentation complex . another molecule of timp - 2 free mt1 - mmp may then perform the asn 37 - leu pro - peptide cleavage . as a result , activation of gela is sensitive to the ratio of the unoccupied activated mt1 - mmp to mt1 - mmp / timp - 2 complex and saturating amounts of timp - 2 inhibit activation . a second set of gela activation models can be proposed based on the data presented here , if the existence of t 2 b - ai + and t2b - ai + mutants is interpreted to mean that gela - ctd binds to another , yet to be identified , cell surface receptor and the resulting complex is activated by timp - 2 free mt1 - mmp . for example , binding of the gela - ctd can occur through interaction with vβ5 integrin as recently reported ( 34 ). the results of mutagenesis indicate that timp - 2 and putative receptor binding sites on gela - ctd overlap since no ai - mutants were found outside of the timp - 2 binding site . this overlap can potentially explain why timp - 2 can inhibit binding of gela to the cell surface even in the case that it is mediated by a receptor other than mt1 - mmp / timp - 2 complex . earlier we have described an analogous but soluble complex of gelb / cli where the cli and timp - 1 binding sites of gelb - ctd overlap ( 22 ). table 1______________________________________gel a - ctd mutants that affect its timp - 2 binding activity ( ki / kd & gt ; 1 ). wild type kd and mutant ki was determined as in fig7 . d and id - mark mutants affecting timp - 2 binding directly and indirectly respectively . mutant # ki / kd mutant # ki / kd______________________________________ # 28 id 8 # 247 d & gt ; 500 asp . sup . 569 → ala lys . sup . 646 → ala # 31 d 6 # 250 d & gt ; 500 lys . sup . 579 → ala trp . sup . 574 → ala # 39 d 25 # 252 d 10 lys . sup . 604 → ala tyr . sup . 636 → ala # 41 d 300 # 255 d 8 asp . sup . 615 → ala phe . sup . 650 → ala # 46 id & gt ; 500 # 257 d 3 glu . sup . 641 → ala + gly . sup . 651 → ala gly . sup . 651 → arg # 229 d ≧ 500 # 258 id 10 lys . sup . 576 → ala asp . sup . 656 → ala # 234 d & gt ; 500 # 259 d 3 arg . sup . 590 → ala asn . sup . 611 → ala______________________________________ 1 . birkedal - hansen , h . ( 1995 ) proteolytic remodeling of extracellular matrix . curr . opin . cell biol . 7 : 728 - 735 . 2 . kleiner , d . e ., and stetler - stevenson , w . g . ( 1993 ). curr . opin . cell biol . 5 : 89 - 897 . 4 . stetler - stevenson w g ., aznavoorian s ., liotta l a . ( 1993 ) [ review ] annual review of cell biology . 9 : 541 - 73 . 5 . stetler - stevenson w g ., liotta l a ., kleiner d e jr . ( 1993 ) [ review ] faseb journal . 7 ( 15 ): 1434 - 41 . 6 . liotta , l . a ., steeg , p . s ., and stetler - stevenson , w g . ( 1991 ) cell 64 : 327 - 336 . 7 . khokha , r ., waterhouse , p ., yagel , s ., lala , p . k ., overlal , c . m ., norton , g ., and denhardt , d . t . ( 1989 ) science 243 : 947 - 950 . 8 . sato h . takino t . okada y . cao j . shinagawa a . yamamoto e . seiki m . nature . 370 ( 6484 ): 61 - 5 , 1994 9 . strongin a y , marmer b l , grant g a , goldberg g i ., ( 1993 ) j . biol . chem . ; 268 : 14033 - 14039 10 . strongin , a . y ., collier , i . e ., bannikov , g ., marmer , b . l ., grant , g . a ., goldberg , g . i . ( 1995 ) journal of biol . chem . 270 ( 10 ): 533 - 8 . 11 . ward r v . atkinson s j . slocombe p m . docherty a j . reynolds j j . murphy g . ( 1991 ) biochimica et biophysica acta . 1079 ( 2 ): 242 - 6 . 12 . azarn h s . thompson e w . ( 1992 ) cancer research . 52 ( 16 ): 4540 - 4 . 13 . murphy g . willenbrock f . ward r v . cockett m i . eaton d . docherty a j . ( 1992 ) biochemical journal . 283 ( pt 3 ): 637 - 41 . 14 . brown p d . kleiner d e . unsworth e j . stetler - stevenson w g . ( 1993 ) kidney international . 43 ( 1 ): 163 - 70 . 15 . seltzer j . l ., lee a . y ., akers k . t ., sudbeck b ., eileen a . southon , wayner e . a ., eisen a . z . ( 1994 ) experimental cell research 213 ( 2 ): 365 - 74 . 16 . overall c m , sodek j . ( 1990 ) j . biol . chem 265 , 21141 - 51 17 . collier , i . e ., wilhelm , s . m ., eisen , a . z ., marmer , b . l ., grant , g . a ., seltzer , j . l ., kronberger , a . m ., he , c ., bauer , e . a ., and goldberg , g . i . ( 1988 ) j biol chem 263 ( 14 ): 6579 - 6587 . 18 . atkinson , s . j ., et al . ( 1995 ) j . biol . chem . 270 : 30479 - 30484 . 19 . hiroshi sato , takahiso takino , takeshi kinoshita , kazushi lmai , yasunori okada , william g . stetler - stevenson , motoharu seiki . ( 1996 ) febs letters 385 , 238 - 240 ,. 20 . goldberg , g . i ., marmer , b . l ., grant , g . a ., eisen , a . z ., wilhelm , s . m . and he , c . ( 1989 ) proc natl acad sci usa 86 : 8207 - 8211 . 21 . goldberg , g . i ., strongin , a , collier , i . e ., genrich , l . t ., marmer , b . l . ( 1992 ) j biol chem . 267 ( 7 ): 4583 - 91 ; 22 . fridman , r ., fuerst , t . r ., bird , r . e ., hoyhtya , m ., oeikuct , m ., kraus , s ., komarek , d ., liotta , l . a ., berman , m . l ., stetler - stevenson , w . g . ( 1992 ) j . biol . chem . 267 : 15398 - 15405 . 23 . willenbrock , f ., murphy g . ( 1994 ) american journal of respiratory & amp ; critical care medicine . 150 ( 6 pt 2 ): s165 - 70 . 24 . declerck , y . a ., yean , t . d ., lee , y ., tomich , j . m ., langley , k . e . ( 1993 ) biochemical j 289 ( pt 1 ): 65 - 69 . 25 . duangqing pei and stephen weiss , ( 1996 ) j . biol . chem . 271 , 9135 - 9140 . 26 . hiroshi sato , takeshi kinoshita , takahiso takino , kazuo nakayama , and motoharu seiki . ( 1996 ) febs letters ( in press ) 27 . libson , a . m ., gittis , a . g ., collier , i . e ., marmer , b . l ., goldberg , g . i ., lattman , e . e . ( 1995 ) nature , structural biology . 2 ( 11 ): 938 - 942 . 33 . hiroshi sato , motoharu seiki . ( 1996 ) a review j . biochem . 119 , 209 - 215 34 . brooks , p . c ., stromblad , s ., sanders , l c ., von schalscha , t . l ., aimes , r . t ., stetler - stevenson , w . g ., quigley , j . p ., cheresh , d . a . ( 1996 ) cell 85 : 683 - 693 . 36 . evans , s . v ., ( 1993 ) setor : j . molec . graphics 11 134 - 145 . __________________________________________________________________________ # sequence listing - - - - ( 1 ) general information : - - ( iii ) number of sequences : 18 - - - - ( 2 ) information for seq id no : 1 : - - ( i ) sequence characteristics : ( a ) length : 42 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 1 : - - asn trp ser lys asn lys lys thr - # tyr ile phe ala gly asp lys - # 5 - # 10 - # 15 - - phe trp arg tyr asn glu val lys - # lys lys met asp pro gly phe - # 20 - # 25 - # 30 - - pro lys leu ile ala asp ala trp - # asn ala ile pro - # 35 - # 40 - - - - ( 2 ) information for seq id no : 2 : - - ( i ) sequence characteristics : ( a ) length : 42 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id : no : 2 : - - arg ser gly arg gly lys met leu - # leu phe ser gly arg arg leu - # 5 - # 10 - # 15 - - trp arg phe asp val lys ala gln - # met val asp pro arg ser ala - # 20 - # 25 - # 30 - - ser glu val asp arg met phe pro - # gly val pro leu - # 35 - # 40 - - - - ( 2 ) information for seq id no : 3 : - - ( i ) sequence characteristics : ( a ) length : 42 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 3 : - - phe glu glu asp thr gly lys thr - # tyr phe phe val ala his glu - # 5 - # 10 - # 15 - - cys trp arg tyr asp glu tyr lys - # gln ser met asp thr gly tyr - # 20 - # 25 - # 30 - - pro lys met ile ala glu glu phe - # pro gly ile gly - # 35 - # 40 - - - - ( 2 ) information for seq id no : 4 : - - ( i ) sequence characteristics : ( a ) length : 42 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 4 : - - ser glu glu asn thr gly lys thr - # tyr phe phe val ala asn lys - # 5 - # 10 - # 15 - - tyr trp arg tyr asp glu tyr lys - # arg ser met asp pro ser tyr - # 20 - # 25 - # 30 - - pro lys met ile ala his asp phe - # pro gly ile gly - # 35 - # 40 - - - - ( 2 ) information for seq id no : 5 : - - ( i ) sequence characteristics : ( a ) length : 42 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 5 : - - his phe glu asp thr gly lys thr - # leu leu phe ser gly asn gln - # 5 - # 10 - # 15 - - val trp arg tyr asp asp thr asn - # his ile met asp lys asp tyr - # 20 - # 25 - # 30 - - pro arg leu ile glu glu asp phe - # pro gly ile gly - # 35 - # 40 - - - - ( 2 ) information for seq id no : 6 : - - ( i ) sequence characteristics : ( a ) length : 41 amino - # acids ( b ) type : amino acid ( c ) topology : linear ( ii ) molecule type : pep - # tide - - ( xi ) sequence description : seq id no : 6 : - - ser asp lys glu lys asn lys thr - # tyr phe phe val glu asp lys - # 5 - # 10 - # 15 - - tyr trp arg phe asp glu lys arg - # asn ser met glu pro gly pro - # 20 - # 25 - # 30 - - lys gln ile ala glu asp phe pro - # gly ile asp - # 35 - # 40 - - - - ( 2 ) information for seq id no : 7 : - - ( i ) sequence characteristics : ( a ) length : 42 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 7 : - - ser asp lys glu lys lys lys thr - # tyr phe phe ala ala asp lys - # 5 - # 10 - # 15 - - tyr trp arg phe asp glu asn ser - # gln ser met glu gln gly phe - # 20 - # 25 - # 30 - - pro arg leu ile ala asp asp phe - # pro gly val glu - # 35 - # 40 - - - - ( 2 ) information for seq id no : 8 : - - ( i ) sequence characteristics : ( a ) length : 42 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 8 : - - trp gly pro glu lys asn lys ile - # tyr phe phe arg gly arg asp - # 5 - # 10 - # 15 - - tyr trp arg phe his pro ser thr - # arg arg val asp ser pro val - # 20 - # 25 - # 30 - - pro arg arg ala thr asp trp arg - # gly val pro ser - # 35 - # 40 - - - - ( 2 ) information for seq id no : 9 : - - ( i ) sequence characteristics : ( a ) length : 40 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 9 : - - trp met pro asn gly lys thr tyr - # phe phe arg gly asn lys tyr - # 5 - # 10 - # 15 - - tyr arg phe asn glu glu leu arg - # ala val asp ser glu tyr pro - # 20 - # 25 - # 30 - - lys asn ile lys val trp glu gly - # ile pro - # 35 - # 40 - - - - ( 2 ) information for seq id no : 10 : - - ( i ) sequence characteristics : ( a ) length : 46 ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 10 : - - asp asn leu asp ala val val asp - # leu gln gly gly gly his ser - # 5 - # 10 - # 15 - - tyr phe phe lys glu ala tyr tyr - # leu lys leu glu asn gln ser - # 20 - # 25 - # 30 - - leu lys ser val lys phe gly ser - # ile lys ser asp trp leu gly - # 35 - # 40 - # 45 - - cys - - - - ( 2 ) information for seq id no : 11 : - - ( i ) sequence characteristics : ( a ) length : 45 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 11 : - - asp thr his asp val phe gln tyr - # arg glu lys ala tyr phe cys - # 5 - # 10 - # 15 - - gln asp arg phe tyr trp arg val - # ser ser arg ser glu leu asn - # 20 - # 25 - # 30 - - gln val asp gln val gly tyr val - # thr tyr asp ile leu gln cys - # 35 - # 40 - # 45 - - - - ( 2 ) information for seq id no : 12 : - - ( i ) sequence characteristics : ( a ) length : 43 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 12 : - - asn lys val asp ala val phe gln - # lys asp gly phe leu tyr phe - # 5 - # 10 - # 15 - - phe his gly thr arg gln tyr gln - # phe asp phe lys thr lys arg - # 20 - # 25 - # 30 - - ile leu thr leu gln lys ala asn - # ser trp phe asn cys - # 35 - # 40 - - - - ( 2 ) information for seq id no : 13 : - - ( i ) sequence characteristics : ( a ) length : 43 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 13 : - - his lys val asp ala val phe met - # lys asp gly phe phe tyr phe - # 5 - # 10 - # 15 - - phe his gly thr arg gln tyr lys - # phe asp pro lys thr lys arg - # 20 - # 25 - # 30 - - ile ile thr leu gln lys ala asn - # ser trp phe asn cys - # 35 - # 40 - - - - ( 2 ) information for seq id no : 14 : - - ( i ) sequence characteristics : ( a ) length : 43 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 14 : - - asp lys val asp ala val tyr glu - # lys asn gly tyr ile tyr phe - # 5 - # 10 - # 15 - - phe asn gly pro ile gln phe glu - # tyr ser ile trp ser asn arg - # 20 - # 25 - # 30 - - ile val arg val met pro ala asn - # ser ile leu trp cys - # 35 - # 40 - - - - ( 2 ) information for seq id no : 15 : - - ( i ) sequence characteristics : ( a ) length : 43 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 15 : - - ser lys ile asp ala val phe glu - # glu phe gly phe phe tyr phe - # 5 - # 10 - # 15 - - phe thr gly ser ser gln leu glu - # phe asp pro asn ala lys lys - # 20 - # 25 - # 30 - - val thr his thr leu lys ser asn - # ser trp leu asn cys - # 35 - # 40 - - - - ( 2 ) information for seq id no : 16 : - - ( i ) sequence characteristics : ( a ) length : 43 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 16 : - - pro lys val asp ala val leu gln - # ala phe gly phe phe tyr phe - # 5 - # 10 - # 15 - - phe ser gly ser ser gln phe glu - # phe asp pro asn ala arg met - # 20 - # 25 - # 30 - - val thr his ile leu lys ser asn - # ser trp leu his cys - # 35 - # 40 - - - - ( 2 ) information for seq id no : 17 : - - ( i ) sequence characteristics : ( a ) length : 46 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 17 : - - glu ile asp ala ala phe gln asp - # ala asp gly tyr ala tyr phe - # 5 - # 10 - # 15 - - leu arg gly arg leu tyr trp lys - # phe asp pro val lys val lys - # 20 - # 25 - # 30 - - ala leu glu gly phe pro arg leu - # val gly pro asp phe phe gly - # 35 - # 40 - # 45 - - cys - - - - ( 2 ) information for seq id no : 18 : - - ( i ) sequence characteristics : ( a ) length : 48 amino - # acids ( b ) type : amino acid ( c ) topology : linear - - ( ii ) molecule type : peptide - - ( xi ) sequence description : seq id no : 18 : - - glu ser pro arg gly ser phe met - # gly ser asp glu val phe thr - # 5 - # 10 - # 15 - - tyr phe tyr lys glu asn lys tyr - # trp lys phe asn asn gln lys - # 20 - # 25 - # 30 - - leu lys val glu pro gly tyr pro - # lys ser ala leu arg asp trp - # 35 - # 40 - # 45 - - met gly cys__________________________________________________________________________	2
with additional reference to fig4 and 5 , fig3 depicts a flow chart illustrating a method of manufacturing lcmds of the present invention . lcmds are formed using two substrates . in one embodiment , the first substrate is a silicon wafer 21 ( less than 1 mm thick ) on which many ( typically hundreds ) of ics are formed . each ic 22 includes a large number ( typically about half a million ) of active pixels comprising electrodes 40 driven by corresponding switching elements 41 . the thickness of each substrate may vary according to the application for which the lcmds will be used . the second substrate is transparent and is typically a thin glass wafer 26 having the transparent electrodes 42 of a corresponding number of lcmds . the transparent electrodes 42 are made from a transparent conductive material such as indium - tin oxide . fill holes 33 are created in one of the wafers as indicated in step 3 a . the fill holes 33 are carefully positioned so as to provide access to the chamber 35 of each lcmd 30 without damaging the ics 22 or the display area of the lcmd 30 . for example , a fill hole 33 may be positioned as illustrated in fig4 and 5 . the fill holes 33 may be created in either the glass wafer 26 or the silicon wafer 21 . if the fill holes 33 are to be in the glass wafer 26 , then they may be created using a glass drilling tool such as a laser device or a rotary drill . however , the fill holes 33 are preferably created in the silicon wafer 21 using an anisotropic etch . the anisotropic etch creates a funnel - shaped fill hole 33 in the silicon wafer 21 such that the opening in the inner surface of the silicon wafer 21 is smaller than the opening in the outer surface , as illustrated in fig5 . the anisotropic etch helps to more precisely place the fill holes 33 in the desired areas of the inner surface of the silicon wafer 21 . after the fill holes 33 are created , wafers 21 and 26 are joined as indicated in step 3 b . this step typically involves applying a sealant material around each ic 22 and then joining the wafers to form lcmd units 30 . the lcmd units 30 are then filled with liquid crystal material via the fill holes 33 , as indicated in step 3 c . the filling is preferably achieved using a standard vacuum filling technique whereby lcmds are placed in a vacuum chamber ( not shown ) in which air pressure is subsequently reduced ; the lcmd units are then lowered into a bath of liquid crystal material and the pressure in the vacuum chamber is reasserted such that the pressure difference between the lcmd chambers 35 and their surroundings forces the liquid crystal material into the lcmd chambers 35 through the fill holes 33 . other filling methods may also be used , such as , for example , injecting or pouring the liquid crystal material into the lcmds through their respective fill holes 33 . these alternative filling methods may be facilitated by the creation of outlet holes in a substrate for allowing the air inside an lcmd chamber 35 to escape while the lcmd chamber 35 is being filled with liquid crystal material . after the lcmds are filled , the fill holes 33 ( and any outlet holes ) are sealed using a sealing object , such as a plug , or a sealing material such as glue , epoxy , or solder , as indicated in step 3 d . the lcmds are then tested as indicated in step 3 e . since the lcmds are still part of the same substrates and are still physically connected , they are easily handled during testing . each row or column of lcmds may share the same testing signal ( s ) as illustrated in fig4 and discussed in the related description below . lcmds that appear to be defective are marked using , for example , an ink marker , so that they may be identified and disposed of at a later time . after the lcmds are tested , they are separated along scribe lines 36 ( as indicated in step 3 f ) using , for example , a scribe and break process as discussed above . by following the above described steps , the debris caused by the scribe and break process should not affect the quality or performance of the lcmds since they are filled and sealed before debris are generated . it should be noted that in some implementations , steps 3 a - 3 f may occur out of the order illustrated in fig3 . as a non - limiting example , step 3 b may occur before step 3 a . furthermore , each one of steps 3 a - 3 f may comprise sub - steps . [ 0025 ] fig4 is a top view of an example lcmd substrate assembly formed by the silicon wafer 21 and the glass wafer 26 before being divided into individual lcmds . for illustration purposes only , the silicon wafer 21 is shown to contain only 9 ics . typically , however , such a silicon wafer would contain hundreds of ics . each ic , such as ic 22 , is surrounded by a sealant wall 23 and is resistively connected to other ics and to a testing terminal , such as testing terminal 25 , located on the silicon wafer 21 and used for receiving a testing signal . a glass wafer 26 covers the ics and is joined to the silicon wafer via the sealant walls 23 that surround the ics . the glass wafer 26 is layered with typically one transparent electrode 42 ( fig5 ) per lcmd . transparent electrodes 42 are made from a transparent material such as indium - tin oxide . parallel paths , such as paths 28 and 29 are used to reduce the impact of open circuits during testing . the glass wafer 26 is placed over the silicon wafer in such a way as to not cover the testing terminals on the silicon wafer . [ 0026 ] fig5 is a cross sectional view of a simplified version an lcmd 30 of fig4 . lcmd 30 contains an lcmd chamber 35 that is filled with liquid crystal material through fill hole 33 . the filling is preferably performed in a vacuum chamber as discussed above . after the lcmd chamber 35 is filled , the fill hole 33 is sealed using a sealing object , such as a plug , or a sealing material such as glue , epoxy , or solder . the filling and testing processes of this invention are easier than the traditional filling and testing processes since lcmds do not have to be individually handled . instead , lcmds 30 are filled and tested before they are separated . furthermore , fewer defects are caused during the new filling process since no debris from the scribe and break process are pulled into the lcmds . [ 0027 ] fig6 illustrates the testing of an lcmd in accordance with an embodiment of the present invention . for illustration purposes only , very few pixel electrodes 40 and corresponding switching elements 41 are shown . however , each lcmd tested may contain hundreds of thousands or even millions of pixels . after the lcmds are filled and sealed , but before they are separated , an electric signal is sent to one or more ics 22 through a testing terminal , such as testing terminal 25 ( fig4 ). the testing signal is routed through a connection 54 to a switching element 53 that is fabricated in or forms part of the ic 22 . each connection , such as connections 54 and 56 , may be resistive and / or may incorporate a resistive element . the testing signal causes the switching element 53 to connect the pixel electrodes 40 to a grounding terminal 52 via respective switching elements 41 . the grounding terminal 52 may be located on the silicon wafer and may be grounded through a connection that is routed between scribe lines . with all the pixel electrodes 40 grounded , a corresponding transparent electrode 42 ( fig5 ) on the glass wafer 26 may be driven with varying voltages to create an all “ black ”, an all “ white ”, and / or an intermediate gray display . optical testing equipment such as , for example , a specialized camera , can then be used to evaluate the lcmd &# 39 ; s performance in response to the testing signals . the optical testing equipment tests to see if the lcmd produces a non - uniform image . an lcmd image may be non - uniform for various reasons such as , for example , the presence of debris in the lcmd or incomplete liquid crystal filling . an lcmd that produces a non - uniform image can be marked using , for example , an ink marker , so that it can be disposed of after the lcmds are separated . the above described approach eliminates the difficulties associated with handling separate lcmds during testing as well as the unnecessary cost associated with packaging defective units . it should be emphasized that the figures described above and attached hereto and the items shown therein are not necessarily drawn to scale or accurately proportioned , but rather , they represent simplified illustrations that help to clearly set forth the principles of the invention . furthermore , the above - described embodiments of the present invention are merely possible examples of implementations setting forth a clear understanding of the principles of the invention . many variations and modifications may be made to the above - described embodiments of the invention without departing substantially from the principles of the invention . all such modifications and variations are intended to be included herein within the scope of the disclosure and present invention and protected by the following claims .	6
fig1 is a view in an operating room showing a patient 10 lying prone on a spinal table 12 . the patient &# 39 ; s chest and groin are padded with suitable padding 14 . in the illustrated example , the patient 10 is about to undergo lumbar fixation instrumentation surgery , thus making it preferable that the patient &# 39 ; s abdomen hang free . the table 12 and padding material 14 should be substantially transparent to radiation from radiologic machinery 16 which is arranged to obtain exposures at various angles through the patient &# 39 ; s lumber spinal region 18 . the radiologic machinery 16 is of the kind having a &# 34 ; c &# 34 ; arm 20 to permit rotation of an x - ray generating unit 22 at one end of the arm 20 together with an x - ray imaging unit 24 with which the generating unit 22 is aligned , so that the generating unit 22 and imaging unit 24 move in unison with one another as the c - arm 20 is positioned to expose a desired section in the patient 10 . prior to making an incision , the lumbar region 18 is prepped and draped to maintain as much a sterile operating environment as is possible . fig2 is a view of a surgical field 26 as seen after a midline incision is made in the lumbar region 18 of interest . tissue is dissected about the tips of the spinous processes , down to the tips of transverse processes 28 of the vertebrae to be fixed . retractor arms 30 keep the surgical field 26 open sufficiently to allow the desired fixation instrumentation to be applied to the spine . fig3 is an enlarged posterior view of skeletal members of the lumbar spinal region 18 in the patient 10 . the region includes a first lumbar vertebra 32 ( l1 ), second lumbar vertebra 34 ( l2 ), third lumbar vertebra 36 ( l3 ), fourth lumbar vertebra 38 ( l4 ), fifth lumbar vertebra 40 ( l5 ), and sacrum 42 comprised of fused vertebrae s1 - s5 . those vertebrae into which screw members are to be inserted are identified by the surgeon and pedicles , e . g ., pedicle 44 of l4 vertebra 38 , are probed for an entry point for the screw member . once an entrance point on the pedicle 44 is determined in accordance with surface landmarks or other known techniques ( see h . n . herkowitz , supra , at 93 - 94 ; and the adult spine , supra , at 1935 ), a screw opening is formed in the pedicle 44 . the screw opening is formed first with a suitable probe member such as a drill bit , an awl or a curette . the opening may also be tapped if desired prior to insertion of a screw member . although the lumbar spinal region 18 of a patient is shown in the drawing for purposes of illustration , the present screw insertion procedure is not limited in application to the lumbar region of the patient 10 , as will be appreciated by those skilled in the art . in one version of the present procedure , a screw opening 46 is formed in the pedicle 44 using a probe tool 48 having a combined stimulator / handle 50 , a probe tip 52 in the form of an awl or a curette , and a tool shaft 54 connecting the tip 52 to the handle 50 . tip 52 , the shaft 54 and the outer wall of the handle 50 may be made of stainless surgical steel or other suitable conductive metallic material of sufficient strength and which is capable of sterilization for repeated surgical use . before urging the tip 52 of the tool 48 into pedicle 44 , it may be necessary first to remove cortical tissue with a high speed drill . the probe tip 52 is then located at the entrance point of the pedicle 44 . a radiological image of the tip 52 at the entrance point on the pedicle 44 may be obtained with the machinery 16 although the present procedure does not require such imaging for proper screw insertion , as will be explained below . the screw opening 46 then continues to be formed with the tool 48 until the probe tip 52 attains a desired depth for the screw opening 46 in the pedicle 44 as may be verified by graduated marking indicia ( not shown in fig3 ) on the tool shaft 54 . if desired , an exposure with the radiologic machinery 16 can be made to confirm the tool depth . details of the construction of probe tool 48 are described in connection with fig5 . inside the casing of stimulator / handle 50 there is arranged the nerve stimulator circuitry shown in fig5 . the stimulator circuitry is powered by a replaceable battery 56 which is accessible through a detachable handle cap 58 ( fig3 ). the battery 56 has its negative terminal grounded to the handle casing , and the positive terminal is switched to connect to the stimulator circuitry through a latching type on / off switch 60 ( not shown in fig3 ). switch 60 is preferably located at a lower part of the handle casing so as not to be inadvertently operated during use of the tool 48 . the handle casing is connected to a patient ground such as muscle tissue within 6 - 8 cm from the surgical field , via a ground lead 59 . grounding of the tool handle casing can also be accomplished using a conventional surgical grounding pad which is affixed to the patient 10 preoperatively . a conventional timer integrated circuit u1 such as a type 555 ic device is connected to the switch 60 via supply voltage bus 61 to be powered by the battery 56 when the switch 60 is closed . the circuit u1 is set with appropriate external resistive and capacitive elements ( not shown ) to produce an output drive pulse at a repetition rate of about 2 hz at timer output terminal 62 . output terminal 62 corresponds to terminal 3 of the mentioned type 555 timer ic . a pnp current switching transistor q1 has its base terminal connected to the output terminal 62 of timer u1 through a series resistor 64 . an operating bias voltage level is set for transistor q1 by bias resistor 66 connected between the timer output terminal 62 and the supply voltage bus 61 . the emitter terminal of transistor q1 is also connected to the supply bus 61 . a pulse current transformer t1 has one terminal of its primary winding 68 connected to the collector terminal of transistor q1 , and the other terminal of winding 68 is connected to a switch bus line 70 . the cathode of a switching diode 72 and one terminal of a reverse current damping resistor 74 also connect to the collector of transistor q1 . the anode of the diode 72 and the other terminal of resistor 74 are connected to the switch bus line 70 . three momentary spst normally open push button switches 76 , 78 , and 80 , each have one terminal connected to ground , i . e ., the metal casing of the handle 50 , respectively . switch 76 corresponds to a high or h button 82 which protrudes through an opening in the handle casing as seen in fig3 . the other terminal of the switch 76 is connected to the switch bus line 70 . switch 78 corresponds to a medium or m button 84 protruding through the handle casing ( fig3 ), and has its other terminal connected to one terminal of a resistor 86 . the other terminal of resistor 86 connects to the bus line 70 . switch 80 corresponds to a low or l button 88 also protruding through the handle casing ( fig3 ) and has its other terminal connected to a terminal of resistor 90 . the other terminal of resistor 90 connects to the switch bus line 70 . secondary winding 92 of the pulse transformer t1 is connected to a pulse output indicator lamp 94 through resistor 96 . winding 92 also connects across the terminals of a load resistor 98 one terminal of which is grounded , and the other terminal of which connects to one terminal of a current limiting resistor 100 . the other terminal of the resistor 100 connects to the anode of zener diode 102 , and the cathode of diode 102 is grounded . the shaft 54 of the probe tool 48 is connected to the anode of the zener diode 102 . shaft 54 is electrically insulated by , e . g ., epoxy resin or other strong electrically insulative material from the handle casing so that output stimulation pulses will not be &# 34 ; shorted &# 34 ; to ground through the tool handle 50 . with the switch 60 set to an on state and the momentary switch 76 closed by depressing the switch push button 82 , current of a certain magnitude is switched at a 2 hz rate through the collector - emitter circuit of transistor q1 in series with the transformer primary winding 68 , by operation of the timer circuit u1 . transistor q1 is biased by resistors 64 and 66 so as to induce relatively high ( h ) level voltage pulses across the secondary winding 92 of transformer t1 with switch 76 closed . for example , pulses having a peak voltage of about 80 - 100 or more volts may be induced across the secondary winding 92 , and their presence observed via the indicator lamp 94 . a sound transducer element ( not shown in fig5 ) may also be energized by the voltage pulses so as to provide an audible indication that pulses are present at the probe tip 52 . also , zener diode 102 may comprise a number of zener diodes connected in series so as to limit the peak pulse voltage that may be applied to a patient by the probe tip 52 . with only the switch 78 closed by depressing the push button 84 , a medium ( m ) level voltage pulse is induced across the secondary winding 92 by limiting the amount of current switched by transistor q1 through the primary winding 68 . resistor 86 is selected so that the medium level corresponds , for example , to a peak voltage of about 20 volts between the probe tip 52 and ground . this medium level voltage corresponds to a potential at which leg twitching would be induced if the pulses were applied in proximity to a nerve root as explained below . when only the switch 80 is closed by depressing the push button 88 protruding from the tool handle casing , relatively low level voltage pulses are induced across the secondary winding 92 by further limiting the collector current through transistor q1 via the resistor 90 . the low level voltage pulses may , e . g ., correspond to a peak voltage of about 4 volts between the probe tip 52 and ground . the low level voltage corresponds to a potential at which leg twitching would become observable if the pulses were applied directly on the nerve root . in use , the surgeon applies the probe tip 52 at the entrance point of a pedicle into which a screw member is to be inserted , as mentioned above . the surgeon then urges the probe tip 52 into the pedicle 44 while holding the high or h level switch button 82 down and twisting the tool handle together with shaft 54 and tip 52 while urging the tool 48 in the direction of the pedicle axis . administration of anesthesia should be tailored to allow muscle contraction in the patient for this stage of the surgery . as long as no twitching of the patient &# 39 ; s leg is observed , the surgeon may continue to advance the probe tip 52 to the desired depth for the screw opening 46 . if , however , twitching movement is observed , before advancing the probe tip further the surgeon releases the h button 82 and depresses the medium ( m ) switch push button 84 . if no twitching movement is observed , the surgeon continues to advance the tool with caution in the same direction . if , however , twitching movement continues to be observed , the surgeon then depresses the low ( l ) switch push button 88 to check for a nervous reaction . if none results , the surgeon may elect to continue in the same direction as previously , or to redirect the direction of the screw opening being formed through the pedicle . if a nervous twitch is observed even with only the low level switch 80 closed , the tool 48 should be withdrawn and a new pedicle screw opening 44 formed in a direction different from the last direction in which twitching movement resulted with only the low level pulses applied through the probe tip 52 . forming of the new screw opening proceeds as above with the surgeon urging the probe tip 52 in the different direction while depressing the h level button 82 . instead of or in addition to observing the patient 10 for leg twitching while urging the probe tip 52 into the pedicle 44 , a conventional electromyography ( emg ) unit may be connected to at least one of the leg muscles including : extensor hallicus longus , tibialis anterior , peroneals , quadriceps , and gastrocnemius . such emg units will provide either visual or audible signals as an indication of nerve twitching . fig4 shows a second embodiment of a probe tool 120 according to the invention . the probe tool 120 is adapted to slide onto a shaft 122 of a commercially available awl , tap or screw head driver 124 . specifically , the driver 124 has a handle 126 that is either non - conductive or is otherwise electrically insulated from shaft 122 . the body of the probe tool 120 has a metallic sleeve 128 extending coaxially through the tool 120 , and the sleeve 128 is arranged with set screws or other conventional locking means ( not shown ) to fit tightly on the shaft 122 . the sleeve 128 is electrically insulated from an outer wall 130 of the tool body on which the three switch push buttons 82 , 84 and 88 are accessible . the output indicator lamp 94 is also mounted on the wall 130 . electrical circuitry inside the tool 120 is identical to the stimulator circuitry disclosed above in connection with fig5 except that the pulse output is applied to the conductive sleeve 128 rather than the tool shaft 54 of the probe tool 48 in fig3 . accordingly , even after forming a screw hole with the tool 48 in fig3 proper insertion of a pedicle screw can be ensured by placing the tool 120 in fig4 over the metal shaft 122 of a tap or screw driver tool , grounding the wall 130 to the patient , turning the tool 120 on , and checking for patient reaction at each of the h , m and l levels of stimulation produced by the tool 120 while the tap or screw driver 124 is engaged with a tap or screw member head in the bone tissue . again , if a patient reaction is observed even with the tool 120 set at the lowest stimulation level ( l ), the tap or screw member should be withdrawn and a new screw opening formed in a different direction using the probe tool 48 in fig3 . a sounding device ( see fig9 ) may also be provided on the tool to sound an audible indication when stimulating pulses are present on the sleeve 128 . fig6 and fig7 a to 7d show a tool handle 200 and a set of detachable probe members 210 , 212 , 214 and 216 according to the invention . unlike the stimulator / handle 50 shown in fig3 tool handle 200 does not include all of the nerve stimulator circuitry and the handle may have a grip body 218 formed of an electrically insulative material capable of withstanding routine sterilization procedures . tool handle 200 preferably has a ratcheting socket mechanism 220 at the forward end of the grip body 218 , and an insulated electrical stimulator attachment cable 222 extending from the back end of the body 218 . a cable connector 224 is provided at the end of the cable 222 remote from the tool handle 200 for attachment to a nerve stimulator unit such as one shown and described in connection with fig8 and 9 . if included on the handle 200 , the ratcheting socket mechanism 220 has a conventional square socket 226 with associated ratcheting members ( not shown ), so as to enable the handle to turn an attached probe member in only one sense of rotation ( e . g ., clockwise ) while urged toward a pedicle . the socket 226 accepts any one of a number of interchangeable probe members having square - shaped attachment ends of the same dimensions . a wire lead 228 is maintained in electrical contact with the ratchet socket 226 by a slip ring or other conventional means ( not shown ). wire lead 228 runs axially through the grip body 218 of handle 200 and through the attachment cable 222 to the remote connector 224 . lead 228 carries nerve stimulating voltage pulses supplied from an external nerve stimulator unit 246 ( fig8 & amp ; 9 ) to which connector 224 is adapted to be connected . a set of three single pole , double throw ( spdt ) momentary ( no , nc ) push switches 252 , 254 and 256 have switch push buttons protruding through corresponding openings in the forward region of the handle grip body 218 . the switches each have three wire leads which connect to their terminals and which leads extend through the attachment cable 222 to terminate at corresponding pins of the connector 224 . fig7 a - 7d are various probe members capable of being attached to the tool handle 200 of fig6 . one or more of the probe members may be used when forming an opening in a vertebral pedicle or other skeletal portion . specifically , fig7 a shows a pedicle finder 210 in the form of a curette . finder 210 has a spoon - shaped tip 210a and is useful for locating entrance points on pedicles , and for forming screw openings at least partially to a desired depth . probe member 212 ( fig7 b ) has a fine wire - like tip 212a extending with a right angle bend , and is useful for probing or exploring the wall of an opening just formed in a vertebra . the tip 212a applies nerve stimulating pulses to the wall and thus helps to determine whether or not the wall of an opening is too close to a nerve root before driving a pedicle screw member into the opening . probe member 214 ( fig7 c ) is a tap having a threaded tap portion 214a for tapping newly formed pedicle openings with a thread at a desired pitch . the tap probe member 214 may also have indicia 214b along its shank to indicate a depth ( in millimeters ) to which the tap portion 214a has penetrated . probe member 216 ( fig7 d ) is a driver having a head end 216a in the form of a hex head , a blade or a phillips head for driving any of the conventional pedicle screw members . fig8 is a view of an operating room environment , showing a patient 10 &# 39 ; lying on spinal table 12 &# 39 ; with the patient &# 39 ; s chest and groin padded with suitable padding 14 &# 39 ;. a conventional grounding pad 240 is adhered at the side of the patient &# 39 ; s chest and is connected via a ground lead 242 to a ground terminal ( g ) on a nerve stimulator unit 246 . the nerve stimulator unit 246 is explained in detail in fig9 and may be situated on a table 248 located conveniently adjacent the spinal table 12 &# 39 ; in the operating room . stimulator unit 246 has a cable connector socket 250 on its front panel which socket is configured to receive terminal pins of the cable connector 224 for coupling with the tool handle 200 in fig6 . the stimulator unit 246 also has three light indicator lamps 270 , 272 and 274 corresponding to low ( l ), medium ( m ) and high ( h ) pulse level settings for the stimulator unit 246 . a sounding device 258 mounted on the stimulator unit provides audible sounds to indicate the presence of stimulating pulses of selected magnitudes at the cable connector socket 250 for delivery to the handle 200 . the frequency or pitch of the audible sounds may correspond to the selected level setting ( l ), ( m ) or ( h ) for the pulses . fig9 is a schematic diagram of the nerve stimulator unit 246 shown in fig8 and of stimulation level selection circuitry housed in the tool handle 200 . components of the stimulator unit 246 similar to those contained in the stimulator / handle 50 in fig3 have corresponding reference numerals . the unit 246 is provided with a conventional dc power supply 260 and an on / off switch 262 for connecting the power supply 260 to the ac mains . the power supply 260 provides one or more operating voltages as may be required by components within the stimulator unit 246 . a sounding device 258 in the form of a conventional sounding circuit provides an audible note at a pitch corresponding to a peak voltage at an input terminal 258a . a sample input voltage at the terminal 258a can be obtained , for example , at a tap terminal 259 of the load resistor 98 &# 39 ;. sounding device 258 can also be incorporated in the handle / stimulator 50 in fig3 . also shown in fig9 is a circuit arrangement wherein simultaneous operation of more than one of the switches 252 , 254 , 256 on the tool handle 200 , will not allow stimulating pulses to be delivered to the connector socket 250 . that is , inadvertent operation of two or all three of the handle switch buttons will disable the pulse generating circuit in the stimulator unit . it will be understood that such a safety feature can also be incorporated in the self - contained handle / stimulator 50 in fig3 . specifically , whenever one of the switches 252 , 254 , 256 is depressed to select the corresponding voltage for the stimulating pulses , ground potential is removed from the corresponding normally closed switch terminal 252a , 254a or 256a . the ungrounded switch terminal is set at a high level via a resistor connected between the terminal and a reference voltage level from the power supply 260 . the terminals 252a , 254a , 256a are also each connected to a corresponding input terminal of an exclusive or gate the output of which is connected to a gate input of an analog switch 290 . the analog switch 290 is connected in series between the switch bus line 70 &# 39 ; and the pulse transformer t &# 39 ;. accordingly , only under the condition that one of the switches 252 , 254 , 256 is operated exclusively will the collector circuit of switching transistor q1 &# 39 ; be completed through the analog switch 290 . the closed switch 290 will enable the generation of stimulating pulses at a terminal of the connector socket 250 . each of the light indicator lamps 270 , 272 , 274 is driven by an associated lamp driver circuit 276 , 278 and 280 . the lamp driver circuits each have their inputs connected to the normally closed ( nc ) contact terminal of a corresponding one of the switches 252 , 254 , 256 . opening of one of the normally closed contacts 252a , 254a , 256a therefore causes the input of the associated lamp driver circuit to go high and the driven lamp to be illuminated . a &# 34 ; digistim iii &# 34 ; nerve stimulator made by neuro technology , inc . of houston , tex ., was set at a 2 hz pulse rate and a pulse duration of 0 . 2 milliseconds . while a patient was undergoing lumbar spinal fixation surgery that required insertion of pedicle screws into the l5 vertebra , pulse amplitude output levels were determined at which the patient &# 39 ; s leg would visibly twitch with the pulses applied ( 1 ) through the machine output leads , ( 2 ) through a so - called k - wire after insertion in the pedicle , and ( 3 ) through an inserted pedicle screw . one of the machine output leads was grounded to the patient through a needle inserted in muscle tissue near the surgical field . it was discovered that when the ungrounded machine output lead was applied directly on a nerve root at the left side of vertebra l5 , twitching occurred at a pulse level corresponding to a current setting of 1 . 5 ma . when the same lead was applied on the root at the right side of l5 , the pulse level at which twitching was observed corresponded to a current setting of 2 . 4 ma . these current settings correspond to pulse voltage levels of 3 . 0 and 4 . 8 volts when a 2000 ohm load is connected to the output of the digistim iii . next , a &# 34 ; proximity &# 34 ; gap between the ungrounded machine lead and the nerve root including surrounding tissue at the left and the right sides of l5 was defined to be about 3 mm of the tissue between the lead tip and the nerve root . when in such proximity , pulse levels applied by the lead tip attained a value corresponding to a 5 . 0 ma current setting at which the patient &# 39 ; s leg twitched with the lead at the left side of l5 , and the pulse level needed for twitching with the lead at the right side of l5 corresponded to a current setting of 3 . 0 ma on the digistim iii unit . a k - wire , about 0 . 062 inch diameter stainless steel and of the kind ordinarily used to form guide holes for pedicle screws , was drilled through the left pedicle cortex to a depth of about 45 mm on l5 , and the stimulator unit output was connected to the wire . the pulse level needed to observe leg twitching corresponded to 15 ma . the pulse level for the right pedicle of l5 corresponded to 12 ma . finally , the k - wire was withdrawn and a screw member inserted in the left pedicle of l5 . when the stimulator unit was adjusted for a pulse level corresponding to 44 ma , no twitching movement could be observed . for the right pedicle of l5 , twitching was observed at the 44 ma setting . the stimulator unit used in example one was set for the same pulse rate and duration , and its output lead connected to 55 mm and 40 mm screws that were about to be inserted in a different patient &# 39 ; s spine . when the 55 mm screw touched the nerve root at the left side of l5 , a pulse level corresponding to 12 . 9 ma was needed to produce twitching movement of the leg . when the stimulator unit output was applied through the 40 mm screw to the nerve root at the right side of l5 , the threshold pulse level corresponded to a current setting of 9 . 8 ma . with the screws properly inserted in the pedicles of l5 , the pulse level had to be increased to a 71 ma setting to produce twitching movement , while no twitching movement could be induced with the stimulator unit lead connected to the screw inserted in the right pedicle of l5 . a threshold pulse level corresponding to a 69 ma setting produced twitching when applied through the screw inserted in the right pedicle of l4 . the digistim nerve stimulator unit used in example one was set again to a pulse rate of 2 hz and a pulse duration of 0 . 2 milliseconds . data was obtained with a third patient who underwent lumbar spinal fixation surgery . the stimulator unit lead was applied directly on the nerve roots at the left sides of l4 and l5 , with the threshold pulse levels needed for leg twitching corresponding to current settings of 2 . 3 ma and 2 . 1 ma , respectively . when a k - wire used to form a screw opening in the left pedicle of l5 was attached to the stimulator unit output , no twitching movement was observable up to a pulse level corresponding to a 41 . 5 ma setting . similarly , with screws inserted in the left and the right pedicles of l5 , no twitching movement was observable through pulse levels corresponding to a 80 ma setting on the digistim iii stimulator unit . while the foregoing description represents preferred embodiments of the present invention , it will be obvious to those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention . for example , the stimulator circuitry of fig5 has been disclosed as contained within the probe tool 48 in fig3 or inside the &# 34 ; slide on &# 34 ; tool 120 of fig4 . the stimulator circuitry of fig5 may also be incorporated into the handle of a so - called sound probe used for sounding out screw holes for interior wall strength once the holes are formed . that is , although a formed screw hole may produce an acceptable sound when probed interiorly , the inside wall of the opening could nonetheless be dangerously close to a nerve root so that postoperative complications would probably ensue after a pedicle screw is inserted in the opening and fixation instrumentation is applied to the patient . according to the invention , applying nerve stimulation pulses during formation of a screw opening , as well as during the tapping and screw insertion phases of fixation surgery , ensures that screw members will be properly located and that postoperative complications arising from misdirected pedicle screws will be negated . accordingly , the present invention is to be delimited only in accordance with the following claims .	0
any conventional vinyl acetate based emulsion adhesive may benefit from the use of the salts in accordance with the teachings of the present invention . formulae for such emulsions are well known in the art and generally include vinyl acetate homopolymer emulsions as well as emulsions of vinyl acetate copolymerized with up to about 50 % by weight of a copolymerizable monomer or mixtures thereof . in particular , copolymers of vinyl acetate with ethylene as well as with acrylate and maleate esters are widely used in industrial applications . these emulsions are commercially available or easily prepared and are generally used in the form of aqueous emulsions at about 55 % solids levels although higher or lower levels could be employed . in considering the relative amounts of components present in the adhesive compositions of the present invention wherein amounts are based as 100 parts by weight , it will be understood that the water used in the vinyl acetate emulsions is included in all calculations . it will be recognized that the adhesives herein are formulated in accordance with known techniques and , depending upon the desired use , may include plasticizers such as , for example , polyethylene glycol , dibutyl phthalate , butyl benzyl phthalate , propylene glycol dibenzoate , triethylene glycol polyester of benzoic acid and phthalic acid , alkyd resin plasticizers , etc . ; humectants such as glycerin , triethylene glycol , propylene glycol and urea ; water soluble polymers or protective colloids and related thickners such as polyvinyl alcohol , polyvinyl pyrrolidine , polyvinyl pyrrolidine - acetate copolymer , polyacrylamide , xanthan gum , etc . ; solvents like toluene , 1 , 1 , 1 - trichloroethane , etc ., as well as mixtures of any of the above . generally the humectants , plasticizers and solvents may be present in amounts varying from 0 to 35 parts per 100 parts of the total composition with the protective colloid or other thickener used in amounts up to about 20 parts . in all cases , however , the total amount of the above described optional additives will represent less than 49 . 5 parts per 100 parts of the total formulation . in particular , the vinyl acetate emulsion adhesives suitable for use in remoistening applications will usually contain approximately 5 to 15 parts partially hydrolyzed polyvinyl alcohol , 5 - 30 parts humectant and 0 - 5 parts plasticizer per 100 parts total formulation . the alcohol is often used in aqueous solution form , with 40 % solutions being the most conventiently made . ( the water present in solutions is not included in the calculations herein .) in addition , other additive known in the adhesive art may also be present in minor amounts . these additive would include , for example , fillers such as clay , chalk ; antioxidants such as butylated hydroxyanisole and butylated hydroxytoluene ; preservatives such as sodium benzoate and formaldehyde ; lubricants ; waxes ; pigments ; dyes ; defoamers ; flavoring agents ; chelating agents ; anti - corrosion agents ; perfumes ; etc . the resultant adhesive compositions of the present invention are usually employed at solids levels of at least about 30 %, preferably 50 % or higher , although additional water may be post - added via the addition of protective colloids or in order to adjust the final viscosity for proper machining . those skilled in the art will recognize that the specific formulations chosen as well as the choice of additives , if any , will vary depending upon the end use to which the particular adhesive or coating is to be employed . adhesives formulated with these specific salts in accordance with the teachings herein may be applied using suitable conventional techniques . the adhesives show no appreciable change in application , machining or adhesive properties while requiring only an effortless cleaning with water of the dried adhesive spills on the machines and other applications apparatus . it is noted that certain salts , including some of the salts utilized herein , have previously been employed as stabilizers and to prevent &# 34 ; pasting - up &# 34 ; of starch - based adhesives ( a premature setting or forming of the adhesive in a storage pot ) or to modify soft pressure sensitive polyacrylate and related copolymer emulsions in which the salt serves to crosslink the dried film via carboxyl or other reactive groups on the polymer to give higher cohesive values and insolubility , properties contrary to those required in the present invention . for this reason , adhesive systems containing carboxyl or related functional groups which react with metal ions cannot be employed for use herein . for the same reason , adhesive systems containing externally added cross - linking components such as trizaine , urea - formaldehyde resins , melamine resins , acid rosinates , etc . are also not contemplated herein . further details of the invention as well as exemplary formulations will be described below . in the examples all parts are by weight . adhesive formulations were prepared using a vinyl acetate homopolymer emulsion ( 55 % solids ) and varying amounts of calcium chloride in order to show the &# 34 ; easy - clean &# 34 ; properties achieved thereby . thus , adhesive compositions were formulated as follows : ______________________________________ samples ( parts ) a b c d______________________________________vinyl acetate homopolymer emulsion 100 100 100 100calcium chloride 10 5 0 . 5 -- ______________________________________ the adhesives were tested for cleaning properties by casting 1 ml portions of each formulation on glass plates and allowing the coatings to dry and age 1 week . drops of water were then put on each film and rubbed comparatively . samples a , b and c containing the calcium chloride salt disintegrated readily with formulations a and b containing higher amounts of salt disintegrating almost immediately while the control d formulation containing no salt required prolonged rubbing in order to achieve removal . other conventional adhesive formulations based on 55 % solids vinyl acetate homopolymer and copolymer emulsions were prepared as follows : __________________________________________________________________________ samples ( parts ) a b c d e f g h__________________________________________________________________________vinyl acetate homopolymer 100 100 100 100 100 100 -- -- emulsionvinyl acetate - acrylate -- -- -- -- -- -- 100 100copolymerbutyl benzyl phthalate 10 10 64 64 44 44 -- --( santicizer 160 - monsanto ) calcium chloride 20 -- -- -- -- -- 5 -- magnesium chloride -- -- 18 -- 18 -- -- -- 1 , 1 , 1 - trichloroethane -- -- -- -- 20 20 -- -- __________________________________________________________________________ when tested for cleaning properties , the adhesives designated a , c , e and g were readily removed from the glass plates using only water as described in example 1 . comparatively , samples b , d , f and h were not easily removed . the adhesive formulation described in sample a , example 1 was prepared replacing the calcium chloride with calcium nitrate , magnesium chloride , magnesium nitrate , aluminum chloride , aluminum nitrate , ammonium chloride , ammonium acetate , potassium acetate , a blend of equal parts of calcium chloride and magnesium chloride and a blend of equal parts sodium chloride and calcium chloride . all samples possessed the &# 34 ; easy - clean &# 34 ; characteristic similar to that of the calcium chloride sample . the following formulations exemplify adhesives useful for &# 34 ; patch gumming &# 34 ; or stenciling applications such as for window envelope adhesives wherein polystyrene inserts or related films are attached to paper envelopes using high speed stenciling techniques . these adhesives are generally formulated with aqueous vinyl acetate copolymer emulsions containing 5 - 20 parts plasticizer and 5 - 35 parts humectant per 100 parts total composition . optionally , up to about 10 parts solvent and / or up to about 10 parts by weight of a water soluble polymer or thickener may then be added to these compositions . __________________________________________________________________________ samples ( parts ) a b c d e f g h__________________________________________________________________________vinyl acetate - maleate -- -- 100 100 -- -- 100 100copolymer emulsion ( 55 % solids ) vinyl acetate - ethylene 100 100 -- -- 100 100 -- -- copolymer emulsion ( 55 % solids ) triethylene glycol 23 . 4 23 . 4 24 24 23 . 4 23 . 4 24 24polyester of benzoicand phthalic acid ( hercoflex 900 , aproduct of herculeschemical co .) xanthan gum -- -- -- -- 1 1 -- -- 1 , 1 - trichloroethane -- -- -- -- -- -- 10 10glycerin 28 . 1 28 . 1 64 64 28 . 1 28 . 1 54 54magnesium chloride 3 . 1 -- 10 -- 3 . 1 -- 10 -- __________________________________________________________________________ when tested , samples a , c , e and g containing magnesium chloride were readily cleaned with water while samples b , d , f and h which did not contain salt had to be rubbed excessively in order to remove the dried adhesive . in a similar manner , various adhesive formulations were prepared which are useful for remoistening applications . calcium chloride was then added to such systems in order to show the &# 34 ; easy - clean &# 34 ; and additionally , the &# 34 ; lay - flat &# 34 ; properties achieved thereby . __________________________________________________________________________ samples ( parts ) a b c d e f g h i j__________________________________________________________________________vinyl acetate homopolymer 100 100 100 100 100 100 100 100 100 100emulsion ( 55 % solids ) glycerin 20 20 20 20 -- -- 10 10 20 2040 % aqueous polyvinyl alcohol 20 20 30 30 -- -- 20 20 50 50solution ( 88 % hydrolyzed ) polyoxyethylene glycol ( 600 mw ) -- -- -- -- 14 14 10 10 -- --( carbowax 600 - union carbide ) polyvinyl pyrrolidines / -- -- -- -- 6 6 -- -- -- -- vinyl acetate ( 1 : 1 ratio ) an alkyd plasticizer ( resoflex -- -- 3 3 -- -- -- -- -- -- r296 - cambridge industries ) calcium chloride 10 -- 10 -- 10 -- 10 -- 10 -- __________________________________________________________________________ all the above adhesive samples were coated at 12 lbs ./ ream on standard gumming stock paper in the machine direction , air dried and permitted to set overnight . thereafter 6 &# 34 ;× 41 / 2 &# 34 ; ( machine direction ) cutouts were taken and observed daily ( coated side up ) for 1 week to observe curl or relative lay flat properties . the examples containing the salt in accordance with the present invention started to exhibit a slight convex curl ( considered desirable from a lay - flat aspect ); while those samples which did not contain the salt developed a slight concave curl . at the end of one week , those samples with salt were still slightly convex while those control samples without salt were considerably concave , i . e . had excessive curl . the &# 34 ; easy - clean &# 34 ; test described in example 1 was also repeated using all the above described formulations with those containing salt exhibiting &# 34 ; easy - clean &# 34 ; properties and those control samples very difficult to clean . the formulation described in sample a of example 5 was prepared using a variety of salts in place of calcium chloride . thus formulations were prepared with magnesium chloride , magnesium nitrate , calcium nitrate and a blend of equal parts calcium chloride plus ammonium acetate . when tested as described in example 5 all formulations possessed the desired &# 34 ; easy - clean &# 34 ; and &# 34 ; lay flat &# 34 ; properties . the preferred embodiments of the present invention now having been described in detail , various modifications and improvements thereon will become readily apparent to those skilled in the art . accordingly , the spirit and scope of the present invention is to be considered as limited not by the foregoing disclosure , but only by the appended claims .	2
fig1 shows a mechanically joined steering assembly . fig2 shows the components of the steering assembly according to the preferred embodiment of the invention . the steering assembly comprises a crown 12 with a central steerer bore hole 28 and two blade bore holes 30 and 32 . the central bore hole 28 is formed to be a close fit with the steerer 14 , and the outer holes 30 and 32 are formed to be a close fit with the upper ends of the blades 16 . a slot 40 is formed through a vertical section of crown 12 and through the center of holes 28 , 30 , and 32 . the bolts 22 cause the crown 12 to elastically deform when they are inserted into the clearance hole 36 best seen in fig2 and threaded into the threaded section 34 of crown 12 and tightened against seat 38 in the clearance hole 36 of the crown . this deformation changes the shape of the horizontal section of crown 12 by reducing the width of slot 40 and causes the steerer bore hole 28 and blade bore holes 30 and 32 to change shape , reducing the diameter across crown 12 parallel to the long axis of bolt 22 . the steerer 14 is formed with a circlip groove 56 at the bottom . the circlip 26 is a substantially ring - shaped coupling clamp best seen in fig2 . the circlip 26 is installed in the circlip groove 56 of the steerer 14 after the steerer has been inserted into steerer bore hole 28 . the steerer is positioned by the circlip 26 contacting the bottom of crown 12 . the reinforcements 24 of the blades 16 are formed to be a close fit with the inside bore 18 . the reinforcements 24 are joined to the inside bore 18 with adhesive and are located within blade 16 inside bore 18 . the blades 16 are then inserted into blade bore holes 30 and 32 in crown 12 . the bolts 22 are then tightened to join the crown 12 , steerer 14 , and blades 16 together . a blade stop band 44 best seen in fig7 may be used to prevent the wheel from contacting the crown if the blades fail . said blade stop band 44 is a substantially ring - shaped protuberance fitting onto blades 16 . the crown bearing race adapter 20 is placed over the steerer 14 and located against the top surface of the crown 12 . the crown bearing race adapter 20 is held in place on the steerer 14 with adhesive . fig5 shows a mechanically joined steering assembly according to another embodiment of the invention . the crown 12 is formed with three holes in it , as 28 , 30 , and 32 in fig2 . the central steerer bore hole 28 is formed to be a press fit with the lower end of the steerer 14 . the press fits cause the crown 12 to elastically deform when the blades 16 and steerer 14 are inserted into holes 28 , 30 , and 32 of the crown 12 . the crown bearing race adapter 20 is machined integrally in the crown in this embodiment . fig6 and fig7 show a mechanically joined steering assembly according to another embodiment of the invention . the crown 12 is formed with three holes as 28 , 30 , and 32 in fig6 . the central steerer hole 28 is formed to be a close fit with the steerer 14 and the outer holes 30 and 32 are formed to be a close fit with the upper end of blades 16 . slots 40 are formed through vertical sections of the crown and through the centerlines of hole 28 . the bolts 22 cause the crown to elastically deform when they are inserted into the clearance hole 36 to cause the holes 28 , 30 , and 32 to change shape . fig8 shows a mechanically joined steering assembly according to another embodiment of the invention . in this embodiment reinforcements 24 are formed integrally in the upper end of the blades 16 . fig9 shows a mechanically joined steering assembly according to another embodiment of the invention . the crown 12 is formed with holes 30 and 32 in a nonlinear arrangement with steerer hole 28 . the outer holes 30 and 32 are formed to be a close fit with the outer edge of reinforcements 24 . the reinforcements 24 are formed to be a close fit with blades 16 with adhesive or press fit and are located on the outside edge of blades 16 as shown in fig9 . the blades 16 and reinforcements 24 are then inserted into the holes 30 and 32 in the crown as shown in fig9 . the mechanically joined steering assembly of fig2 will provide a variety of steering and wheel support functions for wheeled vehicles including bicycles , motor bicycles and the like , but users will find it most useful for bicycle fork assemblies , especially off - road and competitive bicycles . to assemble the mechanically joined steering assembly the user should turn the bicycle or other vehicle upside down and clamp it onto a work stand . the clamping bolts 22 should be loosely inserted into the threaded holes 36 best seen in fig2 . the blades 16 are inserted into the blade bore holes 30 and 32 . the steerer is inserted into the steerer bore hole 28 and the circlip tightened to the bottom of the steerer 14 at the base of crown 12 . the crown bearing race adapter 20 is placed on steerer 14 and tightened against the upper surface of crown 12 and steerer 14 . the user may then slide the blades 16 up or down as required to center the wheel rim between the blades 16 . the crown 12 is then twisted so that it is square with the plane of the wheel rim . the user should then tighten the clamping bolts 22 slightly , recheck the alignment of steerer 14 , crown 12 , blades 16 and the wheel rim . the clamping bolts 22 are then tightened to their final tension . materials that may be used for the construction of the various components of the assembly include steel and high strength white metal alloys . the use of two types of metals is called composite construction . advanced composite materials , such as carbon fiber may also be used . one such embodiment uses blades 16 made of steel and high strength white metal alloys , with the blades 16 and steerer 14 clamped together by an aluminum or magnesium crown . to adjust the mechanically joined steering assembly on a bicycle or other wheeled vehicle , the user slides blades 16 up or down to alter the steering characteristics of the bicycle . alternatively , the user may replace blades 16 with blades of alternative shape to alter the steering geometry of the bicycle or other wheeled vehicle . to adjust or replace with alternative blades the clamping bolts 22 are loosened and the blades 16 moved up or down through holes 30 and 32 . likewise the steerer 14 may be adjusted relative to the crown 12 by loosening bolts 22 and sliding the crown bearing race adapter 20 up the steerer 14 . the steerer 14 is then driven down in the crown 12 so that the circlip 26 can be removed . then the steerer 14 can then be removed from the top of crown 12 . if the user intends to replace the steerer 14 , the crown bearing race adapter should be removed as well . to replace the crown race adapter 20 the user will find that conventional race removers will not work . the user should remove the steerer 14 as previously described . then the crown race adapter 20 can be driven off the bottom of the steerer 14 . the user should use grease or anti - seize compounds on the crown race adapter 20 in order to make the next removal as easy as possible . while the above description contains many specificities , the reader should not construe these as limitations on the scope of the invention , but merely as exemplifications of preferred embodiments thereof . those skilled in the art will envision many possible variations are within its scope . for example skilled artisans will readily be able to change the dimensions and shapes of the various embodiments . they will also be able to make the steering assembly out of alternative materials such as thermoplastics , advanced composite , and composite metallic compounds . they can make many variations on the adjustment mechanisms of fig1 to fig9 e . g ., they can make the crown slotless but with fixed bolts attached thereto and with variations in the positions and angles of the joining members . they can alter the relationship of the fastener bore holes as shown in fig6 and fig7 . as an alternative to the foregoing they can arrange an axial seating of the blade or steerer against a shoulder in the crown . in fact they can provide any type of mechanical fastener for mechanically joining the blades to the crown and steering apparatus . accordingly the reader is requested to determine the scope of the invention by the appended claims and their legal equivalents , and not by the examples that have been given .	8
the novel biodegradable copolymer of the present invention has a core block and a plurality of shell blocks and can be presented by the formula : wherein the number of shell blocks s may be 3 to 10 ( that is , n is an integer between 3 and 10 , and preferably 3 to 6 . each shell block s is linked to the core block c by a covalent bond . thus , the microscopic molecule structure of the copolymer is star shaped ; therefore herein the copolymer is referred to as a “ star copolymer ”. “ biodegradable copolymer ” is defined herein as a copolymer which can chemically break down or degrade within the body to form nontoxic components . the core block c comprises a bioresorbable hydrophobic polyester segment . herein , “ bioresorbable ” means the property which a material has enables the material to be absorbed in an organism . suitable bioresorbable hydrophobic polyester can be , but not limited to , a homopolymer or copolymer synthesized from monomers selected from the group consisting of d , l - lactide , d - lactide , l - lactide , d , l - lactic acid , d - lactic acid , l - lactic acid , glycolide , glycolic acid , ε - caprolactone , ε - hydroxy hexonoic acid , γ - butyrolactone , γ - hydroxy butyric acid , δ - valerolactone , δ - hydroxy valeric acid , hydroxybutyric acids , or malic acid . among them , polycaprolactone is most preferred . the average molecular weight of the bioresorbable hydrophobic polyester is preferably 200 to 10000 , and more preferably 250 to 5000 . the shell block s comprises a hydrophilic polyethylene glycol ( peg ) segment . the average molecular weight of the hydrophilic polyethylene glycol is preferably 200 to 10000 , and more preferably 250 to 7000 . the linkage of the shell block s , hydrophobic polyester , and the core block c , hydrophilic polyethylene glycol , is formed through a urethane linkage . it is noted that a mixture of the biodegradable copolymer of the present invention in water with a solid content of 20 % can undergo a phase transformation with a change in temperature . for example , the mixture , exhibiting a white viscous liquid form of micelle per se at room temperature , turns into a transparent liquid in an ice bath and white precipitates occur upon heating due to the separation of the copolymer and water , and these phenomena are reversible and contrary to the common phenomenon of solubility for a normal substance in a solvent that dissolution occurs upon heating and precipitation occurs at low temperature . the biodegradable copolymer of the present invention presents no cytotoxicity in a physiological environment and exhibits white color in an aqueous medium ( such as water ) which was characterized to be micelles . the critical micelle concentration is low . the micelles are useful as vehicles in a bio - delivery system to encapsulate hydrophobic compounds , for example , drugs ( such as protein complexes , gene drugs , hormone drugs , and anti - cancer drugs ) or bioactive substances and to enable them to have a stable effect . accordingly , in other aspects , the present invention relates to a biodegradable polymeric micelle composition , which comprises : ( a ) a copolymer which is the star - shaped biodegradable copolymer having the formula c s ) n ( wherein n is an integer of 3 to 10 ) of the present invention as described above or the biodegradable linear tri - block copolymer s — c — s . c and s are defined as above , and ( b ) an aqueous medium , such as water , which enables the biodegradable copolymer to disperse therein . the copolymer is dispersed in the aqueous medium . when the concentration of copolymer is higher than the critical micelle concentration , the copolymer forms micelles . the critical micelle concentration is generally between 0 . 001 and 0 . 5 weight percent . the size of the micelle is generally between 20 nm and 800 nm in diameter . as mentioned above , the biodegradable copolymer comprised in the biodegradable polymeric micelle composition can be a linear tri - block copolymer ( s — c — s ) as well as the star - shaped biodegradable copolymer of the present invention . u . s . pat . no . 6 , 201 , 072 discloses an a — b — a - or b — a — b - linear tri - block copolymer containing a biodegradable polyester ( block a ) and peg ( block b ). however , it does not disclose the application of the tri - copolymer in the micelle composition as described in the present invention nor does it mention the micelle structure . in the present invention , the inventors found that the star - shaped biodegradable copolymer , as well as the linear tri - block , can form micelles in a medium . thus the micelle composition of the present invention can be formed from the linear tri - block copolymer or the star - shaped biodegradable copolymer and a medium . the micelle composition of the present invention can encapsulate drugs in the micelles . for example , when the aqueous medium is water , the hydrophilic ends of the copolymer molecules outwardly contact with water molecules and the hydrophobic ends aggregate inwardly , thus forming micelles which encapsulate hydrophobic compounds , drugs , or bioactive substance therein . the biodegradable copolymer of the present invention can be made by the steps as follows . a suitable amount of dbtdl ( dibutyltin dilaurate ) and diisocyanate are added to methoxy - polyethylene glycol dissolved in solution . the mixture is heated and the reaction is performed in a nitrogen atmosphere . then , polyester - diol or - polyol are added and the temperature for reaction is elevated . the product is purified and the structure may be identified using 1 h nmr ( cdcl 3 , 400 mhz ). the copolymer obtained using polyester - diol is s — c — s type tri - copolymer in a linear structure . the novel type star - shaped copolymer of the present invention can be obtained using polyester - polyol , such as polyester - triol and polyester - tetraol . polyester - polyol , such as polyester - triol and - tetraol , can be prepared by referring to the method as described in preparations a and b . the schematic structure of the polyester - triol obtained is shown as follows : the biodegradable copolymer of the present invention shows no cytotoxity determined according to the method described in the astm f895 standard test . the biodegradable polymeric micelle composition can be formed by mixing the copolymer in an aqueous medium in a concentration higher than the critical micelle concentration . the critical micelle concentration can be calculated by means of interpolation in the plotting of the absorbance at uv - vis wavelength versus the concentration of the copolymer in the medium . the application of the biodegradable polymeric micelle composition for the encapsulation of hydrophobic compound can be achieved by the process described as follows . hydrophobic compounds ( such as hydrophobic drugs ) and the copolymer are dissolved in a solvent . the resulting mixture was vacuumed at 60 ° c . by means of rotary evaporation to form a colloid . pure water was added to the colloid at 60 ° c ., forming micelles encapsulating the drug for the application in drug delivery in the present invention . the resultant may be freeze - dried for storage and added water as a medium to form micelles in liquid type before the administration . the administration can be oral , topical , injected , or by another suitable method . 200 g ( 1 . 7522 moles ) of ε - caprolactone monomer ( manufactured by aldrich co .) was placed in a reactor , and 23 . 51 g ( 0 . 175 mole ) of initiator trimethylolpropane and 0 . 567 ml ( 1 . 75 × 10 − 3 mole ) of stannous 2 - ethylhexanoate were added into the reactor . the reaction was performed in a nitrogen atmosphere and the temperature was set at 120 ° c . after 1 . 5 hours of reaction , the reaction was rapidly cooled down to room temperature . the precipitates were purified using ether and then vacuumed to remove solvent , yielding a product characterized by 1 h nmr ( cdcl 3 , 400 mhz ) to be polycaprolactone triol . 200 g ( 1 . 7522 moles ) of ε - caprolactone monomer was placed in a reactor , and 28 . 9 g ( 0 . 175 mole ) of initiator pentaerythritol ( molecular weight = 165 . 15 ) and 0 . 567 ml ( 1 . 75 × 10 − 3 mole ) of stannous 2 - ethylhexanoate were added into the reactor . the reaction was performed in a nitrogen atmosphere and the temperature was set at 120 ° c . after 1 . 5 hours of reaction , the reaction was rapidly cooled down to room temperature . the precipitates were purified using ether and then vacuumed to remove solvent , yielding a product , polycaprolactone tetraol . 45 . 6 g ( 0 . 27 mole ) of hexamethylene diisocyanate and 200 μl of dbtdl were added to 100 g ( 0 . 286 mole ) of methoxy - polyethylene glycol ( molecular weight = 350 ) dissolved in 150 g of toluene . the temperature was set at 60 ° c . and the reaction was performed in a nitrogen atmosphere . after 2 hours of reaction , 81 . 51 g ( 0 . 091 mole ) of pcl - triol ( molecular weight = 900 ) and 100 g of toluene were added , and the reaction was continued for 24 hours . then , the reaction was quenched by dibutylamine ( dba ) to completely consume the nco groups remaining in the reactor . the resultant was precipitated by ether at low temperature , washed repeatedly , and vacuumed until dry , yielding a star copolymer having a formula of c s ) 3 as a powder , herein referred to as “ tri - peg350 - pcl900 ”. the star copolymer obtained from example 1 was dissolved in a 4 μm diphenyl hexatriene ( dph ) ( a hydrophobic fluorescent dye ) aqueous solution to concentrations of 0 . 001 wt %, 0 . 005 wt %, 0 . 01 wt %, 0 . 025 wt %, 0 . 05 wt %, 0 . 1 wt %, 0 . 5 wt %, and 1 wt %, respectively . the absorbance at 412 nm of each resulting mixture was determined using a uv - vis spectrometer . a graph was obtained by plotting absorbance versus concentration , as shown in fig1 . the critical micelle concentration was calculated to be about 0 . 094 wt %, i . e . 4 . 84 × 10 − 4 m , by means of interpolation . 3 . 19 g ( 0 . 019 mole ) of hexamethylene diisocyanate and 200 μl of dbtdl were added to 100 g ( 0 . 02 mole ) of methoxy - polyethylene glycol ( molecular weight = 5000 ) dissolved in 100 g of toluene . the temperature was set at 60 ° c . and the reaction was performed in a nitrogen atmosphere . after 2 hours of reaction , 5 . 7 g ( 0 . 0063 mole ) of pcl - triol ( molecular weight = 900 ) and 6 g of toluene were added , and the reaction was continued for 24 hours . then , the reaction was quenched by dba . the resultant was precipitated by ether at low temperature , washed repeatedly , and vacuumed until dry , yielding a star copolymer having a formula of c s ) 3 as a powder , herein referred to as “ tri - peg5000 - pcl900 ”. the cmc of the product was about 0 . 127 wt %, i . e . 7 . 99 × 10 − 5 m , determined by the method as described in example 1 . 8 g ( 0 . 0475 mole ) of hexamethylene diisocyanate and 200 μl of dbtdl were added to 100 g ( 0 . 05 mole ) of methoxy - polyethylene glycol ( molecular weight = 2000 ) dissolved in 110 g of toluene . the temperature was set at 60 ° c . and the reaction was performed in a nitrogen atmosphere . after 2 hours of reaction , 4 . 75 g ( 0 . 016 mole ) of pcl - triol ( molecular weight = 300 ) and 5 g of toluene were added , and the reaction was continued for 24 hours . then , the reaction was quenched by dba . the resultant was precipitated by ether at low temperature , washed repeatedly , and vacuumed until dry , yielding a star copolymer having a formula of c s ) 3 as a powder , herein referred to as “ tri - peg2000 - pcl300 ”. the cmc of the product was about 0 . 126 wt %, i . e . 2 × 10 − 4 m , determined by the method as described in example 1 . 3 . 2 g ( 0 . 019 mole ) of hexamethylene diisocyanate and 200 μl of dbtdl were added to 100 g ( 0 . 02 mole ) of methoxy - polyethylene glycol ( molecular weight = 5000 ) dissolved in 105 g of toluene . the temperature was set at 60 ° c . and the reaction was performed in a nitrogen atmosphere . after 2 hours of reaction , 1 . 9 g ( 0 . 006 mole ) of pcl - triol ( molecular weight = 300 ) and 2 g of toluene were added , and the reaction was continued for 24 hours . then , the reaction was quenched by dba . the resultant was precipitated by ether at low temperature , washed repeatedly , and vacuumed until dry , yielding a star copolymer having a formula of c s ) 3 as a powder , herein referred to as “ tri - peg5000 - pcl300 ”. the cmc of the product was about 0 . 14 wt %, i . e . 9 . 15 × 10 − m , determined by the method as described in example 1 . 45 . 6 g ( 0 . 27 mole ) of hexamethylene diisocyanate and 200 μl of dbtdl were added to 100 g ( 0 . 286 mole ) of methoxy - polyethylene glycol ( molecular weight = 350 ) dissolved in 150 g of toluene . the temperature was set at 60 ° c . and the reaction was performed in a nitrogen atmosphere . after 2 hours of reaction , 27 g ( 0 . 09 mole ) of pcl - triol ( molecular weight = 300 ) and 30 g of toluene were added , and the reaction was continued for 24 hours . then , the reaction was quenched by dba . the resultant was precipitated by ether at low temperature , washed repeatedly , and vacuumed until dry , yielding a star copolymer having a formula of c s ) 3 as a powder , herein referred to as “ tri - peg350 - pcl300 ”. the cmc of the product was about 0 . 0125 wt % determined by the method as described in example 1 . 8 g ( 0 . 0475 mole ) of hexamethylene diisocyanate and 200 μl of dbtdl were added to 100 g ( 0 . 05 mole ) of methoxy - polyethylene glycol ( molecular weight = 2000 ) dissolved in 150 g of toluene . the temperature was set at 60 ° c . and the reaction was performed in a nitrogen atmosphere . after 2 hours of reaction , 14 . 25 g ( 0 . 016 mole ) of pcl - triol ( molecular weight = 300 ) and 100 g of toluene were added , and the reaction was continued for 24 hours . then , the reaction was quenched by dba . the resultant was precipitated by ether at low temperature , washed repeatedly , and vacuumed until dry , yielding a star copolymer having a formula of c s ) 3 as a powder , herein referred to as “ tri - peg2000 - pcl300 ”. the cmc of the product was about 0 . 0325 wt % determined by the method as described in example 1 . the cytotoxicity response indices of the star copolymers obtained from examples 1 to 6 were determined by the method described in the astm f895 standard test using l929 fibroblast . all of the results showed no cytotoxity . a suitable amount of dbtdl was added to 100 g ( 0 . 05 mole ) of methoxy - polyethylene glycol ( molecular weight = 2000 ) dissolved in 200 ml of dimethylformamide ( dmf ), immediately followed by the addition of 7 . 98 g ( 0 . 0475 mole ) of hexamethylene diisocyanate ( hdi ). the temperature was set at 50 ° c . and the reaction was performed in a nitrogen atmosphere . after 5 hours of reaction , 13 . 25 g ( 0 . 025 mole ) of pcl - diol ( molecular weight = 530 ) was added , the temperature was raised to 100 ° c ., and the reaction was continued overnight . then , the reaction was quenched by dba . after the resultant was cooled down , it was precipitated by 1000 ml of ether , and the resulting precipitates were dissolved in dmf and precipitated from ether . the precipitation process was repeated three times . then the precipitates were vacuumed until dry , yielding a product characterized by 1 h nmr ( cdcl 3 , 400 mhz ) to be a peg2000 - pcl530 - peg2000 tri - block copolymer . the cmc of the product was about 0 . 1367 wt % determined by the method as described in example 1 , as shown in fig2 . suitable amount of dbtdl was added to 200 g ( 0 . 1 mole ) of methoxy - polyethylene glycol ( molecular weight = 2000 ) dissolved in 400 ml of dmf , immediately followed by the addition of 14 . 96 g ( 0 . 095 mole ) of hdi . the temperature was set at 50 ° c . and the reaction was performed in a nitrogen atmosphere . after 5 hours of reaction , 59 . 375 g ( 0 . 0475 mole ) of pcl - diol ( molecular weight = 1250 ) was added , the temperature was raised to 100 ° c ., and the reaction was continued overnight . then , the reaction was quenched by dba . after the resultant was cooled down , it was precipitated by 2000 ml of ether , and the resulting precipitates were dissolved in dmf and precipitated from ether . the precipitation process was repeated three times . then the precipitates were vacuumed until dry , yielding a peg2000 - pcl1250 - peg2000 tri - block copolymer . the cmc of the product was about 0 . 058 wt % determined by the method as described in example 1 . suitable amount of dbtdl was added to 100 g ( 0 . 182 mole ) of methoxy - polyethylene glycol ( molecular weight = 550 ) dissolved in 200 ml of dmf , immediately followed by the addition of 29 g ( 0 . 173 mole ) of hdi . the temperature was set at 50 ° c . and the reaction was performed in a nitrogen atmosphere . after 5 hours of reaction , 172 . 9 g ( 0 . 0865 mole ) of pcl - diol ( molecular weight = 2000 ) was added , the temperature was raised to 100 ° c ., and the reaction was continued overnight . then , the reaction was quenched by dba . after the resultant was cooled down , it was precipitated by 1000 ml of ether , and the resulting precipitates were dissolved in dmf and precipitated from ether . such precipitation process was repeated three times . then the precipitates were vacuumed until dry , yielding a peg530 - pcl2000 - peg530 tri - block copolymer . the cmc of the product was about 0 . 013 wt % determined by the method as described in example 1 . the size of the resulting micelles was determined using a dynamic light scattering instrument ( malvern uk + 44 of malvern instruments company ) to be about 85 nm , as shown in fig3 . suitable amount of dbtdl was added to 100 g ( 0 . 05 mole ) of methoxy - polyethylene glycol ( molecular weight = 2000 ) dissolved in 200 ml of dmf , immediately followed by the addition of 7 . 98 g ( 0 . 0475 mole ) of hdi . the temperature was set at 50 ° c . and the reaction was performed in a nitrogen atmosphere . after 5 hours of reaction , 47 . 5 g ( 0 . 02375 mole ) of pcl - diol ( molecular weight = 2000 ) was added , the temperature was raised to 100 ° c ., and the reaction was continued overnight . then , the reaction was quenched by dba . after the resultant was cooled down , it was precipitated by 1000 ml of ether , and the resulting precipitates were dissolved in dmf and precipitated from ether . such precipitation process was repeated three times . then the precipitates were vacuumed until dry , yielding a peg2000 - pcl2000 - peg2000 tri - block copolymer . the cmc of the product was about 0 . 043 wt % determined by the method as described in example 1 . suitable amount of dbtdl was added to 100 g ( 0 . 022 mole ) of methoxy - polyethylene glycol ( molecular weight = 4600 ) dissolved in 200 ml of dmf , immediately followed by the addition of 3 . 53 g ( 0 . 021 mole ) of hdi . the temperature was set at 50 ° c . and the reaction was performed in a nitrogen atmosphere . after 5 hours of reaction , 22 g ( 0 . 011 mole ) of pcl - diol ( molecular weight = 2000 ) was added , the temperature was raised to 100 ° c ., and the reaction was continued overnight . then , the reaction was quenched by dba . after the resultant was cooled down , it was precipitated by 1000 ml of ether , and the resulting precipitates were dissolved in dmf and precipitated from ether . such precipitation process was repeated three times . then the precipitates were vacuumed until dry , yielding a peg4600 - pcl2000 - peg4600 tri - block copolymer . the cmc of the product was about 0 . 0789 wt % determined by the method as described in example 1 . the size of the resulting micelles was determined using a dynamic light scattering instrument to be about 85 nm . according to the result from the determination of the critical micelle concentration as mentioned above , it is shown that all of the products obtained from examples 1 to 6 and preparations 1 to 5 can form micelles and these micelles are the biodegradable polymeric micelle compositions of the present invention , which were demonstrated to have an ability to encapsulate hydrophobic compounds and can be further employed to encapsulate hydrophobic drugs and bioactive substances . 30 mg of paclitaxel and 150 mg of peg2000 - pcl530 - peg2000 tri - block copolymer were dissolved in 2 ml of acetonitrile . the resulting mixture was vacuumed at 60 ° c . by means of rotary evaporation to form a colloid . pure water was added to the colloid at 60 ° c ., forming micelles encapsulating the drug . the resultant was filtered through 0 . 22 μm filter to remove the impurities in the water and freeze - dried , forming a drug delivery composition . example 8 was performed using the method same as example 7 , provided that 150 mg of peg2000 - pcl2000 - peg2000 tri - block copolymer was used instead of peg2000 - pcl530 - peg2000 tri - block copolymer , forming a drug delivery composition . example 9 was performed using the method same as example 7 , provided that 150 mg of peg530 - pcl2000 - peg530 tri - block copolymer was used instead of peg2000 - pcl530 - peg2000 tri - block copolymer , forming a drug delivery composition . while the invention has been described by way of example and in terms of the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . to the contrary , it is intended to cover various modifications and similar arrangements ( as would be apparent to those skilled in the art ). therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements .	0
the present invention provides a device and a method for reducing intraocular pressure that is free of the problems associated with prior devices and methods . the description below illustrate possible embodiments of the present invention and are in no way meant to be limiting . other embodiments within the scope of the invention will be clear to those skilled in the art . the improvement of the present invention is in the device , the method , and the instrumentation for the technique of surgery . the surgery for reducing intraocular pressure typically involved inserting a device into the eye , such device facilitating the flow of aqueous humour from the eye . the insertable device can be made of a biocompatible material that is foldable and the returns to its original shape . the insertable pressure relieving device can comprise a system of channels , pores or passageways on the surface and / or through the device , to allow for the flow and drainage of aqueous humour and thus prevent pressure build up . the deformability of the device allows it to be implanted through a small incision . according to the methods of the present invention , the insertion surgery can now be performed in a completely novel way . instead of a large 8 mm or greater incision into the conjunctival tissue and further incisions into the sclera which would allow the ingrowths of vascular tissue ( such tissue would seal off the openings in the sclera wall and block the egress of fluid through the sclera and therefore raise the intraocular pressure “ iop ”) and incision is made into the nonvascular cornea at a remote location and entry into the sclera is made from the anterior chamber . thus , the conjunctiva is not incised and the wall of the sclera is not opened ( in a preferred embodiment of the method of the present invention ). according to the method of the present invention , the healing response of the conjunctiva and tenon &# 39 ; s tissue is not stimulated because there is no incision in these tissues and no fibrovascular growth can access into the sclera since there is no incision in the sclera where vascular tissue exists . such ingrowths of vascular tissue would cancel the effects of the pressure relieving device , causing the device to fail by blocking the channels or pores with vascular tissue . the insertable pressure relieving devices of the present invention can be made in a wide variety of shapes , such as rectangular , square , cube or triangular polyhedrons , pyramids , orbs spheres , etc . these shapes can be two or three dimensional , preferably three dimensional , and having a depth of approximately 0 . 2 mm . the shape of the device should be such that it will fill the pocket or chamber of tissue removed from the wall of the sclera and therefore resist migrating back through the small incision through which it was implanted . the present invention provides for a device which is compressible or foldable so that it can go through a small incision and expand back to it &# 39 ; s initial shape , a means for inserting such a device , and for creating a pocket where such a device can be implanted . the pocket created according to the present invention is larger in dimension than the small incision through which the pocket is accessed , and through which the implant is inserted . a distinct advantage of this surgery compared to traditional glaucoma surgery is that it can be performed with topical anesthesia . the patient is brought in to the operating room and the eye is anesthetized with topical lidocaine or equivalent . the operating microscope is brought into view and the site for the implant is determined . a stab incision into the cornea is made roughly 180 degrees from the selected site . unpreserved lidocaine 1 % is irrigated into the anterior chamber . a gonio lens of the koeppe type is place on the cornea . this allows the surgeon to view the anterior chamber angle through the operating microscope . once this view of the trabecular meshwork is obtained a viscoelastic component such as amvisc ® is injected into the anterior chamber to push the iris back and protect the cornea . a drill is then placed through the stab incision and then introduced across the anterior chamber to the trabecular meshwork area . this drill is approximately 0 . 2 mm in diameter . it can extend to a diameter of 0 . 6 mm as the sclera ranges from 0 . 7 mm to 1 mm thick in normal eyes . the drill is then used to enter the wall of the sclera . care is taken to direct the drill into the wall of the sclera and not above or below the sclera for this most ideal form of surgery . the operating microscope can be used to obtain a direct view of this area avoiding the koeppe lens . the drill is then used to make a passageway 2 . 25 to 2 . 50 mm within the sclera . this distance can be controlled by a stop on the body of the drill bit . once this is completed the drill is withdrawn and further viscoelastic material is placed in the angle of the anterior chamber where the iris and cornea come together , ( this is where the sclera begins ) to move the remnants from the area . a second instrument of the present invention , a pocketmaker , can then be placed through the stab incision , across the anterior chamber , and into the hole made by the drill . various embodiments of the pocketmaker device of the present invention can include at least one means for cutting . in the preferred embodiment the pocketmaker would consist of a small disc with two blades which were freely movable . the disc would be attached to a drive train consisting of various gears to transfer the force from the shaft to the disc itself . these types of gears are well known in the art such as automobile transfer of energy to the wheels . the disc with cutting assembly folded would insert through the corneal incision , across the anterior chamber and into the hole drilled in the sclera in the area of trabecular meshwork . the drive shaft would be approximately 15 mm long with a diameter of approximately 0 . 2 mm , a protective sleeve could slide over the blade carrying body containing the two folded blades . the drive shaft could be much longer if chosen , however , it needs to be long enough to extend across the anterior chamber and into the drilled opening . once the disc is guided into the opening previously drilled the protective sleeve could then be retracted . for example , the sleeve , or a portion or attachment to the sleeve , could extend outside the corneal incision with a small protrusion on it to allow the surgeon to manually pull it back . this would then expose the twin blades which when fully extended would create a diameter of 3 mm . ( in this situation a 3 mm round implant approximately 0 . 2 mm in diameter would be used .) once power is applied to the drive train and therefore causes the disc to rotate at high speeds a round opening in the sclera approximately 3 mm in diameter would start to be created opposite the drilled incision . with proper preset angulation of the blades , movement upwards would create a pocket with a depth of 0 . 2 mm . the use of real time ultrasonography on the sclera above the area of surgery would be of great help in detereming the exact thickness of tissue being removed . it would also be helpful to use during the drilling maneuver performed earlier to achieve the optimum location . a further improvement would be the use of irrigation and aspiration around the drive train . the initial diameter may need to be larger in this embodiment as the shaft would contain a hollow tube internally to which suction is supplied from a peristaltic pump or venturi pump and an outer sleeve which contained irrigating fluid supplied by the force of gravity ( for example , by hanging a bottle of irrigating fluid and attaching it to this handpiece .) in this manner the excised pieces of sclera can be removed while the surgery is taking place by irrigating fluid into the newly created chamber and aspirating these pieces and the fluid . this may also provide cooling to the instrument and the tissue . once the pocket has been created the sleeve and be pushed back onto the disc and over the blades . this would push the blades in the opposite direction than they were initially loaded in but will prevent the blades from cutting tissue as the pocket maker is removed . the prior art has described multiple ways of folding intraocular lens implants and delivering them into the eye . the glaucoma device would be folded in a similar manner into an injector , for example , one that uses a screw type delivery system that pushes the device out through a small tube . unlike the intraocular lens implanters , this inserter would require the use of an extended delivery tube of approximately 14 mm minimum inside the eye with the standard working distance outside the eye . ( current devices extend a maximum of 6 to 8 mm inside the eye .) viscoelastic material would then be placed into the anterior chamber , via an injector , which would be placed through the corneal incision , across the anterior chamber , and into the sclera tunnel which had been drilled . by twisting the screw mechanism of the delivery system , the plunger would extend through the tube delivering the glaucoma implant into the pocket created . the deformable implant would then expand to its original shape , filling the chamber or pocket created for it . the inserter would then be retracted out of the tunnel and then the eye . the deformable implant would be trapped in this chamber or pocket , as it is bigger than the scleral tunnel leading from the pocket or chamber . the use of a light pipe with visualization capability could be used to confirm location in addition to using ultrasonagraphy , as mentioned previously in a second embodiment , the pocketmaker can comprise two retractable blades attached to linear body for example , two wheels or pulleys attached linearly . these blades can be moveably attached to the body of the pocket maker . the movement of the blades can be by direct drive or chain means , or any other means for moving the blades around the body of the pocketmaker device . this pocketmaker device can also comprise means for extending the blades and means for retracting the blades . the pocketmaker device is preferably inserted into the incision discussed above with the blades in the retracted position . once inserted into the end of the passageway , the device can be activated so that the blades are moved into the extending position . once in the extended position , the blades can be driven around the body of the pocketmaker device , cutting an area larger than the passageway through which the device was inserted , and creating a chamber at the end of the passageway . the twin blades of the pocket maker are then deployed by backing up ( pushing the trigger forward ) on the trigger . the twin blades are then advanced by repeated squeezing of the trigger ( for this embodiment ). this drives the blades forward , then around , then back , then up , then forward again . this results in a block of sclera 2 by 3 mm being excised . the blade on the right and the blade on the left each excise a quadrilateral 3d structure 1 . 4 mm by 1 mm . ( the drill has already removed a piece that is 0 . 2 mm in diameter .) in alternate embodiments , the tip of each blade can be bent , preferably at about a 90 degree angle , but lesser angles can also be used , so that when the blades are driven around the body of the pocketmaker , a complete dissection of the surrounding tissue has been completed . the angle of the tip of the blade can depend on the size of the chamber or pocket to be formed . the size of the blades can be altered to adjust the amount removed . it would be expected that the blades could be easily replaced on the pocket maker . the pocket maker can be withdrawn by inserting a sleeve that urges the blades back into the retracted position . once the device has been removed , a long forceps with small teeth such as a utrata is introduced into the anterior chamber , across the iris , and into the drill hole . one half of the cut sclera is grasped with the forceps and removed . the second half is then removed in similar fashion . the deformable implant is then placed into the a folder and compressed and deformed so that it fits through the 0 . 2 mm incision . the folder is autoclaveable . the folder is then inserted into the anterior chamber and directed to the previously made drill hole of 0 . 2 mm with the pocket of 2 mm by 3 mm behind it . there is approximately 0 . 5 mm of sclera remaining between the anterior chamber and the pocket . for this embodiment , we will assume it is a screw type delivery mechanism to deliver the device . the device is simply delivered into the pocket previously made and it returns to its original shape it had prior to being deformed . it is now , however , trapped in the scleral pocket . other methods for making the tunnel or bed could be employed . the tunnel could be made with a laser on the end of a tube . yag lasers , and excimer lasers , for example , have this capability . using the first incision into the sclera , a tunnel ( preferably roughly 0 . 3 mm in size ) would be made . techniques for making the tunnel can include drilling , emulsifying , lasering , grinding , or using instruments capable of taking bits of tissue . this tunnel would be made to the point of eventual implantation of the device . there currently exist 20 gauge instruments which contain a light pipe and a video system . such a device would be placed through the corneal incision and into the sclera incision . using a two handed technique , the light pipe and video in one hand , and a cutting instrument in the other hand , a scleral pocket could be created in a fan shaped pattern . the cutting instruments would be those discussed above for making the initial scleral tunnel . for example if an emulsifying unit was used , an initial pass creating a tunnel could be made . the light pipe video viewing system could be inserted here . through a second stab incision in the cornea a second tunnel could be made on such an angle that the two intersect . then , using the video system scleral tissue could be removed in a fan shape with the point of the fan being the second entry site . visulalization would be obtained through the video system of where tissue was being removed . when the process was completed a triangular bed of tissue would have been removed with two access ports into it , the one at the apex and the one for the video unit . an implant designed to fit this type of space , triangular in shape with appropriate thickness ( i . e . that of the emulsifying unit ) could be inserted . the emulsifying unit could employ irrigation and aspiration as described previously for the same reasons . the other instruments , lasers , drills grinders , instruments to take bites of tissue could all be used to perform this . irrigation and aspiration could be combined with these as well . once the incision or passageway has been created to the depth of the desired position of the implantable device , a device of the present invention can be used to create a pocket or chamber for the insertion of the implantable device . the creation of this pocket or chamber can be accomplished by the method of the present invention , as well as by the use of a device of the present invention . a device of the present invention for creation of the pocket or chamber can be called a pocketmaker device . this device accomplishes a step in the method of the present invention , namely , creating a pocket or chamber . the device comprises a body and at least one blade , preferably two blades . the blades are moveably mounted on the body and can be controlled by an individual . such control can be manual , by the use of small chains , pulleys , conveyors and similar devices connected to the device . the device can also comprise a means for extending and retracting the blades . the blades should be retracted so that the pocketmaker device can be inserted through the small incision , and then extended so that the device can be used to create a pocket of larger dimension than the small incision through which the device was inserted . the blades can be extended manually by manipulation of the chains , pulleys or conveyors , or by automated motor controlled externally by radio or other electronic means . such remote control means are known in the art , as are such manual means of activating and controlling the blades . in addition , the blades can be spring loaded and urged into the extended position . the pocketmaker device can be inserted into an injector or sleeve that presses the blades into the retracted position . once the pocketmaker is inserted into position and ejected from the injector or sleeve , the blades will move to the extended position . after the pockemaker had created a pocket or chamber , the sleeve can be reinserted into the incision , and pressed over the pocketmaker , urging the blades into the retracted position and allowing the pocketmaker to be removed . the pocketmaker device can further comprise a drive means for moving the blades around the body of the device . such drive means can comprise a system of chains or pulleys , a track with teeth , gears and cogs , or other means , all attached to a motor or driving means , of propelling the blades around the body of the pocketmaker device . the drive means should be capable of driving the blades around the body of the pocketmaker device . in addition to drive means , the pocketmaker device can further comprise means for vibrating the blades , so that the blades can cut through the scleral tissue more efficiently as the blades are driven around the body of the pocketmaker device . in embodiments of the present invention , the blades can further comprise an angled cutting tip and each end thereof . the tip should be located at the end of the blade farthest from the body , and preferably comprise a 90 ° bend whereby the blades , when driven or rotated about the body of the pocketmaker device , can create a pocket or chamber shaped cut . once the cut tissue is removed , the extended and driven blades will have created a chamber that is larger than the initial incision through which the pocketmaker was inserted . the larger dimensions of this chamber or pocket are useful in inserting a pressure relieving device , so that once the pressure relieving device has been inserted into the chamber or pocket , it cannot easily migrate out or change position . once an area has been removed , for example creating an intrascleral space 0 . 2 mm in height , roughly triangular or a rectangle or quadrilateral shape ( by switching instruments insertions ) the device could then be implanted . the device would be folded , placed in an inserter , introduced through the incisions in the cornea , into the opening in the sclera , and then injected . it would expand back to it &# 39 ; s original form , filling the space made , fluid would access through the opening into the anterior chamber , no sutures would be necessary and the conjunctiva is disturbed for a miniscule amount at a site remote from the device . in this manner , no incision is made in vascular tissue . the cornea has no vessels . the sclera has an occasional vessel which goes through it . the sclera heals only by secondary intention . since the conjunctiva and tenons tissue have not been violated no blood vessels will grow in from above . since the ciliary body has not been violated from below , no blood vessels will grow in from this source . there are no blood vessels in the anterior chamber for the normal eye and all glaucomas except for neovascular glaucoma . the intrascleral deformable device would not be indicated in neovascular glaucoma as the progressive growth of scar tissue ( called peripheral anterior synechiae ) will close over the sclerostomy ( the opening made by the drill into the anterior chamber ). a further advantage of this surgery is that the corneal endothelium is never in contact with the implant . the implant is recessed behind the opening ( sclerostomy ). the implantable pressure relieving devices of the present invention should be sized to fit the space created by the pocketmaker , but can be made in a wide variety of sizes and shapes . for example , if the chamber or pocket created is a circle 3 mm in diameter and has a depth of 0 . 2 mm , the implantable device should be manufactured to fit this space . the implanatable device should be deformable and can comprise a system of passageways , pores , or channels through it and / or on its surface . fluid accessing the device would then be distributed throughout the sclera of the eye . the implantable device can be made from a wide variety of materials , preferably those that are biocompatible . biocompatible materials that can be used include hydrogels , silicons , acrylics , hydrocarbons , and polymethylmethacrylate . preferably , the biocompatible material or combinations of materials can also be deformed , and once deformed will return to substantially their original shape . the pressure relieving devices of the present invention can be deformed , preferably folded , by a wide variety of devices or methods . for example , the implantable pressure relieving device can be placed in a cartridge , pushing down on the middle of the implant and then folding the cartridge together so the device is now folded in half . the cartridge and deformed pressure relieving device can be placed in a screw delivery device . by turning the screw a plunger gradually pushes the device out of the cartridge through a constricting end which further compresses the device to the size desired , preferably 0 . 2 to 0 . 3 mm . however , the size and shape desired will depend on the shape and size of the pocket or chamber formed according to the methods of the present invention . other embodiments of the implant may be used . for example , if subconjunctival filtration is required , the drill can be used to make an opening that extends subconjunctivally . the stop that was previously on the drill would be removed . depending on the design of the implant a small pocket could still be created in the sclera . it may not necessarily be the same size as previously described but only enough to hold the implant in position . for example , the implant may be a tube with a swelling on one or both sides , the tube may then extend further to the subconjunctival space . this type of implant would be folded in an appropriate folder and then injected into the scleral passage made by the drill . when the device returns to its normal size and shape the swellings ( or other types of design ) would then catch in the pocket on either side or on side of the drilled hole . this would then prevent the device from subluxating . the length of the device could also be adjusted from these fixation sites so that the tube did not protrude into the anterior chamber . the ability to deform the intraocular pressure relieving device , and the ability of the device to return to its original , pre - deformation shape and configuration , offers a distinct advantage in that the device can be inserted through a small incision in the cornea but can be anchored to the sclera without contacting the corneal endothelium . the distinct advantage of the device implanted in this manner is that there is no incision in the conjunctiva or tenons tissue . the drill approaches these tissues from underneath , ie , through the sclera . this would be visualized directly with the operating microscope . as the drill begins to penetrate , a viscoelastic substance could be then injected through the drilled passageway and move these tissues away from the sclera . the drilling could then be completed and the device inserted . some implants use a subconjuntival reservoir to increase the success of subconjunctival filtration . embodiments using reservoirs could also be folded and inserted with fixation achieved through the manner described above again , it would be expected that the success rates of subconjunctival filtration surgery ( as opposed to scleral filtration surgery ) would be improved by not inciting the healing response of the conjunctiva and tenons tissue . this is accomplished by performing the surgery from inside out , using the intracameral ( inside the anterior chamber ) approach and not the conjunctival approach . the traditional approach is to make an incision through the conjunctiva and tenons tissue to obtain access to the anterior chamber . this starts the healing response leading to scarring and therefore blockage of the exit of aqueous from the eye and resulting increase in intraocular pressure . since no incision with this new technique is made in the conjunctiva and tenon &# 39 ; s tissue , this is avoided . furthermore , because the devices of the present invention are placed in an area remote from the anterior chamber , they are not in contact with the cells of the corneal endothelium , and thus no corneal decompensation occurs .	0
now will be explained the methodology for calculating the multiphasic solution for achieving a uniform vascular enhancement . the distribution of contrast medium in a blood vessel depends on the circulating blood flow and blood volume of the vessel . although a whole body model provides a complete description of enhancement characteristic in each vessel and each organ , modeling with a limited number of compartments is less complex and more approachable for theoretical analysis of various injection parameters . there are various ways to model body compartments . an optimal model is the one that uses the smallest number of compartments , but adequately describes the underlying pharmacokinetic process . an approach frequently used in prior art studies of drug distribution is to model the whole body with two compartments , whereby contrast medium is introduced into a central plasma compartment , distributed to a peripheral extracellular compartment , and then eliminated from the central plasma compartment by renal excretion . although this scheme is sufficient for describing the late pharmacokinetics of contrast medium ( hours ), it needs further refinement to be applied to the description of early pharmacokinetics ( minutes ). fig2 shows a compartment model which is designed to simulate early contrast enhancement in the aorta . in this model , contrast medium is injected into the antecubital vein and distributed to the right heart , the pulmonary compartment , the left heart , and the aorta . it then recirculates back to the right heart via the systemic circulation . this transport scheme is specifically simplified to focus on early pharmacokinetics of the aortic contrast enhancement , thus reducing the complexity of our analysis . for example , a constant elimination of contrast medium from the central blood compartment by renal excretion ( transport to urine ) is only substantial in late pharmacokinetics and thus not considered in this simple compartment model . the model in fig2 is described mathematically as follows . let cv , cr , cp , cl , and cs be the contrast concentrations in the peripheral vein ( from the antecubital to the right heart , right heart , pulmonary , left heart , and systemic circulation , respectively . vv , vr , vp , vl and vs represent the corresponding compartment ( blood and interstitial ) volumes of the peripheral vein , right heart , pulmonary , left heart , and systemic circulation , respectively . qv is the volumetric flow rate of blood leaving the peripheral vein . qr , qp , ql , and qs are equivalent and represent the cardiac output of the system . cc and qc are the concentration and volumetric flow rate of injected contrast medium , respectively . during contrast injection , all the volumetric blood flow rates ( qv , qr , qp , ql , and qs ) are increased by qc . the governing equations for the model are written from mass balance equations for each compartment ( equations 1 - 5 in appendix a ). the aortic enhancement curves were computer simulated by numerically solving equations 1 - 6 in appendix a . the physiological parameters used in the model for humans include 40 ml for vv ( peripheral vein ), 250 ml each for vr ( right heart ) and for vl ( left heart ), 600 ml for vp ( pulmonary circulation ), and 10 l for vs ( systemic circulation ). associated volumetric blood flow rates are 250 ml / min or 4 . 2 ml / sec for qv and 6 . 5 l / min for the cardiac output . these values were estimated based on published human physiology data for a standard adult . to mimic channels of blood vessels , the peripheral venous compartment and pulmonary compartment are further divided into multiple smaller compartments in series ( 5 subcompartments for the peripheral venous compartment and 30 subcompartments for the pulmonary compartment ). since detailed cardiovascular physiologic data for porcine models are rather lacking compared to human models , the inventors rescaled the above human physiological parameters to determine the physiological parameters for the porcine model . the compartment volumes of the porcine model were estimated by multiplying the compartment volumes of a standard 70 kg human model by the body weight ratio , e . g . for a 25 kg pig , the ratio is 25 : 70 . it is known that the average cardiac output per body weight of pigs is twice as high as that of humans . therefore , the cardiac output for a 25 kg pig corresponds to that of a 50 kg human . although there is some subjectivity in selecting these parameters , they were estimated within available physiologic data and represent simply a set of reference values for simulation to compare with experimental data . a total of 38 ordinary differential equations were used to describe the model in fig2 . these equations were solved using numerical integration programs of fifth - order runge - kutta method . this model was run at a personal computer and took less than a fraction of a second to compute . the contrast concentration curve over time was calculated for each region by solving these differential equations for a given contrast injection protocol . after the contrast concentration in each compartment was computed by solving equations 1 - 6 , it was translated into a ct enhancement value . for a given input injection protocol , the mathematical model described above can be used to predict the output contrast enhancement curve of the aorta . conversely , the model can be used to solve the inverse problem , i . e . to predict an input function for a given output contrast enhancement profile . solving for an input contrast injection algorithm which will generate a prolonged , uniform vascular contrast enhancement is the focus of the present invention . the inverse problem can be solved directly by the laplace transform of governing equations in the model with a given desired constant aortic enhancement and initial conditions . mathematical manipulation for the solution is detailed in appendix a . this solution , i . e . a contrast injection profile , was in turn applied as an input to the mathematical model to simulate and verify the reproducibility of desired constant aortic contrast enhancement . simulation was performed for both porcine and human mathematical models by adjusting the physiological inout values . different injection profiles were tested to study how they affect aortic contrast enhancement . in addition , the effect of reduced cardiac output on the enhancement was investigated . the model was modified by decreasing the cardiac output by 20 % and 40 %. contrast enhancements were simulated in this model with the input injection which , when used in normal cardiac output , would produce a uniform contrast enhancement . the patterns of these enhancements were compared with that from normal cardiac output . in order to test the mathematical solutions , a porcine study was conducted . all animal care and procedures performed were approved by the institutional animal study committee . four pigs weighing initially 24 - 26 kg underwent scanning in two or three separate sessions . each session was separated by at least two days . two pigs had all their sessions within a week , while the other two pigs had their first two and last sessions delays 4 - 5 weeks , which results in an increase in their weight to 35 - 40 kg in their last session . in each session , the pig was anesthetized , intubated , and underwent scanning for three or four sets of images obtained in random order . during scanning , each pig was ventilated with oxygen and low tidal volume to minimize breathing motion artifact . each image set consisted of 27 dynamic ct sections ( 5 mm collimation ) acquired at a fixed mid - abdominal aortic level , following i . v . injection of contrast medium into a peripheral vein . each set of scans were 45 - 60 minutes apart to minimize the effect of prior contrast administration . all ct scanning was performed with a somatom plus - s scanner ( siemens medical systems , iselin , n . j .) using a one - second scanning time and a one - second interscan delay . three types of injection schemes were tested : uniphasic , biphasic , and multiphasic . biphasic injections were performed by a prior art power injector which was used in routine clinical ct scanning while uniphasic and multiphasic injections were conducted with a power injector which was invented for achieving the required protocols . this power injector was capable of delivering contrast medium in various uniphasic or multiphasic injection algorithms , as is explained in greater detail below . the multiphasic injection rate is determined by an initial injection rate and an exponential decay coefficient , as shown in fig3 . the total injected volume of contrast medium corresponds to the integrated sum of the multiphasic injection over injection duration . most injections were performed with the initial injection rate of 2 ml / s . volumes of contrast medium used were 50 , 70 and 90 ml of iothalmate meglumine ( conray 60 ; mallinckrodt medical , st . louis , mo . ; 282 mgi / ml ). three differential exponential decay coefficients ( 0 . 007 , 0 . 017 , 0 . 026 ) were tested . these coefficients were initially designed as ( 0 . 01 , 0 . 02 , 0 . 03 ), respectively , until further testing and verification revealed discrepancies between the design and actual values . these were the three smallest discrete increments allowed in the prototype of the inventive power injector . decay coefficient higher than 0 . 03 was not used because it was evident that a further increase in the coefficient would deviate further away from uniform vascular enhancements . a uniphasic injection was determined as being equivalent to a zero exponential decay coefficient where the injection rate remains constant at an initial injection rate throughout the injection duration . most extensively tested and compared injections were 50 ml total of contrast medium injected by a uniphasic injection of 2 ml / s and by a multiphasic injection of 2 ml / s initial rate having an exponential decay coefficient of 0 . 017 . the same injection methods were repeated but with an increased total contrast medium volume to 70 ml or with both increased injection rate to 3 ml / s and increased volume to 90 ml . other injections studied include biphasic injections of 50 ml ( 2 ml / s for 12 sec and then 1 . 4 ml / s for 18 sec ) and 70 ml of contrast medium ml ( 2 ml / s for 17 sec and then 1 . 0 ml / s for 36 sec ). approximately half of the total contrast volume was injected in each phase of the biphasic injections . the first and second injection rate of the biphasic injections were determined by the initial and final injection rates of the multiphasic injections with an exponential decay coefficient 0 . 017 of a corresponding total contrast medium volume , respectively . attenuation values of the aorta were measured from post - contrast scans ( at the same level as the pre - contrast scans ) using a circular region of interest ( roi ) at the center of the aorta . contrast enhancement was calculated as the absolute different in attenuation value between the pre - and post - contrast scans . for the data analysis , the injection duration ( id ), the magnitude of peak aortic enhancement ( pa ), and the uniformity of enhancement : the duration of the enhancement achieved with 90 % of the peak : 90 % dcf . were evaluated . means and standard deviations were also computed . the results are now explained . fig4 shows a simulated aortic enhancement curve generated from the model for a 25 kg pig with 50 ml of 282 mgi / ml contrast medium injected at a uniphasic 2 ml / sec . this curve was in good agreement with an empiric aortic enhancement curve observed in a 25 kg pig ( fig1 a ), including the time to and the magnitude of the peak aortic enhancement ( simulated vs . empiric : 28 vs . 26 sec and 234 vs . 250 hu ). these curves differed notably at the after - peak portion when the recirculation of contrast becomes substantial with the discontinuity of contrast injection . this portion was simplified in the model which mainly focused on the early part of the injection protocol , i . e . the first pass of contrast bolus pharmacokinetics . the contrast injection algorithm that provided a uniform , prolonged vascular enhancement was solved as shown in appendix a . the solution , i . e . contrast injection protocol is expressed as the product of an initial rejection rate and an exponential function of time , as shown in equation 15 . the exponential decay coefficient equals q / vs , the ratio of the cardiac output to the systematic volume of distribution of contrast medium , which is itself proportional to the cardiac output per body weight . fig5 a shows three exponential injection profiles with a 2 ml / s initial injection rate and decay coefficients ( 0 . 01 , 0 . 02 , and 0 . 03 ) for a 120 sec injection duration . the total amount of contrast medium in each injection is represented by the area under each curve . a lower exponential decay resulted in a higher total amount of contrast medium and a higher final injection rate at 120 sec . aortic contrast enhancement curves corresponding to these exponential injection profiles were simulated from the mathematical model ( with porcine physiological parameters ) by solving equations 1 - 6 and are depicted in fig5 b . uniform , plateau aortic enhancement was observed with an exponential decay constant of 0 . 02 ( q / vs = 77 / 3571 = 0 . 021 ). with decay coefficients 0 . 01 or 0 . 03 , contrast enhancement either steadily rises above this plateau level or declines after a peak below the plateau level , respectively . fig6 shows two simulated aortic enhancement curves for a human model using uniphasic or multiphasic injection protocols with 0 . 01 ( q / vs = 108 / 10000 ) exponential decay injections at an initial injection rate of 3 ml / s for a total of 160 ml of contrast medium . a prolonged , uniform contrast enhancement was achieved with the multiphasic injection protocol . notice that this exponential decay coefficient for the human model is approximately half that of the porcine model , reflecting the physiological values used in the model that the average cardiac output per body weight for humans is half that for pigs . the effect of reduced cardiac output on the enhancement was evaluated by reducing the cardiac output by 20 and 40 % in the model . the exponential injection with a decay coefficient 0 . 01 , which generates a uniform enhancement for normal cardiac output cq = 108 ml / s ), was used as the input contrast injection to this model with reduced cardiac output . the output simulated aortic enhancements are shown in fig7 . as shown therein , the contrast enhancement curves become more dome - shaped with an increase in magnitude , as the cardiac output decreases . fig8 demonstrates the empiric porcine aortic enhancement curves obtained for two pigs using multiphasic exponential injections with three different exponential decay coefficients ( 0 . 007 , 0 . 017 , 0 . 026 ). the contrast injection profiles are described in fig3 . exponential injection with a decay constant of 0 . 017 showed the aortic enhancement to be more uniform than with other injection protocols . this result was compatible with the theoretical model prediction that an exponential injection with a decay constant of 0 . 02 provided a plateaued aortic enhancement . injections with lower ( 0 . 007 ) or higher ( 0 . 026 ) decay constant resulted in aortic enhancements steadily rising or declining after a peak , respectively , as predicted by the theoretical model . the magnitude of aortic enhancement in fig8 a was substantially higher than that in fig8 b , reflecting the difference in body weight between two pigs t25 kg vs . 40 kg ). however , the patterns of aortic enhancement produced by three different exponential decay coefficients were consistent . aortic enhancement curves in two pigs experiencing unichasic and multiphasic exponential injections are shown in fig9 for ( a ) 50 ml and ( b ) 70 ml of contrast medium . the unichasic injection used a contrast injection rate of 2 ml / s , while the multiphasic injection started at 2 ml / s but declined exponentially with a decay constant 0 . 017 . the illustrated results clearly demonstrate that multiphasic injections yielded more prolonged and uniform vascular enhancement than uniphasic injections . performance of the multiphasic compared with the uniphasic injection can be summarized for four pigs as follows . for a 2 ml / s initial injection rate of 50 ml contrast medium , the multiphasic injection increased id by 30 %, reduced pa by a mean of 19 %, and increased 90 % dce by a mean of 81 %. for 70 ml injections with a 2 ml / s initial injection rate , id increased by 51 %, pa decreased by 18 %, and 90 % dce increased by 94 %. fig1 a shows empiric aortic enhancement curves in a 40 kg pig obtained with uniphasic and multiphasic exponential ( decay coefficient 0 . 017 ) injections with a 3 ml / s initial injection rate and 90 ml of contrast medium . in this pig , the multiphasic injection method resulted in more prolonged , uniform but slightly declining aortic enhancement . fig1 b demonstrates three empiric aortic enhancement curves generated by uniphasic , multiphasic and biphasic injections of 70 ml of contrast medium . the uniphasic injection consisted of a 2 ml / s injection for 35 sec , while the multiphasic injection had an initial rate of 2 ml / s with a decay coefficient of 0 . 017 for 53 sec . the biphasic injection was performed with a 2 ml / s rate for 17 sec and then a 1 . 0 ml / s rate for 36 sec . multiphasic injections again yielded more prolonged and uniform vascular enhancement than uniphasic injections . a biphasic injection resulted in more prolonged enhancement than a unichasic injection but generated two enhancement peaks with a valley in between . a prolonged , uniform vascular enhancement is desirable in ct angiography and some chest ct applications where the vessels , not the parenchyma of organs , are the target of interest . this enhancement pattern is useful for the purpose of image processing and display , in which 3d postprocessing is frequently based on a threshold ct attenuation value . it may also provide a longer optimal scanning interval for a given volume of contrast medium than a single - peaked contrast enhancement generated by a conventional uniphasic injection . alternatively , it may enable the use of a lower volume of contrast material for a given scanning duration . prolonged , uniform aortic contrast enhancements can be achieved by multiphasic exponential injections with adequately selected decay coefficients in accordance with the teaching of the present invention . the multiphasic injection protocol was mathematically derived from a physiologically - based pharmacokinetic model , and then a porcine model was used to confirm findings observed in theoretical analyses and computer simulations . although further clinical studies are warranted to validate the findings and injector performance , it is expected from previous experiences in comparative studies and pharmacokinetics that a human model would behave similarly . a simplified compartment model which has a limited number of compartments , instead of a more complex whole body model was used . the current compartment model was designed specifically to solve for a contrast injection profile which generates a prolonged , uniform vascular enhancement . this simple model does not provide a complete description of enhancement characteristics in each organ but can adequately describe the underlying pharmacokinetic process of interest , i . e . first - pass enhancement characteristics of the aorta . in this respect , the simulated results correlated well with the experimental results from the porcine model . since the model equations 1 - 5 in appendix a do not include renal or other clearance from the systemic circulation , the contrast concentration maintains a steady plateau following the cessation of contrast injection . this may not be a significant factor in scans of less than 5 - 1min duration . the fact that a multiphasic exponential injection generates a uniform vascular enhancement can be explained conceptually as follows . contrast enhancement in a system is proportional to the net amount of contrast medium present , i . e . inflow minus outflow contrast medium . aortic enhancement reflects an accumulation of contrast medium in the central blood volume ( i . e . contrast medium injected and recirculated minus medium diffused away from the vessel ). thus , vascular enhancement rises when the rate of contrast material infusion into the central blood volume exceeds the rate at which contrast medium diffuses away . this physiological event explains that aortic enhancement peaks shortly after the completion of the injection with a uniphasic injection , representing the maximal accumulation of contrast medium within the central blood volume compartment . the rate at which contrast medium leaves the central blood compartment to the interstitium compartment is likely proportional to the concentration gradient between the two compartments , i . e . an exponential function of time , because the contrast transport phenomenon is governed by passive diffusion and permeability . thus , when the outflow rate of contrast medium is balanced by the infusion rate of contrast medium by a multiphasic exponential injection protocol , a uniform vascular enhancement occurs . the experimental results showed that proper selection of a decay coefficient in multiphasic exponential injections was crucial to generate uniform vascular enhancement . the decay coefficient was proportional to the cardiac output per body weight . since the cardiac output per body weight in humans is half that of pigs , a 0 . 01 decay coefficient would be adequate for humans . this value , which is already normalized by body weight , is independent of body weight . for example , a multiphasic injection with a 0 . 017 decay coefficient resulted in a similar uniform vascular enhancement pattern but with a decrease in magnitude in the same pig scanned at its baseline weight of 25 kg and later after gaining 15 - 20 kg . the decay coefficient designed to generate a uniform enhancement for normal cardiac output resulted in more dome - shaped enhancement with increased magnitude when there is a reduced cardiac output , demonstrating the effect of cardiac output on contrast enhancement . in theory , albeit difficult in practice , if the degree of cardiac output reduction is known , the exact same uniform vascular enhancement can be reproduced for patients with reduced cardiac output . this can be achieved by lowering the initial injection rate and decay coefficient calculated for patients with normal cardiac output in an amount proportional to the reduction in cardiac output . however , it is apparent that a multiphasic injection designed to achieve a certain level of vascular enhancement in patients with normal cardiac output will not result in overestimation of contrast medium enhancement in patients with reduced cardiac output . the duration of aortic enhancement can be prolonged either by increasing the volume of contrast medium for a given initial rejection rate or by injecting slowly at a lower initial rate for a given contrast medium volume . with a uniphasic injection , peak magnitude of aortic enhancement depends on three injection factors , i . e . the concentration , injection rate , and total volume of contrast medium . with a multiphasic injection , however , the peak magnitude can be independent of the total volume of contrast medium , provided that the volume is not too small to reach an initial upslope enhancement to a plateau level . thus , a multiphasic injection protocol is advantageous over a uniphasic injection when a prolonged duration is desired , while keeping contrast enhancement from rising , by increasing the volume of contrast medium . although the theoretical analysis indicated that a multiphasic injection should follow an exponential decay to generate a prolonged , uniform vascular enhancement , other functional patterns may be used to approximate an exponential decay . for example , a short segment of an exponential curve can be approximated by a linear function without much disparity . this implies in practice that a linear or ramped injection protocol may be used instead of a strictly exponential injection when the injection duration is not too long and when the decay coefficient is relatively small ( for example , the exponential curve with 0 . 007 decay coefficient in fig3 ). in addition , a subtle discrepancy in enhancement from a slightly different approximation of exponential function may be indiscernible because of intrinsic physiological fluctuations in enhancement caused by vascular pulsation and respirator motion . however , these are all included as part of the present invention in accordance with the teaching herein . the data demonstrates that biphasic injections were not sufficient to generate a uniform vascular enhancement . in the study , multiphasic injections were generated with subsecond temporal resolution by the prototype injector . however , this degree of high temporal resolution may not be necessary . the number and interval of temporal steps required in multiphasic injection depends on the injection duration and exponential decay coefficients . although the effect of temporal resolution on the enhancement produced by multiphasic injections has not been fully explored , multiphasic temporal resolution of 2 - 3 seconds appears sufficient to generate uniform enhancement because of intrinsic physiological fluctuation . this factor presents another reason why strict adherence to all exponential decay function is not necessary in order to achieve clinically satisfactory and uniform vascular enhancement . the particular contrast injector or delivery system which is thought by the inventors to be particularly useful for implementation of the present invention includes a computer , or other digitally programmable control , for providing operator input and control of the injection protocol . in particular , a liebel - flarsheim model ct 9000 adv contrast delivery system , as depicted in fig1 , represents such a contrast injector . as shown therein , the contrast delivery system 20 includes a power head 22 for accepting the syringe containing the contrast medium , a control console 24 which may be a lcd display to provide for operator input and control of the injector , and a stand 26 with a base 28 containing the computer or other digital controller . in the subject injector , the injection parameters are entered in phases . each phase has a constant flow , a volume and an optional delay . these parameters are displayed on the injector control console 24 and the operator can change the values . typically , an operator can enter up to four phases . the injector then performs the injection by executing these phases in sequential order . for the injector of the present invention , the parameters of the 2nd phase were changed and the console screen redesigned to allow the operator to enter the parameters for an injection with an exponentially decaying flow rate . the operator enters the exponential coefficient and an elapsed time in order to define the injection protocol . the initial flow rate for the 2nd phase is the flow rate of the 1st phase . this arrangement allows the operator flexibility to experiment with different injection profiles that may include steady state flows before and / or after the exponential decaying flow . in the prototype injector , the 1st flow was used to allow the selected flow rate to reach steady state ( approximately 2 ml of volume ) and the 3rd phase was not used . the flow chart for , and the particular software program used in , the prototype injector are included as appendix b . also included as part of appendix b are the validation data which includes the data obtained by measuring during an injection the syringe volume versus time using a linear position transducer . a plot of this data is included , and compared with a calculated graph of the exponential curve desired to be obtained . as shown , the actual result curve is a close approximation of the theoretical curve . while the invention has been disclosed and described in the form of a preferred embodiment , the inventors contemplate that various changes and variations may be envisioned by those of ordinary skill in the art without departing from the invention . for example , the digital control and vagaries of actual devices may well result in injection protocols which are not truly exponential curves . furthermore , as mentioned above , other factors may serve to limit how close an injection rate may approximate an exponential curve . however , such variations are included within the teaching of the present invention as well as other modifications including changes to the particular injector . for example , virtually any logically controlled injector would be able to perform a multiphasic injection protocol and the invention should not be considered to be limited to a computer controlled , or even a digitally controlled injector . while operator input is usually considered as desirable , a preprogrammed or instructed or wired injector which is set up to perform a multiphasic injection protocol is also considered to be part of the present invention . indeed , the invention should be considered as being limited only by the scope of the claims appended hereto , and their legal equivalents . to develop governing equations for the model in fig2 mass balance equations are written for each compartment with input and output contrast flow . ## equ1 ## subject to the initial conditions at time t = 0 : where cv ( t ), cr ( t ), cp ( t ), cl ( t ), and cs ( t ) represent the concentration of the contrast with respect to time , t , within the peripheral venous , right heart , pulmonary , left heart ( aorta ), and systemic compartments respectively . the vv , vr , vp , vl , and vs are : the volumes of the various compartments which are assumed constant . these blood flow and volume of each compartment are determined from known physiologic data . the qv , qr , qp , ql , and qs represent the flows . qc ( t ) and cc are the time - dependent flow and concentration of the injected contrast material . the flow in each compartment equals the cardiac output , q : equations 1 - 6 can be numerically solved to predict and simulate an aortic enhancement curve for a given contrast injection condition . an example in a porcine model with 2 ml / s uniphasic injection is shown in fig4 . conversely , these differential equations can be used to estimate an input contrast injection algorithm that generates a uniform , prolonged vascular enhancement , i . e . solving an inverse problem , as shown below . because the initial contrast concentrations in the body compartments equal zero , taking the laplace transform of equations [ 1 ]-[ 5 ] yields ## equ2 ## where cv ( s ), cr ( s ), cp ( s ), cl ( s ), cs ( s ), and qc ( s ) are the laplace transforms of cv ( t ), cr ( t ), cp ( t ), cl ( t ), cs ( t ), and qc ( t ) respectively . a uniform aortic enhancement profile , i . e . constant cl ( t ), can be modeled effectively by letting ## equ3 ## where a is a scaling constant and h ( s ) is the laplace transform of the heaviside step - function , h ( t ): ## equ4 ## combining [ 12 ] and [ 7 ]-[ 11 ], ## equ5 ## the inverse laplace transform of [ 13 ] gives the desired result : ## equ6 ## equation [ 14 ] can be approximated by eliminating the terms involving the dirac delta function , d ( t ), and its derivatives since these terms contribute only to the impulse rise in contrast concentration immediately following t = 0 and not to the steady - state behavior . without these terms , [ 14 ] simplifies to ## equ7 ## the parameters forming multiplication terms outside the exponential term in this equation are independent of time and normalized by normalization constant ` α ` to set as the initial injection rate .	0
application servers range from small footprint , web - based processors for intelligent appliances or remote - embedded devices , to complete environments for assembling , deploying and maintaining scalable multi - tier applications across an enterprise . individual application servers are the building blocks of the invention . it is envisaged that almost any appropriate type of application server could serve as the basis for the invention . fig2 shows a simplified representation of a typical single application server , by way of example only . the resources accessible to a client through the application server may include one or more transactional and non - transactional resources 210 , for example relational databases 210 a , in memory databases 210 b , message queues 210 c , or switches 210 d . the particular resources 210 will differ from server to server . in terms of software , the application server comprises a suite of software that helps programmers isolate the business logic in their programs from the platform - related code . application servers can handle all of the application logic and connectivity found in client server applications . what this means is that methods for accessing resources 210 are defined in the server &# 39 ; s suite of software and may be accessed via an api or application programming interface . an api defines an interface to the specific predefined methods by which a programmer writing the application program can make requests of the operating system or other system resources . in using the api a programmer can often ignore any peculiarities of the platform or structure of the databases or other legacy systems that comprise resources 210 since the functionality that deals with these peculiarities is provided by the server software . typically the applications hosted by an application server will be component - based . a component is a software object that encapsulates certain functionality or a set of functionalities and is designed to interact with other components . a component has a clearly defined interface and conforms to a prescribed behaviour common to all components within an architecture . multiple components may be put together to build other components . large software systems can be built by integrating pre - existing software components . a component - based application is , therefore , software that is composed of one or more components that conforms to a prescribed behaviour common to all components within an architecture . typically the api will define the interface for developers to build such component - based functionality . typically therefore , it is the application components that access the system resources 210 , as mentioned above . at a high level of abstraction then , an application server may be considered in terms of a set of functions that it implements to support the execution of the applications the server hosts . on an application server , a very important function commonly supplied via the api is support for transactions . a transaction is a unit of interaction with a database management system or a similar resource . it must be treated in a coherent and reliable way independent of other transactions . a transaction is comprised of one or more software queries or instructions grouped together into an atomic unit of work that must succeed or fail as a whole . when managing transactions it is important to ensure that all resources updated by a transaction requested by an application are always left in a consistent state . in particular , all changes made by one user within a transaction should be isolated from changes made by other users running simultaneously . since multiple application components and system resources 210 may participate in a transaction , it is important to establish and maintain the state of the transaction as it occurs . this information is usually kept in a transaction context . a transaction context is an association between the transactional operations or functions on the resources and the components evoking the operations . some examples of application servers that provide particularly effective runtime environments for component - based applications which may execute within a transactional context include servlet engines , j2ee servers and jain slee servers . in one preferred embodiment the application server of the invention will leverage functionality from an api that is compliant with the jain slee ( service logic execution environment ) api specification . this specification is portable across vendor equipment and diverse types of network and is standardised , thereby allowing a large body of developers to build services that utilise a given set of specialised equipment without a large amount of specialised knowledge . the jain slee api is especially applicable to integrated networks and more specifically telecommunications network services . while the jain slee specification is preferred for the invention , any api specification , particularly one that provides interfaces to diverse types of network , allows for simplified access to diverse protocols and is portable across vendor equipment , would be an appropriate base for the api of the invention . likewise , although the java programming language is the preferred language of development for the invention , any programming language offering the same level of portability would be equally appropriate . it is also envisaged that the application server of the invention 230 should be fault tolerant . fault tolerant means that if there should be a failure somewhere on the server the server is nevertheless able to continue processing the client requests . fault tolerance is often achieved through what is known as clustering . a cluster is essentially a group of one or more application server instances ( as illustrated in fig2 ) where each instance is individually addressable . each instance is called a node and may be reified as one or more processes . an application server cluster may be deployed on one or more computing resources or machines on a network . server nodes are typically connected by a backbone creating a distributed application server . the nodes of the cluster communicate by sending messages to each other via the backbone . state and function information that exists on one node is replicated in at least one of the remaining nodes in the cluster . this redundancy protects clients from application server system failure . since the application server resources are distributed across the nodes of the cluster , if one node fails then in theory another node is able to take over and finish processing the client request . this is known as failover . however , current clustered application servers typically have a master / slave configuration wherein one node in the cluster is responsible for coordinating work on the cluster . in a master / slave configuration , if the master node fails then failover is much more difficult to achieve . the same is true of cluster configurations in which some nodes have special capabilities or access to particular resources that other nodes in the configuration do not have . in this scenario if the node with the critical capability should fail , failover is practically impossible . by comparison , the cluster configuration of the invention is a configuration of peers rather than of master / slave . fig3 illustrates a preferred cluster configuration of peers arranged according to the invention . the cluster includes two or more application server nodes indicated at 310 , 320 , 330 and 340 respectively . each node is preferably similar in configuration to the application server of fig2 . in the peer configuration of the invention each node is capable of providing the same set of functions as every other node and no node has any special responsibilities . in this way any single point of failure is eliminated and failover can be guaranteed as long as there are nodes functioning on the cluster . the cluster server nodes of the invention interact via one or more message streams , for example 350 . a preferred form message stream comprises messages generated by and propagated through the nodes in the network . a node receives messages from a message stream and may also place messages into the message stream . a node that is associated with a particular stream is said to be a member of the stream . a message on a message stream will generally pertain to an occurrence of significance that has occurred ( an event ). an event usually indicates a task that must be completed by the application server . the activities of a server are driven by events . an activity is generally comprised of a related stream of events . for example , on a telecommunications application server an activity might be a call to access voicemail . the process of allowing a user access to the voicemail system involves a great number of events , all of which are related to the activity of the voicemail access of that particular user in that particular session . on a distributed server , all events that are received must be routed for processing . typically , only a subset of all the nodes in the application server of the invention is made responsible for handling a particular event . this subset of the server nodes in the cluster will interact via its own message stream . fig4 illustrates a cluster 400 made up of five nodes node 1 , node 2 , node 3 , node 4 , and node 5 . in the application server shown in fig4 , one message stream 410 is associated with all nodes 1 to 5 . the cluster further includes four message streams with which only a subset of the nodes are associated , namely message stream a , message stream b , message stream c , and message stream d shown at 420 , 430 , 440 and 450 respectively . nodes 1 and 2 are both members of and associated with message stream a . nodes 1 , 4 , and 5 are all members of message stream b . nodes 2 , 3 , and 4 are members of message stream c while nodes 3 and 5 are members of message stream d . typically all event messages that relate to a particular activity will be sent on the same message stream and thus will be processed by the same subset of nodes on the server cluster . thus the activity context is propagated to all nodes that are associated with the particular message stream and which are therefore processing the particular activity . in the application server of the invention , the messages on each message stream are always delivered to each of the nodes on the message stream in a particular “ order ”. each node that is a member of a message stream receives every event in that same order unless one of the nodes has failed . this means for example , that if node 1 in fig4 were to receive message 1 , message 2 , and message 3 in that order on message stream a , then node 2 should receive message 1 followed by message 2 followed by message 3 . if there were any other nodes associated with message stream a then they would also receive message 1 , message 2 , and message 3 in that order . this guaranteed delivery of messages in the same order by all nodes that are a member of a message stream may be referred to as ordered message delivery . in the application server of the invention there is a special type of message referred to as the stream membership change message . this message is received by every node that is associated with the message stream as part of the message order , in the same way as any other message . the content of the membership change message is such that nodes associated with a message stream may know of any new member nodes and any nodes that are no longer members of the message stream . in the application server of the invention it is preferred that each node in the cluster and distributed application server are members of a special message stream referred to as the cluster membership message stream 410 . therefore the membership of a particular message stream is a subset of the membership of the special cluster membership message stream . changes in the membership of any of the other message streams will be driven by changes in the membership of the special cluster membership message stream 410 . so , if a new node is added to the cluster and therefore becomes a member of the cluster membership message stream 410 then the new cluster node is likely to be assigned membership to one or more of the other message streams also . similarly , if a node on the cluster fails or is removed from the cluster , that node will therefore no longer be a member of the cluster membership message stream . in this case the node &# 39 ; s membership in all other message streams with which it was associated will also be terminated . while a single node may be a member of more than one message stream in addition to the cluster membership stream 310 , the failure of any node will only affect those message streams ( other than the cluster membership stream ) of which the node is a member . other streams ( other than the cluster membership stream ) are unaffected . as all members in the cluster and therefore in the message streams are peers it is relatively simple to associate and delete nodes from a message stream dynamically . with the configuration described above the distributed application server of the invention is able to detect the failure of members in the configuration and be reconfigured dynamically whilst preserving the integrity of the messages in the message streams . fig5 illustrates the relationship between local functions 510 on an application server node , distributed functions 520 on the application server and the message streams 530 , 540 , 550 and 560 described above in accordance with the invention . each node for example 570 is preferably identical and provides the same set of functions as every other node in the application server cluster , the functions available on a node typically being comprised of one or more software components . for example , each node in the application server could include the same set of local functions . local functions 510 are functions that can be initiated and completed on a single one of the cluster nodes without co - operation with any other node . in the application server of the invention it is preferred that local functions are implemented using deterministic algorithms . that is , an algorithm in which no randomisation is used in any decision made by the algorithm . deterministic algorithms are particularly preferred for the invention because they guarantee that with identical input the algorithm will always produce identical results . it is important that every node that performs a function based on particular input should produce the same output as every other node that performs the same function based on the same input . distributed functions 520 are functions that require co - operation between the nodes on at least one of the message streams to produce a desired result . as illustrated in fig6 , a distributed function 600 will usually be comprised of two parts . the first part is at least one local function 610 implemented on at least one server node , which is associated with and driven by event messages on one or more ordered message streams for example 620 , 630 and 640 . the second part of a distributed function is a set of associations 650 with one or more message streams by which events are received and may be sent . events received on the message streams constitute input to the local functions . all nodes that support the same distributed function are members of the same required message streams . the local ( deterministic ) functions on each node will therefore perform the same actions in the same order without any additional message exchange for the purpose of coordination . the deterministic algorithms of the local function ( s ) are substantially separated from the node interaction mechanism as additional message exchange for the purpose of coordination is not required . in this way the actual implementation of the distributed function ( the local function ( s )) may be completely decoupled from the interactions between the nodes on the message stream . as described above , membership change messages are delivered to all nodes that are members of a message stream as a part of the message order . the content of the membership change message is such that the implementation of the distributed function ( the local function ( s )) may take action that is consistent among all nodes that are members of the message stream when the membership changes , without requiring additional message exchange . an example of a distributed function on the distributed application server of the invention is the selection of nodes for event processing . all events that are received on the server must be routed for processing . events need to be routed in such a way that the workload on the server cluster is effectively balanced . load balancing is a term which generally refers to the pre - defined procedures by which workload is distributed across two or more server nodes to improve response time and / or throughput . effective load balancing is important for improved scalability of the distributed server . fig7 illustrates some of the elements involved in the routing of events within the distributed server of the invention from the point of view of two nodes ( nodes 1 and 5 ) from the example cluster of fig4 . when a node receives an event , a message stream must be selected to handle the event . the event is then delegated for processing to the selected message stream . if for example , node 1 receives an event , the local event processor function ( s ) will determine where to route the event but they cannot do this without reference to the message stream associations . if for example , node 1 were to receive an event the local event processor functions on node 1 would refer to the message stream associations . this would reveal that node 1 is a member of message streams a and b and would also provide information as to what other nodes are members of the message stream . in addition , each node maintains a local estimate of the load for each message stream of which it is a member . the estimate is derived from the history of events accepted and processed so far . the association data will thus allow the local event processor functions that define rules for event processing and load balancing to determine which of the message streams to which the event should be routed . for example , the local event processor functions may implement sticky load balancing . the event message is then sent out to the members of the selected message stream . in this way the distributed functions of event routing and load balancing are implemented . other examples of distributed functions implemented on the distributed application server of the invention are the replication of component state ( the state of hosted application components ), the co - ordination of event processing success / failure , feedback based event rate limiting and co - ordination of management operations across all nodes in the application server . the foregoing describes the invention including preferred forms thereof . alterations and modifications as will be obvious to those skilled in the art are intended to be incorporated within the scope hereof , as defined by the accompanying claims .	7
in fig1 a television camera 1 is slighted for surveillance of an object or scene to be supervised . a video signal produced by the television camera 1 is delivered to a first gate circuit 2 and a second gate circuit 3 . the contact paths of the gate circuits 2 and 3 are controlled by mutually complementary masking signals m and m which are generated in a masking generator 4 of known type . the masking generator 4 serves for electronic subdivision of the television picture corresponding to the video signal into a plurality of areas . by means of further circuits ( not shown but of known type ) it is possible to adjust the position and size of the picture areas defined by the masking generator 4 . in the present example here considered the television picture is subdivided into a picture area f of rectangular form and a further picture area consisting of the remainder of the television picture p surrounding the area f . the gate circuit 2 is so controlled by the masking signal m that those parts of the video signal which belong to the area f are suppressed . on the other hand , at the output of the gate circuit 3 there are available those parts of the video signal belonging only to the picture area f . the video signal from 2 is delivered to a device 5 for picture analysis where the video signal is evaluated according to any suitable criteria for determining whether an alarm is to be raised . the evaluation is performed with the assistance of a comparison signal deposited in a picture store 6 . at the end of each evaluating interval , for example at the end of each field period , an alarm pulse a is , if the criteria are met , delivered through a delay stage 7 having a delay of one field period t tb and applied and delivered through a normally closed gate circuit 8 to an alarm condition indicator generator 9 for releasing an optical and / or acoustic alarm . the video signal available at the output of the gate circuit 3 is delivered to an analysis device 10 for evaluation of the selected area f . in this device 10 a comparison is effected between the integral value of the video signal , representing the average area brightness , and a reference value deposited in a so - called area store 11 . if the comparison results in a predetermined difference , a suppression pulse f a appears at the output of the device 10 . the pulse f a is logically linked in a logic circuit 12 with the alarm pulse a available at the output of the device 5 , and the result f a &# 39 ; of this logic operation is delayed in a following delay device 13 by a time period δt equal to the time interval between the termination of a selected area within a field and the termination of the field itself . furthermore the suppression pulse f a available at the output of the device 10 is delayed in a delay device 14 by a field period t tb pulse δt , and the same pulse f a is also delayed in a delay device 16 by the period δt . the pulse u ( f a ) available at the output of the delay device 14 , after passing through an or gate 15 , serves for controlling the gate circuit 8 , whilst the pulse r ab available at the output of the delay device 16 serves for controlling the picture store 6 . to another input of the or gate 15 there is delivered or applied the pulse u ( f &# 39 ; a ) which is available at the output of the delay device 13 . by means of the or gate any delayed alarm pulse a &# 39 ; is blocked or suppressed by opening of the gate 8 by either of the pulses u ( f a ) or u ( f a &# 39 ;). the operation of the alarm system shown in the block schematic diagram of fig1 will now be more particularly described in the following with reference to the voltage - time diagrams of fig2 and 3 in the event of the occurrence of a random variation in brightness irrelevant to a genuine alarm . fig2 and 3 represent the conditions occurring when a random brightness variation occurs over different perods of the video signal and will be described separately , fig2 being dealt with first . the signal curve of fig2 a is intended to correspond to eight succeeding television fields which are scanned at vertical frequency . the dashed line within each field indicates the position of the selected picture area f during the field period . let it be assumed that a random overall change in brightness in the picture begins in the blanking gap between fields 1 and 2 and terminates in the blanking gap between fields 4 and 5 . furthermore let it be assumed that the brightness variation detected in respect of the area f gives rise to pulses f a at the respective right hand lower corners of the picture areas f in the fields 2 and 5 ( fig2 b ). in the areas f of the fields 5 and subsequent fields , the average brightness is again constant in the signal available at the output of the gate circuit 3 . in fig2 c there are shown the unwanted alarm pulses a which are assumed to be produced at the output of the picture analysis device 5 by the overall brightness change . in the present practical example under consideration alarm pulses appear in each case at the ends of the fields 2 to 5 . the alarm pulses a &# 39 ; represented in fig2 d are in each case delayed by one period of a field with respect to the alarm pulses a at the input of the delay device 7 . the pulses u ( f a ) shown in fig2 e are delayed with respect to the pulses f a of fig2 b by a field period , and additionally by the period δt . these pulses u ( f a ) coincide with the alarm pulses a &# 39 ; of fig2 d . therefore the alarm pulses a &# 39 ; are not transmitted by the gate circuit 8 to the alarm transmitter 9 which is therefore unable to release an alarm . each pulse f &# 39 ; a shown in fig2 f is produced by the logic circuit 12 when a pulse f a follows an alarm pulse a . fig2 g shows pulses u ( f &# 39 ; a ) at the output of the delay stage 13 . in consequence of the or linkage effected by the or gate 15 , the pulses represented in fig2 h are delivered to the gate circuit 8 to interrupt transmission of the alarm post . the voltage - time diagrams shown in fig2 i and 2k serve for illustrating the functioning of the stores 11 and 6 respectively . the pulses shown in fig2 i initiate renewal or updating of the comparison information stored in the area store 11 in accordance with the changed brightness conditions from one such pulse to the next , and the pulses shown in fig2 k initiate a similar updating of the picture store 6 . thus this updating of information is effected only when variations in brightness render this actually necessary , although it could be effected for each field irrespective of brightness changes . the pulses of fig2 i are coincident with the alarm pulses f a of fig2 b , and the pulses of fig2 k are coincident with the pulses f a of fig2 b when delayed by δt in the delay device 16 . the voltage - time diagram of fig3 a again shows a succession of eight fields . however , in this sequence the variation in brightness begins shortly after the scanning of the area f in the field 2 and is completed shortly before the scanning of the area f in the field 5 . in this case a suppression pulse f a ( fig3 b ) in respect of field 2 is missing , because at the instant of the evaluation of the area f of that field a brightness change had not yet occurred . nevertheless , at the end of the second field an alarm pulse a ( fig3 c ) appears because it is already possible for the device 5 to detect the brightness variation in the remainder of the picture area . in fig3 d there are shown the alarm pulses a &# 39 ; delayed by one field period , and in fig3 e there are shown the suppression pulses u ( f a ) delayed by one field period plus δt . notwithstanding the delay of the alarm pulses a by a field period t tb to provide the alarm pulses a &# 39 ;, it is still not possible to suppress the first alarm pulse a &# 39 ; originating from the second field . this is the reason for the production of the additional suppression pulses u ( f &# 39 ; a ) ( fig3 g ) which was not strictly necessary under the assumed conditions of fig2 . the pulses f &# 39 ; a ( fig3 f ) are produced by the logic circuit 12 each exactly at the time when a suppression pulse f a ( fig3 b ) follows upon an alarm pulse a ( fig3 c ). in the example at present being considered this takes place for example in the fields 2 and 3 , so that by reason of the short delay by the period δt , the first alarm pulse a &# 39 ; ( fig3 d ), which originates from field 2 and which normally would result in a spurious alarm , is suppressed at the right time . the pulses in fig3 h , 3i and 3k are obtained in the above described manner . the position and the dimensions of the area f are so selected in any particular case that any spurious brightness changes in the picture leading to an irrelevant alarm pulse a are always , or almost always , detected by the area analyzer 10 for suppression of the pulse a . in this connection the sensitivity to brightness changes of the area analyzer 10 is sufficiently higher than that of the picture analyzer 5 that variations in picture brightness evoking the production of spurious alarm pulses a will also be almost certain to cause a response of the area analyzer 10 .	6
hereinafter , embodiments of the present disclosure will be described in detail with reference to the drawings . in addition , the following description will be set forth in the following order : an example where element electrodes are installed at upper and lower surfaces . an example where an element electrode is installed at only a lower surface . an example where the light emitting unit of the above embodiments is installed as a pixel . first , a light emitting unit 1 according to a first embodiment of the present disclosure will be described . fig1 a is a perspective view showing an example of a general configuration of the light emitting unit 1 . fig1 b shows an example of a cross - sectional configuration of the light emitting unit 1 of fig1 a in an arrow direction ib - ib . the light emitting unit 1 may be very usefully applied as a display pixel of a display device which is a so - called led display , and is a small package where a plurality of light emitting elements are surrounded by a thin resin . as shown in fig1 a , the light emitting unit 1 has three light emitting elements 10 . each light emitting element 10 is a solid light emitting element emitting light of a predetermined wavelength range from a surface thereof , and in detail is an led chip . the led chip represents a chip obtained by cutting a wafer whose crystal has grown , which is not in a package type surrounded by a molding resin or the like . the led chip is called a micro led since it has a size of , for example , 5 μm or above and 100 mm or less . the planar shape of the led chip is , for example , substantially cubic . the led chip has a thin film shape , and an aspect ratio ( height / width ) of the led chip is , for example , equal to or greater than 0 . 1 and less than 1 . each light emitting element 10 is disposed in the light emitting unit 1 , and for example , as shown in fig1 a , is disposed in a row together with other light emitting elements 10 with a predetermined gap ( interval ) being interposed therebetween . at this time , the light emitting unit 1 has , for example , an elongated shape extending in an array direction of the light emitting element 10 . a gap between two adjacent light emitting elements 10 is , for example , equal to or greater than the size of each light emitting element 10 . in addition , on occasions , the gap may be smaller than the size of each light emitting element 10 . the light emitting elements 10 are respectively configured to emit lights of different wavelength ranges . for example , as shown in fig1 a , three light emitting elements 10 are composed of a light emitting element 10 g emitting a light of a green band , a light emitting element 10 r emitting a light of a red band , and a light emitting element 10 b . for example , in a chase where the light emitting unit 1 has an elongated shape extending in the array direction of the light emitting element 10 , the light emitting element 10 g is , for example , disposed near the short side of the light emitting unit 1 , and the light emitting element 10 b is disposed , for example , near a short side other than the short side of the light emitting unit 1 which is near the light emitting element 10 g . the light emitting element 10 r is disposed , for example , between the light emitting element 10 g and the light emitting element 10 b . in addition , locations of the light emitting elements 10 r , 10 g , and 10 b are respectively not limited to the above , but hereinafter , location relationship of other components may be described on the assumption that the light emitting elements 10 r , 10 g , and 10 b are disposed at the above locations . as shown in fig2 a , for example , each light emitting element 10 has a semiconductor layer where a first conductive layer 11 , an active layer 12 and a second conductive layer 13 are laminated in order . in the light emitting element 10 g and 10 b , the first conductive layer 11 , the active layer 12 and the second conductive layer 13 are made of , for example , ingan - based semiconductor material . meanwhile , in the light emitting element 10 r , the first conductive layer 11 , the active layer 12 and the second conductive layer 13 are made of , for example , algainp - based semiconductor material . a second electrode 15 is installed at the surface of the second conductive layer 13 ( namely , a light emitting surface s 2 ). the second electrode 15 is made of , for example , ti ( titan )/ pt ( platinum )/ au ( gold ), for the light emitting element 10 g and 10 b . the second electrode 15 is made of , for example , auge ( an alloy of gold and germanium )/ ni ( nickel )/ au , for the light emitting element 10 r . the second electrode 15 contacts the second conductive layer 13 and is electrically connected to the second conductive layer 13 . in other words , the second electrode 15 makes an ohmic contact with the second conductive layer 13 . meanwhile , at the lower surface of the first conductive layer 11 , a first electrode 14 is installed . the first electrode 14 is a metal electrode . the first electrode 14 is made of , for example , ti / pt / au for the light emitting element 10 g and 10 b . the first electrode 14 is made of , for example , auge / ni / au for the light emitting element 10 r . the first electrode 14 contacts the first conductive layer 11 and is electrically connected to the first conductive layer 11 . in other words , the first electrode 14 makes an ohmic contact with the first conductive layer 11 . the first electrode 14 and the second electrode 15 may be configured as a single electrode together or may be configured as a plurality of electrodes . in addition , hereinafter , as shown in fig2 a , it is assumed that the first electrode 14 and the second electrode 15 are a single electrode together . the first electrode 14 and the second electrode 15 may be configured to include , for example , metal material with high reflectivity such as ag ( silver ), al ( aluminum ) or the like . a side surface s 1 of each light emitting element 10 ( in detail , a semiconductor layer ) is , for example , an inclined surface crossing a lamination direction , as shown in fig2 a , in detail an inclined surface where a cross section of the corresponding light emitting element 10 has an inverse trapezoidal shape . as described above , as the side surface s 1 has a tapered shape , the light emitting efficiency in the front direction may be improved . in addition , the side surface s 1 may be , for example , a vertical surface perpendicular to the lamination direction , as shown in fig2 b . as shown in fig2 a and 2b , each light emitting element 10 has , for example , a laminated body composed of a first insulation layer 16 , a metal layer 17 , a second insulation layer 18 and a pad electrode 19 . the laminated body is a layer formed from the side surface s 1 of the semiconductor layer over the lower surface . in the laminated body , at least the first insulation layer 16 , the metal layer 17 and the second insulation layer 18 are respectively thin layers , for example , formed by a thin film forming process such as cvd , deposition , sputtering or the like . in other words , in the laminated body , at least the first insulation layer 16 , the metal layer 17 and the second insulation layer 18 are not formed by a thick film forming process such as spin coating , resin molding , potting or the like . the first insulation layer 16 , the metal layer 17 and the second insulation layer 18 covers at least the entire side surface s 1 to be formed from a region opposite to the side surface s 1 over a part of a region opposite to the first electrode 14 . the first insulation layer 16 is for electric insulation between the metal layer 17 and the semiconductor layer . the first insulation layer 16 is formed , among the side surface s 1 , from the end portion of the light emitting element 10 at the light emitting surface s 2 side over the outer circumference of the surface of the first electrode 14 . in other words , the first insulation layer 16 is formed to contact the entire side surface s 1 of the light emitting element 10 and is further formed to contact the outer circumference of the surface of the first electrode 14 . the first insulation layer 16 is made of transparent material with respect to the light generated from the active layer 12 , for example , sio 2 , sin , al 2 o 3 , tio 2 , tin or the like . the first insulation layer 16 has , for example , a thickness of about 0 . 1 μm to 1 μm , substantially regular . in addition , the first insulation layer 16 may have irregularity in thickness due to a production error . the metal layer 17 is for covering or reflecting the light generated from the active layer 12 . the metal layer 17 is formed to contact the surface of the first insulation layer 16 . the metal layer 17 is formed , at the surface of the first insulation layer 16 , from the end portion at the light emitting surface s 2 side to a place slightly rearward from the end portion at the first electrode 14 side . in other words , the first insulation layer 16 has an exposed surface 16 a not covered by the metal layer 17 , at a portion opposite to the first electrode 14 . the end portion of the metal layer 17 at the light emitting surface s 2 side is formed at the same surface of the end portion of the first insulation layer 16 at the light emitting surface s 2 side ( in other words , the same surface as the light emitting surface s 2 ). meanwhile , the end portion of the metal layer 17 at the first electrode 14 side is formed at a region opposite to the first electrode 14 to partially overlap the metal layer 17 with the first insulation layer 16 being interposed therebetween . in other words , the metal layer 17 is insulated ( electrically separated ) from the semiconductor layer , the first electrode 14 and the second electrode 15 by the first insulation layer 16 . between the end portion of the metal layer 17 at the first electrode 14 side and the metal layer 17 , a gap ( interval ) is present as much as the thickness of the first insulation layer 16 . however , since the end portion of the metal layer 17 at the first electrode 14 side and the first electrode 14 overlap each other with the first insulation layer 16 being interposed therebetween , the gap ( interval ) may not be visually recognized in the lamination direction ( namely , in the thickness direction ). further , the thickness of the first insulation layer 16 is just several μm at most . therefore , the light generated from the active layer 12 is substantially not emitted to the outside directly through the gap ( interval ). the metal layer 17 is made of material covering or reflecting the light generated from the active layer 12 , for example , ti , al , cu , au , ni , or their alloys . the metal layer 17 has , for example , a thickness of about 0 . 1 μm to 1 μm , substantially regular . in addition , the metal layer 17 may have irregularity in thickness caused by a production error . the second insulation layer 18 is for preventing a conductive material ( for example , solder , plate , sputtering metal ) joining the pad electrode 19 and a mounting substrate to each other and the metal layer 17 from being shorted , when the light emitting unit 1 is mounted to the mounting substrate ( not shown ). the second insulation layer 18 is formed to contact the surface of the metal layer 17 and the surface of the first insulation layer 16 ( the exposed surface 16 a ). the second insulation layer 18 is formed on the entire surface of the metal layer 17 and is formed on all or a part of the exposed surface 16 a of the first insulation layer 16 . in other words , the second insulation layer 18 is formed from the exposed surface 16 a of the first insulation layer 16 over the surface of the metal layer 17 so that the metal layer 17 is covered by the first insulation layer 16 and the second insulation layer 18 . the second insulation layer 18 is made of , for example , sio 2 , sin , al 2 o 3 , tio 2 , tin or the like . in addition , the second insulation layer 18 may be made of a plurality of materials among the above materials . the second insulation layer 18 has , for example a thickness of about 0 . 1 μm to 1 μm , substantially regular . in addition , the second insulation layer 18 may have irregularity in thickness caused by a production error . the pad electrode 19 is an electrode drawn from the first electrode 14 ( namely , a drawn electrode ). the pad electrode 19 is formed from the exposed surface 14 a of the first electrode 14 over the surface of the first insulation layer 16 and the surface of the second insulation layer 18 . the pad electrode 19 is electrically connected to the first electrode 14 so that a part of the pad electrode 19 overlaps a part of the metal layer 17 with the second insulation layer 18 being interposed therebetween . in other words , the pad electrode 19 is insulated ( electrically separated ) from the metal layer 17 by the second insulation layer 18 . the pad electrode 19 is made of material reflecting the light generated from the active layer 12 with high reflectivity , for example , ti , al , cu , au , ni , or their alloys . in addition , the pad electrode 19 may be formed a plurality of materials among the above materials . between the end portion of the pad electrode 19 and the metal layer 17 , a gap ( interval ) is present as much as the thickness of the second insulation layer 18 . however , since the end portion of the pad electrode 19 and the end portion of the metal layer 17 at the first electrode 14 side overlap each other , the gap ( interval ) may not be visually recognized in the lamination direction ( namely , in the thickness direction ). further , the thickness of the second insulation layer 18 is just several μm at most . further , since the end portion of the first electrode 14 and the metal layer 17 at the first electrode 14 side and the end portion of the pad electrode 19 overlap each other , the passage communicating with the outside from the active layer 12 through the first insulation layer 16 and the second insulation layer 18 is bent in an s shape . in other words , the passage where the light generated from the active layer 12 may pass is curved in as s shape . from the above , the first insulation layer 16 and the second insulation layer 18 used for insulating the metal layer 17 may be a passage communicating with the outside from the active layer 12 , but this passage may be recognized as being configured so that the light generated from the active layer 12 may substantially not leak out since it is extremely narrow and has an s shape . in addition , from the viewpoint that it is prevented for the light generated from the active layer 12 to be directly incident on another light emitting element 10 , the metal layer 17 may not cover a portion of the active layer 12 other than the exposed surface , if it is formed on the surface of the first insulation layer 16 to contact at least a surface of the active layer 12 opposite to the exposed surface . at this time , the first insulation layer 16 may not cover the entire side surface s 1 , if it is formed on the surface of the semiconductor layer to cover at least the exposed surface of the active layer 12 . in addition , the metal layer 17 may not cover the entire side surface s 1 , if it does not cover at least a surface at an adjacent light emitting element 10 side , in the side surface s 1 . at this time , the first insulation layer 16 may not cover the entire side surface s 1 if it does not cover at least a side at an adjacent light emitting element 10 side , in the side surface s 1 . in addition , from the viewpoint that it is prevented for the first conductive layer 11 and the second conductive layer 13 from being shorted through the metal layer 17 , in any case , it is preferable that the metal layer 17 is not drawn at the surface of the first insulation layer 16 . in addition , in the case where three light emitting elements 10 included in the light emitting unit 1 are light emitting elements 10 r , 10 g and 10 b , it is preferred that all light emitting elements 10 have the above laminated body , but any light emitting element 10 may not have the above laminated body . for example , among three light emitting elements 10 , the light emitting element 10 b emitting a light of a shortest wavelength may have the above laminated body . in addition , for example , among three light emitting elements 10 , the light emitting elements 10 ( in detail , the light emitting elements 10 g and 10 b ) other than the light emitting element 10 r emitting a light of a longest wavelength may have the above laminated body . fig3 a and 3b shows an example of a cross - sectional configuration of the light emitting element 10 where the above laminated body is not installed . in addition , in fig3 a and 3b , the light emitting element 10 r emitting a light of a longest wavelength is exemplified as the light emitting element 10 where the above laminated body is not installed . the light emitting element 10 is , for example , configured so that the metal layer 17 and the second insulation layer 18 are excluded from the above laminated body as shown in fig3 a and 3b . in addition , the light emitting element 10 may be configured , on occasions , to exclude even the first insulation layer 16 and the pad electrode 19 , so that the entire first electrode 14 is exposed . as shown in fig1 a , the light emitting unit 1 includes a chip - type insulating body 20 covering each light emitting element 10 and terminal electrodes 31 and 32 electrically connected to each light emitting element 10 . the terminal electrodes 31 and 32 are disposed at the bottom surface side of the insulating body 20 . the insulating body 20 surrounds and retains each light emitting element 10 at least at the side surface of each light emitting element 10 . the insulating body 20 is made of , for example , resin material such as silicon , acryl , epoxy or the like . the insulating body 20 may include other material such as polyimide or the like in part . the insulating body 20 is formed to contact a region where the second electrode 15 is not formed , among the side surface of each light emitting element 10 and the surface of each light emitting element 10 . the insulating body 20 has an elongated shape ( for example , a rectangular parallelepiped shape ) extending in the array direction of each light emitting element 10 . the height of the insulating body 20 is greater than the height of each light emitting element 10 , and the lateral width ( the width in the short side direction ) of the insulating body 20 is wider than the width of each light emitting element 10 . the size of the insulating body 20 is , for example , 1 mm or less . the insulating body 20 has a thin film shape . the aspect ratio ( maximum height / maximum lateral width ) of the insulating body 20 is decreasing when the light emitting unit 1 is transcribed so that the light emitting unit 1 does not lie , to be , for example , ⅕ or less . as shown in fig1 a and 1b , the insulating body 20 has , for example , an opening 20 a at a location corresponding to a side just above each light emitting element 10 . at the bottom surface of each opening 20 a , at least the second electrode 15 ( not shown in fig1 a and 1 b ) is exposed . in addition , as shown in fig1 a and 1b , the insulating body 20 has , for example , an opening 20 b at a location corresponding to a side just below each light emitting element 10 . at the bottom surface of each opening 20 b , at least the pad electrode 19 ( on occasions , the first electrode 14 ) ( not shown in fig1 a and 1b ) is exposed . the pad electrode 19 ( or , the first electrode 14 ) is connected to the terminal electrode 31 through a predetermined conductive member ( for example , solder and plated metal ). meanwhile , the second electrode 15 is connected to the terminal electrode 32 through a bump 33 and a connection portion 34 shown in fig1 a . the bump 33 is a pillar - shaped conductive member buried in the insulating body 20 , and the connection portion 34 is a band - shaped conductive member formed on the surface of the insulating body 20 . in addition , the second electrode 15 may be connected to the terminal electrode 32 through a conductive member other than the bump 33 and the connection portion 34 . the terminal electrodes 31 and 32 are configured to mainly include , for example , cu ( copper ). a part of the surfaces of the terminal electrodes 31 and 32 may be coated with , for example , material not easily oxidized , such as au ( gold ). next , the effects of the light emitting unit 1 of this embodiment will be described . in this embodiment , the above laminated body is installed at the light emitting element 10 b emitting a light of a shortest wavelength , among three light emitting elements 10 . by doing so , among the light generated from the active layer 12 in the light emitting element 10 at which the above laminated body is installed , the light propagating toward the inside of the lamination surface may be reflected by the metal layer 17 installed at the side surface of the light emitting element 10 and disturb light incidence to an adjacent light emitting element 10 . as a result , a bad influence ( for example , degradation of the resin without a light resistance against a blue light ) caused by the light propagating in the insulating body 20 of the light emitting unit 1 may be decreased . in addition , in a case where the above laminated body is installed to at least two light emitting elements 10 b and 10 g among three light emitting elements 10 , the excitation of the light emitting element 10 r caused by the light generated from the light emitting element 10 b or the light emitting element 10 g may also be disturbed . therefore , the change of color temperature or the range of color reproduction may be reduced . in particular , in a case where the first insulation layer 16 and the metal layer 17 cover at least the entire side surface s 1 of the light emitting element 10 , among the light generated from the active layer 12 , not only the light propagating toward the inside of the lamination surface but also the light propagating in an inclined direction may be reflected to the metal layer 17 . as a result , a bad influence caused by the light propagating in the insulating body 20 of the light emitting unit 1 may be greatly reduced . in addition , since the metal layer 17 installed at the side surface s 1 is electrically separated from the first electrode 14 and the second electrode 15 , there is very little change that the first electrode 14 and the second electrode 15 are shorted through the metal layer 17 . for this reason , there is also very little change that the metal layer 17 installed at the side surface s 1 gives a bad influence on a pressure resistance of the light emitting element 10 . however , in this embodiment , in order to avoid that the first electrode 14 and the metal layer 17 are shorted , a gap ( interval ) is present between the metal layer 17 and the first electrode 14 . however , since the first insulation layer 16 and the metal layer 17 are formed from a region of the semiconductor layer opposite to the side surface s 1 over a region opposite to the first electrode 14 , a part of the first electrode 14 and a part of the metal layer 17 overlap each other with the first insulation layer 16 being interposed therebetween . for this reason , the light from the active layer 12 does not directly leak out to the insulating body 20 through the gap ( interval ) between the first electrode 14 and the metal layer 17 . by doing so , a bad influence caused by the light propagating in the insulating body of the light emitting unit 1 may be reduced without giving a bad influence on the pressure resistance of the light emitting element 10 . in addition , in this embodiment , the second insulation layer 18 is formed from the exposed surface 16 a of the first insulation layer 16 over the surface of the metal layer 17 , and further the pad electrode 19 is formed from the exposed surface 14 a of the first electrode 14 over the surface of the first insulation layer 16 and the surface of the second insulation layer 18 . by doing so , since a part of the metal layer 17 and a part of the pad electrode 19 overlap each other with the second insulation layer 18 being interposed therebetween , there is very little change that the light from the active layer 12 leaks out to the insulating body 20 through the gap ( interval ) between the first electrode 14 and the metal layer 17 , and between the gap ( interval ) between the metal layer 17 and the pad electrode 19 . as a result , it is possible to prevent shorting between the metal layer 17 and the first electrode 14 ( or , the pad electrode 19 ) more securely and to further reduce the bad influence caused by the light propagating in the insulating body 20 of the light emitting unit 1 . next , a light emitting unit 2 according to a second embodiment of the present disclosure will be described . fig4 a is a perspective view showing an example of a general configuration of the light emitting unit 2 . fig4 b shows an example of a cross - sectional configuration of the light emitting unit 2 of fig4 a in an arrow direction ivb - ivb . the light emitting unit 2 may be very suitably applied as a display pixel of a display device which is a so - called led display , and is a small package where a plurality of light emitting elements are surrounded by a thin resin , similar to the light emitting unit 1 of the former embodiment . as shown in fig4 a , the light emitting unit 2 has three light emitting elements 40 . each light emitting element 40 is a solid light emitting element emitting light of a predetermined wavelength range from a surface thereof , and in detail is an led chip . the led chip represents a chip obtained by cutting a wafer whose crystal has grown , which is not in a package type surrounded by a molding resin or the like . the led chip is called a micro led since it has a size of , for example , 5 μm or above and 100 mm or less . the planar shape of the led chip is , for example , substantially cubic . the led chip has a thin film shape , and an aspect ratio ( height / width ) of the led chip is , for example , equal to or greater than 0 . 1 and less than 1 . each light emitting element 40 is disposed in the light emitting unit 2 , and for example , as shown in fig4 a , is disposed in a row together with other light emitting elements 40 with a predetermined gap ( interval ) being interposed therebetween . at this time , the light emitting unit 2 has , for example , an elongated shape extending in an array direction of the light emitting element 40 . a gap between two adjacent light emitting elements 40 is , for example , equal to or greater than the size of each light emitting element 40 . in addition , on occasions , the gap may be smaller than the size of each light emitting element 40 . the light emitting elements 40 are respectively configured to emit lights of different wavelength ranges . for example , as shown in fig4 a , three light emitting elements 40 are composed of a light emitting element 40 g emitting a light of a green band , a light emitting element 40 r emitting a light of a red band , and a light emitting element 40 b . for example , in a chase where the light emitting unit 2 has an elongated shape extending in the array direction of the light emitting element 40 , the light emitting element 40 g is , for example , disposed near the short side of the light emitting unit 2 , and the light emitting element 40 b is disposed , for example , near a short side other than the short side of the light emitting unit 2 which is near the light emitting element 40 g . the light emitting element 40 r is disposed , for example , between the light emitting element 40 g and the light emitting element 40 b . in addition , locations of the light emitting elements 40 r , 40 g , and 40 b are respectively not limited to the above , but hereinafter , location relationship of other components may be described on the assumption that the light emitting elements 40 r , 40 g , and 40 b are disposed at the above locations . as shown in fig5 a , for example , each light emitting element 40 has a semiconductor layer where a first conductive layer 41 , an active layer 42 and a second conductive layer 43 are laminated in order . in addition , fig5 a shows an example of a cross - sectional configuration when the light emitting element 40 is cut in a direction perpendicular to the line va - va of fig4 a . in the light emitting element 40 g and 40 b , the first conductive layer 41 , the active layer 42 and the second conductive layer 43 are made of , for example , ingan - based semiconductor material . meanwhile , in the light emitting element 40 r , the first conductive layer 41 , the active layer 42 and the second conductive layer 43 are made of , for example , algainp - based semiconductor material . in the semiconductor layer of each light emitting element 40 , a part of the second conductive layer 43 and a portion including the active layer 42 and the first conductive layer 41 become a pillar - shaped mesa portion 40 - 1 . in the semiconductor layer , at the bottom side of the mesa portion 40 - 1 , a flat surface where the second conductive layer 43 is exposed is spread , and a second electrode 45 is formed at a part of the flat surface . the second electrode 45 is a metal electrode . the second electrode 45 is made of , for example , ti / pt / au for the light emitting elements 40 g and 40 b . the second electrode 45 is made of , for example , auge / ni / au for the light emitting element 40 r . the second electrode 45 contacts the second conductive layer 43 and is electrically connected to the second conductive layer 43 . in other words , the second electrode 45 makes an ohmic contact with the second conductive layer 43 . in addition , the surface of the second conductive layer 43 ( namely , the surface of the semiconductor opposite to the mesa portion 40 - 1 ) becomes a light emitting surface s 4 so that a light shielding structure such as an electrode is not installed . at the surface of the mesa portion 40 - 1 ( namely , the surface of the first conductive layer 41 ), a first electrode 44 is installed . the first electrode 44 is a metal electrode . the first electrode 44 is made of , for example , ti / pt / au for the light emitting element 40 g and 40 b . the first electrode 44 is made of , for example , auge / ni / au for the light emitting element 40 r . the first electrode 44 contacts the first conductive layer 41 and is electrically connected to the first conductive layer 41 . in other words , the first electrode 44 makes an ohmic contact with the first conductive layer 41 . the first electrode 44 and the second electrode 45 may be configured as a single electrode together or may be configured as a plurality of electrodes . in addition , hereinafter , as shown in fig5 a , it is assumed that the first electrode 44 and the second electrode 45 are a single electrode together . the first electrode 44 and the second electrode 45 may be configured to include , for example , metal material with high reflectivity such as ag , al or the like . a side surface s 3 of the mesa portion 40 - 1 is , for example , an inclined surface crossing a lamination direction , as shown in fig5 a , in detail an inclined surface where a cross section of the mesa portion 40 - 1 has an inverse trapezoidal shape . as described above , as the side surface s 3 has a tapered shape , the light emitting efficiency in the front direction may be improved . in addition , the side surface s 3 may be , for example , a vertical surface perpendicular to the lamination direction , as shown in fig5 b . as shown in fig5 a and 5b , each light emitting element 40 has , for example , a laminated body composed of a first insulation layer 46 , a metal layer 47 , and a second insulation layer 48 . the laminated body is a layer formed from the side surface s 3 of the mesa portion 40 - 1 over the surface . the first insulation layer 46 , the metal layer 47 and the second insulation layer 48 are respectively thin layers , for example , formed by a thin film forming process such as cvd , deposition , sputtering or the like . in other words , the first insulation layer 46 , the metal layer 47 and the second insulation layer 48 are not formed by a thick film forming process such as spin coating , resin molding , potting or the like . the first insulation layer 46 , the metal layer 47 and the second insulation layer 48 covers at least the entire side surface s 3 to be formed from a region opposite to the side surface s 3 over a part of a region opposite to the first electrode 44 . the first insulation layer 46 is for electric insulation between the metal layer 47 and the semiconductor layer . the first insulation layer 46 is formed , among the side surface s 3 , from the end portion of the mesa portion 40 - 1 at the bottom side over the outer circumference of the surface of the first electrode 44 . in other words , the first insulation layer 46 is formed to contact the entire side surface s 3 and is further formed to contact the outer circumference of the surface of the first electrode 44 . the first insulation layer 46 is made of transparent material with respect to the light generated from the active layer 42 , for example , sio 2 , sin , al 2 o 3 , tio 2 , tin or the like . the first insulation layer 46 has , for example , a thickness of about 0 . 1 μm to 1 μm , substantially regular . in addition , the first insulation layer 46 may have irregularity in thickness due to a production error . the metal layer 47 is for covering or reflecting the light generated from the active layer 42 . the metal layer 47 is formed to contact the surface of the first insulation layer 46 . the metal layer 47 is formed , at the surface of the first insulation layer 46 , from the end portion at the light emitting surface s 4 side to a place slightly rearward from the end portion at the first electrode 44 side . in other words , the first insulation layer 46 has an exposed surface 46 a not covered by the metal layer 47 , at a portion opposite to the first electrode 44 . the end portion of the metal layer 47 at the light emitting surface s 4 side is formed on the end portion of the first insulation layer 46 at the light emitting surface s 4 side . meanwhile , the end portion of the metal layer 47 at the first electrode 44 side is formed at a region opposite to the first electrode 44 to partially overlap the metal layer 47 with the first insulation layer 46 being interposed therebetween . in other words , the metal layer 47 is insulated ( electrically separated ) from the semiconductor layer , the first electrode 44 and the second electrode 45 by the first insulation layer 46 . between the end portion of the metal layer 47 at the first electrode 44 side and the metal layer 47 , a gap ( interval ) is present as much as the thickness of the first insulation layer 46 . however , since the end portion of the metal layer 47 at the first electrode 44 side and the first electrode 44 overlap each other , the gap ( interval ) may not be visually recognized in the lamination direction ( namely , in the thickness direction ). further , the thickness of the first insulation layer 46 is just several μm at most . therefore , the light generated from the active layer 42 is substantially not emitted to the outside directly through the gap ( interval ). the metal layer 47 is made of material covering or reflecting the light generated from the active layer 42 , for example , ti , al , cu , au , ni , or their alloys . the metal layer 47 has , for example , a thickness of about 0 . 1 μm to 1 μm , substantially regular . in addition , the metal layer 47 may have irregularity in thickness caused by a production error . the second insulation layer 48 is for preventing a conductive material ( for example , solder , plate , sputtering metal ) joining the pad electrode 52 and a mounting substrate to each other and the metal layer 47 from being shorted , when the light emitting unit 2 is mounted to the mounting substrate ( not shown ). the second insulation layer 48 is formed to contact the surface of the metal layer 47 and the surface of the first insulation layer 46 ( the exposed surface 46 a ). the second insulation layer 48 is formed on the entire surface of the metal layer 47 and is formed on all or a part of the exposed surface 46 a of the first insulation layer 46 . in other words , the second insulation layer 48 is formed from the exposed surface 46 a of the first insulation layer 46 over the surface of the metal layer 47 so that the metal layer 47 is covered by the first insulation layer 46 and the second insulation layer 48 . the second insulation layer 48 is made of , for example , sio 2 , sin , al 2 o 3 , tio 2 , tin or the like . in addition , the second insulation layer 48 may be made of a plurality of materials among the above materials . the second insulation layer 48 has , for example a thickness of about 0 . 1 μm to 1 μm , substantially regular . in addition , the second insulation layer 48 may have irregularity in thickness caused by a production error . each light emitting element 40 further includes an embedding layer 49 which covers the mesa portion 40 - 1 , bumps 50 and 51 formed in the embedding layer 49 , and pad electrodes 52 and 53 formed on the embedding layer 49 . the bump 50 is electrically connected to the first electrode 44 so that the surface of the bump 50 is formed , for example , on the same surface as the surface of the embedding layer 49 . the bump 51 is electrically connected to the second electrode 45 so that the surface of the bump 51 is formed in the same surface as the surface of the embedding layer 49 . the pad electrode 52 contacts the bump 50 to be electrically connected to the first electrode 44 through the bump 50 . the pad electrode 53 contacts the bump 51 to be electrically connected to the second electrode 45 through the bump 51 . the bumps 50 and 51 and the pad electrodes 52 and 53 are electrically separated from the metal layer 47 by the embedding layer 49 and the second insulation layer 48 . the embedding layer 49 is made of , for example , resin material such as silicon , acryl , epoxy or the like , or inorganic material such as sio 2 , sin , al 2 o 3 , tio 2 , tin or the like . in addition , the embedding layer 49 may be excluded if necessary . the bumps 50 and 51 may be made of , for example , metal material such as cu , solder or the like . in addition , the bumps 50 and 51 may be excluded if necessary . the pad electrodes 52 and 53 may be made of , for example , metal materials such as ti , al , cu , au , ni , or their alloys or the like . in addition , the pad electrodes 52 and 53 may be a plurality of materials among the above materials . the pad electrode 52 is an electrode drawn from the first electrode 44 ( namely , a drawn electrode ). the pad electrode 52 is formed at least at a region opposite to the first electrode 44 , and in detail , is formed at a region which includes a region opposite to the first electrode 44 and a region of the metal layer 47 opposite to the end portion at the first electrode 44 side . in other words , a part of the pad electrode 52 overlaps a part of the metal layer 47 with the embedding layer 49 and the second insulation layer 48 being interposed therebetween . between the end portion of the pad electrode 52 and the metal layer 47 , a gap ( interval ) is present as much as the thickness of the embedding layer 49 and the second insulation layer 48 . however , since the end portion of the pad electrode 52 and the end portion of the metal layer 47 at the first electrode 44 side overlap each other , the gap ( interval ) may not be visually recognized in the lamination direction ( namely , in the thickness direction ). further , the distance between the end portion of the pad electrode 52 and the metal layer 47 ( namely , the thickness of the embedding layer 49 and the second insulation layer 48 ) is just several μm at most . further , since the end portion of the first electrode 44 and the metal layer 47 at the first electrode 44 side and the end portion of the pad electrode 52 overlap each other , the passage communicating with the outside from the active layer 42 through the first insulation layer 46 , the second insulation layer 48 and the embedding layer 49 is bent in an s shape . in other words , the passage where the light generated from the active layer 42 may pass is curved in as s shape . from the above , the first insulation layer 46 , the second insulation layer 48 and the embedding layer 49 used for insulating the metal layer 47 may be a passage communicating with the outside from the active layer 42 , but this passage may be recognized as being configured so that the light generated from the active layer 42 may substantially not leak out since it is extremely narrow and has an s shape . in addition , from the viewpoint that it is prevented for the light generated from the active layer 42 to be directly incident on another light emitting element 40 , the metal layer 47 may not cover a portion of the active layer 42 other than the exposed surface , if it is formed on the surface of the first insulation layer 46 to contact at least a surface of the active layer 42 opposite to the exposed surface . at this time , the first insulation layer 46 may not cover the entire side surface s 3 , if it is formed on the surface of the semiconductor layer to cover at least the exposed surface of the active layer 42 . in addition , the metal layer 47 may not cover the entire side surface s 3 , if it does not cover at least a surface at an adjacent light emitting element 40 side , in the side surface s 3 . at this time , the first insulation layer 46 may not cover the entire side surface s 3 if it does not cover at least a side at an adjacent light emitting element 40 side , in the side surface s 3 . in addition , in the case where three light emitting elements 40 included in the light emitting unit 2 are light emitting elements 40 r , 40 g and 40 b , it is preferred that all light emitting elements 40 have the above laminated body , but any light emitting element 40 may not have the above laminated body . for example , among three light emitting elements 40 , the light emitting element 40 b emitting a light of a shortest wavelength may have the above laminated body . in addition , for example , among three light emitting elements 40 , the light emitting element 40 r may have the above laminated body since it emits a light of a longest wavelength . fig6 a and 6b shows an example of a cross - sectional configuration of the light emitting element 40 where the above laminated body is not installed . in addition , in fig6 a and 6b , the light emitting elements 40 ( in detail , the light emitting element 40 g and the light emitting element 40 b ) other than the light emitting element 40 r emitting a light of a longest wavelength are exemplified as the light emitting element 40 where the above laminated body is not installed . the light emitting element 40 is , for example , configured so that the metal layer 47 and the second insulation layer 48 are excluded from the above laminated body as shown in fig6 a and 6b . as shown in fig4 a , the light emitting unit 2 includes a chip - type insulating body 50 covering each light emitting element 40 and terminal electrodes 61 and 62 electrically connected to each light emitting element 40 . the terminal electrodes 61 and 62 are disposed at the bottom surface side of the insulating body 50 . the insulating body 50 surrounds and retains each light emitting element 40 at least at the side surface of each light emitting element 40 . the insulating body 50 is made of , for example , resin material such as silicon , acryl , epoxy or the like . the insulating body 50 may include other material such as polyimide or the like in part . the insulating body 50 is formed to contact the side surface of each light emitting element 40 and the surface of each light emitting element 40 . the insulating body 50 has an elongated shape ( for example , a rectangular parallelepiped shape ) extending in the array direction of each light emitting element 40 . the height of the insulating body 50 is greater than the height of each light emitting element 40 , and the lateral width ( the width in the short side direction ) of the insulating body 50 is wider than the width of each light emitting element 40 . the size of the insulating body 50 is , for example , 1 mm or less . the insulating body 50 has a thin film shape . the aspect ratio ( maximum height / maximum lateral width ) of the insulating body 50 is decreasing when the light emitting unit 2 is transcribed so that the light emitting unit 2 does not lie , to be , for example , ⅕ or less . as shown in fig4 a and 4b , the insulating body 50 has , for example , an opening 50 a at a location corresponding to a side just below each light emitting element 40 . at the bottom surface of each opening 50 a , at least the pad electrode 52 ( not shown in fig4 a and 4b ) is exposed . the pad electrode 52 is connected to the terminal electrode 61 through a predetermined conductive member ( for example , solder and plated metal ). meanwhile , the pad electrode 53 is connected to the terminal electrode 62 through a predetermined conductive member ( for example , solder and plated metal ). the terminal electrodes 61 and 62 are configured to mainly include , for example , cu ( copper ). a part of the surfaces of the terminal electrodes 61 and 62 may be coated with , for example , material not easily oxidized , such as au ( gold ). next , the effects of the light emitting unit 2 of this embodiment will be described . in this embodiment , the above laminated body is installed at the light emitting element 40 b emitting a light of a shortest wavelength , among three light emitting elements 40 . by doing so , among the light generated from the active layer 42 in the light emitting element 40 at which the above laminated body is installed , the light propagating toward the inside of the lamination surface may be reflected by the metal layer 47 installed at the side surface of the light emitting element 40 and disturb light incidence to an adjacent light emitting element 40 . as a result , a bad influence ( for example , degradation of the resin without a light resistance against a blue light ) caused by the light propagating in the insulating body 50 of the light emitting unit 2 may be decreased . in addition , in a case where the above laminated body is installed to at least two light emitting elements 40 b and 40 g among three light emitting elements 40 , the excitation of the light emitting element 40 r caused by the light generated from the light emitting element 40 b or the light emitting element 40 g may also be disturbed . therefore , the change of color temperature or the range of color reproduction may be reduced . in particular , in a case where the first insulation layer 46 and the metal layer 47 cover at least the entire side surface s 3 of the mesa portion 40 - 1 , among the light generated from the active layer 42 , not only the light propagating toward the inside of the lamination surface but also the light propagating in an inclined direction may be reflected to the metal layer 47 . as a result , a bad influence caused by the light propagating in the insulating body 50 of the light emitting unit 2 may be greatly reduced . however , since the metal layer 47 installed at the side surface s 3 is electrically separated from the first electrode 44 and the second electrode 45 , there is very little change that the first electrode 44 and the second electrode 45 are shorted through the metal layer 47 . for this reason , there is also very little change that the metal layer 47 installed at the side surface s 3 gives a bad influence on a pressure resistance of the light emitting element 40 . however , in this embodiment , in order to avoid that the first electrode 44 and the metal layer 47 are shorted , a gap ( interval ) is present between the metal layer 47 and the first electrode 44 . however , since the first insulation layer 46 and the metal layer 47 are formed from a region of the mesa portion 40 - 1 opposite to the side surface s 3 over a region opposite to the first electrode 44 , a part of the first electrode 44 and a part of the metal layer 47 overlap each other with the first insulation layer 46 being interposed therebetween . for this reason , the light from the active layer 42 does not directly leak out to the insulating body 50 through the gap ( interval ) between the first electrode 44 and the metal layer 47 . by doing so , a bad influence caused by the light propagating in the insulating body of the light emitting unit 2 may be reduced without giving a bad influence on the pressure resistance of the light emitting element 40 . in addition , in this embodiment , the second insulation layer 48 is formed from the exposed surface 46 a of the first insulation layer 46 over the surface of the metal layer 47 , and further the pad electrode 52 is formed at a region including a region opposite the first electrode 44 and the end portion of the metal layer 47 at the first electrode 44 side . by doing so , since a part of the metal layer 47 and a part of the pad electrode 52 overlap each other with the second insulation layer 48 and the embedding layer 49 being interposed therebetween , there is very little change that the light from the active layer 42 leaks out to the insulating body 50 through the gap ( interval ) between the first electrode 44 and the metal layer 47 , and between the gap ( interval ) between the metal layer 47 and the pad electrode 52 . as a result , it is possible to prevent shorting between the metal layer 47 and the first electrode 44 ( or , the pad electrode 52 ) more securely and to further reduce the bad influence caused by the light propagating in the insulating body 50 of the light emitting unit 2 . in the second embodiment , the first insulation layer 46 , the metal layer 47 and the second insulation layer 48 are mainly formed at the side surface s 3 of the mesa portion 40 - 1 and not installed at the entire side surface of the light emitting element 40 , but it may also be installed at the entire side surface of the light emitting element 40 . for example , as shown in fig7 a and 7b , the end portions of the first insulation layer 46 , the metal layer 47 and the second insulation layer 48 may be formed at the center of the side surface of the light emitting element 40 , from the end portion at the light emitting surface s 4 side over the outer circumference of the surface of the first electrode 44 . in the second embodiment , the embedding layer 49 covering the mesa portion 40 - 1 is installed , but it may be excluded . for example , as shown in fig7 a and 7b , the embedding layer 49 and the bumps 50 and 51 may be excluded so that the pad electrode 52 directly contacts the first electrode 44 and the pad electrode 53 directly contacts the second electrode 45 . next , a display device 3 according to a third embodiment of the present disclosure will be described . the display device 3 includes the light emitting unit 1 or the light emitting unit 2 according to the above embodiment as a display pixel . fig8 is a perspective view showing an example of a general configuration of the display device 3 . the display device 3 is a so - called led display , and an led is used as a display pixel . the display device 3 includes , for example , a display panel 310 and a driving circuit ( not shown ) for driving the display panel 310 as shown in fig8 . the display panel 310 is configured so that mounting substrates 320 and transparent substrates 330 are put alternately . the surface of the transparent substrate 330 becomes an image display surface to have a display region 3 a at the center portion and have a frame region 3 b , which is a non - display region , around it . fig9 shows an example of a layout of a region of the surface of the mounting substrate 320 at the transparent substrate 330 side , which corresponds to the display region 3 a . in the region of the surface of the mounting substrate 320 which corresponds to the display region 3 a , for example , as shown in fig9 , a plurality of data wires 321 are formed to extend in a predetermined direction and is arranged in parallel with a predetermined pitch . in the region of the surface of the mounting substrate 320 which corresponds to the display region 3 a , further for example , a plurality of scan wires 322 are formed to extend in a direction crossing with ( for example , perpendicular to ) the data wire 321 and are arranged in parallel with a predetermined pitch . the data wire 321 and the scan wire 322 are made of , for example , conductive material such as cu ( copper ) or the like . the scan wire 322 is formed , for example , at the outermost layer , for example on an insulation layer ( not shown ) formed on the substrate surface . in addition , the base material of the mounting substrate 320 is made of , for example , a glass substrate , a resin substrate or the like , and the insulation layer on the substrate is made of , for example , sin , sio 2 , or al 2 o 3 . meanwhile , the data wire 321 is formed in a layer other than the outermost layer including the scan wire 322 ( for example , a layer below the outermost ), and , for example , is formed in the insulation layer on the substrate . on the surface of the insulation layer , in addition to the scan wire 322 , for example , a block is installed as necessary . the block is for enhancing a contrast , and is made of light - absorbing material . the block is formed , for example , at a region of the surface of the insulation layer where pad electrodes 321 b and 322 b , described later , are not formed . in addition , the block may be excluded if necessary . a neighborhood of a crossing portion of the data wire 321 and the scan wire 322 becomes a display pixel 323 , and a plurality of display pixels 323 are disposed in the display region 3 a in a matrix shape . at each display pixel 323 , the light emitting unit 1 including a plurality of light emitting elements 40 or the light emitting unit 2 including a plurality of light emitting elements 40 is mounted . in addition , fig9 exemplarily shows the case where a single display pixel 323 is configured with three light emitting elements 10 r , 10 g and 10 b or three light emitting elements 40 r , 40 g and 40 b so that the light emitting element 10 r or the light emitting element 40 r outputs a light of red color , the light emitting element 10 g or the light emitting element 40 g outputs a light of green color , and the light emitting element 10 b or the light emitting element 40 b outputs a light of blue color , respectively . at the light emitting unit 1 and 2 , a pair of terminal electrodes 31 and 32 or a pair of terminal electrode 61 and 62 is installed to each of the light emitting element 10 r , 10 g and 10 b or the light emitting element 40 r , 40 g and 40 b . in addition , one terminal electrode 31 or terminal electrode 61 is electrically connected to the data wire 321 , and the other terminal electrode 32 or terminal electrode 62 is electrically connected to the scan wire 322 . for example , the terminal electrode 31 or the terminal electrode 61 is electrically connected to the pad electrode 321 b of the front end of a branch 321 a installed at the data wire 321 . in addition , for example , the terminal electrode 32 or the terminal electrode 62 is electrically connected to the pad electrode 322 b of the front end of a branch 322 a installed at the scan wire 322 . each pad electrode 321 b and 322 b is formed , for example , at the outermost layer , and , for example , as shown in fig9 , is installed at a portion where each light emitting unit 1 , 2 is mounted . here , the pad electrodes 321 b and 322 b are made of , for example , conductive material such as au ( gold ). at the mounting substrate 320 , further for example , a plurality of supports ( not shown ) for regulating a gap between the mounting substrate 320 and the transparent substrate 330 are installed . the support may be installed within a region opposite to the display region 3 a and may be installed within a region opposite to the frame region 3 b . the transparent substrate 330 is made of , for example , a glass substrate , a resin substrate or the like . the surface of the transparent substrate 330 at the light emitting unit 1 , 2 side may be flat , but is preferably a rough surface . the rough surface may be installed over the entire region opposite to the display region 3 a , or may be installed only in the region opposite to the display pixel 323 . the rough surface has an unevenness as fine as scattering an incident light when the light generated from the light emitting elements 10 r , 10 g and 10 b or the light emitting element 40 r , 40 g and 40 b is incident to the corresponding rough surface . the unevenness of the rough surface may be manufactured by , for example , sand blast , dry etching or the like . the driving circuit drives each display pixel 323 ( each light emitting unit 1 , 2 ) based on an image signal . the driving circuit includes , for example , a data driver for driving the data wire 321 connected to the display pixel 323 and a scan driver for driving the scan wire 322 connected to the display pixel 323 . the driving circuit may be , for example , mounted on the mounting substrate 320 , or may be installed independently from the display panel 310 and connected to the mounting substrate 320 through a wire ( not shown ). in this embodiment , the light emitting unit 1 , 2 is driven by the driving circuit through the data wire 321 and the scan wire 322 disposed in a simple matrix pattern ( simple matrix driving ). by doing so , current is supplied to the light emitting unit 1 , 2 installed near the crossing portion of the data wire 321 and the scan wire 322 one by one so that an image is displayed on the display region 3 a . however , in this embodiment , the light emitting unit 1 , 2 is used as the display pixel 323 . by doing so , a bad influence ( for example , degradation of a resin without light resistance against a blue color ) caused by the light propagating in the insulating body 20 , 50 of the light emitting unit 1 , 2 may be reduced , or the excitation of the light emitting element 10 r , 40 r caused by the light generated from the light emitting element 10 b , 40 b may be prevented . as a result , the change of color temperature or the decrease of a color reproduction range may be reduced , and so it is possible to reduce the aging degradation of the image quality . in addition , in this embodiment , in the case where the surface of the transparent substrate 330 is a rough surface , the light generated from the light emitting unit 1 , 2 in an inclined direction is partly scattered by the rough surface . by doing so , the scattered light is partly emitted out through the transparent substrate 330 , and so it is possible to suppress that the light generated from the light emitting unit 1 , 2 in an inclined direction is reflected on the rear surface of the transparent substrate 330 or is confined in the transparent substrate 330 to generate stray light . therefore , the deterioration of light emitting efficiency caused by the transparent substrate 330 may be suppressed . heretofore , the present disclosure has been described based on a plurality of embodiments and their modifications , but the present disclosure is not limited to those embodiments but may be modified in various ways . for example , even though the light emitting unit 1 , 2 has three light emitting elements 10 , 40 in the above embodiments , it may include only two light emitting elements 10 or four or more light emitting elements 10 , 40 . the present disclosure contains subject matter related to that disclosed in japanese priority patent application jp 2011 - 043710 filed in the japan patent office on mar . 1 , 2011 , the entire contents of which are hereby incorporated by reference . it should be understood by those skilled in the art that various modifications , combinations , sub - combinations and alterations may occur depending on design requirements and other factors insofar as they are within the scope of the appended claims or the equivalents thereof .	7
a portable telephone handset in accordance with an embodiment of this invention shown in fig2 to 12 comprises a housing 1 having a main body 2 enclosing substantially the whole of the electronic circuitry of the radio telephone and a sleeve portion 3 slidably mounted on the main body 2 . the handset has an antenna 5 , a transceiver 6 and processing means 7 programmed with an algorithm which is operative to select a communication channel with a base station ( fig2 ). information is displayed on a liquid crystal display ( lcd ) panel 8 included on the housing 1 is a set of keys . there is a first group 10 of keys or buttons labelled 0 - 9 , * and # arranged in an array of three rows and four columns , as is usual and a second group 11 of control keys or buttons for selecting various predetermined actions such as memory storage and recall , last number redial , call start ( e . g . labelled send ) etc ., again as is usual . the “ key ” could be a key or button or any element for providing input to the microprocessor , preferably input from a user and preferably by means of contact with and / or pressure on and / or touching of the key . the display panel , lcd 8 is located on the housing above the two groups of keys . above the display is located a series of holes 12 behind which is an earphone or speaker 13 for transmitting speech or other sounds to the user of the radio handset . the sleeve has a series of holes 14 at its lower end behind which are mounted a microphone 15 ( fig2 ). the sleeve portion 3 is arranged to slide relative to the main body between a closed position illustrated in fig1 and a fully open position illustrated in fig3 . the main body of the housing is curved and the sleeve - like portion provides a curvature sufficient for the ear 13 and mouth 15 pieces to be positioned respectively adjacent the ear and mouth of the user . the material chosen for the slide of this particular embodiment of the invention is a polycarbonate with added teflon to provide a satisfying sliding feel when in use . in the closed position , both groups of keys 10 , 11 are concealed ( fig1 ); the only key available for use being a multi - purpose key 16 positioned on the side of the handset . in the fully open position ( fig3 ) both groups of keys 10 , 11 are revealed allowing both numerical and control keys to be selected . a third sleeve position is illustrated in fig4 in which the sleeve is partially open showing only the second group of keys 11 . in this position the control keys can still be selected but the numeric keys cannot as they are concealed . calls can be made using the control keys , i . e . calls from memory , and calls can be taken . in this embodiment it is the physical concealment of the keys , with the wall of the sleeve portion interposed between the keys and the user , that prevents them from being used . in other embodiments ( not illustrated ) it could merely be the interposition of a barrier which does not conceal the keys but covers them at least enough to prevent fingers reaching them that prevents the keys from being used . for example , the barrier could have small holes in it . the intermediate position of fig4 further allows single handed operation of the phone . the sleeve can ideally be slid to the intermediate position under the force of the user &# 39 ; s thumb . the control keys can then be manipulated to make a call or set the mode of operation of the handset . although the microprocessor 7 is functional at all times , when the numerical keys 10 of the first group are concealed they cannot physically be actuated to make a telephone call . when the sleeve is fully closed , the only key that can be actuated is the multipurpose key 16 , which forms a third key group , positioned on the side of the phone and revealed for all positions of the sleeve 3 . the handset is programmed to respond to actuation of the multi - purpose key 16 in dependence on the position of the sleeve relative to the main body . when the sleeve is closed actuation of the multi - purpose key 16 answers incoming calls ( by putting the handset “ off hook ”) and optionally the function of the key may include adjusting the volume of the phone when there is no incoming call . when the sleeve is open , so that other keys are exposed ( particularly answer key 11 a ) the multipurpose key 16 cannot ( except in “ any key answer ” mode ) be used to answer incoming calls ; it only acts as a volume key . the handset may be programmed so that when the slide is closed the use of the multipurpose key 16 for volume adjustment adjusts the ringing volume of the phone and when the slide is open the key adjusts the speaker volume of the phone . the function of the multi - purpose key depends on the position of the slide . the sleeve portion 3 is attached to the main body 2 for sliding movement relative thereto . a groove 20 is provided on each side of the main body ( fig3 , 4 , 5 ) running substantially along its length . runners 21 positioned , one on each side of the underside of the sleeve portion ( fig9 ), are held in the grooves to allow the sleeve portion 3 to slide relative to the main body 1 whilst being captured thereby . in the embodiment described , the arrangement of the groups of keys is such that in particular positions the sleeve provides access to the respective groups . it is desirable , therefore , that there is a preference for the sleeve to be located in positions revealing either neither the first nor the second set of keys ( closed ) ( fig1 ), the second set of keys alone ( intermediate ), ( fig4 ) or both the first and second sets of keys ( fully extended ( fig3 ). the third set of keys i . e . ( in this embodiment ) the multipurpose key 16 is revealed at all times . in order to hold the sleeve in the three preferential positions the main body of the handset is provided with a pair of members 22 ( fig5 , 10 ) located within the main body that protrude one into each of the grooves 20 located on the main body 2 of the handset . the members 22 are spring loaded to allow the sleeve portion to move from the preferred positions when desired . the member 22 is resillent and mounted in a holder 24 inside the main body 2 with a detent 23 that protrudes through an aperture 25 in the groove 20 . the detent 23 is depressed so that it no longer protrudes into the grooves 20 by one of the runners 21 of the sleeve portion 3 . the runners are provided with recesses 26 ( fig9 ), when a recess 26 coincides with a detent 23 , the sleeve 3 is held in position . the recesses 26 are provided so that the sleeve portion is ‘ caught ’ in the closed , intermediate and the fully open positions . two of the recesses 26 in the runners 21 , those corresponding to the closed and intermediate positions have cammed edges so that when extra force is provided to slide the sleeve from the first two sleeve positions , the detent 23 is depressed below the surface of the bottom of the groove 20 for disengagement from the recess 16 allowing the sleeve portion 3 to continue to slide in the chosen direction . the recess corresponding to the intermediate position will have cammed leading and trailing edges to allow movement in either direction . the recess corresponding to the closed position may only have a cammed leading edge to allow for ease in opening . when the sleeve is in the fully extended position it is not desirable for the sleeve to continue to open as this could result in the sleeve portion being removed from the main body of the handset . to avoid this , the third recess 26 is deeper and the abutment surface in the direction of a complete withdrawal of the sleeve portion is not cammed . this provides a more absolute stop against further extension of the sleeve portion . as a secondary measure , an in - mould plastic pin 27 ( fig9 ) is provided on each side of the sleeve portion 3 of the handset . each of these abuts complementary surfaces located on the main body 2 of the handset to substantially prevent withdrawal of the sleeve portion 3 . as can be seen from fig9 and 12 , the microphone 15 is mounted on a small flexible pcb 30 along with a filter 31 and a foam plastics member 32 that acts , together with microphone holder 33 , as an acoustic dampener to improve the acoustic properties of the microphone 15 . the flexible pcb 30 also includes two conducting tracks 34 for maintaining contact between the microphone 15 and the electronics of the handset located within the housing of the main body . the flexible pcb 30 is mounted to the underside of the bare plastic sleeve itself suitably by laminating a polycarbonate foil 35 with apertures 36 coinciding with tracks 34 to it and then welding that part to the underside of the sleeve portion to the slide cover by ultrasonic welding . a microphone housing 37 surrounding the microphone 15 in the microphone holder 33 is then fitted . the resulting assembly 38 is attached to the underside of the sleeve 3 with the aid of guide pines indicated by dotted lines 39 . when in position the two conducting slide tracks 34 extend substantially from one end of the sleeve portion to the other to allow the microphone 15 to maintain electrical contact with the electronics of the handset for all positions of the sleeve between and including the open and closed positions . the microphone housing 37 can also suitably be ultrasonically welded to the underside of the sleeve and encloses the microphone and its components to additionally protect from dirt or other damage . when in position , the microphone 15 is located behind the holes 14 at the bottom end of the slide connected to the two slide tracks a microphone connector 40 is mounted on the main body of the handset suitably by ultrasonic welding ( fig5 ). the connector is positioned so that it is in electrical contact with the main pcb in the body of the handset by contacts 41 or other mechanism . it is positioned to make contact with the two slide tracks at all positions of the sleeve for provide an electrical connection between the microphone and the main processor of the handsets . as the microphone is in electrical contact with the main processor via the slide tracks at all times the signals from the microphone can be utilised in the main processor when appropriate for incoming or outgoing calls . the connection is also maintained during movement of the sleeve portion . the handset can , therefore , be used to the extent that the relevant keys are exposed in all positions of the sleeve relative to the main body . the microphone connector can be seen in greater detail in fig6 to 8 . the microphone connector 40 comprises two spring contacts 42 disposed for contact with respective ones of the two slide tracks . the bearing surfaces 43 of the spring clip are flattened to provide for improved contact with the slide tracks . the spring loading of the contacts ensures good electrical contact between the microphone and microprocessor for a range of distances between the sleeve portion and main body at the microphone connector element . this provides for a good degree of tolerance for the manufacturing process . it also allows the sleeve to be at different distances from the microphone connector for respective positions to the slide . for reliability is it desirable that the electrical connection between the microphone connector and the slide tracks is hard wearing and resistant to dirt or other damage . in this particular embodiment the connectors are plated with 20 microns of palladium nickel followed by 2 microns of hard gold . the slide tracks 34 can also be plated with hard gold , in this embodiment 5microns , for improved life . the microphone connector also has a built - in microswitch 44 which is activated by a protrusion located in the underside of the sleeve portion . the microswitch 44 provides a signal indicating that the sleeve portion 3 is not in the closed position . the signal is used to allow movement of the slide from the closed position to be detectable . this enables movement of the slide 3 to be utilised to answer an incoming call . the microswitch 44 has a spring loaded member 45 protruding from the main body towards the sleeve cover 3 and a contact arm 46 in alignment with the spring loaded member such that when the spring loaded member is depressed by a sufficient degree contact is made with the contact arm . on such contact a signal is sent to the microprocessor . a protrusion 47 on the underside of the sleeve 3 in a position corresponding to the microswitch when the sleeve is in the closed position is provided on the underside of the sleeve portion . the protrusion 47 has a cammed surface that progressively presses the spring loaded element into contact with the contact arm as the sleeve portion slides towards the closed position . the switch 44 is closed when the sleeve is in the closed position and signals from the switch can , accordingly , be used as an indication as to whether or not the sleeve is closed position . by providing an input from the microswitch to the microprocessor the position of the sleeve portion can be used as an additional indication to the microprocessor . a call can be answered when the sleeve is moved from the closed position , and / or a call terminated when the sleeve is closed . and this data can be used to determine the function of the multi - function key 16 . two of the operating modes of the handset are ‘ any key answer ’ modes . if the handset is in the first ‘ any - key answer ’ mode and an incoming call is indicated , the handset can be put in the off - hook condition for receiving the call by pressing any of the exposed keys other than the power key 30 , including the multi - function key . when the sleeve portion of the handset is fully open any one of the available keys can be used to answer a call . in the second ‘ any - key answer ’ mode the multi - purpose key does not answer a call if the slide is open . when in either ‘ any key answer ’ mode , or in the telephones normal answer mode , if the sleeve is closed there are two exposed keys , the multi - purpose key 16 and the power control key 50 . the handset can be closed and powered up or closed and powered down . if the handset is powered up it is in standby , i . e . in condition to receive calls . if the handset then receives a paging message indicating that there is an incoming call for the handset , the call can be answered in two ways , either by actuating the volume control key or by sliding the sleeve from the closed position . the microprocessor uses the signal from the microswitch to determine that the sleeve is in the closed position . any signal received from the multi - purpose key when the sleeve is closed can accordingly be utilised to receive an incoming call . likewise , with the microswitch indicating that the sleeve is closed , moving the sleeve from the closed position causes the microswitch to indicate the displacement to the microprocessor 7 . this signal can also then be used to place the handset in the off - hook condition for receiving an incoming call . a call can be terminated by pressing the end key , provided it is exposed or closing the sleeve . the microphone and earpiece are connected to the microprocessor for all positions of the slide and the keys are continually polled to determine if they have been actuated . the present invention includes any novel feature or combination of features disclosed herein either explicitly or any generalisation thereof irrespective of whether or not it relates to the claimed invention or mitigates any or all of the problems addressed . in view of the foregoing description it will be evident to a person skilled in the art that various modifications may be made within the scope of the invention .	7
referring to fig1 the improved insect swatter 10 of the present invention comprises a handle 12 and a substantially planar striking surface 14 comprising individual tines 16 . the handle 12 has an elongate stem 20 suitable for gripping . one end of the stem 20 may be conveniently provided with an aperture 22 to facilitate hanging the insect swatter 10 from a hook , nail or other suitable protrusion . the handle stem 20 may be conveniently formed in a planar configuration having a laterally upstanding border 24 surrounding the periphery thereof for providing rigidity . the handle 12 also comprises a tray 30 attached to the stem 20 . the planar portion of the stem 20 necks out to the width of the tray 30 . the border 24 may conveniently be terminated into the side surface 32 of the tray 30 , as shown in fig3 . the intersection between the stem 20 and the tray 30 forms a thickened section 34 . in addition to the support provided by the handle stem border 24 , the strength of the stem / tray joint may be augmented by a number of suitable means , including the stiffening rib 36 shown in fig1 . the handle 12 may be conveniently formed of many suitable materials , including wood , wire , metal and plastic . a particularly preferred embodiment of the present invention contemplates forming the handle of a polymeric material , preferably polypropylene . use of such material allows for easy molding of the handle 12 and use of brightly colored materials to enhance the attractiveness of the insect swatter 10 . referring to fig2 striking surface 14 is composed of tines 16 . the tines 16 are preferably fashioned to be substantially contiguous so that they form a continuous planar striking surface 14 . this requires only that tines 16 have one planar surface , but it has been found convenient to form tines 16 in square or rectangular cross - section . tines 16 are formed so as to provide flexibility to facilitate their application to irregular surfaces . it has been found convenient to form tines 16 of a vinyl polymer . application of a substantially continuous planar striking surface prevents escape of insects through striking surface interstices . on the other hand , the substantially contiguous , but independent , tines 16 allow application of a controlled amount of striking force limited to that provided by the accelerated mass of only the tines actually striking the insect . as shown more clearly in fig4 the force of the striking tine 40 is applied to the insect 42 without contribution of the force delivered by adjoining tines 44 . the tines 40 , 44 shown in fig4 are shown in a spaced parallel relation . however , it is preferred that the tines be substantially contiguous as shown in fig1 to prevent escape of insects . referring to fig5 the insect swatter 10 is shown being applied to an insect ( not shown ) on an irregular surface 50 , such as a window sill . while the top tines 52 proceed unobstructed at the end of the swing , the bottom tines 54 penetrate the interstices of the irregular surface 50 to strike the insect lurking therein . moreover , the configuration of the tines , coupled with the individual tine flexibility , allows penetration of the tines 16 into a small crevice , limited only by the width of an individual tine 16 . therefore , the substantially continuous planar striking surface 14 comprised of substantially contiguous individual tines 16 allows killing of insects on regular and irregular surfaces and limits the striking force so as to kill the insect with limited lateral expulsion of insect bodily fluids . as shown in fig2 it has been found convenient to form striking surface 14 from a first and second set of tines 60 , 62 . each tine set 60 , 62 is comprised of flexible parallel spaced tines 16 which are interconnected at end 64 thereof . the interconnection 66 is preferably provided in an offset manner as shown in fig2 so as to facilitate interleaving tines 16 together as shown in fig3 . preferably , the spacing between individual tines 16 is equal to the width of an individual tine 16 . in this manner , first and second tine sets 60 , 62 may be conveniently identically fashioned . it will be appreciated by one of ordinary skill in the art that the spacing between the tines 16 may be altered , for example , to equal two tine widths , so as to allow any number of tine sets . use of multiple tine sets is preferred because the tine sets 60 , 62 may be individually molded so that the tines 16 may be interleaved to form a substantially continuous planar surface without the need for any additional manufacturing steps , such as slitting or cutting . referring to fig3 the interleaved tine sets 60 , 62 are adapted to be received by shelf - like handle tray 30 . the tine sets 60 , 62 may be conveniently provided with a registration aperture 70 to mate with the registration boss 72 on the handle tray 30 . one of ordinary skill in the art will appreciate that a number of suitable alternative registration means may be utilized to securely lock the tines 16 to the handle tray 30 . the tines 16 may be attached to the handle tray 30 at their first end 64 by a number of suitable means . as shown in fig3 a retaining bar 74 may be applied to the tray 30 to sandwich therebetween the first and second tine sets 60 , 62 . the retaining bar 74 , handle tray 30 and tine sets 60 , 62 may be conveniently joined by a number of methods , including adhesives and various fasteners . however , it has been found preferable to form the retaining bar 74 of a material similar to the handle tray 30 , such as polypropylene , and heat - seal the retaining bar 74 , handle tray 30 and tine sets 60 , 62 . the details of heat - sealing such materials are well known in the art and warrant no further discussion here . this invention has been described in detail in connection with the preferred embodiments , but these are examples only and this invention is not restricted thereto . it will be easily understood by those skilled in the art that other variations and modifications can be easily made within the scope of this invention .	0
according to another aspect of the invention there is provided a process for making a compound of formula 1 : with a suitable azide in the presence of a solvent , followed by reaction with hydrochloric acid . preferably the azide is diphenylphosphoryl azide or an alkali metal azide , such as sodium azide . it is to be noted that to form pharmaceutically acceptable salts other than the hydrochloride salt , an acid other than hydrochloric acid may be selected . selection of a suitable acid and conditions is within the knowledge of the skilled person , and does not require undue experimentation . alternatively , the salt , eg the hydrochloride salt , may be converted to the free base and isolated , or , optionally , converted to a still further pharmaceutically acceptable salt . the solvent may be any suitable inert solvent . preferably the solvent is a mixture of ethyl acetate and triethylamine . according to another aspect of the invention there is provided a compound of formula 3 : according to another aspect of the invention there is provided a compound of formula 2 : it will be appreciated that the processes according to the invention provide a method of making the compound of formula 1 starting from the compound of formula 4 . potassium thiocyanate was added in one portion to the suspension of 4 , dihydroxyacetone dimer and acetic acid in ethyl acetate and the mixture was stirred at 50 ° c . for 2 hours . heating was removed , 1m sulfuric acid was added , the mixture was stirred for 15 - 20 min and cooled to room temperature . sodium hydroxide solution was added followed by sodium bicarbonate until evolution of co 2 ceased . the organic phase was separated , washed with brine , dried over mgso 4 and evaporated in vacuo . the residue was re - crystallised from a mixture of petroleum ether and ethyl acetate ( 1 : 1 v / v , 50 ml ) in the fridge overnight , yield 5 . 21 g ( 76 %), mp 166 ° c . ( dec .). to a solution of sodium in ethanol diethyl malonate was added followed by 3 at room temperature with stiffing under nitrogen . the mixture was stirred overnight , methanol was added followed by a solution of sodium hydroxide in water . after 4 hours at room temperature organic solvents were evaporated in vacuo , the residue was diluted with water to 60 ml and the solution was washed with ethyl acetate ( 15 ml ). the aqueous phase as acidified with 6n hcl to ph 1 - 2 , extracted with ethyl acetate ( 2 × 30 ml ). the combined extract was dried over mgso 4 and evaporated in vacuo . the resulting oil ( 2 . 47 g ) was dissolved in formic acid , triethylamine was added dropwise and the mixture was heated at 115 ° c . under reflux with stiffing under nitrogen for 2 hours . the solution was cooled in the ice bath and crushed ice was added to a total volume ca . 75 ml . the mixture was allowed to warm up to room temperature with stiffing , the precipitate was collected , washed with water , dried in vacuum at 40 - 50 ° c . yield 1 . 38 g ( 76 %), decomposes without melting . to suspension of acid 2 in etoac triethylamine was added in one portion . to the clear solution formed dppa was added at 5 ° c . in one portion with stirring . after 4 . 5 h at 5 ° c . the mixture was washed with cold 1n hcl ( 800 ml ), brine ( 200 ml ), dried ( mgso 4 ) and evaporated in vacuum at 27 ° c . the resulting suspension was diluted with dioxane ( 240 ml ) and ether ( 480 ml ) and left in the fridge overnight for crystallisation . the crystals were collected , washed with cold dioxane - ether mixture ( 1 : 2 v / v , 100 ml ). the obtained azide ( 90 g after 0 . 5 h drying in vacuum ) in the mixture of dioxane ( 2 . 3 l ), 1n hcl and formic acid was heated to 60 ° c . with stiffing during 0 . 5 h , then to 75 ° c . in 15 min and stirred at the above temperature for 40 min . the solution was cooled to 25 - 30 ° c . and evaporated in vacuum at 45 ° c . to the final pressure 30 mbar . the semi - crystalline residue was re - suspended in isopropanol , evaporated to half of the initial volume , diluted with ether ( 1 l ) and left in the fridge overnight . the crystals were collected , washed with the mixture of ether and isopropanol ( 2 : 1 v / v ), dried in vacuum . the crude product ( 60 g ) was re - crystallised by dissolving in 96 % etoh ( 1 . 1 l ) under reflux , diluting with toluene ( 1 . 1 l ), evaporating of the solution to half of the volume on a rotavap and crystallising overnight in the fridge . the crystals were collected , washed with toluene and dried in vacuum at 40 - 50 ° c . yield 49 . 5 g ( 42 %). ( r )- 5 -( 2 - aminoethyl )- 1 -( 6 , 8 - difluorochroman - 3 - yl )- 1 , 3 - dihydroimidazole - 2 - thione hydrochloride ( 9 . 64 g , 27 . 72 mmol ) was dissolved in water ( 160 ml ) at 40 - 45 ° c . with stiffing . to the resulting solution 2 - propanol ( 64 ml ) was added , the mixture was cooled to 35 - 38 ° c ., dichloromethane ( 256 ml ) was added followed by 1n naoh ( 28 ml , 28 mmol ) and the stirring continued for 10 - 15 min . lower organic phase was separated , dried over mgso4 and evaporated under reduced pressure to approx . 40 ml . the resulting suspension was diluted with petroleum ether ( 200 ml ), the precipitate was collected , was with petroleum ether on the filter , dried in vacuum . yield 7 . 8 g ( 91 %), mp 192 - 5 ° c . ( dec ). the free base can be converted to a desired salt using techniques known to those skilled in the art .	2
referring to fig1 the radio receiver 10 includes an rf section 14 with an input connected to an antenna 12 , a local oscillator mixer section 16 and an if section 18 . thus in the receiver 10 , the main am - modulated - signal path passes through the tandem connected rf , mixer and if sections to the am detector 20 . the main audio signal path of the receiver 10 subsequently passes through the audio amplifier 22 to the speaker 24 . a noise impulse 26p , that may be superimposed on an rf carrier is illustrated by waveform 26 in fig2 a . impulse 26p appears at the input of the receiver 10 , at point a in fig1 . in response , a &# 34 ; pulse &# 34 ; of substantial width as illustrated by the waveform 28 in fig2 b appears at point b at the output of the tuned rf section 14 having a band width of about 10 khz . this &# 34 ; pulse &# 34 ; 28 at point b is a transient oscillation of the frequency to which the rf section 14 is tuned . in conventional am broadcast receivers tunable over the band of 0 . 5 to 1 . 5 khz , pulse 28 typically lasts for about 50 microseconds , a quantity that is inversely related to the bandpass of the rf section 14 . also its beginning is slightly delayed from the impulse 26 . the if section 18 of the receiver 10 has a piezoelectric filter 18 &# 39 ; that resonates at the if frequency and establishes an if section bandpass of about 12 khz . if section 18 further includes an amplifier 18 &# 34 ;. in passing through the if filter 18 &# 39 ;, the transient becomes even wider owing to the narrow if bandpass . in fact , from point b to point c , the pulse id transformed in three respects . the rf pulse 26 is transformed to transient pulse 28 that oscillates at the if frequency after being heterodyned by the mixer 16 . the filter 18 &# 39 ; delays the start of this oscillation by about 50 microseconds and lengthens it to about 200 microseconds . the pulse at point c illustrated in fig2 c as waveform 30 is a transient oscillation at the if frequency , e . g . 455 khz . all pulse widths are measured at a level of 10 % of peak pulse amplitude . because of the if - bandpass - related exponential decay characteristic at the trailing edge of the pulse 30 at point c and because of the early saturation of the high gain amplifier 18 &# 34 ;, the pulse width of the amplified and clipped pulse 32 at point d at the output of the amplifier 18 &# 34 ; is much greater yet . the am detector 20 preserves only the envelope of pulse 32 to produce at point e an &# 34 ; audio &# 34 ; pulse 34 of the same width as is pulse 32 . for noise pulses of increasing energy , the amplitudes of pulses 28 and 30 increase proportionally while their pulse widths remain about constant . however , for noise pulses of increasing energy if amplifier 18 &# 34 ; soon saturates and the pulses 32 and 34 have no greater amplitudes but their pulse widths increase , e . g . to as much as 800 and 1000 microseconds for a typical am broadcast band receiver . referring to fig3 a noise suppression circuit 38 of this invention is connected to the radio receiver 10 . the noise suppression circuit 38 has an amplifier 40 followed by a one shot multivibrator 42 and an electrically activatable gate 44 . these three elements constitute a preliminary noise suppression or blanking means that is operative in the am - modulated signal path . the noise suppression circuit 38 additionally includes another one shot multivibrator 46 , another electrically activatable gate 48 that momentarily blanks for a period determined by the blanking control pulse from block 46 , and a sample and hold circuit 50 . these later three circuits are the key components of an audio noise blanking means having noise - blanking efficacy only in the audio signal path of the receiver 10 . when the receiver is tuned to an rf carrier signal 52 and a noise impulse 54 is picked up by the antenna 12 as in fig4 f , an oscillating transient pulse 56 appears at the output of mixer section 16 in receiver 10 at point g . at the same time the amplifier 40 filters out the rf signal 52 and thus selectively amplifies the noise impluse 54 . the amplified noise impulse triggers the one shot multivibrator 42 after a short delay ( e . g . 10 microseconds ) to produce at the output of the multivibrator 42 a first blanking gate control pulse 58 about 70 microseconds wide that is coincident in time and a little larger in width than that of the pulse 56 . control pulse 58 causes the mos gate 44 to open and thus momentarily blank the am - modulated signal path for the period when the control pulse is on . by this blanking means the noise pulse is prevented from getting through . however , during the blanking of pulse 56 , the carrier as well as the noise is prevented from getting through and at point j in the receiver the waveform 60 consists of the if carrier with a hole in it , as in fig4 j . this hole represents a period of zero am modulation and after transmission through the narrow bandpass ( e . g . 6 khz ) of the if section 18 appears at point k as the if signal with waveform 62 as shown in fig4 k . the envelope of pulse 62 appears downstream of the detector 20 at point l in the signal path as the &# 34 ; audio &# 34 ; signal having a waveform 64 shown in fig4 l . the one shot multivibrator 46 produces an output blanking pulse 66 that is delayed about 45 microseconds from the noise impulse 54 and that has a width of about 190 microseconds . the audio blanking pulse 64 turns off the gate 48 opening the audio signal path beyond point l and turns on the sample - and - hold circuit 50 to clamp the voltage at point n for the duration of pulse 66 at the level it had been at the time of initiation of pulse 66 . as a result , the noise impulse causes essentially no disturbance in the audio signal at point n that is represented in fig4 n as a straight line waveform 68 . referring again to the foregoing discussion of a standard superheterodyne receiver 10 without noise suppression means as in fig1 the width of a pulse appearing at the output of the bandwidth determining portion 18 &# 34 ; of the if section 18 in response to an impulse of infinitesimal width at the input of the if section 18 will always be about equal to 1 / 2bw where bw is the if bandwidth . for example , that if output pulse at points c will be the reciprocal of the if bandwidth halved , 170 microseconds , plus the amount of the input pulse width , 50 microseconds , totalling 220 microseconds . actually in this case it was closer to 200 microseconds but this rule of thumb is always useful and points up the fact that the width of pulses along the signal path in the receiver that stem from noise impulses are a known function of the bandwidths of the tandem connected receiver sections through which the am modulated signals are processed , except when any section is allowed to saturate , e . g . as in fig2 d . that causes signal clipping which can expand the pulse width many times due to the amplification and exponential tailing off of the preliminary - blanking disturbance . the preliminary blanking system represented in fig3 by circuit blocks 40 , 42 and 44 prevents saturation and produces a short 150 microseconds wide pulse of am modulation at the output of the if section , point k , as shown in fig4 k . the width of this if output &# 34 ; noise pulse &# 34 ; is not dependent upon the bandwidth of the if section . its width is basically only dependent upon the duration of the am - modulated - signal path blanking pulse ( determined by one shot multivibrator 42 ), namely about twice that duration . this is the case because the if output disturbance has a falling portion initiated at the delayed onset of the rf blanking pulse and symmetrically therewith a rising portion initiated at the delayed termination of the rf blanking pulse . a preferred mos audio blanking gate circuit and a preferred mos - bipolar sample - and - hold circuit are shown merged in fig5 . the mos gate transistor 70 is a p - channel depletion device having a source connected to a biasing voltage divider of resistors 72 and 74 and to an input terminal 76 corresponding to input terminal 76 in fig3 . the gate of transistor 70 is connected to control input terminal 78 and a high ( positive ) signal here turns off transistor 70 whereas a low signal here turns on transistor 70 . capacitors 82 and 84 each have a value of 0 . 1 picofarads and serve to &# 34 ; compensate &# 34 ; and thus cancel the rise and fall portions of the audio blanking pulse that tend to couple into the input of audio amplifier 22 .. the drain of gate transistor 70 is connected to the network comprised of resistor 86 ( e . g . 100k ohms ) and capacitor 88 ( e . g . 10 picofarads ) that are connected at the gate of the n - channel transistor 90 . transistor 90 serves as a high - input - impedance linear buffer amplifier with an output connected to the darlington connected transistors 92 and 94 . when the gate transistor 70 is conducting as is the case when there is no impulse noise , transistor 90 and transistors 92 and 94 pass the audio signal from terminal 76 to output terminal 96 that is in turn connected to the input of the audio amplifier 22 . but as soon as a noise impulse causes a positive pulse at control terminal 78 , transistor 70 opens and the gate voltage at transistor 90 is held at the level last appearing at terminal 76 . the audio signal at terminal 96 is &# 34 ; frozen &# 34 ; until the blanking pulse at control terminal 78 again connects the audio signal from the detector 20 to amplifier 22 . in the second preferred embodiment of fig6 a stereo am radio receiver 100 has an antenna 102 , a tuned rf section 104 , a mixer 106 , an if section 108 , an am stereo detector 110 with a &# 34 ; left &# 34 ; audio signal path 112 amd a &# 34 ; right &# 34 ; audio signal path 114 , two audio amplifiers 116 and 118 , and two speakers 122 and 124 . a noise blanking system 126 has its own antenna 128 and its own rf section 130 . rf section 130 is a broadband rf amplifier . large impulse noise triggers the one - shot multivibrator 132 that turns off the normally on mos gate 134 effecting blanking of the very same noise impulse having been simultaneously picked up by the radio antenna 102 . another one shot multivibrator 136 is also triggered by the same noise impulse but has a built - in delay of about 40 microseconds , a similar feature to that of the multivibrator 46 described above . multivibrator 136 produces an audio gating pulse of about 190 microseconds . this turns off for 190 microseconds both the audio blanking gates 138 and 140 , each of which includes a sample and hold circuit . in this way both left and right audio signals are blanked and smoothed during the audio signal disturbance created by the preliminary blanking of the impulse noise in the am - modulated signal path . of course , the antenna 102 may or may not be a part of the receiver 100 in fig6 . likewise , the antenna 128 may or may not be part of the noise blanking system 126 . also , the receiver 100 and the noise blanking system 126 may have their rf sections , 104 and 130 respectively , connected to the same antenna . also , in principle the blanking mos gate 134 may alternatively be connected between the antenna and the rf section 104 or anywhere else in the am modulated signal path down to the if filter . and even more generally , this blanking circuit may be employed in a t . r . f . receiver having no if section ( not shown ).	7
hereinafter , embodiments of the present disclosure will be described with reference to the drawings . fig1 is a schematic diagram showing a content reproduction system according to a first embodiment of the present disclosure . a content reproduction system 100 is a system in which contents are transmitted and received among a plurality of apparatuses mutually connected via a home network 10 . in this embodiment , renderers 20 ( 20 a , 20 b ) as reproduction apparatuses , servers 30 ( 30 a to 30 c ) as content providing servers , and a controller 40 that instructs the renderers 20 to reproduce contents are connected to the home network 10 . the controller 40 corresponds to an information processing apparatus according to the embodiment of the present disclosure . the home network 10 is a network conforming to the dlna standard . therefore , in this embodiment , the renderers 20 each function as a dmr ( digital media renderer ) of dlna . moreover , the servers 30 each function as a dms ( digital media server ). the controller 40 functions as a dmc ( digital media controller ). however , networks using other protocols may be used instead . the renderers 20 are capable of acquiring contents from the servers 30 via the home network 10 based on a reproduction request from the controller 40 and reproducing them . the renderers 20 may be capable of operating as a dmp ( digital media player ) of dlna . in this case , the renderers 20 acquire contents from the servers 30 based on a reproduction request from a user transmitted via a ui ( user interface ) of the renderers themselves , for example , and reproduce them . examples of the renderers 20 include a television apparatus , a pc ( personal computer ), an audio video receiver , a video monitor , and a home game apparatus . the servers 30 transmit list information of a plurality of contents that can be provided by themselves to the controller 40 . moreover , the servers 30 stream designated contents to the renderers 20 . it should be noted that the designated contents may be downloaded . in the servers 30 , data of a plurality of contents categorized into a plurality of types based on a predetermined criterion are stored . in this embodiment , the contents are categorized into a plurality of types based on content attribute information . for example , contents are categorized into types of “ hdd ( hard disk drive ) video ”, “ hdd photo ”, “ hdd music ”, “ internet radio ”, and “ external input ”. however , how the content types are determined and how the contents are categorized can be set as appropriate . for example , the contents may be categorized based on an activity name , category name , or function name of the contents . alternatively , the contents may be categorized based on a data format of the contents or the like . as shown in fig1 , in this embodiment , contents of “ hdd video ”, “ hdd photo ”, “ hdd music ”, “ internet radio ”, and “ external input ” are delivered by the server 30 a . contents of “ hdd music ” are delivered by the server 30 b . contents of “ hdd video ”, “ hdd photo ”, and “ hdd music ” are delivered by the server 30 c . as each of the servers 30 , a pc or an hdd ( nas ) compatible with a network is used , for example . fig2 is a schematic plan view showing an outer appearance of the controller 40 according to this embodiment . the controller 40 is of a size that a user is capable of carrying . on the controller 40 , a display screen 41 that functions as a touch panel , arrow keys 42 , operation buttons 43 , and the like are provided . on the display screen 41 , a content list transmitted from the servers 30 , guis ( graphical user interfaces ) for inputting a reproduction request to the renderers 20 , and the like are displayed . by operating the displayed gui , arrow keys 42 , and the like , the user can select a content , instruct the renderer 20 to reproduce the selected content , and the like . the display screen 41 , the arrow keys 42 , and the like correspond to an input unit according to this embodiment . further , as described below , in this embodiment , a reproduction request including at least content type information is input to the input unit . in other words , a type of a content to be reproduced is designated by the user . as the controller 40 , a pda ( personal digital assistants ), a game apparatus , or the like is used . fig3 is a schematic block diagram showing structural examples of the renderers 20 , the servers 30 , and the controller 40 shown in fig1 . as shown in fig3 , the controller 40 includes a reproduction apparatus selection unit 44 , a content type selection unit 45 , a server list acquisition unit 46 , a server list display / selection unit 47 , a content list acquisition unit 48 , a content list display / selection unit 49 , a renderer controller 50 , a reproduction content history management unit 51 , a reproduction content judgment unit 52 , and a network i / f ( interface ) unit 53 . the renderer 20 includes a control command reception unit 21 , a command processor 22 , a content reception processor 23 , a content decode unit 24 , a content display / reproduction unit 25 , and a network i / f unit 26 . the server 30 includes a content delivery processor 31 , a content management unit 32 , and a network i / f unit 33 . the reproduction apparatus selection unit 44 of the controller 40 displays a gui used for selecting the renderer 20 to reproduce a content on the display screen 41 . then , information on the renderer 20 selected by the user is output to the content type selection unit 45 as reproduction renderer information . the content type selection unit 45 displays , on the display screen 41 , a list of content types ( e . g ., “ hdd video ” and “ hdd photo ”) that can be reproduced by the reproduction renderer 20 . then , information on the content type selected by the user is output to the server list display / selection unit 47 and the reproduction content judgment unit 52 . it should be noted that in this embodiment , the renderer 20 is an apparatus that is capable of reproducing all types of contents from “ hdd video ” to “ external output ” described above . the server list display / selection unit 47 narrows down the servers 30 to those that are capable of delivering contents of the content type selected by the content type selection unit 45 and displays them on the display screen 41 as a server list . for example , profile information of the servers 30 that are present on the home network 10 is acquired by the server list acquisition unit 46 . the server list is created based on the profile information . the profile information is information on a corresponding protocol , and the like . further , content lists of the servers 30 may be acquired so that the server list is created based on the content lists . the content list acquisition unit 48 acquires a list of contents that the server 30 selected by the user provides . the content list acquisition unit 48 transmits , via the network i / f unit 53 , a content acquisition request to the content delivery processor 31 of the server 30 . the content delivery processor 31 that has received the request receives the content list from the content management unit 32 and transmits it to the content list acquisition unit 48 of the controller 40 . the acquired content list is output to the content list display / selection unit 49 . the content list display / selection unit 49 narrows down contents matching the content type selected by the content type selection unit 45 based on a tree structure of the content list or content meta - information and displays the contents on the display screen 41 as a list . then , identification information of the content selected by the user and information on the reproduction renderer 20 and server 30 that provides the content are output to the renderer controller 50 and the reproduction content history management unit 51 . the content identification information is information for identifying one or more contents to be reproduced by the renderer 20 . in this embodiment , a content id or a content uri ( uniform resource identifier ) is used as the content identification information , though not limited thereto . as the information on the renderer 20 and the server 30 , information such as an ip address or udn ( uniform device name ) of each apparatus is used . the renderer controller 50 transmits a reproduction control command to the control command reception unit 21 of the renderer 20 via the network i / f unit 53 . the reproduction control command is an instruction to acquire a content from the server 30 that provides the content and reproduce it and includes content identification information and server information . the reproduction content history management unit 51 creates history information of a content that has been selected by the user and reproduced by the renderer 20 and stores it . the history information is information in which content identification information and type information indicating a type of the content ( e . g ., “ hdd video ”) are associated with each other . the reproduction content history management unit 51 corresponds to a storage according to this embodiment . fig4 is a table showing history information according to this embodiment . in this embodiment , history information in which content identification information and information on the server 30 that stores the content are associated with each other in addition to content type information is created . although fig4 shows the table of history information on the renderer 20 a , history information on the renderer 20 b is also created and stored . in other words , history information is created and stored for each of the plurality of renderers 20 connected to the home network 10 . moreover , in this embodiment , information in which identification information of a lastly - reproduced content and content type information are associated with each other is stored as the history information for each content type . the reproduction content judgment unit 52 shown in fig3 judges whether a content of the selected content type has been reproduced in the past by the selected renderer 20 . based on content type information included in a reproduction request received from the user , the reproduction content judgment unit 52 searches for history information of the reproduction content history management unit 51 . accordingly , whether a content of the selected content type has been reproduced in the past is judged . when there is a content reproduction history , a content that has been reproduced in the past is judged as a content to be reproduced . then , content identification information and server information included in the history information are output to the renderer controller 50 , and a reproduction control command is transmitted to the renderer 20 . when there is no content reproduction history , processing of selecting the server 30 and a content is executed , and history information is created by the reproduction content history management unit 51 . the reproduction content judgment unit 52 and the renderer controller 50 correspond to an instruction transmission unit according to this embodiment . the control command reception unit 21 of the renderer 20 receives the reproduction control command transmitted from the controller 40 . the command processor 22 receives the reproduction control command from the control command reception unit 21 and instructs the content reception processor 23 to start the streaming reproduction . the content reception processor 23 transmits a content delivery request to the content delivery processor 31 of the server 30 via the network i / f unit 26 . the content delivery processor 31 that has received the request receives the content from the content management unit 32 and transmits it to the content reception processor 23 of the renderer 20 . the content decode unit 24 decodes the stream received from the content reception processor 23 and outputs it to the content display / reproduction unit 25 . then , the content is reproduced by the content display / reproduction unit 25 . fig5 is a flowchart showing an operation of the controller 40 as the information processing apparatus according to this embodiment . fig6 and 7 are schematic diagrams showing the display screen 41 of the controller 40 . first , a case where a content is selected by the user and the content is reproduced by the renderer will be described . this is an operation carried out in a case where a content has not been reproduced in the past regarding the content type selected by the user , and there is no reproduction history . as shown in fig6 , a reproduction apparatus list 61 is displayed on the display screen 41 ( step 101 ), and a reproduction renderer 20 a is selected by the user ( step 102 ). a content type list 62 of contents that can be reproduced by the renderer 20 a is displayed on the display screen 41 ( step 103 ). then , “ hdd video ” is selected as the content type ( step 104 ). the servers 30 are narrowed down to those that are capable of delivering contents belonging to “ hdd video ” ( step 105 ), and a server list 63 indicating the servers 30 a and 30 c are displayed ( step 106 ). then , the server 30 a is selected by the user ( step 107 ). a content list 64 that shows only contents belonging to “ hdd video ” that have been narrowed down from the plurality of contents that can be delivered by the server 30 a is displayed on the display screen 41 ( step 108 ). when a content v 3 is selected by the user ( step 109 ), a reproduction control command is transmitted to the renderer 20 a ( step 110 ). as a result , the content v 3 is reproduced by the renderer 20 a . on the display screen 41 of the controller 40 , a reproduction operation screen 65 used for inputting instructions of pause , fast - forward , and the like is displayed . further , the table of history information shown in fig4 is created and stored by the reproduction content history management unit 51 shown in fig3 . as a result , a reproduction history of the contents belonging to “ hdd video ” in the renderer 20 a is updated ( step 111 ). next , a case where there is a content reproduction history will be described . here , an example of a case where a reproduction request of the content v 3 is input again by the user will be described . as shown in fig7 , the reproduction apparatus list 61 is displayed on the display screen 41 , and the renderer 20 a is selected ( steps 121 and 122 ). then , the content type list 62 is displayed on the display screen 41 , and “ hdd video ” is selected ( steps 123 and 124 ). the reproduction content judgment unit 52 shown in fig3 judges whether there is a reproduction history of contents belonging to “ hdd video ” in the renderer 20 a ( step 125 ). the table shown in fig4 is stored in the reproduction content history management unit 51 , and the content v 3 and the server 30 a are specified based on the table ( step 126 ). in step 110 , a reproduction control command that instructs to acquire the content v 3 from the server 30 a and reproduce it is transmitted to the renderer 20 a . in the update processing of step 111 , identification information of the content v 3 and information on the server 30 a may be newly created as the history information . alternatively , the processing of updating a reproduction history does not need to be carried out when reproduction control based on history information is carried out . in the controller 40 as the information processing apparatus of this embodiment , history information in which identification information of the content v 3 that has been reproduced by the renderer 20 a and type information of the content v 3 (“ hdd video ”) are associated with each other is stored . when a reproduction request including at least the content type information is input , history information is searched for based on the content type information , and the content v 3 to be reproduced is judged . then , a reproduction instruction including the identification information of the content v 3 to be reproduced is transmitted to the renderer 20 a via the home network 10 . therefore , for the content v 3 whose past reproduction history is stored , reproduction can be started by merely selecting the content type . in other words , the sever selection and content selection by the user can be omitted . as a result , control to view a content that the user has viewed in the past again with favorable operability can be realized . in this embodiment , history information is created and stored for each of the renderers 20 a and 20 b connected to the home network 10 . as a result , control of the renderers 20 a and 20 b connected to the home network 10 to view a content that the user has viewed in the past again with favorable operability can be realized . in this embodiment , the reproduction content history management unit 51 stores , as history information , information in which identification information of a lastly - reproduced content and content type information are associated with each other for each content type . therefore , it becomes possible for the user to again view a content that has been viewed last with favorable operability for each content type . in other words , even when the content that has been viewed last belongs to “ hdd music ”, a content belonging to “ hdd video ”, that has been viewed last before that content can be viewed again with ease . moreover , in this embodiment , information on the server 30 is also stored in the reproduction content history management unit 51 as information associated with content identification information . then , a reproduction control command including the content identification information and information on the server 30 is transmitted to the renderer 20 . as a result , a time required for carrying out content reproduction processing by the renderer 20 is shortened . consequently , user operability is improved . moreover , the reproduction processing can be started at a time point the renderer 20 or the server 30 a included in the history information is found on the home network 10 . therefore , there is no need to wait for a response from other renderers 20 and servers 30 , with the result that a time required for starting reproduction can be shortened . a controller as an information processing apparatus according to a second embodiment of the present disclosure will be described . in descriptions below , descriptions on parts having the same structures and operations as those of the content reproduction system 100 and controller 40 described in the above embodiment will be omitted or simplified . the controller 240 of this embodiment is capable of acquiring identification information of a content that is being reproduced by the renderer 20 and type information of the content . based on the acquired content identification information and content type information , history information stored in the reproduction content management unit can be updated . for example , an update unit as a block that carries out the processing described above is provided in addition to the blocks shown in fig3 . fig8 is a sequence diagram showing an example of control between the controller 240 of this embodiment and the renderer 20 connected to the home network . fig9 is a diagram for explaining information that can be acquired by the controller 240 by the control sequence shown in fig8 . as shown in fig8 and 9 , “ getmediainfo ” or “ getpositioninfo ” is transmitted from the controller 240 to the renderer 20 as a upnp ( universal plug and play ) control message . as a response to the message , “ avtransporturimetadata ” or “ currentmetadata ” is transmitted from the renderer 20 to the controller 240 . as shown in fig9 , the information returned from the renderer 20 includes meta - information on contents such as a content name , a content uri , and dlna . org_pn . based on the content meta - information , information necessary for updating history information that includes content identification information and content type information is acquired . fig1 is a flowchart showing an example of processing carried out by the controller 240 for acquiring information necessary for updating history information based on the content meta - information shown in fig9 . “ getpositioninfo ” is transmitted to the renderer 20 ( step 201 ), and whether a response from the renderer 20 is made within a predetermined time is judged ( step 202 ). upon reaching timeout with no response from the renderer 20 , an acquisition of content meta - information is judged to have failed , and processing is ended ( step 203 ). when a response is made by the renderer 20 , content meta - information included in “ currentmetadata ” from the renderer 20 is checked ( step 204 ). dc : title as the content meta - information is acquired as information on a name of a content that is being reproduced ( step 205 ). moreover , a content uri is acquired as uri of the content that is being reproduced ( step 206 ). in this embodiment , information on a content name and a content uri are acquired as content identification information . whether a udn of a server that has provided the content that is being reproduced is included in the content meta - information is judged ( step 207 ). when a server udn is included in the content meta - information , the udn is acquired as information for identifying a server ( step 208 ). the server udn may be added by the server as unique meta - information . the server udn may be acquired by reproduction of playcontainer . when a server udn is not included in the content meta - information , address information is acquired from the content uri acquired in step 206 . then , the address information is acquired as server identification information ( step 209 ). it should be noted that by using the content uri , a content can be acquired from the server to be reproduced . therefore , the server identification information does not need to be acquired . however , by acquiring the server identification information , processing of displaying server information on a display screen of the controller 240 or displaying content lists of servers becomes possible as appropriate . by referring to the tables to be described later , content category information is acquired from the content meta - information ( step 210 ). in this embodiment , content category information is acquired as the content type information . fig1 are diagrams showing examples of tables for acquiring content category information from content meta - information . fig1 a is a table for judging a category based on dlna . org_pn as content meta - information . a table of a profile defined by dlna as dlna . org_pn and a category corresponding thereto may be used instead . the value of dlna . org_pn becomes a value like “ mpeg_ps_ntsc ”, for example , but focusing on the first half portion as shown in fig1 ( mpeg in this example ), the profile may be judged based on a match on the front side . accordingly , the table may be simplified . when arib . or . jp_pn , profile information that uniquely defines an apparatus vendor , or the like is defined in addition to dlna . org_pn , a category corresponding to the profile may be judged using the same tables as those shown in fig1 . it should be noted that the idea described herein is also applicable to a category judgment of contents based on mime - type as the content meta - information shown in fig9 . fig1 b is a table for judging a category of contents based on meta - information uniquely added by the server . meta - information that the controller 240 can acquire from the renderer 20 is based on information that the renderer 20 has acquired from the server that delivers the contents . therefore , it is also possible for unique content meta - information to be added at a time point a content is provided by the server , for example , and a content category to be judged based on the content meta - information acquired from the renderer 20 . as shown in fig1 b , the content category can be judged more specifically since it is based on the content meta - information uniquely added by the server . accordingly , the user can view a content that has been viewed in the past again with favorable operability for each of the specifically - categorized content types ( category in this example ). in step 211 of fig1 , the information on the renderer 20 that has returned “ currentmetadata ” to the controller 240 , the category information , the information on a content name , the content uri , and the server identification information are linked . based on those pieces of information , history information stored in the reproduction content history management unit is updated . for example , there are a case where a content is reproduced based on a reproduction instruction from another controller connected to the home network and a case where a content is reproduced with the renderer functioning as a dmp . in such cases , by appropriately updating history information , the user can reliably view the content again . the series of processing executed by the controllers 40 and 240 according to the first and second embodiments above may be executed either by hardware or software . when causing software to execute the series of processing , a computer in which a program constituting the software is incorporated into dedicated hardware is used , for example . alternatively , a program is installed from a program recording medium to a computer that is capable of executing the series of processing by installing various programs . fig1 is a block diagram showing a structural example of a computer that executes the series of processing described above . the series of processing described above may be executed by a computer that has the following hardware structure instead of the controller 40 shown in fig2 . a computer 300 includes a cpu ( central processing unit ) 301 , a rom ( read only memory ) 302 , a ram ( random access memory ) 303 , an input / output interface 305 , and a bus 304 for mutually connecting those components . connected to the input / output interface 305 are a display unit 306 , an input unit 307 , a storage 308 , a communication unit 309 , a drive unit 310 , and the like . the display unit 306 is a display device that uses , for example , liquid crystal , el ( electro - luminescence ), and crt ( cathode ray tube ). the input unit 307 is , for example , a pointing device , a keyboard , a touch panel , or other operation apparatuses . when the input unit 307 includes a touch panel , the touch panel may be integrated with the display unit 306 . the storage 308 is a nonvolatile storage device such as an hdd ( hard disk drive ), a flash memory , and other solid state memories . the drive unit 310 is a device capable of driving a removable recording medium 311 such as an optical recording medium , a floppy ( registered trademark ) disk , a magnetic recording tape , and a flash memory . in contrast , the storage 308 is often used as a device that is mounted on the computer 300 in advance , for mainly driving an unremovable recording medium . the communication unit 309 is a modem , a router , or other communication apparatuses connectable with the lan ( local area network ), the wan ( wide area network ), and the like for communicating with other devices . the communication unit 309 may communicate with other devices either by wires or wirelessly . the communication unit 309 is often used separate from the computer . data processing by the computer 300 is realized by software stored in the storage 308 , the rom 302 , or the like in cooperation with hardware resources of the computer . specifically , by the cpu 301 loading and executing the program that is stored in the storage 308 , the rom 302 , or the like and constitutes software in the ram 303 , various types of data processing are realized . the embodiment of the present disclosure is not limited to the embodiments above and may be variously modified . for example , in the above embodiments , a reproduction control command of the content v 3 is transmitted to the renderer 20 a when it is judged in step 125 of fig5 that there is a reproduction history of the content v 3 . however , whether to reproduce the content v 3 may be judged by the user before the reproduction control command is transmitted . for example , a popup window of , for example , “ there is a content of the selected content type that has been reproduced in the past . do you wish to reproduce the content ?” may be displayed on the display screen 41 of the controller 40 . as a result , reproduction control of favorable operability is realized when a content different from the content v 3 that the user has viewed in the past is to be viewed . fig1 is a diagram showing a modified example of the content type list 62 displayed on the display screen 41 shown in fig7 . as shown in the figure , the content type list 62 may display a name of a content that has been reproduced in the past for each content type . accordingly , the user can grasp a content to be reproduced by selecting the content type by visually checking the content type list . as a result , user operability is improved . furthermore , identification information of a lastly - reproduced content has been stored as the history information for each content type . however , history information of a plurality of contents may be stored for each content type . for example , identification information of not only the lastly - reproduced content but also a content that has been reproduced before that and also a content before that may be stored for each content type . in this case , after the content type is selected , a list of the plurality of contents belonging to the content type , that have been reproduced in the past , is displayed on the display screen . the user selects a content that he / she wishes to view again from the displayed list of contents . accordingly , an operation of selecting and reproducing a content that the user wishes to view most from the contents that have been reproduced in the past becomes possible , for example . moreover , in steps 101 to 109 of fig5 , the content has been selected by selecting the renderer , the content type , and the server in the stated order . however , the order is not limited to this order . for example , a content may be selected by selecting the content type , the server , and the renderer in the stated order . further , the renderer selection processing of step 121 of fig5 may be omitted . for example , the renderer that has lastly received a reproduction control command from the controller may be used as a default renderer . as a result , the renderer selection processing can be omitted . furthermore , when a server to provide a content is not found when a content reproduction instruction is transmitted to the renderer based on history information , another server capable of delivering a content belonging to the content type selected by the user may be displayed on the display screen of the controller . as a result , a content of the same content type can be viewed swiftly when a server that is to be connected first is not activated , for example . the controllers of the above embodiments may operate as an ir remote controller equipped with a macro function . accordingly , it becomes possible for the user to also control an apparatus that is not connected to the home network by operating the controller . it should be understood by those skilled in the art that various modifications , combinations , sub - combinations and alterations may occur depending on design requirements and other factors insofar as they are within the scope of the appended claims or the equivalents thereof .	7
embodiments of an air cleaner of the present invention will be described with reference to the drawings . fig1 is a longitudinal cross sectional view schematically showing a main portion of an example of an air cleaner of the present invention , fig2 is a longitudinal cross sectional view of another example of an air cleaner of the present invention , fig3 is a longitudinal cross sectional view of a further example of an air cleaner of the present invention , and fig4 is a longitudinal cross sectional view schematically showing an existing air cleaner . fig4 shows an example of a structure of the existing air cleaner disposed in an engine room , wherein numeral 1 denotes a filter element and numeral 2 denotes a circumferential wall having an l - shaped cross section formed around the circumference of the element 1 integrally with it to keep the shape of the element 1 and accommodate the element 1 in and fix the same to a casing 3 . a horizontal portion of the circumferential wall is a portion to be held 2a . the filter element 1 is composed of a sheet - shaped filter member made of nonwoven fabric or the like which is repeatedly bent to form a pleat continuous member 1a having a zigzag cross section so that the filter element 1 has a large surface area . the filter element 1 usually has a rectangular plane shape . the filter element 1 has the circumferential wall 2 formed around the circumference thereof which is formed to substantially the l - shape and has the portion to be held 2a so that the shape of the filter element 1 is kept and the filter element 1 is mounted to the casing 3 . the filter element 1 having the circumferential wall 2 formed around the circumference thereof is held between the divided surfaces 3c , 3d of the casing 3 having a structure divided into two portion , i . e ., an upper casing member 3a and a lower casing member 3b through the flange - shaped portion to be held 2a formed around the entire circumference of the circumferential wall 2 of the filter element 1 . the divided surfaces 3c , 3d or the abutting surfaces 3c , 3d are tightened by clips 4 . numeral 3e denotes an air intake port defined to the upper casing member 3a , numeral 3f denotes an air feed port defined to the lower casing member 3b , and numeral t 1 denotes a wall thickness of the portion to be held 2a . with the above arrangement , the casing 3 of the air cleaner shown in fig4 is divided into the two portions or the upper portion and the lower portion through the filter element 1 . therefore , external air taken into the upper casing member 3a from the air intake port 3e is filtered through the filter element 1 , fed into the lower casing member 3b and further fed into a carburetor from the air feed port 3f . according to the present invention , a height of the pleat continuous member 1a is increased so as to increase a filtering area of the filter element 1 in the above air cleaner as compared with that of the filter element shown in fig4 and to form the filter element 1 to the same outline as that of the filter element shown in fig4 when the plane surface of the filter element 1 is viewed . when a height of the pleat continuous member 1a of the element 1 is increased , the shoulder part of the edge portion is abutted against the inner surface of the casing 3 and thus the element 1 cannot be accommodated in the casing 3 in the state as it is . to cope with this problem , according to the present invention , in the circumference wall 2 formed around the circumference of the element 1 having the pleat continuous member 1a whose height h 1 is increased to a height h 2 , the wall thickness t 1 of the portion to be held 2a which to be held between the divided surfaces 3c , 3d of the casing 3 is set to a wall thickness t 2 larger than t 1 , as shown in fig1 . with this arrangement , when the portion to be held 2a having the increased wall thickness t 2 to be held between the divided surfaces 3b , 3c of the casing 3 , an effective internal height formed by the upper and lower casing members 3a , 3b is increased by the difference of the wall thickness of the member to be held 2a which is increased from t 1 to t 2 , as shown in fig1 . as a result , the element 1 whose surface area is increased by increasing the height of the pleats 1a from h 1 to h 2 can be accommodated in the conventionally used casing 3 in the state as it is . note , clips whose size is made larger than that of the clips shown in fig2 in accordance with an increase of the wall thickness of the portion to be held 2a are used as clips 4 &# 39 ; for holding the divided surfaces 3c , 3d from the outside thereof . further , according to the present invention , in a circumference wall 2 formed around the circumference of an element 1 including a pleat continuous member 1a having a height h 2 higher than the height h 1 shown in fig3 a volume increasing abutment member 5 is applied to a member to be held 2a which to be held between divided surfaces 3c , 3d of a casing 3 so as to increase a thickness of the portion to be held 2a in its entirety to which the abutment member 5 is applied , as shown in fig2 . the abutment member 5 is formed of a suitable metal , rubber , or plastic material formed to a necessary thickness and has substantially the same shape as the member to be held 2a when the plane surface thereof is viewed . note , numeral t 3 denotes a wall thickness of the abutment member 5 . when the portion to be held 2a whose volume is increased by the abutment member 5 applied thereto is held between the abutment surfaces 3c , 3d of the casing 3 , an effective internal height formed by the upper and lower casing members 3a , 3b is increased in accordance with an increase of thickness of the member to be held 2a . as a result , the element 1 whose surface area is increased by increasing the height of the respective pleats 1a from the height h 1 of the conventional pleats to the height h 2 can be accommodated in the existing casing 3 in the state as it is . also in this case , clips whose size is made larger than that of the clips shown in fig4 in accordance with an increase of the interval between the abutment faces 3c , 3d are used as clips 4 &# 39 ; for holding the divided surfaces 3c , 3d from the outside thereof . although the embodiment of fig3 is arranged such that a volume increasing abutment member 5 is applied to the upper surface of a member to be held 2a , the abutment member 5 may be applied to the lower surface of the member to be held 2a as shown in fig3 or to the upper and lower surfaces thereof although not shown in fig3 . in these cases , the position of the member to be held 2a in the height direction of pleats la is previously changed and adjusted . as described above , since the air cleaner of the present invention increases a filtering area by increasing a height of pleats without changing a plane shape of a filter element as well as increases a wall thickness of the part of an edge portion to be held by a casing or a volume increasing abutment member is applied to the part of the edge portion to be held by the casing , a capacity of the air cleaner can be increased while using a conventionally used casing without replacing it . as a result , an air cleaner having a capacity corresponding to a displacement of engines can be provided at a low cost to the engines to which an air cleaner having the same capacity has been conventionally applied regardless of the displacement of the engines .	5
the invention in its several embodiments includes a computer aided manufacturing system 100 , as illustrated in a functional block diagram in fig1 , where the system comprises a machining apparatus 130 and a device 102 comprising a planning module 110 and a numerical code generator 120 . the planning module 110 has a processing module and the numerical code generator 120 may be a separate processing module or may be embodied as computer - executed instructions that are executed by the processing module of the planning module . the machining apparatus 130 may provide a machining tool or cutting tool and may reorient the cutting tool relative to a workpiece according to instructions provided by the numerical code generator 120 . the position of the cutting tool may be expressed in three absolute positions , i . e ., xyz , and two rotary positions , i . e ., a — a rotary position about x , and b — a rotary position about y . the numerical code generator may be responsive to the output of the planning module 110 . the planning module may have access to one or more databases 140 comprising computer - based models of : ( a ) areas 141 of a workpiece to be machined ; ( b ) patterns 142 that may be applied for machining the workpiece ; ( c ) relationships expressing the relative orientation 143 between a cutting tool of the machining apparatus 130 and the workpiece ; and ( d ) auxiliary movements 144 that may include : ( 1 ) instructions for approaching the workpiece ; ( 2 ) instructions for departing the workpiece ; and ( 3 ) instructions for movements linking machining sub - areas . via a user interface 150 , a user of the system 100 may select files or objects from the databases 140 for application by the planning module 110 to generate the numerical code 121 that may for example be g - code . the machining apparatus 130 may then receive the g - code and execute the coded instructions to drive the machine tool . for example , the device may have a user interface 150 adapted to receive a user selection from a first menu 151 that may be a touch screen , or a display and indicating device , where the first menu 151 includes a plurality of machining patterns and the device may have a user interface 150 adapted to receive from a second menu 152 that may be presented via the same touch screen , or a display and indicating device , as the first menu 151 or via a separate touch screen , or a display and indicating device , where the second menu 152 includes a plurality of tool axis orientations . the invention in its several embodiments includes an exemplary method of five - axis machining , as illustrated in a top - level flowchart of fig2 where a composite machining cycle includes a planning or programming process comprising four steps which may then be followed by the cnc coding . the exemplary four planning steps of the five - axis composite machining comprise : ( a ) defining or selecting the area of the workpiece to be machined ( step 210 ); ( b ) selecting the pattern to apply when machining the selected area ( step 220 ); ( c ) defining the orientation of the relationships between the cutting tool and the workpiece ( step 230 ); and ( d ) defining the auxiliary movements ( step 240 ) that may include : ( 1 ) approaching the workpiece ; ( 2 ) departing the workpiece ; and ( 3 ) movements linking machining sub - areas . thereafter , the method may include the step of generating the cnc code ( step 250 ). another method embodiment may be described in the top level flowcharts of fig3 a and 3b . the exemplary steps comprises : selecting an area for machining by defining the selected region via a defined set of surfaces ( step 310 ); selecting a generation method for a pattern of curves ( step 320 ); selecting a rule for driving the tool axis direction along the curves ( step 330 ); selecting the lateral increments between the single cuts of the tool path ( step 340 ); selecting , for each set of cuts , the type of approaches , the detach at the beginning and the detach at the end ( step 350 ); selecting the types of connections between the larger portions of the tool path ( step 360 ); selecting a anomalous event response ( step 370 ); and determining a tool path ( step 380 ). illustrated in fig4 is an exemplary functional block diagram of the content and use of a curve pattern database of an embodiment of the present invention . the plurality of rules of generating a pattern of curves on the area to be machined 410 may be used to establish a curve pattern database 420 and the curve pattern database may be referenced to along with the rules to define the machine tool axis direction along the points of the curve 430 . exemplary curve generation methods include : ( a ) isoparametric interpolation ; ( b ) projection of drive surface isoparametrics ; ( c ) intersection with a set of planes ; and ( d ) offsetting from a defined or given contour . the curve pattern data comprising the curve pattern database may be expressed as : ( a ) points in xyz ; ( b ) a surface of pertinence ; ( c ) a vector normal to the belonging surface ; and uv - mapping onto the surface , where u = ƒ 1 ( x , y , z ) and v = ƒ 2 ( x , y , z ). the exemplary rules to define a tool axis of direction along the points of the curve pattern may include : ( a ) a direction normal to the drive surface or normal to the machined surface ; ( b ) a direction passing through a fixed point or through points of a given curve ; and ( c ) a direction parallel to a given fixed vector . fig5 a and 5b illustrate in top level flowchart form an example of the composite machining method where one may select an entire workpiece for machining ( step 510 ), one may select a curve pattern that comprises a series of planes , each perpendicular to a given curve , that intersect the workpiece surfaces ( step 520 ), the tool axis of direction may be selected as being normal to the surface of the workpiece to be machined ( step 530 ), the lateral increments between single cuts or workfeed links may be selected as fluent cubic links ( steps 540 ); the approaches and detaches are selected as motion about a radius or radiused ( step 550 ); and the connection between large portions of the tool path may be selected as rapid links thatn in this example may be radial about the x - axis ( step 560 ). with the planning completen the tool path may be determined ( step 580 ). with this composite machining method , many different methods for machining a part having multiple machining cycles , may be condensed into one composite machining function . from the perspective of the cam system development , to realize such a composite function implies building each individual orientation and each individual pattern as objects that may be used interchangeably . this interchangeable object approach provides a high rate of reliability in the resulting software , as any individual object is cleared of parasite dependency and appears only once in the software body . the method of the five - axis composite machining cycle makes available to a user a set of choices for the selection of the pattern , a selection typically larger in number than the state - of - the - art , and makes available the pattern choices in combination with the range of choices for orientation typically greater in number than the state - of - the - art . accordingly , by selecting a combination of pattern and orientation , the user may readily and reliably setup a five - axis machining cycle . for example , if the number of available choices for the patterns is six , and the available choices for orientation is six , the user may choose from 36 combined ways to machine the part . from the point of view of the cam system development , adding , in this example , one new choice for the orientation means automatically having six new and different machining cycles — one for each existing pattern . one of ordinary skill in the art will also appreciate that the modules and functions described herein may be further subdivided , combined , and / or varied and yet still be in the spirit of the embodiments of the invention . in addition , while a number of variations of the invention have been shown and described in detail , other modifications , which are within the scope of this invention , will be readily apparent to those of ordinary skill in the art based upon this disclosure , e . g ., the exemplary flowcharts or processes described herein may be modified and varied and yet still be in the spirit of the invention . it is also contemplated that various combinations or subcombinations of the specific features and aspects of the embodiments may be made and still fall within the scope of the invention . accordingly , it should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another in order to form varying modes of the disclosed invention . thus , it is intended that the scope of the present invention herein disclosed should not be limited by the particular disclosed embodiments described above .	6
referring now to the drawings , and more particularly to fig1 there is shown a perspective view of a preferred embodiment of the inventive sprue bushing 10 . sprue bushing 10 includes a body member 11 , body member first end 13 and body member second end 15 . body member 11 further includes a fluid passageway 17 . passageway 17 is coextensive with body member 11 and includes a surface 19 and first 21 and second 23 ends . thus , passageway 17 forms an opening through which molten material is passed through body member 11 and into a mold 25 . as shown in fig4 passageway 17 may be generally cylindrical in cross section . other suitable passageway 17 shapes , such as conical or helical , are intended to be within the scope of this invention . as illustrated in fig1 and 4 , body member 11 may have an elongated portion 27 which is inserted into a corresponding opening 26 in mold 25 . stop member 29 is provided to aid in positioning sprue bushing 10 relative to mold 25 . positioning of sprue bushing 10 with respect to mold 25 is seen , by way of example only , in fig3 . the stop member 29 shown in fig1 and 4 is a shoulder . fig2 and 4 show the nozzle seat 31 of the inventive sprue bushing 10 . nozzle seat 31 is for receiving an injection molding machine nozzle 35 . nozzle seat 31 is positioned at the body member 11 first end 13 . passageway 17 is coextensive with nozzle seat 31 . nozzle seat 31 shown in fig2 is annular . nozzle seat 31 may include tapered portion 33 for positioning the injection molding machine nozzle tip 35 with respect to body member first end 13 . fig4 best shows liner 37 attached to body member 11 and positioned along substantially all of passageway 17 . liner 37 is in contact with the molten material being moved through sprue bushing 10 . liner 37 prevents degradation of body member 11 caused by abrasive materials ( e . g ., glass , talc , etc .) in the molten material . liner 37 prolongs the service life of sprue bushing 10 by preventing passageway 17 from becoming worn and enlarged thereby impairing control of flow of material through the passageway 17 . further , liner 37 prevents fragments of body member 11 material from being swept into the mold 25 potentially contaminating a molded part . body member 11 is made of heat - conductive material . the heat - conductive material draws heat from the molten material thereby shortening the cycles . rapid heat removal is important to efficient operation of the mold cycle . copper alloys are particularly preferred for use as the body member 11 material because of the high heat conductivity of such materials . a particularly useful beryllium - free copper alloy is designated c - 18000 and is manufactured by ampco metal , inc . of milwaukee , wis . ( c - 18000 includes approximately 96 . 4 % copper , 2 . 5 % nickel , 0 . 7 % silicon and 0 . 4 % chromium .) c - 18000 is an excellent heat conductor and has an approximate thermal conductivity of 125 btu / ft / hr / ft 2 /° f . however , such material is prone to degradation in applications involving abrasive materials because it has a hardness of approximately 94 on the rockwell hardness b scale . the body member 11 may also be formed of other heat - conductive materials , such as aluminum . the body member may be made by any suitable process such as casting or machining . nozzle seat 31 is made of a material dissimilar from that of the body member 11 . the material used for nozzle seat 31 has less heat - conductivity than the material used to make the body member and serves as a partial barrier to heat transfer from the injection molding machine . # 420 stainless steel manufactured by crucible specialty metals of chicago , ill . is particularly suitable for use in making nozzle seat 31 because it is durable and has an approximate thermal conductivity of 7 btu / ft / hr / ft 2 /° f -- much less than that of the preferred copper alloy for use in making the body member 11 . other suitable materials for use in nozzle seat 31 include tool steels having aisi designations d - 2 , d - 5 , a - 2 and m - 2 . materials , such as those set forth herein , are durable and reduce wear caused by contact between nozzle seat 31 and the injection molding machine nozzle tip 35 . the nozzle seat may be attached to the body member first end 13 by any acceptable method . tungsten carbide steels are particularly useful materials for liner 37 . such materials are harder , and thus more wear - resistant , than the highly heat - conductive materials preferred for use as the body member component 11 . such materials , nonetheless , have good heat conductivity . one example of a suitable tungsten carbide steel is designated c - 2 and is manufactured by carbidie corporation of irwin , pa . c - 2 has a hardness of about 77 . 0 - 80 . 0 on the rockwell hardness c scale and a thermal conductivity of about 45 btu / ft / hr / ft 2 /° f . other carbidie products , such as c - 9 and c - 1 , are also suitable for use in making liner 37 . liner 37 may be constructed and attached to the body member 11 in any suitable manner . in preferred embodiments , liner 37 is a tube attached to the body member passageway 17 . in this embodiment , liner 37 is attached to body member 11 by heating body member 11 ( thereby expanding the circumference of passageway 17 ) and inserting liner 37 into passageway 17 . the passageway 17 circumference is reduced as the body member 11 cools thereby locking liner 37 in place . any protruding portions of liner 37 may be removed by appropriate means . this is also an acceptable method by which to attach the nozzle seat 31 to body member first end 13 . for instance , a formed seat 31 may be placed into an aperture ( not shown ) formed in heated body member first end 13 . shrinkage of body member 11 upon cooling locks nozzle seat 31 in place . liner 37 is not restricted to a pre - made tube and could be of other suitable construction such as a coating applied to passageway 17 . fig3 depicts a sprue bushing placed in position for a typical molding operation . sprue bushing 10 is inserted into a corresponding opening 26 ( shown by phantom lines in fig3 ) of mold 25 and is held in position by stop 29 . mold 25 is placed in an injection molding machine so that the body member first end 13 and passageway opening 21 are in registry with nozzle tip 35 as shown by the dashed line 36 . as the molding cycle begins , nozzle tip 35 is brought into contact with nozzle seat 31 by the injection molding machine and molten material , such as thermoplastic , is discharged from nozzle tip 35 into passageway 17 . liner 37 resists wear caused by any abrasive material in the molten plastic . the molten material passes through the sprue bushing 10 and into mold 25 filling the mold cavity ( not shown ). heat from the molten plastic is drawn away by liner 37 and body member 11 speeding the cooling process . the cycle is typically completed by withdrawing the nozzle tip 35 , opening mold 25 and permitting the molded part to fall into a drop box . the lined passageway 17 of applicant &# 39 ; s invention increases the service life of the sprue bushing and improves control over the molding process by maintaining a constant flow path for the molten material . the heat - transfer characteristics of the body material promote rapid material cooling and shorter cycle times . applicant &# 39 ; s invention makes the molding process more economical by decreasing replacement part costs and reducing costs associated with handling molded product and replacement of defective plastic product . while the principles of this invention have been described in connection with specific embodiments , it should be understood clearly that these descriptions are made only by way of example and are not intended to limit the scope of the invention .	1
the technical solution in the embodiment of the present invention will be described clearly and completely in conjunction with the drawings in the embodiment of the present invention hereinafter . obviously , the described embodiments are only a part but not all of the embodiments of the present invention . all the other embodiments obtained by those skilled in the art without creative work based on the embodiment in the present invention pertain to the scope of protection of the present invention . reference is made to fig2 , which is a schematic flow chart of a method for identifying valuable document provided by a first embodiment of the present invention , and the method includes the following steps : s 1 . detecting characteristics of the valuable document in different spatial scales to obtain multi - source information ω ={ x i , x j , . . . , x n }, where x i indicates the characteristic in the i - th space scale , x j indicates the characteristic in the j - th space scale , 1 ≦ i ≦ n , 1 ≦ j ≦ n , and i ≠ j ; semantic constraints on x i and x j are : s 2 . determining a spatial location of x j with x i according to the semantic constraints on x i and x j to obtain a location constraint ψ ij ( x , y ); s 3 . extracting a feature value f i from the x i ; and extracting a feature value f j from the x j according to the location constraint ψ ij ( x , y ); s 4 . judging whether f i and f j conform to a characteristic standard of the valuable document ; receiving the valuable document if yes ; else rejecting the valuable document . in the above step s 1 , as required by practical application , the characteristics of the valuable document in different spatial scales can be detected by a specific array of sensors to obtain multi - source information . the multi - source information includes spectral information , magnetic information , material information and other physical information . the characteristic of the valuable document has the feature of “ global cooperation and local competition ”, the characteristics in different spaces not only keep relatively independent , but also keep a certain semantic constraint in the context ( scene ) for describing the valuable document : redundancy , complementation or correlation . individual characteristics work cooperatively in the context circumstance for describing the valuable document , consisting integral description of the valuable document . as shown in fig3 , the characteristics of the valuable document in different spatial scales is detected by a sensor 1 , a sensor 2 , a sensor 3 , . . . , and a sensor n to obtain respectively the characteristics x 1 , x 2 , x 3 , . . . , and x n . there exists redundancies between x 1 and x 2 , and between x 3 and x n , there exists correlation between x 1 and x n , and they cooperatively constitute the consistent description or explanation of the valuable document . this procedure obtains the information of the valuable document in different spatial scales by building the array of sensors , for providing multi - source information for the following cooperative sensing process . the above steps s 2 and s 3 are the cooperative sensing processes . spatial characteristics of the valuable document keep relatively independent locally , which have integrity for describing the nature thereof ; and keep “ cooperative ” relationship globally and conform to a certain semantic constraint . by establishing the context scene of individual spatial characteristics , the optimal characteristics of individual spaces are extracted according to the idea of “ local competition and global cooperation ”, considering completely the context constraint on individual characteristics , during the identification process . the optimal characteristic refers to the feature value that is legal and most adequate for representing the nature of this space . in the above step s 3 , the feature value f i extracted from x i and the feature value f j extracted from x j are both optimal characteristic . the above step s 4 is the cooperative decision process , the decision sorting is performed based on practical application scene according to the optimal characteristics of individual spaces obtained during the cooperative sensing process . locally , when one feature value is determined as an illegal input , the match of the other spatial characteristics is stopped , a rejection identification is output to reject to identify the valuable document ; and globally , only when all the feature values are determined as legal , the identification result is output . the method for identifying valuable document provided by a second embodiment of the present invention will be described in detail only by taking the multi - source information ω including spectral information x 1 , magnetic information x 2 and material information x 3 as an example in conjunction with fig4 to 6 hereinafter . in this embodiment , the multi - source information of the valuable document is defined as : spectral information x 1 , magnetic information x 2 and material information x 3 . specifically , the 2 - dimensional spectral information x 1 is collected by a spectral sensor , the 1 - dimensional magnetic information x 2 is collected by a magnetic sensor , and the 1 - dimensional material information x 3 is collected by a material sensor . the 2 - dimensional spectral information x 1 forms the image of the valuable document , the 1 - dimensional magnetic information x 2 records the magnetic signal information which is collected during the valuable document passing , and the 1 - dimensional material information x 3 records the thickness information which is collected during the valuable document passing . 1 . the semantic constraint on the spectral information x 1 and the magnetic information x 2 for the valuable document , the spectral information x 1 is used for representing the image information of the valuable document , the magnetic information x 2 is used for representing the collected magnetic signal information of the magnetic carrier ( e . g ., magnetic security thread on the valuable document ). the spectral information x 1 contains the optical imaging information of the magnetic carrier , the location “ coordinate ” of the magnetic carrier can be accurately determined by the spectral information x 1 . therefore , the magnetic sensor forms the semantic constraint on the spectral information x 1 and the magnetic information x 2 for the collecting point “ coordinate ” of the magnetic carrier on the valuable document , which can be specifically described by the following formula : in fig4 , a schematic diagram of the semantic constraint on the multi - source information is shown , in which the black belt - shaped region ( i . e ., the region b ) is the optical image of the magnetic security thread ; and the inclined stripe region ( i . e ., the region a and the region c ) is the optical image of the other portion in the valuable document . the magnetic information x 2 represents the magnetic signal information of the magnetic security thread , the optical imaging of the magnetic security thread is contained in the optical imaging x 1 of the whole valuable document , then x 1 ∩ x 2 ≠ φ and x 1 & lt ;=& gt ; x 2 . because the optical reflectivity of the magnetic security thread is low , the optical image thereof is the black belt - shaped region in fig4 , and the gray value thereof is significantly lower than that of the ambient region . the location of the magnetic security thread in the image can be determined by analyzing the variance in the gray value of the image . this is the inherent relation between the spectral information and the magnetic security thread ( magnetic information ) of the valuable document . 2 . the semantic constraint on the spectral information x 1 and the material information x 3 the material information x 3 is used for representing the material thickness of the valuable document , and the spectral information x 1 contains the optical imaging information of various material thickness varying regions of the valuable document . the variance in the material thickness of the valuable document reflects onto the strength of the transmitted or reflected spectral energy , which is the inherent instinct relation between the spectral information and the material information . therefore , the variance in the material thickness ( i . e ., the material information x 3 ) of the valuable document can be reflected by the spectral information x 1 . the semantic constraint on the spectral information x 1 and the material information x 3 can be described by the following formula : as shown in fig4 , the optical imaging lightness value of the magnetic security thread , i . e ., the region b , is low , and the optical imaging lightness value of the other regions , such as the regions a and c , is high . from the region a to the region b , the material of the valuable document varies , its corresponding optical imaging lightness value experiences the variation from “ high ” to “ low ”; and from the region b to the region c , the material of the valuable document varies , its corresponding optical imaging lightness value experiences the variation from “ low ” to “ high ”. therefore , the part of specific material on the valuable document can be accurately determined by the spectral information x 1 . 3 . the semantic constraint on the magnetic information x 2 and the material information x 3 the magnetic region in the valuable document has particular material characteristic , and the particularity of this region can be reflected by the material information x 3 . the material information x 3 contains the thickness information of the magnetic carrier , and the semantic constraint on the magnetic information x 2 and the material information x 3 can be described by the following formula : as shown in fig4 , the thickness of the magnetic security thread ( i . e ., the region b ) is much thicker than that of the ambient material . from the region a to the region b , their corresponding thickness values experience the variation from “ low ” to “ high ”; and from the region b to the region c , their corresponding thickness values experience the variation from “ high ” to “ low ”. reference is made to fig5 , which is a schematic flow chart of a cooperative sensing portion of a method for identifying valuable document provided by a second embodiment of the present invention . according to the above three semantic constraints , i . e ., the semantic constraints ( 1 ), ( 2 ) and ( 3 ), the cooperative sensing procedure of the valuable document is as follow . s 21 . determining a location of the magnetic carrier in the image according to the variety state of the image gray value of the spectral information x 1 , and obtaining a magnetic information location constraint ψ 12 ( x , y ); s 22 . determining locations of various materials in the image according to the variety state of the transmittance or refractive index in the spectral information x 1 , and obtaining a material information location constraint ψ 13 ( x , y ); s 31 . extracting a feature value f 1 from the spectral information x 1 based on a main component analyzing method ; s 32 . extracting a feature value f 2 from the magnetic information x 2 based on the magnetic information location constraint ψ 12 ( x , y ); specifically , the magnetic information location constraint ψ 12 ( x , y ) determines the location of the magnetic carrier ( e . g . the magnetic security thread ) in the valuable document . the feature value f 2 of the magnetic carrier can be accurately extracted from the magnetic information x 2 based on the ψ 12 ( x , y ). the feature value f 2 is the time sequence of the magnetic information . s 33 . extracting a feature value f 3 from the material information x 3 according to the material information location constraint ψ 13 ( x , y ); specifically , the material information location constraint ψ 13 ( x , y ) determines the locations of various materials in the valuable document , and the feature value f 3 of a certain material can be accurately extracted from the material information x 3 based on the ψ 13 ( x , y ). for example , the material information x 3 is the thickness information , and the thickness of the magnetic security thread or the thickness of the paper material ( such as the paper material other than the magnetic security thread ) can be accurately extracted from the material information x 3 based on the ψ 13 ( x , y ). s 34 . checking whether f 2 and f 3 conform to the semantic constraint on x 2 and x 3 , and determining that f 2 and f 3 are legal if yes ; because the production of the valuable document ( such as banknote ) complies with a strict technology standard , the spectral characteristic and the magnetic characteristic of the real banknote strictly comply with the standard value , without exceeding the range of the standard value . for example , the magnetic security thread of the banknote has specific magnetic information and thickness value . in this embodiment , according to the semantic constraint on x 2 and x 3 , the feature values f 2 and f 3 is checked mutually to verify the legality of f 2 and f 3 . s 35 . in the case that f 2 and f 3 are legal , checking whether an correlation attribute among f 1 , f 2 and f 3 conforms to the valuable document standard ; and determining that f 1 is legal , if yes ; and s 36 . outputting f 1 , f 2 and f 3 , if f 1 , f 2 and f 3 are all legal ; else outputting a rejection identification . moreover , in the above flow of cooperative sensing valuable document , the location information of the magnetic information x 2 can also be determined by the material information x 3 to obtain the magnetic information location constraint ψ 32 ( x , y ). after the feature values f 1 , f 2 and f 3 are extracted based on the main component analyzing method , the legality of f 2 and f 3 can be verified by ψ 12 ( x , y ), ψ 13 ( x , y ), ψ 32 ( x , y ), rather than by verifying whether f 2 and f 3 conform to the semantic constraint on x 2 and x 3 . that is to say , the variable f 2 can be substituted into ψ 12 ( x , y ), and f 2 is determined as legal when ψ 12 ( x , y ) is satisfied . in the same way , the variable f 3 can be substituted into ψ 13 ( x , y ) to check whether f 3 is legal ; and variables f 2 and f 3 are substituted into ψ 32 ( x , y ) to check the legality of f 2 and f 3 . the cooperative decision process in a method for identifying valuable document provided by a second embodiment of the present invention is as follow : s 41 . judging whether f 1 conforms to a real banknote spectral information data standard ; performing s 42 if yes , else performing s 45 ; s 42 . judging whether f 2 conforms to a real banknote magnetic information data standard ; performing s 43 if yes , else performing s 45 ; s 43 . judging whether f 3 conforms to a real banknote material information data standard ; performing s 44 if yes , else performing s 45 ; in the system for identifying valuable document , the valuable document that is transferred into the detection region is easily subject to abnormity , such as incline , misplacement , and fold . for example , as shown in fig4 , assuming that the detecting direction of the magnetic sensor is the y - axis direction , the location of the magnetic security thread is offset when the valuable document is inclined in the detecting region , and thus only a part of the magnetic information , even no magnetic information , can be collected by the magnetic sensor . further , the material sensor for collecting the thickness of the magnetic security thread is fixedly mounted in the specific location , and thus the material information of the area other than the magnetic security thread will be collected by the material sensor if the valuable document in the detecting region is offset . in this way , if the identification is performed directly by the information collected by the sensor , rejecting to identify or false identifying can be caused in the system , and thus the reliability is lowered . according to the method for identifying valuable document provided by the embodiment of the present invention , after the spectral information x 1 , the magnetic information x 2 and the material information x 3 of the valuable document are obtained , the feature value f 2 of the magnetic carrier is extracted from the magnetic information x 2 according to the magnetic information location constraint ψ 12 ( x , y ); and the feature value f 3 of a certain material is extracted from the material information x 3 according to the material information location constraint ψ 13 ( x , y ). even if the valuable document in the detecting region is easily subject to abnormity , such as incline , misplacement , fold , the optimal characteristics of the valuable document in different spatial scales can be extracted accurately , and the reliability of the system for identifying valuable document can be enhanced . in fig6 , a schematic flow chart of a more specific embodiment of the cooperative decision process is shown . in this embodiment , the decision set φ 1 (), φ 2 () and φ 3 () is employed for indicating decision rules of individual identification sub - tasks , which are specifically as follows . φ 1 ()— spectral information reality deciding rule which indicates the match with the real banknote spectral information data standard . if φ 1 ()& lt ; t 1 , the current valuable document is rejected ; and if φ 1 ()≧ t 1 , the current valuable document is received , in which t 1 is the preset threshold range of the spectral information . φ 2 ()— magnetic information reality deciding rule which indicates the match with the real banknote magnetic information data standard . if φ 2 ()& lt ; t 2 , the current valuable document is rejected ; and if φ 2 ()≧ t 2 , the current valuable document is received , in which t 2 is the preset threshold range of the magnetic information . φ 3 ()— material information reality deciding rule which indicates the match with the real banknote material information data standard ; if φ 3 ()& lt ; t 3 , the current valuable document is rejected ; and if φ 3 ()≧ t 3 , the current valuable document is received , in which t 3 , is the preset threshold range of the material information . if the identification results of individual sub - tasks satisfy the cooperative rule ξ ( φ 1 , φ 2 , φ 3 ), the “ reception ” identification is output ; else the “ rejection ” identification is output . the cooperative rule is represented by the following formula : as shown in fig6 , the cooperative decision procedure is as follow . i . rejecting if no legal characteristic is extracted during the cooperative sensing process ; ii . substituting the individual spatial optimal feature values f 1 , f 2 , and f 3 into the cooperative decision rule ξ ( φ 1 , φ 2 , φ 3 ), if the feature values f 1 , f 2 , and f 3 are extracted during the cooperative sensing process ; iii . stopping calculating other attributes to avoid an invalid calculation if any of φ 1 ( f 1 )& lt ; t 1 , φ 2 ( f 2 )& lt ; t 2 , and φ 3 ( f 3 )& lt ; t 3 is satisfied , outputting the “ rejection ” identification , and turning to step v ; iv . substituting φ i ( f i )( i = 1 , 2 , 3 ) into the cooperative decision rule ξ ; outputting the “ reception ” identification if yes ; else outputting the “ rejection ” identification ; and in the method for identifying valuable document provided by the present embodiment , by performing the collaborative decision , according to the local competition principle , different technical characteristics having semantic constraints provide mutually parameters for determining . when any one of the technical characteristics is determined as illegal , the calculation of the other attribute is stopped to avoid the invalid calculation , so as to improve the calculating efficiency . according to the global cooperative principle , mutual determination is performed on different characteristics to improve the reliability and accuracy of the system for identifying . it is to be understood by those skilled in the art that all or a part of the processes in the above example method can be implemented by instructing related hardware with computer program , which can be stored in a computer readable storage medium , and the program when performed can include the procedure of the example of the above individual methods . the storage medium can be magnetic disk , optical disk , read - only memory ( rom ), random access memory ( ram ), or the like . correspondingly , the present invention further provides a system for identifying valuable document to achieve all the steps of the method for identifying valuable document in the above embodiment . reference is made to fig7 , which is a schematic structural diagram of an embodiment of a system for identifying valuable document provided by the present invention . the system for identifying valuable document according to this embodiment includes : a multi - source information detecting module adapted for detecting characteristics of the valuable document in different spatial scales to obtain multi - source information ω ={ x i , x j , . . . , x n }; where x i indicates the characteristic in the i - th space scale , x j indicates the characteristic in the j - th space scale , 1 ≦ i ≦ n , 1 ≦ j ≦ n , and i ≠ j ; semantic constraints on x i and x j are : x i ∩ x j ≠ φ ; or x i ∩ x j ≠ φ and x i & lt ;=& gt ; x j ; a cooperative sensing module adapted for determining a spatial location where x j is located with x i according to the semantic constraints on x i and x j , and obtaining a location constraint ψ ij ( x , y ); extracting a feature value f i from the x i ; and extracting a feature value f j from the x j according to the location constraint ψ ij ( x , y ); and a cooperative decision module adapted for judging whether f i and f j conform to a characteristic standard of the valuable document ; receiving the valuable document if yes ; else rejecting the valuable document . a spectral information detecting device adapted for obtaining spectral information x 1 of the valuable document ; a magnetic information detecting device adapted for obtaining magnetic information x 2 of the valuable document ; and a material information detecting device adapted for obtaining material information x 3 of the valuable document ; the spectral information x 1 is used for representing image information of the valuable document ; the magnetic information x 2 is used for representing magnetic signal information of a magnetic carrier of the valuable document , the spectral information x 1 contains optical imaging information of the magnetic carrier , and semantic constraints on x 1 and x 2 are : x 1 ∩ x 2 ≠ φ and x 1 & lt ;=& gt ; x 2 ; the material information x 3 is used for representing material thickness of the valuable document , the spectral information x 1 contains optical imaging information of various material thickness varying regions of the valuable document , and semantic constraints on x 1 and x 3 are : x 1 ∩ x 3 ≠ φ and x 1 & lt ;=& gt ; x 3 ; and the material information x 3 contains thickness information of the magnetic carrier , and a semantic constraint on x 2 and x 3 is : x 2 ∩ x 3 ≠ φ . a magnetic information location constraint processing unit adapted for determining a location of the magnetic carrier in the image according to the variety state of the image gray value of the spectral information x 1 to obtain a magnetic information location constraint ψ 12 ( x , y ); and the magnetic information location constraint processing unit also adapted for determining a location of magnetic information x 2 according to the material information x 3 to obtain magnetic information location constraint ψ 32 ( x , y ); a material information location constraint processing unit adapted for determining locations of various materials in the image according to the variety state of the transmittance or refractive index in the spectral information x 1 , and obtaining a material information location constraint ψ 13 ( x , y ); a spectral characteristic extracting unit adapted for extracting a feature value f 1 from the spectral information x 1 based on a main component analyzing method ; a magnetic characteristic extracting unit adapted for extracting a feature value f 2 from the magnetic information x 2 based on the magnetic information location constraint ψ 12 ( x , y ); a material characteristic extracting unit adapted for extracting a feature value f 3 from the material information x 3 according to the material information location constraint ψ 13 ( x , y ); and a feature value legality judging unit adapted for checking whether f 2 and f 3 conform to the semantic constraint on x 2 and x 3 , and if yes , determining that f 2 and f 3 are legal and checking whether an associate attribute among f 1 , f 2 and f 3 conform to the valuable document standard ; if the associate attribute among f 1 , f 2 and f 3 conform to the valuable document standard , determining that f 1 is legal and outputting f 1 , f 2 and f 3 ; else outputting an rejection identification . a spectral information realness judging unit adapted for judging whether f 1 conforms to a real banknote spectral information data standard ; a magnetic information realness judging unit adapted for judging whether f 2 conforms to a real banknote magnetic information data standard ; a material information realness judging unit adapted for judging whether f 3 conforms to a real banknote material information data standard ; and a synthetic decision unit adapted for outputting an identification of receiving the valuable document if f 1 , f 2 , and f 3 all conform to the standard ; else outputting an identification of rejecting the valuable document . according to the method and the system for identifying valuable document provided by the embodiment of the present invention , the multi - source information is obtained and the context scene of the multi - source information is established by detecting characteristics of the valuable documents in different spatial scales ; the cooperative process is performed on the multi - source information of the valuable document by using the context constraint on the multi - source information during the identifying process , the covering range of the system is expanded , the information of the detected object is obtained with higher accuracy and reliability , the consistent explanation and description of the detected object is established more accurately , the reliability and the robustness of the system for identifying valuable document is enhanced , and the calculating efficiency of the system is improved . the above are the preferred embodiments of the present invention , it is to be noted that , several modifications and retouches can be made by those skilled in the art without deviating from the principle of the present invention , which are also seemed as within the scope of protection of the present invention .	6
the data storage apparatus now to be described utilises a helical - scan technique for storing data in oblique tracks on a recording tape in a format similar to that used for the storage of pcm audio data according to the datc conference standard ( june 1987 , electronic industries association of japan , tokyo , japan ). the present apparatus is , however , adapted for storing computer data rather than digitised audio information . in conventional manner the apparatus includes a helical - scan tape deck in which magnetic tape passes at a pre - determined angle across a rotary head drum whilst the head drum is rotated . the head drum houses a pair of diametrically opposed read heads and a pair of diametrically opposed write heads at 90 ° to the read heads . in known manner , these heads in use write overlapping oblique tracks across the tape , with the tracks written by one head having a positive azimuth and those written by the other head having a negative azimuth . the tracks are used to store data provided to the apparatus ( main data ) together with items of auxiliary information known as sub - codes which relate , for example , to the logical organisation of the main data , its mapping onto the tape , certain recording parameters ( such as format identity , tape parameters etc .,) and tape usage history . the tracks also contain synchronisation bytes (&# 34 ; sync bytes &# 34 ;) to enable data byte boundaries to be identified , and which are used to generate timing signals for controlling tape movement etc . at the beginning and end of each track are margin regions and there is a preamble block between the beginning margin and the main data area . referring now to fig1 data stored on tape 10 is read by a read - head 12 on the main drum and the signal passes via a rotary transformer 14 to an amplifier 16 and thence to a filter 18 for initial approximate equalisation to a combined pr - 1 target . in practice a differential signal is taken from the read head , rather than making one end grounded . fig1 however , shows just one signal line . the signal is then supplied to an automatic gain control ( agc ) circuit 20 for establishing and stabilising the + 2 and - 2 amplitudes of the three - level signal received from the filter and integrator 18 . the signal from the agc circuit 20 is supplied to a phase lock loop ( pll ) 22 for recovery of a clock signal and is also passed to an adaptive filter referred to herein as a feed forward equaliser ( ffe ) 24 which provides adaptive equalisation to a combined pr - 1 target , so that the overall channel frequency response matches the characteristic of an ideal pr - 1 partial response channel . the filtered signal is supplied to an analogue to digital converter ( adc ) 26 which produces a digitised version of the filtered signal , for supply to a viterbi detector 28 . the output of the viterbi detector 28 is an nrzi - encoded data stream . in other embodiments , the feed forward equaliser 24 may be located after the analogue to digital converter instead of before it . referring now to fig2 the automatic gain control system is shown here in more detail and the two differential signal lines are evident . in operation , the automatic gain control system serves to present a constant signal amplitude to the ffe 24 to within a specified nominal amplitude . for ideal operation , this amplitude must not vary along the length of any one track , or between tracks of the same azimuth . within the bounds of a specified absolute gain error , it does not matter what the signal amplitude is , as long as it remains substantially constant . the variation of the amplitude of the vga 32 during any transient behaviour of the agc control loop must be controlled to within a pre - set relative gain error , which is much smaller than the absolute gain error . the recorded track comprises zones of differing spectral characteristics . the most important of these zones are the preamble regions and the random data regions . for ideal operation downstream of the agc block 20 , the agc system , when taken as a whole , must be immune to changes in frequency spectrum . the relative amplitude tolerance must not be exceeded on either side of the boundary between preamble regions and random data regions . the signal is input on lines 30 to the voltage gain amplifier ( vga ) 32 and the output passes via an output driver 34 to pass onwards to the adc 26 or ffe 28 ( not shown in fig2 ). a feedback loop 36 , comprising an amplifier 38 , a low pass filter 40 and summers 42 is provided for dc offset control . the output from the output driver 34 also passes to a common , simple peak detector 44 which detects peaks in the output signal . the output of the peak detector 44 is supplied together with a target value from a digital to analogue converter ( dac ) 46 to an operational transconductance amplifier ( ota ) 48 ( the vga control voltage ) acts as a comparator . the output of the amplifier 48 ( the vga control voltage ) is supplied to a gain control 50 which supplies the gain control signal to the vga 32 . the gain control loop defined by the peak detect circuit 44 , amplifier 48 and gain control 50 has a relatively fast response time . the output of the amplifier 48 is also supplied to a pre - amplifier 52 and latching comparator 54 , which tracks a measure vga 1 of the vga control voltage at or immediately before the interface between the preamble region and the main data region , and then holds it . a second measure vga 2 of the vga control voltage is taken a number of channel bits later ( i . e . at the beginning of the main data region ). a direct comparison of vga 1 and vga 2 reveals whether the gain of the voltage gain amplifier 32 has increased or decreased in making the transition between the preamble region and the random data region . based on this information , an appropriate counter 60 ; 62 holding the preamble target for the peak detector of the appropriate a or b track is incremented or decremented . adjustment of the preamble target is enabled and disabled via line 64 . a register 65 holds a constant value for the random data target for the peak detector 44 under all conditions . the response of the target control loop is slower than that of the gain control loop . after an initial training period , the preamble target will have adapted to equalise the vga control voltages immediately prior to and after the interface between the preamble region and the main data region , separately for the a and b tracks with respective target values held in counters 60 and 62 , ready for the next track . thus , in this circuit , the differing response of a simple peak detector 44 to preamble and random data is adaptively calibrated out . the preamble target counters 60 and 62 are saturating counters which will not overflow or underflow , and so , if one currently holds its maximum count and is asked to increment , it will maintain its maximum count . similarly , if it holds its minimum count and is asked to decrement , it will maintain the minimum count . the bandwidth or response time of the target control loop may be adjusted between preset values by adjusting the bandwidth mode of the ota amplifier 48 on line 250 . the preamble regions of the a and b tracks exist to enable the clock recovery loop and agc loop to achieve fast lock - up on data of known properties , and as such the regions are short . the bandwidth of the agc system is selected to be high at the start of the preamble region to facilitate this fast lock - up . once coarse amplitude settling has been achieved , medium bandwidth mode may be selected on line 50 until accurate gain amplitude settling has been achieved . then low bandwidth mode is selected prior to the arrival of the random data so that excessive signal modulation by the vga control voltage is avoided . by this arrangement the gain can be controlled sufficiently accurately for the processing downstream . referring now to fig3 after passing through the agc block 20 , the signal is applied to an ffe 24 . the ffe 24 comprises a finite impulse response ( fir ) filter 66 , a bank 68 of coefficient capacitors 69 , and a circuit 70 for adapting the coefficients to reduce the error between the output on line 72 and reference values generated by reference generator 74 . the signal from the agc block 20 is input into the fir filter 66 on a tapped delay line 76 with delays 78 which produce in parallel successively delayed versions of the input . the majority of the circuit elements within the ffe 24 may be implemented in switched capacitor technology . the input at 76 of the fir filter 66 is sampled by charging a capacitor at the clock time determined by the phase lock loop ( pll ) 22 . this charge is then passed from one capacitor to another at the bit times to form a delay line . the output at each stage along the delay line is multiplied at a multiplier 79 by a respective weighting coefficient from the associated coefficient capacitor 69 , and all the weighted outputs are summed by summer 80 to provide the filter digital output on line 72 . the coefficients in register 68 are repeatedly adapted to maximise the signal to noise ratio ( snr ) in the equalised analogue signal on line 72 , at the bit sampling times as defined by the phase lock loop 22 , while the frequency response of the head and tape , or the head - tape contact conditions vary ( either in manufacture or during operation ). in dds - 3 mode the pr - 1 input signal will usually be approximately spectrally shaped by the filter 18 , and will consist of three levels (+ 2 , 0 , - 2 ). in this case , in the adaption block 70 , the coefficients are adapted in a least mean squares ( lms ) algorithm , using an error signal which is the difference between the fir filter output , and the nearest three level nominal signal level , provided by reference generator 74 . the error signal is supplied in parallel to respective multipliers 82 together with the tapped and delayed input signal and this is used to adapt each of the coefficients in the coefficient capacitors 69 . in dds - 3 mode the equalised signal is monitored at 84 to determine whether it is considered to be a + 2 , 0 , or - 2 signal using a reference from reference generator 74 . the reference generator 74 supplies a slicing level signal of ± 1 which the decision block 84 uses to decide whether the signal is meant to be + 2 , 0 , or - 2 . the decision block then causes the reference generator 74 to supply the appropriate + 2 , 0 , - 2 nominal level to the error summer 75 which also receives the filter output signal to obtain an error signal supplied to the multipliers 82 . the rate of adaption may be altered between preset values ( typically 6 ) for the signal ( μsig ) and dc coefficient ( μdc ), at multipliers 86 and 88 . the ffe 24 must not be allowed to adapt in the preamble or margin regions of the a and b data tracks as it would quickly maladapt away from the optimum coefficient set for the random data region . the beginning and end of the main data region are normally predicted by a data recovery state machine , which uses a combination of timing and intelligent decisions based on the structure of the data on the tape and the knowledge of the format being read , relying inter - alia on the preamble detector 23 ( fig1 ). the preamble detector 23 may be of conventional type , typically in the form of a matched filter matched to the pure sinusoidal tone in the preamble region , and supplying a high output when the signal contains the characteristic sinusoidal tone . the output of the preamble detector 23 is supplied to the state machine 21 , which controls the target switching for the a and b preamble and main data targets in the agc 20 , and also selection of the a and b track coefficients in the feed forward equaliser 24 , as to be described below . the spectral characteristics of the a and b tracks differ , and the capacitors 69 store separate coefficients for the a and b tracks , with an appropriate set of coefficients cients being written to the ffe capacitors 69 at the beginning of each track . the apparatus includes a set of coefficient registers ( not shown ) corresponding to the coefficient capacitors 69 . the values held on the capacitors 69 can be processed by an a - d convertor and stored in the coefficient registers . for restoring the coefficients at the start of each track they are processed by a digital time log convertor and then supplied to the capacitors . thus a typical sequence is as follows : 1 . the contents of the a coefficient registers are written to the ffe coefficient capacitors 69 . 2 . the ffe adapts these coefficients over the a track , according to the adaption process implemented by block 70 . 3 . the adapted ffe coefficient capacitor 69 values are digitised and stored in the a coefficient registers , and the contents of the b coefficient registers are written to the ffe coefficient capacitors 69 . 4 . the ffe adapts these coefficients over the b track according , to the adaption process implemented by block 70 . 5 . the adapted ffe coefficient capacitor 69 values for the b track are digitised and stored in the b coefficient registers . it should however be noted that various other routines may be followed . for example , each track may have its own standard set of coefficients which is loaded into the coefficient capacitors at the beginning of the track , irrespective of the adapted coefficient values at the end of the previous track of that azimuth . alternatively , the coefficient capacitors may be loaded with adapted values taken part way through the previous track of that azimuth . the position at which the coefficients are taken may be optimised according to machine requirements to provide the best adaption . for example if the track is curved it may be best to take coefficients from approximately half - way along the track . for any design of machine , the optimal position may be determined empirically and then production machines programmed to take the coefficients at this point . it would be possible to take the a and b coefficients at different points . thus the adapted filter coefficients from the minimum error portions of the read operations for the previous a track may be used as the initial set of coefficients for the next a track and the same process applied to the b track coefficients . to avoid straying into end of track non - linearities , a &# 34 ; snapshot timer &# 34 ; arrangement may be used to pick the coefficient values a predetermined time after the start of the minimum error portion of a read operation . in one embodiment successive sets of coefficients for a given a or b track may be averaged over many tracks and used as the initial set of coefficients for the next a or b track respectively . this has the advantage that it is possible then to adapt quickly within a track , but slowly over multiple tracks . this may be implemented most easily in a digital scheme . in a particular embodiment , in each of the a and b track coefficient sets , there are 13 signal coefficients and one dc coefficient . if the ffe 24 is adapting while it counters a drop out in the read signal , then the ffe coefficients can maladapt into a state from which they cannot recover . to counter this , an automatic restart mechanism is built in . when the centre coefficient falls below a programmable threshold ( e . g . 50 %), the coefficients are all forced to a default set of values , for example a unit step impulse response in which the centre signal coefficient is loaded with the value 1 unit and the remaining signal coefficients are forced to zero . from this starting point , the ffe 24 is allowed to continue adapting . it either maladapts again , and the process is then repeated automatically , or it converges to the correct target if the drop out contains recoverable signal . thus , in the illustrated embodiment , the centre coefficient is supplied to a comparator 90 which compares it with a value of a preset reference from reference generator 91 , and implements a &# 34 ; kick start &# 34 ; routine to force the default set of coefficients if the centre coefficient has fallen below a value which , in practice , is likely to lead to the coefficients stabilising to an incorrect state . in track - crossing modes , where the track on the tape is misaligned with the scan path of the read head , the head output signal cycles between good and bad snr many times per scan and in this situation the arrangement of fig3 can increase the amount of data recovered . it should be noted that a large number of stable , adapted states of the ffe coefficients are possible , but only a small set of these are useful in this scheme . the technique described above tests only the centre coefficient and so cannot detect all possible undesirable states . it will be appreciated however that the technique may be extended to monitor other coefficients in addition to or instead of the centre one and also a different default set of coefficients may be forced . also ranges rather than single limits may be monitored . referring now to fig4 the phase lock loop 22 is required to recover the bit clock from the read - back wave form under a variety of different conditions . essentially , the phase lock loop 22 must acquire frequency and phase lock at the start of a track and then follow the bit frequency variations caused by head - tape velocity jitter , with a tolerable phase error . in broad outline , the phase lock loop 22 comprises a phase detector 92 , a loop filter 94 , and a phase accumulator 96 whose output is used to select the appropriate clock signal from a series thereof available from a system clock tapped delay line 98 . the input signal has been subjected to automatic gain control at agc 20 , so that the nominal levels should be at 2 , 0 , - 2 units . two input comparators 100 , 102 , look for times when the input signal crosses a ± 1 unit ( approximate ) threshold . the times of these threshold crossings are then compared to the current clock time ( system read clock ) to determine the phase error . the phase error is digitally encoded ( i . e . - 4 , - 3 , - 2 , - 1 , 1 , 2 , 3 , 4 depending on the sign and magnitude of the phase error ) and passed to the loop filter 94 . at the loop filter 94 , the ( digital ) phase error is filtered using two multipliers 104 , 106 and an accumulator 108 . in the upper filtering path , the phase error is multiplied by a constant , kp . in the lower filtering path , the phase error is multiplied by a constant ki and the result is accumulated by the ki accumulator 108 . the accumulated ( ki ) result and the direct ( kp ) result are added together at a summer 110 and passed to the phase accumulator 96 . the phase accumulator 96 integrates the output of the loop filter 94 . the upper four bits of the phase accumulator output act as a &# 34 ; pointer &# 34 ; to which of the sixteen delayed versions of the external system clock available at the delay line 98 will be used as the system read clock ( i . e . the clock locked to the input signal ). thus , as the input signal gets out of phase with the system read clock , the phase errors build up to a large value at the output to the loop filter 94 , which causes the phase accumulator 96 to increment , eventually changing the upper four bits of its output , which then selects a delayed version of the system clock which is nearer in phase to the input signal . referring in more detail to the arrangement , to provide for the optimisation of error rate in the final product , the loop filter parameters are programmable ; a second order loop is assumed . in addition , the loop bandwidth is switchable in real time , between two pre - programmed values . this is to make best use of the preamble zones , for acquisition , and still maintain low phase jitter in the data region . the phase lock loop 22 must be able to recover phase lock after signal drop outs that occur during normal replay of a track . the recovered read clock drives the ffe 24 , the adc 26 and the viterbi decoder 28 , and so must be robust . it is preferred for the phased lock loop 22 to be able to operate in dds - 1 / 2 or dd - 3 formats . dds - 1 or 2 format results in a two - level signal , where the bit sampling time is at the eye centre . here , the phase detector 92 typically tests for zero crossings , as this method is simple and relatively insensitive to amplitude variations . in dds - 3 format , reading of the format results in a three - level pr - 1 signal . in this case , the phase detector 92 cannot test for simple zero crossings without disqualifying a large proportion of the incoming signal . a threshold crossing scheme is required ( approximately + 1 , - 1 ). thus , the pll 22 contains a threshold - crossing - time phase detector 92 , whose output is quantised into discrete steps . in dds - 1 or 2 mode , the phase detector responds to zeros crossings , whereas in dds - 3 mode it responds to half nominal signal levels crossings . fig4 shows two ( conceptual ) paths through the phase detector 92 , where the input signal ( from the agc 20 ) is compared at 100 , 102 to each of the half nominal signal level threshold levels ( positive and negative ). the timings of the threshold crossings in the incoming signal are compared at comparator output sampler 116 with eight evenly spaced ( 1 / 8th period shifted ) phases of the output clock ( derived from the 16 tap delay line 98 ) and at the loop phase encoder 118 to the current output phase selection . the quantised phase is then determined directly by loop phase selector 120 from between which of the eight output clock phases the input crossing falls . in dds - 1 or 2 mode the input signal is compared to a single nominal zero level reference , and only the upper ( conceptual ) signal path in fig4 is used . in dds - 3 mode , the half nominal signal thresholds are derived from phase detector threshold reference registers 112 , 114 , which programme dac references to the agc random data target dac references . this arrangement allows the agc targets , and pll phase detector references to be independently optimised . the quantised phase output from the loop phase selector 120 is then fed to a digital loop filter 94 , having a kp ( proportional ) and ki ( integral ) term . for illustration , the phase detector 92 output is shown as a four bit bus ( encoding the state {- 4 , - 3 , - 2 , - 1 , 1 , 2 , 3 , 4 }) and the multiplier 104 , 106 outputs as an eight bit bus . the kp and ki multipliers may typically have the following ranges : the ki multiplier 106 fees the ki accumulator 108 which in this example has a range : the ki accumulator 108 integrates the incoming ki multiplier outputs , but only the most significant eight bits from the accumulator are added at 110 to the eight bits from the kp multiplier 104 , and then fed to the ( least significant ) end of the phase accumulator 96 . thus the loop filter 94 can apply - 252 . . . 252 to the phase accumulator 96 per bit period . the two programmable pairs of kp and ki values are available in registers 105 , 107 , to give the loop a fast or slow time constant , which can be selected by a state machine , in accordance with system requirements . the ki accumulator 108 is arranged to be reprogrammable when the conditions indicate that it has lost or is in danger of losing phase lock . for example , in the preamble region pll frequency may be initialised . during so called &# 34 ; stunt modes &# 34 ; a frequency offset will occur where , for fast forward tape motion , the centre frequency of the a tracks may be displaced lower and the b tracks higher , ( or vice versa for reverse tape motion ). in addition , the ki accumulator 108 may overflow either positively or negatively , indicating that the centre frequency is outside an acceptable range . still further the ki accumulator 108 may be re - centered if the ffe coefficients &# 34 ; kickstart &# 34 ; routine as referred to above has been triggered . this condition indicates that there is a tape drop out or other disturbance to the signal which suggest that the pll is likely to lose its phase lock . under these conditions , the most significant bits of the ki accumulator 108 are loaded with the contents of a variable phase oscillator frequency offset register 109 , which essentially re - centres the frequency to a default value . for example , the frequency may be re - centered to that with which the pll 22 started reading the current track . the digital phase accumulator 96 sums the output of the loop filter 94 and uses the four most significant bits to select an output clock phase from the sixteen tap delay line 98 , which itself is phase locked to the system bit frequency clock . the 16 system clock phases from this delay line 98 are also used by the comparator output sampler 116 in the phase detector 92 to perform the timing of threshold crossings . the number of bits passed from the loop filter accumulator 108 to the phase accumulator 96 determines the maximum sustained frequency error that can be supported . the phase accumulator 96 integrates the loop filter 94 output ( the sum of the kp and ki terms ). the most significant four bits are used to select the phase of the system clock from the tapped delay line to be used as the current clock phase . the phase accumulator output 96 is represented in this example as a twelve bit number , which can be regarded as a simple unsigned up - down counter . thus as positive loop filter outputs are applied , the accumulator counts up until it reaches 4095 and then wraps around to zero . likewise if negative loop filter outputs are applied it counts down until it reaches zero and then wraps around to 4095 . under these conditions , the four most significant bits simply increment from 0 . . . 15 and then wrap around to zero again , to that progressively later phases of the system clock are selected as the output clock . the tapped delay line 98 has sixteen evenly spaced taps and is fed with the system clock . conceptually , the delays are adjusted so that the output of the sixteenth tap is coincident with the next system clock period ( where the system clock frequency is different for the various operating modes of the channel ). a static phase offset value from a register 122 is incorporated at the summer 124 which provides an output to the clock selector 126 which selects the appropriate clock signal from the tapped delay line 98 . there are two contributors to the need for a static phase offset between the phase at which the loop locks , and the clock phase which is applied at the output 128 , which is used by the ffe 24 and the adc 26 . firstly the ffe 24 samples at the bit centres , whereas the pll 22 locks to the bit edges , where the transitions are . secondly , there are unknown circuit path delays between the phase measuring loop and the point at which the clock is used in the ffe . accordingly the phase offset register is programmed with a four bit ( unsigned ) number which is added to the four most significant bits of the phase accumulator to select the clock phase to be passed to the ffe 24 , the adc 26 and the rest of the system , but not the clock phase of the pll internal clock , which is selected by the clock selector 130 . attention is directed to our co - pending application ser . no . 96 , 306 , 941 . 4 ( our reference 395 , 009 ), 96 , 306 , 940 . 6 ( our reference 395007 ) 96 , 306 , 939 . 8 ( our reference 394 , 004 / 396 , 026 ) and filed on even date herewith the contents of which are incorporated herein by reference .	6
component a ) of the compositions according to the invention is selected from known polyurethane thickeners , preferably those containing at least 50 wt . % of hydrophilic segments and at most 10 wt . % of hydrophobic segments . examples include the thickening agents described in u . s . pat . nos . 4 , 079 , 028 , 4 , 155 , 892 , 4 , 499 , 233 and 5 , 023 , 309 ( all of which are herein incorporated by reference ), wherein suitable starter molecules for preparing component b ) are monofunctional and polyfunctional phenols corresponding to formula ii , preferably those corresponding to the following formulas : ## str1 ## wherein m has an average value of 0 . 5 to 2 . 8 and r 1 represents hydrogen or methyl and ## str2 ## wherein has an average value of 0 . 5 to 2 . 8 . component c ) is preferably selected from compounds corresponding to formula i r 2 represents an optionally branched and / or unsaturated aliphatic radical having 6 to 22 , preferably 6 to 16 , more preferably 8 to 16 carbon atoms and most preferably 8 to 12 carbon atoms , a cycloaliphatic radical having 6 to 10 carbon atoms or a heterocyclic radical having 5 to 12 , preferably 5 to 7 ring atoms , as obtained by removing the active hydrogen from a hydroxyl , amino , carboxylic acid or amide group , q 2 represents c 2 - c 4 alkylene oxide units , preferably ethylene oxide units and / or propylene oxide units , t has a value from 1 to 30 , preferably 2 to 20 and more preferably 4 to 14 and u has a value 1 to 10 , preferably 1 to 6 , and more preferably 1 or 2 . component c ) is selected from the alkylation products of suitable , known starter molecules . examples of alkylene oxides being include ethylene oxide , propylene oxide and the isomeric butylene oxides , preferably ethylene oxide or mixtures containing ethylene oxide . it is possible to use different alkylene oxides in succession so as to form different polyether blocks . suitable starter molecules for component c ) include n - hexanol , n - octanol , isooctanol , n - nonanol , isononanol , n - decanol , iso - undecanol , undecanol , n - dodecanol , tetradecanol , hexadecanol and mixtures thereof , such as those in industrial syntheses or from natural products . other examples include cyclohexanol , methylcyclohexanol , hydroxytetraline , n - hexylamine , n - octylamine , n - dodecylamine , dodecanoic acid amide , caprolactam etc . in a preferred embodiment of the present invention component c ) is selected from compounds corresponding to formula iii r 2 represents a linear aliphatic radical having 6 to 16 , preferably 8 to 16 carbon atoms , more preferably 10 to 14 atoms , v + w has a value of 3 to 16 , preferably 8 to 14 , more preferably 8 to 10 . in another preferred embodiment of the present invention component c ) is selected from compounds corresponding to formula iv ## str3 ## wherein q 2 represents ethylene oxide and / or propylene oxide , additives d ), which may optionally be used , include polyhydric alcohols such as propylene glycol , optionally in aqueous mixtures , which may be used , inter alia , to formulate the individual components . in the thickener compositions according to the invention component b ) is preferably present in an amount of 0 . 5 to 80 , more preferably 5 to 50 and most preferably 10 to 30 wt . %, based on the total solids of components a ), b ) and c ). component c ) is preferably present in an amount of 0 . 5 to 80 , more preferably 1 to 50 and most preferably 1 to 40 wt . %, based on the total solids of components a ), b ) and c ). the total amount of the components b ) and c ) is preferably at most 90 wt . %, more preferably at most 70 wt . % and most preferably at most 50 wt . %, based on the total solids of components a ), b ) and c ). total solids means the total weight of the aqueous - free individual components a ), b ) and c ). in addition to components a ), b ) and c ) that are essential to the invention , additives d ) may also be present . the amount of these additives is at most 30 wt . %, based on the total solids of components a ), b ) and c ). the thickener compositions according to the invention may be prepared in a known manner . for example , components b ) and c ) may be added successively while stirring and optionally heating to polyurethane thickener a ), which may optionally dissolved in water . it is also possible to prepare a mixture of components b ) and c ), which is then added to polyurethane thickener a ), which may optionally dissolved in water . in this connection it is possible to use known solvents and / or diluents as component d ) to improve the miscibility of the individual components . another embodiment for preparing the compositions according to the invention is to add components b ) and c ), and optionally water , to polyurethane thickener a ) immediately after its preparation . this method is particularly preferred since it has economic advantages over the other methods . the compositions according to the invention are generally aqueous solutions or dispersions having a solids content of 10 to 90 wt . %, preferably 30 to 70 wt . % and more preferably 40 to 50 wt . %. in determining the solids content the term &# 34 ; solids &# 34 ; means the solids present in components a ), b ), c ) and d ). in the thickener composition the weight ratio of component a ) to the sum of the components b ) and c ) is 3 : 1 to 1 : 3 and the weight ratio of component b ) to component c ) is 2 : 1 to 1 : 8 . the inherent viscosity of the compositions according to the invention can be determined by known methods , for example , in a haake vt 500 rotational viscometer or in a brookfield viscometer . the viscosity may vary within broad limits . however , the flow properties of the compositions are preferably such that they can be poured , pumped , etc ., without any difficulty . the viscosity , measured at 10 . 3s 13 1 and 23 ° c ., is 100 to 60 , 000 mpa . s , preferably 100 to 20 , 000 mpa . s and more preferably 100 to 10 , 000 mpa . s . due to their relatively low inherent viscosity , the compositions according to the invention may also be added in concentrated form for their use according to the invention . it is particularly noteworthy in this connection that the thickening action of the thickeners according to the invention is not reduced , or only insignificantly reduced , despite the comparatively sharply reduced inherent viscosity of these thickeners . a further advantage of the compositions according to the invention is their compatibility with the aqueous compositions to be thickened , e . g ., emulsion paints , which facilitates the incorporation of the thickeners , and at the same time the so - called maturation time of the resulting thickened compositions , i . e ., the time to reach the maximum possible viscosity is significantly reduced . the compositions according to the invention are suitable for thickening aqueous or predominantly aqueous compositions such as paints , printing inks and pigment pastes , filler dispersions and pigment dispersions , textile , leather and paper additives , oil extraction preparations , detergents , adhesives , waxes and polishes , formulations for pharmaceutical and veterinary purposes , plant protection preparations and cosmetic articles . the water itself may also be thickened with the polyurethane thickeners according to the invention so that further additives may be added , or so that the water itself can be added to aqueous preparations . the thickener compositions according to the invention are suitable not only for thickening purely aqueous compositions , but also those compositions that contain organic solvents or other volatile additives , for example , polyhydric alcohols . the aqueous compositions to be thickened may contain known additives such as defoaming agents , flow control agents , fillers and pigments . examples of aqueous compositions that can be thickened according to the invention include aqueous polyacrylate dispersions , aqueous dispersions of copolymers of olefinically unsaturated monomers , aqueous polyvinyl acetate dispersions , aqueous polyurethane dispersions , aqueous polyester dispersions , two - component paints , and especially ready - to - use compositions containing these dispersions . when the compositions according to the invention are used to thicken latex paints , this often leads to improved flow behavior of these compositions and to an improved surface finish of the resulting coatings . a further advantage of the compositions according to the invention is that their use in pigment - containing and / or filler - containing latex paints often leads to an improved wettability of these solids , which in turn facilitates the dispersion process , i . e ., the production of the ready - to - use latex paints . coatings produced using emulsion paints thickened according to the invention are also characterized by an enhanced gloss . the invention is further illustrated but is not intended to be limited by the following examples in which all parts and percentages are by weight unless otherwise specified . to 26 g of the polyurethane thickener a ) were added as component b ) various amounts of a non - ionic surfactant corresponding to the formula ## str4 ## and as component c ) various amounts of a low molecular weight polyether r 9 -- 11 -- eo 6 -- po 2 . 5 prepared from a 1 : 1 mixture of nonyl and undecyl alcohols ( r 9 - 11 ) propylene oxide ( po ) and ethylene oxide ( eo ), and water ( up to 100 g ). the mixtures were stirred for 30 minutes at 70 ° c . ( 500 revs / min ), then for 8 hours at 50 ° c . before they were stored for 8 hours at room temperature . the viscosity of the resultant solutions was measured in a haake vt500 viscometer , measurement body sv din , at 23 ° c . and 10 . 3 s -- 1 . the results are set forth in table 1 . table 1______________________________________composition of the thickener composition ( wt . %, remainder water ) example component component viscosityno . thickener a ) b ) c ) ( mpa · s / 23 ° c .) ______________________________________1 26 19 5 138502 26 14 10 104003 26 9 15 68004 26 7 17 54005 26 4 20 5100______________________________________ the procedure of examples 1 to 5 was repeated with the exception that either one or both of components b ) and c ) was not added . the results are set forth in table 2 and demonstrate that neither component b ) nor component c ) was sufficient by itself to produce products having the low viscosity and storage stability of the thickeners according to the invention . either the viscosity was too high ( example 7 ) or the mixtures were not storage stable ( examples 8 to 10 ). table 2______________________________________composition of the thickener preparation ( wt . %, remainder water ) viscosity warmexample thick - comp - comp - ( mpa · s / storage , no . ener a ) onent b ) onent c ) 23 ° c .) 50 ° c . ______________________________________6 26 -- -- too high . sup . 2 not ( not meas - relevant urable ) 7 26 24 -- 30 , 500 satis - factory8 26 -- 24 4000 separated9 28 -- 22 6300 into two10 30 -- 20 11100 layers at & gt ; 40 c . ______________________________________ 2 ) & gt ; 60 , 000 mpa · s the following examples demonstrate that the thickening action of component a ) was not adversely affected by viscosity - reducing additives b ) and c ). the values fell within the known limits . in each example 2 g of an aqueous solution of a thickener composition were added to 98 g of a commercially available polyacrylate dispersion ( dilexo ra3 , available from condea , hamburg ). in each example the concentration of polyurethane thickener a ) was 2 . 5 wt . %, based on resin solids . the mixtures were stirred for 5 minutes at 2000 revs / min and the resulting homogeneous dispersions were stored for 3 hours at 23 ° c . the viscosity was then measured as described above . the results are set forth in table 3 . table 3______________________________________ thickener composition from thickening actionexample no . example no . viscosity ( mpa · s ) ( 23 ° ______________________________________ c .) 11 7 ( without component c ) 1240012 2 1220013 4 1260014 9 1230015 10 12500______________________________________ the procedure of example 1 was repeated with the exception that different compounds were used as component c ). in all of the examples the ratio of components a ), b ) and c ) was 26 : 12 : 12 ; the remaining 50 parts was water . table 4______________________________________composition of the thickeners and thickening action composition of viscosity thickener actionexample no . component c ) mpa · s ) mpa · s / 23 ° c . ______________________________________16 mixture nonanol / 10900 12700 undecanol 1 : 1 / 7eo17 tridecanol / 4eo / 13800 12400 1 . 5po18 tridecanol / 5eo / 3po 12800 1250019 isooctanol / 6eo / 4po 12900 1245020 isooctanol / 5eo / 5po 10400 1230021 nonanol / undecanol / 10000 12700 1 : 1 / 5eo / 5po22 isodecanol / 6eo / 5po 13100 1240023 2 - ethylhexanol / 26300 12200 8po / 6eo24 ( comp ) 24 parts component 30500 12500 b ), without component c ) ______________________________________ the procedure of examples 1 to 5 was repeated with the exception that a different thickener was used , i . e ., the thickener from example 79 of u . s . pat . no . 4 , 079 , 028 , except that hexamethylene diisocyanate was used instead of toluylene diisocyanate . the results are set forth in table 5 . table 5 also sets forth the thickening action of the compositions according to the invention , which were measured as described in examples 11 to 15 . in all of the examples the ratio of components a ), b ) and c ) was 26 : 12 : 12 ; the remaining 50 parts was water . component b ) was the same as in example 1 . the examples demonstrate that the thickening action of component a ) was not adversely affected by viscosity - reducing additives b ) and c ). table 5______________________________________composition of the thickeners and thickening action thickening composition of viscosity actionexample no . component c ) mpa · s mpa · s / 23 ° c . ______________________________________25 nonanol / undecanol 1 : 1 / 7eo 3300 930026 tridecanol / 4eo / 1 . 5po 3900 910027 tridecanol / 5eo / 3po 3600 900028 isooctanol / 6eo / 4po 3700 940029 isodecanol / 5eo / 5po 3200 925030 nonanol / undecanol 2800 9150 1 : 1 / 5eo / 5po31 isodecanol / 6eo / 5po 5200 910032 2 - ethylhexanol / 8po / 6eo 6900 930033 nonanol / undecanol 2700 9200 1 : 1 / 6eo / 2 . 5po34 ( comp ) 24 parts component b ), 8250 9200 without component c ) ______________________________________ examples 25 - 33 were repeated with the exception that different compounds were used as component b ). in all of the examples the ratio of components a ), b ) and c ) was 26 : 12 : 12 ; the remaining 50 parts was water . component c ) was the same as in example 1 . the examples demonstrate that the thickening action of component a ) was not adversely affected by viscosity - reducing additives b ) and c ). the results are set forth in table 6 . table 6______________________________________composition of the thickeners and thickening actionexample viscosity thickener actionno component b ) mpa · s mpa · s / 23 ° c . ______________________________________35 borchigen dfn 3000 9250 ( aralkylphenol / 14eo ) 36 component b ) from 3500 9300 example 1 , but with 2 . 2 moles of styrene per mole of phenol and 16eo37 nonylphenol / 10eo 2900 9100______________________________________ the procedure of example 1 was repeated with the exception that the following compounds were used as component b ): i . condensation product of 2 . 2 moles of benzyl chloride and 1 mole of hydroxybisphenyl , reacted with 15 moles of eo ii . condensation product of 2 . 8 moles of styrene and 1 mole of phenol , reacted with 17 moles of ethylene oxide iii . condensation product of 2 moles of styrene and 1 mole of phenol , reacted with 12 moles of ethylene oxide iv . condensation product of 2 . 8 moles of vinyl toluene with i mole of phenol , reacted with 20 moles of eo v . condensation product of 1 . 8 moles of styrene with 1 mole of phenol , reacted with 14 moles of eo vi . condensation product of 2 moles of styrene with 1 mole of phenol , reacted with 20 moles of eo and 4 moles of po vii . condensation product of 2 moles of styrene with 1 mole of phenol , reacted with a mixture of 13 moles of eo and 4 moles of po viii . condensation product of 1 . 8 moles of α - methyl styrene and 1 mole of phenol , reacted with 16 moles of eo these compounds were used in the amounts set forth in table 7 to prepare the compositions according to the invention . table 7__________________________________________________________________________ thickener actionexample component b ) component c ) viscosity mpa · s mpa · s / 23 ° __________________________________________________________________________ c . 38 12 parts i 12 parts component c ) from example 1 11100 1230039 12 parts ii 12 parts n - hexanol / 4 eo 12000 1180040 14 parts i 10 parts n - hexanol / 4 eo 13600 1190041 10 parts v 14 parts n - octanol / 4 eo / 2 po 10500 1210042 14 parts vi 10 parts caprolactam / 4 po 14200 1240043 12 parts iv 12 parts n - nonanol / 4 . 5 eo / 2 . 5 po 12200 1250044 20 parts i 4 parts n - hexanol / 3 eo / 1 po 21600 1270045 13 parts iii 11 parts n - octanol / 4 eo 12900 1220046 12 parts vii 12 parts n - hexanol / 5 eo 11800 1250047 12 parts viii 12 parts n - dodecanol / 5 eo / 2 po 13400 1270048 14 parts i 10 parts n - hexadecanol / 8 eo / 3 po 15100 1240049 24 parts of 30500 12500 ( comparison ) component b ) from example 1__________________________________________________________________________ although the invention has been described in detail in the foregoing for the purpose of illustration , it is to be understood that such detail is solely for that purpose and that variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention except as it may be limited by the claims .	2
the present invention will be explained and illustrated below in association with several embodiments to be described later , in particular , the cross groove joint of eight ball type . however , it is noted that the present invention is not limited to the eight ball type joint , but is applicable to the cross groove joint of any ball type , for example , having six , eight , ten , or more balls . referring to fig5 - 10 of the drawings , the cross groove type constant velocity joints of the present invention are described herein in details with several exemplary or preferred embodiments thereof . however , the following descriptions of such embodiments are intended primarily for illustrating the principles and exemplary constructions of the constant velocity joints of the present invention , and the present invention is not specifically limited to these exemplary embodiments . thus , one skilled in the art can appreciate or recognize that various modifications and substitutions can be made thereto without departing from the spirit and scope of the present invention . throughout the description of the present application , common or similar elements are to be referred with the same or similar reference characters for simplicity purposes . with reference to fig5 , one preferred embodiment of the present invention is described below in details . in this embodiment , the cross groove joint includes an outer joint member 31 having a plurality of ( i . e ., eight ) inwardly facing outer ball grooves 31 a - 31 h , and an inner joint member 33 placed inside the outer joint member 31 and having a plurality of ( i . e ., eight ) outwardly facing inner ball grooves 33 a - 33 h . the corresponding outer and inner ball grooves 31 a - 31 h and 33 a - 33 h face each other in pairs with each of the eight balls ( not shown in fig5 ) retained between each pair for torque transfer between the inner and outer joint members 31 and 33 . the cross groove joint further includes a cage ( not shown in fig5 ) containing eight cage windows ( not shown in fig5 ) for retaining the balls therein and to transmit the rotational torque between the outer and inner joint members as is similar to that shown in fig4 . however , unlike the conventional cross groove joint as shown in fig4 , having the grooves alternately disposed in opposite directions with the same inclination angle δ , the ball grooves 31 a - 31 h and 33 a - 33 h of the outer and inner joint members have composite or complex shapes as shown in fig5 ( b ) and 5 ( c ). more specifically , in the present embodiment the shapes of the ball grooves are differentiated in two groups as illustrated in fig5 . in particular , a first group of grooves , namely , four ball grooves 31 a , 31 c , 31 e , 31 g of the outer joint member 31 ( displaced to each other with the phase angle of 90 degree ) and four ball grooves 33 a , 33 c , 33 e , 33 g of the inner joint member 33 ( displaced to each other with the phase angle of 90 degree ) each have a skewed groove with a skew angle δ 1 throughout the length of the groove , but alternately arranged in opposite directions . on the other hand , a second group of grooves , namely , the remaining four ball grooves 31 b , 31 d , 31 f , 31 h of the outer joint member 31 and the remaining four ball grooves 33 b , 33 d , 33 f , 33 h of the inner joint member 33 each have a composite groove shape which consists of a straight groove segment st from the groove center lc to one end of groove and a skewed groove segment sk from the groove center lc to the other end of groove , each with a skew angle δ 2 but arranged alternately in opposite directions . here , the skew angle δ 2 may be selected to have an angle the same as or less than δ 1 which is in turn selectable depending on the desired design of the joint system , and generally , in the range between 5 degree and 20 degree . with such a composite groove configuration , combined with a skewed groove and a groove having the straight groove segments st and the skewed groove segments sk with appropriate skew angle δ , the minimum thickness ( the least effective thickness ) ll of the outer and inner joint members 31 and 33 can be increased than that of the conventional cross groove joint as shown in fig4 . as a result , the ball movements in the cross groove joint and the size of cage windows can be reduced , while enlarging the thickness of cage webs as compared to that shown in fig4 . accordingly , the cross groove joint of the present embodiment can enhance the mechanical strength and durability of the joint as compared to the conventional joint . with reference to fig6 , another preferred embodiment of the present invention is described below in details . the basic structure of this joint is similar to that described shown in association with fig5 above , and detailed descriptions regarding to the common elements and structure of this embodiment are to be omitted herein for simplicity purposes , and to be referred above . as is similar to the previous embodiment of fig5 , and unlike the conventional cross groove joint as shown in fig4 ( which has the grooves alternately disposed in opposite directions with the same inclination angle δ ), the ball grooves 31 a - 31 h and 33 a - 33 h of the outer and inner joint members of the present embodiment have composite or complex shapes , in different pattern , as shown in fig6 ( b ) and 6 ( c ). more specifically , in this embodiment as illustrated in fig6 , a first group of grooves , namely , four ball grooves 31 a , 31 c , 31 e , 31 g of the outer joint member 31 ( displaced to each other with the phase angle of 90 degree ) and four ball grooves 33 a , 33 c , 33 e , 33 g of the inner joint member 33 ( displaced to each other with the phase angle of 90 degree ) each have a skewed groove with a skew angle δ 1 throughout the length of the groove , but alternately arranged in opposite directions . on the other hand , a second group of grooves , namely , the remaining four ball grooves 31 b , 31 d , 31 f , 31 h of the outer joint member 31 and the remaining four ball grooves 33 b , 33 d , 33 f , 33 h of the inner joint member 33 each have a composite groove shape which consists of a straight groove segment st at the central area relative to the groove center lc and skewed groove segments sk 1 and sk 2 at the both end regions of the groove , each with a skew angle δ 2 but arranged alternately in opposite directions as shown . here , the skew angle δ 2 may be selected to have an angle the same as or less than δ 1 which is in turn selectable depending on the desired design of the joint system , and generally , in the range between 5 degree and 20 degree . with such a composite groove configuration as shown , combined with a first group of grooves of alternately - arranged skewed groove and a second group of grooves composed of the straight groove segments st and the skewed groove segments sk at either or both ends of the groove , the minimum thickness ( least effective thickness ) ll of the outer and inner joint members 31 and 33 can be increased to that of the conventional cross groove joint as shown in fig4 . as a result , the ball movements in the cross groove joint and the size of cage windows can be reduced , while enlarging the thickness of cage webs as compared to that shown in fig4 . accordingly , the cross groove joint of the present embodiment can enhance the mechanical strength and durability of the joint as compared to the conventional joint . with reference to fig7 , another preferred embodiment of the present invention is described below in details . the basic structure of this joint is similar to that described shown in association with fig5 above , and detailed descriptions regarding to the common elements and structure of this embodiment are to be omitted herein for simplicity purposes , and to be referred above . as is similar to the previous embodiments of fig5 - 6 , and unlike the conventional cross groove joint as shown in fig4 ( which has the grooves alternately disposed in opposite directions with the same inclination angle δ ), the ball grooves 31 a - 31 h and 33 a - 33 h of the outer and inner joint members of the present embodiment have composite or complex shapes , in different pattern , as shown in fig7 ( b ) and 7 ( c ). more specifically , in this embodiment as illustrated in fig7 , a first group of grooves , namely , four ball grooves 31 a , 31 c , 31 e , 31 g of the outer joint member 31 ( displaced to each other with the phase angle of 90 degree ) and four ball grooves 33 a , 33 c , 33 e , 33 g of the inner joint member 33 ( displaced to each other with the phase angle of 90 degree ) each have a skewed groove with a skew angle δ 1 throughout the length of the groove , but alternately arranged in opposite directions . on the other hand , a second group of grooves , namely , the remaining four ball grooves 31 b , 31 d , 31 f , 31 h of the outer joint member 31 and the remaining four ball grooves 33 b , 33 d , 33 f , 33 h of the inner joint member 33 each have a curved groove with a skew angle δ 2 with a radius r centered on the normal line relatively to the skew angle line at the center , but arranged alternately in opposite directions as shown . here , the skew angle δ 2 may be selected to have an angle the same as or less than δ 1 which is in turn selectable depending on the desired design of the joint system , and generally , in the range between 5 degree and 20 degree . with such a composite groove configuration as shown , combined with a first group of grooves of alternately - arranged skewed grooves and a second group of grooves of alternately - arranged curved grooves , the minimum thickness ( least effective thickness ) ll of the outer and inner joint members 31 and 33 can be increased to that of the conventional cross groove joint as shown in fig4 . as a result , the ball movements in the cross groove joint and the size of cage windows can be reduced , while enlarging the thickness of cage webs as compared to that shown in fig4 . accordingly , the cross groove joint of the present embodiment can enhance the mechanical strength and durability of the joint as compared to the conventional joint . with reference to fig8 , another preferred embodiment of the present invention is described below in details . the basic structure of this joint is similar to that described shown in association with fig5 above , and detailed descriptions regarding to the common elements and structure of this embodiment are to be omitted herein for simplicity purposes , and to be referred above . as is similar to the previous embodiments of fig5 - 7 , and unlike the conventional cross groove joint as shown in fig4 ( which has the grooves alternately disposed in opposite directions with the same inclination angle δ ), the ball grooves 31 a - 31 h and 33 a - 33 h of the outer and inner joint members of the present embodiment have composite or complex shapes , in different pattern , as shown in fig8 ( b ) and 8 ( c ). more specifically , in this embodiment as illustrated in fig8 , a first group of grooves , namely , four ball grooves 31 a , 31 c , 31 e , 31 g of the outer joint member 31 ( displaced to each other with the phase angle of 90 degree ) and four ball grooves 33 a , 33 c , 33 e , 33 g of the inner joint member 33 ( displaced to each other with the phase angle of 90 degree ) each have a linear or straight groove with no skew angle . on the other hand , a second group of grooves , namely , the remaining four ball grooves 31 b , 31 d , 31 f , 31 h of the outer joint member 31 and the remaining four ball grooves 33 b , 33 d , 33 f , 33 h of the inner joint member 33 each have a curved groove with a skew angle δ with a radius r centered on the normal line relatively to the skew angle line at the center , which are arranged alternately in opposite directions as shown . here , the skew angle δ may be selected depending on the desired design of the joint system , and generally , in the range between 5 degree and 20 degree . with such a composite groove configuration as shown , combined with a first group of grooves of linear grooves and a second group of grooves of alternately - arranged curved grooves , the minimum thickness ( least effective thickness ) ll of the outer and inner joint members 31 and 33 can be increased to that of the conventional cross groove joint as shown in fig4 . as a result , the ball movements in the cross groove joint and the size of cage windows can be reduced , while enlarging the thickness of cage webs as compared to that shown in fig4 . accordingly , the cross groove joint of the present embodiment can enhance the mechanical strength and durability of the joint as compared to the conventional joint . with reference to fig9 , another preferred embodiment of the present invention is described below in details . the basic structure of this joint is similar to that described shown in association with fig5 above , and detailed descriptions regarding to the common elements and structure of this embodiment are to be omitted herein for simplicity purposes , and to be referred above . as is similar to the previous embodiments of fig5 - 8 , and unlike the conventional cross groove joint as shown in fig4 ( which has the grooves alternately disposed in opposite directions with the same inclination angle δ ), the ball grooves 31 a - 31 h and 33 a - 33 h of the outer and inner joint members of the present embodiment have composite or complex shapes , in different pattern , as shown in fig9 ( b ) and 9 ( c ). more specifically , in this embodiment as illustrated in fig9 , four ball grooves 31 a , 31 c , 31 e , 31 g of the outer joint member 31 ( displaced to each other with the phase angle of 90 degree ) and four ball grooves 33 a , 33 c , 33 e , 33 g of the inner joint member 33 ( displaced to each other with the phase angle of 90 degree ) each have a curved groove with a skew angle δ with a radius r centered on the normal line relatively to the skew angle line at the center . on the other hand , the remaining four ball grooves 31 b , 31 d , 31 f , 31 h of the outer joint member 31 and the remaining four ball grooves 33 b , 33 d , 33 f , 33 h of the inner joint member 33 each have a simlarly curved groove with the skew angle δ with a radius r centered on the normal line relatively to the skew angle line at the center , but arranged in direction opposite to the first group of grooves described above . here , the degree of the skew angle δ is selectable depending on the desired design of the joint system , generally , in the range between 5 degree and 20 degree . with such a composite groove configuration , having the oppositely oriented curved grooves in alternate arrangement and with appropriate skew angle δ , the minimum thickness ( least effective thickness ) ll of the outer and inner joint members 31 and 33 can be increased to that of the conventional cross groove joint as shown in fig4 . as a result , the ball movements in the cross groove joint and the size of cage windows can be reduced , while enlarging the thickness of cage webs as compared to that shown in fig4 . accordingly , the cross groove joint of the present embodiment can enhance the mechanical strength and durability of the joint as compared to the conventional joint . with reference to fig1 , another preferred embodiment of the present invention is described below in details . the basic structure of this joint is similar to that described and shown in association with fig5 above , and detailed descriptions regarding to the common elements and structure of this embodiment are to be omitted herein for simplicity purposes , and to be referred above . as is similar to the previous embodiment of fig5 - 9 and unlike the conventional cross groove joint as shown in fig4 ( which has the grooves alternately disposed in opposite directions with the same inclination angle δ ), the ball grooves 31 a - 31 h and 33 a - 33 h of the outer and inner joint members of the present embodiment have composite or complex shapes , in different pattern , as shown in fig1 ( b ) and 10 ( c ). more specifically , in this embodiment , a first group of grooves , namely , four ball grooves 31 a , 31 c , 31 e , 31 g of the outer joint member 31 ( displaced to each other with the phase angle of 90 degree ) and four ball grooves 33 a , 33 c , 33 e , 33 g of the inner joint member 33 ( displaced to each other with the phase angle of 90 degree ) each have a composite groove shape which consists of a straight groove segment st from the groove center lc to one end of groove and a skewed groove segment sk from the groove center lc to the other end of groove , each with a skew or inclination angle δ but arranged alternately in opposite directions . on the other hand , a second group of grooves , namely , the remaining four ball grooves 31 b , 31 d , 31 f , 31 h of the outer joint member 31 and the remaining four ball grooves 33 b , 33 d , 33 f , 33 h of the inner joint member 33 each have a composite groove shape having a straight portion st and a skewed portion sk with the same skew angle δ , but arranged in opposite directions with respect to the groove center lc relatively to the above - identified first group of grooves . here , the degree of the skew angle δ is to be selected depending on the desired design of the joint system , generally , in the range between 5 degree and 20 degree . with such a composite groove configuration having the straight groove segments st and the skewed groove segments sk with appropriate skew angle δ , the minimum thickness ( the least effective thickness ) ll of the outer and inner joint members 31 and 33 can be increased to that of the conventional cross groove joint as shown in fig4 . as a result , the ball movements in the cross groove joint and the size of cage windows can be reduced , while enlarging the thickness of cage webs as compared to that shown in fig4 . accordingly , the cross groove joint of the present embodiment can enhance the mechanical strength and durability of the joint as compared to the conventional joint . as described above in connection with several exemplary embodiments thereof , in order to provide an enhanced strength to the cage web and the cross groove joint , the present invention provides a cross groove joint including an outer joint member with a plurality of inwardly facing ball grooves and an inner joint member with a plurality of outwardly facing ball grooves , in which the shapes of the ball grooves of the outer and inner joint member are configured to increase the thickness and also the mechanical strength of the cage web as compared to the conventional cross groove joint , in particular , by applying composite and / or non - linear groove patterns to the ball grooves in various different patterns as illustrated with several embodiments as examples . the above disclosed embodiments of the invention are representatives of a presently preferred form of the invention , but are intended to be illustrative rather than definitive thereof . accordingly , those skilled in the art will appreciate or recognize that various modifications and substitutions can be made thereto without departing from the spirit and scope of the present invention as set forth in the appended claims .	5
a first embodiment of the invention is described with respect to fig1 in which a sensor device 5 comprises a source piece 10 and a sensor piece 15 . the source piece 10 has a permanent magnet 20 and a source field shaper 25 . the source field shaper 25 comprises a non - corrosive , soft magnetically permeable material , such as iron . because the permanent magnet 20 exerts a magnetic field in all directions , the source field shaper 25 directs the magnetic field in the horizontal direction away from the source field shaper 25 . as shown , the sensor piece 15 comprises sensors 30 and a sensor field shaper 35 . the sensor field shaper 35 also comprises a non - corrosive , soft magnetically permeable material , again such as iron . the sensor field shaper 35 shields the sensors 30 from the effects of external magnetic fields such as the earth &# 39 ; s magnetic field . a motor 40 is attached to the source piece 10 by a shaft 45 . in the embodiment illustrated in fig1 the source piece 10 is advantageously e - shaped , with three separate horizontal sections and a vertical section . the center horizontal section is the permanent magnet 20 . the upper and lower horizontal sections and the vertical section comprise the source field shaper 25 . the source piece 10 is horizontally rotatable 360 degrees by the motor 40 and shaft 45 . the shaft 45 that connects the motor 40 to the source piece 10 is embedded into the vertical section of the source piece 10 and runs lengthwise down the vertical section . the motor 40 horizontally rotates the source piece 10 about the vertical axis of the shaft 45 , thereby creating the alternating magnetic field . with further reference to fig1 the sensor piece 15 is also advantageously e - shaped , with three separate horizontal sections and a vertical section . the upper and lower horizontal sections contain the sensors 30 . the vertical section and the three horizontal sections comprise the sensor field shaper 35 . a variety of sensor technologies known in the art may be used for the sensors 30 but preferably hall effect sensors are used . hall effect sensors are well known in the art . examples of available hall effect sensors include honeywell ss 495a and micronas hal800 sensors . in the alternative , anisotropic magnetoresistive sensors or giant magnetoresistive sensors could be used for sensor technology instead of hall effect devices . the center horizontal section serves as a return for the magnetic field , which helps shape the magnetic field . in addition to containing the sensors 30 , the upper and lower horizontal sections also serve as conduit points for the return of the magnetic field thereby further helping shape the magnetic field . the invention is not limited to an e - shaped sensor piece 15 as illustrated on fig1 . in another embodiment of the invention ( not illustrated ), the sensor field shaper 35 may have a vertical section and upper and lower horizontal sections but without a center horizontal section . in a further embodiment , the sensor piece 15 is separated into an upper and lower section , each section advantageously u - shaped and comprising a sensor field shaper 35 and a sensor 30 . the sensor field shaper 35 of the upper section of the sensor piece 15 has a vertical section and upper and lower horizontal sections , with either the upper or lower horizontal sections containing the sensor 30 . alternatively , both the upper and lower horizontal sections may contain a sensor 30 . the sensor field shaper 35 of the lower section of the sensor piece 15 also has a vertical section and upper and lower horizontal sections , with either the upper or lower horizontal sections containing the sensor 30 . alternatively , both the upper and lower horizontal sections may contain a sensor 30 . as further illustrated on fig1 an evaluation board 50 is connected to the sensors 30 by evaluation board connectors 55 . the evaluation board 50 comprises an analog to digital converter . examples of available analog to digital converters include the analog devices ad7730 converter . a battery box 60 is connected to the evaluation board 50 . examples of available battery boxes 60 include the orga type cca battery box . fig2 is a further view of the embodiment shown on fig1 . fig2 illustrates a housing 65 that secures the source piece 10 , sensor piece 15 , and motor 40 to a nonmagnetic cylindrical spool 110 . the sensor piece 15 is attached to the housing 65 by bolts , screws , or other suitable fasteners . the source piece 10 is attached to the housing 65 by the shaft 45 and motor 40 . the housing 65 wraps around the outside surface of the nonmagnetic cylindrical spool 110 and is firmly secured to the outside surface of the nonmagnetic cylindrical spool 110 by velcro , hooks and receivers , or other suitable fasteners . the source piece 10 and sensor piece 15 are oriented within the housing 65 so that when the housing 65 is secured to the nonmagnetic cylindrical spool 110 , the source piece 10 and sensor piece 15 are secured on opposite sides of the nonmagnetic cylindrical spool 110 . when the housing 65 secures the sensor piece 15 to the nonmagnetic cylindrical spool 110 , the three horizontal sections of the sensor piece 15 are pressed to the nonmagnetic cylindrical spool 110 . the source piece 10 is secured to the nonmagnetic cylindrical spool 110 but is not in physical contact with the nonmagnetic cylindrical spool 110 . the source piece 10 is horizontally rotatable about the vertical axis of the shaft 45 by the motor 40 , and so should be disposed close to , but not touching the nonmagnetic cylindrical spool 110 . the source piece 10 is connected to the motor 40 by the shaft 45 and oriented within the housing 65 so that a small space exists between the source piece 10 and the nonmagnetic cylindrical spool 110 . the motor 40 is located within the housing 65 . the motor 40 is preferably enclosed within a motor housing 85 , which motor housing 85 is attached to the housing 65 . the motor housing 85 may be attached to the housing 65 by bolts , screws , or other suitable fasteners . advantageously , the motor 40 may be a pneumatic motor . examples of available pneumatic motors include the cooper tools 21m1340 - 40 motor . an air supply 75 provides air to power the motor 40 through an air supply line 80 . an opening in the housing 65 allows the air supply line 80 access to the motor 40 . as shown , the shaft 45 connects the motor 40 to the source piece 10 . alternatively , the motor 40 may be an electric motor . examples of available electric motors include the mcmaster - carr 6331k31 motor . it will be appreciated that the invention is not limited to one sensor piece 15 secured to an opposite side of the nonmagnetic cylindrical spool 110 from the source piece 10 , as illustrated on fig2 , 5 , 8 , 9 , 10 , 11 , and 12 . in alternative embodiments ( not illustrated ), the invention may comprise more than one sensor piece 15 , with each sensor piece 15 advantageously disposed on the opposite side of the nonmagnetic cylindrical spool 110 from the source piece 10 . in these alternative embodiments , the invention may also comprise one or more of these sensor pieces 15 joined together . fig3 is a further view of the embodiment depicted in fig1 showing a nonmagnetic cylindrical spool 110 with a tubing string 95 and tool joint 90 . as shown , the nonmagnetic cylindrical spool 110 is a section of a riser spool 115 . the nonmagnetic cylindrical spool 110 comprises a nonmagnetic material , preferably nonmagnetic stainless steel . the source piece 10 is on the opposite side of the nonmagnetic cylindrical spool 110 from the sensor piece 15 . the tubing string 95 and tool joint 90 are movable in or out of the nonmagnetic cylindrical spool 110 . it will be seen on fig3 that the source piece 10 creates an alternating magnetic field across the nonmagnetic cylindrical spool 110 by the motor 40 rotating the source piece 10 horizontally 360 degrees about the vertical axis of the shaft 45 . when the tubing string 95 is stripped through the nonmagnetic cylindrical spool 110 , the sensors 30 detect the presence of the tubing string 95 . when present , the tubing string 95 will cause a decrease in the magnetic field across the nonmagnetic cylindrical spool 110 created by the rotatable source piece 10 . upon detection of this decrease in the magnetic field , the sensors 30 notify the evaluation board 50 ( via the evaluation board connectors 55 ) of such detected decrease . the evaluation board 50 advantageously converts this information into a digital form . a remotely located computer 51 may then receive and process the information from the evaluation board 50 . with further reference to fig3 the presence of a tool joint 90 in the nonmagnetic cylindrical spool 110 will cause the sensors 30 to detect an even larger decrease in the magnetic field created by the rotating source piece 10 . the evaluation board 50 receives and processes this information from the sensors 30 and then transmits this information on to the computer 51 . the computer 51 on fig3 may optionally use threshold detection and waveform analysis techniques to differentiate between signals so as to detect the presence of tubing strings 95 or tool joints 90 . by threshold detection , the computer 51 evaluates the readings transmitted by the sensors 30 and compares them to predetermined values expected for the presence of tubing strings 95 and tool joints 90 and to predetermined values when no tubing strings 95 or tool joints 90 are present . such comparisons are selected to indicate to the computer 51 whether a tool joint 90 or tubing string 95 is present , or the initial presence of the tubing string 95 in the nonmagnetic cylindrical spool 110 , or when the last of the tubing string 95 exits the nonmagnetic cylindrical spool 110 . alternatively , the computer 51 may also evaluate the sensor 30 information by waveform analysis . in normal mode ( i . e ., magnet 20 rotating without tool joints 90 or tubing strings 95 present ), the magnetic field creates a characteristic waveform that is known and identified by the computer 51 . the change in the magnetic field , and thereby change in waveform , by the presence of a tubing string 95 is known and identified by the computer 51 . in addition , the change in the magnetic field , and thereby further change in waveform , by the presence of the tool joint 90 is also known and identified by the computer 51 . these waveform changes are recognized by the computer 51 again with reference to predetermined changes in waveforms expected during the presence of tubing strings 95 , tool joints 90 , or when the tubing string 95 initially enters the nonmagnetic cylindrical spool 110 , or when the last of the tubing string 95 exits the nonmagnetic cylindrical spool 110 . fig4 illustrates an exemplary waveform analysis of the alternating magnetic field by the computer 51 during expected normal operation of an embodiment such as is illustrated on fig3 . the y axis represents the sensor readings in counts . the x axis represents 0 . 028 seconds / sample reading . the readings in counts represent the presence of a jointed tubing string 95 with connecting tool joints 90 that are pulled through a sensor device 5 , as shown on fig3 . as shown , the tubing string 95 is identified when entering the sensor device 5 , registering a reading of over 3 , 200 , 000 counts . as the tubing string 95 is pulled through the sensor device 5 , sensors 30 register these readings with the evaluation board 50 and then to the computer 51 on fig3 which registers these readings on fig4 as waveforms . it will be understood that the computer 51 on fig3 will compare the registered waveform with predetermined changes in waveforms that are expected for the presence of tubing strings 95 and tool joints 90 . with reference to the predetermined changes in waveforms , the computer 51 identifies these readings as a characteristic tubing string waveform 120 , which is illustrated on fig4 . as a tool joint 90 is pulled through the sensor device 5 , the sensors 30 register the decrease in counts from the magnetic reading , and the computer 51 registers these readings in waveform . again from predetermined changes in waveforms , the computer 51 recognizes this waveform as a characteristic tool joint waveform 125 , which is illustrated on fig4 . fig5 is a further view of the embodiment depicted in fig1 showing a nonmagnetic cylindrical spool 110 and blow out preventers ( bops ) 100 and 105 . as shown , an upper bop 100 and a lower bop 105 are connected to a riser spool 115 . the nonmagnetic cylindrical spool 110 is a section of the riser spool 115 . the nonmagnetic cylindrical spool 110 comprises a nonmagnetic material , preferably nonmagnetic stainless steel . the nonmagnetic cylindrical spool 110 separates the upper bop 100 from the lower bop 105 . the source piece 10 is on the opposite side of the nonmagnetic cylindrical spool 110 from the sensor piece 15 . the tubing string 95 and connecting tool joints 90 are moveable in or out of the riser spool 115 . it will be seen on fig5 that the source piece 10 creates an alternating magnetic field across the nonmagnetic cylindrical spool 110 by the motor 40 rotating the source piece 10 horizontally 360 degrees about the vertical axis of the shaft 45 . when the tubing string 95 is stripped through the nonmagnetic cylindrical spool 110 , the sensors 30 detect the presence of the tubing string 95 . when present , the tubing string 95 will tend to cause a decrease in the magnetic field across the nonmagnetic cylindrical spool 110 created by the rotating source piece 10 . upon detection of this decrease in the magnetic field , the sensors 30 notify the evaluation board 50 ( via the evaluation board connectors 55 ) of such detected decrease . the evaluation board 50 processes this information and transmits it to the computer 51 . with further reference to fig5 the evaluation board 50 and battery box 60 are located adjacent to the sensor piece 15 . alternatively , the evaluation board 50 and battery box 60 are remotely located , preferably on a structure supported by the christmas tree . the computer 51 is shown located remotely from the sensor piece 15 . in this embodiment , the computer 51 is also connected to an audio and / or visual alarm by a cable . the audio and / or visual alarm will preferably be located near an operator . this audio and / or visual alarm indicates to the operator the presence of the tool joint 90 in the nonmagnetic cylindrical spool 110 . upon this alarm , the operator may halt the movement of the tubing string 95 and open and close the appropriate bops . this audio and / or visual alarm may also notify the operator of the presence of the tubing string 95 , or when the tubing string 95 initially enters the nonmagnetic cylindrical spool 110 , or when the last of the tubing string 95 exits the nonmagnetic cylindrical spool 110 . the following describes an exemplary application of the present invention as embodied and illustrated on fig5 . in operation , as the tubing string 95 is stripped from the well bore , it can be seen on fig5 that the tubing string 95 is pulled upwards through the riser spool 115 . the lower bop 105 is open , and the upper bop 100 is closed . both the upper bop 100 and the lower bop 105 are openable and closable around the tubing string 95 , separating the high pressure of the well bore from the lower atmospheric pressure . the sections of the tubing string 95 are connected by tool joints 90 . as the motor 40 rotates the permanent magnet 20 , the permanent magnet 20 creates an alternating magnetic field across the nonmagnetic cylindrical spool 110 . the sensors 30 measure the alternating magnetic field created by the permanent magnet 20 and transmit a signal to the evaluation board 50 , which advantageously converts the signal into digital form . the evaluation board 50 then transmits this information to the computer 51 , which continually monitors and processes these sensor 30 readings . when a tubing string 95 enters the nonmagnetic cylindrical spool 110 during stripping , the lower bop 105 remains open , and the upper bop 100 remains closed . the sensors 30 transmit a signal to the evaluation board 50 indicating presence of the tubing string 90 in the nonmagnetic cylindrical spool 110 . the evaluation board 50 processes this signal and transmits this signal to the computer 51 , which monitors and further processes the information . as a tool joint 90 enters the nonmagnetic cylindrical spool 110 , the lower bop 105 remains open , and the upper bop 100 remains closed . the sensors 30 will identify the lower reading of the magnetic field caused by the tool joint 90 . the sensors 30 will transmit the reading to the evaluation board 50 . the evaluation board 50 will process this reading and transmit the reading to the computer 51 , which will monitor and further process the reading . by analysis using techniques such as threshold detection or waveform analysis , the computer 51 will identify the presence of the tool joint 90 and notify the operator of the tool joint &# 39 ; s 90 presence by audio and / or visual alarm . notified of the presence of the tool joint 90 in the nonmagnetic cylindrical spool 110 of fig5 the operator will temporarily halt the stripping of the tubing string 95 . with the upper bop 100 remaining closed , the lower bop 105 is then closed , and the nonmagnetic cylindrical spool 110 is depressurized to atmospheric pressure . after the nonmagnetic cylindrical spool 110 is depressurized , the lower bop 105 remains closed , and the upper bop 100 is opened . the stripping of the tubing string 95 is then resumed . when the tool joint 90 exits the upper bop 100 , the sensors 30 will transmit to the evaluation board 50 the increased magnetic readings . the evaluation board 50 will process this information and then transmit the information to the computer 51 . the computer 51 will identify that no tool joint 90 is within the nonmagnetic cylindrical spool 110 . the computer 51 will then notify the operator by audio and / or visual alarm that no tool joint 90 is present in the nonmagnetic cylindrical spool 110 . the operator will then temporarily halt the movement of the tubing string 95 . with the lower bop 105 remaining closed , the upper bop 100 will be closed , and the nonmagnetic cylindrical spool 110 will be re - pressurized to the pressure within the riser spool 115 . after re - pressurization , the upper bop 100 will remain closed , and the lower bop 105 will be opened , followed by resumption of the stripping of the tubing string 95 . when a tubing string 95 is moved into the well instead of stripped from the well , the same procedures apply in clearing the tool joints 90 of the bops but in converse order . fig6 is a further embodiment of the invention showing a sensor device 5 comprising a source piece 10 , sensor piece 15 and with a motor 40 attached to a magnet housing 21 . the source piece 10 includes a magnet housing 21 and a source field shaper 25 . a permanent magnet ( see fig7 ) is enclosed within the magnet housing 21 . the magnet housing 21 and source field shaper 25 comprise a non - corrosive , soft magnetically permeable material , such as iron . because the permanent magnet exerts a magnetic field in all directions , the source field shaper 25 directs the magnetic field in the horizontal direction away from the source field shaper 25 . as shown , the sensor piece 15 comprises sensors 30 and a sensor field shaper 35 . the sensor field shaper 35 also comprises a non - corrosive , soft , magnetically permeable material , again such as iron . the source field shaper 25 includes a void section 26 . the void section 26 comprises a removed section of the source field shaper 25 . the magnet housing 21 is advantageously disposed within the void section 26 . a motor 40 is attached to the magnet housing 21 by a shaft 45 . in the embodiment illustrated in fig6 the source piece 10 comprises three sections , upper and lower horizontal sections and a vertical section . these three sections comprise the source field shaper 25 . alternatively , the source field shaper 25 may have more than two horizontal sections . the void section 26 and magnet housing 21 are located within the vertical section . the magnet housing 21 is rotatable 360 degrees by the motor 40 and shaft 45 . the shaft 45 is secured to the magnet housing 21 by bolts , screws , or other suitable fasteners . the motor 40 rotates the magnet housing 21 about the horizontal axis of the shaft 45 , thereby creating the alternating magnetic field . as further illustrated , an evaluation board 50 is connected to the sensors 30 by evaluation board connectors 55 . a battery box 60 is connected to the evaluation board 50 . fig7 is a cross sectional frontal view as shown on fig6 . fig7 illustrates the source piece 10 comprising a permanent magnet 20 , magnet housing 21 , and source field shaper 25 . as shown , the permanent magnet 20 is disposed within the magnet housing 21 . the motor 40 rotates the permanent magnet 20 and magnet housing 21 . fig8 illustrates a further view of the embodiment depicted on fig6 showing a housing 65 that secures the source piece 10 , sensor piece 15 , and motor 40 to a nonmagnetic cylindrical spool 110 . the sensor piece 15 is attached to the housing 65 by bolts , screws , or other suitable fasteners . the source piece 10 is attached to the housing 65 by bolts , screws , or other suitable fasteners . the housing 65 wraps around the outside surface of the nonmagnetic cylindrical spool 110 and is firmly secured to the outside surface of the nonmagnetic cylindrical spool 110 by velcro , hooks and receivers , or other suitable fasteners . the source piece 10 and sensor piece 15 are oriented within the housing 65 so that when the housing 65 is secured to the nonmagnetic cylindrical spool 110 , the source piece 10 and sensor piece 15 are secured on opposite sides of the nonmagnetic cylindrical spool 110 . when the housing 65 secures the sensor piece 15 to the nonmagnetic cylindrical spool 110 , the three horizontal sections of the sensor piece 15 are pressed to the nonmagnetic cylindrical spool 110 . when the housing 65 secures the source piece 10 to the nonmagnetic cylindrical spool 110 , the two horizontal sections of the source piece 10 are also pressed to the nonmagnetic cylindrical spool 110 . the magnet housing 21 is disposed within the void section 26 and is rotatable about an axis that is orthogonal to the cylindrical axis of the nonmagnetic cylindrical spool 110 . fig8 illustrates that such orthogonal rotation is about shaft 45 of motor 40 . the source piece 10 is connected to the motor 40 by the attachment of the shaft 45 to the magnet housing 21 . the motor 40 is located within the housing 65 . the motor 40 is enclosed within a motor housing 85 , which motor housing 85 is attached to the housing 65 . the motor housing 85 may be attached to the housing 65 by bolts , screws , or other suitable fasteners . advantageously , the motor 40 may be a pneumatic motor . an air supply 75 provides air to power the motor 40 through an air supply line 80 . an opening in the housing 65 allows the air supply line 80 access to the motor 40 . as shown , the shaft 45 connects the motor 40 to the source piece 10 . alternatively , the motor 40 may be an electric motor . fig9 is a further view of the embodiment illustrated in fig6 showing a nonmagnetic cylindrical spool 110 with a tubing string 95 and tool joint 90 . the nonmagnetic cylindrical spool 110 comprises a nonmagnetic material , preferably nonmagnetic stainless steel . as shown , the nonmagnetic cylindrical spool 110 will be understood to be a section of a riser spool 115 . the source piece 10 is on the opposite side of the nonmagnetic cylindrical spool 110 from the sensor piece 15 . the tubing string 95 and tool joint 90 are movable in or out of the nonmagnetic cylindrical spool 110 . it will be seen on fig9 that the source piece 10 creates an alternating magnetic field across the nonmagnetic cylindrical spool 110 by the motor 40 rotating the magnet housing 21 , which encloses the permanent magnet 20 . the rotation of the magnet housing 21 is 360 degrees about shaft 45 , and the axis of rotation is disposed orthogonal to the cylindrical axis of the nonmagnetic cylindrical spool 110 . when the tubing string 95 is stripped through the nonmagnetic cylindrical spool 110 , the sensors 30 detect the presence of the tubing string 95 . when present , the tubing string 95 will cause a decrease in the magnetic field across the nonmagnetic cylindrical spool 110 created by the rotatable permanent magnet 20 . upon detection of this decrease in the magnetic field , the sensors 30 notify the evaluation board 50 ( via the evaluation board connectors 55 ) of such detected decrease . the evaluation board 50 advantageously converts this information into digital form . a remotely located computer 51 then receives and processes this information from the evaluation board 50 . with further reference to fig9 the presence of a tool joint 90 in the nonmagnetic cylindrical spool 110 will cause the sensors 30 to detect an even larger decrease in the magnetic field created by the rotating permanent magnet 20 . the evaluation board 50 receives and processes this information from the sensors 30 and then transmits this information on to the computer 51 for further processing . fig1 is a further view of the embodiment depicted in fig6 showing a nonmagnetic cylindrical spool 110 and blow out preventers ( bops ) 100 and 105 . as shown , an upper bop 100 and a lower bop 105 are connected to a riser spool 115 . the nonmagnetic cylindrical spool 110 is a section of the riser spool 115 . the nonmagnetic cylindrical spool 110 comprises a nonmagnetic material , preferably nonmagnetic stainless steel . the nonmagnetic cylindrical spool 110 separates the upper bop 100 from the lower bop 105 . the source piece 10 is on the opposite side of the nonmagnetic cylindrical spool 110 from the sensor piece 15 . the tubing string 95 and connecting tool joints 90 are moveable in or out of the riser spool 115 . it will be seen on fig1 that the source piece 10 creates an alternating magnetic field across the nonmagnetic cylindrical spool 110 by the motor 40 rotating the magnet housing 21 , which encloses the permanent magnet 20 . the rotation of magnet housing 21 is 360 degrees about shaft 45 . when the tubing string 95 is stripped through the nonmagnetic cylindrical spool 110 , the sensors 30 detect the presence of the tubing string 95 . when present , the tubing string 95 will tend to cause a decrease in the magnetic field across the nonmagnetic cylindrical spool 110 created by the rotatable magnet 20 . upon detection of this decrease in the magnetic field , the sensors 30 notify the evaluation board 50 ( via the evaluation board connectors 55 ) of such detected decrease . the evaluation board 50 processes this information and transmits it to the computer 51 for further processing . with further reference to fig1 , the evaluation board 50 and battery box 60 are shown located adjacent to the sensor piece 15 . alternatively , the evaluation board 50 and battery box 60 may be located remotely , preferably on a structure supported by the christmas tree . the computer 51 is remotely located from the sensor piece 15 . in this embodiment , the computer 51 is also connected to an audio and / or visual alarm by a cable . the audio and / or visual alarm will preferably be located near an operator . this audio and / or visual alarm indicates to the operator the presence of the tool joint 90 in the nonmagnetic cylindrical spool 110 . upon this alarm , the operator may halt the movement of the tubing string 95 and open and close the appropriate bops . this audio and / or visual alarm may also notify the operator of the presence of the tubing string 95 , or when the tubing string 95 initially enters the nonmagnetic cylindrical spool 110 , or when the last of the tubing string 95 exits the nonmagnetic cylindrical spool 110 . in operation , fig1 is analogous to the application depicted in fig5 except that the motor 40 rotates the magnet housing 21 and thereby rotates the enclosed permanent magnet 20 . fig1 illustrates an alternative embodiment of the invention depicting a synchronization sensor 31 disposed to monitor the rotation of the permanent magnet 20 , which is enclosed within the magnet housing 21 . the synchronization sensor 31 is pressed to the nonmagnetic cylindrical spool 110 and secured by the housing 65 . the synchronization sensor 31 is attached to the housing 65 by bolts , screws , or other suitable fasteners . a variety of sensor technologies known in the art may be used for the synchronization sensor 31 but preferably conventional hall effect sensors are used . in the alternative , anisotropic magnetoresistive sensors or giant magnetoresistive sensors could be used for sensor technology instead of hall effect devices . it will be seen on fig1 that the source piece 10 , sensor piece 15 , and synchronization sensor 31 are oriented within the housing 65 so that when the housing 65 is secured to the nonmagnetic cylindrical spool 110 , the source piece 10 and synchronization sensor 31 are disposed on the opposite side of the nonmagnetic cylindrical spool 110 from the sensor piece 15 . the synchronization sensor 31 is disposed in close proximity to the source piece 10 . the synchronization sensor 31 and sensor piece 15 are connected to the evaluation board 50 by evaluation board connectors 55 . when the motor 40 rotates the magnet housing 21 and thereby rotates the permanent magnet 20 , an alternating magnetic field is created across the nonmagnetic cylindrical spool 110 , which alternating magnetic field results in alternating maximum magnetic flux values and minimum magnetic flux values being detectable and measurable across the nonmagnetic cylindrical spool 110 . it will be seen on fig1 that the synchronization sensor 31 measures the magnetic field created by the source piece 10 . the synchronization sensor 31 does not measure the magnetic field across the nonmagnetic cylindrical spool 110 , which is measured by the sensor piece 15 . instead , the synchronization sensor 31 continuously monitors the magnetic field created by the source piece 10 and transmits measured flux values to the evaluation board 50 via the evaluation board connectors 55 . the evaluation board 50 will receive this signal and transmit it to the computer 51 , which computer 51 will process and evaluate this information to determine whether a maximum or minimum magnetic flux value is at that instant being exerted . upon an evaluation that the source piece 10 is creating a maximum magnetic flux value , the computer 51 transmits a signal via the evaluation board 50 to the sensors 30 . upon receipt of this signal identifying the maximum magnetic flux value , the sensors 30 will take their reading of the magnetic field across the nonmagnetic cylindrical spool 110 . unless the sensors 30 receive the signal from the computer 51 identifying a maximum magnetic flux value , the sensors 30 will not take their reading . a technical advantage of synchronizing the sensor 30 readings to the maximum magnetic flux value is that the effects of electrical and magnetic noise interferences are averaged out and minimized . in an alternative embodiment that is not illustrated , the synchronization sensor 31 may be attached to the source field shaper 25 . in this alternative embodiment , the synchronization sensor 31 may be connected to the source field shaper 25 by bolts , screws , or other suitable fasteners . fig1 illustrates a further embodiment of the invention showing a coiled tubing string 130 , a crown valve 135 , and a bop stack 140 . the crown valve 135 is the top valve in the christmas tree of a well . as shown , an adapter spool 145 connects the nonmagnetic cylindrical spool 110 to the crown valve 135 . the nonmagnetic cylindrical spool 110 separates the bop stack 140 from the adapter spool 145 and crown valve 135 . the bop stack 140 may have a plurality of bops comprising at least one stripping bop . the different types of bops comprising the bop stack are well known in the art . examples of available bops include stripping , blind , and cutter bops . the source piece 10 is on the opposite side of the nonmagnetic cylindrical spool 110 from the sensor piece 15 . the coiled tubing string 130 is moveable in or out of the crown valve 135 and the bop stack 140 . it will be seen on fig1 that the source piece 10 creates an alternating magnetic field across the nonmagnetic cylindrical spool 110 by the motor 40 rotating the magnet housing 21 , which encloses the permanent magnet 20 . the rotation of magnet housing 21 is 360 degrees about shaft 45 . when the coiled tubing string 130 is stripped through the nonmagnetic cylindrical spool 110 , the sensors 30 detect the presence of the coiled tubing string 130 . when the last of the coiled tubing string 130 exits the nonmagnetic cylindrical spool 110 , the exit of the coiled tubing string 130 will tend to cause an increase in the magnetic field across the nonmagnetic cylindrical spool 110 created by the rotatable magnet 20 . upon detection of this increase in the magnetic field , the sensors 30 notify the evaluation board 50 ( via the evaluation board connectors 55 ) of such detected increase . the evaluation board 50 processes this information and transmits it to the computer 51 for further processing . with further reference to fig1 , the evaluation board 50 and battery box 60 are shown located adjacent to the sensor piece 15 . alternatively , the evaluation board 50 and battery box 60 may be located remotely , preferably on a structure supported by the christmas tree . the computer 51 is remotely located from the sensor piece 15 . in this embodiment , the computer 51 is also connected to an audio and / or visual alarm by a cable . the audio and / or visual alarm will preferably be located near an operator . this audio and / or visual alarm indicates to the operator the exit of the last of the coiled tubing string from the nonmagnetic cylindrical spool 110 . upon this alarm , the operator may halt the movement of the coiled tubing string 130 and close the crown valve 135 . this audio and / or visual alarm may also notify the operator when the coiled tubing string 130 initially enters the nonmagnetic cylindrical spool 110 . the invention is not limited to the nonmagnetic cylindrical spool 110 separating the adapter spool 145 and crown valve 135 from the bop stack 140 . alternatively , a spacer spool ( not illustrated ) may separate the bop stack 140 from the nonmagnetic cylindrical spool 110 . the following describes an exemplary application of the present invention as embodied and illustrated on fig1 . in operation , as the coiled tubing string 130 is stripped from the well bore , it can be seen on fig1 that the coiled tubing string 130 is pulled upwards through the crown valve 135 , nonmagnetic cylindrical spool 110 , and the bop stack 140 . the crown valve 135 is open and the stripping bops of the bop stack 140 are closed . both the crown valve 135 and the stripping bops of the bop stack 140 are openable and closable , with the stripping bops of the bop stack 140 openable and closable around the coiled tubing string 130 , separating the high pressure of the well bore from the lower atmospheric pressure . as the motor 40 rotates the permanent magnet 20 , the permanent magnet 20 creates an alternating magnetic field across the nonmagnetic cylindrical spool 110 . the sensors 30 measure the alternating magnetic field created by the permanent magnet 20 and transmit a signal to the evaluation board 50 , which advantageously converts the signal into digital form . the evaluation board 50 then transmits this information to the computer 51 , which continually monitors and processes these sensor 30 readings . when the coiled tubing string 130 is passing through the nonmagnetic cylindrical spool 110 during stripping , the crown valve 135 remains open and the stripping bops of the bop stack 140 remain closed . the sensors 30 transmit a signal to the evaluation board 50 indicating the presence of the coiled tubing string 130 in the nonmagnetic cylindrical spool 110 . the evaluation board 50 processes this signal and transmits this signal to the computer 51 , which monitors and further processes the information . as the last of the coiled tubing string 130 exits the nonmagnetic cylindrical spool 110 , the crown valve 135 may be closed and the stripping bops of the bop stack 140 remain closed . the sensors 30 will identify the higher reading of the magnetic field caused by the exit of the coiled tubing string 130 . the sensors 30 will transmit the reading to the evaluation board 50 . the evaluation board 50 will process this reading and transmit the reading to the computer 51 , which will monitor and further process the reading . by analysis using techniques such as threshold detection or waveform analysis ( as functionally described earlier ), the computer 51 will identify the exit of the coiled tubing string 130 and notify the operator of the coiled tubing string &# 39 ; s 130 exit by audio and / or visual alarm . notified of the exit of the coiled tubing string 130 from the nonmagnetic cylindrical spool 110 of fig1 , the operator will temporarily halt the stripping of the coiled tubing string 130 . with the stripping bops of the bop stack 140 remaining closed , the crown valve 135 is then closed , and the adapter spool 145 and nonmagnetic cylindrical spool 110 are depressurized to atmospheric pressure . after the nonmagnetic cylindrical spool 110 and adapter spool 145 are depressurized , the crown valve 135 remains closed , and the stripping bops of the bop stack 140 remain closed . the stripping of the coiled tubing string 130 is then resumed . when the coiled tubing string 130 exits the bop stack 140 , the stripping bops of the bop stack 140 may be opened . when a coiled tubing string 130 is moved into the well instead of stripped from the well , the same procedures apply in maintaining the well pressure but in converse order . it will be understood that the invention is not limited to a magnet housing 21 that encloses a permanent magnet 20 . in alternative embodiments that are not illustrated , the permanent magnet 20 is not enclosed within a magnet housing 21 . the permanent magnet 20 may be secured directly to the shaft 45 instead . the permanent magnet 20 may be secured to the shaft 45 by bolts , screws , or other suitable fasteners . it will be further understood that the invention is not limited to an evaluation board 50 and computer 51 that receive and evaluate magnetic readings from the sensors 30 . one alternative embodiment ( not illustrated ), may comprise an analog to digital conversion board and a control panel . a suitable example of a control panel includes but is not limited to the medc ltd . gp2 control panel . the analog to digital converter is remotely located from the sensors 30 , and preferably the analog to digital converter may be secured within the housing 65 . the control panel is remotely located from the sensors 30 , preferably on a structure supported by the christmas tree . the analog to digital converter will process readings from the sensors 30 and / or the synchronization sensor 31 and then transmit these processed signals on to the control panel . the control panel may optionally use threshold detection and waveform analysis ( as functionally described earlier ) to differentiate between readings during the insertion or stripping of tubing strings 95 so as to detect the presence of tool joints 90 , tubing strings 95 , or the initial presence of the tubing string 95 in the nonmagnetic cylindrical spool 110 , or to detect when the last of the tubing string 95 exits the nonmagnetic cylindrical spool 110 and during the insertion or stripping of coiled tubing strings 130 so as to detect when the last of the coiled tubing string 130 exits the nonmagnetic cylindrical spool 110 or to detect the initial presence of the coiled tubing string 130 in the nonmagnetic cylindrical spool 110 . the control panel may also evaluate the reading of the synchronization sensor 31 and determine whether a maximum magnetic flux value is at that time being detected and may then in turn notify the sensors 30 of such reading . even though the above disclosure describes identifying the location of tool joints 90 in a tubing string 95 and identifying the presence of a coiled tubing string 130 in the nonmagnetic cylindrical spool 110 , the present invention is expressly not limited to such applications , and may be useful in various other applications . the present invention would prove useful , for example , for identifying the initial presence of a tubing string 95 in a bop spool or another predetermined section of pipe . for instance , the computer 51 or control panel may also give an audio and / or visual signal to the operator signifying the initial presence of the tubing string 95 in the predetermined section of pipe and also when the last of the tubing string 95 exits the predetermined section of pipe . the present invention is further not limited to use in a well bore . it will be appreciated that the invention may detect changes in mass and / or diameter of ferrous objects passing through a cylindrical space in any technology or application calling for such functionality . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims .	6
the present invention pertains to a method and apparatus for planarizing layers on a semiconductor wafer by the use of a pulsed - force chemical - mechanical planarization ( cmp ) technique . in the following description , numerous specific details are set forth , such as specific shapes , materials , structures , compositions , etc ., in order to provide a thorough understanding of the present invention . however , it will be obvious to one skilled in the art that the present invention may be practiced without these specific details . in other instances , well known processes and structures have not been described in detail in order not to unnecessarily obscure the present invention . the technique described herein is referred to as a &# 34 ; pulsed - force chemical - mechanical polishing ( pfcmp )&# 34 ; technique . although a novel apparatus can be designed to incorporate the method of the present invention , it is appreciated that a variety of prior art polishing equipment can be readily adapted to implement the technique of the present invention as well . furthermore , once the technique described herein is disclosed , those ordinarily skilled in the art can readily implement the technique in a variety of ways . however , the description of the present invention is better understood when referenced to an operative theory pertaining to current cmp techniques . referring to fig1 a typical set up of a tool for performing cmp is shown . a wafer 10 supported by a wafer carrier 14 is placed face - down on to a polishing pad 12 so that a surface 11 , which is to be polished ( etched ), rests against the surface of the pad 12 . the wafer carrier 14 is coupled to equipment ( not shown ) which provides for the rotation of the wafer 10 relative to the pad 12 . in most instances , the pad 12 is also rotated so that both the wafer 10 and pad 12 rotate . a slurry 13 is made to flow over the pad surface so as to provide a hydrodynamic layer between the wafer surface 11 and pad 12 during the polishing operation . the slurry 13 is necessary to perform the cmp operation . additionally , in many cmp tools the carrier 14 is made to move horizontally over the whole of the pad , so that it is not disposed only over a portion of the pad area underlying the wafer at the start of the cmp process . therefore , in most instances , the pad 12 has a larger surface area than the wafer 10 itself . the horizontal movement aids in the distribution of the slurry 13 , as well as reducing pad wear . finally , a slurry delivery system 16 is utilized to deliver and flow the slurry 13 onto the pad 12 surface . it is to be appreciated that the general technique for performing cmp , as described above , is well - known in the prior art . types of slurries , slurry delivery systems , pad designs and the complete tool for performing cmp are also well - known in the prior art . a variety of tools and equipment are available for purchase , in order to perform cmp on a semiconductor wafer , such as a silicon wafer . however , it is also well - known that significant problems are present in the current generation of cmp tools . one problem in particular is in maintaining steady slurry distribution between the wafer and the pad while maintaining consistently high abrasive material removal , during the complete polishing cycle . it is unclear how much of the wafer is removed by direct pad - wafer contact , but it is certainly clear that the presence of the slurry is necessary to achieve desired polishing results for cmp . therefore , the presence of the slurry is essential for performing cmp and that continuous replenishment of the slurry layer between the wafer and pad is absolutely necessary for optimum cmp performance . it is also to be noted that a number of techniques have been devised to maintain a continuous slurry distribution between the pad and the wafer . treatment of the pad surface is one approach . one technique employs the cutting of grooves in the pad to direct the slurry flow to the exposed wafer surface . another technique which is receiving more usage is noted below in the discussion pertaining to fig2 . referring to fig2 the same wafer 10 , carrier 14 and pad 12 structures as fig1 are shown but now with the inclusion of a gimbal 18 . gimbal 18 is located at the wafer carrier 14 so that the carrier 12 , along with wafer 10 , will freely pivot about the gimbal point 19 . it has been shown through experimentation that the pivoting of the wafer further aids in improving the polishing of the wafer . it is theorized that as the wafer 10 transitions across the pad 12 , the wafer 10 swings about the gimbal point 19 , thereby permitting the slurry 13 to establish a hydrodynamic layer between the wafer surface 11 and pad 12 . however , even with this improvement to the prior art cmp tool , it is still difficult to control the polishing of the wafer , let alone obtain consistent polish repeatability from wafer to wafer . although not shown in fig1 but exaggerated in the illustration of fig2 the surface 11 of wafer 10 can actually be slightly curved . this curvature is exaggerated in the drawing of fig2 but what is to be noted is that the amount of the deformation of the wafer is directly related to the dome height &# 34 ; d &# 34 ; at the center of the wafer . dome height d is the extent of the convex deformity at the center of the wafer . the space ( distance ) between the wafer surface 11 and pad 12 is denoted as &# 34 ; h &# 34 ; and will vary across the wafer surface . the amount of the variation is directly related to the dome height d . during actual operation , h will change as wafer and pad motion will necessarily cause h to fluctuate . it is to be appreciated that in the above descriptions , the actual downward ( normal ) force f exerted on the wafer is substantially constant . other than this vertical downward force f , a tangential force is exerted on the surface of the wafer , which force is noted as &# 34 ; pad motion &# 34 ; in fig2 . an inclination of the wafer 10 relative to the pad 12 is noted as attack angle θ . when θ is equal to zero , the pad would be tangent to the surface 11 at the center of the wafer . thus , when θ equals zero , the shortest h ( h min ) is encountered at the center and the longest h ( h max ) at the edges of the wafer . however , if the angle is changed , the tangent point will move away from the center , causing h min to shift toward the edge of the wafer as the value of θ increases . therefore , another factor affecting the location and the value of h is the value of angle θ , which is determined by the angle of pad 12 relative to wafer 10 . other factors affecting the value of h are the relative value of a downward force f and the composition and flow of slurry 13 . the downward force f exerts at least a portion of the necessary force for performing cmp . it is to be noted that force f is maintained relatively constant when using existing cmp techniques . in reference to viscosity , studies have shown that distance h is affected by viscosity , which in turn is affected by temperature changes as well . it should be noted that the presence of the slurry is critical for the proper operation of polishing the surface 11 . however , because of the variability of the hydrodynamic slurry layer , it is difficult to maintain a constant polishing characteristic during the utilization of existing cmp techniques . the analysis of the components of fig1 and 2 show that for existing processes , the pad - wafer interface is an unstable mix of hydrodynamic lubrication by the slurry and direct pad - wafer contact . it has been theorized that abrasive material removal from the wafer surface 11 requires actual pad - wafer contact . another theory is that the actual material removal is achieved by the pad pressure on the hydrodynamic layer . whichever theory is applied , the fact of the matter is that the slurry must be present for achieving optimum results in performing cmp . the analysis is a straightforward application of computational fluid dynamics . the slurry 13 is treated as a thin film of fluid between the surface 11 and pad 12 . the slurry is characterized by its thickness h and attack angle θ . the flow of the slurry is computed and the stresses on the surface 11 , which result from the flow , are integrated to determine the net upward force on the wafer 10 along with their moment m ( shown emanating out of the page ) about the gimbal point 19 . the computations are repeated for various h / θ pairs until one is found such that the net upward force on the wafer matches f and the moment about the gimbal point is zero . this relationship can be better described using the incompressible form of the navier - stokes equations for newtonian fluid as noted below . where ρ is the slurry density , μ is the slurry viscosity , p is the pressure and u is the vector - valued velocity at any point in the flow . further analysis of this relationship is described in a copending application entitled &# 34 ; forced - flow wafer polisher &# 34 ;; ser . no . 08 / 284 , 316 ; filed aug . 2 , 1994 , which application is incorporated by reference herein . in this particular instance , a stress free boundary condition is presumed at the outer edge of the fluid film . in one example , results have shown that for the following polish conditions : ( 1 ) platen and carrier rotation speeds of 20 rpm ; ( 2 ) slurry density of 997 kg / m 3 ; and ( 3 ) slurry viscosity μ of 0 . 8908 + 10 - 3 kg / ms , a hydrodynamic layer with h = 65 microns exists between the pad and the wafer . applying this analysis , it is readily evident to determine the sensitivity of the hydrodynamic layer based on viscosity and wafer curvature . additionally , fig3 illustrates that slight variations in viscosity , which could be due to temperature changes alone , can result in dramatic changes for h due to the change in the thickness of the slurry . furthermore , fig4 illustrates that variations in curvature ( especially below 10 micron dome heights ) can also result in dramatic changes in h as well due to changes in the curvature of the wafer . thus , with the use of the prior art cmp tools where downward force f is substantially constant , it is difficult to ascertain the value of h . the variations in h will result in varying polishing results and repeatability is difficult to achieve from wafer to wafer . an object of the present invention is to alleviate this problem . referring to fig5 an illustration of the application of the present invention is shown in reference to a wafer undergoing a cmp process . it is to be appreciated that even though only two prior art schemes are shown in fig1 and 2 , the present invention can be adapted to practice with a variety of prior art tools and / or techniques . although the description below discusses the present invention without reference to a use of a gimbal , the present invention can be readily practiced with both gimbal and non - gimbal systems . in fig5 the wafer 20 is shown disposed adjacent to the polishing pad 22 . generally , surface 21 of wafer 20 would be parallel to pad 22 , if surface 21 was flat . however , due to the curvature 27 of wafer 20 , the distance ( height &# 34 ; h &# 39 ;&# 34 ;) between surface 21 and pad 22 at any particular point on the surface 21 will depend on that particular point relative to the center of the wafer . typically , the minimum h &# 39 ; is encountered at the center of the wafer . however , if the wafer 20 is angled relative to the pad 22 as it traverses along the pad 22 ( such will be the case when a gimbal 28 is used ), the minimum h &# 39 ; may be encountered at some point other than at the center of the wafer . as shown in fig5 a slurry 23 fills the space between the pad 22 and surface 21 . this set up for cmp is equivalent to that illustrated in fig1 and 2 . it is appreciated that the gimbal can be present ( although not necessary ) in the practice of the present invention . however , in the practice of the present invention , a downward force f &# 39 ; pushing the wafer 20 onto pad 22 is made to vary at a predetermined rate . a preferred technique is to pulse f &# 39 ;, utilizing a pulse pattern , such as a sinusoidal waveform or a triangular waveform , at a fairly low frequency . frequencies in the approximate range of 0 . 5 - 4 hz are applicable , but higher frequencies can be used . the actual frequency selected , as well as the pulse pattern , are design choices . however , the time period of the f &# 39 ; oscillations must be sufficiently slow in order to allow the slurry to flow between the wafer and the pad . a good estimate is to have the time required for slurry to be transported under the wafer to be approximately equal to d / v , where d is the diameter of the wafer being polished and v is the average pad speed . however , it is to be stressed that the actual values will depend on the particular tool , material and process being utilized . the force f &# 39 ; exerted will vary between high and low limit values . typical values for f &# 39 ; expressed in terms of pressure , are approximately 2 - 3 p . s . i . at the lower limit and approximately 9 - 12 p . s . i . at the upper limit . it is preferred that f &# 39 ; be periodic with a time - averaged value approximately equal to a desired fixed force f , if the process was originally designed having a constant force f . however , non - periodic pulsing , as well as variations on the value of f &# 39 ; can be used without departing from the spirit and scope of the present invention . due to the pulsed nature of the force being exerted , the process of the present invention has been referred to as &# 34 ; pulsed - force chemical mechanical polishing &# 34 ; ( pfcmp ). during the lower values of f &# 39 ;, the downward force is lessened thereby allowing a hydrodynamic layer of slurry to flow and accumulate in the region between the wafer 20 and the pad 22 . during the higher values of f &# 39 ;, the downward force is increased thereby squeezing out ( reducing ) the hydrodynamic layer and allowing for mechanical action from the pad surface to abrasively remove material from the wafer . accordingly , a more uniform slurry layer is distributed during the polishing process under controlled conditions and abrasive removal of the wafer material can be controlled as well . in the construction of the pfcmp tool , a variety of prior art devices can be readily implemented to provide the pulsing action . for example , the periodic waveform can be generated by electrical oscillations ( generated from an oscillator or a signal generator ). an electrical mechanical arm coupled to the wafer carrier then can be driven by the electrical oscillations . these techniques are well - known in the prior art . therefore , by the application of the present invention , a much more controlled cmp technique can be achieved to planarize layers on a surface , such as a semiconductor wafer , especially a silicon wafer . however , the present invention can be readily adapted to other areas of technology , such as in the manufacture of flat panel video displays . thus a pulsed - force chemical - mechanical polishing technique is described .	1
a preferred embodiment of the present invention will now be described in detail with reference to the annexed drawings . in the following description , a detailed description of known functions and configurations incorporated herein has been omitted for conciseness . the present invention concerns different reception techniques for transmission / reception of a differential stbc . fig1 is a block diagram of a general apparatus for transmitting a differential stbc . referring to fig1 , the apparatus for transmitting a differential stbc includes a convolutional encoder 12 , an interleaver 13 , and a differential stbc encoder 14 . the apparatus performs convolutional encoding and then interleaving on data u n generated from a source , and performs differential stbc encoding on a result of the interleaving for transmission . since a convolutional code has a coding gain that is larger than a block code and is easy to decode , it has been widely used . the apparatus for transmitting a differential stbc changes a burst error of bits that may be generated in a channel into an isolated error , and the interleaver 13 performs interleaving to improve the efficiency of error correction coding . the differential stbc encoder 14 performs differential stbc encoding on an interleaved signal , combines a transmission signal x k with a previously transmitted signal w k - 1 , and transmits a result of the combination as w k . in other words , w k = w k - 1 x k . the transmission signal x k is expressed as equation ( 1 ): x k = 1 n s ⁢ ∑ n = 1 n s ⁢ ( s _ n ( k ) ⁢ a n + j ⁢ s ~ n ( k ) ⁢ b n ) ( 1 ) where { overscore ( s )} n ( k ) is a real part of a qam symbol and { tilde over ( s )} n ( k ) is an imaginary part of a qam symbol , and a n and b n are a transmission matrix corresponding to respective symbols . fig2 is a block diagram of an apparatus for receiving a differential stbc encoded as described above , according to the present invention . referring to fig2 , the apparatus for receiving a differential stbc according to the present invention includes a differential stbc detector 25 , a deinterleaver 24 , a bahl , cocke , jelinek and raviv ( bcjr ) decoder 23 , and an interleaver 21 . thus , the data u n generated from a source , as described with reference to fig1 , finally arrives at a sink . the differential stbc detector 25 detects a symbol in a received signal y k using a trellis diagram and a viterbi algorithm . as the viterbi algorithm , a forward viterbi algorithm , a backward viterbi algorithm , or both , may be used . the symbol detected by the differential stbc detector 25 passes through the deinterleaver 24 for error correction and is decoded by the bcjr decoder 23 . although a long burst error is generated when an interleaved signal passes through a transmission channel , it is divided for each block after passing through the deinterleaver 24 . thus , more errors can be corrected as compared to a case where interleaving is not performed . a decoded signal is interleaved by the interleaver 21 and is fed back to the differential stbc detector 25 . the interleaver 21 rearranges an input order of information bits to convert information having a correlation into information having no correlation , thereby removing an error pattern . thus , a transmission error is reduced , as the decoded signal is fed back through the interleaver 21 . detection of a symbol through the differential stbc detector 25 using the trellis diagram and the viterbi algorithm is now described in more detail . the signal y k received by the differential stbc detector 25 is expressed as equation ( 2 ) by multiplying the transmission signal w k by a channel gain h of a transmission channel and adding noise e k . where since w k = w k - 1 x k , equation ( 2 ) can be expressed as equation ( 3 ): assuming that the signal y k received by the differential stbc detector 25 is expressed as equations ( 2 ) and ( 3 ), if an observation interval is 3 , detection of signals x k and x k , using received signals y k , y k - 1 , and y k - 2 is performed using equation ( 4 ). min { x k , x k - 1 } ⁢  y k - hw k  2 +  y k - 1 - hw k - 1  2 +  y k - 2 - hw k - 2  2 ( 4 ) where since w k = w k - 1 x k and x k x k h = i ( h of x k h indicates a hermitian operation and i indicates an identity matrix ), equation ( 4 ) can be expressed as equation ( 5 ): min { x k , x k - 1 } ⁢  y k - hw k - 1 ⁢ x k  2 +  y k - 1 - hw k - 1  2 +  y k - 2 - hw k - 1 ⁢ x k - 1 h  2 ( 5 ) equation ( 5 ) can be differentiated with respect to hw k - 1 as equation ( 6 ): min { x k , x k - 1 } ⁢ re ⁢ { tr ⁡ ( x k ⁢ y k h ⁢ y k - 1 + x k ⁢ y k h ⁢ y k - 2 ⁢ x k - 1 + x k - 1 ⁢ y k - 1 h ⁢ y k - 2 ) } ( 6 ) equation ( 6 ) can be expressed using a trellis diagram as equation ( 7 ): λ ⁡ ( x k - 1 → x k ) = ⁢ re ⁢ { tr ⁡ ( x k ⁢ y k h ⁢ y k - 1 + x k ⁢ y k h ⁢ y k - 2 ⁢ x k - 1 ) } = ⁢ ∑ n ⁢ re ⁡ [ tr ⁢ { a n ⁢ y k h ⁢ y k - 1 } ] ⁢ s _ n ( k ) - ⁢ ∑ n ⁢ im ⁡ [ tr ⁢ { b n ⁢ y k h ⁢ y k - 1 } ] ⁢ s ~ n ( k ) + ⁢ ∑ n ⁢ ∑ n ′ ⁢ re ⁡ [ tr ⁢ { a n ⁢ y k h ⁢ y k - 2 ⁢ a n ′ } ] ⁢ s _ n ( k ) ⁢ s _ n ′ ( k - 1 ) - ⁢ ∑ n ⁢ ∑ n ′ ⁢ im ⁡ [ tr ⁢ { jb n ⁢ y k h ⁢ y k - 2 ⁢ b n ′ } ] ⁢ s ~ n ( k ) ⁢ s ~ n ′ ( k - 1 ) + ⁢ ∑ n ⁢ ∑ n ′ ⁢ re ⁡ [ tr ⁢ { ja n ⁢ y k h ⁢ y k - 2 ⁢ b n ′ } ] ⁢ s _ n ( k ) ⁢ s ~ n ′ ( k - 1 ) - ⁢ ∑ n ⁢ ∑ n ′ ⁢ im ⁡ [ tr ⁢ { b n ⁢ y k h ⁢ y k - 2 ⁢ a n ′ } ] ⁢ s ~ n ( k ) ⁢ s _ n ′ ( k - 1 ) ( 7 ) a viterbi algorithm is implemented in the differential stbc detector 25 as follows . μ f ⁡ ( x k ) = max { x k - 1 } ⁢ { μ f ⁡ ( x k - 1 ) + λ ⁡ ( x k - 1 → x k ) } ( 8 ) if a signal decoded in the bcjr decoder 23 is fed back through interleaver 21 , log pr ( x k - 1 ) is added to equation ( 8 ) and the forward viterbi algorithm is implemented as equation ( 9 ): μ f ⁡ ( x k ) = max { x k - 1 } ⁢ { μ f ⁡ ( x k - 1 ) + λ ⁡ ( x k - 1 → x k ) + log ⁢ ⁢ pr ⁡ ( x k - 1 ) } ( 9 ) where log pr ( x k - 1 ) indicates a priori probability output from the bcjr decoder 23 during a previous feedback session . like the forward viterbi algorithm , a backward viterbi algorithm is implemented as equation ( 10 ): μ b ⁡ ( x k ) = max { x k + 1 } ⁢ { μ b ⁡ ( x k - 1 ) + λ ⁡ ( x k - 1 → x k ) } ( 10 ) like in the forward viterbi algorithm , if a signal decoded in the bcjr decoder 23 is fed back through interleaver 21 , the backward viterbi algorithm is implemented as equation ( 11 ): μ b ⁡ ( x k ) = max { x k + 1 } ⁢ { μ b ⁡ ( x k + 1 ) + λ ⁡ ( x k + 1 → x k ) + log ⁢ ⁢ pr ⁡ ( x k + 1 ) } ( 11 ) the differential stbc detector 25 outputs a bit value after implemting the trellis diagram and the viterbi algorithm as described above . the calculation of the bit value is performed as equation ( 12 ): l ⁡ ( x k q ) = ∑ x k ∈ x + 1 q ⁢ { μ f ⁡ ( x k ) + μ b ⁡ ( x k ) } - ∑ x k ∈ x - 1 q ⁢ { μ f ⁡ ( x k ) + μ b ⁡ ( x k ) } ( 12 ) where x ± 1 q , represents a group of transmission symbols having a q th bit of ± 1 . as described above , in the present invention , a differential stbc is received using the trellis diagram and the viterbi algorithm without channel estimation . therefore , by using the trellis diagram and the viterbi algorithm , a differential stbc can be received and the performance of receiving the differential stbc can be improved , without channel estimation . in addition , the performance of receiving a differential stbc can be similar to that in conventional coherent detection , without channel estimation . while the invention has been shown and described with reference to a certain preferred embodiment thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention .	7
the word &# 34 ; nuts &# 34 ; in this invention includes peanut , almond , pecan nut , seed of pumpkin , walnut , sesame , sunflower seed , hazel nut , brazil nut , pistachio nut , cashew nut , macadamia nut , seed of pine tree , seed of rotus and so on . fats contained in nuts are composed of highly unsaturated fats , so they are rapidly oxidized after roasting or heating or frying . however coffee beans are relatively stable after roasting though they contain oxidation - sensitive aroma components . the reason for roasted coffee bean stability is ascribed to carbon dioxide gas which evolves during roasting owing to chemical reactions , and carbon dioxide gas remains after roasting in coffee beans . when hot water is poured onto ground roasted coffee beans , many bubbles evolve , which are composed chiefly of carbon dioxide gas . and also it is said that roasted coffee beans which do not release bubbles at the time of extraction by hot water lose their aromas . so it is probable that when carbon dioxide gas is pushed into nuts forcedly , it can prevent or retard oxidation of oils in the nuts . the inventors made some experiments to treat nuts with compressed carbon dioxide gas and found that in some cases oxidation velocities became much slower than untreated nuts . and the fact that nitrogen gas cannot replace carbon dioxide gas was also found out , too . the methods of this invention involves treatment of nuts with compressed carbon dioxide gas under heating conditions . carbon dioxide gas of pressure below 30 kg / cm 2 is effective enough . if higher pressure is chosen , a discharge of compressed gas after treatment requires more time , because rapidly discharging gas causes breakage of nuts owing to a violent vaporization of carbon dioxide dissolved into nuts tissues . temperature higher than room temperature but not too high to cause browning or roasting should be chosen to enhance carbon dioxide gas diffusion into nuts . it is also desirable to chill nuts quickly after carbon dioxide gas treatment to prevent damage from excess heating or browning and a loss of carbon dioxide gas from nuts . and also it is recommended to evacuate air from the treatment vessel before carbon dioxide gas treatment to remove oxygen completely . ( 1 ) its main part is a vessel which can hold compressed carbon dioxide gas therewith . ( 2 ) it has to have ( a ) door ( s ) or ( a ) gate ( s ) to put nuts into and take them out . of course these doors or gates should be airtight and withstand the pressure of the compressed gas . ( 3 ) the device has ( a ) heater ( s ) to heat nuts during treatment . these heaters can be composed of heat exchangers , e . g . pipe ( s ) or tube ( s ) or plate ( s ) or jacket ( s ) through which steam or hot water or hot oil or any other hot fluid can circulate , or electrical heater , or generators of radiation , such as infrared or microwave , can be provided . ( 4 ) it has ( a ) chiller ( s ) to chill nuts therewithin quickly after treatment . these chillers can be made in the same manner as the heater through which chilled water or chilled oil or any other chilled fluid can circulate . in some cases heaters can be used also as chillers , when hot fluid is replaced by chilled fluid . ( 5 ) it has ( a ) valve ( s ) through which compressed carbon dioxide gas is supplied into and discharged out of the vessel . in some cases a single valve can be used for introduction as well as release of the co 2 gas . ( 6 ) it is desirable to make a device in such a manner so that it can be rotated freely to make ( a ) door ( s ) or ( a ) gate ( s ) face upward or downward . in this case nuts are put into the device through ( a ) door ( s ) or ( a ) gate ( s ) when the door ( s ) or gate ( s ) are facing upwardly , and after treatment the device is rotated upside down and nuts are easily taken out when it ( they ) is ( are ) facing downwardly . ( 7 ) it is also preferable to attach ( a ) vibrator ( s ) on or in a device to facilitate taking treated nuts out of the device . ( 8 ) to save carbon dioxide it is also recommended to attach ( a ) compressor ( s ) and ( a ) container ( s ) or ( a ) bomb ( s ) to recover and store used carbon dioxide gas . ( 9 ) to discharge air and remove oxygen completely out of a device , it is also preferred to attach ( a ) pump ( s ) to a device . a typical structure of device of this invention is shown in fig1 . a main part of the device , i . e ., a vessel 1 can contain compressed carbon dioxide gas therewithin . through a door or a gate 2 nuts are put into and taken out of the vessel 1 . in this figure the door or gate 2 is placed downward , but when the vessel is rotated upside down , it faces upwardly . the vessel 1 can be rotated freely by a shaft 6 which is rotated by a motor 5 . when the door or the gate 2 is upward , nuts are easily put into the vessel 1 and when downward , they are easily taken out of the vessel 1 . heaters 3 are provided in the vessel 1 , which can be made as hollow plates or tubes or pipes to circulate hot fluid inside . and in this case heaters 3 are easily changed into chillers if chilled fluid is passed inside instead of hot fluid . a vibrator 7 is attached to make it easy to take treated nuts out of the vessel 1 . preferably a pressure gauge 8 , a thermometer 9 and a window 10 are attached to the vessel 1 to confirm a process condition in the vessel 1 . carbon dioxide gas is supplied from a bomb 13 through valves 16e and 16a into the vessel 1 . a pipe 4 is through the shaft 6b and is connected to a distributing pipe by means of a sealer 15 to enable the vessel 1 to be rotated . before supplying gas into the vessel 1 , a pump 14 evacuates air from the vessel 1 . after a treatment is finished , gas is discharged out of the vessel 1 through the pipe 4 by means of a compressor 11 . at that time compressed gas is chilled by a chiller 12 , then stored in the bomb 13 . commercial roasted peanuts 350 gr were put into a glass container which was placed onto the other same one without peanuts in an autoclave of 3l inner volume . after sealing the autoclave , carbon dioxide gas was supplied from a bomb until the inner pressure became 10 kg / cm 2 , then released rapidly to an atmospheric pressure . this procedure was repeated two more times to replace air for carbon dioxide gas in the bomb . then carbon dioxide gas was filled in the bomb to a pressure 10 kg / cm 2 and the autoclave was heated to maintain the temperature of peanuts between 70 °˜ 72 ° c . for an hour , then carbon dioxide gas was discharged for about 30 minutes , while the autoclave was placed at a room temperature , then the autoclave was opened to take peanuts out . these peanuts are called ( a ). the same commercial roasted peanuts treated in the same manner under the condition that the chilling the autoclave as well as discharging gas was done for 18 hours at a room temperature . ( a ), ( b ) and ( c ) were put in pouches which are made of polyethylene 80 μm thick and sealed with rubber bands . they were stored at a room temperature and periodically about 50 g of them were extracted with fresh ethyl ether of a chemical reagent grade to extract oils in soxlet extractor . extracted oils were condensed and dried completely in vacuo , then titrated to evaluate their acid values ( av : mg / gr ) and peroxide values ( pov : meq / 1000 gr ). ______________________________________ just after the after 1 after 2 treatment month month______________________________________ ( a ) av 1 . 36 1 . 11 1 . 01 pov 3 . 8 26 . 81 35 . 41 ( b ) av 1 . 25 1 . 13 0 . 94 pov 2 . 6 24 . 81 34 . 11 ( c ) av 1 . 38 1 . 08 1 . 64 pov 4 . 7 33 . 71 42 . 01______________________________________ roasted peanuts freshly roasted in a factory were treated with carbon dioxide gas in a similar manner described in example 1 . in this experiment they were treated under the condition of a pressure 25 kg / cm 2 and a temperature 120 °± 5 ° c . for an hour . after the treatment the autoclave was chilled forcedly by putting wet towels on its surface for about 2 hours till the inner temperature became 50 ° c ., then carbon dioxide gas was released for about 15 minutes . they were pouched in the same manner described in example 1 , then stored at 37 ° c . ______________________________________ just after the treatment after 1 month______________________________________treated av 0 . 92 0 . 93 pov 1 . 5 17 . 8untreated av 1 . 14 0 . 97 pov 12 . 1 51 . 8______________________________________ after 2 after 3 after 4 months months months______________________________________treated av 1 . 05 0 . 93 1 . 19 pov 38 . 3 37 . 4 40 . 8untreated av 1 . 17 1 . 17 1 . 21 pov 80 . 4 62 . 7 64 . 9______________________________________ commercial roasted peanuts were treated in a similar manner described in example 1 under the condition of a pressure 5 kg / cm 2 and a temperature 80 ° c . for an hour and the release of carbon dioxide gas was done for 30 min . without forced chilling at a room temperature . they were pouched in the same manner described in example 1 and stored at 37 ° c . ______________________________________ just after the after 1 after 2 treatment month month______________________________________treated av 1 . 45 1 . 11 2 . 32 pov 21 . 6 69 . 1 89 . 3untreated av 1 . 78 2 . 23 2 . 37 pov 64 . 7 113 . 2 129 . 4______________________________________ roasted peanuts freshly roasted in a factory were treated with compressed nitrogen gas under the condition of a pressure 25 kg / cm 2 and of a temperature 120 °± 5 ° c . before the treatment , air in the autoclave was replaced by nitrogen in the same manner described in example 1 . after the treatment , chilling the autoclave forcedly and releasing inner gas were done in the same manner described in example 2 . peanuts were packed in the same manner described in example 1 and stored at 37 ° c . ______________________________________ just after the treatment after 1 month______________________________________treated av 0 . 88 0 . 69 pov 1 . 0 34 . 0untreated av 0 . 90 0 . 90 pov 1 . 1 35 . 4______________________________________	0
[ 0020 ] fig1 depicts the central components of the present invention . the reader should appreciate that the device can be used to gasify solids , liquids , or a combination of the two ( a “ slurry ”). in this initial example , a solid will be employed . mixer 10 contains solids inlet 16 and gas inlet 18 . a finely - ground hydrocarbon - containing solid is fed in through solids inlet 16 . natural gas is fed in through gas inlet 18 . the entire system is pressurized . thus , those skilled in the art will know that the gas must be fed in under pressure and the solid material must be fed in under pressure . mixer 10 disperses the hydrocarbon - containing solid into the natural gas , and delivers it through the connecting pipe into acceleration / gasification tube 12 . the mixture is heated within acceleration / gasification tube 12 . it undergoes a transformation process — which will be described subsequently — before passing through the connecting pipe into gas diffuser 14 . [ 0022 ] fig2 shows acceleration / gasification tube 12 sectioned in half to show its internal details . the unit is connected to mixer 10 by inlet flange 28 . the mixture of hydrocarbon gas and solids is forced in through inlet 24 . it then passes through first expansion nozzle 38 . most of the length of the tube is contained within housing 30 . refractory shell 34 surrounds the tube and insulates the metal comprising housing 30 from the extreme heat generated by a plurality of electrical heating elements 32 . a set of tube supports 90 holds the tube in position within housing 30 . the wall of the cylindrical tube must have a high degree of thermal conductivity , in order to conduct heat to the gas and solids passing within the tube ( essential to the processes occurring therein ). it must also be capable of withstanding high temperatures . outlet flange 36 connects acceleration / gasification tube 12 to gas diffuser 14 . the temperature within the refractory shell is typically maintained between 2200 and 3400 degrees fahrenheit , depending on the material to be gasified . this heat is transferred to the mixture of gases and solids being forced through the tube . [ 0025 ] fig4 graphically depicts the processes occurring within acceleration / gasification tube 12 . in this example , a mixture of finely - ground coal and natural gas 58 is forced into the tube from the left . it expands through first expansion nozzle 38 . it is simultaneously heated . the heating adds energy to reach the activation energy needed to alter the chemical structure of the compounds present . the result is that the hydrocarbon chains within the natural gas are “ cracked ”, thereby releasing some carbon bond energy . the coal is also broken into progressively finer particles (“ softened ”) by the intense turbulent motion of the swirling gases . the added heat produces explosive acceleration , which further contributes to the carbon chain cracking process . the result is the region denoted as cracked natural gas and softened coal 60 . as the temperature of the mixture rises , the carbon bonds contained within the coal break , thereby releasing more potential energy . the sharply rising temperature causes the gas to expand — producing violent acceleration down the tube . this is denoted as first acceleration phase 62 . the energy transferred to the mixture from heating elements 32 causes more expansion and further acceleration , denoted as second acceleration phase 64 . the gases can exceed the speed of sound , forming shock waves as illustrated . a violently rotational flow typically develops as the gas accelerates down the tube . the hydrocarbon chains within the coal ultimately break into their constituent elements , as do the hydrocarbon chains within the natural gas . this action occurs through the region marked gasification phase 66 . the result is the escape of hot gas 68 out the right end of the assembly at high velocity . this hot gas , at this stage , may be composed mostly of hydrogen . shorter - chain hydrocarbon gases may also be present ( methane , ethane , etc .). those skilled in the art will also realize that a substantial quantity of free electrons will be present ( so long as the gas remains at highly the elevated temperature ). the goal of the device is to provide a continuous process . thus , the hot gas produced must be removed and collected . it must first be cooled , however . fig3 illustrates the device intended to accomplish this task . gas diffuser 14 assumes the form of an enclosed expansion nozzle . it is connected to acceleration / gasification tube 12 by inlet flange 40 . the hot gases entering the device expands through second expansion nozzle 42 . this process expands and cools the hot gas . second expansion nozzle 42 is surrounded by gas cooling jacket 44 . cool gas is forced into the jacket through gas inlet 46 . it flows around a circular manifold and is forced along the bell - shaped wall of second expansion nozzle 42 , where it is eventually collected in a second circular manifold and extracted through gas outlet 48 . the cooling gas , which may be ambient air , can be used as a heat source for another process or simply exhausted . although gas cooling jacket 44 removes considerable thermal energy from the expanded gas within gas diffuser 14 , more energy must typically be removed prior to storing the gasified hydrocarbons . a second cooling stage is produced by liquid cooling jacket 50 . a conductive liquid , such as water , is fed in through liquid inlet 52 . the liquid flows around a circular manifold and through liquid cooling jacket 50 . it is then collected in a second circular manifold and extracted through liquid outlet 54 . the cooled hydrocarbon gas is then extracted through cooled gas outlet 80 . the gas may then be fed directly into a combustion process , or compressed and stored for later use . in either case , an extraction pump is generally attached to cooled gas outlet 80 ( via outlet flange 56 ) in order to maintain flow in the system . those skilled in the art will realize that the gas extraction can be accomplished using multiple pumps attached to multiple gas outlets . although nearly all of the hydrocarbon - containing solid will be converted to a gas , some solid materials ( such as silicon ) will remain . these materials will generally collect in the bottom of gas diffuser 14 . solids collection outlet 26 is provided for the removal of these materials . it is attached to an accumulation unit , from which the solids must periodically be collected . continuing the example using coal , fig5 schematically depicts the comprehensive process . hopper 70 feeds the coal into material feeder 72 . from there , depending on the moisture content , it may be fed into dryer 74 . once dried , the coal is passed into grinder / shredder 76 , which produces fine particles within a specified size rage . these particles are then dispersed within the natural gas inside mixer 10 ( with the gas coming from gas supply 78 ). after leaving mixer 10 , the mixture of gas and solids passes through acceleration / gasification tube 12 . as explained previously , gasification takes place within this unit , with the result that a stream of very hot gas enters gas diffuser 14 . those skilled in the art will know that the hydrocarbon gas present at this point in the process may be different from the one fed into the acceleration / gasification tube . the extreme temperatures and violent kinetic action tends to break down longer carbon chains (“ cracking ”). as an example , if the feed gas is propane ( containing a molecule with a carbon chain which is three carbon atoms long ), the gas may be very nearly transformed to free hydrogen and methane ( containing only a single carbon atom per molecule ) by the time it reaches the end of the acceleration / gasification tube . both the input and output gas include hydrocarbon gases , but they are not the same gases . for purposes of clarity , the gas exiting the acceleration / gasification tube will be referred to as a “ resultant gas .” those skilled in the art will know that the predominance of free hydrogen gas will be present only at the highly elevated temperatures . as the gas cools , the free hydrogen will tend to recombine with the available carbon atoms to form hydrocarbon gases . thus , it may be desirable to extract the free hydrogen gas before any significant cooling occurs . if the acceleration / gasification tube is configured to produce violently rotational flow , centrifugal separation devices can be used to extract the lighter hydrogen atoms from the heavier carbon atoms and hydrocarbon atoms ( those skilled in the art will realize that this process is imperfect , but it can be expected to extract the hydrogen gas with a tolerable amount of carbon and hydrocarbon impurities ). this separation preferably occurs prior to the gas entering the diffuser , or only part way through the expansion portion of the diffuser . in such a case , a portion of the “ resultant ” gas does not pass completely through the diffuser . gas diffuser 14 is provided primarily to cool the resultant gas . the resultant gas passes through a second expansion nozzle ( which may briefly accelerate the gas further , depending on the pressure maintained by the extraction pump ). looking again at fig5 tthe gas can then be passed through gas filter / cleaner 82 ( which may be needed to remove pollutants , depending on the feed material ). extraction pump 86 then recompresses the resultant gas and feeds it into storage containers . solids accumulator 84 is provided to collect unwanted solids . the accumulated materials must periodically be removed . this process must generally be performed while the system is shut - down , since solids accumulator 84 cannot be opened without disturbing the flow in the system . various other conventional components have not been illustrated . for instance , as explained previously , the solid material must be pressurized in order to feed into mixer 10 . this pressurization component has not been illustrated . although coal has been used in the preceding example , other solid materials can be substituted . as a second example — used rubber tires can be employed as the hydrocarbon - containing solid . different mechanical hardware is needed to shred used tires to an appropriate particle size , but the process is otherwise similar . the process is not limited to the use of hydrocarbon - containing solids , however . hydrocarbon - containing liquids , such as crude oil , can also be employed . in many respects the use of such a liquid simplifies the process , since it is easier to disperse the liquid into the natural gas than a finely ground solid . combinations of liquids and solids are also possible . finely ground coal can be mixed into crude oil to form a slurry , which is then dispersed into the natural gas and fed into acceleration / gasification tube 12 . a slurry can also be made by mixing shredded rubber products with crude oil . the components disclosed in detail can obviously be modified in many ways without changing the basic function of the overall device . as one example , electrical heating elements 32 could be replaced by gas burners . likewise , a conventional gas to liquid heat exchanger ( one type of “ boiler ”) could be substituted for the complex form of gas diffuser 14 . some efficiency would obviously be lost , since the delaval - type expansion nozzle would not be present . so long as sufficient heat is extracted from the gasified hydrocarbons to allow their subsequent use , however , the loss of efficiency could be tolerated . many different devices can be used to feed the solid and / or liquid hydrocarbon - containing materials into the gasifier . fig6 shows solid injector 106 , which would be contained within mixer 10 . it is preferable to have the mixer generate a fast moving gas with an even dispersion of fine solid particles . solid injector 106 is designed to accomplish this task . the unit is shown with a cutaway to reveal its internal features . a high pressure gas supply is connected to gas intake 112 , typically using the flange provided . housing 116 , along with the internal components , serve to define an acceleration nozzle 102 followed by a deceleration nozzle 104 . gas flows through the device in the direction indicated by the arrows . shaft support 98 is centrally fixed within deceleration nozzle 104 by radially - spaced support struts 96 . drive shaft 94 passes through and is supported by shaft support 98 . it attaches to rotor 92 on its leading end . rotor 92 is spun rapidly by drive shaft 94 . it features powder intake 88 near the center of its leading portion . powder intake 88 rotatably connects to a tube supplying finely ground hydrocarbon - containing solids ( this tube passes through the gas intake stream just upstream of the unit shown ). once the solid particles enter rotor 92 , they are propelled aft by auger 90 . fig7 shows a cutaway through rotor 92 to reveal its internal details . the reader will observe how auger 90 ( which is shown cutaway ) propels the particles rearward and eventually out through a set of six powder injectors 100 . as rotor 92 is rapidly spinning , the solid particles are thrown violently out through the powder injectors 102 . the powder then enters the stream of rapidly moving gas , in close proximity to throat 108 . those skilled in the art will realize that the gas velocity is maximized in the region of throat 118 . the flow tends to be fully developed turbulent flow in this region as well , which promotes thorough mixing . by the time the gas decelerates through deceleration nozzle 104 , the solid particles are thoroughly dispersed within the gas . a gearbox ( typically a right - angle gearbox ) is located in the gas flow stream just downstream of solid injector 106 . it provides input power to the drive shaft . just downstream of this gearbox , the gas flow enters acceleration / gasification tube 12 . the reader will recall from the prior explanation that the gas is heated within acceleration / gasification tube 12 , using an external energy source . some additional heat may be added by partially combusting the hydrocarbon gas , as it passes through acceleration / gasification tube 12 . oxygen , or some other suitable oxidizer , must be added if this function is desired . looking again at fig7 the reader will observe that radially - spaced oxygen injectors 108 are positioned to direct oxygen into deceleration nozzle 104 . the oxygen can be supplied from external oxygen manifold 110 , which is simply abounded cavity surrounding housing 116 , into which pressurized oxygen is fed . if the oxygen is added , a desired portion of the hydrocarbon gas can be burned to generate additional heat . although the device shown in fig6 and 7 is configured to handle solid hydrocarbon - containing material , it can be easily modified to handle heavy liquids ( such as oil ). for this modification , powder injectors 108 would be reduced in diameter near where they open into the surrounding gas stream . the pressure drop across these nozzles , combined with the substantial centrifugal acceleration of the spinning rotor , will finely distribute a liquid spray into the rapidly moving gas stream . thus , the device shown can uniformly disperse a hydrocarbon - containing liquid into the gas stream in preparation for the acceleration / gasification tube . the device shown in fig6 and 7 can also handle a slurry containing solids dispersed within a liquid . slurries are often used to handle finely particulated solids , since such a slurry behaves like a liquid and can be handled by liquid handling equipment rather than conveyor belts and the like . as one example , a slurry of oil and finely ground carbon dispersed in oil can be fed into powder intake 88 . the auger and powder injectors will handle such a slurry and disperse it into the stream of rapidly moving gas . although the specific hydrocarbon - containing examples of coal , shredded rubber , and crude oil were disclosed , the reader should keep in mind that the devices disclosed could be used to gasify virtually any type of hydrocarbon - containing liquid or solid . the preceding descriptions should not be construed , therefore , as limiting the scope of the invention but rather as providing illustrations of the preferred embodiments of the invention .	2
the snap - on vernier syringe 1 of the present invention is best described while referring to the drawings . in fig1 there is shown an exploded view of a syringe assembly comprising a threaded piston 2 , a collar 4 , a flexible piston sealing head 6 , and a conventional calibrated syringe cylinder 8 . in the assembled relationship of fig2 and referring concurrently to fig1 and 2 of the drawings , the threaded piston 2 is received in a centrally disposed , threaded opening formed in collar 4 . the piston 2 has a pair of locking grooves 3 extending longitudinally along the the threaded body thereof . the piston head 6 is secured to a terminal 10 formed at the distal end of piston 2 , and a piston control knob 12 is affixed to the proximal end of piston 2 . the piston head 6 is inserted through the open mouth 14 of syringe cylinder 8 , so that the piston 2 may be controllably moved through syringe cylinder 8 in a manner and for a purpose that will be described in greater detail hereinafter . in accordance with an important feature of the present invention , the collar 4 is snapped into releasable engagement with the lips 16 which surround the mouth 14 of syringe cylinder 8 . for disposable usages , the syringe cylinder 8 is preferably fabricated from a clear , non - breakable plastic material . in accordance with another important , soon to be described feature of the present invention , the disclosed vernier syringe 1 is adapted to quickly and easily convert the conventional syringe cylinder 8 into a precisely accurate pipetting cylinder to control the infusion of highly potent , dosage sensitive , radioactive , or very expensive materials ( e . g . drugs ) without requiring that modifications be made to the cylinder 8 . the aforementioned advantages of the present invention are now described in detail while referring to fig3 - 6 of the drawings where the syringe collar 4 is illustrated . as previously disclosed , collar 4 has a centrally disposed , threaded opening 9 for receipt therethrough of the threaded piston 2 . collar 4 is provided with a manually accessible , spring biased cylinder removal pin 18 which is adapted to ride up and down through a slot 19 ( of fig1 ) formed in a side of collar 4 to selectively secure or release the connection between the lips 16 of syringe cylinder 8 and the collar 4 . more particularly , and referring specifically to fig3 of the drawings , an access opening 20 is formed in the bottom face 22 of collar 4 . opening 20 has a shape which generally conforme to the shape of the lips 16 which surround the mouth of syringe cylinder 8 . spaced above the bottom face 22 and accessible through the opening 20 formed therein is the core 24 of collar 4 . a catch member 26 is interconnected to the aforementioned piston removal pin 18 and adapted to move between the collar core 24 and the bottom face 22 when the pin 18 rides through the slot 19 formed in collar 4 . that is , with the cylinder removal pin 18 in a lower - most position in slot 19 , catch member 26 is recessed within a seat 28 formed in collar core 24 . with the cylinder removal pin 18 raised to the upper - most position in slot 19 , the catch member 26 is correspondingly raised out of its seat in the core 24 and moved upwardly into the space between the bottom face 22 and the core 24 of collar 4 . in operation , and to complete the assembled syringe relationship of fig2 the physician places the collar 4 over the syringe cylinder 8 , so that the cylinder lips 16 are received in the access opening 20 of collar 4 and the piston 2 is extended into and past the mouth of cylinder 8 . the cylinder removal pin 18 is moved against the bias of its associated spring ( designated 58 in fig5 ) and held at its lower - most position in slot 19 , whereby catch member 26 is seated within the collar core 24 . the physician then rotates the syringe cylinder 8 so that the lips 16 thereof are rotated through the space between the bottom face 22 and the core 24 of collar 4 and past the recessed catch 26 . at this time , the physician releases the cylinder removal pin 18 . the normal bias of the spring automatically returns the cylinder removal pin 18 to its upper - most position in slot 20 . accordingly , the catch member 26 is moved out of its seat 28 in the core 24 and into the space between the bottom face 22 and core 24 of collar 4 . the catch member 26 therefore performs a positive locking function by blocking the path of rotation of the lips 16 and preventing the lips from being inadvertently rotated in a direction back towards the opening 20 . hence , the collar 4 will be securely connected to the syringe cylinder 8 whereby to permit the locking of a hypodermic needle tip to the syringe cylinder and avoid the accidental loss of highly potent , rare and / or expensive materials to be infused from cylinder 8 . in the event that the physician wishes to remove the syringe cylinder 8 from the collar 4 ( for the purpose of either disposing the cylinder or substituting a different cylinder ), the cylinder removal pin 18 is once again moved to and held at its lower - most position in slot 19 , whereby the catch member 26 is returned to its recessed seat 28 to be moved out of the way of the lips 16 of syringe cylinder 8 . the physician rotates cylinder 8 so that the lips 16 thereof are aligned below the opening 20 in the bottom face 22 of collar 4 . the lips 16 of the cylinder 8 may then be easily withdrawn through the opening 20 , whereupon the cylinder 8 may be separated from the piston 2 . referring now to fig4 of the drawings , the top face 30 of the collar 4 is shown with the aforementioned threaded opening 9 extending therethrough for receipt of piston 2 . a narrow slot 32 is formed in the top face 30 . extending outwardly from slot 32 is a manually accessible mode selector button 34 . the mode selector button 34 is slideable through slot 32 ( in the direction of reference arrow 36 ) to either a freely rotated or incrementally rotated switch position . as will be disclosed in greater detail when referring to fig5 the mode selector button 34 operates in combination with a piston release button 44 , so that the rotational movement of the threaded piston 2 through the threaded opening 9 and the corresponding linear , axial movement of the piston head 6 through syringe cylinder 8 can be selectively controlled . in this manner , the piston movement is stabilized against the effects of suction or back pressure to avoid resulting variances in fluid pressures . the means by which to enable the physician to selectively control the rotation of threaded piston 2 and linear , axial movement of piston head 6 is mechanical linkage housed within the collar 4 and now described while referring to fig5 of the drawings . more particularly , the mechanical linkage includes a rotatable detent arm 38 which is located within a cavity 39 formed in the collar core 24 . detent arm 38 is mounted upon a pivot pin 40 which extends upwardly through cavity 39 and around which such detent arm is adapted to rotate . detent arm 38 has a relatively narrow detent tooth 42 formed at one end thereof . an opening ( not shown ) is formed through the other end of detent arm 38 for receiving the stem of the aforementioned piston release button 44 . the rotational movement of the detent arm 38 around pivot pin 40 is controlled by the release button 44 and a coaxially aligned compression spring 46 which surrounds the stem of button 44 between detent arm 38 and a wall of cavity 39 . release button 44 extends from detent arm 38 and along cavity 39 to a manually accessible location at a side of collar 4 . coextensively formed with cavity 39 is a narrow trough 48 . resting within and slideable through the trough 48 is a dog 50 . the dog 50 has a small aperture formed therein for receiving the stem 35 of the aforementioned mode selector button ( designated 34 in fig1 and 4 ). referring concurrently to fig4 and 5 , and in the assembled collar relationship , the slot 32 formed in the top face 30 of collar 4 is positioned above the trough 48 formed in the collar core 24 . therefore , when the physician moves the mode selected button 34 along slot 32 ( in one of the directions designated by reference arrows 52 ), the dog 50 , which is connected to selector button 34 by way of stem 35 , moves in a corresponding direction through trough 48 for a purpose which will now be disclosed . in operation , and still referring concurrently to fig4 and 5 of the drawings , with the mode selector button 34 moved to an incrementally rotated switch position along slot 32 , the dog 50 is moved to a corresponding position in trough 48 out of the way of the detent tooth 42 of detent arm 38 ( best illustrated in fig5 ). in the incrementally rotated mode of operation , the compression spring 46 biases the detent arm 38 at a first position in cavity 39 such that the detent tooth 42 is received within one of the pair of longitudinal locking grooves 3 which extends along the threaded body of piston 2 . the receipt of the detent tooth 42 in a groove 3 prevents both the rotation of piston 2 and the linear movement of piston head 6 through the syringe cylinder 8 . in the incrementally rotated mode of operation , when the physician wishes to accurately dispense material from syringe cylinder 8 in discrete , calibrated increments , he depresses the piston release button 44 ( in the direction of reference arrow 54 ) against the bias of spring 46 . the depression of release button 44 causes a corresponding rotation of detent arm 38 around pivot pin 40 ( shown in phantom in the rotated position ), such that the detent tooth 42 is moved out of the groove 3 in piston 2 . the physician rotates the piston control knob 12 ( of fig1 and 2 ) of threaded piston 2 while releasing the release button 44 . each degree of rotation of control knob 12 and threaded piston 2 causes a corresponding linear movement of the piston head 6 through the syringe cylinder 8 in one of the directions represented by reference arrows 56 ( of fig1 ). in this manner , and depending upon the direction of rotation of control knob 12 , the physician may either withdraw the piston 2 from the cylinder 8 or infuse a precisely accurate volume of material from the cylinder to a recipient . the physician continues to rotate the control knob 12 and piston 2 during the incrementally rotated mode of operation until the second of the pair of grooves 3 is moved into position to receive the detent tooth 42 . the normal bias of spring 46 rotates the detent arm 38 around pivot pin 40 , such that the detent tooth is automatically moved into the second groove 3 of piston 2 to , once again , prevent any further rotation of piston 2 and linear movement of piston head 6 . because the pair of longitudinally extending grooves 3 are at opposite sides of piston 2 , the detent tooth 42 will be received in one of the grooves 3 after each 180 rotation of the piston 2 in the manual mode of operation . thus , the receipt of the detent tooth 42 in successive ones of the grooves 3 provides an automatic locking feature and a fail - safe mechanical monitoring and drug infusion means by which to assure that the same , precisely measured volume of material is dispensed from the syringe cylinder during each 180 rotation of piston 2 . in accordance with a preferred embodiment of the invention , each 180 ° rotation of the threaded piston 2 causes a linear movement of the piston head 6 a particular distance through the syringe cylinder so as to dispense 0 . 25 cc . of material . of course , the pitch of the threaded piston 2 and / or the inside diameter of the syringe cylinder can be varied so that different volumes of material are dispensed with each 180 ° rotation of the piston . however , by dispensing 0 . 25 cc . during each 180 ° rotation ( or 0 . 50 cc . during each complete 360 ° rotation ), the volume of material dispensed will correspond with the calibration lines typically marked on the conventional 10 cc . syringe cylinder 8 . in this manner , and by virtue of the previously described self - locking feature provided by receipt of detent tooth 42 within a piston groove 3 , the physician may mechanically and visually monitor the volume of material being dispensed , so as to prevent waste and avoid infusing under and over - doses of highly potent , critically needed , rare or expensive drugs . in the freely rotated mode of operation , when the physician wishes to rotate threaded piston 2 to either continuously dispense material from the syringe cylinder or rapidly disassemble the syringe assembly 1 , he depresses the piston release button 44 ( in the direction of reference arrow 54 ) against the bias of spring 46 . the depression of locking button 44 causes a corresponding rotation of detent arm 38 around pivot pin 40 such that the detent tooth 42 is moved out of the locking groove 3 in piston 2 . with the locking button 44 depressed and the detent tooth 42 moved out of groove 3 , the mode selector button 34 is moved away from the incrementally rotated switch position and into the freely rotated switch position at an opposite end of slot 32 . the movement of mode selector button 34 causes a corresponding movement of the dog 50 through the trough 48 to a location between detent tooth 42 and piston 2 ( best illustrated in fig6 ). hence , the dog 50 functions as a stop and prevents the return of detent tooth 42 to a groove 3 in piston 2 . therefore , in the freely rotated mode of operation , and as long as the dog 50 is located in a blocking position between the tooth 42 and the piston 2 , the physician may freely rotate piston control knob 12 and threaded piston body 2 in either rotational direction in order to quickly and easily remove the piston or continuosly dispense material from the syringe cylinder . should the physician wish to return to the incrementally rotated mode of operation , he simply moves the mode selector button 34 out of the freely rotated switch position and along slot 32 towards the incrementally rotated switch position . the movement of mode selector button 34 along slot 32 causes a corresponding movement of the dog 50 through trough 48 and away from detent tooth 42 . accordingly , with dog 50 moved out of the blocking position , the normal bias of spring 46 automatically rotates the detent arm 38 , such that detent tooth 42 is returned to a locking groove 3 in piston 2 , whereupon the syringe assembly 1 is adapted for operation in the incrementally rotated mode of operation , in the manner previously described . referring once again to fig5 and as previously disclosed when referring to fig3 the physician may move a cylinder removal pin 18 so as to selectively secure or release the connection of the lips of syringe cylinder 8 to the syringe collar 4 . as was also previously disclosed , the movement of pin 18 is controlled by a spring . such a spring 58 is located in an aperture which extends from the top face 30 of collar 4 and through the collar core 24 to the catch member 26 ( in fig3 ). accordingly , spring 58 normally biases the catch member 26 out of its seat 28 in the collar core 24 so as to block any rotational movement therepast of the syringe lips ( designated 16 in fig3 ). when the physician moves pin 18 through slot 19 ( of fig1 and 2 ), the catch member 26 is correspondingly moved against the bias of spring 58 to be received within its seat , so that the cylinder lips 16 can be rotated therepast when the syringe cylinder 8 is to be secured to or released from the syringe collar 4 by way of the access opening 20 ( of fig3 ). an alternate collar 4 - 1 for forming the vernier syringe assembly 1 of fig1 and 2 is shown in fig7 of the drawings . the mechanical linkage previously described when referring to collar 4 of fig5 is replaced by a one - piece actuator 60 . actuator 60 is received in and slideable through a cavity 62 formed in the core 64 below the top face 66 of collar 4 - 1 . actuator 60 is preferably fabricated from a flexible material such as plastic , or the like . actuator 60 comprises a generally rectangular body 68 . piston locking and releasing buttons 70 and 72 extend outwardly and in opposite directions so as to be manually accessible at opposite ends of the actuator body 68 . coextensively formed with piston locking button 70 at one end of actuator body 68 is a bellows - type spring member 74 . a detent tooth 76 projects inwardly from the spring member 74 towards the centrally disposed piston 2 . the detent tooth 76 is sized so as to be received within each of the pair of locking grooves 3 formed in piston 2 . coextensively formed with the core 64 of collar 4 - 1 and extending through cavity 62 is a locking arm 78 . locking arm 78 has a locking finger 80 which is snapped into one of a pair of notches 82 and 83 formed in an adjacent side of actuator body 68 . the particular notch 82 or 83 which receives the locking finger 80 is dependent upon the location of the actuator 60 within cavity 62 . that is , with the actuator 60 moved to a first end of cavity 62 ( as illustrated in fig7 ), the locking finger 80 of locking arm 78 is snapped into a first notch 82 to prevent the lateral movement of actuator 60 through cavity 62 . with the actuator 60 moved to the opposite end of cavity 62 , the locking finger 80 is snapped into the second notch 83 to prevent an unintended return of actuator 60 to the first cavity end . to place the syringe in the freely rotated mode of operation , the physician depresses piston release button 72 in the direction of reference arrow 86 to force actuator 60 to slide to the first end of cavity 62 ( i . e . at the location illustrated in fig7 ). in the freely rotated mode , the spring 74 is relaxed , such that locking finger 80 is snapped into notch 82 and the detent tooth 76 is spaced away from piston 2 and out of the grooves 3 . accordingly , the physician is free to continuously rotate the piston 2 by turning control knob 12 ( of fig1 and 2 ) in the manner and for the purpose that were earlier described . to place the syringe in the incrementally rotated mode of operation , the physician depresses piston locking button 70 in the direction of reference arrow 84 to force actuator 60 to slide to the opposite end of cavity 62 . in the incrementally rotated mode , the spring is compressed , such that locking finger 80 is snapped into notch 83 to oppose the normal bias and tendency of spring 74 to force actuator 70 to return to the first cavity end . moreover , the detent tooth 76 is moved towards the piston 2 . accordingly , as the physician rotates the piston , the bias of spring 74 will move detent tooth 76 into receipt by successive ones of the pair of grooves 3 formed in piston 2 after each 180 ° rotation thereof for the purpose and advantage that were previously described . it will be apparent that while a preferred embodiment of the invention has been shown and described , various modifications and changes may be made without departing from the true spirit and scope of the invention . it is to be recognized that once the linear - to - vernier syringe is assembled in the manner earlier disclosed , the syringe is automatically placed in the incrementally rotated mode of operation to provide increased safety and prevent an excessive amount of material from being accidentally or unknowingly infused from the syringe cylinder . moreover , by virtue of the present invention , a physician need not constantly visually monitor the syringe when in the incrementally rotated mode . the physician may feel and / or hear the resulting locking sound each time that detent tooth 42 is received in a locking groove 3 . therefore , the physician can accurately determine the volume of material infused without being unecessarily distrated from his patient .	0
the present invention may be embodied in other specific forms and is not limited to any specific embodiment described in detail which is merely exemplary . various other modifications will be apparent to and readily made by those skilled in the art without departing from the scope and spirit of the invention . the scope of the invention will be measured by the appended claims and their equivalents . the preferred embodiment of the present invention is the sequential deposition of inorganic and organic material by plasma enhanced chemical vapor deposition ( pecvd ) onto a plastic substrate . most preferably , the entire process is conducted in a vacuum chamber . the plastic substrate used in the present in the present invention may be any substrate which would benefit from reduced gas and / or water vapor transmission in its end use . a representative but not limiting list of such substrates includes films , films for packaging , containers such as bottles , medical devices such as syringes , tubes , tubing and vials . most preferably , soft drink containers and medical devices would benefit from reduced gas and / or vapor transmission . it is within the purview of this invention that the sequential deposition of the materials may be formed by radio frequency discharge , direct or dual ion beam deposition , sputtering or plasma enhanced chemical vapor deposition , as described in u . s . pat . nos . 4 , 698 , 256 , 4 , 809 , 298 , 5 , 055 , 318 and 5 , 691 , 007 , the disclosures of which are herein incorporated by reference . the non - ideal barrier coating sequence preferably comprises multiple materials expressed as follows : referring to fig1 the apparatus for depositing materials onto a plastic substrate comprises an enclosed reaction chamber 170 in which a plasma is formed and in which a substrate or tube 171 , is placed on electrodes 172 . one or more gases can be supplied to the reaction chamber by a gas supply system 173 . an electric field is created by a power supply 174 . the reaction chamber can be of an appropriate type to perform any of the plasma - enhanced chemical vapor deposition ( pecvd ) or plasma polymerization process . furthermore , the reaction chamber may be used so that one or more substrates may be coated simultaneously within the chamber . the pressure of the chamber is controlled by a pump 188 connected to chamber 170 by a valve 190 . the substrate to be coated is loaded into chamber 170 onto electrodes 172 . for purposes of illustration , the substrate to be coated is a tube or container . the pressure of the chamber is reduced to about 5 m torr by mechanical pump 188 . the operating pressure of the chamber is about 50 to about 2 , 000 mtorr for a pecvd or plasma polymerization process and is achieved by flowing the process gases , as needed into the chamber through monomer inlet 176 and / or oxidizer inlet 178 . a radio frequency ( rf ) electrical current from supply 174 is then applied to the electrodes at a frequency of about 0 . 4 to 100 mh z and a power per electrode area of about 0 . 1 to 2 . 0 watts / cm 2 depending upon the number and proximity of the electrodes to generate a plasma and finally an inorganic or organic coating on the substrate . examples of suitable oxidizers useful for the gas stream in the plasma deposition method are oxygen , nitrous oxide , and air . examples of suitable organosilicon compounds useful for the gas stream in the plasma deposition methods are liquid or gas at about ambient temperature and when volatilized have a boiling point about 0 ° c . to about 150 ° c . and include dimethylsilane , trimethylsilane , diethylsilane , propylsilane , phenylsilane , hexamethyldisilane , 1 , 1 , 2 , 2 - tetramethyldisilane , bis ( trimethylsilyl ) methane , bis ( dimethylsilyl ) methane , hexamethyldisiloxane , vinyl trimethoxy silane , vinyl triethyoxysilane , ethylmethoxysilane , ethyltrimethoxysilane , divinyltetramethyldisiloxane , hexamethyldsilazane divinylhexamethyltrisiloxane , trivinylpentamethyltrisiloxazane , tetraethoxysilane and tetramethoxysilane . among the preferred organosilicons are 1 , 1 , 3 , 3 - tetramethyldisiloxane , trimethylsilane , hexamethyldisiloxane , vinyltrimethylsilane , methyltrimethoxysilane , vinyltrimethoxysilane and hexamethyldisilazane . these preferred organosilicon compounds have boiling points of 71 ° c ., 55 . 5 ° c ., 102 ° c ., 123 ° c . and 127 ° c . respectively . a non - ideal barrier coating sequence and comparative coatings were applied to pet tubes using the apparatus as described in fig1 with varying conditions . the tubes were positioned in the vacuum chamber , as shown in fig1 on electrodes . the chamber was evacuated to about 0 . 5 m torr . organic and inorganic coatings were applied to the tubes in various configurations . an organic coating of hmdso was deposited whereby a monomer was delivered to the chamber with a specific power supplied to the electrodes . an inorganic coating of sio x was deposited whereby a monomer and an oxidizer were delivered to the chamber at a specific pressure and power supplied to the electrodes . the system parameters used for the various sequences and controls are listed in tables 1 - 2 . pet tubes were prepared in accordance with example 1 above and then the following characteristics and properties were evaluated and the results are reported in tables 1 - 3 . when the transmission rate of a permeant , such as oxygen or water , through as barrier structure is obtained at several different temperatures , the thermodynamic energy necessary to transport the permeant completely through he barrier structure is obtained by the arrhenius equation : ## equ5 ## where δg is the energy necessary to move one mole or permeant molecules through the barrier structure in cal / mole , r is the gas constant in cal / mole - degree , t is temperature in degrees kelvin , q is the permeant transmission rate and q o is a constant unique to the structure . in practice , the transmission rate q for oxygen transport through the barrier structure is the permeance π , obtained at several temperatures . then the natural log of the transmission rate obtained at each temperature versus the reciprocal of each temperature is plotted . the slope of the resultant linear plot is - δg / r , from which δg is obtained . these data are obtained at several defined temperatures , using the same equipment as described above . the resulting permeance data ( π ) are then treated by the arrhenius equation , and δg values for the laminate are compared to δg values obtained for the components of the laminate . an ideal laminate system has a δg equivalent to that of the component with the best barrier characteristics . a non - ideal system has a δg greater than that of either component . tube samples were tested for oxygen permeance ( otr ) using mocon ox - tran 1 , 000 ( sold by modem controls , inc ., 7500 boone avenue n ., minneapolis , minn . 55428 ). a package adapter was used for mounting the tubes in a manner that allowed the outside of the tube to be immersed in a 100 % o 2 atmosphere while the inside of the tube was flushed with a nitrogen carrier gas . the tubes were then tested at 50 % r . h . the tubes were allowed to equilibrate for 2 - 14 days before a steady state permeability was determined the results are reported in table 1 . tubes were filled with a 2 ml of distilled water , close with a rubber stopper , and placed into an oven at 40 ° c ., 50 % r . h . the tubes were then weighed once per week for 4 months . the water vapor transmission rates were then calculated based on the equilibrium water loss per day . the results are reported in table 2 . to measure air permeance through tubes , the apparatus as described used in u . s . pat . no . 5 , 792 , 940 was used and has been incorporated by reference . table 1______________________________________gas barrier characteristics of tubes measured oxygen theoretical oxygen permeance permeance ( 10 . sup .- 10 moles / ( 10 . sup .- 10 moles / m . sup . 2 · sec atm m . sup . 2 · sec atm @ 40 ° c ., @ 40 ° c ., sample description 50 % r . h .) 100 % r . h .) ______________________________________pet , control 67 . 8 -- pet / sio . sub . x ( i ) 34 -- pet / hmdso 67 . 8 -- pet / hmdso / siox 34 34pet / sio . sub . x / hmdso / sio . sub . x ( i ) ( ii ) 14 . 5 22 . 7______________________________________ . sub . ( i ) sio . sub . x coating was deposited using the following conditions : power = 130 watts pressure = 120 mtorr hmdso flow = 2 . 5 sccm o . sub . 2 flow = 70 sccm . sub . ( ii ) hmdso coating was deposited using the following conditions : power = 150 watts pressure = 120 mtorr hmdso flow = 8 sccm table 2______________________________________water barrier characteristics of tubes ( example 5 ) water vapor transmission measured theoretical water vapor water vapor permeance rate permeance ( 10 . sup .- 7 moles / ( 10 . sup .- 7 moles / m . sup . 2 · sec m . sup . 2 · sec @ 40 ° c ., @ 40 ° c ., sample description 50 % r . h .) 50 % r . h .) ______________________________________pet tube , control 369 -- pet / sio . sub . x ( i ) 160 . 4 -- pet / hmdso / sio . sub . x ( i ) ( ii ) 184 . 5 160 . 4pet / sio . sub . x / hmdso ( i ) ( ii ) 98 . 4 160 . 4pet / sio . sub . x / hmdso / sio . sub . x ( i ) ( ii ) 41 . 8 102 . 2pet / hmdso ( ii ) 369 369______________________________________ ( i ) sio . sub . x coating was deposited using the following conditions : power = 130 watts pressure = 120 mtorr hmdso flow = 2 . 5 sccm o . sub . 2 flow = 70 sccm ( ii ) hmdso coating was deposited using the following conditions : power = 150 watts pressure = 120 mtorr hmdso flow = 8 sccm table 3______________________________________activation energy for air transport through tubessample description g . sub . air ( kcal / mole ) ______________________________________pet 9pet / sio . sub . x 9pet / hmdso 9pet / sio . sub . x / hmdso / sio . sub . x 29______________________________________	1
the present invention provides various configurations of an all - optical data processing device that has a significantly reduced volume in comparison with the known devices of the kind specified , and which relieves the dependence of the operation rate on a response time of an optical medium of the device through which light propagates . the present invention also provides a method for all - optical data processing and manipulation based upon the fact that several light beams that interact among themselves in a linear - medium optical waveguide generate focuses at different positions in the device , that depend on the phase and the spatial distribution of the input light . this property allows for constructing a device that is independent of the materials response time . known approaches for data processing operation use phase and / or amplitude modulation of input data . the devices of the present invention may be designed for such types of modulation . thus , the present invention provides an all - optical device that includes a linear medium based waveguide structure in the form of one or more optical waveguide units , each configured to cause diffractive interaction between several light components of the same wavelength that undergo multiple reflection ( e . g ., at waveguide unit defining dielectric / metallic boundaries ) while these components propagate through the linear medium , to create an interference pattern with multiple - focii arrangement along the light propagation path . the invention allows all - optical realization of various logical functions that may be used for constructing a fast ram module , a femto second pulse generator , a light amplitude / phase modulator , a coder / decoder , an optical switch , an analog / digital or digital / analog converter and other data processing components . the rate of the enabled information processing is close to the rate of light ( 100 thz ). to facilitate understanding , the same reference numbers are used for identifying components that are common in all the examples of the invention . fig1 a and 1b are schematic illustrations of the principles of light propagation in a linear optical medium for , respectively , a single light beam and two light beams . the figures show the light propagation in free space ( linear medium ) for , respectively , a single light beam and two light beams of the same wavelength . referring to fig2 , the principles of the present invention are illustrated for interaction of two beams of equal phases in a waveguide unit 10 suitable to be used in a waveguide device of the present invention . waveguide unit 10 is formed by a waveguide portion 11 , an input aperture arrangement 14 , and an output aperture arrangement ( not shown ). waveguide portion 11 includes a waveguide core 12 made of a linear medium ( e . g ., glass ) and having an input facet 12 a where the input aperture arrangement is formed and an output facet ( not shown ) where the output arrangement is formed . in the present example , input aperture arrangement 14 includes two input apertures 14 a and 14 b ( associated with respective input waveguides iw 1 and iw 2 ). in the present example , input aperture arrangement 14 is located symmetrically with respect to an axis of symmetry of the waveguide core 12 , namely , apertures 14 a and 14 b are equally spaced from the axis of symmetry . the input waveguides may or may not be a constructional part of waveguide unit 10 ; for example , the input waveguide may be an output waveguide of another optical device ( exemplarily also configured according to the present invention , as further described below ), or it may be an optical fiber of a communication network , etc . waveguide unit 10 is configured to ensure a change in the energy distribution of the input light , namely a divergence of each input light beam when the light beam enters the relatively wide waveguide core 12 via the relatively narrow input aperture . waveguide 10 is further configured to ensure multiple internal reflection of the input light from a side wall arrangement 12 c ( which defines for example dielectric - metallic boundaries ) of waveguide unit 10 , while the light propagates therethrough towards the output facet . these effects are achieved by providing an appropriate geometry of input aperture arrangement 14 and waveguide core 12 so as to determine an appropriate interference pattern ip that results from the interaction of the light components of the input light when they propagate through waveguide core 12 . the desired interference pattern defines a desired array of focuses , generally at f i . as described below , this allows for appropriately locating the output aperture ( s ) relative to the features of this pattern so as to provide at the output of the waveguide unit an appropriate modulation of the phase and / or the amplitude of the input light . interference pattern ip is obtained by making a cross - sectional dimension a of waveguide core 12 larger than a cross - sectional dimension b of input aperture 14 a , and by providing an appropriate configurations of side wall arrangement 12 c . this configuration may include using a reflective coating 15 ( e . g ., aluminum ) or surrounding the linear medium ( waveguide core ) 12 that has a core refractive index ( e . g ., glass with refractive index 1 . 5 ) by a medium 15 of a smaller refractive index ( e . g ., air ). generally speaking , the input aperture dimension b , the waveguide core dimension a , as well as the location of the output aperture ( i . e ., a longitudinal dimension l of the waveguide core and the accommodation of the output aperture within the output facet ) are selected in accordance with the desired operation of the device , namely , the desired input light modulation to be obtained at the output of the waveguide unit . it should be understood that the smaller the ratio of dimension b to a wavelength of the input light , the smaller the longitudinal dimension l of the waveguide portion required for the realization of the focuses . the waveguide unit of the present invention may be configured such that a cross - sectional dimension c of a surface region of input facet 12 a of the interaction zone waveguide portion , defined by the multiple - aperture input arrangement 14 , is substantially equal to or smaller than a . the dimension c is determined from the formula c = nb +( n − 1 ) d , where n is a number of the input apertures and d is a space between the input apertures . in the case a single input aperture is used ( as further described below ) where cab , c is smaller than a ( to provide the light beam divergence and thus change the energy distribution in the waveguide portion ). in the example of fig2 , c is substantially equal to a . fig3 a - 3c and 4 a - 4 b show two more examples , respectively , of the waveguide unit configurations suitable to be used in a device of the present invention for the case in which two input apertures are used and c is substantially equal to a . in each of these two examples , a waveguide unit 110 has a waveguide portion 11 formed by core 12 with the two input apertures 14 a and 14 b at its input facet 12 a , and an appropriate side walls arrangement ( which is not specifically shown ). the device dimensions in micrometers are shown in the figures . in both examples , space d between the input apertures is equal to aperture dimension b , and thus a = c = 3b . in the example of fig3 a - 3c , the cross - sectional dimension b of each aperture is substantially equal to a half a wavelength of the input light . in the example of fig4 a - 4b , b is substantially equal to a wavelength of the input light . fig3 c and 4b show the two beam interaction ( energy distribution defining an interference pattern ) for the case in which the input beams have equal phases . fig5 a and 5b show respectively two examples of a device 120 of the present invention configured for two - input beam interaction and a single beam output , where c is smaller than a . device 120 includes a waveguide unit 11 having a waveguide core portion 12 ( of cross - sectional size a ) defining input and output facets 12 a and 12 b , and a side walls arrangement 12 c . here , input aperture arrangement 14 includes two input apertures 14 a and 14 b , each of cross - sectional size b , spaced from each other a distance d = b , and arranged within input facets 12 a such that the cross - sectional dimension c ( c = n · b +( n − 1 )· d = 2b + d = 3b , where d = 2b + d ) is smaller than the cross - sectional dimension a of waveguide portion 12 . this is a so - called “ step - like ” configuration . in this specific but not limiting example , a difference δ = a − c is a half aperture size , δ = a − 4d = b / 2 . an output arrangement 16 at output facet 12 b includes a single aperture 16 a located coaxially with the axis of symmetry of waveguide portion 12 ( i . e ., at the center of the output facet ). in the example of fig5 a , two input beams a and b have equal phases and in the example of fig5 b input beams a and b have opposite phases . as shown , the interference patterns ip 1 and ip 2 are different ( both being also different from the interference patterns in the examples of fig2 , 3 c and 4 b for the case where c = a ). as shown in fig5 a and 5b , for the same device configuration ( the same dimensions a , b , d , c and l ; and the same accommodation of the output aperture ), the equal phase input ( fig5 a ) provides an output light beam c ( i . e ., the location of the output aperture matches the focus of the interference pattern ), while the opposite phases input ( fig5 b ) provides substantially no output of the device . thus , either one of the above - described waveguide units ( i . e ., having two input apertures and one output aperture ) may be operable as a phase detector device . the following table 1 ( a so - called “ truth table ”) summarizes the operation of such a device , device 120 for example , showing possible situations for the phase of an output light beam c , when both input beam is a and b are of the same phase , φ 0 or φ 1 = φ 0 + π , and when they are of different phases . here , “ 0 ” signifies no output . reference is now made to fig6 a to 6d that show a configuration ( fig6 a ) of a device ( waveguide unit ) 130 operable as a generalized diffractive phase detector , and diffractive images ( a light propagation scheme ) for three possible logical states ( fig6 b - 6d ). the device 130 is a waveguide unit having a waveguide core portion 12 with input and output facets 12 a and 12 b , and a side walls arrangement 12 c . an input aperture arrangement 14 includes three spaced - apart apertures 14 a , 14 b and 14 c . in the present example , the input apertures are located very close to each other ( space d between them being a thin reflective layer ). the input apertures are arranged symmetrically with respect to the axis of symmetry of waveguide portion 12 ( intermediate aperture 14 b coincides with the axis of symmetry and the two side apertures 14 a and 14 b are equally spaced from the intermediate one ). also , in the present example , the cross - sectional dimension c defined by the input apertures , is equal to a cross - sectional dimension a of the waveguide portion 12 . an output aperture arrangement 16 includes a single central aperture 16 a . the device operates as follows : an input light beam . c , is an information beam ( for example the output beam of the phase detector configured as the above - described device 120 ) and enters the waveguide portion 12 through central aperture 14 b , and two reference beams , generally at t , which are of equal phase ( say phase ( φ 0 ) and which have the same wavelength as the information beam c , are input to the waveguide portion through the side apertures 14 a and 14 c . as shown in fig6 b - 6d , an output beam d resulting from the interaction of the input beams always exhibits the same phase but an amplitude level that depends on the phase of information beam c : when information beam c has a phase opposite to that of the reference beam ( i . e . φ 1 ) and when there is no information beam at the input ( fig6 b and 6d , respectively ), output beam d has the same amplitude . when information beam c has the same phase as the reference beam ( i . e . ( φ 0 ), the output energy of beam d is 1 . 5 times more than in the other two possibilities of the input combinations ( fig6 c ). fig7 illustrates a device 140 formed by the above - described devices 120 and 130 , where the output of device 120 is optically coupled to the central input aperture of device 130 , output d of waveguide unit 130 presenting the output of the entire device 140 . the following table 2 (“ truth table ”) summarizes the operation of device 140 . here , a d is the amplitude of light beam d at the output of the device , and the reference beams r are of phase φ 0 . as shown , the only case when an effect of change in the amplitude of the output d occurs ( i . e ., changed from a 1 to a 2 ) is that of both initial input beams a and b being of phase φ 0 equal to that of the reference beams , while in all other cases ( both beams a and b are of φ 1 phase , or one of the beams has a π - shifted case with respect to that of the other ) the amplitude of the output d is of the same a 1 value . the following are examples of various all - optical devices of the present invention , configured to perform various types of data processing . reference is now made to fig8 a to 8c that show a device configuration ( fig8 a ) and light propagation schemes therein ( fig8 b - 8c ) operable as an all - optical adder / subtractor . a device 150 is a waveguide unit having a waveguide core portion 12 with an appropriate side walls arrangement , an input aperture arrangement 14 at an input facet of waveguide portion 12 , and an output aperture arrangement at an output facet of waveguide portion 12 . in the present example , waveguide portion 12 has a varying cross - sectional dimension defined by a two - part design of the waveguide portion , such that a cross - sectional dimension a of the first ( input ) part 13 a is larger than that of the second ( output ) part 13 b . it should however be noted that the adder / subtractor device configuration of the present invention is not limited to this specific example of the waveguide portion 12 design . the input aperture arrangement 14 is formed by three apertures 14 a , 14 b and 14 c ( each of a cross - sectional dimension b ) slightly spaced from each other ( preferably very close to each other , spaced by thin reflective regions each of dimension ad . the input apertures are arranged such that a cross - sectional dimension c of the surface region of the input facet defined by the input aperture arrangement ( i . e . the apertures dimensions , 3b , and the spaces between them , 2d , is smaller than the dimension a of waveguide portion 12 . the difference δ = a − c is about 0 . 5b . the output aperture arrangement 16 includes a single aperture 16 a of a cross - sectional dimension b . also provided in device 150 is a phase - shifting optical element 20 configured as a π / 2 phase shifter ( e . g ., a layer having a different refractive index ). phase - shifting element 20 is located at the input of the waveguide unit so as to be in an optical path of a light beam passing through central input aperture 14 b . device 150 operates as follows : a central input beam a enters the waveguide portion 12 after passing phase - shifting element 20 , and two other beams b of the same phase ( φ 0 ) enter waveguide 12 through apertures 14 a and 14 c . central beam a ( which may have a phase φ 0 or φ 1 = φ 0 + π ) thus always enters waveguide portion 12 at a phase π / 2 - shifted in comparison to that of beam b . as shown in fig8 c , when beam a originally ( prior to be phase shifted ) has the same phase φ 0 as beam b , then after the π / 2 phase shift of beam a the interaction between beams a and b results in an output beam c having an amplitude equal to a sum of the amplitudes of beams a and b . as shown in fig8 b , if the phases of original beam a and beam b are opposed ( original beam a has a phase φ 1 = φ 0 + π ), then the output beam c has an amplitude ( a − b ). the interaction between beams a and b generates either two maxima at the periphery and minima in the center of the interference pattern ( fig8 b ) or vice versa ( fig8 c ). this configuration requires the amplitude of beam b to be smaller than that of beam a (\| a \|& gt ;\| b \|). fig9 a to 9e exemplify the construction and operation of an all - optical device 160 which is a phase insensitive adder / subtractor . this device can realize the subtraction operation ( a − b ) also in cases when \| a \|& lt ;\| b \|, while the output energy c is attenuated by a factor of 2 . device 160 is a waveguide unit having a waveguide portion 12 with two input apertures 14 a and 14 b ( in this example c = a ) and two output apertures 16 a and 16 b . as shown in fig9 b and 9c , device 160 operates to divide each of the two incoming beams a and b into two symmetrical paths . the left and the right outputs 16 a and 16 b for , respectively , left and right input beams a and b , are generated at identical spatial locations , i . e ., in a beam splitting operation . if at the input a proper phase shift is generated between beams a and b ( by passing one of them , beam a for example , through a phase shifter 20 ), a subtraction operation can be obtained at one output aperture , while an adder is realized at the same time at the other output aperture . as shown in fig9 d , when beam a is originally of the same phase as beam b , then after applying a π / 2 phase shift to beam a , the interaction between beams a and b results in output beam c at output aperture 16 a having an amplitude that is a function of the sum of amplitudes of beams a and b , and in an output beam c ′ at output aperture 16 b having an amplitude that is a function of the subtraction of the amplitudes of beams a and b . the situation shown in fig9 e is opposite , corresponding to the original phase of beam a being opposite to that of beam b . the inventors have found that smaller amplitudes of input beams a and b provide for output beams c and c ′ having amplitudes of respectively ( a / 2 + b / 2 ) and ( a / 2 − b / 2 ), while for higher amplitudes of beams a and b the output beams c and c ′ have amplitudes ( a + b ) and ( a − b ), respectively . fig1 a to 10c exemplify an all - optical diffractive amplifier device 170 of the present invention . device 170 includes a waveguide portion 12 of a cross - sectional dimension a formed with three slightly spaced - apart input apertures 14 a , 14 b and 14 c ( c = a ) and one central output aperture 16 a . here , amplification of the input information beam ( entering through central input aperture 14 b ) is obtained due to the interaction of three beams — information beam a and two reference beams r ( the reference beams being of the same amplitude and phase ). a π / 2 phase shifting element 20 is provided close to or within aperture 14 b to provide a π / 2 phase shift between information beam a and reference beam r . all three beams enter the interaction region ( waveguide portion 12 ), and at certain distance l from input facet 12 a ( i . e ., at the output facet where the output aperture is located ). either a maximal ( fig1 c ) or a minimal energy ( fig1 b ) is obtained , depending on the presence of the input information beam : no output when there is no information beam ( fig1 b ) and amplified output c when there is an information beam ( fig1 c ). fig1 a - 11c and 12 a - 12 c show two examples , respectively , of an all - optical device of the present invention configured and operable as a diffractive phase detector . a device 180 of fig1 a - 11c as well as a device 190 of fig1 a - 12c includes a waveguide core portion 12 having two input apertures 14 a and 14 b and one output aperture 16 a which is located asymmetrically with respect to waveguide portion 12 ( i . e ., in the periphery region of the output facet ) so as to be aligned with one of the input apertures . in the example of fig1 a - 11c , the input aperture arrangement is such that c & lt ; a , and output aperture 16 a is aligned with left input aperture 14 a . as shown in fig1 c , when two input beams a and b have identical phases , no energy is obtained at the output . with the opposed phases of input beams ( fig1 b ), one of the beams propagates to output aperture 16 a . in the example of fig1 a - 12c , the input aperture arrangement is such that c = a , and output aperture 16 a is aligned with input aperture 14 b . actually , device 190 is configured similarly to the above - described phase insensitive adder / subtractor but with a single output aperture . when two input beams a and b have a certain phase relation (+ π / 2 or − π / 2 ), an energy maximum is obtained at one side of the output facet of the waveguide portion ( fig1 b ); and when the phase relation is opposite , the maximal energy is obtained at the opposite side of the output facet ( fig1 c ). considering that input beams arriving at the device 190 can be of the same phase or opposite phases , the appropriate phase relation ( depending on whether the output aperture is aligned with the left or right input aperture , one of the beams ( information beam a ) passes through a phase - shifting element 20 configured to apply π / 2 or − π / 2 phase shift to this beam . this configuration provides improved contrast of above 120 ( a ratio between the intensity at “ on ” and “ off ” states respectively ) as compared to that of fig1 a - 11c . fig1 a to 13c exemplify the configuration and operation of an all - optical amplitude modulator device 240 of the present invention . the device includes a waveguide portion 12 formed with two input apertures 14 a and 14 b ( in this example c = a ) and one output aperture 16 a located at the periphery of output facet 12 d so as to be aligned with input aperture 14 b . an information beam a is input through aperture 14 b and a reference beam r is input through aperture 14 a . a phase shifting element 20 is placed in the path of beam a when the beam enters waveguide portion 12 . when input beam a is in phase with reference beam r , after the phase shifting of beam a , the beams &# 39 ; interaction results in an output beam c ( fig1 b ) of increased amplitude ; when input beam a is of opposite phase to reference beam r , there is no output ( fig1 c ). fig1 a to 14c exemplify an all - optical device 250 of the present invention configured and operable as a phase modulator . the device is a waveguide unit configured generally similar to the above - described phase insensitive adder / subtractor , and includes a waveguide core portion 12 , two spaced - apart apertures 14 a and 14 b , and one output aperture 16 a at the edge of output waveguide facet 12 b to be aligned with input aperture 14 a . fig1 b shows the light propagation scheme for reference beam r only , considering there is no interaction with information beam a . as shown , an output beam c ′ is obtained with a certain phase . in order to obtain at the output of device 250 a light beam c having a phase opposite to that of beam c ′, a beam a having the same phase but double the amplitude of beam r is provided to be subtracted from beam r , as shown in fig1 c . thus , at a proper combination of phase and amplitude ratios of the input beams , a phase modulated signal c is obtained at the output . the energetic efficiency of this element is 0 . 25 . the above - described configurations of the waveguide units can be used in various combinations to construct logical elements . an all - optical processor device may be realized for phase as well as amplitude modulation of information . fig1 a to 15e illustrates how the technique of the present is used for configuring a . device 210 to operate as a logical and element . as shown in fig1 a , device 210 includes a first waveguide unit configured similarly to the above - described phase detector 190 ( fig1 a - 12c ) namely having a waveguide portion 12 formed with input apertures 14 a and 14 b and an output aperture 16 a , which is aligned with input aperture 14 b and is optically connected to a middle input aperture 14 b ′ of a second waveguide unit configured as the above - described phase detector unit 130 ( fig6 a - 6d ). the latter has a waveguide portion 12 ′ formed with three input apertures — middle aperture 14 b ′ and two external apertures 14 a ′ and 14 c ′, and with an output aperture 16 a ′ aligned with middle input aperture 14 b ′. output aperture 16 a ′ is in turn optically coupled to one of two input apertures , aperture 14 b ″, of a third waveguide unit 200 . waveguide unit 200 is configured generally similarly to the above - described phase insensitive adder / subtractor 160 ( fig9 a - 9e ), namely has a waveguide portion 12 ″ formed with two input apertures 14 a ″ and 14 b ″, but has only one output aperture 16 a ″. the phases of input beams a and b are compared using phase detector unit 190 ( it is preferred to use a phase detector with the improved contrast ). in case the phases of input beams a and b are equal , then keeping in mind that one of the beams is then appropriately ± π / 2 shifted , a maximal energy is obtained at one side ( right side ) of output facet 12 b . when the phases of input beams a and b are opposite , an appropriate ± π / 2 phase shifting of one of them provides the maximal energy at the other side of the output facet 12 b . the maximal energy output ( right output in the present example ) is connected to middle aperture 14 b ′ of generalized phase detector unit 130 to thereby direct an information beam c output from waveguide unit 190 to phase detector 130 , while the other input apertures 14 a ′ and 14 c ′ of waveguide unit 130 are input with reference beams . as described above with reference to fig6 a - 6d , for three input phase states , a beam d at the output of detector 130 is obtained with equal energy and identical phase ; and in one of the phase combination states of the inputs ( identical phases ) the output has 1 . 5 times more energy and an identical phase state . applying the subtraction operation to this output d ( as described above with reference to fig9 a - 9e ) generates a positive phase output d ′ for input beams with positive input phases and zero for all the other three input combinations . although the resulting output d ′ is amplitude and not phase modulated , this combination presents a logical and gate operation . by changing the amplitude of reference beam r , phase modulation can be obtained , as described further below . the output beam has a tilted propagation direction , which can be corrected by changing its direction or by constructing the following elements of the vlsi circuit at tilted axes . the contrast of each one of the elements in the and module is more than 120 ( i . e . a ratio between the intensity at “ on ” and “ off ” states respectively ). fig1 a - 16e show another example of an all - optical device 215 of the present invention configured and operable as a logical and element . device 215 comprises two waveguide units : a first waveguide unit configured as the above - described phase detector 190 with a phase shifting element 20 being associated with one of input apertures ( e . g ., input aperture 14 a ) and an output aperture 16 a optically connected to one of two input apertures ( aperture 14 a ′) of a second waveguide unit which is configured similar to the above - described phase modulator 250 ( fig1 a - 14c ) having input apertures 14 a ′ and 14 b ′, and an output aperture 16 a ′. when input beams a and b are of a certain identical phase ( say φ 0 ) matching that of reference beam r ( fig1 b ), then after beam a passes through phase - shifting element 20 located at the input of waveguide unit 190 , the interaction between the beams provides an output beam c that is further input to waveguide unit 250 . interaction of this output beam c with a reference beam r supplied to input aperture 14 b ′ of unit 250 results in an output d with an amplitude four times higher than that of input beam c . in all other cases , i . e ., when input beams a and b are originally of the same phase φ 1 opposite to that of reference beam r ( fig1 c ) and when beams a and b are of opposite phases ( fig1 d and 16e ), there is substantially no output ( or a relatively weak output representing “ noise ”). fig1 a and 17b illustrate the principles of the invention for constructing an all - optical device operating as a not gate for phase modulation of information ( inverter ). the not element inverts the phase of the input light . fig1 a and 17b show , respectively , three examples of waveguide units 220 a - 220 c , and light propagation schemes therein . here , waveguide unit 220 a is a typical optical fiber having a core portion of a certain diameter with input and output openings of the same diameter . as shown in fig1 b , light propagation through such a waveguide unit does not affect the phase of an input light . waveguide units 220 b and 220 c are configured according to two examples of the invention to provide a change of phase of the input light at the output . this can be achieved by passing the input light through a region of the waveguide that has a different refraction index , width or length ; as a result , the phase inversion occurs at the output . waveguide unit 220 b is configured generally similar to unit 220 a but has a region 221 of a refraction index different from that of regions 222 located at opposite sides of region 221 inside the waveguide . waveguide unit 220 c has a waveguide portion of a diameter a , input aperture 14 a of a diameter b where b & lt ; a , and an output aperture 16 a of diameter b . as shown , due to the waveguide width variation , inversion of phase of input light occurs at the output . fig1 a to 18c illustrate the principles of an all - optical device 230 of the present invention operating as a not gate for amplitude modulation of information . device 230 includes a waveguide unit having a core 12 , three input apertures 14 a - 14 c located in a spaced - apart relationship close to each other ( the arrangement is such that c = a ), and an output aperture 16 a aligned with the middle input aperture 14 b . aperture 14 b serves for inputting an input information beam a and apertures 14 a and 14 c serve for reference beams r . the not element is capable of producing an output beam c when there is no input beam . it should be noted that , although not specifically shown , an or gate could be realized using classical schemes which include not gates ( configured as described above ) positioned at the two inputs and at the output of an and element ( configured as described above ). additionally , the technique of the present invention provides for configuring a trigger element . to this end , classical schemes can be used including two logical gates ( those described above ), the output of each gate being connected to input of the other gates . the technique of the present invention can be used for the realization of a pulse generator . the pulse generator may be realized based on a not gate for amplitude modulation of information . to this end , it is sufficient to amplify the output of a not gate using a diffractive amplifier module ( configured as described above ) and to connect the output of the amplifier to the input of the not gate . such a feedback generates pulses at the device output . a frequency of the generated pulses is inverse proportional to the overall length of the device ( or the feedback loop ). the amplifier may be positioned at the feedback loop itself , the length of the overall device being thus decreased and the frequency of the generated pulses maximized . the principles of the technique of the present invention can be demonstrated for water waves instead of optical waves . the wave equation of water is similar , but the wavelength is more than 10 , 000 larger , and hence the device construction is scaled up and becomes easier . such an experimental device ( bath ) is illustrated in fig1 . a projector was used to project images of the waves on a wall . a motor was used to generate the waves . the rotation speed was adjusted such that the wavelength is 4 cm . the constructed device is the basic building block of an and gate , namely a phase detector with improved contrast ( i . e . a comparator ). fig2 a presents the result of an interaction between two input beams of equal phases . an interaction region ( marked in the figure ) fits well to the numerical simulations including a number of wavelengths required to obtain the desired interaction . a relevant interaction , after some image processing of the contrast enhancement , is separately shown in fig2 a . as can be seen in this experimental image ( as well as in the numerical simulation ), the wave curvatures at two sides of the focus point ( the interaction region ) are opposite . in case the two inputs are at opposite phases , no interaction occurs as shown in fig2 b . the experiments have shown that when a rotational speed of the motor generated wavelength that did not fit the dimensions of the waveguide , no interaction was generated . this effect is completely anticipated also form the numerical investigation . advantageously , and in contrast with the known all - optical methods and devices for manipulating light , the method and device of the present invention provide for making small volume processors , low cost processors without non - linear materials , which are simple for fabrication , and provide ultra fast operation rate even higher than those obtainable with the non - linear optics realization . the technique of the present invention allows for making an all - optical data processing device very small , with the operation rate being substantially independent of a response time of a waveguide medium through which light propagates ( i . e ., independent of the materials response time ). the rate of the enabled information processing is close to the rate of light ( 100 thz ). those skilled in the art will readily appreciate that various modifications and changes can be applied to the embodiments of the invention hereinbefore described without departing from its scope defined in and by the appended claims .	6
it is to be understood that the figures and descriptions of the present invention have been simplified to illustrate elements that are relevant for a clear understanding of the invention , while eliminating , for purposes of clarity , other elements that may be well known . those of ordinary skill in the art will recognize that other elements are desirable and / or required in order to implement the present invention . however , because such elements are well known in the art , and because they do not facilitate a better understanding of the present invention , a discussion of such elements is not provided herein . the detailed description will be provided herein below with reference to the attached drawings . the submersible robotically operated vehicle is a unique and novel , unobvious integration of , and refinement to the prior art . the srov has transformed the remotely operated vehicle into the robotically operable vehicle . a remotely operated vehicle requires both the participation of a remote operator , as well as divers and surface attendants . a robotically operable vehicle incorporates an end - to - end automation suite that dramatically reduces the need for human intervention yet leaves the potential for conscious and intelligent human control open at all levels . the preferred embodiment ( fig2 ) is comprised of the following major subsystems : ( 1 ) an srov ( 220 ); ( 2 ) a mp ( 211 ); and , ( 3 ) an oc ( 230 ). the mp ( 211 ) is a non - srov facility used to manage the umbilical and the debris line . the umbilical ( 212 ) supplies both power to the srov and communication ( i . e . both sensing and control signals ) between the srov and other subsystems . the umbilical supply reel ( 214 ) manages the paying out and recovery of the umbilical in unison with the travel of the srov . the debris line ( 213 ) carries debris pumped from the srov . an overhead crane ( 215 ) is utilized to insert or remove sections of debris line hose ( 216 ) as to synchronize debris line length with that of the umbilical . the debris line terminates into the debris reclamation interface ( 219 ) allowing for proper debris disposal . the oc ( 230 ), including the ccu , is used to plan and manage autonomous performance by the srov of tasks , activities , and goals ; provide operator - initiated control ; and to monitor , present , display , record , analyze , and respond to status signals from the srov . the srov ( fig3 ) comprises a number of standardized assemblies and modules , described below . srov modules share certain common components , common means for connecting to other modules , and a degree of common construction . the latter includes materials selection for frame and body components and could range from an appropriate composite material , or alternatively , anodized marine grade aluminum , or even a marine grade of stainless steel . these and other selections of material or detailed construction are irrelevant to their novel application . each assembly and module capable of articulation uses actuators to control power and movement , and sensors to monitor a plurality of conditions — which in combination effect the instrumented articulation for the srov at each of the separable levels of module , sub - unit , and srov - as - a - whole . for any subset of module , instrumentation , actuators , and sensors — one or more modules or sub - modules , for the srov as a whole — these actuators and sensors may be controlled and monitored within the srov ( e . g ., autonomous control ), or remotely ( e . g ., remote control ). the srov modular architecture incorporates and integrates ( 1 ) technologies common to modules , ( 2 ) capabilities specific to a particular module , and ( 3 ) configurability that aggregates the capabilities of multiple modules . this physical modular architecture is paralleled with internal computer architecture . encapsulation at a functional level enables implementation details and current sensory feedback to be pushed down to the most appropriate and most readily correlated and correctable level . problems within a particular module are separate from overall srov operation , allowing replacement to be managed with a least level of effort . online , autonomous “ track - and - swap ” capability , allows for repair without requiring the entire srov to be removed from service . in the preferred embodiment , sensors are embedded into all modules to track external ( e . g ., temperature , pressure , electrical conductivity , chemical toxicity levels ) and internal ( e . g ., connectivity , stress , accelerations ) conditions . each module is capable of ‘ self - awareness ’ that can be communicated beyond the scope of an internalized model of the environment , but as experience in real - time . these actuators and sensors are linked both within the module and to the mp and oc , enabling both local ‘ reflexes ’ and remote ‘ intelligent , conscious control ’. for purpose of the preferred embodiment , each combination of oc , mp , and srov modules function as an integrated whole , spanning operations capacity ranging from the fully automated to fully under human control . srov components ( e . g ., the modules , tools , and assemblies described herein ) are easily interconnected in numerous configurations so as to provide a wide range of functionality . this is accomplished by standardizing the mechanics and method of module interconnectivity . standardized module interconnectivity comprises both ( 1 ) a mechanical means for hardware interconnection of , and transfer of physical resources between , modules , and ( 2 ) a signaling means for software interconnection of and transfer of informational resources between modules . the mechanical inter - module connection means provides support for physical module connection and for the physical interconnection of the bus , which is the conduit of resources between modules , and is mediated by standardized interfaces . preferably , the mechanical means serves the dual purpose of a physically stable connection of modules and a protective shield around the bus where it interconnects to transfer bus resources between and across modules . the bus comprises a standardized set of power conductors ( i . e ., means for conveying power ) and communications conductors ( i . e ., means for conveying signals ) for conveyance of bus resources between modules and subsystems . bus resources include , without limitation , signals and power ( e . g ., hydraulic , electrical , pneumatic , mechanical , etc .). signals may share a common networked conductor ( e . g ., by multiplexing ) and the number and type of power conductors are standardized ( and preferably minimized ) throughout an srov ( including the modules , tools and assemblies ). this approach resolves a prior art limitation , where the mating of conductors depends upon the number and function of conductors , or the type of modules being interconnected , and greatly limits configuration flexibility . a single , standardized design for each of ( a ) a srov power and communication bus (“ bus hereafter ) being divided into a plurality of bus segments , ( b ) a connector , the srov plug (“ plug ” or “ plugs ” hereafter ), and ( c ) a mating connector , the srov socket (“ socket ” or “ sockets ” hereafter ), to provide a standard method for physical interconnect of bus segments running between modules , assemblies , and subsystems . the architecture of the bus , as shown in fig1 a , includes primary hydraulic supply and return lines ( 1123 ), auxiliary hydraulic supply and return lines ( 1124 ), electric power conductors ( 1125 ), and communication conductors ( 1127 ). other or additional connectors , conductors , or alternative means of conveyance may be used in this embodiment . the hardware interconnection of srov modules , as shown in fig1 b and fig1 c , utilizes plug ( 1130 ) and socket ( 1131 ) for simultaneous and transparent hardware interconnect , and to pass the bus resources via the bus ( 1110 ) between modules . in this embodiment , a plug or socket encapsulates the connectors of the individual conductors of the bus and passes the bus between modules by providing connection , seating , and seal ( e . g ., against pressure , leakage , corrosion , etc .). in some environments , the plugs and sockets may be of the “ quick connect ” and “ quick disconnect ” variety ( well known in the prior art ), further improving the ease with which srov configurations may be effected . plug and socket bodies are machined from non - corrosive metal such as marine grade stainless steel or cast from a high - strength , composite material . for each type of individual bus conductor , a proper seating , and seal ( e . g ., against pressure , leakage , corrosion , etc .) is provided . the contours of the interlocking nesting between plug and socket create areas for environmental seal by machine fit , incorporation of o - rings , or other approaches well known in the art . the hardware interconnection architecture , also shown in fig1 b and fig1 c , includes a pair of adapters , corresponding to the interlocking profile of the plug and socket and having the requisite mechanical structural integrity for cross module interconnection . a plurality of adapter diameters is incorporated as to accommodate differing diameters of srov modules and includes : ( 1 ) a large plug adapter ( 1132 ) and a large socket adapter ( 1133 ), used to provide mechanical connection for the larger modules ( e . g ., frame module and shoulder module ); ( 2 ) a small plug adapter and a small socket adapter ( not shown ), used to provide mechanical connection for smaller modules ( e . g ., the units of the articulation and the hand module ); and , ( 3 ) an auxiliary plug adapter and auxiliary socket adapter ( not shown ), used to terminate an umbilical version of the srov bus into a flush mount socket . for the purposes of describing this embodiment , when the term plug or socket are used below , in reference to a module or sub - module , the incorporation of the proper corresponding adapter is to be included by above reference . an adapter provides for insertion of a plug or socket connector through a receptacle area milled from the center of the adapter . a lip on the face of this cutout conforms to a reveal in the face of the connectors so as to provide a stop for the insertion . the contours of the interlocking nesting between the connector and the adapter provide additional areas for environmental seal by machine fit , incorporation of o - rings , or other approaches well known in the art . to assure proper connection , insertion and orientation , a plurality of alignment mechanisms , such as a notch that corresponds to a groove , are incorporated in the following areas : ( 1 ) on a plug face and corresponding socket face to assure proper connection ; ( 2 ) on an outer body of plug or socket and corresponding interior of an adapter cutout to assure proper insertion ; and , ( 3 ) on an adapter face and corresponding mating adapter face to assure proper orientation . mechanical fasteners affix the plug or socket into the corresponding adapter . additional mechanical fasteners secure the adapter , through a plurality of mounting holes located around both edges of the flange perimeter , allowing one side to be bolted to the module , and the other to its mating adapter . the software interconnection or communication portion of the bus provides network connectivity , preferably over a fiber optic cable as the conductor . signals include , for example , control signals and sensor signals . control signals convey commands to actuators and sensors . sensor signals convey , for example , operational information such as status , location , motion , solution pattern currently being executed or scheduled , function , damage , history , and current model , and environmental information such as temperature , pressure , and conductivity . each module contains local intelligence in the form of a module control unit (“ mcu ” hereafter ) ( described below ) so that the module selectively accepts only those control signals intended for it , and executes only relevant commands . this means , for example , that a module need respond only to module - specific safety constraints ( inter - module physical interference or co - positioning efforts will be ignorable by other modules in the srov unless or until control and tasks of the srov as a whole , as opposed to the directly contacting modules , are involved . other localizable subordinate interactions can be embedded such as loss - of - connection responses , blockage or wear warnings , or similar ‘ local reflexes ’. actuators and sensors within a module are connected to the portion of the bus used for communication signals via the mcu in that module . the mcu responds to commands , locally collects and interprets sensor signals ( including feedback of positioning , movement and other results such as module or environmental measurements ), and activates or deactivates actuators . this design provides the mechanisms and information necessary for a complete , closed - loop automation feedback cycle . preferably , signals are formatted using a standard language for command , control , and sensing , as discussed in more detail below . configuration ease and flexibility is achieved by the standardized connections between modules and the ability of mcus within modules to be interconnected ( both mechanically and with respect to bus resources ) and to communicate , and identify themselves to other mcus . the master module control unit (“ mmcu ” hereafter ) and the ccu ( described below ), without mechanical or software re - engineering — interpret , aggregate configuration , and provide monitoring , control , and functionality of an srov body and attachments resulting from interconnection . any of the modules described herein may be interconnected with “ plug - and - play ” simplicity , thereby enabling the srov with the functionality necessary for a wide range of work processes and environments . integrating tactile or ‘ haptic ’ sensors at any level of module enable real - time , real - world coordination between operating model and real world conditions of both environment and that module itself . field operations personnel can easily configure srov modules ( described above ) and in support of an unlimited array of work processes and environments . this includes the automated remediation for any of the following : interior infrastructure surfaces as characterized by size , geometry , and irregularities ( e . g ., curves , slopes , angles , or protrusions ); exterior infrastructure surfaces ; a variety of types and amounts of fouling ; and , specialized tasks by easily integrating third - party or custom tools . each module of the srov incorporates both on - board or module - specific intelligence and instrumentation ( the ‘ mii ’ first referenced above ) that are interfaced to the communication portion of the bus . preferably the on - board intelligence is a programmable computer having at least a memory unit , a processing logic unit , a stored program for the module suited to the processing logic unit , and an i / o unit or on - board sensor and instrumentation . input is taken regarding the module &# 39 ; s external environment and internal status , and output is produced regarding motion or current status for the module . on - board intelligence is pre - programmed to control the detailed functionality of the module responsive to external signals ( both control and sensory ) and to collect and aggregate data from the instrumentation . this provides each module with a degree of articulation and the means for the control and monitoring of that articulation as well as the monitoring of the resultant effect upon the experienced environment . thus a track tool could have intelligence and sensors focusing on position , location , energy usage , internal temperature , drive tread motion , and pressure ; while a debris removal tool might have intelligence and sensors focusing on spin , resistance , temperatures , pressure , and surface conductivity . an interruptable but closeable loop feedback and control system is created by the instrumentation of srov motion , the observation of srov location or other operations within the external environment . feedback collectively includes signals or information from any output device , or actuator ; any sensor for the external environment ; any sensor for the internal status ; any on - board logic - processing and memory units or any embedded program . these may be monitored and controllable through automated , automatable , or manual efforts at the mp or even the oc providing the feedback link for an interruptable but closeable loop feedback and control system . control signals , received by the module over the bus are filtered to determine if they should be implemented within the module . signals are transformed , according to control templates , from generic commands ( e . g ., for positioning and movement ) into the detailed commands necessary to achieve the desired result using the actuators within that particular module . sensors respond with feedback of positioning , movement and other environmental results to provide a complete , closed - loop , automation feedback cycle , and as more fully described in the distributed control section below . mechanical motion of a module is generated and governed through a set of standardized actuators , joint assemblies , and sensors . this includes control of the mechanical movements required of the actuators , as well as the monitoring and feedback of the results and impact of the actuation . standard joint assemblies include but are not limited to : ( 1 ) a sliding joint assembly ( fig1 a ) is incorporated into the articulation module as well as various tools to provide means for controllable inline motion or extension ; ( 2 ) a rotary joint assembly ( fig1 b ) is incorporated into the shoulder module , as well as various tools , to provide controllable rotation capability ; and , ( 3 ) a multi - axis joint assembly ( fig1 c ) is incorporated into the frame module and wrist unit , as well as various tools to provide controllable multi - axis articulation and rotary positioning ( i . e ., radial orientation ). not excluding other potential embodiments , the multi - axis joint assembly consists of a plurality of rotary joint assemblies and where one set is positioned perpendicular to the longitudinal axis of the joint ( 1240 , 1244 , and 1248 ), while another set is positioned at an offset angle ( e . g ., twenty - two and one half degrees ) ( 1242 and 1246 ) in this embodiment . as additional rotary joint assemblies are added , the overall possible angle of the articulation for the joint increases . this above approach provides an accurate radial and rotary positioning while providing an exoskeleton for internal routing of and protection of the bus . each individual joint assembly utilizes standardized parts and comprises : ( 1 ) a drive sub - assembly ( 1210 and 1232 ) to create the proper articulation ; ( 2 ) a bus sub - assembly ( 1220 and 1230 ) to route the bus across the mechanical connection ; and ( 3 ) a control sub - assembly ( not shown ) to operate the actuators and monitor the sensors as to intelligently instrument its articulation and enable current - status feedback and control . the drive sub - assembly consists of a mechanical coupler , drive mechanism , and hydraulic actuator : the mechanical coupler enables the desired articulation ( e . g ., differential , inline , linear , radial , or rotary ) and is constructed to provide the requisite structural integrity as to be able to withstand moments of inertia and other load factors . it is comprised of hardened and corrosion proof materials and has bearing surfaces of a proper material to assure a smooth and stable motion as well as reduced friction and wear . the drive mechanism incorporates a self - locking mechanical drive ( i . e . worm drive , or screw jack ), and is thereby able to avoid the possibility of reverse torque from altering position . it eliminates the need to provide constant power to the actuator ( motor ) as a means of holding position , and avoids the potential of premature wear or failure . the hydraulic actuator provides the force to power the drive mechanism as to control and manipulate the mechanical coupler . it is fabricated from corrosion resistant materials , is sealed in an environmental housing , and is further protected by a bath of dielectric oil . the bus sub assembly consists of the bus conductors ( power and communication ) within the joint assembly and the requisite bus coupler to transfer bus conductor connections across the motion of the mechanical coupler ( i . e . inline , linear , radial , or rotary ). it is packaged in an environmentally protected housing to protect against corrosive elements and may be co - located with the control sub - assembly within the same housing . the control sub assembly includes a positioning sensor to indicate the position of travel of the mechanical coupler , additional associated sensor arrays as required to instrument articulation issues ( e . g ., speed , acceleration , force , pressure , and resultant environmental or other conditions ), means to collect and transform sensor data into meaningful feedback in support of autonomous operation , and interpolation of sensor feedback into a self - model of localized constraints and ‘ reflexes ’ ( stimulus - response without override ). each module and assembly contains within itself the above described on - board intelligence and instrumentation , and physical and mechanical means , these are synchronized in an on - board and internal self - model , which is stored in the memory . the processing logic unit uses signals from the instrumentation ( e . g ., sensors ), both for performing design functions , and for enabling real - world comparison between the module &# 39 ; s self - model and the reality it currently senses and affects . the use of a standardized and encapsulated modular programming structure allows localized signal / sensory performance guidance as well as transmittable feedback on goal attainment . specific exception recording can account for unit deviation from standard expectations ( e . g . wear - caused degradation ) without requiring or affecting overall reprogramming of either the srov or other modules . as exemplified in fig5 a , the mcu ( 527 ) residing in track tool ( 350 ), decodes a command from bus ( 1110 ) to make contact with the work surface as had been issued by the oc . in response , the track tool mcu ( 527 ) generates a signal onto the bus requesting forward extension . this signal is decoded by mcu ( 517 ) located within the extensible arm unit ( 1500 ). in response , mcu ( 517 ) activates linear actuator ( 513 ) to begin a powered forward extension ( 515 ). upon the inboard track making contact with the work surface ( 531 ), the associated inboard track sensor ( 529 ) indicates contact via increased pressure . in response , track tool mcu ( 527 ) generates a signal onto the bus to halt extension . the extensible arm mcu ( 517 ) decodes this signal and in response , deactivates linear actuator ( 513 ). as exemplified in fig5 b , a similar process is repeated where the track tool mcu ( 527 ) generates a signal onto the bus to square up the track tool upon the work surface . the mcu ( 557 ), located in wrist unit ( 1520 ), decodes the signal and in response activates multi - axis actuator ( 553 ) to begin an axial articulation ( 555 ) to rotate the track tool down onto the work surface . when the outboard track makes contact with the work surface ( 561 ), and the associated outboard track sensor ( 559 ) indicates equal pressure to inboard track sensor ( 529 ), in response , track tool mcu ( 527 ) generates a signal on the bus to halt articulation . wrist unit mcu ( 557 ) decodes the signal , and in response , deactivates multi - axis actuator ( 553 ). sensors include any of the set of possible internal - to - the - module sensors ( e . g ., position , orientation , speed , electronic resistance , magnetic , accelerometric , force , pressure or chemical differentiation , angular deflection , haptic , self - check diagnostics , and other conditions ) that are desirable to affect a feedback linkage between current condition and modeled norms for the module , both as to its function and status . any of a number of specialized tools ( e . g . grinders , propellers , treads , pumps , jets , welding apparatus , sealing apparatus , levers , hammers , jacks , grippers , caulkers , and other standard mechanical and physical repair and maintenance devices ) can be an operable part of any modular component , a device subject to that modular component &# 39 ; s effort . each operating tool , or device , or each actuator for placing the modular component or srov into the proper position , will be linked with appropriate external and internal sensors to form the feedback link which can communicate the tool &# 39 ; s effect on both the external environment and the module and thus , on the srov . the srov comprises a plurality of modules ( inter - connectable via the previously described module interconnection technology ) categorized by functional types and having a common architecture . these include at least the following types ( fig3 ): frame module , shoulder module , articulation module , and hand module . a frame module ( as shown in fig1 and for the purposes of the preferred embodiment ) is an articulatable “ spine ” ( 1300 ) that provides the foundation upon which the srov is built and forms its “ core .” to enable flexible navigation , either end of the frame is fitted with a multi - axis joint assembly ( 1350 and 1351 ). the bus ( 1110 ) is passed through the joint assemblies terminating in a plug ( 1130 ) and adapter ( 1132 ) at the proximal end socket ( 1131 ) and adapter ( 1133 ) at the distal end . shoulder modules may be connected to either end of the frame module , or alternatively , multiple frame modules may be interconnected to extend the body of the srov and expand its functionality , while permitting articulation . enclosed in an environmentally protecting tube ( 1330 ) of the frame module are the following units , which contain all of the sub - systems required to manage , monitor , operate and navigate the srov , and including but not limited to : the master module control unit ( 1310 ) to both receive control signals from and communicate data signals to the ccu ; to register ( e . g ., identification , functionality , and configuration ) and to then monitor and provide coordinated control of the modules and assemblies attached to the frame module by the issuing of control signals to , and by the aggregating of data signals from , the mcus located within these other srov modules and assemblies . module control unit ( 1312 ) specific to the frame module as to operate internal module equipment including the monitoring of thresholds of sensors for values that have been or are about to be exceeded , and if so , to generate signals onto the bus indicating the need for corrective action , enabling either the ccu , the mmcu , or both operate and navigate the srov . sensor bay ( 1314 ) to house sensors oriented to general operations and navigation and that may include sensors to detect orientation ( e . g ., lateral and longitudinal trim , depth , etc . ), tilt ( e . g ., pitch , yaw , or roll ), position ( e . g ., external references , transit , natural landmarks , or artificial landmarks from which srov position may be computed relative to a map ), and control sensors to indicate all critical operational aspects of the srov ( e . g ., fluid pressure , voltage , amperage temperature , etc .). the hydraulic power unit ( 1316 ) converts electrical power into hydraulic fluid pressure so that it may be delivered through the power portion of the bus . an electric motor , housed in a chamber of dielectric oil , extends its shaft through a rotary seal as to connect to a hydraulic pressure pump . the pump side of the chamber is filled with the hydraulic fluid that serves as the pump reservoir . the pump feeds into the supply side of the bus , while the return line of the bus feeds back into the reservoir . the failsafe unit ( 1318 ) provides emergency override and comprises a set of redundant critical components ( e . g ., mmcu and mcu , an auxiliary hydraulic power unit , an emergency control unit , and an emergency power back - up battery bank including a charging circuit ). it implements software and hardware to automate failover to those components in event of a failure of primary components of the srov . a back - up battery bank powers srov emergency procedures ( e . g ., shutdown , report , retraction , return or other ). the failsafe unit monitors signals and operational conditions via the bus . it may be triggered in response to receipt of an explicit command or may be programmed to be triggered on a detection of wide variety of input signals , and predetermined or abnormal conditions such as power failure , component failure , loss of communication with the cu , etc . on detecting such a condition , it activates a corresponding failover procedure that may include emergency shutdown or other responsive procedure subject to situational constraints . failover or emergency shutdown procedures may , for example , retract all articulators and place vulnerable electronics or mechanics in a safe mode in preparation for manual extraction . alternatively , an emergency srov self - extraction program may be triggered , depending on the last known status report ( s ) available to the fail - safe unit , causing the srov to “ back out ” of the conduit by at least partially reversing its recorded path . additionally , a fail - safe unit will have on - board memory , processing , and program components comprising the control and operating management device to implement automated operation of pre - programmed , situation - specific tasks as best match up with the last signal inputs stored and received before the loss of umbilical - provided power ; and a set of stimulus - response programmed activities stored in the on - board memory , against which the on - board processing component compares the last signal inputs stored and received to determine and activate the best matching response , using the same last signal inputs stored and back - up battery bank power limit as the situational constraints on the selection . a shoulder module ( fig1 ) comprises a controllably rotating frame around a central shaft connectable to a plurality of articulation modules , and provides means for the radial rotation of a plurality of articulation modules around a central shaft . a plurality of shoulder modules may be configured in an srov . position and orientation , both localized and global , of the rotating frame may be sensed via the bus and on - board sensors for the shoulder module or a specific sub - portion pertinent to a specific sensor . the shoulder module ( 1400 ) specific components and assembly comprises : a central shaft ( 1430 ) contains bus ( 1110 ) and where the proximal end of the central shaft is affixed with plug ( 1130 ) and adapter ( 1132 ). the shaft distal end is affixed to socket ( 1131 ) and adapter ( 1133 ). this allows the transparent interconnection and passing of bus resources between the shoulder and frame module or between a plurality of shoulder modules . rotary joint assembly ( 1444 ) is fitted to rotate upon central shaft ( 1430 ). the proximal end of a plurality of sockets ( 1450 ) ( four in the figure ) are affixed to rotary joint assembly ( 1444 ) and preferably arranged in a radial and equi - angular manner . the distal end of said sockets are affixed to articulation module frame ( 1460 ). a bus splitter ( not shown ) is installed within the central shaft as to provide the bus ( 1110 ) into the inner section of a bus sub - assembly ( 1440 ) that is affixed to the central shaft ( 1430 ) adjacent to rotary joint assembly ( 1444 ). affixed to the outer section of said bus sub - assembly is a second bus splitter ( not shown ) and in this embodiment , the outputs connect the bus ( 1110 ) to the sockets ( 1450 ) ( four in the figure ), and to the mcu ( not shown ) for the purpose of governing drive sub assembly ( 1442 ) co - located with bus sub - assembly ( 1440 ). a protective cover is installed on either side of the articulation frame and comprises a top section ( 1470 ) and bottom section ( 1472 ). the articulation module consists of a plurality of inter - connectable types of units , deployed in various configurations to provide greater articulation , and that singly or in combination will comprise a complete articulation module : specific types of units include at least : ( 1 ) ( fig1 a ) an elbow unit ( 1530 ) to provide means for redial realignment of an arm unit and may be configured in a plurality of different angles ; ( 2 ) ( fig1 b ) a wrist unit ( 1520 ) incorporating a multi - axis joint to provide multi - way articulation and rotary positioning ; ( 3 ) ( fig1 c ) a fixed arm unit ( 1510 ) that may fashioned in a plurality of lengths ; ( 4 ) ( fig1 d ) an extensible arm unit ( 1500 ) that incorporates a sliding joint assembly as to be able to extend and retract ; and , ( 5 ) a brace unit ( 1540 ) comprising a plurality of means to increase structural bracing and stability . the proximal end of each unit ( excepting the brace unit ) is affixed with a plug ( 1130 ), while the distal end is affixed with a socket ( 1131 ) to enable passing of bus resources between units and / or modules via the bus . one embodiment of a combination of shoulder and articulation modules is shown in fig4 a and where shoulder module ( 1400 ) can be configured to several modular units , and where these units have a standard means of inter - connection as to provide a wide range of configuration versatility , and in this view includes the extensible arm unit ( 1500 ) and the wrist unit ( 1520 ) and to which is affixed a track tool ( 350 ). as shown in fig4 b , the extensible arm unit ( 1500 ) includes a powered extension and retraction capability . as shown in fig4 c , the wrist unit ( 1520 ) includes a powered multi - axial articulation capability . the hand module ( 1610 ) functions as an integration platform between the srov and tools used by the srov . the proximal end of the hand module is fitted with a plug to pass bus resources into an mcu and an auxiliary socket located in the hand module frame . the distal end of the hand module is conformed into a mounting plate ( 1620 ), to stably and robustly affix it to an associated tool . incorporated into the mounting plate is a socket featuring additional power conductors to distribute a plurality of channels of power under the control of the mcu , for utilization by the tool . a developer kit , preferably operable upon a personal computer , facilitates integration of a specific tool into the hand module . developers can to easily and seamlessly integrate third party tools into srov operation by defining tool specifications , physical characteristics and srov reciprocal requirements or constraints so they may be stored in the hand module mcu in a standard format . tool functionality can be mapped in terms of signals , commands , or other command , control , and sensor language elements so that , from the perspective of the mmcu and the ccu , or other modules , signals to and from a hand module use the same interface as any other module . mechanically , tool developers need be concerned only with providing mechanical connection to the hand module socket , creating distribution of power into the appropriate number of controllable channels , and connecting signal conductors from the tool to the communication portion of the bus . if analog controls or signals are necessary in the tool , analog - to - digital or digital - to - analog conversion is the responsibility of the tool provider . this easy , standardized and pre - packaged access to power and communication , in combination with a ccu developer programming interface , enables field engineers to quickly adapt existing or new generation tools into the srov system . the following types of tools are disclosed for purposes of the preferred embodiment : a tractor tool ( 350 ), to provide a means for “ crawler ” type controllable propulsion . a male tool mounting plate is attached to the top of the tractor frame . internal to the frame is a rotary joint assembly that drives a geared tractor drive wheel assembly . a set of dual tracks , are fitted to the drive wheels to assure a high degree of traction , and the ability to navigating misaligned surfaces . in the preferred embodiment , a tractor tool comprises of a set of hydraulically powered , track - encircled wheels for engaging a multiplicity of surface types and angles , and thereby providing a high degree of traction , and ability to navigate misaligned surfaces . the thruster tool , ( not shown ) provides means for “ swimming ” type propulsion . it consists of a mounting plate , and frame containing a rotary joint assembly that is used to power an impellor and that is enclosed within a cylindrical cage . the debris removal tool ( fig1 ) provides a means to controllably remove high volumes of material from a surface . a hand module , ( 1610 ) is attached via its mounting plate ( 1620 ). a rough cut unit ( 1630 ) ( i . e ., any tool capable of cutting , ripping , chipping , tearing , or digging away debris down to a uniform stubble ), in this embodiment , consists of a pair of closely spaced , counter - rotating , carbide toothed , circular blades , and where the counter - rotation of dual blades offsets the transfer of potentially damaging moments of inertia , should the blades encounter difficult debris conditions . a fine cut unit ( 1640 ) ( i . e ., any tool able to remove the stubble and / or polish the surface ), in this embodiment , consists of a plurality of shafts featuring a spring loaded shaft insert ( providing conformance to minor work surface variations ). the distal end of said shaft insert is threaded in order to accept industry standard cutting brushing , and polishing implements so as to enable selection from numerous alternatives and deliver best practice restoration of work surface conditions . for illustrative example , spur polishers are shown in the figure . the srov debris recovery tool ( fig1 ) provides means to controllably recover debris in an environmentally responsible and regulatory compliant manner . a pair of hand modules ( 1610 ) is attached to each side of the debris recovery frame . the hopper mouth ( 1720 ) is preferably adjustable ( e . g ., via adjustable side skirts that conform to the surface or via a hydraulically inflatable and conformable wire mesh ) and that conform to surface of conduit . water jets ( 1735 ), located in the hopper mouth , are powered by a pump ( 1730 ), and direct debris back into the crushing mill ( 1740 ). an acquisition upper and lower roller pair features interlocking tine shaped teeth that engages the debris and reduces it to a uniform smaller sized chunks . a second roller pair reduces debris into a small particulate , while a final set reduces debris into a slurry . the rear of the hopper contains an ejection pump ( 1750 ) ( e . g ., a trash pump or other pumping means ), which moves debris through the debris line . a set of variable size collets support differing diameter of debris line hose ( 1760 ). the srov inspection tool ( fig6 ) comprises a variety of sensor hardware ( 611 ) and enables flexibility in mounting location ( e . g ., an extensible probe ( 610 ) projected in front of or behind the srov ), and interfaces to the bus via the mcu in the hand module . one configuration may use a mounting plate onto a hand module for resource and attachment . another configuration may use an auxiliary socket as resource and mechanical attachment . an alternative may include the use of an umbilical bus to allow remote positioning of the enclosure and attachment by means of a clamp . multiple inspection and sensing modalities are enabled so as to reduce reliance upon visual devices ( e . g ., remote camera monitored by a remote operator ) or human vision . inspection activities may include real - time before and after sensing of work process performance , resultant surface finish and sub - surface structural condition , or the environment mapping to support navigation , orientation , and positioning . signals from these sensors are transferred to the surface via the umbilical , where they may be further analyzed and recorded by the ccu . inspection sensors may be incorporated into srov tools such as the debris removal tool ( 1600 ), track tool ( 350 ), or debris recovery tool ( 1700 ). signals are selectively transferred to the surface via the communication portion of the bus and the umbilical , where they may be further analyzed and recorded by the ccu . types of sensors well - known in the art and easily adapted for use in the inspection tool or elsewhere in the srov include , for example , video , infrared , ultra sonic , sonar imaging , and eddy - current . other types of sensors will be readily apparent to those of ordinary skill in the art . sensors can also be used for external examination of the srov , mp , and connections for ‘ self - check ’, removing a major problem with many rov and automated operations when the problem arises from the device , not the environment or operations . types of sensors well - known in the art and easily adapted for use in the inspection tool or elsewhere in the srov include , for example , video , infrared , ultra sonic , sonar imaging , thermal , conductivity , and eddy - current . other types of sensors will be readily apparent to those of ordinary skill in the art including , but not limited to , wired , wireless , tactile , inertial , corrosion , ph , position , ultrasonic flow , incline , pressure , voltage , current , flow , payout , tilt , gas composition , imaging , bump , debris , edge , gas composition , environmental , robot tilt , temperature , humidity , hydraulic pressure , pneumatic air pressure , gamma ray , neutron , electrical , acoustic , location , accelerometric , haptic , particulate assessment , multiple - sensor arrays , and so - called lab - on - a - chip ( including those for genetic or dna analysis ). sensors may be integrated using analog - to - digital or digital - to - analog converters as necessary . functional programming for tool - specific operation is encapsulated with each hand module ; sensory records and reports can be thus used to iteratively adapt and improve the srov with a succession of better - designed hand modules specific to the localized needs , without requiring the entire srov to be recalled and redesigned . other types of tools will be readily apparent to those skilled in the art such as , but not limited to , tools for grasping ; clamping ; object manipulating ; object handling ; pipe cleaning ; barrel cutting ; lateral cutting ; rotating rasp ; root cutting ; pipe cleaning ; lateral trimming ; high pressure jet ; pipe joint sealing ; pipe joint testing ; pipe profiling ; pipe sampling ; drilling , pipe installation , pipe sealing , and internal repair . standardized connections between modules and the ability of control units within modules to be interconnected ( both mechanically and with respect to bus resources ) and to communicate and identify themselves to other control units . aggregate configuration , monitoring , control , and functionality of an srov resulting from interconnection are made known to both the mmcu and the ccu without mechanical or software re - engineering . the modules described herein may be interconnected with “ plug - and - play ” simplicity to provide the srov with the functionality necessary for a wide range of work processes and environments . field operations personnel can easily configure srov modules ( see , for example , fig3 ) and in support of an unlimited array of work processes , environments , and achieving the automated remediation for any of the following : the configuration ( fig1 a ) to function in a small conduit , where a shortened extensible arm unit ( 1505 ) is utilized . the configuration ( fig1 b ) to function in a very large conduit , where a full size extensible arm unit ( 1500 ) is used in conjunction with fixed arm unit ( 1510 ), and supported by a brace unit ( 1540 ). the configuration ( fig1 c ) to function in a rectangular conduit and where additional shoulder modules are utilized and where each only has a pair of opposing extensible arm units ( 1500 ) and where the shoulder modules operate in a reciprocal fashion as the arm units extend and retract , and the wrist units articulate in order to conform to the work surface . the configuration ( fig1 d ) to function on an exterior surface ( e . g . conduit exterior ) and where the frame module is not a “ spine ” but a wrap around “ exo - skeleton ” ( 1040 ) and where the track tool may incorporate additional special purpose attachment equipment ( e . g ., electromagnetic attachment , grappling arms , vortex generators , or clamps ). the configuration ( fig1 e ) to function on a flat surface . the srov control system hardware and operating environment functionality is described herein in terms of a computer executing computer - executable instructions . fig2 illustrates one control system hardware and operating environment ( 2000 ) in conjunction with which some embodiments of the srov and its supporting equipment is implemented . some embodiments of the control system can be implemented entirely in computer hardware with the computer - executable instructions implemented in read - only memory , some entirely in software , and some in a combination of hardware and software . some embodiments can also be implemented in client / server computing environments where remote devices that perform tasks are linked through a communications network . program modules can be located in both local and remote memory storage devices in a distributed computing environment . some embodiments can also be at least partially implemented in a quantum mechanical computing and communications environment or using analog devices . computer ( 2002 ) may include a processor ( 2004 ), commercially available from intel , motorola , cyrix and others . the computer can also include random - access memory ( ram ) ( 2006 ), read - only memory ( rom ) ( 2008 ), and one or more mass storage devices ( 2010 ), and a system bus ( 2012 ) that operatively couples various system components to the processing unit . the memory and mass storage devices are types of computer - accessible media . mass storage devices are more specifically types of nonvolatile computer - accessible media and can include one or more hard disk drives , floppy disk drives , optical disk drives , and tape cartridge drives . the processor can be communicatively connected to the internet ( 2014 ) ( or any communications network ) via a communication device ( 2016 ). internet connectivity is well known within the art . in one embodiment , a communication device is a modem that responds to communication drivers to connect to the internet via what is known in the art as a “ dial - up connection .” in another embodiment , a communication device is an ethernet ™ or similar hardware network card connected to a local - area network ( lan ) or wireless lan that itself is connected to the internet via what is known in the art as a “ direct connection ” ( e . g ., t1 line , etc .). a wireless router ( 2040 ) may be interfaced to the system bus as another means to connect to the internet . a user enters commands and information into the computer through input devices such as a keyboard ( 2018 ) or a pointing device ( 2020 ). the keyboard permits entry of textual information into computer , as known within the art , and embodiments are not limited to any particular type of keyboard . the pointing device permits the control of the screen pointer provided by a graphical user interface ( gui ) of operating systems such as versions of microsoft windows ™. embodiments are not limited to any particular pointing device . such pointing devices may include mice , touch pads , trackballs , remote controls and point sticks . other input devices ( not shown ) can include a microphone , joystick , game pad , gesture - recognition or expression recognition devices , or the like . in some embodiments , computer is operatively coupled to a display device ( 2022 ). the display device can be connected to the system bus and permits the display of information , including computer , video and other information , for viewing by a user of the computer and embodiments are not limited to any particular display device . such display devices include cathode ray tube ( crt ) displays ( monitors ), as well as flat panel displays such as liquid crystal displays ( lcd &# 39 ; s ) or image and / or text projection systems or even holographic image generation devices . in addition to a monitor , computers typically include other peripheral input / output devices such as printers ( not shown ). speakers ( 2024 ) and ( 2026 ) ( or other audio device ) provide audio output of signals and may also be connected to the system bus . numerous other input and output devices may be connected in various ways well known to those of skill in the computing arts . the computer may also include an operating system ( not shown ) that is stored on the computer - accessible media ram , rom and mass storage device , and is executed by the processor . examples of operating systems include microsoft windows ™, apple macos ™, linux ™, unix ™. examples are not limited to any particular operating system , however , and the construction and use of such operating systems are well known within the art . embodiments of computer are not limited to any type of computer . in varying embodiments , computer comprises a pc - compatible computer , a macos ™- compatible computer , a linux ™- compatible computer , or a unix ™ compatible computer . the construction and operation of such computers are well known within the art . the computer can be operated using at least one operating system to provide a graphical user interface ( gui ) including a user - controllable pointer . the computer can have at least one web browser application program executing within at least one operating system , to permit users of the computer to access an intranet , extranet or internet world - wide web pages as addressed by universal resource locator ( url ) addresses . examples of browser application programs include modzilla firefox ™ and microsoft internet explorer ™ the computer can operate in a networked environment using logical connections to one or more remote computers , such as remote computer ( 2028 ). a communication device coupled to , or a part of , the computer can achieve logical connections . embodiments are not limited to a particular type of communications device . the remote computer can be another computer , a server , a router , a network pc , a client , a peer device or other common network node . the logical connections depicted in fig2 include a local - area network ( lan ) ( 2030 ), wireless lan ( 2024 ) and a wide - area network ( wan ) ( 2032 ). such networking environments are commonplace in offices , enterprise - wide computer networks , intranets , extranets and the internet . when used in a lan - networking environment , the computer and remote computer are connected to the local network through network interfaces or adapters ( 2034 ), which is one type of communications device . the remote computer also includes a network device ( 2036 ). when used in a conventional wan - networking environment , the computer and remote computer communicate with a wan through modems ( not shown ). the modem , which can be internal or external , is connected to the system bus . in a networked environment , program modules depicted relative to the computer , or portions thereof , can be stored in the remote computer . the computer also includes power supply ( 2038 ). each power supply can be a battery . distributed control maximizes srov autonomous operation under intelligent planning and control , while retaining the possibility of remote monitoring , override and control . each tier of control ( in this embodiment ) is comprised of a computer , having at least a processing unit , i / o unit , memory , and one or more software programs . the distributed control system ( fig1 ) is distributed across a plurality of tiers — three in the preferred embodiment ( 1800 ): ( 1 ) a ccu ( 1801 ) comprising a computer and an operator interface for remote control as well as programmed control and monitoring necessary to support autonomous robotic operation , and connection to the frame module via umbilical ; ( 2 ) a mmcu ( 1803 ) for the overall control of the srov ; and , ( 3 ) a mcu ( 1805 ) for the internal control of each module within the srov , including autonomic operation ; the first tier implements computerized control and monitoring of the entire system ( including possibly multiple srov deployments ) from planning through operation and srov retrieval . the ccu is used to develop and download srov work plans ( i . e ., high level programs or scripts ) to implement , for example , the remediation of a specific submerged infrastructure . during srov operation , the ccu comprises at least one operator interface to externally control the srov via signals ( both manual and programmatic fly - by - wire ) and for receiving and processing monitoring signals from the srov . the ccu may include a remote computer that can be accessed via switch ( 1802 ). the first tier communicates and is interconnected with the second tier . the second tier implements control at the srov level . as some implementations call for additional an srov ( 1807 ), a separate mp ( 1804 ) is associated with each srov being deployed . a network ( 1810 ) connects the ccu to the mp . the mp contains an umbilical ( 1811 ) that connects the network to the srov and , in particular , the mmcu . within each srov ( typically in the frame module ) resides a mmcu which detects , records and registers the srov configuration ( i . e ., which modules have connected to the bus , where , and their functionality ); monitors and coordinates the movements of the various modules of the srov ; controls power conditioning and distribution ; manages signal distribution ; and monitors srov parameters ( e . g ., position , travel , routing through the conduit , etc . ); and navigates the srov . the mmcu is responsible , for example , for preventing module movements from colliding with each other ( e . g ., by constraining their movements to mutually exclusive regions ), for controlling their rates of performance relative to each other , and similar coordinating functions . the second tier also communicates and is interconnected with the third tier . the third tier implements control at the module level of the srov . within each srov module resides the srov bus ( 1812 ) that passes resources to each module of the srov . within each module resides an mcu ( 1805 ) providing embedded intelligence . each mcu is connected to a sensor interface ( 1831 and 1832 ) to monitor sensors ( 1836 and 1837 ). in the case of an additional srov , an additional sensor interface ( 1833 and 1834 ) monitors sensors ( 1838 and 1839 ). each mcu aggregates , formats , and uploads sensor data to other control units ; accepts externally provided instructions ; and controls the detailed operation of the specific module responsive to externally provided or pre - programmed instructions . it also manages its connection ( via the bus ) to the network . each mcu is also connected to an articulator interface ( 1821 and 1822 ) to operate actuators ( 1826 and 1827 ). in the case of an additional srov , an additional articulator interface ( 1823 and 1824 ) operates additional actuators ( 1828 and 1829 ). responsive to instructions , a mcu may cause the articulated movement of a module to perform a complex movement once , to repeat a pattern of movements , or to perform obstacle detection , obstacle avoidance , or obstacle following independent of what other modules are doing . information about a submerged infrastructure may be loaded into the ccu and used to develop the set of instructions that will implement a desired work plan or process . for example , the physical layout and geometry of the submerged infrastructure may be captured using blueprints or their electronic equivalent , and inspection data used to identify obstacles , irregularities , fouling , and obstructions . from this information , simulation facilities are used to develop the srov configuration requirements and a work plan . a work plan will typically include a path for navigation of the infrastructure , and commands for configured modules as the srov transits the path . the work plan is then converted into a program to be downloaded from the ccu to the mmcu that is located in the srov . the ccu is used to develop and maintain a library of solution patterns . each solution pattern is a set of instructions ( as embodied in , for example and without limitation , an interpretable script , compilable source code , subprogram , precompiled program module , dll , firmware , etc .) for the srov or any control unit corresponding to a specific work requirement and / or srov configuration . typically , a solution pattern will specify a particular behavior of the configuration ( such as a pattern of one or more senses and responses implemented via sensors and actuators ). a solution pattern may be used to effect the coordination or synchronization of multiple modules . for example , one solution pattern , having a specific srov configuration as a requirement , causes a debris removal tool to remove crustaceans from a conduit having a round geometry , with the diameter of the conduit as a function of srov radial extension and length of srov travel being a deployment parameter . the solution pattern may incorporate obstacle ( or other deviation ) detection and automatic obstacle following so that the debris removal tool independently removes crustaceans around the obstruction without colliding with it . other solution patterns address , for example , autonomous navigation , autonomous inspection , autonomous remediation , monitoring requirements , detecting and working around types of obstacles or irregularities , autonomous pre - remediation and post - remediation inspection , and so on . solution patterns may be combined , possibly with custom programming or live operator instructions , to form a complete work plan as needed to accomplish a particular remediation . solution patterns can be linked to the specific tool or combination of tools , sensors , and srov design for the goal ( s ) that the srov &# 39 ; s operator , user , or customer wishes to effect . because of the modular software and physical architecture , designers can focus on the specifics of each tool unit they wish to provide ; or srov users can put out for bid and design their needs for upcoming or experienced taskings . during operation , the ccu coordinates the srov and non - srov subsystems ( including the mp ). the operator interface of the ccu preferably incorporates a virtual , three - dimensional portrayal of the work area , the srov as configured , and activities of the srov , combining pre - loaded submerged infrastructure data with sensor data from the srov during operation . for example , a previously acquired and loaded visual image of the work area may be overlaid with schematics , plots , and identification of obstacles , deviations , or other data . this data may be acquired , for example , by separate inspection or by the srov during operation . optionally , a representation or image ( e . g ., previously recorded , acquired from a camera , simulated , etc .) of the srov may be incorporated to show its position , orientation , and movements with respect to the work area . preferably , the operator may change perspectives and viewing angles , zoom in and out , directly test the operating conditions using a ‘ haptic ’ interface to verify the feasibility and / or safety of a tool &# 39 ; s operation , and control other viewing or display options so as to optimize monitoring , interaction , and control . this method eliminates the “ operator blindness ” endemic in prior art . when an operator must rely on remote cameras , productivity diminishes as turbidity and debris cloud the work environment . the srov simultaneously provides the operator with an accurate remote visual experience of the operation , enhanced by various simulated views of srov position and orientation , and direct measures of work progress . monitoring of srov internal status via sensors ( limited self - awareness &# 39 ;) permits comparison to the planned goals of the current tasking , enabling adaptive response to changed conditions whether of infrastructure or srov . during operation , the ccu records operator instructions ( sensor data ( both from the srov and from the mp ), and correlates it with the solution patterns being used . performance , unanticipated events , and errors are analyzed in real - time and corrective actions taken , either autonomously or under operator control . in addition , using accumulated data about the effectiveness of a particular solution pattern and comparison of solution patterns , solution patterns are optimized for performance ( e . g ., by selecting those movements that remove a particular type of debris the fastest ), made more robust and flexible ( e . g ., by providing multiple , alternative solution patterns ), made more autonomous ( e . g ., by preprogramming a broader range of actions responsive to detectable sensor data patterns ), and become responsive to unforeseen conditions ( e . g ., having a solution pattern for working around a protruding but previously undetected pipe ). the linkage of internal modular sensory and status information prevents the futility of attempting work beyond the capacity of the tool and srov on site which has been damaged or when in an environment beyond its safe limits . methods well known to those versed in the art of expert systems ( for example , rule based or neural net systems ) are applied so that the ccu ( and therefore the srov ) can learn about its environment and adapt during operation . this technology is particularly well suited to improving srov navigation using methods well known in the art for obstacle detection , obstacle avoidance , and path planning . the mmcu receives srov configuration requirements from the ccu . it then senses and compares the current configuration of modules to the required configuration , providing feedback to the ccu in case of discrepancies . preferably , the mcu continuously integrates and compares the internal model of the srov system and its environment against the experienced and perceived current state of both the operating environment and its physical status and capacity . this is particularly useful in the event of a module failure ( e . g ., loss of module connection or function ), and enables adjustments and compensation for the loss , or extraction and repair . the mmcu also downloads control templates from the ccu and distributes them to the intended mcus ( optionally as firmware upgrades ). control templates provide instructions for translating high - level operational command strings into a correlated set of low - level command streams targeted to a specific module , and for translating between internal signals from a sensor to a data format for inter - module communication and for communication to the remote control means ( e . g ., ccu ). for example , it may be implemented as a software translation table having means for parameter substitution , and downloadable to a control unit as firmware . this enables the ccu to reprogram modules or to expand and alter the set of high - level commands to which the srov and its modules can respond . the same control template is used by the mmcu to associate and aggregate sensor data with high - level commands , and upload a more coherent status to the ccu . control templates are also used by the mmcu to translate commands and sensor data between modules for purposes of synchronization and coordination during operation . this provides the flexibility for the mp or oc level of control — the ‘ human operator ’— to determine whether it will be better to run multiple passes , or to begin at one while simultaneously sending down multiple task - special units to allow , post - modification , multiple - tool applications on a single pass — with appropriate ‘ corrections ’ for the just - affected target . the mcu accepts low - level commands from the mmcu via the srov bus and decodes those commands into peripheral control signals that govern actuators ( e . g ., electrical solenoids , fluid control valves for the operation of joint assemblies , etc .). the mcu ( 1805 ) aggregates current real - world status data ( returned by sensors ( e . g ., joint assembly , motion , positioning , and inspection sensors ), compares this against current functions and goals within its operative hierarchy , and uploads this combined status back to the mmcu . the srov distributed control architecture ( fig1 ) implements computerized and integrated command and control of the srov . this architecture comprises physical interfaces for operator input and output , sensors , and actuators . each physical sensor and actuator is connected to the communication portion of the bus ( preferably via a mcu ), which provides network interconnection for the system . analog sensors and actuators preferably incorporate analog - to - digital converters for output ( data ) and digital - to - analog converters for input ( control ) so that all data is in a common digital bus format accessible to the software system . in addition to providing measurement and monitoring signals as output , some sensors may be controllable and accept input signals to control any of , for example , on and off status , positioning , resolution , data rate , and so on . similarly , in addition to accepting input signals for control purposes , some actuators may provide status , measurement and monitoring signals . all of these signals are shared between system components via the communication portion of the srov bus . higher tiers may override any preprogrammed or otherwise automated response of a lower tier . lower tiers signal higher tiers when that tier is sensing a problem such as out - of - limit resistance to movement , functional failure , and so on . in appropriate circumstances , a first mcu may send messages directly to a second mcu as , for example , to more rapidly avoid local collisions . this cross - tier , closed loop control and sensing system maximizes opportunities for response , adaptability , and autonomy . the srov control architecture &# 39 ; s tiered hierarchy enables ‘ real - time ’ operation for the srov and any subordinate grouping of its modules . it should be noted here that the use of the term “ real - time ” within this application does not denote either instantaneous time or the minimal time for computer processing of a control determination . the concept of what constitutes “ real - time ” srov operation depends upon number of different factors , including the given application , the time constraints for that application , and the internal and external conditions . for example , an asynchronous communication link could be considered ‘ real - time ’ if the packets are exchanged on a very high - speed network , if the response must engage the reading , comprehension , and reaction of a human at one end , even though the individual packets may be transmitted ( and even lost and retransmitted ) in microseconds . accordingly “ real - time ” must incorporate the boundaries of operative and communicative delays imposed by competing signal needs for the bus ; normal , current , and extraordinary signal density relating to operation of the srov and module ( s ); the distance between sender and receiver ( doubled for higher - level feedback or override control commands ), and like real - world factors . remote operation , whether by human ‘ telepresence ’, wireless radio signaling from a remote mainframe , or any mixture of human and off - location computer guidance , will also be limited to the transmission speed and information capacity of the bus . if the motion of the srov is measured in centimeters per second , a half - second delay in transmission around the half the globe to a centralized human command center may well be a meaningful delay when edging up to a hazard ; alternatively , the entire operation of placing a seal on a pipeline leak may be considered a ‘ real - time ’ effort . in this application , ‘ real - time ’ refers to the totality of a sensor - response feedback loop in the physical world as opposed to an internalized model or partially - enacted hardware effort , or an attempt that has no real - world effect on the intended goal unless and until transformed into the final and completed operation . the degree to which an application is “ real time ” is largely a measure of the speed with which the application can detect ( i . e ., perceive , sense or compute ) a situation and react appropriately ( e . g ., providing the information to a user , automatically correcting a detected problem , or otherwise responding ). the functional software architecture ( 1900 ) of the srov comprises at least the following programmable subsystems , each encapsulatable in the preferred embodiment so as to minimize control - and - status and / or feedback signaling load on the bus : command and control subsystem — the command and control subsystem ( 1920 ) is the main subsystem that coordinates process and data flow among the other subsystems , however distributed . responsive to signals from the interface subsystem ( 1926 and 1928 ), it invokes the functions ( 1922 ) required for any design , simulation , and operation task . other functions include storage and retrieval ( e . g ., infrastructure specifications , work processes , solution patterns , configurations , sensor data , histories , etc . ), system functions ( e . g ., startup , shutdown , backup , recovery ), system health check and monitoring , automated system failover and recovery , download ( e . g ., configurations , solution patterns , control templates ), upload ( e . g ., status , configuration , sensor data ), and emergency srov recovery procedures . configurations include computer readable descriptions of modules , sensors , actuators , and software reflective of a particular srov configuration . optionally , the command and control subsystem maintains a complete record or “ history ” of every design , simulation , and operation task that is performed on the system . these histories are used for , for example , additional simulations , new work process or solution pattern design , optimizations , and auditing purposes and is stored in the library ( 1924 ). interface subsystem — the interface subsystem ( 1910 ) manages and drives all operator interfaces , including at least one interface ( 1912 ) for operators to interact with the software system , including output ( e . g ., video display , audio , optics , speech generation , haptics , etc .) and input ( e . g ., mouse and keyboard , touch , voice recognition , accelerometric , pressure , etc .). types of interaction include design ( 1914 ) ( including specification of infrastructure and its state , work process , solution patterns , and templates ), simulation , operation and may require other ( 1916 ) types of interface . during operation , the interface subsystem combines data from , for example , the sensor subsystem , the intelligent planning subsystem , and the navigation subsystem to provide real - time display of the srov and its environment . images ( e . g ., visual , sonar , ultrasonic , thermal , etc .) from sensors or previously recorded still images may be overlaid with blueprints , schematics , computer generated images or renderings ( e . g ., of fouling , debris , or obstacles ), and supplemented with other sensor data . the interface subsystem also communicates with the command and control subsystem and sensor subsystem , to allow the display of the difference between planned , current , and past conditions , thus allowing progress of any task to be more accurately during simulation , these same facilities are used without need to physically deploy the srov to simulate a work process or task , using sensor data that is either computer generated or pre - recorded . this simulation allows ‘ failure simulations ’ to test operators &# 39 ; and system capacities to deal with the unanticipated , and usually unwanted , differences between model and goal . sensor subsystem — the sensor subsystem ( 1930 ) manages all software specific to physical sensors . it detects and registers ( as part of the srov configuration ) sensors that are connected , receives and forwards commands to sensors , receives data signals from sensors , performs sensor health checks , maintains a history of data , commands , and status in storage ; aggregates and formats data and status , and sends data and status to other subsystems . actuator subsystem — the actuator subsystem ( 1940 ) manages all software specific to physical actuators , thereby controlling the relative positions and movements of the srov modules relative to the frame module . it detects and registers ( as part of the srov configuration ) actuators that are connected , receives and forwards commands to actuators , receives data signals from actuators , performs actuator health checks , maintains a history of data , commands , and status in storage , aggregates and formats data and status , and sends data and status to other subsystems . planning subsystem — the planning subsystem ( 1950 ) receives sensor data and status , detects obstacles and other deviations from anticipated surface and infrastructure conditions ( using , for example , maps , obstacle detection , and obstacle avoidance methods well - known to in the arts pertaining to robotics ), develops plans ( i . e ., positioning and orientation commands necessary to negotiate the deviation and achieve the navigation goal using methods well - known to in the arts pertaining to robotics ), and sends ( 1952 ) plans and information describing detected deviations to other subsystems . from a record of the insertion and transit of the srov and its current position , the planning subsystem may compute an exit path and commands to implement the exit path . navigation subsystem — the navigation subsystem ( 1960 ) receives signals and data relevant to srov position and orientation , interprets those signals , determines srov position and orientation , and forwards this information ( 1962 ) to other subsystems . positioning subsystem — the positioning subsystem ( 1970 ) controls srov position and orientation . it accepts srov position and orientation signals , commands pertaining to srov position and orientation , and generates and sends commands ( 1972 ) to the actuator subsystem to modify position and orientation by actuating the srov propulsion subsystem . debris control subsystem — the debris control subsystem ( 1980 ) manages all software pertaining to physical debris , including removal , recovery , and reclamation . it receives signals pertaining to srov position and orientation , debris removal rate ( e . g ., from sensors in a debris removal tool ), and debris recovery rate ( e . g ., from debris recovery tool or sensors measuring turbidity ), and coordinates ( 1982 ) the rates of srov transit , debris removal , debris recovery ( e . g ., to maintain uniform remediation , avoid infrastructure abrasion , removal system clogging , jamming , etc . ), dredge pumping , and debris reclamation . each of these functional subsystems may be implemented on one or more computer systems , and distributed in any convenient manner . functionality may be distributed ( i . e ., be partitioned or replicated ) in numerous ways . for example , in the preferred embodiment , these functions may be distributed across different computing tiers ( e . g ., ccu , mmcu , and mcus of the preferred embodiment ), across multiple srov modules ( e . g ., frame module , shoulder module , articulation module , and hand module of the preferred embodiment ), or some combination . many functions supporting the srov are better managed from the surface . this support is provided by the mp , situated to best manage deployment functions including those associated with the umbilical and debris line . the oc manages power and communication functions . the mp ( 211 ) manages the deployment and recovery of the srov , the srov umbilical and debris line , and automates the synchronization of the umbilical and debris line with the travel of the srov under monitoring and control of the ccu . this includes collocating , managing , and synchronizing the travel of the umbilical ( 212 ) and debris line ( 213 ) that are housed on the platform and connected to the srov . the umbilical supplies both power to the srov and communication ( i . e . both sensing and control signals ) between the srov and other sub - systems . the umbilical is environmentally protected , constructed as to maintain neutral buoyancy , resist abrasion , and re - enforced to allow its use as a retraction tether . the proximal end of the umbilical is fitted with an umbilical plug while the distal end is fitted with an umbilical socket ( 383 ). the power management unit ( 381 ) features an umbilical plug at its proximal end in order to attach to the umbilical socket ( 383 ). it features a socket and adapter at its distal end so as to attach to the rear of the srov . the power management unit contains a step - down transformer , and power supply components , to transform the high umbilical transmission voltages into the proper voltages and amperage to power the srov bus . the debris line is a flexible conduit for moving debris from the srov up to the surface , in order to allow the transfer of debris into a dredge spoil reclamation facility . the debris line may be deployed in conjunction with the umbilical or separately . in one variation of the illustrative embodiment the debris line is a standard dredge line . in another variation it is physically integrated with the umbilical . the umbilical and the debris line are instrumented with sensors that provide measures of payout , position , operating , and health status to at least the ccu . the mp , since it will be the principal human operational control center for a specific srov , will have a monitoring and operational control station to monitor and control the umbilical and debris line connections and operations linking the srov with the mp and oc . thus the mp for each srov will have means for extending and retrieving the umbilical ; umbilical positioning means for extending and retrieving the umbilical ; umbilical placement means for managing the rotational and directional position of the umbilical , or a sub - portion thereof ; a debris retrieval line ; debris retrieval line positioning means for extending and retrieving the debris retrieval line ; debris retrieval placement means for managing the rotational and directional position of the debris retrieval line , or a sub - portion thereof ; debris retrieval line operating means for activating , operating , and shutting down the debris retrieval line ; means for directing the output from the debris retrieval line into a targeted deposit area or volume ; and , means for monitoring the status of the umbilical , the debris retrieval line , the debris retrieval line positioning means , the debris retrieval line placement means , the debris retrieval line operating means , and the targeted deposit area or volume . this platform is preferably constructed from a modified shipping container , allowing for easy transshipment and is a self - contained , enclosed structure . the top cover lifts away to expose the platform and the cover then serves as the facilities shed during deployment . standard container doors provide access and the opposing end of the container features a spare parts locker that , among other things , provides for the storage of a set of floor panels . a distribution panel , located adjacent the locker , allows for connection of power and communication lines to oc power and the further connection to the platform junction box . the umbilical supply reel unit ( 214 ) located on the platform is used to pay out and take in the sorv umbilical . this unit consists of a motorized base with the appropriate rotary coupler that has one side connected to the junction box , and where the other features an umbilical socket in order to connect with a slide on spool containing the srov umbilical . multiple spools may thereby be attached together for long distance deployments . the platform has davits to support a removable cradle that houses the srov during transshipment . the platform may be positioned in various ways such as at the shores edge or on a floating barge . guide sheaves and a set of associated brackets or anchors align the travel of the umbilical from the supply reel to the designated work area of the srov . these sheaves are installed in such a manner so as to allow the umbilical to be used as a retraction towing line , in case of malfunction of the srov . a debris line station stores , inserts , or removes sections of the debris line , a booster pump that can be inserted into the debris line to increase flow volume , and transfers recovered debris into a dredge spoil reclamation facility . the umbilical features a replaceable outer abrasion jacket , woven from a wear - resistant material , to protect the umbilical . under the abrasion jacket is a layer of high - strength woven fiber to provide the structural integrity and strength to allow the umbilical to be utilized as a towing line as to retrieve the srov . a thermoplastic flexible core , of the proper density to provide neutral buoyancy , encapsulates all of the conductors within the umbilical . individual conductors include power , communication and systems ground . typical power conductors include a neutral power conductor , ground conductor , and a plurality of hollow power conductors ( typically three ). the hollow portion for the insertion of communication conductors serves to minimize the negative impact on signal quality from the surges in the power conductors as power is adjusted or fluctuates . communication conductors are wrapped in an interference shield to further isolate the radio interference projected by the high voltage alternating current . the communication conductor may be a fiber optic cable fitted with its own signal shield and insulation . alternatively in other power conductors , an electrical signal conductor may be inserted ). the oc ( 230 ) is preferably a self - contained , enclosed structure having environmental conditioning to protect human operators and sensitive equipment . this equipment provides the ability to connect with a source of power , monitors and condition that power according to load requirements , support communications , and to control and monitor the srov and mp . the ccu comprises both an operator interface for remote operation and means of monitoring the srov . it further comprises means to pre - program control units for autonomous operation , including functions to monitor , respond to , present , display , record , and analyze signals from the srov . the oc can be remotely located and in real - time re - located or re - directed to specialist technician , operative ( s ), or secure recording archive . it is constructed from a modified shipping container to simplify transshipment , and that has been partitioned into a maintenance area , an equipment area , and an operations area . the maintenance room is entered through the standard container doors . the interior is fitted with a service bench , storage bins , shelves , and diamond plate floor . all materials and equipment are properly secured for container transshipment . the equipment room consists of a dual bulkhead forming a room that separates the maintenance area from the operations area . a man door is located in each bulkhead forming not only access to this room , but a hallway between maintenance and operations . located within the equipment room is a forced air conditioning system to protect human operators and sensitive equipment . a fold up service mast accepts standard industrial power ( e . g ., three - phase , 440 volt ), either from the grid or alternatively from an equivalent generator . the power control center is located between the bulkheads , and against an outside wall . the power control center transforms grid voltages , conditions and regulates resultant electric power , as well as to provide overload and ground fault protection . a fail - safe electric power lockout assures that divers are protected if they must enter the water near the srov or its umbilical . the power control center also has an interface to the control equipment located in the operations room as more fully described below . the operations room partitions the opposite side from the bulkhead in order to enclose a lavatory , kitchenette , and bunk facilities . the operational side of this partition includes built - in closet and filing facilities . a door and windows provide access , natural light and a view of outside activities . the center of the operations area includes a conference table and chairs . an operator &# 39 ; s monitoring and operations station and including a desk and equipment rack are built into the equipment room bulkhead . the enclosed equipment includes a communications unit and supporting cellular , radio , landline , or alternatively satellite communications , with associated handsets , and facsimile . a power monitoring unit displays key electrical status and provides means for emergency power shutoff . the ccu has an operator console with display unit for presenting a depiction of the srov in its work environment . in an extension to the preferred embodiment , independent and specialized helper modules having auxiliary flanges may be deployed between , and connected to , sections of the umbilical . typically , a helper module will be powered , monitored ( via incorporated sensors ), and controlled ( via actuators ) via the umbilical . a helper module may also incorporate any of its own mcu , independent intelligence , and power source . a helper module may , for example , be a pumping station used to augment pumping capacity for the debris line over long deployments . as another example , a helper module may be incorporate locomotion means ( e . g ., a motor ) for additional power when deploying or retracting the umbilical or towing the srov . a helper module may also incorporate stabilizing means ( e . g ., extensible clamps to attach to a conduit wall ) so as to stabilize the position of the umbilical or debris line with respect to the work surface . in a further embodiment , redundant modules may be configured so that failure of a module results in failover to the standby , taking the failed module offline automatically . in a further embodiment , a helper module is used on detection of a failed module to deliver a replacement module and remove and return the failed module to the mp . numerous other uses of helper modules will be readily apparent to those of skill in the art . in another extension to the preferred embodiment , a strain relief module is used to detect and relieve strain and stress due to , for example , friction or obstructions on a line linking the frame module to the mp , the frame module to a helper module , or the oc to the mp ( e . g ., the umbilical or debris line ). the strain relief module is preferably an autonomous robot , having independent power , locomotion means , and on board intelligence . it is preferably attached around the line , and travels along the line via a motor driving wheels in contact with the exterior surface of the line . on board sensors enable the strain relief module to monitor stress and strain in the line and to detect upcoming obstructions such as contact with a work surface ( e . g ., interior of a conduit wall ); and to communicate the same with any or all of the other modules , mp , or oc also connecting with and through that same line . the strain relief module travels to the part of the line where it is needed and then positions at least a portion of itself between the obstruction and the line , extends extensible arms to stabilize itself with respect to the work surface ( e . g ., via hydraulic pressure or mechanical clamps ). it then disengages its wheels from the motor in such a way that they may rotate freely and so that the line is provided with relief from stress , strain , friction , abrasion , and the like . the strain relief module may retract its arms , re - engage its wheels , and reverse its motor so as to return to the surface independent of the srov . retraction may occur in response to receipt of an external command or may be programmed for retraction on detection that the line is being retracted to the surface . communication with the surface may be effected via ( for example ) wireless , sonar , or electromagnetic sensor capable of detecting a signal carried on the electrical power line ). in a further embodiment , additional modules for specialized tasks ( item retrieval , item delivery , etc .) can be created and added , with the developer only having to program the lower level needed for that module &# 39 ; s functional operation ; this makes the srov capable of expansive adaptation to infrastructure - specific tasking . in an alternative of the preferred embodiment , the highly distributed control architecture is replaced by a more centralized architecture . in the distributed architecture , a separate module performs every major function , and that functionality is distributed across three or more tiers of control . in a more centralized architecture , functions may be compressed into fewer or even a single module , and control of functionality may be provided in a two - tier , or even a single tier of control . in an alternative of the preferred embodiment , operating srov functions by hydraulic power is replaced by other means . the use of electricity to drive a hydraulic pressure pump is but one means to provide power to operate srov functions . alternative means could include all electric , fuel cell or other new power production technologies , or any hybrid combination ( e . g . electric power from the mp to the frame module , and from the frame module to the shoulder module , combined with hydraulic power from the shoulder module to a thruster module or a debris removal tool ). in an alternative of the preferred embodiment , communication between various modules and supporting equipment by fiber optic cables is replaced by other means . optical fiber is but one means to communicate between modules and supporting equipment . alternative means could include electrical cables , wireless transmission , acoustic coupling , and other methods of signal communication and control . in several further embodiments , alternative responses are embedded into the mii to deal with failures of the srov , whether from internal or external causes . these include the placement in the frame module of a ‘ state record ’, recording device comparable to the ‘ black box ’ of a jet airliner , which retains onboard the srov the sensory records for retrieval after a shutdown , to allow post - incident review and engineering corrections . another alternative is the incorporation of an internal power source and a set of alternative ‘ recovery or retrieval ’ options selected by the srov upon any failure , where the choice of automated response is principally driven by the battery state ( i . e . available power ). another alternative is the incorporation into separable and self - mobile modules of detachment means and a homing beacon , enabling the slimming of an srov &# 39 ; s profile and dependence upon an external , perhaps wire - driven , retrieval means . in another alternative to the preferred embodiment , any of a set of srov self - repair or re - tasking efforts are handled by a specialized module , e . g . a delivery module that brings down thrusters and replaces all the tractors to enable free - swimming propulsion ( or vice versa ); or replaces chemical with nuclear sensory guides for debris removal tools ; or performs an ‘ in - pipe ’ substitution and removal of an old and perhaps damaged articulator or tool module with a new and more apt replacement . in an alternative of the preferred embodiment , the mechanical apparatus used for debris removal is replaced by other means . the utilization of mechanical cutting and polishing devices is one device to remove debris . alternative devices may include other mechanical devices , water jets , laser beams , sonic wave transducers , compressed gases , heat , cold , or any other means for the removal of debris . in another alternative of the preferred embodiment the mechanical apparatus used for debris removal is replaced by a conduit - filling scraping unit ( or ‘ pig ’) connected to the frame module or mp through communications , power , and signal lines , and is driven through a portion of a conduit or pulled through a portion of a conduit by pressure differential or a prepared traction line to move debris internal to the conduit to a collection location , without losing communication and contact with the srov , thereby ensuring continuous feedback and control reflecting current factors whether such is effected autonomously or under real - time human direction . in an alternative of the preferred embodiment , the mechanical collection of debris in a hopper , pulverizing it in a crushing mill , and pumping it to the surface is replaced by other means . the utilization of the apparatus specified in the preferred embodiment is but one approach . alternative means may utilize other apparatus , such as a macerator , particulate distributor , or entirely new components and configurations may be incorporated , to meet specific job requirements . in an extension of the preferred embodiment , inspection devices and units specialized for sensing and measuring may be expanded to include traction . propulsion achieved by tracked wheels may be replaced by other locomotion means . other embodiments may utilize additional methods and means for determining position , including satellite or other global positioning frameworks , sonic , acoustic , laser telemetry , or any other practicable means that can provide positional data for the purposes of navigation , mapping or control . in an extension of the preferred embodiment , other hazardous environments may require service . alternative embodiments for hazardous service duty could include , the interiors of tanks , the holds of ships , the bottoms of settling ponds , mine shafts , tunnels , pipelines , sewers , water mains , areas of radioactivity or high voltage , areas dangerous heights above the water or land , or any other hazardous environment , where infrastructure inspection , repair or maintenance can be conducted to remove humans from exposure to harm , and to incorporate robotic efficiency to increase rates of production over manual processes . in another embodiment , the debris removal tool hopper is designed to funnel debris from the conduit by having sides that conform to a significant portion of a cross section of the conduit , and being approximately centered on the axis of the conduit . the hopper sides may be contracted and expanded as needed to address changes in the geometry or cross section of the conduit . in an extension to the preferred embodiment , alignment of the means of locomotion ( e . g ., drive wheels of the tractor tool ) with respect to the rov frame may be changed in response to signals ( e . g ., by issuing commands from the operator console ). in an alternative of the preferred embodiment , traction and propulsion achieved by tracked wheels or propellers is replaced by other locomotion means . tracked wheels are but one means of securing and moving the srov . alternative means could utilize vortex generators , pumps , fans , suction pods , water or air jets , electrical motors , electro - magnetic units , inch worm units , pneumatic units , or other developments in the field of traction and propulsion . other means of locomotion such as , but not limited to , iris - like , flow - driven with insertion from head end of conduit , towing via tow line , umbilical , jets , electric motor , propeller , corkscrew , separate robot , helper module , and the like . in yet another extension to the preferred embodiment , the umbilical is terminated in a docking module to which the srov frame connects ( e . g ., a frame module ). in this case , the plug and socket are preferably designed for submerged quick connect . the docking module comprises means to attach stably to the work surface ( e . g ., conduit or pipe ) on command , whereupon the srov ( e . g ., the frame module ) can disengage or undock from the docking module , perform a work process autonomously , and then return to dock with the docking module , for extraction , recharging , uploading data , downloading new instructions ( e . g ., commands , solution patterns , control templates , etc . ), or moving the docking module or umbilical . this capability is particularly advantageous when addressing surfaces that cannot be easily remediated by the srov while attached to and pulling the umbilical . when the docking module includes a debris disposal tool , it also permits the srov to move a distance away from the docking module , perform a debris removal function , and push debris back toward the debris disposal tool . other embodiments of the srov may capture and move debris using means other than crushing and pumping through a debris line , and may move debris to locations other than the surface . for example , in another embodiment , the debris removal tool is augmented with means for manipulating and grasping chunks of debris that are not easily crushed , attaching a tow line to them , and towing them to another location , another module , or to the surface . in one embodiment , debris pumping means is augmented by injecting air into the debris line , use of an airlift , or jet hoses . in an alternative embodiment , the functionality of the mmcu is deployed such that every module interacts with every other module on a peer - to - peer basis and shares responsibility for coordinating functions . this embodiment improves upon reliability and robustness at the cost of implemented a more complex distributed control system . in one embodiment , sensors have sufficient intelligence and network awareness to be connected directly to the bus and are not necessarily connected via a separate control unit ( e . g ., a mcu ). in another embodiment , all sensor data is communicated between control units via a common digital data format and instructions are communicated between control units using a common command , actuator , control , and sensor language ( e . g ., variations and specialization of actuator programming language ipl autonomous vehicle control language , compact control language , gbml , gsml , opengis sensorml , xml , etc .). preferably , actuator control and sensor data are communicated using message - passing and a light weight services - oriented runtime , such as supplied by microsoft robotics developer studio ™. in a further embodiment , sensor or actuator profiles to which instruction executed by control units relate , including operating characteristics , operating thresholds and bounds , and the like , may be altered by , for example , loading new profiles into storage accessible by the control unit . in a further embodiment the mp manages for each umbilical and power line a torsional tracing and current strain measurement for that line , to both measure against the operational safety / wear limits and to guide motion of the srov at the far end . in a further embodiment the mp and oc are each able to manage multiple , potentially coordinating , but not overlapping umbilical and debris lines , and multiple srovs . in yet a further embodiment , each oc and mp may also serve as conscious control center for limited - purpose sub - modules ( independent modules or assemblies not fully integrated with any existing srov ) for activities such as ‘ swapping out ’ one type of actuator or tool for another , replacing a damaged unit , or managing supportive purpose and special - functions such as strain relief or line - repair modules as described herein . in a further embodiment , a damage - limiting seal closes off a plug ( and another for the socket ) to avoid internal damage due to separation or penetration of a module or joint . in a further embodiment , the mechanical fasteners that affix the plug or socket are self - actuating upon receiving a connection ( or disconnection ) instruction , and report their status , and any change therein , to the mcu and thus up to the mmcu and the ccu . in further embodiment , “ self - learning ” by the control units enables continuous improvement for progressive ‘ adaptation and improvement ’ of generations of modules without requiring overall srov re - design and remaking . in a further embodiment incorporates a ‘ swarm ’ of sub - srovs with specialized limited local tasks ( scrubber , watcher , debris hauler ) on periodic or task - dependent , automatable subordinate operations . in yet a further embodiment , the mp and operation center have the capability to operate multiple ‘ trees ’ and / or ‘ nodes ’ ( e . g ., promote and enable ‘ swarm ’ coordination of multiple srov units . in a further embodiment , layered , multiple - level , hierarchical yet locally - aware ; stacks of cycles depending on connections and srov configuration . in place of a single device , the system can become ‘ swarm ’ and be reconfigured on the fly . in a further embodiment , a damaged module can be ‘ dropped ’ and replaced on - site ; potentially the damaged module could then auto - return to the mp for repair . to this end , seals on connectors prevent environmental hazards from affecting modules on separation . this also allows repair after accidental disconnects , and reconnects so that a ‘ stuck module ’ need not become a problem on its own . throughout this written description of the invention , a described instantiations of a single elements ( e . g ., platform , srov , component , plug , socket , bus , conductor , module , tool , system , and assembly ) is intended to include as a further extension and possibility an instantiation with multiple elements , so that a ‘ platform and module ’ can also be read as ‘ a first and second platform , each with a first and second module ’. moreover , the plurality may differ at different levels from one instantiation to the next yet each still should be understood as a reasonable , merely differentiated extension . the scope of this invention includes any combination of the elements from the different embodiments disclosed in this specification , and is not limited to the specifics of the preferred embodiment or any of the alternative embodiments mentioned above . individual user configurations and embodiments of this invention may contain all , or less than all , of the elements disclosed in the specification according to the needs and desires of that user . the claims stated herein should be read as including those elements which are not necessary to the invention yet are in the prior art and may be necessary to the overall function of that particular claim , and should be read as including , to the maximum extent permissible by law , known functional equivalents to the elements disclosed in the specification , even though those functional equivalents are not exhaustively detailed herein .	1
referring to the drawings , wherein like reference numerals represent like elements , there is shown in fig1 an unassembled variable electronic component in the nature of a variable trimmer capacitor generally designated by reference numeral 100 , and constructed in accordance with the present invention . the trimmer capacitor 100 is primarily constructed of a housing 102 , a housing base 104 , a conductive member 106 , a rotatable threaded member 108 , a pair of dielectric plates 110 , 112 and a pair of terminal contact members 114 , 116 . in addition , the trimmer capacitor 100 includes an o - ring 118 , a stainless steel washer 120 and a metallic bearing 122 . referring generally to the drawings , the housing 102 is rectangular in shape having a configured hollow interior generally designated by reference numeral 124 . as shown in fig3 the housing 102 is provided with a bore 126 having an enlarged annular recess 128 , both of which communicate with the interior 124 of the housing 102 . the opposite end of the housing 102 is provided with an enlarged opening 130 formed by tapered side walls 132 . as thus far described , the interior 124 of the housing 102 is configured to receive in assembled relationship the conductive member 106 , the threaded member 108 , the dielectric plates 110 , 112 , the terminal contact members 114 , 116 and the base 104 , as well as the o - ring 118 , washer 120 and bearing 122 . the housing base 104 is generally rectangular in shape and having a configured hollow interior generally designated by reference numeral 134 . the interior 104 is formed to include parallel spaced apart narrow rectangular dielectric plates receiving openings 136 communicating with a larger central rectangular shaped conductive member receiving opening 138 and a central bore 140 . the hollow interior 134 is generally configured to receive the dielectric plates 110 , 112 , the conductive member 106 and a portion of the threaded member 108 in assembled relationship . the base 102 , along its opposing longitudinal side walls 142 , 144 , is provided with spaced apart cutout portions 146 , as further pronounced by adjacent projecting ribs 148 . the cut - out portions 146 receive and retain the terminal contact members 114 , 116 to enable accurate positioning of the terminal contact members as they are being assembled about the base 104 . in this regard , the base 104 is further provided with tapered lower side walls 150 , 152 which facilitates the assembly of the terminal contact members 114 , 116 about the base as to be described hereinafter with respect to the trimmer capacitor 100 in accordance with the present invention . the housing 102 and base 104 may be constructed from suitable plastic material such as polyphenylene sulfide resins , polyetherimide resins and the like . the conductive member 106 is constructed generally as a rectangular body having parallel spaced apart opposing wall surfaces 154 , 156 and a threaded centrally positioned through opening 158 . the conductive member 106 is preferably constructed of metallic material , for example , brass , copper based alloys , beryllium - copper , phosphor bronze and the like . as it is only required that the wall surfaces 154 , 156 be electrically conductive , the surfaces may comprise a metal deposited layer on the conductive member 106 which may be constructed of suitable plastic material . the conductive member 106 is preferably plated with an electrically conductive layer of copper , gold , silver or the like . the threaded member 108 is constructed as a longitudinal cylindrical threaded body 160 for threaded engagement within the threaded opening 158 of the conductive member 106 . one opposing end of the threaded body 160 is provided with a circular flange 162 and an enlarged head 163 having a transverse slot 164 adapted to receive the tip of a screwdriver or other such implement to effect rotation of the threaded member 108 as to be described hereinafter . the other opposing end of the threaded body 160 is formed as an unthreaded cylindrical projection 165 of reduced diameter . the threaded member 108 may be constructed from a variety of materials , such as stainless steel , plastic or the like . the terminal contact members 114 , 116 are constructed as a u - shaped member 166 including a pair of spaced apart legs 168 , 170 planar electrical contact regions 171 and an outwardly extending depending member 172 defining an external contact terminal to the trimmer capacitor 100 . the terminal contact members 114 , 116 may be constructed from a variety of metals , such as copper based alloys , beryllium - copper , phosphor bronze or base metals plated with silver or gold . the dielectric plates 110 , 112 are generally of rectangular construction sized to be received within the dielectric plate receiving openings 136 within the base 104 so as to be positioned overlying a portion of the wall surfaces 154 , 156 of the conductive member 106 . the dielectric plates 110 , 112 can be constructed from a variety of materials , for example , quartz , alumina ( aluminum oxide ), sapphire ( aluminum oxide pure crystal ), porcelain , dielectric resonator materials , barium titanate ceramics , plastics and the like . it should be understood that by changing the dielectric constant of the dielectric plates 110 , 112 , vis - a - vis the selected material , the capacitance range of the trimmer capacitor 100 may be predetermined as desired . in accordance with one embodiment of the present invention , approximately one - half , i . e ., top half or bottom half , of the outer surface 173 of the dielectric plates 110 , 112 is coated with a conductive layer 174 , e . g ., a metallized layer such as silver frit , platinum , copper and the like . in addition , the conductive layer 174 applied to the outer surface 173 of the dielectric plates 110 , 112 may be in the nature of a metal plated base alloy using thick or thin film technology . the assembly of the aforementioned components of the trimmer capacitor 100 will now be described with general reference to fig2 - 4 . the conductive member 106 is rotatably mounted onto the threaded member 108 via threaded opening 158 . washer 120 is positioned on flange 162 of the threaded member 108 about head 163 . o - ring 118 is positioned within the annular recess 128 of the housing 102 and metal bearing 122 is positioned within the bore 140 of the base 104 . the dielectric plates 110 , 112 are supported within opposing dielectric plate receiving openings 136 within the base 104 with their conductive layers 174 facing outward . the dielectric plates 110 , 112 may be arranged such that the conductive layers 174 are either on the top or bottom half as to be described hereinafter . the dielectric plates 110 , 112 are maintained in spaced apart parallel relationship by positioning the conductive member 106 therebetween as best shown in fig3 . the cylindrical projection 165 of the threaded member 108 is received within the bearing 122 as positioned within the bore 140 of the base 104 . as shown in fig2 the dielectric plates 110 , 112 are positioned overlying a portion of the opposing wall surfaces 154 , 156 of the conductive member 106 , i . e ., a first contact portions . the dielectric plates 110 , 112 by being unsecured are considered to be free floating . that is , the dielectric plates 110 , 112 are allowed to move inwardly towards each other so as to make surface contact with the opposing wall surfaces 154 , 156 of the conductive member 106 . the dielectric plates 110 , 112 , are maintained in proper registration and in aligned contact with the first contact portions of conductive member 106 by means of the dielectric plate receiving openings 136 as previously described and terminal contact member 114 . to this end , the terminal contact member 114 is positioned about the base 104 in alignment with the cutout portion 146 defined between ribs 148 . the terminal contact member 114 has its depending legs 168 , 170 extending about and engaging the spaced apart dielectric plates 110 , 112 . the dimension between the free ends of legs 168 , 170 at the electrical contact regions 171 is smaller than the distance between the outer surfaces 173 of the dielectric plates 110 , 112 . as a result , the terminal contact member 114 compresses each dielectric plate 110 , 112 into surface contact with the opposing wall surfaces 154 , 156 of the conductive member 106 . any air gap between the dielectric plates 110 , 112 and the wall surfaces 154 , 156 of the conductive member 106 is effectively eliminated which would otherwise cause potential variations in the capacitance of the trimmer capacitor 100 from time to time during operation . more specifically , the electrical contact regions 171 of legs 168 , 170 contact the dielectric plates 110 , 112 over a central region . the electrical contact regions 171 engage the central region of the dielectric plates 110 , 112 in a manner to provide stability to the dielectric plates 110 , 112 during linear translation of the conductive member 106 between positions of minimum and maximum capacitance of the trimmer capacitor 100 . in this regard , the electrical contact regions 171 of legs 168 , 170 continuously oppose a portion of the conductive member 106 regardless of the position of the conductive member to prevent the dielectric plates 110 , 112 from toeing inwardly as a result of their free - floating arrangement . in this regard , as shown , when the conductive member 106 is either at its maximum or minimum position , a portion of the electrical contact regions 171 maintain a force upon the dielectric plates 110 , 112 in engagement with a portion of the conductive member . as such , there is an even and uniform force applied to the free floating dielectric plates 110 , 112 to ensure uniform and constant surface contact between the dielectric plates and the wall surfaces 154 , 156 of the conductive member 106 during linear movement thereof during adjustment and subsequently during use when installed in an electronic device . the other terminal contact member 116 is similarly arranged about the base 104 being positioned in alignment by means of the cut - out portions 146 between adjacent ribs 148 . the electrical contact regions 171 of the legs 168 , 170 of the terminal contact member 116 are in direct sliding contact with portions , i . e ., second contact portions , of the wall surface 154 , 156 of the conductive member 106 . thus , the terminal contact members 114 , 116 have four related functions , providing contact to the conductive member 106 , providing compression to maintain contact with the conductive member 106 , providing contact with the dielectric plates 110 , 112 and providing terminals , i . e ., depending members 172 to the electronic circuit in which the trimmer capacitor 100 is employed . the trimmer capacitor 100 , as thus far assembled , is received within the interior 124 of the housing 102 such that head 163 of the threaded member 108 extends into bore 126 and is circumferentially engaged by o - ring 118 . in this manner , a fluid tight seal is created within the bore 126 , while at the same time , allowing access to the slot 164 of the threaded member 108 to enable rotation thereof by means of a suitable implement such as a screwdriver and the like . as the printed circuit board to which the trimmer capacitor 100 is mounted will inevitably be subjected to process cleaning fluids and the like , it is highly desirable that the trimmer capacitor be completely sealed from the surrounding environment . to this end , a potting compound 176 such as epoxy or silicone is provided within the opening 130 of the housing 102 and surrounding the base 104 . briefly , in operation , the tip of a screwdriver or other such implement is inserted within slot 164 to rotate the threaded member 108 about its longitudinal axis . as a result , the conductive member 106 is displaced between the dielectric plates 110 , 112 along a linear path between the limits established by the base 104 and flange 162 of the threaded member 108 . as shown in fig3 the conductive layer 174 of the dielectric plates 110 , 112 is arranged in the upper half of the interior 124 of the housing 102 closest to flange 162 of the threaded member 108 . by arranging the conductive layer 174 within the upper portion of the housing 102 , a number of advantages are achieved . for example , this arrangement results in a lower minimum capacitance achievable by the trimmer capacitor 100 to about 0 . 6 pf ., which otherwise would be about 2 . 5 pf . for the same dielectric material and the conductive layers 174 arranged in the bottom half of the housing 102 . in addition , it is found that the temperature coefficient of the trimmer capacitor 100 will be lower . the temperature coefficient is the measure of how much the capacitance changes when measured at extreme temperatures . still further , the quality factor , i . e ., the ratio of energy stored to energy dissipated , will be higher for the trimmer capacitor 100 . these advantages result by arranging the conductive layer 174 within the upper half of the housing 102 as the stray capacitance caused by the plastic parts , e . g ., base 104 , and the terminal contact members 114 , 116 are not as extensively positioned within the active circuit of the trimmer capacitor 100 as would otherwise occur . finally , the stresses caused by the expansion or contraction of the housing 102 and base 104 do not act directly on the conductive layer 174 of the dielectric plates 110 , 112 . however , it is to be understood that the conductive layer 174 of the dielectric plates 110 , 112 , may be arranged within the bottom half of the housing 102 adjacent the base 104 without departing from the present invention . as shown in fig2 and 3 , the conductive layer 174 of the dielectric plates 110 , 112 , are in their maximum overlapping relationship with the conductive member 106 . as a result , the trimmer capacitor 100 has its maximum rated capacitance . on the other hand , when the conductive member 106 is arranged in the position shown in phantom , the conductive layer 174 of the dielectric plates 110 , 112 are in their minimum overlapping relationship with the conductive member 106 . this results in the trimmer capacitor 100 having its minimum rated capacitance . as the rotatable member 108 is rotated , the capacitance of the trimmer capacitor 100 will vary from its minimum to maximum depending upon the percentage overlap between the conductive layer 174 of the dielectric plates 110 , 112 and the conductive member 106 . the number of threads on the rotatable member 108 determines the resolution of the trimmer capacitor 100 . for example , the trimmer capacitor 100 may be made operative between its minimum and maximum capacitance in about nine to ten turns of the rotatable member 108 . although the invention herein has been described with references to particular embodiments , it is to be understood that the embodiments are merely illustrative of the principles and application of the present invention . for example , only one dielectric plate may be used or , in another embodiment , a square design includes four dielectric plates and a square shaped sliding conductive member . it is therefore to be understood that numerous modifications may be made to the embodiments and that other arrangements may be devised without departing from the spirit and scope of the present invention as defined by the claims .	7
fig1 illustrates the general configuration of sense amps in a memory array . a pulldown sense amp 20 includes cross coupled n - channel transistors q1 and q2 , as well as a pulldown transistor q3 , which is an n - channel transistor driven by a signal designated as lensa . these elements play a part in sensing and amplifying a voltage difference between d and d * caused by shorting a memory cell 22 to d by way of access transistor q4 . the sources of q1 and q2 are connected to a common pulldown node 24 , and the gate of each is connected to the other &# 39 ; s drain . the gate of q1 also connects to the lo line d , whereas the gate of q2 connects to the line d . as discussed above , each line d and its corresponding line d are initially at the same voltage dvc 2 . for purposes of explanation , dvc 2 is assumed to be 1 . 65 volts , or one half of the source voltage v cc , which is 3 . 3 volts . lines d and d * connect to opposite sides of each sense amp 20 . common pulldown nodes 24 found in the sense amp arrays will also be at dvc 2 . a signal sent through the path wl will cause a storage capacitor 150 of particular memory cell 22 to discharge to a line d , thereby slightly changing d &# 39 ; s voltage while the voltage of d * remains at dvc 2 . again , for purposes of explanation , a memory cell discharge will be assumed to cause a 0 . 2 volt difference in d . the pulldown sense amp 20 will then turn on when the common pulldown node 24 is one transistor threshold voltage below d or d , whichever is highest . for instance , if a memory cell 22 is storing a logic 1 , a discharge to d will increase d &# 39 ; s voltage to 1 . 85 volts . as a result , the pulldown sense amp transistor gated by d ( q2 ) turns on faster than the one gated by d ( q1 ). with transistor q2 on , d &# 39 ; s voltage is pulled down from 1 . 65 volts towards ground as the common pulldown node 24 is pulled down as well . further , the lowering voltage of d serves to turn on the pullup sense amp transistor gated by d * ( q14 ) before the other pullup sense amp transistor turns on . the voltage supply v cc then charges line d . on the other hand , if the memory cell 22 had been storing a logic 0 , then a discharge to d would slightly lower d &# 39 ; s voltage to 1 . 45 volts . the pulldown sense amp transistor gated by d * ( q1 ) would turn on first and d &# 39 ; s voltage would be further decreased toward ground by the pulldown sense amp , thereby allowing the pullup sense amp to increase d &# 39 ; s voltage toward v cc . in this way , a small voltage difference between d and d is sensed and amplified . once the voltage difference has been amplified , d and d * can drive less sensitive circuitry not shown in fig1 . it should be noted that , if a logic 0 is transmitted to d , then the pulldown sense amp need only pull down d from 1 . 45 volts . if a logic 1 is transmitted to d , then the pulldown sense amp must pull d * from the higher dvc 2 level -- 1 . 65 volts . therefore , if many logic 1 &# 39 ; s in a memory array row are read , the extra voltage that must be pulled contributes to saturating the pulldown transistor q3 with drive current , thereby slowing any further pulldown . the problem created by slow pulldown is illustrated in fig2 where slope x denotes the initial discharge to d from a memory cell 22 storing a logic 0 . fig2 further illustrates the amplification of the difference in voltage between d and d . slope y denotes the time required for d to drop in voltage given a situation where a row of cells contains a roughly equal number of logic 1 &# 39 ; s and logic 0 &# 39 ; s . should there be many logic 1 &# 39 ; s read amongst a single logic 0 , then the outcome changes : as the logic 0 is read , the pulldown transistor q3 , having approached saturation , takes much longer to pull down d &# 39 ; s voltage . this result is illustrated by slope z . other circuitry elements ( not shown ) that are driven by d may read d before its transition to a lower voltage has been completed . as a result , a logic 0 value may be misread as a logic 1 . as illustrated in fig3 increasing the voltage to the gate of the pulldown transistor allows the transistor to pulldown more current before saturation . one preferred embodiment of the current invention that uses this principal is detailed in fig4 where the pulldown transistor q3 is driven by a test circuit 26 through an inverter 27 . in this embodiment , the inverter 27 comprises a p - channel transistor q6 and an n - channel transistor q8 . the coupled gates of inverter transistors q6 and q8 form an input node 28 for receiving a signal ensa , which may be v cc , ground , or a signal from another driver . the coupled drains of the inverter transistors q6 and q8 output the lensa signal that drives the pulldown transistor q3 . the source of q8 is coupled to ground . the source of q6 is coupled to a source node 30 that branches into a first conducting path 32 and a second conducting path 34 . the first conducting path 32 is coupled to an n - channel transistor q10 , which has a channel width - to - length ratio of around 500 / 2 . the drain of transistor q10 is coupled to a contact pad 36 . it should be understood that the term &# 34 ; contact pad &# 34 ; includes any conductive surface configured to permit electrical communication with a circuit or a node . the gate of transistor q10 is coupled to an inverter 60 through another n - channel transistor q36 . together , inverter 60 and transistor q36 comprise a latch device , and both are coupled to v ccp . further , inverter 60 receives a test * signal as an input . in addition , the gate of transistor q10 is also coupled to a feedback capacitor 62 . this feedback capacitor 62 comprises an n - channel transistor having a size of approximately 100 / 100 , wherein the drain and source are shorted and coupled to the first conductive path 32 . the second conducting path 34 is coupled to a p - channel transistor q12 , driven by a signal test , which is understood to be the complement of test . the transistor q12 is also coupled to v cc , although no voltage source is considered to be a part of the invention . during testing , test transmits a low voltage signal which is received by the inverter 60 . in response , the inverter 60 initiates a v ccp signal , sending it through transistor q36 which outputs the v ccp signal to the gate of transistor q10 , thereby switching on q10 . the feedback capacitor 62 serves to maintain and replenish this v ccp signal in the event of leakage . capacitive coupling between the gate and drain of transistor q10 allows q10 to carry signals having a range of voltages for modifying the drive of the pulldown transistor q3 . simultaneously , the test signal , applying a high voltage to transistor q12 , isolates v cc . a test data pattern is entered into the memory cells 22 and read with varying voltages driving the pulldown transistor q3 . the data read at various alternate voltages sent through bond pad 36 can be compared with the data as originally written . this series of readings indicates the range of voltages through which the pulldown transistor q3 is capable of allowing accurate data readings . once testing has ended , test * sends a high voltage signal and test becomes low , thereby isolating the bond pad and allowing the v cc signal to transmit to the pulldown transistor q3 . the embodiment illustrated in fig5 is a package part of the semiconductor circuit device and receives a plurality of voltage sources with different magnitudes . the test circuit 26 allows selection among these sources for driving the gate of the pulldown transistor q3 . the inverter 27 is the same as in fig4 . in this exemplary embodiment , however , source node 30 is coupled to three discrete voltage sources . first , source node 30 is coupled to v ccp through a p - channel transistor q20 that is driven by a low signal a . source node 30 is also coupled to dvc 2 through another p - channel transistor q22 that is driven by a low signal b . finally , source node 30 is coupled to v cc by way of a p - channel transistor q24 . this p - channel transistor q24 is gated by the output of a logic unit , such as a nand gate 46 , which will drive transistor q24 in response to receiving a high signal a as a first input and a high signal b as a second input . given the input vector scheme of this embodiment , one of the transistors q20 , q22 , or q24 will be operable to the exclusion of the other two . thus , a low signal a * will drive the p - channel transistor q20 , thereby allowing v ccp to drive the pulldown transistor q3 . simultaneously , signal b will be high , turning off p - channel transistor q22 . further , the nand gate output will also be high and turn off p - channel transistor q24 . if , on the other hand , signal b is low and signal a is high , then only p - channel transistor q22 will be on , allowing dvc 2 to transmit to the pulldown transistor q3 . only when both signals a and b are high does the nand gate 46 output a low signal and allow v cc drive the pulldown transistor q3 . the data read at these three voltage levels can then be compared with the data as originally written . it should be noted that this configuration does not require the die space needed for the contact pad 36 . another embodiment concerns varying the voltage applied to a pullup sense amp 40 . as seen in fig1 the pullup sense amp 40 includes cross coupled p - channel transistors q14 and q16 as well as a pullup transistor q18 . as one of ordinary skill in the art understands , there is generally a pullup sense amp 40 corresponding to every pulldown sense amp . nevertheless , for purposes of clarity , only one pullup sense amp 40 is shown . the sources of q14 and q16 are connected to a common pullup node 42 , and the gate of each is connected to the other &# 39 ; s drain . further , the gate of q14 connects to line d , and the gate of q16 connects to line d . common pullup node 42 is coupled with pullup transistor q18 , which is another p - channel transistor . pullup transistor q18 is also coupled to the voltage source v cc . the pullup transistor q18 is driven by a signal lepsa . fig6 illustrates that the voltage driving pullup transistor q18 may also be varied through the use of a test circuit 26 analogous to that used with the pulldown transistor q3 in fig5 . fig6 depicts an inverter 27 comprising a p - channel transistor q26 and an n - channel transistor q28 . the coupled gates of inverter transistors q26 and q28 form an input pathway 48 for a control signal designated epsa . the coupled drains transmit the inverted output signal epsa * which , in turn , is received by a prior art device 50 that outputs the lepsa * signal used to drive the pullup transistor q18 . the source of q26 is coupled to v cc , whereas the source of q28 is coupled to the test circuit 26 which , in this embodiment , includes three conductive paths . the first path 52 leads to dvc 2 by way of an n - channel transistor q30 , which is driven by a signal c . the second path 54 is coupled to a voltage source v bb through an n - channel transistor q32 , as driven by a signal d . the third path 56 leads to ground by way of n - channel transistor q34 . the gate of n - channel transistor q34 is coupled to the output of a nor gate 58 . the nor gate 58 accepts signal c as a first input and signal d as a second input and will activate transistor q34 only when both signals are low . further , this embodiment is configured in a manner analogous to the embodiment in fig5 in that signals c and d will never simultaneously activate their respective transistors q30 and q32 . the three n - channel transistors q30 , q32 , and q34 will turn on if a high , or logic 1 , signal is transmitted to their respective gates . as with the embodiment shown in fig5 for the pulldown sense amp , the signals and transistors are configured to allow only selective communication between one voltage source and the pullup transistor q18 . as a result , if signal c is high , it will latch the n - channel transistor q30 and provide electrical communication between dvc 2 and the pullup transistor q18 . at the same time , the low signal from d turns off n - channel transistor q32 . under these circumstances , the signals c and d also result in a low signal output from the nor gate 58 , thereby turning off n - channel transistor q34 . thus , all of the other voltage sources are isolated . similarly , if signal d is high , then only n - channel transistor q32 is turned on and v bb electrically communicates with pullup transistor q18 . when both signals are low , the nor gate 58 outputs a high signal , thereby grounding the source of the n - channel inverter transistor q28 . this embodiment has benefits similar to the embodiment in fig5 . returning to fig1 a prior art equilibration circuit can be seen as part of the memory device . for purposes of explaining the following embodiments of this invention , v cc is now presumed to be 5 volts . a transistor q101 is coupled between digit line d and its complementary digit line d . the transistor is driven by an equilibration signal eq . it should be noted that the signal eq results from a logic function and is distinguishable from the equilibrate voltage veq , which represents the common mid - range voltage level of the complementary digit lines before a reading operation . the signal eq also drives two additional transistors q102 and q103 , which are connected together in series at a node 120 . these connected transistors q102 and q103 are also coupled between lines d and d . moreover , node 120 is coupled to a cell plate 64 and a dvc 2 voltage generator 68 through a bleeder device 122 . the dvc 2 voltage generator 68 transmits a cell plate signal cp of voltage dvc 2 to the node 120 . for purposes of explaining the following embodiments of this invention , dvc 2 is now 2 . 5 volts . the bleeder device 122 is driven by a signal of voltage v ccp , wherein v ccp results from having pumped v cc to an even higher potential . at the beginning of a precharge cycle , digit line d and its complementary digit line d * are at different voltages as a result of a discharge of the memory cell 22 during the reading cycle . one line will have a charge equal to the v cc value of 5 volts , while the other line will have a 0 volt charge . the equilibrate signal eq is then sent , activating transistor q101 , which shorts d and d * together . moreover , the signal eq activates transistors q102 and q103 , which not only provide another short between d and d * but also allow the cp signal to be communicated to those lines . as a result , the lines d and d * equilibrate , both gaining a charge of potential dvc 2 ( 2 . 5 volts ), which is the desired equilibrate voltage veq in this example . once the lines are equilibrated , they are ready for further testing . for various reasons , a particular portion of the memory array may be defective . hopefully , testing processes will identify those defects . as discussed above and illustrated in fig7 a , a first defect 124 that may exist is a short to ground of the digit line d . fig7 b illustrates the effect of the first defect 124 . during the precharge cycle , the cp signal is trying to charge the digit lines d and d * to the 2 . 5 volt dvc 2 level and maintain that level . however , if the resistance of the short is not too great , the first defect 124 may cause the digit lines to discharge toward ground faster than cp can charge them to 2 . 5 volts . as a result , once the precharge process has ended at time t 1 , the digit lines may be equilibrated at a potential lower than 2 . 5 volts , such as 1 . 7 volts . having a veq at a level other than dvc 2 makes the memory array susceptible to reading errors . for example , in the present situation illustrated in fig7 b , where veq is too low , line noise on d occurring at time t 2 is more likely to register as a logic 0 discharge when in fact the storage cell 150 contains a logic 1 and has not yet discharged . alternatively , assuming that a logic 1 is properly discharged and sensed at time t 2 &# 39 ;, a reading error is still likely : as seen in fig7 c , veq may be so low due to the short that the pullup sense amp may not be able to sufficiently pull up the digit line &# 39 ; s voltage by the time t 3 , when external circuitry accesses line d . in order to find such a reading error , prior art requires an extended precharge time , up to time t 1 , in order to allow the discharge from the first defect 124 to overtake the charge from cp . the current invention , however , provides an alternative to requiring a long precharge time . fig7 a illustrates that the v ccp signal driving the bleeder device has been replaced with the test circuit 26 that applies a different voltage vreg to regulate the bleeder device . in the case of the first defect 124 , the test circuit 26 transmits a signal having a voltage lower than v ccp to drive the bleeder device 122 . this causes a slower charge rate and allows the discharge from the first defect 124 to quickly overtake the charging from cp , as seen by the dashed lines in fig7 b and 7c . with the resulting increased disparity between the charge rate and the discharge rate , the precharge period need only endure until time t 1 &# 39 ; in order to increase the likelihood of detecting an error . the design of test circuit 26 can be the same as those used in fig4 and 5 , wherein a source node 30 has access to at least one test voltage , either through a bond pad 36 or from a discrete voltage source . in this application , however , the source node 30 is coupled to the bleeder device 122 . furthermore , v ccp is the voltage used in non - test operations to drive the bleeder device , and v cc and dvc 2 are used to slow the charge rate . it should be further understood that the number of voltage options could be increased . alternatively , the number of voltage options could be decreased to offer only one test voltage and one non - test voltage . these circuit embodiments , as well as others falling under the scope of the invention , have uses in detecting other defects . fig8 a illustrates another defect 136 that might occur within a memory array . the cross - sectional view in fig8 a shows the cell plate 138 coupled to a first n - region 140 of access transistor q4 . ideally , the only way for the dvc 2 voltage generator 68 to charge the digit line d through the cell plate 138 is to drive the gate 142 of transistor q4 so that the charge may pass from the first n - region 140 to a second n - region 144 . from there , the charge travels through a tungsten plug 146 , which serves as a contact between the second n - region 144 and the digit line d . occasionally , however , a second defect 136 in the memory array may occur in the form of a short between the cell plate 138 and the tungsten plug 146 . as discussed above , a long ras low signal is used to detect this second defect 136 . assuming line d is charged to 0 volts , fig8 b shows that the long ras signal allows line d to be charged to a higher voltage . thus , when the low ras signal ends at time t 1 and the digit lines are shorted to begin equilibration , the digit lines will no longer have an initial tendency to reach an average potential between 5 and 0 volts ( 2 . 5 volts ). rather , because line d is now higher than 0 volts , the shorted lines will settle at a higher midpoint , such as 3 . 5 volts . at this point , the margin between the new equilibrate voltage and the voltage representing a logic 1 has decreased . thus , an erroneous reading is more likely , as discussed above . conversely , if line d is initially charged to v cc ( fig8 c ), the short to the cell plate will cause d &# 39 ; s voltage to lower during a long ras low period . the resulting equilibrate voltage of lines d and d * could be lower than the preferred 2 . 5 volts . the lower equilibrate would again make an error in reading more likely . in either case , the cp signal will restore the equilibrate voltage to 2 . 5 volts by time t 2 . however , by decreasing the drive to the bleeder device 122 , any of the embodiments of the current invention will serve to slow down the restoration of veq to dvc 2 . with restoration time extended to time t 2 &# 39 ;, any circuit embodiment of the current invention increases the likelihood of detecting errors that would suggest the existence of the second defect 136 . alternatively , fig8 d shows that a circuit embodiment of the current invention could be used during a non - test mode to compensate for the second defect 136 by driving the isolation device 122 at a higher - than - normal level . as discussed above , the bleeder device 122 is normally driven at v ccp , a voltage level representing one or two v t &# 39 ; s above v cc . the potential v t , in turn , is the threshold voltage of the bleeder device 122 . a further increase in the potential of v ccp would allow the bleeder device 122 to quickly restore veq to 2 . 5 volts by time t 2 &# 34 ;. the shorter restoration period reduces the chances of an erroneous reading . fig9 a demonstrates yet another instance wherein the current invention could shorten test time . this instance concerns a third defect 148 comprising a short that may be caused by a nitride defect within the storage capacitor 150 of a memory cell 22 . it should also be noted that one of the plates of the storage capacitor 150 is in fact the cell plate 64 and is therefore connected to the dvc 2 generator . given this third defect 148 , fig9 b indicates that the cp signal , having a potential of dvc 2 , will charge the storage capacitor 150 toward that potential even though a logic 0 has been written to that cell for test purposes . during a static refresh pause , the word line wl leading to the memory cell 22 will continuously transmit a low signal , which turns off access transistor q4 of the memory cell 22 and allows the storage capacitor 150 to take on a greater charge . with the stored charge having a higher voltage , such as 2 volts , it is more likely that the logic 0 will be misread at line d as a logic 1 . in order to speed up the leakage into the storage capacitor 150 , dvc 2 is forced to a voltage higher than the normal 2 . 5 volts . unfortunately , this would not result in much benefit under the prior art , as demonstrated by fig9 c : because the cp signal has a voltage of dvc 2 and is in communication with d and d * during the static refresh pause , the cp signal would also charge lines d and d * to a higher voltage . with the circuit embodiments of the present invention , however , a lower voltage could be used to drive the bleeder device 122 and thereby slow the charging of the digit lines , as illustrated in fig9 d . thus , while d and d * are regulated to substantially remain at 2 . 5 volts despite the forced dvc 2 voltage , the storage capacitor may be quickly charged to a higher potential , such as 2 . 7 volts , which exceeds the equilibrate voltage and makes it very likely that a logic 1 will be mistakenly recognized . one of ordinary skill can appreciate that , although specific embodiments of this invention have been described for purposes of illustration , various modifications can be made without departing from the spirit and scope of the invention . concerning the invention as used with a sense amp , for example , a test circuit for the pullup sense amp could be configured to transmit an entire range of voltages through a contact pad , as done with the pulldown sense amp depicted in fig4 . in addition , the test circuit 26 in fig6 could be used with a pulldown sense amp . conversely , the test circuit 26 in fig5 could be used with a pullup sense amp . moreover , both of these test circuits could be coupled to the same inverter and used to test drive either type of sense amp . further , regarding the embodiments use with a cell plate , it should be noted that the embodiments may be applied for other testing . any circuit embodiment , for instance , may be used during the precharge cycle discussed above in order to detect a short between a row line and a column line . moreover , a circuit embodiment of the current invention could also be used during a non - test mode to overcome other defects in addition to the short between a digit line and cell plate , as described above . it should also be noted that , given a particular voltage source used in an embodiment , that source can be independent of v cc rather than a mere alteration of v cc , such as v ccp or dvc 2 . accordingly , the invention is not limited except as stated in the claims .	6
referring now to the drawings , it is seen that the system for the environmental viewing of an outdoor ad space of the present invention involves capturing video images 12 of each outdoor ad space 14 within a salesperson &# 39 ; s outdoor ad space portfolio . to capture each image 12 , a video camera 16 is mounted onto a dashboard 18 or other suitable location of a vehicle 20 ( or may be held by a passenger within the vehicle 20 ), the video camera 16 pointing outwardly through the front windshield 22 of the vehicle 20 . the video camera 16 records as each outdoor ad space 14 is driven past so as to capture an image 12 that approximates what a motorist sees when driving pass the outdoor ad space 14 . the length of the image to capture is decided by the operator and may be from the time the outdoor ad space 14 can be seen to the time the outdoor ad space 14 cannot be seen , however , the image 12 may run from prior to the outdoor ad space 14 coming into view to after the outdoor ad space 14 is out of view in order to give the client a sense of the area whereat a particular outdoor ad space 14 is located . the operator of the video camera 16 notes what outdoor ad space 14 is associated with each video clip being recorded . such outdoor ad space location may be via physical location of the outdoor ad space 14 , may be some internal identifying code associated with each outdoor ad space 14 , or may be by gps ( global positioning system ) coordinates of the outdoor ad space 14 . the gps coordinates can be captured manually either from a gps - based navigation device installed within the vehicle 20 or via a hand - held gps device ( neither illustrated ) or , as some video cameras come equipped with gps chips that tag the gps coordinates to the image being recorded , the video camera 16 itself can capture the gps coordinates of the outdoor ad space 14 being recorded . each image 12 that is recorded is downloaded into an appropriate database with each image 12 being retrievable from the database via an appropriate identifier . a client logs onto the system for the environmental viewing of an outdoor ad space on his or her computer 24 in some appropriate fashion and is taken to a screen 26 wherein images 12 of the various outdoor ad spaces 14 can be retrieved and viewed . the client enters either the physical location 28 in an address box 30 , which physical location 28 can be a roadway name and a mile marker or cross street or even a roadway name and a landmark , such as main street at the baseball park . the client may enter only a roadway name 28 and have all of the images 12 that are on that particular roadway retrieved with possible further refinement to a section of the roadway if the roadway is long or has a high number of outdoor ad spaces 14 therealong . the database search engine also performs best match searches so that if in the example shown in fig2 , of i - 65 at mile marker 23 is entered , yet the database is not populated with such an entry , the search engine retrieves one or more near matches so that the system returns an image of an outdoor ad space 14 at mile marker 22 and another image of an outdoor ad space 14 at mile marker 25 , for example , allowing the client to view the desired image 12 or both images 12 as desired . alternately , an identification code 32 is entered in an identifier box 34 that identifies the outdoor ad space 14 under consideration by some identifier 32 provided by the salesperson and the appropriate image 12 retrieved via this identifier 32 . when the identifier 32 is entered into the identifier box 34 , an optional pop - up balloon can be displayed that gives the physical location of the outdoor ad space 14 about to be retrieved by the client so as to verify to the client that the correct image 12 is about to be retrieved . alternately , gps coordinates 36 can be entered into a gps coordinate box 38 and the database is searched via such coordinates 36 , again performing a best match type of retrieval . once the appropriate outdoor ad space identifier ( physical location 28 , identification code 32 , or gps coordinates 36 ) is entered , the database is searched via the identifier and the appropriate image 12 retrieved . if more than one image 12 is retrieved , then an intermediate screen ( not illustrated ) is displayed , which intermediate screen displays all of the database output resulting from the input query , possibly with a representative thumbnail of each image 12 retrieved , allowing the client to select a particular image 12 . thereafter , the image 12 is viewed on the screen 26 of the computer 24 . the image 12 can be manipulated ( play , stop , pause , rewind , etc ., in the usual way using typical control buttons 40 . other information may be displayed on the screen 26 such as the identifier 32 , the physical location 28 , and / or the gps coordinates 36 . additionally , a traffic count number 42 can be displayed in order to allow the client to know approximately how many vehicles 20 pass the outdoor ad space 14 under consideration in a given time period . the traffic count number 40 can be further refined into smaller time periods if desired . for example , an entrepreneur running a coffee and donut shop is far more interested in the vehicle counts between , say 6 : 00 am to 9 : 00 am ( breakfast time ) than overall daily counts . the client views each desired image 12 in turn in order to make a more informed decision as to what outdoor ad spaces 14 to advertise upon . of course , if the client is local , the client can physically go to each prospective location identified by the system for the environmental viewing of an outdoor ad space in order to gather even more information . while the invention has been particularly shown and described with reference to an embodiment thereof , it will be appreciated by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention .	6
the present disclosure provides a system and method for extracting performance metrics of objects without the use of transmitters . the present disclosure may be used in any suitable application including , for example , sports evaluation , coaching , entertainment and medical applications . although the following description primarily describes embodiments of the present disclosure for use in conjunction with sports related applications , it should be understood that embodiments of the present disclosure may be used in a variety of other suitable applications . the present disclosure evaluates objects contained in a live video stream and performs image processing algorithms on the user - selected object and tracks that object . using information obtained by tracking the object , the present disclosure can calculate object metric data . fig1 is a snapshot of a sample video 100 of a person 102 moving in a watercraft 104 shown on any suitable media player 106 . it should be understood that video 100 may be any audio / visual file ( avi ), video , film or movie that is stored in or is capable of being stored in digital form . video 100 is shown for illustration purposes only . video 100 could include any suitable moving objection according to one embodiment of the present disclosure . one embodiment of the present disclosure traces an object &# 39 ; s movement on video and can process the movements into a series of useful information . for example , the sample video 100 referred to in conjunction with the description accompanying fig1 is first downloaded into a computer program according to one embodiment of the present disclosure . the moving object ( for example , watercraft 104 ) is followed throughout the image plane through various motion detection algorithms and image correlations as described later in detail herein . the computer program referred to above is generally referred to herein as trackometer ™. fig2 is a sample snapshot of a graphical user interface ( gui ) 200 for the main screen of the trackometer ™. in one embodiment , the trackometer ™ computer program evaluates the objects contained in the sample video based on the user - selected analysis . the gui 200 is for illustration purposes only and may be in any suitable gui or other interface . say for example , that the user desires to track an object and calculate data such as velocity and accelerations . the gui 200 can display certain metrics important to the user in the metric display area 202 . the user , using the trackometer ™ graphical user interface ( gui ) 200 , can also select the entire stream , select portions of or a specific series of frames from the sample video . next , the user can select the specific object or group of objects within the video stream or frame to analyze . gui 200 also includes trackometer ™ playback controls are used to control the playback of the input file or sample video 100 . the slider bar 204 illustrates the current relative frame position with respect to the beginning and ending of the input file or sample video 100 . the running frame counter displays the current frame , and the total frames in the file . the playback controls include a “ play ” 206 , “ frame advance ” 208 , “ frame reverse ” 210 , “ forward ” 212 , “ reverse ” 214 and “ stop ” 216 capabilities . in one embodiment , the “ play ” button 206 plays the input file 100 and preferably toggles from “ play ” to “ pause ” as the user views the file . the “ stop ” button 216 stops the input file 100 in the current frame . preferably , after the “ stop ” button 216 is enabled , a subsequent election of the “ play ” button 206 will start the input file 100 from the beginning of the input file 100 . in one embodiment , the “ frame advance ” 208 or “ frame reverse ” 210 controls are used to advance or reverse frames , respectively , preferably in increments of 1 or 10 . the increments are preferably selected by the user and allow viewing the entire or selected portions of the input file 100 on a frame by frame basis . in one embodiment , a “ frames per second ” control gives the user the flexibility to choose the rate at which the input file will be recorded . by changing the “ frames per second ” control , the user can preferably change the value of the playback speed . the scale is proportional to the size of the input file 100 . the current frame selected is indicated in a current frame window and can be changed by dragging the slider 204 to the portion of the input file 100 desired by the user . in addition , the playback speed may be increased or decreased by the user using the slider button 204 . it should be understood that other embodiments of the trackometer ™ playback controls may be used including , for example , embodiments in which the respective buttons have different functionality . in one embodiment , the user can define each of the control buttons differently from the standard set - up described earlier . for example , the trackometer ™ playback controls may include any other suitable controls such as , for example , a separate “ pause ” control or a “ fast forward ” control . as another example , the gui 200 shown may be changed to suit a certain application or project . it should be understood that any suitable gui 200 may be used as required according to embodiments of the present disclosure . after selecting the object or group of objects to track , the video stream 100 may be played in real time and trackometer ™ can provide a real time analysis of the selected object &# 39 ; s metrics . for example , suppose that the sample video stream 100 contained footage of a runner participating in a 100 yard dash . suppose further that the runner &# 39 ; s coaches had a desire to monitor and analyze the runner &# 39 ; s injured left leg as the 100 yard dash was going on . a camera is set up to capture the runner &# 39 ; s image as she attempts the 100 yard dash . the user can download the video directly to trackometer ™ and set it up to monitor the runner &# 39 ; s left leg . as the 100 yard dash occurs , the coaches are able to track the performance of the runner &# 39 ; s left leg in real time as the 100 yard dash is performed . in other words , the user ( perhaps a coach or team manager ) is able to monitor the velocity and acceleration of the runner &# 39 ; s left leg in real time during the 100 yard dash . the real - time information may be displayed in a superimposed results box , displayed as part of gui 200 and / or recorded , downloaded and reviewed at a later time . the physical location of the result box on the image may be changed using the velocity overlay box portion 308 a of the gui 300 a or 300 b , for example , to a location most convenient to the user . the colors and background of the results box may be changed to suit the user &# 39 ; s immediate needs using the gui 300 a or 300 b . other features may also be changed according to a user &# 39 ; s preference . the user interfaces shown in fig3 a and 3b for trackometer ™ are alternative embodiments for gui 300 a and 300 b , respectively , and are shown for illustration purposes only . any suitable gui 300 a and 300 b may be used according to the present disclosure . gui 300 a and gui 300 b allow the user to choose several options while tracking a moving object . for example , a specialized area or “ track box ” area 302 a or 302 b may be designated to specify the image area to be tracked in order to isolate the object from other objects in the sample video 100 ( e . g ., tracking the left knee of a runner as opposed to the entire left leg ). in other words , the track box 302 a or 302 b allows the user to input the size of the image to be analyzed . as another example , tracking may be specified to an object of a specific color ( e . g ., tracking a red shoe worn by a runner ). in other words , the color box 304 a or 304 b may be used to input the specific color or colors required to be tracked . there are several other tracking options available to the user . for example , the user can specify that trackometer ™ track the relative movement between two objects using tracking block 306 a or 306 b . for example , suppose the coaches in the above example wanted to track both of the runner &# 39 ; s feet and the relative movement between the two . trackometer ™ can track such activity and provide information based on the relative movement of the runner &# 39 ; s two feet . as another example , suppose the coaches in the above example wanted to track activity of the feet of their runner against the same of one of their competitors . accordingly , trackometer ™ can track the relative motion of the two runners and provide a report of their performances with respect to each other . for example , the velocity differences between the two runner may be displayed by selecting the “ v = difference ” option . the rate at which the trackometer ™ reference image is updated may also be set in the “ reference % ” option . using tracking block 306 a or 306 b , a user can program trackometer ™ to identify and track the center of mass of an object . for example , suppose the coaches in the example given above wanted to track changes in the runner &# 39 ; s center of mass as the race progressed or during discrete time periods , such as while running past bends in the race track . trackometer ™ can track such activity and provide a visual aid such as , for example , a providing a highlighted or colored area within the image to track the center of mass for the user of the program . using gui 300 a or 300 b , and specifically tracking block 306 a or 306 b , a user can program trackometer ™ to adjust the image with different filters such as , for example , a mean filter or an edge filter . thus , in one embodiment , the present disclosure can use different filters on the image to specify a particular part of an object . in addition , the “ action size ” option sets the size that the trackometer ™ tracks in the next frame . in one embodiment , as the video is processed , the moving object and its location are determined . once the position is determined , a velocity may be calculated through a change in position over time . after two or more velocities are calculated , an acceleration calculation is determined from the change in velocities . in one embodiment , the present disclosure provides trackometer ™ the ability to track any minimum and / or maximum values obtained over a period of time . calibration is necessary to ensure the accuracy and reliability of the trackometer ™. calibration techniques essentially scale the program to the current image . in one embodiment of the present disclosure , for example , the user of the trackometer ™ first identifies a first sample object in the image of known size . the user enters the size of the sample object and inputs this into the trackometer ™ calibration gui . for example , the user enters the size of the sample object into the “ calibration 1 ” or cal . 1 field . after entering the size of the known object or objects , the user is then prompted to select two end points for a known distance . in order to calibrate the trackometer ™ accurately , care must be taken to select the ends of the object . in one embodiment , if there is a second sample object of known size in the image , the user enters the size of the sample object into the “ calibration 2 ” or cal2 field . otherwise , the user has the option to calibrate the trackometer ™ over one known image using the “ same cal . for both targets ” box . calibration may be performed at any time when the trackometer ™ is in a paused or stopped state . for example , in one embodiment of the present disclosure , if an input file changes the “ zoom ” setting , analysis should be stopped and a calibration is warranted . calibration may be performed on an image by image basis or by performing one calibration over a series of images in accordance with the present disclosure . in one embodiment , the trackometer ™ takes into account the properties of the camera used for the input video . for example , trackometer ™ may take into account , the location , field of view , tilt , range , projection corners and pan of the camera . each of or a desired subset of the factors may be used to calibrate the video image plan fed into the processing system . according , the as the camera moves , the calibration routine can adjust the subject object &# 39 ; s position in , for example , real time . for example , the camera factors may affect the pixels - to - feet scale factor used by trackometer ™ in its calculations . in another embodiment , if camera information is not available , a second calibration routine may be called upon . the second calibration routine places another image track on a known stationary object . accordingly , a position delta can be generated off of the fixed object . additionally , an object of known size can be used to provide additional input to produce the pixels - to - feet scale factor , if need be . it should be understood , however , that any number of suitable calibrations may be performed according to one embodiment of the present disclosure . in addition , trackometer ™ can track the overall changes and calculations in a report form as a function of a desired factor . for example , the user can request a performance report which calculates the acceleration of an object at one second intervals . as another example , the user can request a performance report that plots acceleration calculations in graphical form . as still another example , the use can request a performance report that averages the acceleration at any given time over several repeat performances ( e . g ., a report of the runner &# 39 ; s performances over five 100 yard dashes ). in one embodiment , the present disclosure saves raw data and any performance reports into user - designated output files . trackometer ™ has several other output formats . for example , in one embodiment , trackometer ™ may output a digital video file with object location and metric data overlaid in the file or video itself . thus , a person observing the video can watch the video and access the metric data easily on the same screen . in another embodiment , the present disclosure may also output an independent data stream via , for example , a serial or ethernet connection , with real - time data . thus , in this embodiment , multiple users may have access to such metric data while observing the video . in still another embodiment , the present disclosure provides an output in which discrete data files contain just the performance statistics in a database or report format . it should be understood that any aggregated display or other suitable form of output may be used according to one embodiment of the present disclosure . fig4 is a somewhat simplified block diagram describing the image processing 400 according to one embodiment of the present disclosure . image processing 400 is shown for illustration purposes only and other suitable image processing methods could be used according to one embodiment of the present disclosure . after a video is input into the system in step 405 , a user selects the object in the video to track in step 410 . the system determines the object and follows the object through the pixel space in step 415 . in step 420 , the video may be adjusted for color , luminance . in addition , the video image may be filtered to render a specific form of the image . any suitable adjustments and / or filtering could be used or applied according to the present disclosure . in step 425 , the video image may be processed to determine several factors such as , for example , the center of mass for the object . the detected motion is correlated for , for example , a minimum absolute difference and a specific x , y location . in some embodiments , the object &# 39 ; s location in 3d may also be possible . finally , the system outputs the objects pixel locations in step 430 . the system could output the pixel locations in any suitable form according to one embodiment of the present disclosure . the pixel locations are input into a translator that takes into account the camera and projection factors described above and a calibration process is completed in step 435 . finally taking into account the pixel locations and pixels - to - feet factor , the object location is finally found . in step 440 , the output is then correlated to find a change in location ( i . e ., delta location or “ δ ” location ). from the change in location , the system is able to calculate metrics such as , for example , velocity , acceleration , a change in velocity ( i . e ., delta velocity or “ δ ” velocity ), and a change in acceleration ( i . e ., delta acceleration or “ δ ” acceleration ) at any given point in time . the information correlated can be output in any user - desired form such as , for example , graphs , charts , tables , reports or any combination thereof in step 445 . embodiments of the present disclosure have many applications . for example , in certain embodiments the present disclosure may be used in the computer and arcade gaming market , entertainment related activities , children &# 39 ; s applications , rehabilitation services and sporting activities . in one embodiment , the present disclosure may be used to evaluate and predict an object &# 39 ; s performance . for example , owners and managers can track the speed of a batter &# 39 ; s swing or predict the dynamics of a golf swing . owners and managers of sports teams can use embodiments of the present disclosure to provide an analysis of a current athlete or a perspective athlete . owners and managers can also predict the performance of an athlete over time or analyze an athlete &# 39 ; s performance before and after injuries . in addition , owners and managers can use embodiments of the present disclosure to assess and rank team members based on a performance ability index based on certain metrics obtained by the trackometer ™. it may be advantageous to set forth definitions of certain words and phrases used in this patent document . the term “ couple ” and its derivatives refer to any direct or indirect communication between two or more elements , whether or not those elements are in physical contact with one another . the terms “ include ” and “ comprise ,” as well as derivatives thereof , mean inclusion without limitation . the term “ or ” is inclusive , meaning and / or . the phrases “ associated with ” and “ associated therewith ,” as well as derivatives thereof , may mean to include , be included within , interconnect with , contain , be contained within , connect to or with , couple to or with , be communicable with , cooperate with , interleave , juxtapose , be proximate to , be bound to or with , have , have a property of , or the like . while this disclosure has described certain embodiments and generally associated methods , alterations and permutations of these embodiments and methods will be apparent to those skilled in the art . accordingly , the above description of example embodiments does not define or constrain this disclosure . other changes , substitutions , and alterations are also possible without departing from the spirit and scope of this disclosure , as defined by the following claims .	6
the variable speed ratio , centrifugal drive clutch assembly 10 embodying my invention includes a drive sheave 12 mounted on a drive shaft 14 , driven shaft 16 , a driven sheave or pulley , generally 18 , which is mounted on the driven shaft 16 , and a drive belt 20 which operatively and drivably interconnects the drive sheave 12 with the driven sheave 18 . referring to fig3 my new drive sheave 12 is shown in an exploded , pictorial view . the drive sheave 12 includes a fixed sheave half 22 , a drive sleeve 24 , a movable sheave half which includes a movable sheave housing assembly , generally 26 , a spider assembly , generally 28 , a split ring 30 , a coil spring 32 , and a housing cover assembly , generally 34 . referring to fig3 - 5 , the fixed sheave half 22 is secured to the drive sleeve 24 so as to be non - rotatable and non - axially movable thereon . desirably , the fixed sheave half 22 is cast from aluminum directly onto the inner end of the drive sleeve 24 . the drive sleeve 24 advantageously includes peripheral grooves 36 therein so that the cast metal of the fixed sheave half 22 flows therein to prevent axial movement of the fixed sheave half 22 on the drive sleeve 24 . as will be described in greater detail , the drive sleeve 24 has a non - circular periphery , which is preferably hexagonal . since the fixed sheave half 22 is cast thereon , the hub of the fixed sheave half 22 is non - rotatable on the hexagonal sleeve 24 . the outer peripheral shape of the drive sleeve 24 , as described above , is non - circular , prefereably hexagonal , in cross - sectional shape . the drive sleeve 24 is fixed to a motor shaft 38 rotated by drive means ( not shown ) such as an internal combustion engine of the type used on a snowmobile . although one important application of the drive clutch 10 is in snowmobiles , it is to be understood that the device is useful for a wide variety of purposes . the drive sleeve 24 has a hollow interior which includes an inner peripheral frusto - conical portion 40 which receives , in mating relationship , the frusto - conical outer peripheral portion of a motor shaft 38 . the motor shaft 38 includes an outer cylindrical portion 44 having an end which is received within an opening 46 in a transverse interior wall 48 of the drive sleeve 24 . a threaded well 50 is provided in the outer end of the cylindrical portion 44 of the motor shaft 38 . a bolt 52 is threadably received within the threaded well 50 , with the head of the bolt 52 bearing against a lock washer 54 which , in turn , bears against the outer surface of the wall 48 . the bolt 52 draws the drive sleeve 24 into firm , non - rotatable and non - axially movable relationship with the motor shaft 38 , with the mating tapered portions 40 and 42 assuring substantially no relative rotation , by frictional resistance , between the drive sleeve 24 and motor shaft 38 . the drive sleeve 24 and motor shaft 38 together define the drive shaft 14 for the drive sheave 12 . referring to fig3 and 4 , the movable sheave housing 26 includes an annular , tapered or frusto - conical sheave face 56 and a unitary outer peripheral wall 58 . the sheave face 56 cooperates with the fixed sheave half 22 for drivably engaging the tapered edges of the drive belt 20 along the tapered surfaces of both the sheave face 56 and the cooperating sheave face of the fixed sheave half 22 . referring to fig4 the housing cover assembly 34 includes an annular outer wall 60 and a unitary outer peripheral wall 62 which includes a peripheral lip 64 for receiving the outer edge of the peripheral wall 58 of the movable sheave housing 26 . a plurality of bolts 66 rigidly secure the housing covering assembly 34 to the movable sheave housing 26 . the bolts 66 are received within threaded apertures 68 provided on internal bosses 70 positioned along the inner periphery of the outer wall 58 of the sheave housing 26 . the head ends of the bolts 66 are located within circumferentially spaced depressions 72 along the outer periphery of the outer peripheral wall 62 of the cover assembly 34 . desirably , a plurality of spaced inspection openings 74 are located in the outer wall 60 of the housing cover 34 . referring particularly to fig3 and 4 , the housing cover assembly 34 has a bearing 76 mounted along an inner hub 78 thereof . the sheave housing 26 includes a bearing 80 which is mounted along the inner periphery of an inner hub 82 of the sheave housing 26 . the structural relationship and mounting of the bearings 76 and 80 on the cover housing 34 and on the sheave housing 26 constitute important features of the invention . both bearings 76 and 78 are constructed of a reinforced plastic ; preferably the bearings are made of &# 34 ; duralon &# 34 ;. duralon bearings comprise a teflon fabric lined filament wound , reinforced plastic fiberglass backed bearing structure . the outer periphery of each of the bearings 76 and 78 is substantially cylindrical , and each of the bearings 76 and 78 is press fit in the respective hubs 78 and 82 of the cover housing assembly 34 and the movable sheave housing 26 , respectively . it is important for the outer periphery of each of the bearings 76 and 80 to be non - rotatable relative to the housings 34 and 26 , not only in order to avoid slippage of the housing 26 during operation of the clutch assembly 10 , but it is also important for the spider assembly 28 , to be hereinafter described , to be maintained in a predetermined orientation relative to the housings 26 and 34 . in order to insure non - rotatability between the hub 78 and the bearing 76 , a plurality of circumferentially spaced set screws 84 , as seen best in fig4 are threaded into threaded apertures defined in both the outer periphery of the bearing 76 and in the inner periphery of the hub 78 . a plurality of set screws 84 , as seen best in fig3 are desirably used in order to assure against relative movement between the bearings 76 and 80 and the housings 26 and 34 , when the clutch is in operation . the inner periphery of each of the bearings 76 and 78 is the same cross sectional shape as the outer periphery of the drive sleeve 24 , and like the sleeve 24 , is preferably hexagonal in shape . the shape of the inner periphery of the bearings 76 and 80 and of the outer periphery of the drive sleeve 24 provides the desired axial sliding movement between the drive sleeve 24 and the bearings 76 and 80 , while the hexagonal shape of the mating parts prevents a rotary movement therebetween . referring to fig3 , and 6 , the spider assembly 28 includes a central hub 86 having an inner periphery with the same outer periphery as the drive sleeve 24 , again , preferably hexagonal in shape . like the bearings 76 and 80 , the spider assembly 86 is non - rotatable on the drive sleeve 24 because of the hexagonal shape of the cooperating drive sleeve 24 and of the inner periphery of the hub 86 . a plurality of spaced pairs of unitary support ears 88 project radially from the spider hub 86 . each pair of ears 88 has a pin 90 mounted therein . each pin rotatably carries a pair of spaced links 92 , which at their outer ends , carry flyweights 94 which have a low friction defined in the portion thereof positioned between the links 92 . the flyweights 94 are secured to the links 92 , as by a bolt 96 and a nut 98 . the spider assembly 28 is axially fixed on the drive sleeve 24 by the split ring 30 and by a plurality of cooperating locking set screws 100 . the split ring 30 is received within a peripheral groove 102 , as seen best in fig3 in the drive sleeve 24 . each set screw 100 , as seen best in fig4 extends radially inwardly toward the drive sleeve 24 and is received within a threaded opening 104 in the spider hub 86 . the inner end of each set screw 100 is pointed or conical in shape and is received within an oversized conical depression 106 having its axis offset inwardly relative to the axis of the end of the set screw . since the depression 106 is oversized and offset relative to the end of the set screw 100 , as the set screw is tightened and the pointed end passes into the depression 106 , the tightening of each set screw 100 causes the spider assembly to move laterally outwardly against the split ring 30 in order to assure firm abutting relationship therebetween , thereby avoiding axial movement of the spider . desirably , in order to assure that the set screws 100 remain in the desired position , a lock nut 108 is mounted on each set screw 100 and bears against the outer surface of the spider hub 86 . as conventional , the roller cam portions of the flyweights 94 , as best seen in fig6 are in engagement with outwardly tapered ramps or cams 110 which are rigidly secured to support portions 112 of the sheave housing 26 by means of a bolt 114 , as seen in fig4 . each bolt 114 passes through the ramp 110 and into the support portion 112 for rigid securement therebetween . the coil spring 32 is mounted around the drive sleeve 24 and is interposed between the split ring 30 and the hub 78 of the cover assembly 34 in order to normally bias the sheave face 56 of the sheave housing 26 away from the fixed sheave half 22 , as seen in fig4 . referring to fig4 and 7 , when the clutch assembly 10 is in the rest position , the inner periphery of the drive belt rests against the hexagonal outer periphery of the drive sleeve 24 because the spring 32 urges the housing 26 from the fixed sheave half 22 . it is preferred that , in the portion of the outer periphery of the drive sleeve 24 , as seen in fig7 contacting the inner periphery of the drive belt 20 , the points or peaks of the hexagonal periphery are reduced , as by turning the sleeve 24 on a lathe , so as to provide a relatively smooth surface contacting the inner periphery of the drive belt . in this way , when the clutch sleeve 24 starts and stops rotating , there will be no sharp points on the hexagonal sleeve 24 to cut or tear the inner periphery of the drive belt 20 and thereby undesirably shorten the expected life of the belt 20 . although the driven sheave 18 is of substantially conventional construction , a brief description will be provided herein in order to fully describe the clutch 10 and the improvements therein . the driven sheave 18 is of substantially conventional construction and includes a fixed half 116 which is non - rotatable and non - slidable on the driven shaft 16 . the driven sheave 18 also includes a movable sheave half 18 which is axially movable towards and away from the fixed half 116 on the driven shaft , in a conventional manner , but is non - rotatable thereon . a fixed cam support 120 is rigidly secured to the outer end of the driven shaft 6 . the cam support 120 has a cylindrical wall including a plurality of unitary ramp portions 122 which define a plurality of inwardly facing arcuate cam surfaces . the movable sheave half 118 includes a cylindrical , outwardly projecting wall 124 which terminates in a plurality of outwardly facing arcuate cam surfaces which mate in camming relationship with the inwardly facing cam surfaces on the ramp portions 122 . a torsion compression spring 128 is mounted around the driven shaft 16 interior of the cylindrical wall 124 and cam support 120 in order to normally bias the movable sheave half 118 toward the fixed sheave half 116 , as seen in the embodiment of fig1 . in operation , referring to fig4 when the clutch assembly 10 is in the rest condition , the housings 34 and 26 are spaced away from the fixed sheave half 22 so that the drive belt substantially rests against the outer periphery of the drive sleeve 24 as best seen in fig4 and 7 . the spring 32 normally biases the housings 26 and 34 away from the fixed sheave half 22 in the manner shown . as the motor shaft 38 and thereby the drive sleeve 24 begin to rotate , the hexagonal drive sleeve 24 rotates the bearings 76 and 80 . since the bearings 76 and 80 are non - rotatable relative to the housings 34 and 26 , both housings 76 and 80 are rotated by the direct interconnection between the bearings and the drive sleeve . at the same time , the hexagonal interconnection between the spider assembly 28 and the drive sleeve 24 causes the spider 28 to rotate . as the speed of the drive shaft 14 increases , the flyweights 94 move outwardly by action of centrifugal force and the cam portions thereof bear against the cam surfaces of the ramps 110 ; so as to simultaneously move upwardly and outwardly on the ramps 110 , thereby compressing the spring 32 as rotational speed increases . the greater the speed , the more the flyweights 94 move along the ramps 110 and the more the spring 32 is compressed . since the duralon bearings 76 and 78 are non - rotatable but slidable along the hexagonal drive sleeve 24 , both the housing 26 and the housing 34 move axially inwardly toward the fixed sheave half 22 . the belt 20 is then forced away from the periphery of the drive sleeve 24 until reaching the maximum outer drive position shown in fig5 . as is conventional , as the drive belt 20 moves outwardly on the drive sheave 12 , the drive belt 20 moves radially inwardly on the driven sheave 18 as the movable half 118 moves in a conventional manner , axially away from the fixed sheave half 116 thereof . as the speed of the shaft 14 decreases , the opposite action occurs , that is , the flyweights 94 move back down the ramps 110 and the spring 32 moves the housings 26 and 34 away from the fixed sheave half 22 , until the idling or stopped condition is attained with the drive belt once again contacting the outer periphery of the drive sleeve 24 , as seen in fig7 . from the foregoing , it is seen that we have provided a simply constructed and repaired variable drive clutch assembly . there is no driving torque applied to the spider assembly 28 as found in prior art devices . the spider 28 acts only as a carrier for the flyweights . the drive from the drive sleeve 24 is imparted directly to the moving half of the drive sheave 12 and to the spider 28 by the hexagonal shape of the drive sleeve . at the same time , the relative alignment which is required to be maintained between the flyweights 94 , connected to the spider assembly 28 , and the ramp portions 110 on the housing 26 , is accomplished in a simple and convenient manner , as the structure assures that there is no rotation between the bearings 76 and 80 and the housings 26 and 34 , and a positive relative alignment is also assured between the drive sleeve 24 and the spider assembly 28 . since the spider assembly 28 no longer undergoes undue wear , not only are the assembly problems required with prior art devices alleviated , but the life of the spider 28 is extended . the device can be easily repaired , even in the unlikely event of undue breakdown resulting from improper maintenance . only conventional hand tools would normally be needed for repairs . while a detailed description of one embodiment of the present invention is provided herein , it is to be understood that all equivalents obvious to those having skill in the applicable art are to be included within the scope of my invention , as claimed .	5
turning attention now to the drawings , it is first of all remarked that the gas sensing unit of the present development can be used in the gas sensing signaling system of the aforementioned commonly assigned , copending u . s . application ser . no . 54 , 786 , to which reference may be readily had and the disclosure of which is incorporated herein by reference . therefore , in the disclosure to follow there will only be considered the specific features of the gas sensing unit of this development which constitute the subject matter of the invention and there have been omitted those portions of the system which are not absolutely necessary for one skilled in the art to readily understand the underlying principles and concepts of the present development . directing attention to fig1 there is illustrated therein the principle construction of an exemplary embodiment of inventive gas sensing unit which , as will be seen , contains three mutually separated , explosion protected or explosion secured chambers or spaces 2 , 3 and 4 . within a housing 1 composed of a housing body member or body 1a and a cover member 1b , which housing is formed for instance of steel , aluminum or a suitable plastics material , there is arranged a first compression - proof chamber or space 2 within which there is located the evaluation circuit . this chamber or space 2 is conveniently referred to as the &# 34 ; circuit chamber or space &# 34 ;. since the gas sensing unit is typically mounted in an inverted position , the cover or cover member 1b may be considered to close the chamber or space 2 towards its top and forms the base of the second chamber or space 3 which is structured so as to be explosion protected . the second chamber or space 3 , conveniently referred to as the &# 34 ; sensor chamber or space &# 34 ;, contains the gas sensor or gas sensing element 6 and the balancing adapter 7 . this second chamber 3 communicates with the room or area which is to be monitored by means of the cover member or cover 5 which is formed of a gas pervious sintered metal as previously explained . beneath the cover 5 there is arranged a splash - proof protection 8 , for instance a metallic hood having a gridded window . within the body member 1a of the housing 1 there is additionally arranged , as likewise previously explained , the third explosion protected chamber or space 4 , conveniently referred to as the &# 34 ; connection chamber or space &# 34 ;, containing the connection terminals or the like and hermetically sealed from the ambient air by the connection chamber - cover member or cover 18 . the sensor chamber or space 3 only contains the gas sensor or gas sensing element 6 and the balancing adapter 7 , the construction of which has been more fully illustrated in fig2 a and 2b . the gas sensor 6 possesses at its underside or lower surface contact pins 12 , which when plugged together with the balancing adapter 7 , engage into appropriate , not particularly shown bushings at the upper surface of the balancing adapter 7 and establish the mechanical and electrical connection between both of these parts or components 6 and 7 . according to a preferred embodiment the connection is accomplished by spring or resilient contacts such that separation of these components 6 and 7 is extremely difficult , if not totally impossible . in this way there is obtained the beneficial result that there can be effectively prevented any unauthorized disconnection of the balancing adapter 7 from the related gas sensor or gas sensing element 6 for whose balancing or compensation the same has been designed . the balancing adapter 7 is provided at its underside with contact pins 17 , by means of which the gas sensor / adapter - unit can be plug connected into metallic bushings 9 located in the housing cover 1b and by virtue of which there is established the requisite mechanical connection with the housing 1 , and , at the same time , the electrical connection with the evaluation circuit , the construction of which will be discussed more fully hereinafter . to this end the bushings or sockets 9 , embedded by means of a suitable casting resin in the cover member 1b , are provided at the underside of the cover member 1b which is located within the chamber 2 with the contact pins 10 at which there is connected , by means of a socket or bushing plug 11 or equivalent structure , the evaluation circuit of the gas sensing unit . within the balancing adapter 7 , shown particularly well in fig2 b , there is located a balancing resistance or resistor 16 , by means of which it is possible to insure that all of the gas sensor / adapter - units 6 , 7 have the same electrical characteristics . for this purpose the balancing resistor 16 is connected such that , upon assembly with the gas sensor or gas sensing element 6 , there is formed a voltage divider , at the tap of which there can be tapped - off the signal which is infed to the evaluation circuit . the circuit configuration of the gas sensor / adapter - unit has been shown by way of example in fig4 . between the terminals 24 and 26 , which for safety reasons are designed as double plugs , and the terminal 27 there are dispositioned the gas sensor 6 and the balancing resistor or resistance 16 . as mentioned , the gas sensor 6 and the balancing resistor 16 form a voltage divider , at the tap of which there can be tapped - off the signal which is infed to the evaluation circuit , by means of the plugs 21 and 23 also designed as a double plug arrangement for safety reasons . the resistance 16 is dimensioned such that the relationship or ratio of the balancing resistance 16 to the resistance of the gas sensor 6 is the same for all of the gas sensor / adapter - units . with the same supply voltage , in this case , the voltage at the terminals 21 and 23 is the same , with the same ambient conditions , for all of the gas sensor / adapter - units . the current infeed for the heating of the gas sensor 6 is accomplished by means of the terminals or connections 22 and 25 . as mentioned , within the compression - proof chamber or space 2 ( fig1 ) there is arranged the evaluation circuit . the latter is advantageously divided into a number of superimposed plates 13 , 14 and 15 by way of example . the circuit elements are distributed upon the individual plates 13 , 14 and 15 such that in the event of a possibly required change in the circuit design only as few as possible plates need be exchanged , preferably only a single plate . for instance , this may be necessary if the semiconductor gas sensor or gas sensing element is exchanged for a gas sensor operating according to the principle of catalytic oxidation , in which case there is required a balanced measuring bridge circuit in the evaluation circuit . remembering that the gas sensing unit is typically mounted in an inverted position , the plate 13 therefore will be referred to as the uppermost plate . this uppermost plate 13 , the so - called inverter plate , has arranged thereon circuit components or elements which amplify the signal which is delivered by the gas sensing unit and renders such signal suitable for further conduction . additionally , this plate 13 contains circuit elements in order to adjust , stabilize and monitor the sensor operating potential and the current needed for heating the gas sensor and for possibly generating a malfunction or disturbance indication signal . upon interruption of the current , in the event of a shortcircuit or after a more or less depleted use of the equipment , a disturbance indication signal is transmitted to a corresponding signal line . the intermediate plate 14 , the so - called logic plate , contains circuit elements or components which are responsible for the evaluation of the sensor signal , for instance , the threshold value switch which delivers a warning signal and alarm signal or serves to further conduct a disturbance or malfunction signal . additionally , there are also provided switching circuits which prevent the response of more than one gas sensing unit of the same group and additionally control suitable response indicators . the lowermost plate 15 , the so - called base plate , contains protective devices for the gas sensing unit , for instance protective devices against faulty connection , false poling , overvoltages and so forth , and , as the case may be , when necessary a switch 50 for changing the sensitivity of the gas sensing unit which can be serviced with a special tool , such as the belt - like connection or actuation element 19 shown in fig1 . gas sensing signaling systems are generally designed to operate as two - stage systems , i . e . at a certain gas concentration there is given a &# 34 ; warning &# 34 ;, whereas at a higher gas concentration there is triggered an &# 34 ; alarm &# 34 ;. in this respect attention is directed to the gas sensing signaling system disclosed in the aforementioned u . s . application ser . no . 54 , 786 . it is desirable that the threshold values for the &# 34 ; warning &# 34 ; and &# 34 ; alarm &# 34 ; modes of a gas sensing unit be accommodated to predestined fields of application . to this end there are provided setting or adjustment devices , as the same have been illustrated in fig3 a to 3e . by means of these setting devices it is possible to simultaneously set or adjust both of the threshold values of a gas sensing unit . these setting or adjustment devices , contain , in each case , a voltage divider between the power supply line u and the ground bus o , which for the embodiment of fig3 a consists of three resistors or resistances r 1 , r 2 and r 3 , wherein the first resistance r 1 is adjustable . with the embodiment of fig3 b the resistance r 2 is replaced by a zener diode zd or , as shown in fig3 e , connected in parallel with a zener diode zd . in fig3 c a zener diode zd is connected in parallel to the resistance or resistor r 3 . both of the taps at the voltage divider are connected with the reference inputs of two threshold value switches t 1 and t 2 , whose control inputs receive the analogue - output signal of the related gas sensing unit in accordance with the resistance change which arises under the action of the prevailing gas and whose outputs are connected with the signal lines s 1 and s 2 . by adjusting the resistance r 1 , with the embodiment of fig3 a , there is obtained a simultaneous proportional shifting of both concentration thresholds , whereas with the embodiments of fig3 b and 3e there occurs a parallel shifting of both threshold values at least over one part of the adjustment range . with this combination it is possible to extensively compensate for non - linearity of the gas sensor elements . in the embodiment of fig3 c initially there are shifted both threshold values proportionally , until there is reached the breakdown voltage of the zener diode . from this value on the lower threshold value remains constant , and specifically remains at the value which is governed by the zener diode zd . if , as shown in fig3 d , the zener diode zd is connected with the tap of a voltage divider formed of two resistances or resistors r 3 and r 4 , i . e . if the resistance r 3 of the circuit configuration of fig3 c is divided into two components and the zener diode is connected with the tap , and at least one of these components is adjustable , then it is possible to obtain a further , more sensitive setting possibility of the threshold value . an important requirement which is placed upon gas sensing signaling systems is that such should be able to be accommodated as to their sensitivity to different conditions of use and that the set sensitivity not be accidentally changed or altered by non - authorized personnel . this safeguard is realized with the inventive gas sensing unit in that , the setting of the individual gas sensing units need not be accomplished , as was heretofore the case with the prior art gas warning devices , by adjusting a potentiometer at the erection site , rather such setting or adjustment can be accomplished by means of the above - discussed switch at the sensitivity stages which are fixedly prescribed by the manufacturer . according to a preferred design there is provided at the equipment a switch , such as the switch 50 shown in fig1 which can be actuated with the aid of a special actuation tool or key such as the previously described bolt - like actuation element 19 of fig1 with the aid of which it is possible to set four different sensitivity stages of the gas sensing unit . it has been found that four sensitivity stages are usually satisfactory for conditions encountered in practice . according to a further preferred embodiment of the inventive gas sensing unit there is mounted at the gas sensor housing or at the direct region of the gas sensing unit a response indicator , as generally indicated in fig1 by reference character 60 , which indicates in any suitable manner the momentary state of the gas sensing unit . normally the warning stage can be indicated by a lamp which continuously illuminates , the alarm mode or state by continuous blinking of such lamp , and by means of the same response indicator it is also possible to indicate malfunction or disturbances of the response readiness of the gas sensing unit . this has the advantage that the occupants or personnel present in the monitored room or area are informed at all times about questionable or dangerous gas concentrations by the gas sensing unit . finally , in fig5 there is shown an exemplary circuit configuration of a catalytic sensor ( pellistor )/ adapter unit . here a gas - active sensing element 31 and a gas - passive reference element 32 form one arm of a wheatstone bridge . the other arm of this bridge consists mainly of resistors 33 and 34 which are located in the adapter unit 40 . the wheatstone bridge is powered ( e . g . 20 v / 500 ma ) by means of terminals 41 , 42 and 43 , 44 which for good contact reasons are designed as double plugs . the output signal of the bridge is fed through terminals 45 and 46 to the evaluation circuit ( e . g . differential amplifier input ). a balancing resistor 35 is dimensioned such that with zero gas concentration , the output signal of the bridge will be zero . similarly , resistor 36 is dimensioned such that for a given gas concentration , the output signal of the bridge circuit is the same for all pellistor / adapter units . both resistors 35 and 36 can be evaluated in advance by means of contact plugs 41 ( 42 ), 47 and 45 , 47 , respectively . appreciable advantages of the inventive gas sensing unit reside in the fact that by housing the evaluation circuit in a chamber or space which is separated from the sensor within the gas sensing unit , there is realized an appreciably simpler construction of the entire gas sensing signaling system , an appreciably simpler design , maintenance and checking of the gas sensing unit , and there is possible an appreciably simpler setting and checking of the response preparedness or readiness of the gas sensing unit . while there are shown and described present preferred embodiments of the invention , it is to be distinctly understood that the invention is not limited thereto , but may be otherwise variously embodied and practiced within the scope of the following claims . accordingly ,	6
according to the present invention , demands for bandwith from point to point in an optical communications system are prioritized based on a comparison of optical reach of the network with lengths of routes of the demands . bandwidth is preferentially assigned to demands having routes with lengths not greater than the optical reach , and regenerators required for overcoming optical reach limitations for demands having routes with lengths greater than the optical reach are strategically placed at blocked links to overcome blocking for those demands wherever possible . a resource allocation system 34 according to the present invention is described with reference to fig2 . therein , an input module 36 is receptive of demands 38 for bandwidth from an origin node to a destination node of the network . the input module 36 is further receptive of optical network attributes 40 . example optical network attributes include fiber types of the network , line hardware , systems / fiber , subbands per system , channels per subband , network node placement , network node interconnection , and scale of the network . resource allocation system 34 further has a routing module 42 in communication with input module 36 and operable to route the demands on the network according to a shortest path ( sp ) and / or shortest cycle ( sc ) methodology . hence , routed demands 44 are generated by routing module 42 and communicated to prioritization module 46 . prioritization module 46 generates prioritized demands 48 with predetermined routes based on a comparison of lengths of demand routes and an optical reach of the network . preferably , demands with routes having lengths not greater than the optical reach are generally given priority over demands with routes having lengths greater than the optical reach . notably , the optical reach is fiber - dependent , such that it may vary for demands with different routes where more than one fiber type is present in the network . preferably , prioritization module 46 is further operable to prioritize demands based on hop count of the demands and the magnitude of the bandwidth required by the demands . for example , a demand passing through seven switch nodes ( and thereby having a hop count of eight ), is preferably given priority over a demand with a hop count of four . further , demands with the same hop count are preferably prioritized based on bandwidth requirement , such that demands with higher bandwidth requirements are given priority over demands with lower bandwidth requirements . of further note , all other demands are preferably given priority over demands with a hop count of zero . thus , these zero length demands are an exception in that they are preferably not given priority over demands with routes having lengths greater than the optical reach . resource allocation system 34 further has a link requirements evaluation module 50 in communication with input module 36 and receptive of routed demands 44 . link requirements evaluation module 48 is operable to compute minimum link requirements and maximum capabilities 52 based on the routed demands 44 and the optical network attributes 40 . for example , if each fiber can provide a maximum of two systems , each system can provide a maximum of four subbands , and each subband can provide a maximum of four channels ( wavelengths ), then if there are a total of sixty - five channels that must be routed through a link , then there must be at least three fibers , and thus six systems . consequently , the link has a total of ninety - six channels organized into twenty - four subbands . the minimum requirements and maximum capabilities 52 are communicated , along with the prioritized demands 48 , to assignment module 54 . assignment module 54 is operable to generate assigned bandwidth 56 by assigning bandwidth to demands based on their priority . thus , bandwidth is first assigned to demands with routes having lengths not greater than the optical reach , and bandwidth is next assigned to demands with routes having lengths greater than the optical reach . also , bandwidth is last assigned to demands with a hop count of zero . further , prioritization based on hop counts and magnitude of bandwidth requirements is further observed in the assignment process . preferably , assignment module 54 seeks to use all available unblocked channels on a link and / or , if possible , increase the number of fibers on a link before adding translators to remove blocking . also , for demands with routes having lengths greater than the optical reach , assignment module 54 is operable to strategically position regenerators required to overcome optical reach limitations within the network to overcome blocking for those links . thus , assignment module 54 is operable to generate assigned regenerator positions 58 for allocating regenerators in the network . this technique eliminates the need for a translator and thus avoids a costly oeo conversion . further embodiments of resource allocation system 34 also exist . for example , routing module 42 may be eliminated where demands are pre - routed and communicated to input module 36 . also , link requirements evaluation module 50 may also be eliminated by communicating pre - evaluated link requirements and maximum capabilities to input module 36 . further , additional embodiments of resource allocation system 34 will be apparent to one skilled in the art from the preceding and subsequent disclosure , wherein the method of the present invention may be implemented in a variety of ways . the flowchart of fig3 depicts a method for prioritizing demands according to the present invention . starting at 60 , the method proceeds to step 62 , wherein all demands are routed on the shortest path or shortest cycle , such that each demand comprises a need for a specific amount of bandwidth from an origin network node to a destination network node through a predetermined route comprising an ordered set of optical switching nodes . as mentioned above , this step is optional because the demands could also be pre - routed and communicated to the present invention . with demands routed , the method then proceeds to step 64 , wherein the number of fibers / systems ( fi / si ) required per link is computed without blocking considerations , and the first fiber / system is lit up such that fi = 1 / si = 1 ( where fi is the number of systems / fibers used on link i , and si is the number of subbands used on link i ). for example , consider the case where each fiber can provide a maximum of two systems , each system can provide a maximum of four subbands , and each subband can provide a maximum of four channels ( wavelengths ). if there are a total of sixty - five channels that must be routed through link i , then fi must equal three and si must equal six . the first fi and first si can be lit up ( powered up and made available but not assigned ) until fi ≦ fi and si ≦ si , but fi cannot exceed fl and si cannot exceed si . similarly as with step 62 , step 54 is also optional as this information can be pre - computed and the fiber pre - lit . thus , the information may be received and / or assumed . with demands routed and fi / si per link computed , the method proceeds to step 66 , wherein the demands are prioritized based on optical reach ( or ) by sorting the demands into three lists . for example , demands with a hop of zero ( thus guaranteed to be less than the optical reach ) are sorted into a list 68 . also , demands with routes having lengths ≦ or are sorted into a list 70 . further , demands with routes having lengths & gt ; or are sorted into a list 72 . the list 70 is given priority over the list 72 , which in turn has priority over list 68 . with the demands prioritized based on optical reach , further prioritization takes place as needed . for example , lists 70 and 72 are further sorted in hop decreasing order at steps 74 and 76 . further , demands with the same hop count in lists 70 and 72 are sorted in bandwidth decreasing order at steps 78 and 80 . thus , by giving priority to demands with larger bandwidth requirements , then blocking of demands with smaller bandwidth requirements can be overcome , if necessary , with a smaller number of translators than would be required for demands with larger bandwidth requirements . this bandwidth size prioritization is another strategy in reducing non - revenue generating oeo conversions . channels and / or subbands are - assigned to demands of list 70 first as at 82 . assignment as at 84 of channels and / or subbands to demands of list 72 only occurs after assignment to demands of list 70 has completed as at 86 and 88 . similarly , assignment as at 90 of channels and / or subbands to demands of list 68 only occurs after assignment to demands of list 72 has completed as at 92 and 94 . once assignment of list 68 has been completed as at 96 , the method ends at 98 . a method according to the present invention for accomplishing assignment of list 70 is illustrated in fig4 . therein , step 82 ( fig3 ) is further detailed as a sub - method . the method of fig4 begins at 100 and proceeds to step 102 , wherein the available channels and / or subbands for the next demand in the list are found . depending on whether blocking exists as at 104 , the method proceeds to 106 , wherein the blocking links are determined , or step 108 , wherein the channel ( s ) and / or subband ( s ) are assigned to the demand and made unavailable . after blocking links are determined at step 106 , then it is determined whether the set of available channels and / or subbands can be increased as at 110 . if so , the set is increased and related variables incremented at step 112 , and the method returns to step 102 . if the set cannot be increased , then the method proceeds to 104 where it is determined if blocking can be removed by reassigning one or more of the assigned channels or subbands of assigned demands . if so , the method proceeds to step 116 wherein the applicable demands are appropriately reassigned new channels and / or subbands . from there , the method proceeds to step 108 wherein the assigned channels and / or subbands are made unavailable . if however , the answer to the test at 114 is no , then the method proceeds to step 118 , wherein translators are used to overcome the blocking at the blocked links . the method proceeds from step 118 to step 108 , and from there the method ends at 120 . a method according to the present invention for accomplishing assignment of list 72 ( fig3 ) is illustrated in fig5 . therein , step 84 ( fig3 ) is further detailed as a sub - method . the method of fig5 begins at 122 and proceeds to step 124 , wherein the available channels and / or subbands for the next demand in the list are found . depending on whether blocking exists as at 126 , the method proceeds to step 128 , wherein the blocking links are determined , or step 130 , wherein distance regenerators required to extend the optical reach are placed where required . in the case where there is no blocking , the regenerators are places anywhere along the route of the demand that will efficiently regenerate the optical signal beyond the optical reach to the destination node . then , the method proceeds to step 132 , wherein the channel ( s ) and / or subband ( s ) are assigned to the demand and made unavailable . where blocking exists , then after blocking links are determined at step 128 , it is determined whether the number of regenerators required to regenerate the optical signal beyond the optical reach to the destination node is greater than or equal to the number of blocking links as at 134 . for example , if the length of the demand route twice , but not thrice , exceeds the optical reach , then two regenerators are required . if there are two blocking links , then these regenerators can be placed at the blocking links to both regenerate the optical signal and overcome blocking at step 130 . the case may arise where a blocking link is at the beginning or end of a demand route such that placement there of the regenerator will not sufficiently extend the optical signal beyond the optical reach , and in this case an additional translator may be required . nevertheless , the odds are that most regenerators required for a blocked demand can be strategically placed in the network to overcome blocking for a link , thereby decreasing the number of costly regenerators otherwise required . in the case where there are not enough regenerators to match the number of blocked links , it is preferred to check whether the set of available channels and / or subbands can be increased as at 136 . if so , the set is increased and related variables incremented at step 138 , and the method returns to step 124 . if the set cannot be increased , then the method proceeds to 140 where it is determined if blocking can be removed by reassigning one or more of the assigned channels or subbands of assigned demands . if so , the method proceeds to step 142 , wherein the applicable demands are appropriately reassigned new channels and / or subbands . from there , the method proceeds to step 132 wherein the assigned channels and / or subbands are made unavailable . if however , the answer to the test at 140 is no , then the method proceeds to step 144 , wherein translators are used to overcome the blocking of the blocked links . the method proceeds from step 144 to step 132 , and from there the method ends at 146 . notably , the test at 134 may incorporate criteria to assess whether the regenerators can be successfully placed to both overcome blocking and serve their function as regenerators . thus , the method can still attempt to increase the set of available channels and / or subbands before adding any additional oeo conversions . similarly , where the number of regenerators is less than the number of blocked links and the set of available channels and / or subbands cannot be increased , then the method at step 144 can still strategically place the regenerators to overcome blocking and then add translators only as needed . while the invention has been described in its presently preferred form , it will be understood that the invention is capable of modification without departing from the spirit and scope of the invention as set forth in the appended claims .	7
the following detailed description is of the best currently contemplated modes of carrying out the present invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention , since the scope of the invention is best defined by the appended claims . referring now to the drawings in detail , a radiator inlet adapter generally designated 100 may include a top portion 110 , a body portion 120 , a thrust bearing portion 130 , and an expandable portion 140 . a bolt 150 having left - handed threads 160 may be threadingly engageable with a threaded top portion bore 170 in an assembled configuration such as shown in fig1 and fig3 . with particular reference to fig2 , top portion 110 may be of unitary construction and include a radiator neck portion 200 sized and configured to accept a radiator cap ( not shown ) or a cap portion of a pressure testing system pump ( not shown ). top portion may be manufactured of any suitable material including steel . radiator neck portion 200 may include a bottom portion 310 ( fig3 ) through which is formed a transverse bore 320 in communication with threaded top portion bore 170 . top portion 110 may further include a threaded portion 220 having threaded top portion bore 170 formed at an end 230 thereof . a hex portion 210 may be formed with bottom portion 310 as a top surface , hex portion being disposed intermediate radiator neck portion 200 and threaded portion 220 . body portion 120 may include a hex portion 240 and a cylindrical portion 250 . a body portion threaded bore 330 for receiving threaded portion 220 may be formed in body portion 120 . thrust bearing portion 130 may include a conventional thrust bearing . a thrust bearing rotating washer 260 may be disposed adjacent a body portion bottom surface 270 in the assembled configuration . thrust bearing portion 130 may be adapted to provide rotation separation of the body portion 120 and a first washer 280 as described herein . expandable portion 140 may be manufactured from a deformable material , such as rubber , and include a circular cross section . expandable portion 140 may include a bore 285 formed therethrough . in the assembled configuration , expandable portion 140 may be disposed between a first washer 280 and a second washer 290 . preferably , first washer 280 has a larger diameter than expandable portion 140 and second washer 290 has a smaller diameter than expandable portion 140 . bolt 150 having left - handed threads 160 may be adapted to threadingly engage threaded top portion bore 170 in the assembled configuration . bolt 150 may include a head 295 having a larger diameter than an inner diameter of second washer 290 . a bore 350 is formed in bolt 150 . in use , the radiator inlet adapter 100 may be assembled in the assembled configuration by sliding bolt 150 through second washer 290 , expandable portion 140 , first washer 280 and thrust bearing portion 130 , respectively . threaded portion 220 may next be threadingly engaged in body portion threaded bore 330 in such manner that left - handed threads 160 of bolt 150 are threadingly engageable to threaded top portion bore 170 . in the assembled configuration , a space ( not shown ) may be disposed between hex portions 210 and 240 . hex portions 210 and 240 may be used for rotating body portion 120 and top portion 110 . radiator inlet adapter 100 may be positioned in a radiator filler neck 400 in such manner that first washer 280 is disposed adjacent a radiator filler neck top surface 410 ( fig4 ). turning body portion 120 in a clockwise direction relative to top portion 110 causes bolt 150 to move toward top portion 110 in threaded top portion bore 170 . such movement of bolt 150 compresses expandable portion 140 between first washer 280 and second washer 290 as shown in fig3 . compression of expandable portion 140 causes a side surface 420 of expandable portion 140 to sealingly contact an inner surface 430 of radiator filler neck 400 to thereby form a seal useful in pressure testing a fluid system ( not shown ) associated with radiator filler neck 400 . a conventional pump ( not shown ) may be engageable to radiator neck portion 200 to pressurize the fluid system . thrust bearing portion 130 may provide rotation separation between body portion 120 and first washer 280 . in this manner , rotation of body portion 120 is separated from rotation of expandable portion 140 . conventionally , radiator filler neck 400 may have an inner diameter ranging from 20 – 50 mm . expandable portion 140 may have a diameter of 18 mm , 27 mm , 35 mm , and 40 mm for use with radiator filler necks 400 of different diameters . as shown , the radiator inlet adapter of the invention overcomes the deficiencies of the prior art by providing a radiator inlet adapter for use with radiator filler necks of various diameters which is of simple construction and easy to use . it should be understood , of course , that the foregoing relates to preferred embodiments of the invention and that modifications may be made without departing from the spirit and scope of the invention . for example , washers 280 and 290 may be of varied diameters to accommodate expandable portions 140 of different diameters . any such modifications should in no way limit the scope of the invention , which should only be determined based on the following claims .	5
the present invention provides for distributed , adaptive ip filtering techniques for detecting and blocking packets involved in a ddos attack . although the present invention may be utilized in a variety of applications or devices , the operation of the present invention will be described using specific embodiments ( i . e ., examples ). the present invention envisions preventing the disablement of internet network devices when an ip packet source ( s ) sends an inordinate amount of ip packets in an attempt to disable such devices . in an exemplary embodiment of the present invention , a network processor ( np ) is used to protect a network server from an overload of ip packets sent from a router . referring now to fig1 a np 30 is shown within network 10 . the network 10 also comprises at least one router 20 and at least one server 40 . the np 30 is adapted to detect and filter ip packets traveling , for example , from the router 20 to the server 40 . ip packets come in various forms including email , file transfers , and ping / udp / icmp floods . those skilled in the art will appreciate that nps are generally capable of processing ip packets as fast as they can receive them at oc3 or above rates ( i . e ., at a rate of hundreds of thousands of packets per second ). it should be noted that although server 40 , np 30 and router 20 have been depicted as three units in fig1 they may comprise fewer or additional units . as discussed previously , internet traffic contains millions of various packets transmitting data for different purposes . every packet can be classified by many attributes such ip source and destination addresses , port numbers , protocol type , packet size , etc . in accordance with the present invention , it is assumed an incoming packet carries a set of discrete - valued attributes a , b , c denoted as ( a , b , c , . . . ). let jp n ( a , b , c , . . . ) be the joint probability mass function of this set of attributes under normal traffic situation , i . e . without any hacker &# 39 ; s attack . if we assume the attributes to be independent of each other , we will have : where a , b and c , . . . are the particular values that the attributes a , b and c take , and p n ( x ) is the marginal probability mass function of packet attribute x under normal ( no attacker ) conditions . let us denote jp m ( a , b , c , . . . ) as joint probability mass function of packet attributes measured from current incoming traffic , which may be normal or under attack . by assuming independence among different packet attributes , we can estimate jp m ( a = a , b = b , c = c , . . . ) by p m ( a = a )· p m ( b = b )· p m ( c = c ) . . . where p m ( x = x ) is the marginal probability of packet attribute x being equal to x , based on the current incoming traffic . the conditional legitimate probability of packet p can then be defined as , cp ( p )= prob ( p is a legitmate packet \| attributes a , b , c , . . . of packetp are equal to a p , b p , c p , . . . , respectively ) assuming there are n m packets in total within a measurement interval among which n n packets are from legitimate sources , and n a packets are sent only to overload the system . we have : cp  ( p ) = n n  jp n  ( a = a p , b = b p , c = c p , ⋯ ) n n  jp n  ( a = a p , b = b p , c = c p , ⋯ ) + n a  jp a  ( a = a p , b = b p , c = c p , ⋯ ) = n n  jp n  ( a = a p , b = b p , c = c p , ⋯ ) n m  jp m  ( a = a p , b = b p , c = c p , ⋯ ) = ρ n ρ m · jp n  ( a = a p , b = b p , c = c p , ⋯ ) jp m  ( a = a p , b = b p , c = c p , ⋯ ) eq .  ( 1 ) n n = total number of legitimate , i . e . normal , packets over a certain observation interval ; n a = total number of attack packets over a certain observation interval ; n m = total number of packets over a certain observation interval = n n + n a ; ρ n = nominal / baselined utilization of the system ( at a specific time - of - the - day , day - of - the - week , etc ) p a ( a , b , c , . . . ) is the joint probability mass function of header attributes of attacking traffic . in eq . 1 , we estimate n n \| n m by ρ n / ρ m ; cp  ( p ) = ρ n ρ m · p n  ( a = a p ) p m  ( a = a p ) · p n  ( b = b p ) p m  ( b = b p ) · p n  ( c = c p ) p m  ( c = c p ) eq .  ( 2 ) once cp ( p ) is computed for each incoming packet , it will be used as a key decision metric for the acceptance / dropping of the packet . in particular , cp ( p ) of a packet is compared to a dynamically adjusted threshold . notwithstanding other additional “ immunity rules ” ( which will be discussed herein ), a packet p will be dropped if its conditional legitimate probability cp ( p ) is less than the dynamically adjusted threshold value . this threshold is computed / updated based on an ongoing cumulative distribution function ( cdf ) of the legitimate probabilities of the incoming packets . alternatively , we can take the logarithm of both sides of eq . ( 2 ) to yield : log  ( cp  ( p ) ) = [ log  ( ρ n ) + log  ( p n  ( a = a p ) ) + log  ( p n  ( b = b p ) ) + log  ( p n  ( c = c p ) ) + … ] - [  log  ( ρ m ) + log  ( p m  ( a = a p ) ) + log  ( p m  ( b = b p ) ) + log  ( p m  ( c = c p ) ) + … ] eq .  ( 3 ) the use of eq . ( 3 ) instead of eq . ( 2 ) can facilitate the real - time computation of cp ( p ) of a packet p by avoiding numerous floating - point multiplication / division operations in eq . ( 2 ). notice that only the addition / subtraction operation is required for eq . ( 3 ) where the logarithm function can be implemented in form of simple table lookup . in this case , we would maintain the ongoing cdf of log ( cp ( p )) of the incoming packets for establishing the dynamically adjusted threshold on log ( cp ( p )). as would be understood , one should wary of boundary cases where p m ( x = x )= zero , it such cases , some minimum value , say minval , is assigned to p m ( x = x ). also some noise filtering mechanism for obtaining “ stable ” pn ( ) and pm ( ) estimates can be considered . first , we have to ensure that some minimum number of incoming packets have to be observed / measured before pn ( ) and pm ( ) estimates are considered stable . second , the values of pn ( ) and pm ( ) can be updated in an exponential moving average manner so as to filter out short - term , high - frequency , fluctuations in pn ( ) and pm ( ). other additional filtering mechanisms can be applied on pm ( ) and pn ( ) in order to reduce / control the impact of the short - term fluctuations in their estimates on cp ( ). for instance , in the case where eq . 2 is used to compute cp ( ), we can choose to include an attribute x in cp ( ) computation based on eq . 2 only if the difference between pm ( x ) and pn ( x ) is significant , i . e . if { pn ( x )/ pm ( x )} ratio is bigger than some preset threshold , say thd1 , or the ratio is less than 1 / thd1 . referring to fig2 a high level flow diagram 200 of the overload control algorithm of the present invention is shown . each of the main steps shown in fig2 is described in greater detail herein . a first general step as shown in box 210 of fig2 is to compute a probability measure for each incoming packet as was described with respect to eq . 1 and 2 above . next , in box 220 , a decision is made as to whether an incoming packet , p , is a known type . if so , the conditional legitimate probability of the packet is determined ( box 230 ). next , in box 240 , a conditional probability distribution function is updated for all the incoming packets . in box 250 , a throttling decision , e . g ., whether to admit or drop the packet , is made based on the computed probability measure and the updated cdf function . what follows is a detailed description of one embodiment of an overload control algorithm in accordance with the present invention . the functions and variables to be used in the algorithm are given in table 1 below . referring to fig3 a , 3b and 3 c in connection with the following discussion , a detailed step - by - step description of the procedure for implementing the present invention overload control algorithm invention is presented . it should be noted that step 1 - step 4 below are for calculation the conditional probability given in eq . ( 1 ) and / or eq . ( 2 ). 1 . a first step in the procedure 310 is to update the marginal probability mass functions p m ( a ), p m ( b ), p m ( c ), . . . if eq . ( 2 ) is used to calculate the conditional probability cp ( p ), and / or update the joint probability mass function jp m ( a , b , c , . . . ) based on attributes carried by p , if eq . ( 1 ) is used ; note that in order to adaptively update the probabilities p m ( a ), p m ( b ), p m ( c ), . . . and p m ( a , b , c , . . . ), a sliding window mechanism is used . we will need to determine the appropriate noise - filtering / smoothing mechanisms , e . g . sliding window - size , step - size , etc , in order to obtain robust distributions of p m ( a ), p m ( b ), p m ( c ), . . . and p m ( a , b , c , . . . ). 2 . in a next step 315 , update ρ m — all , which is required for calculation cp ( p ) in eq . ( 1 ) or eq . ( 2 ). 3 . after it has been determined that there is no significant change in the incoming traffic characteristics , i . e . confirm that no attack is in progress , we may also update the normal profile ρ n ( step 320 ), p n ( a ), p n ( b ), p n ( c ), . . . and / or jp n ( a , b , c , . . . ) according to attributes of packet p . there are various existing mechanisms for determining if there is attack , as would be understood by persons skilled in the art . one exemplary method for determining an attack is described in flash crowds and denial of service attacks : characterization and implications for cdns and web sites jaeyeon jung , balachander krishnamurthy , and michael rabinovich ( at & amp ; t labs - research ) www 11 — the eleventh international world wide web conference , honolulu , hawaii , may 2002 , the contents of which are incorporated by reference herein . in this proposal , we will not focus our discussions on any particular mechanism . the process of determining if there is an ongoing attack is simply viewed as a black box here . due to the potentially large number of attributes as well as that of the possible values of each attributes , more efficient data structures may be required for the maintenance of the marginal and the joint probability mass functions of the attributes described above . in particular , instead of keeping track of / maintaining the complete marginal / joint probability mass functions , i . e . histograms , we may , instead , maintain the “ iceberg - style ” histograms using techniques similar to those described in g . s . manku , “ approximate frequency counts over data streams ”, in proceedings of the 28th vldb conference , hong kong , china , august 2002 , tehcontents of which are incorporated by reference . by “ iceberg - style ”, it means that the histogram will only include those entries in the population which appear more frequently than a preset percentage threshold . in other words , entries which are absent from an iceberg - style histogram can be safely assumed to have their probability mass below the preset percentage threshold . the use of iceberg - style histogram is particularly important for the case of joint probability mass function due to its vast input dimensions . 4 . in the next step 325 , based on 1 - 3 , compute cp ( p ), i . e . the conditional probability that p is a legitimate packet based on eq . 2 ( or eq . 1 at the expense of additional complexity of keeping track of the joint probability distribution functions ). note : in addition , one can also maintain the normal attribute distribution as well as cdf of the conditional legitimate probability for a particular subset of packets , cp_typex ( p ) where type x refers to this particular type / subset of packets , e . g . http packets . by tracking the normal / current attribute distributions for different types of packets separately , i . e . pm , x ( ), pn , x ( ) or jpm , x ( ), jpn , x ( ), one would be able to further enhance the accuracy of the bayesian estimation for cp at the expense of additional computational complexity and storage requirement . 5 . in a next series of steps ( 220 from fig2 ), which may or may not be performed , it is determined if packet p belongs to some pre - determined sub - type of packets , say , type x , perform the following : a ) referring to fig3 b , update the current measured throughput for type x packets ( bw_m_typex ); this measures current offered load of type x packets ( step 330 ); b ) in step 335 , update the cdf of the conditional probability of packets with type x ; cdfupdate ( cdftypex , cp ( p )); c ) calculate the fraction of type x packets which should be granted “ immunity ” in order to guarantee some minimum throughput of type x packets ( step 340 ). this is defined as the ratio of the minimum throughput desired for type x packets and the current measured throughput for type x packets ( frac_thd_typex = bw_min_typex / bw_m_typex ). d ) in step 340 , look up the conditional probability threshold based on frac_thd_typex calculated above , i . e ., we should grant immunity to type x packets whose cp ( ) value & gt ;= immu_cp_thd_typex , where immu_cp_thd_typex = invcdf ( cdftypex , 1 − frac_thd_typex ); f ) if there are other pre - determined sub - types which packet p belongs to , goto step 5 ( 330 ). otherwise , continue to 5g ) ( 350 ). g ) if cpadjustment = true , cp ( p )+ 1 → cp ( p ); this operation grants immunity to packet p ; the objective of step 5 is to be able to guarantee preset minimum throughput for some pre - selected type of packets . this is via the granting of immunity to a preset portion of such pre - determined special types of packet even if they have a very small conditional legitimate probabilities . immunity is granted by explicitly inflating the cp ( ) of a packet in step 5g ). 6 . if p belongs to some known type of attack packets , then set cp ( p )= 0 . 0 ( step 355 ); in some scenarios , assuming additional information is known about the packets , we can then decide if they belong to the known type attack packets . 7 . in step 360 , update the cdf of the cp ( ) values of all incoming packets ( cdfall ) only after cp ( p ) has been potentially adjusted ; cdfupdate ( cdfall , cp ( p1 )). an exemplary conditional probability distribution function ( cdf ) in accordance with the present invention is shown in fig4 ; 8 . in step 365 , look up the conditional probability threshold based on ψ for all the packets . cp_drop_thd = invcdf ( cdfall , 1 − ψ ), where ψ is the fraction of current traffic we need to keep in order to reduce the system load ; the value of ψ is updated adaptively in every measurement interval by an existing overload control algorithm as described in j . kaufmann , “ a new traffic overload control for the autoplex series ii cell — work project no . 170211 - 2200 ”, technical memorandum , bell labs , lucent technologies , feb . 25 , 1999 , the contents of which are incorporated by reference , and as described in the next section . it would be understood , however that other load shedding algorithms may also be utilized . 9 . if ( cp ( p )& lt ; cp_drop_thd ) where cp_drop_thd is determined in step 8 , drop packet p ; otherwise , packet p will pass through the system ; this is the throttling decision of fig2 ( 250 ). the cdfupdate (,) and invcdf (,) functions / operations mentioned above can be efficiently implemented in an online , one - pass manner using recent data - stream mining techniques similar to those described , for example , in m . greenwald , s . khanna , “ space - efficient online computation of quantile summaries ”, in procs . of the 2001 acm sigmod intl . conference on management of data , pp . 58 - 66 , santa barbara , calif ., may , 2001 ; fei chen , diane lambert and jose c . pinheiro , “ incremental quantile estimation for massive tracking ”, in the proceedings of the sixth international conference in knowledge discovery and data mining , 2000 ; anna c . gilbert et al , “ how to summarize the universe : dynamic maintenance of quantiles ”, in proceedings of the 28th vldb conference , hong kong , china , august 2002 ; m . datar et al , “ maintaining stream statistics over sliding windows ”, in the procs . of thirteenth annual acm - siam symposium on discrete algorithms ( soda &# 39 ; 02 ), 2002 and b . babcock et al , “ sliding window computations over data streams ”, technical report , department of computer science , stanford university , april 2002 , the contents of each of the above references being incorporated herein by reference . this is done , for example , by maintaining the quantile estimation of the value of interest , i . e . the adjusted cp ( p ) or log ( cp ( p )) in our case , over a sliding window of incoming packets . for the sake of completeness , we describe below the load - shedding algorithm by joe kaufmann . this algorithm is used as a sub - module on the current invention . in particular , it is used for determining \ psi (= ψ i ) by comparing the rho_m_all parameter against the rho_max_all parameter in the pseudo - code . let ψ i denote the fraction of packets permitted to pass the throttle points during the ( i + 1 ) st interval . let ψ 0 = 1 and ψ i will always be constrained to lie in the interval [ ψ min , 1 ] where ψ min is a small but non - zero number which prevents the throttle from shutting off all incoming packets . at the end of the i th measurement interval , □ ρ i □ ( the utilization estimate during the i th interval ) is available , and we calculate where ρ max is the maximum core utilization defined by the server . if □{ circumflex over ( ρ )} i = 0 , we set □ φ i = φ max where φ max is a large number whose precise value is unimportant . ρ max is chosen to permit the serve to maintain a reasonable delay for all incoming packets . with φ i calculated , the throttle to be in the next ( i + 1 ) st interval , denoted by ψ i is given by : since ψ i □ must be truncated to lie in the interval [ ψ min 1 ] we can rewrite the above as follows : ψ i = max  { min  { ψ i - 1  φ i , 1 } , ψ min } = max  { min  { ψ 0  ∏ j = 1 i   φ j , 1 } , ψ min } ψ 0  ∏ j = 1 i   φ j , which shows that the throttle adjusts rather quickly to all changes in the offered load . the overload control algorithm given above is applied to the expanded cdfall to determine the threshold of the conditional probability to drop packets . as shown in fig5 a type is a subset of all the packets which share a certain set of attributes in addition to those common attributes shared by all the packets . in this paper , we define cdfall as the cdf of the conditional probability that a packet belongs to the normal traffic , given the common set of attributes , i . e ., prob ( a packet is a legitimate ( non - attacking ) one \| values of attributes a 1 , a 2 , . . . , ak ). on the other hand , cdftypet 1 refers to the cdf of the conditional probability that a packet belongs to the normal traffic , given all the attributes in that particular type , i . e ., prob ( a packet is a legitimate ( non - attacking ) one \| values of attributes a 1 , a 2 , ak , b 1 , . . . , f 1 ). the foregoing description merely illustrates the principles of the invention . it will thus be appreciated that those skilled in the art will be able to devise various arrangements , which , although not explicitly described or shown herein , embody the principles of the invention , and are included within its spirit and scope . it would also be understood that a delegate port card need not be embodied in a separate physical card , but that only a separate distributed processing functionality be present . furthermore , all examples and conditional language recited are principally intended expressly to be only for instructive purposes to aid the reader in understanding the principles of the invention and the concepts contributed by the inventor to furthering the art , and are to be construed as being without limitation to such specifically recited examples and conditions . moreover , all statements herein reciting principles , aspects , and embodiments of the invention , as well as specific examples thereof , are intended to encompass both structural and functional equivalents thereof . additionally , it is intended that such equivalents include both currently known equivalents as well as equivalents developed in the future , i . e ., any elements developed that perform the same function , regardless of structure . in the claims hereof any element expressed as a means for performing a specified function is intended to encompass any way of performing that function including , for example , a ) a combination of circuit elements which performs that function or b ) software in any form , including , therefore , firmware , microcode or the like , combined with appropriate circuitry for executing that software to perform the function . the invention as defined by such claims resides in the fact that the functionalities provided by the various recited means are combined and brought together in the manner which the claims call for . applicant thus regards any means which can provide those functionalities as equivalent as those shown herein . many other modifications and applications of the principles of the invention will be apparent to those skilled in the art and are contemplated by the teachings herein . accordingly , the scope of the invention is limited only by the claims appended hereto .	7
referring to fig1 there is generally indicated at 1 a continuous base strip of flexible material , which is ultrasonically heat - sealable at least on one surface thereof , being fed forward ( from left to right ). this strip is preferably a laminated strip comprising a central layer of polyurethane film laminated ( under heat and pressure ) between two outer layers of non - woven polyester material . as shown , this base strip is folded generally in half on fold line 2 extending longitudinally thereof to have two plies 3 and 5 which are open at one edge 7 of the folded strip and integrally joined along the fold line 2 at the other side edge thereof . ply 3 is the lower ply and ply 5 is the upper ply as the strip feeds forward . preferably the strip is supplied unfolded in a roll 9 and folded in half on line 2 as it is unwound from the roll and fed forward . a continuous fastener tape 11 , more particularly a velcro or velcro type hook fastener tape , is unwound from a roll 13 , fed forward along with the base strip 1 , and combined with the strip as the strip and tape are fed forward with the tape extending longitudinally of the strip on the bottom of the strip and with its hooks 15 on the underside . tape 11 is ultrasonically heat - sealable for being ultrasonically heat - sealed to the strip 1 , preferably being a nylon hook tape as is commercially available . it is narrower than the folded strip 1 and is combined with the folded strip 1 on the bottom of the folded strip extending generally centrally of the folded strip . the combined folded base strip 1 and hook tape 11 feed forward between the horn 17 and wheel 19 of an ultrasonic sealing apparatus of the type shown in u . s . pat . no . 3 , 666 , 599 and solo by branson sonic power company of danburg , conn . the wheel is formed with two annular peripheral ridges each designated 21 on its cylindrical surface spaced axially of the wheel a distance somewhat less than the width of the tape 11 . the tape is generally centered transversely with respect to the two ridges so that it becomes ultrasonically sealed to the folded strip 1 on two lines of seal each designated 23 adjacent the side edges of the tape , leaving an unsealed portion 25 of the tape between the two lines of seal where the hooks 15 of the tape are intact . the composite of the strip 1 and tape 11 produced as above - described is then segmented into individual fastener elements or parts such as indicated at p1 in fig2 by cutting the composite on transverse lines at intervals spaced longitudinally thereof , as by means of a cutter such as indicated at 27 in fig1 . each such part comprises a band 29 of the base material 1 and a segment 31 of the fastener tape material heat - sealed on one surface of the band by the relatively narrow lines of seal 23 extending across the part from one side edge thereof to the other . the two plies 3 and 5 of the band 29 are free of one another at the side edge 7 opposite the fold 2 . the seals at 23 secure the plies together . the part p1 has free margins 33 of the plies at edge 7 adapting it for being stitched as indicated at 35 in fig2 to a back part 37 of a bra with the latter sandwiched between said free margins . referring to fig3 there is generally indicated at 41 a continuous base strip of flexible material , which is ultrasonically heat - sealable at least on one surface thereof , being fed forward ( from left to right ). this strip is preferably a laminated strip like strip 1 but wider , comprising a central layer of polyurethane film laminated ( under heat and pressure ) between two outer layers of non - woven polyester material . as shown in fig3 base strip 41 is folded generally in half on fold line 42 extending longitudinally thereof to have two plies 43 and 45 which are open at one edge 47 of the folded strip and integrally joined along the fold line 42 at the other side edge thereof . ply 43 is the lower ply and ply 45 is the upper ply as the strip feeds forward . preferably the strip is supplied unfolded in a roll 49 and folded in half on line 42 as it is unwound from the roll and fed forward . a continuous fastener tape 51 , more particularly a velcro or velcro type plush fastener tape , is unwound from a roll 53 , fed forward along with the base strip 41 , and combined with the strip as the strip 41 and tape 51 are fed forward with the tape extending longitudinally of the strip on the bottom of the strip and with its plush 55 on the underside . tape 51 is ultrasonically heat - sealable for being ultrasonically heat - sealed to the strip 1 , preferably being a nylon plush tape as is commercially available . it is somewhat narrower than the folded strip 41 and is combined with the folded strip 41 on the bottom of the folded strip extending generally in centered relation with respect to folded strip 41 . the combined folded base strip 41 and plush tape 51 feed forward between the horn 57 and wheel 59 of an ultrasonic sealing apparatus again of the above - mentioned type . the wheel is shown as formed with four annular peripheral ridges each designated 61 on its cylindrical surface spaced axially of the wheel . the tape , generally centered with respect to the folded strip 41 , becomes ultrasonically sealed to the folded strip 41 on four lines of seal each designated 63 leaving three unsealed portions 65 of the tape between the four lines of seal where the plush 55 of the tape are intact . the composite of the strip 41 and tape 51 produced as above - described is then segmented into individual fastener parts such as indicated at p2 in fig4 by cutting the composite on transverse lines at intervals spaced longitudinally thereof , as by means of a cutter such as indicated at 67 in fig3 . each such part comprises a band 69 of the base material 41 and a segment 71 of the plush tape material heat - sealed on a surface of the band by the relatively narrow lines of seal 63 extending across the part from one side edge thereof to the other , these lines of seal dividing the segment into three side - by - side plush zones 71a , 71b and 71c . the two plies 43 and 45 of the band 69 are free of one another at the side edge 47 opposite the fold 42 . the seals at 63 secure the plies together . the part p2 has free margins 73 of the plies at edge 47 and a band 75 of elastic material is sandwiched between these free margins and stitched thereto as indicated at 77 in fig4 . for bra repair , or for original bra manufacture , the repair part p1 is stitched as indicated at 33 to the back of a bra at one side and the elastic band 75 of the repair part p2 is stitched to the back of the bra at the other side . the wearer may readily press together the hook zone 31 of part p1 and one of the plush zones 71a , 71b , 71c of part p2 as shown in fig5 to fasten these parts together , the provision of the three plush zones providing for adjustment to fit the wearer . of special note is that the hook tape segment or zone 31 and the plush zones 71a , 71b and 71c are secured to the bands 29 , 69 only by the seals 23 , 63 extending transversely of the bands and are otherwise free of the bands throughout their extent from one side edge to the other . it has been observed that with the hook and plush zones free from the bands except at the seals ( 23 , 63 ) extending transversely of the bands , the parts cling better together and are less prone to separate , in relation to an arrangement in which the hook and plush zones are secured completely around their edges ( i . e ., at the ends as well as the sides ) to the bands . referring now to fig6 there is generally indicated at 81 a continuous base strip of flexible material , which is ultrasonically heat - sealable on both surfaces thereof , being fed forward ( from left to right ). this strip may be of the same material as above - described three - layer laminate used for the manufacture of the bra - back repair parts , but is substantially wider than the strips used in the manufacture of the bra - back repair parts . as strip 81 is fed forward , it is folded on a fold line 83 to have a relatively narrow margin 85 folded under on the bottom of the strip at one side of the strip . the strip is supplied unfolded in a roll 87 and folded on the line 83 as it is unwound from the roll and fed forward . a continuous velcro or velcro type hook fastener tape 89 and a continuous velcro or velcro type plush fastener tape 91 are unwound from respective rolls 93 and 95 , fed forward along with the base strip 81 and combined with the strip as the strip and tapes are fed forward , with the tapes extending longitudinally of the strip on the bottom of the strip and with the hook and plush sides 97 and 99 of the tapes facing down . each tape is ultrasonically heat - sealable for being ultrasonically heat - sealed to the strip 81 , preferably being nylon hook and plush tapes as are commercially available . each tape is relatively narrow . one of them , e . g ., the hook tape 89 is combined with the strip 81 up against the folded - under margin 85 overlapping the edge of the latter and extending inwardly therefrom . the other tape , i . e ., the plush tape 91 , is combined with the strip 81 on the underside of strip 81 adjacent the edge 81a of strip 81 opposite the fold 83 . the combined base strip 81 ( with the folded - under margin 85 ) and the tapes 89 and 91 feed forward between the horn 107 and wheel 109 of an ultrasonic sealing apparatus as above - described . the wheel is formed with two circular peripheral ridges each designed 111 on its cylindrical surface adjacent one end of the wheel for sealing the hook tape 89 to the strip , and with two annular peripheral ridges each designated 113 on its cylindrical surface adjacent the other end of the wheel for sealing the plush tape 91 to the strip . the tape 89 is generally centered transversely with respect to ridges 111 , which are spaced axially a distance somewhat less than the width of tape 89 , so that the tape 89 becomes sealed to the strip on two lines of seal 115 adjacent the side edges of the tape , leaving an unsealed portion 117 of the tape between the two lines of seal where the hooks of the tape are intact . the outer one of these two lines of seal 115 seals the folded - under margin 85 to the strip 81 proper . the tape 91 is generally centered transversely with respect to the ridges 113 , which are spaced axially a distance less than the width of the tape 91 , so that the tape becomes sealed to the strip 81 on two lines of seal 119 , leaving an unsealed portion 121 of the tape between the two lines of seal where the plush of the tape is intact . the composite of the strip 81 and the tapes 89 and 91 produced as above - described is segmented into individual shoulder strap guards such as indicated at 123 in fig6 and 7 by cutting the composite on transverse lines at relatively narrow intervals spaced longitudinally thereof , as by means of a cutter such as indicated at 125 in fig6 . referring to fig6 and 7 , each such guard is shown to comprise the relatively narrow band 127 of heat - sealable material ( derived from strip 81 ), an end portion 129 of which ( derived from margin 85 ) is folded over on the fold line 83 extending across the band adjacent one end of the band and overlying one face of the band , said fold line constituting one end of the guard . a segment 131 of the heat - sealable hook fastener material ( derived from tape 93 ) and a segment 133 of the heat - sealable plush fastener material ( derived from tape 95 ) are heat - sealed to the band . one of said segments , namely the segment 127 , overlies said folded - over end portion 129 of the band and is heat - sealed thereto by heat seal 135 spaced inwardly from said fold line 83 , said folded - over end portion being heat - sealed to the band at this heat seal , and by a heat seal 137 . the folded - over end portion 129 forms a loop at said one end of the guard for receiving a safety pin 139 . the other of said segments , namely 133 , is heat - sealed to said band adjacent the other end of the band on lines 119 . the band is adapted to be folded around a shoulder strap on a fold line extending across the band between the two segments 131 , 133 to bring the hook material and plush material segments together , and the band is adapted to be secured around the strap by pressing together the said hook material and plush material segments . the safety pin is used to pin the band to the user &# 39 ; s dress , as will be readily understood . in view of the above , it will be seen that the several objects of the invention are achieved and other advantageous results attained . as various changes could be made in the above constructions without departing from the scope of the invention , it is intended that all matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense .	1
referring to the drawing , a better understanding of the principles of this invention may be gauged by inspection of fig1 . in fig1 an improved internal burner type supersonic velocity flame jet apparatus indicated generally at 25 takes the form of an internal burner 26 comprised of cylindrical section 6 , which is closed off at its upstream end by a permeable burner block 12 and closed off at its downstream end by an exit accelerating nozzle piece 1 , thus forming a combustion chamber 27 internally of burner 26 . the accelerating nozzle piece 1 is provided with an axial nozzle bore , comprising an inlet bore 5 followed by an outlet diverging bore 2 that opens downstream . the radial dimension of an inlet bore 5 should be big enough in order to prevent heated powder stream 29 from touching the walls of the inlet bore 5 . the inlet bore 5 , which can be converging as shown in fig1 , diverging ( not shown ), or straight ( not shown ), or be of variable geometry ( not shown ), of the accelerating nozzle piece 1 is connected to the combustion chamber 27 by a converging inlet passage 4 . the rear piece 15 is provided with holes 18 and 19 , which open to the interior of the mixing chamber 23 , and which receive respectively the ends of primary oxidizer supply tube 17 and primary fuel supply tube 20 . a combustible mixture distributor 14 has a circular series of orifices 16 , which connect a mixing chamber 23 with circular shape distribution chamber 24 . a permeable burner block 12 typically made of high temperature ceramic has a plurality of small diameter orifices 13 , which open into the combustion chamber 27 . an orifice of axial powder injector 22 opens to the interior of the combustion chamber 27 , and receives the end of powder supply tube 21 . a narrow continuous slot 11 of a circumferential ring geometry shown in fig2 , or alternatively a circular series of closely spaced orifices 11 a shown in fig3 , or alternatively a permeable portion of the nozzle wall 11 b of a circumferential ring geometry shown in fig4 open to the interior of the accelerating nozzle 1 in the vicinity of the entrance 3 to the diverging outlet bore of the accelerating nozzle 1 , and to the interior of a circular cavity 10 . the accelerating nozzle piece 1 is provided with a hole 9 which opens to the interior of the circular cavity 10 , and which receives the end of secondary gas supply tube 8 . thus , reactants including a fuel as indicated by arrow f 1 and an oxidizer as indicated by arrow p 1 are fed into the mixing chamber 23 where they form a combustible mixture , which is fed through the orifices 16 into the distribution chamber 24 and further , through the plurality of orifices 13 in the permeable burner block 12 , into the combustion chamber 27 with ignition and combustion taking place within the chamber 27 and hot combustion product gases pass through the accelerating nozzle piece 1 . the ignition means is not shown , but it is usually a regular spark plug placed in the combustion chamber . high melting point particles indicated schematically by arrow g may be introduced axially into burning gases within combustion chamber 27 through the tube 21 and powder injector 22 and further accelerated in the supersonic gdvn 31 formed within the bore of accelerating nozzle piece 1 . a heated powder stream 29 forms a coating 32 upon impact against a substrate 33 . in one aspect the present invention is directed to a method and apparatus for eliminating clogging of the throat of a supersonic nozzle by utilizing gdvn instead of actual solid convergent - divergent nozzle . a coaxial gas flow as indicated by arrow p 2 is fed into the circular cavity 10 through the secondary gas supply tube 8 and orifice 9 . a supersonic gdvn 31 is defined as an inner boundary of a coaxially co - flowing gas 30 through a narrow continuous slot of circumferential ring geometry 11 under pressure that is higher than the static pressure in the main flow of hot combustion product gases h . formed this way gdvn 31 has a supersonic convergent - divergent shape having convergent 31 a and divergent 31 b portions , with a virtual throat 28 having flow area at sonic point a , and exit 37 having exit flow area a . the ratio a / a is determined by mach number at which the spray torch is supposed to operate , and can be adjusted by changing the flow rate of a coaxial gas flow 30 forming gdvn . thus , the main high velocity stream of hot combustion product gases , as indicated by arrows h , discharged from the combustion chamber 27 and flowing through the inlet bore 5 is further compressed in diameter through gas dynamic forces exerted by gas 30 coaxially co - flowing through a narrow continuous slot of circumferential ring geometry 11 and forming convergent portion 31 a of gdvn 31 . the main high velocity hot gas stream h with entrained powder particles is further accelerated to supersonic velocity in the divergent portion 31 b of gdvn 31 forming a supersonic flame jet indicated generally at 36 , characterized by oblique shock waves 7 , mach disks 34 , and expansion fans 35 . therefore , a supersonic gdvn 31 obviates the need for a solid nozzle to form a convergent - divergent flow and at the same time alleviates a possible build - up 38 , as shown in fig2 , which would plague conventional solid nozzle of thermal spray apparatus , if it had the same throat diameter as gdvn throat 28 . since virtual throat 28 &# 39 ; s cross sectional area a *, which actually forms a choke condition for the stream of hot combustion product gases h , is intentionally designed to be much smaller than any cross sectional area of the accelerating nozzle piece 1 , including entrance 3 to the diverging outlet bore of the solid accelerating nozzle piece 1 , the inlet bore 5 may have any shape , since it does not affect operation of the gdvn , e . g . it can be straight cylindrical , or diverging , or be of variable geometry , if desired or otherwise necessary . while any gas may be used for forming a coaxial gas flow that forms a supersonic gdvn , of particular advantage is the use of compressed air , which allows for significant reduction of cost of coating application . in another aspect the present invention is directed to a method and apparatus for increasing the jet temperature by adding a reactive fuel to the gases in the coaxial gas flow 30 forming a supersonic gdvn 31 . the secondary fuel as indicated by arrow f 2 may be pre - mixed with air , oxygen or other gas forming a coaxial gas flow 30 and a supersonic gdvn 31 , and fed through tube 8 and hole 9 . alternatively , the secondary fuel may be fed at least through one additional circular series of orifices ( not shown ), or narrow continuous slot of circumferential ring geometry ( not shown ), or a permeable portion of the nozzle wall of circumferential ring geometry ( not shown ), located in the vicinity of the narrow continuous slot of circumferential ring geometry 11 . the secondary fuel may be low reactive gaseous fuel , selected from the group consisting of propane , propylene , methane , ethane , butane , or liquid fuel which may in the form of mist , vapor , or liquid . the secondary fuel is pre - heated by the stream of hot combustion product gases discharged from the combustion chamber 27 , reaching auto ignition temperature , and burns in the divergent portion of the coaxial gas flow 30 that forms a supersonic gdvn 31 . this burning gas expands inwards the core of the stream of hot combustion product gases , which is supersonic due to expansion in a supersonic gdvn 31 , until essentially complete mixing takes place . therefore , the combustion of the secondary fuel increases the static temperature of a supersonic flow , which in turn increases velocity of main stream of hot combustion product gases , as well as temperature and velocity of entrained particles . greater particle velocity and temperature are of extreme importance for low combustion temperature hvaf thermal spray process , and allow to significantly improve coating quality . when even higher particle temperature is needed , the secondary fuel may be a highly reactive gaseous fuel , selected from the group consisting of methyl - acetylene and its compounds , and hydrogen . in accordance with an exemplary embodiment , a coating is sprayed with an hvaf apparatus 25 comprising an accelerating nozzle piece 1 with means of forming a supersonic gdvn 31 ( as described with reference to the fig1 ). the apparatus 25 is operated with primary air flow of about 55 liters per second , an inlet pressure of about 6 . 2 bar , and a primary propane flow of about 2 . 0 liters per second under the pressure of about 5 . 1 bar . the coaxial air flow 30 , forming a supersonic gdvn 31 , is about 32 liters per second , at an inlet pressure of about 6 . 8 bar , and a secondary propane flow is about 1 . 6 liters per second , at an inlet pressure of about 5 . 5 bar . thus , the total heat energy generated by apparatus is about 1 , 140 , 000 btu / hr . a coating is applied using 5 - 30 μm particle size tungsten carbide - cobalt - chrome 86 % wc - 10 % co - 4 % cr agglomerated - sintered powder . the mean hardness of the coating is measured at about 1 , 390 hv300 . under these operating parameters , the apparatus is able to operate for a long time without nozzle plugging , generating a very narrow and focused powder stream . the particle velocity of about 1 , 198 m / sec and particle temperature of about 1 , 750 ° c . have been measured with accuraspray sensor by tecnar automation ltée ( canada ). alternatively , for comparison , a regular hvaf apparatus , without supersonic gdvn , but instead having regular straight accelerating nozzle of the same length , and diameter similar to the diameter of the throat 3 of the apparatus with supersonic gdvn , was used to apply a coating with the same material : 5 - 30 μm particle size tungsten carbide - cobalt - chrome 86 % wc - 10 % co - 4 % cr agglomerated - sintered powder . the apparatus operates with air flow of about 85 liters per second , an inlet pressure of about 6 . 3 bar , and propane flow of about 3 . 4 liters per second under a pressure of about 5 . 3 bar , thus generating 1 , 050 , 00 btu / hr , e . g . the same total amount of heat energy as apparatus with supersonic gdvn according to the exemplary embodiment . the mean coating hardness is measured at about 1 , 040 hv300 . the particle velocity of about 664 msec and particle temperature of about 1 , 690 ° c . have been measured with accuraspray sensor . thus , the use of supersonic gdvn combined with feeding of secondary fuel to the coaxial gas flow forming supersonic gdvn , provides non - clogging operation of hvaf or hvof apparatus , and when compared to typical hvaf apparatus with a straight cylindrical nozzle , allows for a nearly 2 fold increase in the particle velocity without lowering particle temperature , which significantly improves coating properties . in accordance with the provisions of the patent statutes , the principle and mode of operation of this invention have been explained and illustrated in its preferred embodiment . however , it must be understood that this invention may be practiced otherwise than as specifically explained and illustrated without departing from its spirit or scope .	2
fig2 shows a block diagram of a portion of an ethernet switch 200 for a communication system that conforms to the ieee 802 . 3 ethernet and the ieee 802 . 3af power over ethernet ( poe ) standards , according to one embodiment of the present invention . as shown in fig2 , ethernet switch 200 comprises ethernet phy module 202 , rj - 45 ethernet connector 204 , 48 - volt switcher 206 , line - side pse power conditioning module 208 , isolated - side pse control module 210 , four - pair signal - isolation transformer 212 , and power - isolation transformer 214 , where switcher 206 and power conditioning module 208 function together as an isolated switching power supply . ethernet phy module 202 , connector 204 , and transformers 212 and 214 are similar to the corresponding elements in conventional switch 100 of fig1 . note that , unlike switch 100 of fig1 , switch 200 does not have any optical isolator . according to this embodiment of the present invention , the pse detection and ( optional ) classification functions that were performed by line - side pse control and power conditioning module 108 of fig1 and all of the pse control functions that were performed by isolated - side pse control module 110 of fig1 are now performed by isolated - side pse control module 210 of fig2 . the only pse functions that remain on the line side of switch 200 of fig2 are the power conditioning functions implemented by pse power conditioning module 208 of fig2 . these power conditioning functions include , but are not limited to , rectification , filtering , and impedance control . note that , in this embodiment , isolated - side pse control module 210 does not receive any explicit information from the line side of switch 200 about the status of the operations at line - side pse power conditioning module 208 . the migration of the pse detection and classification functions from the line side of switch 100 to the isolated side of switch 200 is enabled by the fact that all of the information needed to implement those functions appears on both sides ( i . e ., on both the primary - and secondary - side coils ) of power - isolation transformer 214 . note that ethernet phy module 202 , switcher 206 , and pse control module 210 are preferably , but do not have to be , implemented in a combined manner on a single integrated circuit . this function migration from line side to isolated side also enables practical implementation of a separate line - side pse power conditioning module , similar to module 208 of fig2 , for each ethernet connector , similar to connector 204 , supported by switch 200 . as such , a switch of the present invention can be configured with multiple ethernet ports , while providing electrical isolation between all of the ethernet ports . in particular , the high voltage associated with a lightening strike near an ethernet cable connected to one of the ethernet ports will not reach any of the other ethernet ports ( or their associated cables and pd devices ). in one possible implementation , a single module , like isolated - side pse control module 210 of fig2 , can be designed to support multiple ethernet ports , with each port having its own switcher ( like switcher 206 ), transformer ( like transformer 214 ), pse power conditioning module ( like module 208 ) and ethernet connector ( like connector 204 ), while still allowing very high levels of integration . fig3 shows a schematic block diagram of switcher 106 , line - side pse control and power conditioning module 108 , power - isolation transformer 114 , and optical isolator 116 of conventional switch 100 of fig1 . in fig3 , the elements in the upper half of the diagram that are to the left of transformer 114 correspond to switcher 106 . diode 302 and capacitor 304 symbolically represent the line - side circuitry that provides the power conditioning functions of line - side pse module 108 , while the elements in the lower half of the diagram represent the line - side circuitry that provides the detection and classification functions of line - side pse module 108 . as represented in the upper half of fig3 , switcher 106 is a stand - alone , isolated , 48 - volt , flyback switching supply that provides power to the pse circuitry . pulse width modulation ( pwm ) control logic 306 is provided information regarding output voltage ( via transformer winding 308 ) and drive current ( via current - sensing resistor 310 and current reference amplifier 312 ) and uses this information to adjust the pulse width of the drive signal applied to the gate of power fet 314 , such that the desired voltage , with an appropriate current limit , is applied to the output . as represented in the lower half of fig3 , optionally under the control of isolated - side pse control module 110 , pse control logic 316 of line - side pse module 108 performs the poe detection and classification functions by sequentially providing two different fixed currents 318 and 320 onto the output , while the output voltage is measured by pse control logic 316 . this is followed by the application of a fixed voltage 322 during which the current is measured by resistor 324 and amplifier 326 . during a normal power - up sequence , this is followed by pse control logic 316 turning on power fet 328 and continuing to monitor current draw and voltage for health / fault / disconnect status . fig4 shows the schematic block diagram of fig3 annotated to indicate the migration of functions associated with particular elements in the line - side circuitry of pse control and power conditioning module 108 of fig1 to a combined switcher / pse control module corresponding to a combined implementation of switcher 206 and pse control module 210 of fig2 , located on the isolated side of switch 200 . as represented in fig4 , all of the line - side functions on the lower half of the diagram either migrate to the isolated side or are eliminated ( i . e ., in the case of the optical isolator ). the functions of power fet 328 are migrated to power fet 314 ; the functions of current sources 318 and 320 , resistor 324 , and amplifier 326 are migrated to resistor 310 , amplifier 312 , and pwm control logic 306 ; the functions of pse control logic 316 are migrated to pwm control logic 306 ; the functions of voltage source 322 are migrated to voltage reference 330 ; and the detection and classification power provided to the ethernet connector is migrated to the output of the line - side power conditioning function . fig5 shows a schematic block diagram of switcher 206 , line - side pse power conditioning module 208 , isolated - side pse control module 210 , and power - isolation transformer 214 of switch 200 of fig2 , according to one possible embodiment of the present invention . in fig5 , the elements to the left of transformer 214 correspond to switcher 206 and pse control module 210 , while diode 502 and capacitor 504 symbolically represent the line - side circuitry that provides the power conditioning functions of pse power conditioning module 208 . in this particular implementation , the pse control module 210 is shown being implemented as a set of logic separate from enhanced pwm control logic 506 of switcher 206 . in a combined implementation , a single logic device can be used to implement all functions to the left of power - isolation transformer 214 in fig5 . alternatively , the functions of pse control module 210 may be implemented in software and / or hardware in two or more different processing modules , including one or more processing modules that support multiple ports . for example , in one possible implementation , a single logic device implements all of the functions to the left of power - isolation transformer 214 that are associated with a single port , while another ( shared ) logic device , such as a microcontroller , implements additional functions that are associated with multiple ports , such as power balancing . in any case , pse control module 210 monitors the current and voltage from transformer 214 and current sense amplifier 512 and determines the appropriate pse state for commanding enhanced pwm control logic 506 , which is enhanced ( relative to pwm control logic 306 of fig3 ) to support the detection and classification functions that migrated to the isolated side . fig6 shows a schematic block diagram of switcher 206 , line - side pse power conditioning module 208 , isolated - side pse control module 210 , and power - isolation transformer 214 of switch 200 of fig2 , according to one possible low - voltage , mixed - signal , cmos - technology embodiment of the present invention . the pse circuitry of fig6 supports all three modes of operation described previously : detection , classification , and power conditioning ( i . e ., power on ). in this embodiment , pse control module 210 is implemented in digital logic as logic modules 602 - 610 . similarly , enhanced pwm control logic 506 of fig5 is implemented in digital logic as pwm control logic module 612 and pulse frequency modulation ( pfm ) control logic module 614 , where pwm control logic module 612 controls pulse width modulation during the classification and power - on modes , and pfm control logic module 614 controls a pfm loop comprising detection ( mosfet ) transistor 616 and current - limiting resistor 618 used during the detection mode . when power is first applied to the pse circuitry of fig6 , analog bias circuitry is stabilized , clocks ( e . g ., from clock generator 620 ) are started , and all circuitry is reset or initialized . following initialization , operation of the pse circuitry is under the control of master sequencer 602 , which will determine the mode of operation for the pse circuitry . per the ieee 802 . 3af poe standard , the basic sequence of operation is : ( 1 ) detection , ( 2 ) classification , and ( 3 ) power conditioning . provisions may be made for various fault conditions and / or user interventions to override this basic sequencing . not explicitly shown in fig6 ( or in subsequent fig7 - 9 ) are paths whereby digital logic functions are clocked at appropriate times taking into account proper settling of the sensed levels . also not explicitly shown are ( a ) control signals , whereby sequencers ( e . g ., master sequencer 602 , detection sequencer 606 , and classification sequencer 608 ) can adjust ( i ) loop filter parameters ( e . g ., of pfm loop filter 622 and pwm loop filter 624 ), ( ii ) gains ( e . g ., of amplifiers 626 , 628 , and 630 ), or ( iii ) other parametric settings and ( b ) the control and test interface paths ( e . g ., from interface 632 ) that allow a user or surrogate processor to adjust voltages and current thresholds and to fine - tune timing , as appropriate . operation of the pse circuitry of fig6 for the three different modes of operation ( i . e ., detection , classification , and power conditioning ) is described below in the context of fig7 - 9 , respectively . fig7 shows a schematic block diagram of only those elements of fig6 that are involved in the pse detection mode of operation . following initialization , master sequencer 602 will set variable load 648 to mimic the expected detection load and then direct detection sequencer 606 to begin the detection process , which continues under the control of detection sequencer 606 . detection sequencer 606 directs voltage - control logic 604 to select and apply the first detection voltage point v 1 ( e . g ., nominally about 3 volts ) as reference voltage 642 to be used by voltage - sense adc ( analog - to - digital converter ) 634 of voltage - sense block 636 . detection sequencer 606 then enables pfm control logic 614 , which sends short - duration pulses ( e . g ., typically about 100 to 500 ns long ) to detection transistor 616 , which in turn sends precision low - current pulses to the isolated side of power transformer 214 , such that the resulting output voltage on the line side of power transformer 214 ramps up slowly . this transformer output voltage is sensed through third winding 638 in power transformer 214 by voltage - sense block 636 , in which adc 634 compares sensed voltage 640 with reference voltage 642 . the resulting digitized signal 644 from adc 634 is appropriately filtered by pfm loop filter 622 in order to maintain loop stability , and the resulting filtered signal 646 is used by pfm control logic 614 to determine an appropriate pulse sequence that stabilizes the transformer output voltage at set point v 1 . detection sequencer 606 monitors the duration taken to arrive at set point v 1 . if the duration is too long , then detection sequencer 606 will time out , resetting the sequence . such a time - out is indicative of an improper detection load on the output , such as the excessive capacitance required to be detected by the ieee 802 . 3af poe standard . if the initial voltage set point v 1 is reached successfully ( e . g ., within a specified duration ), then detection sequencer 606 will record the frequency ( f 1 ) that pfm control logic 614 employed to stabilize at that level . detection sequencer 606 will then direct voltage - control logic 604 to select the second detection voltage point v 2 ( e . g ., nominally about 8 volts ), and an analogous ramp - up sequence will be implemented until either set point v 2 is reached or a time - out occurs . if the second voltage set point v 2 is reached successfully , then detection sequencer 606 will record the frequency ( f 2 ) that pfm control logic 614 employed to stabilize at that level . if the detection process gets this far without timing out , then detection sequencer 606 estimates the detection load from the difference between frequencies f 1 and f 2 . this is possible because the frequency , pulse width , peak current , and peak voltage at both set points v 1 and v 2 are known and can be used to calculate the average current and the average voltage . after compensating for parasitic losses , the value of the detection resistor in the poe powered device can be calculated from the slope of the average voltage - current curve between set points v 1 and v 2 . if the detection mode was not successful ( e . g ., detection sequencer timed out while trying to achieve either set point v 1 or set point v 2 ), then master sequencer 602 will wait a specified period ( e . g ., one half second ) before re - initiating the detection sequence , as required by the ieee 802 . 3af poe standard . fig8 shows a schematic block diagram of only those elements of fig6 that are involved in the pse classification mode of operation . if the detection process was successful , then master sequencer 602 will initiate a classification process under the control of classification sequencer 608 . classification sequencer 608 directs voltage - control logic 604 to select the classification voltage ( e . g ., nominally about 18 volts ). during classification , switcher 206 operates as a conventional current - mode , pulse - width modulated , switching power supply . reference voltage 642 from voltage - control logic 604 is compared by adc 634 to sensed voltage 640 , which depends on the output voltage of power transformer 214 as reflected to third winding 638 . to ensure that the voltage from third winding 638 is closely representative of the actual transformer output voltage ( in order to maintain high accuracy ), an adjustable matching load 648 is utilized and set by master sequencer 602 to mimic the actual load expected in the classification mode . ( master sequencer 602 analogously controls variable load 648 during the detection and power - on modes .) adc 634 digitizes the error between the desired output voltage and the actual output voltage . this digitized error 644 is conditioned through pwm loop filter 624 to maintain loop stability . the resulting filtered error signal 650 is processed through digital current - limit function 652 and applied to current - sense block 654 , which senses the transformer current , to enable pwm control logic 612 to determine the peak current at which the pulse width modulator should turn off the power ( mosfet ) transistor 656 . in the pse classification mode , the programmable current - limit function 652 is set and monitored by fault monitor 610 to limit the average output current , e . g ., to under 100 ma , as required by the ieee 802 . 3af poe standard . classification sequencer 608 controls all aspects of voltage application , timing , and time - out processing for the pse classification mode defined in the ieee 802 . 3af poe standard . if the classification process completes successfully , then the current observed ( i . e ., the output of current - limit function 652 ) is reported to classification sequencer 608 , which determines the power class of the poe powered device per the ieee 802 . 3af poe standard . fig9 shows a schematic block diagram of only those elements of fig6 that are involved in the pse power - on mode of operation . following the classification process , master sequencer 602 will initiate the power - on mode . master sequencer 602 will set variable load 648 to mimic the expected load and then direct voltage - control logic 604 to select the power - on voltage level ( e . g ., nominally about 48 volts ). during power - on , switcher 206 operates as a conventional current - mode , pulse - width modulated , switching power supply . reference voltage 642 from voltage - control logic 604 is compared by adc 634 to sensed voltage 640 , which depends on the output voltage of power transformer 214 as reflected to third winding 638 . adc 634 digitizes the error between the desired output and the actual output voltage . this digitized error 644 is conditioned through pwm loop filter 624 to maintain loop stability . the resulting filtered error signal 650 is processed through current - limit function 652 and applied to current - sense block 654 , which senses the transformer current , to enable pwm control logic 612 to determine the peak current at which the pulse width modulator should turn off the power ( mosfet ) transistor 656 . in the pse power - on mode , the programmable current - limit function 652 is set and monitored by fault monitor 610 to limit the average output current , e . g ., to nominally about 425 ma during initial power application ( in - rush conditions ) and then to a current limit dependent upon the results of the classification process , not to exceed nominally about 375 ma , as required by the ieee 802 . 3af poe standard . master sequencer 602 controls all aspects of voltage application , timing , and time - out processing for the pse power - on mode defined in the ieee 802 . 3af poe standard . various current limits , such as icut , ilimit , and iinrush , are programmed and monitored by fault monitor 610 using information received from current - limit function 652 . appropriate levels of ramp - up rates , ramp - down rates , noise , and ripple currents are ensured by a combination of loop characteristics and hardware components utilized in the output circuits ( e . g ., power conditioning module 208 ). off - load block 658 in power conditioning module 208 senses when switcher 206 is shutting down in order to apply a small additional load to the output to ensure that the transformer output decays within the duration allotted by the ieee 802 . 3af poe standard . depending on the particular implementation , the isolated - side pse control module of the present invention can provide other pse control functions that are normally implemented on the line side of certain conventional ethernet switches . in general , these functions may be those required by the ieee 802 . 3af standard , and , in particular , by the requirements of fig3 - 6 ( entitled “ pse state diagram ”) and fig3 - 7 ( entitled “ pse monitor overload , monitor short , and monitor mps state diagram ”) of the ieee 802 . 3af standard . although the present invention has been described in the context of communication systems conforming to the ieee 802 . 3 ethernet and ieee 802 . 3af poe standards , the invention is not necessarily limited to communication systems that conform to either or both of those two standards . moreover , as those standards may evolve over time , it is expected that implementations of the present invention can also evolve in a corresponding manner . although the present invention is described in the context of switches in which a 48 - volt ( differential ) dc signal is applied to the secondary - side coils of two signal - isolation transformers , the invention is not necessarily so limited . for example , the present invention may be implemented in the context of ( 1 ) dc power signals having voltage levels other than 48 volts , ( 2 ) non - differential ( i . e ., single - sided ) dc power signals , and ( 3 ) even differential or single - sided ac power signals . moreover , the power signals may be provided to the cables via other means , such as direct connection to the connector . furthermore , the present invention may be implemented in contexts other than switches , such as routers or other suitable apparatus . the present invention may be implemented as circuit - based processes , including possible implementation as a single integrated circuit ( such as an asic or an fpga ), a multi - chip module , a single card , or a multi - card circuit pack . as would be apparent to one skilled in the art , various functions of circuit elements may also be implemented as processing steps in a software program . such software may be employed in , for example , a digital signal processor , micro - controller , or general - purpose computer . it will be further understood that various changes in the details , materials , and arrangements of the parts which have been described and illustrated in order to explain the nature of this invention may be made by those skilled in the art without departing from the scope of the invention as expressed in the following claims . reference herein to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment can be included in at least one embodiment of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment , nor are separate or alternative embodiments necessarily mutually exclusive of other embodiments . the same applies to the term “ implementation .”	7
tris ( 3 - acetylthiopropyl ) isocyanurate provided according to this invention is a novel compound having the following formula ( i ): ## str1 ## tris ( 3 - acetylthiopropyl ) isocyanurate ( hereinafter referred to as the compound of this invention ) having the above - shown formula ( i ) is in the form of white crystals having a peculiar odor with a melting point of 64 °- 66 ° c . and is stable in the atmosphere . also , this compound is easily soluble in acetone , benzene , chloroform , carbon tetrachloride and acetetic acid esters but scarcely soluble in petroleum type low - boiling solvents , ethanol and water . this compound can be produced from a radical addition reaction of thiolacetic acid ( thioacetic acid ) to triallyl isocyanurate as depicted by the following reaction formula ( ii ): ## str2 ## the said addition reaction for preparing the compound of this invention is carried out at a temperature of 0 ° to 150 ° c . in at least one solvent selected from hydrocarbons , ethers , ketones , lower fatty acids , esters , halogenated hydrocarbons , nitriles and acid amides . in order to promote said addition reaction to elevate the yield of the objective compound , the said reaction may be carried out ( 1 ) under application of the ultraviolet rays in the presence of a ketone compound as sensitizer , ( 2 ) at a temperature of 50 °- 150 ° c . in the presence of a non - oxidative organic radical reaction catalyst , or ( 3 ) under application of the ultraviolet rays in the co - presence of a ketone compound as sensitizer and a non - oxidative organic radical reaction catalyst . the hydrocarbons usable as solvent in performing the said reaction according to this invention include : petroleum ethers , benzine , ligroin , gasoline , kerosine , light oil , pentane , hexane , heptane , octane , cyclohexane , methylcyclohexane , benzene , toluene , xylene , trimethylbenzene , ethylbenzene and cumene , and the ethers also usable for the said purpose include dimethyl ether , diethyl ether , dipropyl ether , dibutyl ether , methyl ethyl ether , methyl propyl ether , methyl butyl ether , anisole , phenetole , methylal , ethylal , tetrahydrofuran , dioxane , dimethoxyethane , diethoxyethane , methoxyethyl acetate and ethoxymethyl acetate . examples of the ketone compounds usable as solvent in the said reaction include acetone , methyl ethyl ketone , diethyl ketone , dipropyl ketone , methyl propyl ketone , methyl butyl ketone , cyclopentanone , cyclohexanone , acetophenone and methylacetophenone , and examples of the lower fatty acids include formic acid , acetic acid , propionic acid and butyric acid . the esters usable in this invention include methyl formate , ethyl formate , propyl formate , butyl formate , amyl formate , methyl acetate , ethyl acetate , propyl acetate , butyl acetate , methyl propionate , ethyl propionate , propyl propionate , methyl butyrate , propyl butyrate , butyl butyrate , ethylene glycol diacetate , propylene glycol diacetate , butylene glycol diacetate , glycerin triacetate and methylene diacetate , and the halogenated hydrocarbons include methylene chloride , chloroform , carbon tetrachloride , methane fluoride chloride ( freon ), ethane fluoride chloride ( freon ), ethylene chloride , trichlene , perchlene , methylchloroform , dichloropropane , chloroalkane , chlorobenzene , dichlorobenzene and chlorotoluene , and the examples of acid amides are acetonitrile , benzonitrile , formamide , dimethylformamide and dimethylacetamide . these solvents may be used either singly or in combination of two or more . also , they may be used in all compound forms such as n -, iso -, secondary , tertiary , ortho -, meta - and para -. among these solvents , the following are preferred in industrially practicing the said addition reaction according to this invention : petroleum ether , benzine , ligroin , gasoline , hexane , heptane , cyclohexane , benzene , toluene , xylene , ethyl ether , dipropyl ether , dimethoxyethane , tetrahydrofuran , dioxane , acetone , methyl ethyl ketone , methyl butyl ketone , formic acid , acetic acid , methyl formate , methyl acetate , methylene chloride , chloroform , carbon tetrachloride , methylchloroform , chlorobenzene , acetonitrile and dimethylformamide . particularly , the ketone compounds can further promote the reaction since they act as a sensitizer as said before . in case of using the above - cited substances other than the ketone compounds as solvent , the following ketone compounds may be incorporated as sensitizer : acetone , methyl ethyl ketone , diethyl ketone , dipropyl ketone , dibutyl ketone , methyl propyl ketone , methyl butyl ketone , mesityl oxide , cyclopentanone , cyclohexanone , acetophenone , propiophenone , butyrophenone , benzophenone , dibenzyl ketone , halogen - oacetophenone , methylacetophenone , methoxyacetophenone , dimethylaminoacetophenone , nitroacetophenone , hydroxyacetophenone , anthraquinone , naphthoquinone , benzoquinone , cumoquinone , benzanthraquinone , fluorenone , benzyl , benzoin , nitrofluorein , dinitrofluorein , nitroacenaphthene , benzoylacenaphthene , acethylacetone , diacetyl , benzoylacetone , dibenzoyl , acetoacetic acid ester , methylbenzophenone , halogenobenzophenone , methoxybenzophenone , dimethylaminobenzophenone , aminobenzophenone , nitrobenzophenone , hydroxybenzophenone , and one or a mixture of the compounds selected from the group consisting of acyl halides , anhydrous organic acids and polyacylated compounds derived from ketene by a friedel - crafts reaction . among these ketone compounds , acetone , methyl ethyl ketone , acetophenone , benzophenone or their nuclear substituents are particularly preferred for use as sensitizer because of availability at low cost . the term &# 34 ; non - oxidative organic radical reaction catalyst &# 34 ; used for promoting the said addition reaction according to this invention referes to the radical reaction catalysts excluding those which can act as oxidizer such as oxygen , ozone , persulfates , percarbonates , perchlorates , perborates , permanganates , organic peracids , hydrogen peroxide and peroxides exclusive of ozonides , and the examples of such organic radical reaction catalysts are : benzoyl peroxide , para - ( or ortho - or meta -) chlorobenzoyl peroxide , para - ( or ortho - or meta -) methylbenzoyl peroxide , para - methoxy - benzoyl peroxide , para - nitrobenzoyl peroxide , methyl ethyl ketone peroxide , cumene hydroperoxide , tert - butyl hydroperoxide , di - tert - butyl peroxide , caproyl peroxide , isooctanoyl peroxide , lauroyl peroxide , methyl isobutyl ketone peroxide , cyclohexanone peroxide , acetyl peroxide , propionyl peroxide , 2 , 4 - dichlorobenzoyl peroxide , tert - butylcumyl peroxide , dicumyl peroxide , tert - butyl peracetate , diisopropyl peroxydicarbonate , di - sec - butyl peroxydicarbonate , azobis - 2 , 4 - dimethylvaleronitrile , azobis - 2 - methylbutyronitrile , azobis - isobutyronitrile , 2 , 2 &# 39 ;- azobis -( 2 - amidinopropane ) dihydrochloride , azobis - 2 - cycloalkylidene cyanide and the compounds of the type in which the said cyano groups have been converted into carbomethoxyl or carboethoxyl groups . these compounds may be used either singly or in combination as the said organic radical reaction catalyst . the ultraviolet rays used for promoting the reaction in this invention are those having a wavelength ( λ ) of 200 - 500 nm , preferably 250 - 400 nm , and the ordinary ultraviolet lamp , mercury lamp , fluorescent lamp , xenon lamp , tungsten lamp , sun rays or arc lamp may be used for the said purpose . in preparation of tris ( 3 - acetylthiopropyl ) isocyanurate according to the above - shown reaction formula ( ii ), triallyl isocyanurate used as a starting material is preferably one having a purity of at least 95 %. particularly , it is advised to select a material whose contents of primary amine , secondary amine and triallyl cyanurate are minimized . the thiolacetic acid used for the addition reaction with the said triallyl isocyanurate is one synthesized by a reaction of hydrogen sulfide with acetic anhydride , and it is possible to use commercially available thiolacetic acid as well as an acetic acid solution of thiolacetic acid obtained by reacting acetic anhydride and hydrogen sulfide . it is desirable that the thiolacetic acid used here should contain no such impurities as sulfur oxides , sulfuric acid and alkali sulfides . in the said addition reaction for synthesizing tris ( 3 - acetylthiopropyl ) isocyanurate according to this invention , since the starting material triallyl isocyanurate is having unsaturated functional groups , is per se highly polymeric , there is a risk of causing by - production of 2 - acetylthiopropyl compounds and / or side reactions such as allyl rearrangement reaction or dimerization reaction due to formation of thioether . in this invention , therefore , in order to prevent such side reactions , there are used triallyl isocyanurate ( starting material ) and thiolacetic acid of high purity as said above , and also the reaction is carried out in the presence of a solvent such as cited above and under a specified temperature condition . it is also attempted to add a sensitizer and a non - oxidative organic radical reaction catalyst such as mentioned above and to apply the ultraviolet rays . the addition reaction in this invention is carried out under a temperature condition of 0 °- 150 ° c ., preferably 5 °- 100 ° c . if the reaction temperature is below 0 ° c ., the reaction is sluggish and a long time is required till it is completed , so that air might be absorbed into the reaction system during such a long time reaction to give rise to excessive side reaction products such as said above . on the other hand , if the reaction temperature exceeds 150 ° c ., it becomes necessary to elevate the pressure applied to the reaction system because the boiling point of thiolacetic acid , which is one of the reaction material , is 93 ° c ., and this promotes polymerization of triallyl isocyanurate which is the other reaction material . as the solvents used in this invention , such as mentioned above , are inert to the reaction materials , there is no fear of inducing any unexpected side - reaction , and also there is little chance of air absorption into the reaction system because of low air solubility . it is to be noted in this connection that such substances as water , alcohol , nitrohydrocarbons , aldehydes , dimethyl sulfoxide , dimethyl sulfone , tetramethyl sulfone and tertiary amines , which are often used as solvent for the synthesis of organic compounds , can cause unexpected reactions with thiolacetic acid or may partially oxidize thiolacetic acid , and moreover , they have high air solubility , so that these solvents can not be used singly in this invention . it is , however , possible to use these substances in admixture with the solvents employed in this invention provided that the said substances are mixed in an amount not exceeding 30 %. the sensitizers used in this invention , such as above - mentioned , are excited by absorbing light in the reaction system and the energy thus absorbed is transferred into the reaction materials to expedite the addition reaction of this invention . it should be understood , therefore , that the said sensitizers are essentially different from the optical catalysts which do not absorb effective light but merely act to promote the reaction . the ketone compounds employed as a sensitizer for this purpose are preferably used in an amount of 0 . 1 to 10 % by weight based on the reaction mixture , and in case of using a protonic solvent such as acetic acid as solvent in the reaction system of this invention , it is desirable to increase the loading of such solvent . the non - oxidative organic radical reaction catalyst used in this invention serves as a radical initiator of the addition reaction of this invention . in case of using such catalyst , the reaction temperature is preferably adjusted to 50 °- 150 ° c ., more preferably 50 °- 120 ° c ., at which the said catalyst is decomposed in the reaction mixture . the amount of the said radical reaction catalyst added is preferably within the range of 0 . 05 - 5 . 0 % by weight based on the reaction mixture . it should be noted that too much loading of the catalyst or too high reaction temperature induces polymerization of triallyl isocyanurate itself to cause resinification . application of ultraviolet rays in this invention has a role of supplying the electronic energies required to elevate the ground state of the reaction material thiolacetic acid or trially isocyanurate to their excited state , and consequently , the said reaction materials are thus activated to undergo the desired reaction . according to this invention , tris ( 3 - acetylthiopropyl ) isocyanurate can be produced in a high yield , without inducing substantially any side - reaction , by reacting triallyl isocyanurate and thiolacetic acid under the said reaction conditions for a period of about 10 to 1 , 000 minutes under the normal pressure or by applying only a slight pressure of less than 10 atm . by using an ordinary reaction apparatus . the tris ( 3 - acetylthiopropyl ) isocyanurate preparation process according to this invention may be either batch type or continuous type . in the case of the batch type process , in view of the structural formula of tris ( 3 - acetylthiopropyl ) isocyanurate , it is essential for improving the yield of the objective product to feed thiolacetic acid in an amount of 3 mols or more to 1 mol of triallyl isocyanurate into the reactor , but in certain types of reaction operation ( for example , in the case of a continuous system ), thiolacetic acid may be initially fed into the first stage reactor in an amount of 30 to 60 % by weight of the total amount of thiolacetic acid to be reacted , and the remaining amount of thiolacetic acid may be reacted in the second and / or third stage reactor . the reaction product is further subjected to a necessary chemical treatment such as distillation , extraction or recrystallization to separate tris ( 3 - acetylthiopropyl ) isocyanurate from the said reaction products . the reaction of the said hydrolysis may be accomplished by acidic hydrolysis , neutral hydrolysis or alkaline hydrolysis . the acidic hydrolysis can be performed by using a non - oxidative mineral acid such as hydrochloric acid , sulfuric acid , phosphoric acid , etc ., as catalyst at a reaction temperature of 20 °- 110 ° c . and with an acid concentration of about 0 . 2 - 150 %. the neutral hydrolysis is performed under pressure in hot water of higher than 100 ° c ., but the solution becomes acidic as acetic acid is librated . the alkaline hydrolysis is carried out at 40 °- 120 ° c . in the presence of ammonia water , sodium hydroxide , potassium hydroxide , sodium carbonate , potassium carbonate , calcium hydroxide , calcium carbonate or the like . when a calculated amount of an alkali exists , an alkali acetate is produced , but in case an excess amount of an alkali exists , there is produced the corresponding mercaptide , so that , in this case , it needs to acidify the reaction product after completion of the reaction to liberate mercaptan . any of the said reactions can be accomplished relatively easily , but it is free to add a small amount of a surfactant for the purpose of expediting dispersion of the reaction material in water for further accelerating the hydrolysis . the reaction product is subjected to a suitable chemical treatment such as solvent extraction , vapour distillation , oil phase separation , salting - out or centrifugation to separate tris ( 3 - mercaptopropyl ) isocyanurate ester from the said reaction products , and this ester is refined by suitable means such as water washing , drying , decoloring , distillation or recrystallization . what is to be noted here is that the whole operations between hydrolysis and the final refining should preferably be performed under a non - oxidative atmosphere to a maximum possible degree so as to prevent the contamination of the objective product due to mixing of disulfide which may be caused by the presence of the oxidizer . the term &# 34 ; non - oxidative atmosphere &# 34 ; as used herein means a reaction atmosphere excluding oxidizers , such as organic active halogen compounds , hydrogen peroxide , permanganates chromic acid , nitric acid , halogens , organic peracids , persulfuric acid , selenium dioxide , iron chloride , potassium ferricyanide , oxygen ( air ) and ozone , which may oxidize mercaptan when hydrolyzing the reaction product obtained from the reaction of triallyl isocyanurate with thiolacetic acid , that is , tris ( 3 - mercaptopropyl ) isocyanurate , or when refining tris ( 3 - mercaptopropyl ) isocyanurate obtained by the hydrolysis . it is advisable to actually use an inert gas such as nitrogen or argon for the said non - oxidative atmosphere . the hydrolysis is preferably performed on the solvent - removed reaction product containing tris ( 3 - acetylthiopropyl ) isocyanurate obtained as said above according to this invention . in the case of acidic hydrolysis for example , the said solvent - removed reaction product is dissolved in methanol , and the solution is mixed with concentrated hydrochloric acid and heated , and then after neutralizing the obtained product , methanol is distilled off in a nitrogen atmosphere to obtain tris ( 3 - mercaptopropyl ) isocyanurate . in the case of alkaline hydrolysis , the solvent - removed reaction product is mixed with an aqueous solution of sodium hydroxide and heated , and after cooling , the resultant product is made acidic with concentrated hydrochloric acid and then subjected to solvent extraction ( by using benzene for example ), and the extract solution thus obtained is distilled under an argon stream to obtain tris ( 3 - mercaptopropyl ) isocyanurate . tris ( 3 - mercaptopropyl ) isocyanurate obtained by hydrolyzing tris ( 3 - acetylthiopropyl ) isocyanurate and then refining the hydrolyzed product as said above is a viscous heavy liquid having a slight odor , and this liquid is turned into a glassy liquid upon cooling . this compound is soluble in organic solvents and aqueous alkaline solutions , and when reacted with 2 , 4 - dinitrofluorobenzene , it gives the corresponding trithioether ( melting point : 104 ° c .). as described above , it is possible according to this invention to advantageously produce tris ( 3 - mercaptopropyl ) isocyanurate by first producing as an intermediate tris ( 3 - acetylthiopropyl ) isocyanurate by reacting triallyl isocyanurate and thiolacetic acid , and then hydrolyzing this intermediate . the invention is described in further detail hereinbelow by way of the examples thereof . a mixture of 5 . 3 g ( 0 . 021 mol ) of triallyl isocyanurate , 5 . 8 g ( 0 . 076 mol ) of thiolacetic acid and 150 ml of benzene was placed in a reactor provided with a high - pressure mercury lamp , and irradiated with stirring under a nitrogen stream at 25 ° c . for 5 hours . benzene was distilled off from the reaction mixture and the residue was dissolved in methanol and recrystallized therefrom to obtain 0 . 6 g ( 6 . 0 % yield ) of tris ( 3 - acetylthiopropyl ) isocyanurate ( i ). this compound was in the form of white needle - like crystals with a melting point of 64 . 0 °- 66 . 0 ° c . and its structure was identified as follows : calcd . for c 18 h 27 n 3 o 6 s 3 : c , 45 . 28 %; h , 5 . 66 %; the calculated and found values agree with each other within the range of errors in the analytical experiment . c ═ o bonds of ═ n -- co -- n ═ and -- s -- co -- ch 3 ), 1130 cm - 1 and the structure and bonding positions of tris ( 3 - acetylthiopropyl ) isocyanurate were determined from the foregoing measurements . ( 4 ) synthesis of confirmed compound : tris ( 3 - acetylthiopropyl ) isocyanurate ( i ) was put into an alcoholic aqueous solution of potassium hydroxide and boiled , and after adding 2 , 4 - dinitrochlorobenzene , the mixture was again boiled . the reaction mixture was charged into water and the precipitated crystals were collected and recrystallized from alcohol to obtain tris [ 3 -( 2 , 4 - dinitrophenyl )- thiopropyl ] isocyanurate having a melting point of 103 °- 104 ° c . the elemental analysis and the n . m . r . and i . r . tests on this product confirmed that the starting material was obviously tris ( 3 - acetylthiopropyl ) isocyanurate ( i ). triallyl isocyanurate ( 124 g ., 0 . 5 mol ), 126 g ( 1 . 7 mols ) mols ) of thiolacetic acid and 1 . 5 litres of acetone serving as solvent / sensitizer were put into a reactor provided with a high - pressure mercury lamp , and the mixture was irradiated with stirring under a nitrogen stream to effect a a reaction at 20 ° c . for 2 hours . then acetone was distilled off from the reaction mixture and the residue was dissolved in methanol and recrystallized therefrom to obtain 230 g ( 96 % yield ) of tris ( 3 - acetylthiopropyl ) isocyanurate ( i ). the process of example 2 was repeated but by using 1 . 5 litres of the solvents and the sensitizers shown in table 1 below instead of acetone , consequently obtaining tris ( 3 - acetylthiopropyl ) isocyanurate ( i ) in the yields shown in the same table . table 1______________________________________ sensitizer yield of ( i ) solvent ( amount used , g ) (%) ______________________________________toluene benzophenone ( 5 ) 94cyclohexane benzophenone ( 5 ) 96methyl ethyl --* 98ketoneacetophenone --* 99acetic acid p - chlorobenzophenone ( 10 ) 90chloroform p - methylbenzophenone ( 10 ) 88______________________________________ ( note ) *: the solvent doubled as sensitizer . triallyl isocyanurate ( 5 . 3 g ., 0 . 021 mol ) and an acetic acid solution containing 5 . 8 g ( 0 . 076 mol ) of thiolacetic acid ( a reaction solution obtained according to the method described in organic synthesis , vol . 31 , p . 105 ( 1951 ), by blowing hydrogen sulfide into acetic anhydride ) were put into a sealed pressure - resistant glass tube , and the mixture was reacted at 90 ° c . for 10 hours in the presence of the radical reaction catalysts shown in table 2 below . the reaction mixture was charged into water and subjected to either extraction , and tris ( 3 - acetylthiopropyl ) isocyanurate ( i ) was collected by means of distillation of ether and subsequently recrystallization , and the yield was measured . table 2______________________________________radical reaction catalyst ( amount used , g ) yield of ( i ) (%) ______________________________________benzoyl peroxide ( 0 . 01 ) 682 , 4 - dichlorobenzoyl peroxide ( 0 . 01 ) 75azobisisobutyronitrile ( 0 . 02 ) 81azobis - 2 , 4 - dimethylvaleronitrile ( 0 . 02 ) 80cyclohexanone perxoide ( 0 . 01 ) 71dicumyl peroxide ( 0 . 01 ) 65______________________________________ triallyl isocyanurate ( 5 . 3 g ., 0 . 021 mol ), 5 . 8 g ( 0 . 076 mol ) of thiolacetic acid and 10 ml of the solvents as well as the sensitizers or radical reaction catalysts shown in table 3 below were put into a sealed pressure - resistant glass tube and the mixture was reacted at 60 ° c . for 4 hours under the direct sun - beam and then treated in a similar manner to example 4 , whereby tris ( 3 - acetylthiopropyl ) isocyanurate ( i ) was obtained in the yields shown in table 3 . table 3______________________________________ sensitizer or radical yield ofsolvent catalyst ( amount used , g ) ( i ) (%) ______________________________________benzene acetone ( 0 . 5 ) 75xylene methyl isobutyl ketone ( 0 . 7 ) 62dimethoxyethane acetophenone ( 0 . 8 ) 78tetrahydrofuran benzophenone ( 0 . 8 ) 80carbon benzoyl peroxide ( 0 . 01 ) 52tetrachloridechlorobenzene azobisisobutyronitrile ( 0 . 01 ) 66ethyl acetate p - methoxyacetophenone ( 0 . 4 ) 69n - heptane o - methylacetophenone ( 0 . 5 ) 68acetonitrile dibenzyl ketone ( 1 . 0 ) 84dimethylformamide p , p - dimethoxybenzophenone ( 0 . 4 ) 73acetone nitrofluorenone ( 0 . 5 ) 92ether / acetone anthraquinone ( 0 . 5 ) 85 ( 1 : 1 ) ______________________________________ triallyl isocyanurate ( 10 . 5 g ., 0 . 042 mol ), 10 . 5 g ( 0 . 138 mol ) of thiolacetic acid , 0 . 5 g ( 0 . 002 mol ) of benzoyl peroxide , 0 . 04 g ( 0 . 0002 mol ) of benzophenone and 300 ml of benzene were put into a reactor provided with a high - pressure mercury lamp and a pyrex clear chemical glass filter , and the mixture was irradiated with stirring under a nitrogen stream at 25 ° c . for one hour . benzene was distilled off and recovered from the reaction mixture and the residue was dissolved in methanol and recrystallized therefrom to obtain 18 . 6 g ( 97 . 5 % yield ) of tris ( 3 - acetylthiopropyl ) isocyanurate ( i ). triallyl isocyanurate ( 124 g ), 126 g of thiolacetic acid , 1 , 000 g of acetone and 500 g of acetic acid were put into a flask so designed as to allow application of ultraviolet rays , and the mixture was reacted at 30 ° c . for 100 minutes under irradiation of ultraviolet rays . the reaction mixture was distilled under reduced pressure to recover 950 g of acetone and 470 g of acetic acid , and the residue was dissolved in about 10 times as much amount of methanol , then treated with 50 g of centrated hydrochloric acid and refluxed under boiling for 6 hours . then the reaction mixture was neutralized by adding anhydrous sodium carbonate and passed through a column packed with neutral active alumina . methanol was distilled off under a nitrogen stream from the obtained methanol solution and the residue was dried under reduced pressure to obtain tris ( 3 - mercaptopropyl ) isocyanurate with m . p . of - 27 to - 26 ° c . and n d 29 1 . 5561 in a yield of approximately 98 %. anal . calcd . for c 12 h 21 n 5 o 3 s 3 : c , 41 . 03 %; h , 5 . 98 %; n , 11 . 97 %; s , 27 . 35 %. found : c , 41 . 28 %; h , 6 . 08 %; n , 11 . 63 %; s , 27 . 10 %. this compound was identified as tris ( 2 , 4 - dinitrophenyl ) thioether ( m . p .= 104 ° c .) from the reaction with 2 , 4 - dinitrochlorobenzene or 2 , 4 - dinitrofluorobenzene . the n . m . r . and i . r . spectra of tris ( 3 - mercaptopropyl ) isocyanurate were as follows : triallyl isocyanurate ( 124 g ), an acetic acid solution containing 120 g of thiolacetic acid ( a solution obtained by dissolving hydrogen sulfide in acetic anhydride according to the method shown in organic synthesis , vol . 4 , p . 928 ( 1967 ), john wiley and sons , inc .) and 200 g of methyl ethyl ketone were put into a flask so designed as to allow irradiation of ultraviolet rays , and the mixture was stirred at 25 °- 35 ° c . for 28 hours under irradiation of ultraviolet rays and then distilled under reduced pressure to recover the substantial portions of acetic acid and methyl ethyl ketone , and the residue was mixed with 400 ml of a 5 % aqueous solution of sodium hydroxide and boiled for one hour . after cooling , the reaction mixture was made acidic with concentrated hydrochloric acid and extracted with benzene and the extract solution was dried with anhydrous magnesium sulfate and distilled under an argon stream , whereby tris ( 3 - mercaptopropyl ) isocyanurate was obtained as a viscous distillation residue . this residue was decolored and refined by using active carbon and activated clay to obtain an oily substance with m . p . of - 27 ° to - 26 ° c . and n d 29 1 . 5559 in a yield of about 92 %. this substance was identified as 2 , 4 - dinitrophenyl ether .	2
suitable hydraulic binders useful for the formation of a cementitious slurry in the present invention include portland cement , aluminous cement , pozzolanic cement , gunite , calcium sulfate hemi - hydrate ( gypsum , both non - hydrated and hydrated plaster of paris ), with gypsum being particularly preferred . portland cement is known to be the binder of choice where resistance to moisture is important or in high traffic areas where higher density ( e . g ., 15 - 30 pcf , more typically 22 - 26 pcf ) coatings are desired . while gypsum can be used in higher density applications , it is usually used for light density ( about 5 - 19 pcf , preferably about 10 - 15 pcf ) compositions . preferably the binder is used in an amount of about 10 to about 98 % by weight , more preferably about 90 to about 95 % by weight . preferably the hydraulic binder is provided in a finely divided dry powder form . the term “ foam ” is used herein to mean a group of bubbles separated from one another by thin films , the aggregation having a finite static life sufficiently long to allow for conveying and spraying of the foam in accordance with the present invention . in order to stabilize the foam mechanically formed in accordance with the present invention , surfactants , protein compounds , and / or hydrophilic compounds or polymers that are soluble , miscible or dispersible in water are suitable . the preferred foam stabilizing agent is polyvinyl alcohol , most preferably powdered polyvinyl alcohol . the amount of polyvinyl alcohol used as a foam stabilizing agent is preferably in an amount of from about 1 % to 12 % inclusive by mass of water , more preferably about 2 % to 10 % inclusive , even more preferably about 2 % to 8 %, most preferably about 2 - 3 % in order to ultimately produce a foam of the desired density . the viscosity of the polyvinyl alcohol used affects the volume increase of the foamed composition from the unfoamed state . preferred polyvinyl alcohols are partially hydrolyzed grades with a degree of hydrolysis mol % in the range of 79 % to 90 %, preferably about 88 %, with an ester value mg koh / g of 140 , and residual acetyl content weight percent of 10 . 7 . examples of suitable polyvinyl alcohols are the mowiol grade sold by clarient , 4 / 88 through to 40 / 88 , which at 20 ° c . and at a 5 % concentration in water , each have viscosities of 8 pa . s for 4 / 88 , 9 mpa . s for 5 / 88 , 12 mpa . s for 8 / 88 , 55 mpa . s for 18 / 88 ( which is particularly preferred ), 75 mpa . s for 23 / 88 and 100 mpa . s for 40 / 88 ; and celanese celvol 523s and 523 sf . it is most preferable that the polyvinyl alcohol be used in the form of a powder . the powder must be comprised of particles sufficiently small to ensure that the polyvinyl alcohol readily dissolves in water . powdered polyvinyl alcohols having particles averaging from 80 to 400 microns have been found to be suitable . those skilled in the art can readily determine which commercially available polyvinyl alcohol powders in addition to the foregoing are suitable . other suitable foam stabilizers include fluoro surfactants such as those commercially available from dupont , including zonyl fs300 , which is a general - purpose non - ionic fluoro surfactant free of organic solvents , unaffected by hard water or ph , with a large capacity to wet out . these may be used in an amount of from about 0 . 005 % to about 0 . 5 % inclusive by mass of water . suitable protein compounds include hydrolyzed protein based concentrates . protein compounds may be used in an amount of from about 2 % to about 5 % inclusive by mass of water . suitable hydrophilic compounds or polymers include modified starches , natural carbohydrates such as gums or seaweed colloids , semi - synthetic polymers such as the cellulose ethers , hydrogels such as the homo - and co - polymer derivatives of acrylic and methacrylic acid , or the polyacrylamide polyacrylate co - polymers , and dispersions such as polyvinyl acetate and styrenated acrylics . in contrast to the chemically foamed , pumped and sprayed fireproofing described in the aforementioned u . s . pat . no . 4 , 904 , 503 and presently used in commercial practice , the foams of the present invention are mechanically created . foam generation apparatus such as high shear mixers known in the board - making art can be used . however , it has been found that such device are unnecessary and that the mechanical creation of turbulence effective to generate gas bubbles and thereby foam the slurry can be carried out in the tubing or hosing conventionally used in present pump and spray fireproofmg applications , which tubing or hosing is also used to convey the resulting foam to a dispense point such as a nozzle for ultimate spray application to the substrate . the gas , preferably compressed air , preferably is introduced into the hose or tube in which the slurry is resident , such as by injection . in one embodiment of the present invention , the location of the gas introduction into the hose or tubing is near the dispense point , since it has been found that as the hose or tube length increases after the point of gas introduction , the longer it takes for the foam to reach steady state ( defined as capable of being dispensed from the hose at a uniform rate without large pulses of gas ). it is desirable that steady state be reached , otherwise the foam is ejected from the dispense point as plugs rather than a uniform spray . pulsed dispense makes it difficult to uniformly apply the foam to the substrate , as the pulses of gas tend to “ blow ” the product off of the substrate as fast as it can be sprayed onto the substrate . in addition , locating the gas introduction relatively close to the point of application minimizes the length of hose through which the foam needs to be conveyed . the density of the foam produced is a function of the rate of flow of the slurry as well as the length and diameter of the hose or tubing , as well as the gas pressure and gas volume ( cfm ) injected into the foam , and the residence time of the slurry ( and foam ) in the hose or tube . those skilled in the art can adjust the foregoing parameters to achieve the desired final density of the product . for example , one suitable system uses a 50 foot hose having a diameter of ¾ inch and air injection at a rate of 26 cfm at 70 psi . if the hose or residence time of the composition in the hose is too short , insufficient foaming will occur . if the hose or residence time of the composition in the hose is too long , steady - state will not be realized and the composition will form plugs which “ spit ” from the exit and cannot be readily spray - applied to the substrate in a uniform manner as mentioned above . the objective is to provide a hose of sufficient length and diameter so that the composition entering the hose in a slurried state can be foamed with gas and reach steady - state prior to the composition exiting the hose . those skilled in the art balance the flow rate as well as the length and diameter of the hose with the gas pressure and gas volume being injected into the hose to achieve a desired foam consistency and density . it has been found that for a given hose diameter and a given air pressure , shorter hoses result in the foamed product reaching equilibrium or steady - state faster than longer length tubes . for example , the foam reached equilibrium in a 25 foot hose having a 0 . 5 inch diameter in 30 seconds compared to more than 300 seconds for a 0 . 5 inch diameter hose 150 feet long . similarly , foams in hoses 25 and 50 feet long with diameters of ¾ inch reached equilibrium immediately , whereas lengths of 100 feet at a diamter of ¾ inches took 55 seconds and 150 feet with the same diameter took more than 300 seconds . suitable hose or tubing lengths include 15 to 150 feet , with diameters including ½ ″, ⅝ ″, ¾ ″ and 1 inch . shorter length hoses allow the product to reach equilibrium or steady state faster than longer lengths . for a given formulation , the density of the product was the same regardless of whether the tube was coiled or laid in straight line . an advantage of the present invention is that the fireproofing can be applied using lighter weight hoses than those conventionally used , easing the burden on the applicator . the compositions of the present invention can include a fibrous component . the fibrous component can be either organic or inorganic . preferably , the fibrous component is a mixture of a high wet bulking organic fiber , preferably cellulose fiber as described in u . s . pat . nos . 3 , 719 , 513 and 3 , 839 , 059 , and an inorganic fiber which provides reinforcement , preferably steel or glass fiber . polymeric reinforcing fibers such as polypropylene fibers also can be used . other suitable components include silica , diatomaceous earth , expanded perlite , exfoliated vermiculite , shredded expanded polystyrene , alumina , grog , colloidal silica , ceramic fibers , mineral fibers and combinations thereof . the total amount of the fibrous component in the composition is preferably in the range of about 0 % to about 40 % by weight . a particularly preferred composition comprises about 4 % to 10 % by weight of high wet bulking cellulosic fiber and about 0 . 0 % to about 1 % by weight of glass fiber , with about 1 % cellulosic fiber and about 0 . 5 % glass fiber being especially preferred . other optional additives include methyl cellulose or other suitable thickeners or air stabilizers known to those skilled in the art , in an amount from about 0 . 1 to about 5 %, chemical air entrainers in an amount of from about 0 . 1 to about 3 %; polyvinyl acetate in an amount of from 0 to about 5 %; clay in an amount of from about 1 % to about 5 %; gas generants such as calcium carbonate in an amount of about 0 % to about 5 %; and a biocide to inhibit bacterial formation . where possible , the optional components are added in the dry state to the hydraulic binder in order to form a slurry precursor or admixture for convenience . since the compositions of the present invention are typically transported to the application site as dry mixtures and are formed into slurries upon the addition of the appropriate amount of water , the preparation and application process may span many hours or even days , and thus the setting time of the mix is generally heavily retarded to provide an acceptable field “ pot life ”. this retarding contradicts the desired quick setting time upon application to the ultimate substrate , and thus a delicate balance of retarding and accelerating is difficult to achieve . were the mixture to set prematurely , it would be rendered non - pumpable and useless for the intended application . accordingly , a retarder is preferably used to delay the set time of the composition to avoid premature set . suitable retarders are conventional in the art , and include maleic anhydride , used in an amount of 0 . 1 % to 0 . 75 % inclusive by mass of the hydraulic binder , sodium polyacrylate and polyacrylic blend . the preferred retarder is the standard proteineous retarder used in the industry , such as that commercially available under the name goldbond high strength retarder . the retarder is preferably added to the hydraulic binder in the dry state for convenience . accelerators can be added to the cementitious composition in order to decrease the set time upon a structure . any set accelerating agent capable of satisfactorily offsetting the retardation of the slurry within the desired time period without deleteriously effecting the same or the substrate which is the subject of the application can be used . for most commercial applications , the type and amount of accelerator is that which rapidly converts the setting time from about 4 to about 20 hours to about 5 to 15 minutes . the amount required to provide such a setting time will vary depending upon the accelerator and the type and amount of retarder and binder . generally , an amount in the range of about 0 . 1 % to 20 % by weight of dry accelerator based upon the weight of dry fireproofing is used , with 1 - 5 % being preferred . suitable accelerators are those known to accelerate the set of the hydraulic binder employed . for gypsum based hydraulic binders , suitable accelerators include aluminum sulfate , aluminum nitrate , ferric nitrate , ferric sulfate , ferric chloride , ferrous sulfate , potassium sulfate , sulfuric acid , sodium carbonate , sodium bicarbonate and acetic acid . aluminum sulfate is a preferred accelerator . it can be used as a solution . where portland cement is the hydraulic binder , conventional set accelerators can be used such as calcium choride , calcium formate , calcium nitrate , alkali aluminates , and silicates such as water glass . it has further been found that the introduction of aluminum sulfate into the foamed composition can be used to control the stability of the foam by modifying the microstructure of the formulation , particularly in compositions comprising polyvinyl alcohol as the foam stabilizing agent and calcium sulfate hemihydrate as the hydraulic binder . specifically , foams that are “ more stable ” produce finer structures , while foams that are “ less stable ” produce coarser structures . the size of the voids or pores formed thus can be critical , and can be controlled by controlling the rate of reaction of the calcium sulfate hemihydrate with water to form calcium sulfate dihydrate . aluminum sulfate can be used to accelerate this reaction , thereby controlling the stability of the resulting foam such as by producing foam having a finer microstructure . in essence , introduction of the aluminum sulfate into the foam reacts with the binder and causes it to set , thereby “ freezing ” the microstructure of the foam . preferably the introduction of aluminum sulfate is introduced near or at the nozzle used to spray the foam onto the substrate , such as by using a nozzle as disclosed in u . s . pat . no . 4 , 904 , 503 , the disclosure of which is hereby incorporated by reference . the dramatic results achieved in the microstructure of the foam upon the addition of aluminum sulfate can be seen with reference to fig1 - 2 . fig1 and 2 are foams prepared under identical conditions except that the foam in fig1 was injected with alum at the spray nozzle , whereas the foam of fig2 received no alum injection . the resulting foam of fig1 shows a finer microstructure than that of fig2 . the introduction of set accelerator , such as alum , in a mixture that includes a foam stabilizer , such as polyvinyl alcohol and an air - entraining agent such as alpha olefin sulfonate , also causes the foam to “ gel ”. the consistency of the foam changes from a “ shaving cream ” consistency to a “ sticky ” mass upon the introduction of set accelerator and its distribution into the foam . gel formation enhances the ability of the product to remain or “ hang ” on a substrate , particularly a steel beam or the like , before and during the setting time . the addition of a basic substance such as calcium carbonate enhances the gelling . the set accelerator thus serves to both form the gel , and then to accelerate the setting of the hydraulic binder . with reference to fig3 to form the cementitious slurry in accordance with one embodiment of the present invention , the hydraulic binder , set retarder , foam stabilizing agent and water are mixed in a hopper 112 , together with optional components such as the fibrous material . a lightweight aggregate is not needed in view of the inherent lightweight provided by the foaming . the order of addition of the various components is not critical . preferably the mixing is carried out at or near the site of application , both to avoid premature setup of the composition and to limit the distance the slurry has to be conveyed once formed . dry material , such as the hydraulic binder , retarder , and other optional components , are mixed in a hopper 112 or other suitable mixing vessel . water and foam stabilizing agent are added , together or separately , to form the cementitious slurry . in a preferred embodiment of the present invention , where powdered polyvinyl alcohol is the foam stabilizing agent , the powdered polyvinyl alcohol is mixed with the hydraulic binder , retarder and optional components in the dry state . water is then added to the dry mixture to form a pumpable cementitious slurry . the slurry thus formed is conveyed , preferably by pumping with pump auger 110 , to a hose or tubing 100 as discussed above . conveyance of the slurry should be at commercially feasible rates , generally about 1800 board feet / hour . variable speed rotor stator pumps such as the putzmeister s - 5 are suitable for this purpose . the most preferred dry mix formulation in accordance with the present invention that , upon addition of water , forms a slurry , comprises 90 - 95 % stucco , 1 - 3 % powdered pva ( mowiol 18 - 88 g - 2 powder ), 1 % cellulosic fibers , 0 . 5 % glass fibers , 0 - 2 % calcium carbonate , 0 . 25 % alpha - olefin sulfonate , 0 . 1 - 0 . 3 % retarder , and 0 - 2 % portland cement . this formulation , particularly with the inclusion of calcium carbonate , upon the addition of water the mechanical formation of foam , and the set acceleration by alum addition at or near the spray nozzle , results in a low density product ( dry density 9 . 3 pcf ) exhibiting improved hangability ( 1 - 1 . 5 inches thick on a steel substrate ) at a low cost . a small amount of basic substance such as portland cement can be added to minimize or prevent any significant carbon dioxide generation caused by the alum reacting with carbonate . the portland cement raises the ph of the mix and inhibits the reaction of the acidic accelerator with base . the above preferences may vary depending upon the desired final density of the product . gas , preferably air , is introduced , preferably by injection , into the hose with a pipe or tube 21 in communication with a compressor 22 . sufficient gas is introduced to foam the slurry and to convey the resulting foam towards the nozzle 10 . those skilled in the art will appreciate that this introduction of air to mechanically foam the slurry and convey the resulting foam is different from the conventional use of chemical air - entraining agents to entrain air in an open system to improve pumpability . although the introduction of gas at a single location is preferred , gas can be introduced at several locations along the hose , if desired . in order to further reduce or eliminate pulsing that can occur as the foam is sprayed from the hose , the pressure in the hose can be controlled a number of different ways . controlling the pressure in the hose provides a dampening effect to the spraying operation . pressure also can be used to control the rate of spray out of the nozzle 10 . in addition , the final density of the product can be controlled using pressure . in its simplest form , a pressure relief valve or the like can be incorporated in the hose in order to vent gas ( air ) from the hose to control the pressure in the hose . in another more preferred embodiment , an air - separating and foam flow control enclosure 12 defining an expansive volume ( relative to the hose ) can be placed in line , whereby the foam in the hose is fed into the inlet of the enclosure and is forced out an outlet in the enclosure to a further length of hose leading to the nozzle . the enclosure can have a controlled vent in order to regulate the pressure therein . the mass flow rate into the enclosure is controlled by the pump pumping the slurry into the hose , and the mass flow rate out of the enclosure is controlled by the pressure in the enclosure . the velocity of the gas used to convey the foam in the hose is high , which makes it difficult to effectively spray the foam . the enclosure 12 allows the gas that is conveying the foam to separate from the foam , and allows control of the flow rate of the foam independent of that velocity . turning now to fig4 there is shown such an enclosure 12 having an inlet 14 communicating with the hose conveying the foam and an outlet 16 spaced from the inlet 12 . the foam being conveyed by compressed air in the hose enters the enclosure 12 at the inlet 14 . as the foam / air mixture enters the enclosure 12 , the excess ( i . e ., conveying ) air separates from the foam and the foam falls to the bottom of the enclosure 12 where it is forced out the outlet 16 by the pressure in the enclosure 12 into a further length of hose 18 and finally out nozzle 10 . an air vent 20 in communication with a valve 22 such as a gate valve allows the pressure in the enclosure 12 to be controlled to a desirable level . the pressure can be controlled manually or automatically . a pressure gauge 19 displays the enclosure 12 pressure . suitable pressures in the enclosure 12 can be is controlled to between about 10 and about 65 psi , depending upon the flow rate desired and the exiting hose diameter and length . a pressure of about 40 psi . has been found to be particularly suitable in one application . this has been found to be sufficient pressure to cause the foam to be forced out of the outlet 16 and travel through the hose 18 and be sprayed out of nozzle 10 at an acceptable rate . an added advantage is that because the foam is under pressure , additional air entrainment occurs since more air is forced into the foam . the result is an even lower density product compared to identical formulations sprayed absent the enclosure 12 . preferably the length of hose from the outlet 16 of the enclosure 12 to the nozzle 10 is from about 15 to 30 feet . the diameter of the hose 18 should be as small as possible in order to provide hose flexibility for ease of application . however , as the diameter decreases , more pressure is needed to convey the foam through the hose , and as the pressure increases , the spray tends to exit the nozzle faster , which may be undesirable . diameters of from 1 to 1 . 5 inches have been found to be suitable , with a hose length of about 25 feet being especially preferred in order to ensure that the enclosure 12 does not interfere with the applicator . for example , where the applicator is operating in a high - rise building , preferably the enclosure 12 is located on the same floor as the applicator , whereas the mixing and pumping equipment for mixing and pumping the slurry is generally located on the ground floor of the building . in the present system , the amount of air that is contained in the product is substantially greater than conventional pump and spray fireproofing compositions . in general , the amount of air contained in the product of the present invention is at least about twice the amount contained in conventional pump and spray fireproofing products , and is preferably at least about 4 times that amount . in all cases , all of the materials listed in table 1 except for water were dry blended for 3 minutes to have a uniform mixture . this mixture was then added to a standard paddle mixer and the water was added . this combination was mixed for 2 minutes . the slurry produced was poured into the pump hopper of a rotor / stator type pump ( putzmeister s - 5 ). the slurry was then pumped to another location , where air was injected into the slurry that was in the hose . this air injection turned the slurry into a foam in the 30 ′ of ¾ ″ foaming hose . in formulas 1 and 2 in table 1 , the foam entered an air - separating and foam flow control enclosure that was pressurized to 37 psi . the foam then was forced out of the enclosure and passed through 25 ′ of 1 ″ hose and a standard spray nozzle . alum was injected into the foam as the foam was passing through the spray nozzle . in formulas 3 , 4 , 5 and 6 , the air - separating and foam flow control enclosure was not used . a standard spray nozzle was attached directly to the end of the 30 ′ of ¾ ″ hose in which the foaming was taking place ( see the end of the paragraph above ). as in cases 1 and 2 , alum was injected into the foam as the foam was passing through the spray nozzle . table 1 shows the final density of the products . formula 6 is a high density product containing portland cement as the primary hydraulic binder . in an example of a pumped and sprayed foam of the invention , suitable for use in “ shotcrete ” applications ( sealing the walls of tunnels and mines ), the stucco and retarder used in formula 6 of table 1 is replaced by additional portland cement . the cellulose and glass fiber used in formula 6 is replaced by conventional steel fiber used in shotcrete applications , and the resulting formula is processed as in the foregoing examples 1 - 6 , except that sodium aluminate is used as the set accelerator in place of alum .	1
in fig1 a christmas tree 10 is suggested on which are hung a number of string lights 12 , 14 , 16 , . . . , each composed of a substantial number of ornaments 20 . as suggested above , while ordinarily the failure of one bulb will not effect the other lights in a string , occasionally the failure of one will cause the entire string to go dark . the single string , 22 suggested in fig2 includes a plug 21 at one end for connecting the string to a power source . the plug is merely representative of a number of different electrical connectors that may be used . it is not uncommon to have fifty or more lights in a single string , and in large displays a single string may have a very large number , even exceeding 100 or more lights . it is not difficult to appreciate that when all the lights in a string go dark , it is a difficult and time consuming task to locate the failed bulb that caused it , and this task is made more difficult because of the need to trace the string and test the bulbs in sequence . while various sophisticated circuits have been developed that will indicate where failure has occurred and so as to avoid the necessity for tracing along an entire string , they are expensive and not fully reliable . in accordance with the present invention , sequential indicia is associated with each of the lights in a string . thus , as fig2 suggests ‘ n ’ lights in the string , they are consecutively numbered 1 -“ n ”. in accordance with one aspect of the invention , the indicia may be applied to the sockets as suggested in fig2 and 3 , but it should be appreciated that the indicia may alternatively be applied to the wiring adjacent each socket by an inconspicuous tag or label 30 wrapped on the wiring as in fig4 or alternatively the wiring itself between adjacent sockets may be sequentially marked so as to assist a person in tracing the string from one end to the other if necessary to locate the failed bulb or other ornament . while in fig2 the indicia is in the form of consecutive numbers applied to the series of lights in sequence , the numbers may be replaced by sequential letters of the alphabet or any other sequential indicia that a person will readily recognize so as to assist him or her to follow the ornaments in series in the string . while in the foregoing description , the invention has been described as applied to a series of christmas tree lights in a string , the lights may be replaced by any other electrically powered ornament or device . while in the foregoing description the lights carry sequential indicia throughout the string , for convenience in manufacturing and to reduce costs , particularly in long strings , an indicia sequence may be repeated . for example in a string of 50 lights , a sequence of 1 through 10 may be repeated five times , or a different sequence may be repeated a sufficient number of times to cover the entire string . in many applications , that arrangement will be adequate to enable a person to trace the string so as to locate the failed light or other ornament . having described this invention in detail , those skilled in the art will appreciate that numerous modifications may be made of this invention without departing from its spirit . therefore , it is not intended that the breadth of the invention be limited to the specific embodiment illustrated and described . rather , the breadth of the invention should be determined by the appended claims and their equivalents .	8
referring now to fig1 there is illustrated a foil journal bearing 10 having a shaft 12 rotatably disposed with respect to a bushing 14 . disposed between the shaft 12 and bushing 14 are a plurality of individual foil / stiffener elements 16 . arrows on the end of the shaft 12 and the exterior of the bushing 14 indicate a direction of relative rotation between the shaft and the bushing . it is not necessary however that both the shaft and the bushing rotate ; one of the shaft or the bushing may be stationary . it is only necessary that the relative rotation between the shaft and the bushing be in the direction so indicated . as is more clearly illustrated in fig2 the individual foil / stiffener elements 16 are mounted in slots 18 in the bushing 14 . extending from the mounting end 20 , the elements 16 comprise a stiffener or stiffening portion 22 and a foil or foil portion 24 , with the foil 24 overlapping the stiffener 22 of the next adjacent element 16 as illustrated in fig2 . the stiffener 22 , shown as undulating , may in fact be wavy or having alternating ridges and grooves . it is only important that it provide a spring - like pre - load underneath the foil 24 which overlays it . while the mounting end 20 of the element 16 is shown in fig2 as generally l - shaped , the stiffener 22 may be attached to a bar 26 which can be inserted into the slot 18 as shown in fig3 . while the integral end - mounted compliant foil / stiffener illustrated in fig2 and 3 is by far the simplest of such an integration , there are many variations which are possible , some of which are illustrated in the following figures . fig4 and 5 , for example , show an underfoil 30 which overlays the stiffener 22 at the mounting end 20 of the element 16 which also includes foil 24 extending from the stiffener 22 . the foil 24 of the element 16 overlays the underfoil 30 of the next adjacent element 16 as illustrated in fig4 . the underfoil 30 is shown as integral with the stiffener 22 at the mounting end 20 of the element 16 . in this manner the element can be formed in a single piece construction . as with respect to the embodiment of fig2 and 3 and also with respect to certain of the embodiments which follow , alternate mounting means , such as the bar 26 of fig3 can be utilized . in the embodiment of fig6 both the foil 24 and the stiffener 22 extend in the same direction from the end mounting 20 , with the stiffener 22 disposed underneath the foil 24 . the free end of the foil 24 would overlap the mounting end of the next adjacent element 16 . the stiffener 22 , as shown in fig7 may include cut out portions 32 to effectively change the spring rate thereof . fig8 , and 10 illustrate three alternate stiffening portion arrangements , each with differing spring rates . a further alternative integral end - mounted foil / stiffener embodiment is illustrated in fig1 . in this arrangement , as in those shown in fig6 - 10 , both the foil 24 and the stiffener 22 extend in the same direction from the end mounting 20 . the free end of the stiffener 22 is , however , folded back underneath itself toward the end mounting 20 to form a compliant underfoil 34 . by providing an integral foil / stiffener , whether extending in series from the end mounting or where both extend in overlapping fashion in the same direction from the end mounting , a simplied construction , having ease of manufacture , is set forth . while a number of specific embodiments of this invention have been illustrated and described , it is to be understood that these are provided by way of example only and that the invention is not to be construed as being limited thereto but only by the proper scope of the following claims .	5
the electrographic stylus recording apparatus embodying the invention presented herein is one which carries out a printing or recording process which is commonly referred to as electrographic magnetic stylus recording . this process has been described in several articles , such as the one by l . w . carlson , &# 34 ; electrographic magnetic stylus recording ; a high speed non - impact magnetic printing process ,&# 34 ; ieee transactions of magnetics , vol . may - 17 , no . 6 , november 1981 . several references are listed in the article which are pertinent to the recording process . such process is utilized in the apparatus disclosed in u . s . pat . no . 4 , 460 , 907 , supra . as in the apparatus of the such patent , the apparatus embodying the present invention is used to produce nonpermanent or unfixed toner images and provides for return of toner powder that is collected for reuse in the recording process . magnetically attractable , electronically conductive toner powder is used . referring to fig1 of the drawing , the apparatus embodying the invention presented herein is diagrammatically shown and includes a receptor recording belt 10 which is flexible and includes a backing layer of a material such as polyester on which a thin dielectric layer is carried with a thin conductive layer intermediate the dielectric layer and the polyester . it should be noted that due to the size of the apparatus , a portion of the belt 10 has been removed in the drawing so that other portions of the apparatus can be presented to clearly show various details . the conductive layer can be indium tin oxide , for example . the conductive layer of the belt 10 is represented by the center line of the side view of belt 10 in fig1 and is connected to ground . one way for making such connection involves having the width of the dielectric layer less than the width of the conductive layer allowing the conductive layer to be contacted by a conductive brush that is connected to ground . since a wear problem is presented , it is desirable to have the edge of the conductive layer to be contacted covered with a durable conductive coating . for example , graphite applied using a mixture of graphite and alcohol will provide such a coating . one or more driven rolls , represented at 11 - 13 , move and direct the receptor belt in a counterclockwise direction as viewed in fig1 and indicated by the arrow 14 . the dielectric layer of the belt 10 is presented at the outer surface of the belt . the drive means for the driven roll ( s ) includes an electric motor ( not shown ). the inner surface of the receptor recording belt makes contact with the rolls 11 - 13 . a stylus electrode array 16 is positioned on the dielectric layer side of the receptor recording belt 10 opposite the roller 13 . the stylus electrode array extends generally perpendicular to the receptor recording belt 10 and transverse to the direction of movement of the receptor recording belt . the stylus electrode array 16 includes a number of parallel conductive styli that are closely spaced and insulated from one another . conductors indicated at 17 , one for each stylus , are used for selectively applying recording electrical signals to the styli from a source ( not shown ). the stylus electrodes are preferably comprised of magnetic permeable material . the array 16 is positioned so one end of each stylus electrode is a relatively short distance from the receptor recording belt 10 establishing a recording region or gap at each stylus to which toner powder is delivered . the recording gap preferably should be large enough so a plurality of toner particles , forming at least one elongate toner chain - like aggregate , can be accommodated in the gap at each stylus electrode thereby insuring a suitable electronically conductive path between the tip of each stylus electrode and the receptor recording belt to cause toner particles to be held by an electrical charge to the receptor recording belt 10 opposite a given stylus electrode whenever an electrical signal is applied to such stylus electrode . a toner powder applicator in the form of a first rotatable , electrically conductive , cylindrical sleeve 19 is positioned on the upstream side of the stylus array 16 within a short distance of the stylus array 16 and the receptor recording belt 10 . the sleeve 19 has a connection 20 to which a d . c . voltage , depicted by the battery 21 , can be supplied via a switch means , as indicated by the switch 22 . the sleeve 19 is disposed with its axis extending transversely to the styli of the stylus array . the toner powder applicator also includes a non - rotatable magnetic field producing means positioned within the sleeve 19 that provides a plurality of alternate magnetic poles around the inner surface of the sleeve 19 . the magnetic field producing means can be formed by a number of magnet sectors 23 . in the embodiment shown in fig1 six magnet sectors 23 are used . the magnetic field producing means is positioned so a magnet sector presenting a north ( south ) magnetic pole is positioned directly opposite the stylus array 16 for use in providing magnetic flux at the recording ends of the styli . with the magnetic field producing means so positioned , the south ( north ) magnetic pole , adjacent to the north ( south ) magnetic pole opposite the stylus array , is positioned directly opposite the receptor recording belt 10 . the toner applicator also includes a doctor blade member 24 for controlling the depth of toner powder to be presented on the sleeve 19 . a &# 34 ; c &# 34 ;- shaped doctor blade member 24 is shown , the &# 34 ; c &# 34 ;- shape serves to provide sufficient capacity for holding the amount of toner powder that is needed for an apparatus of the type disclosed wherein the toner powder is reused . when the apparatus is operated to produce a toner powder image the sleeve 19 is rotated and is connected by the switch 22 to the d . c . voltage 21 . while the sleeve 19 can be rotated in either direction , counterclockwise movement , as indicated by the arrow 25 , is preferred . this causes toner powder to be presented to the gap between the sleeve 19 and the receptor recording belt 10 . the toner powder bridges the gap between the sleeve 19 and the receptor recording belt 10 due to the magnetic flux present at the gap and due to the applied d . c . voltage toner powder is held to the belt by an electrical force allowing toner powder to be moved in a controlled manner to the recording gap at the stylus array . the toner powder applicator also functions to remove excess toner powder from the recording gap due to the magnetic field presented by the magnetic field producing means within the sleeve 19 and rotation of the sleeve 19 thus providing further control over the amount of toner powder in the recording gap . during an image recording operation the toner powder presented to the recording gap will bridge the gap due to the magnetic flux present at the end of each styli . those styli receiving an electrical signal will cause toner powder opposite each such stylus to be held to the receptor recording belt 10 and thus cause a toner image to be formed which is carried downstream from the recording gap by movement of the belt 10 . accordingly all the toner powder is not used to form an image so such excess toner powder and other toner powder held loosely on the belt 10 as the belt moves downstream must be removed to have a clear toner powder image present for viewing as the belt 10 moves downstream of the roller 12 . a second rotatable , electrically conductive , cylindrical sleeve 26 is positioned on the downstream side of the stylus array 16 within a short distance of the stylus array 16 and the receptor recording belt 10 . like sleeve 19 , sleeve 26 has a connection 27 to which a d . c . voltage , depicted by battery 28 , can be supplied via switch means , as indicated by the switch 34 . the sleeve 26 is disposed with its axis extending transversely to the styli of the stylus array . like sleeve 19 , the sleeve 26 has a non - rotatable magnetic field producing means positioned within sleeve 26 that provides a plurality of alternate magnetic poles around the inner surface of the sleeve 26 . this magnetic field producing means can be formed by a number of magnet sectors 29 . in the embodiment shown in fig1 six magnet sectors 29 are used . the magnetic field producing means for sleeve 26 is positioned so a magnet sector presenting a north ( south ) magnetic pole is positioned directly opposite the stylus array 16 to provide like magnetic poles on opposite side of the stylus array . this magnetic pole adds to the magnetic flux provided at the recording ends of the styli by the north ( south ) magnetic pole positioned on the upstream side of the stylus array 16 . with the magnetic field producing means in sleeve 26 so positioned , the south ( north ) magnetic pole , adjacent to the north ( south ) magnetic pole positioned opposite the stylus array , is positioned directly opposite the stylus receptor recording belt 10 . the sleeve 26 can be arranged to rotate either clockwise or counterclockwise . counterclockwise rotation is preferred as indicated by the arrow 30 . when the apparatus is operated to produce toner powder images the sleeve 26 is not connected to a d . c . voltage , but is preferably connected to ground via the switch 34 . during such operation excess toner powder at the recording region and toner powder loosely held on the belt 10 in the area a short distance downstream from the recording gap is attracted to the sleeve 26 by its magnetic flux producing means and is carried counterclockwise by rotation of the sleeve 26 . as in the case of the sleeve 19 , the sleeve 26 has a doctor blade member 31 which serves to control the thickness of the toner powder carried on the outer surface of sleeve 26 . unlike the doctor blade member 24 , the doctor blade member 31 is arranged to provide two different gaps at the sleeve 26 . a small gap is provided when the apparatus is operated to produce a toner powder image . the small gap keeps the thickness of the toner powder on the sleeve 26 at a level such that it does not touch the surface of the belt 10 . the doctor blade member 31 is shown presenting the small gap in fig1 . a larger gap is provided by the doctor blade member 31 at the sleeve 26 when the apparatus is operated to return toner powder collected at the sleeve 26 to the upstream side of the stylus array 16 , as will be explained . the doctor blade member 31 is shown as a &# 34 ; c &# 34 ;- shaped member to provide sufficient capacity for holding toner powder collected at the sleeve 26 . the doctor blade member 31 can be pivotally mounted and linked to a rotary or linear solenoid , as indicated by the solenoid 32 , to position the doctor blade member 31 for the desired doctor gap setting . when six magnet sectors are used within the sleeve 19 and sleeve 26 , the positioning of the magnet sectors as described relative to the stylus array 16 and belt 10 can be optimized by placing the centers of rotation for the roller 13 and the sleeves 19 and 26 at the corners of an equilateral triangle . the sleeves 19 and 26 are then of the same diameter . the arrangement provided by the apparatus shown in fig1 provides a way for returning toner powder from the sleeve 26 to the upstream side of the stylus array 16 without the use of any parts in addition to those already described . it should be noted also that the return of toner powder for reuse , as will be described , does not require any lateral movement of the toner powder so abrasion of the toner is minimized . when the apparatus of fig1 is to be operated to return toner powder from the area of the sleeve 26 to the upstream side of stylus 16 , the belt 10 can be driven either clockwise or counterclockwise , the doctor blade member 31 is positioned to provide the larger doctor gap that has been mentioned and the sleeve 26 is connected to a source of d . c . voltage . twenty volts have been found to be sufficient . no voltage is connected to the sleeve 19 at this time and it is preferably connected to ground via the switch 22 . with the large doctor gap provided at the sleeve 26 sufficient toner is supplied between the sleeve 26 and the surface of the belt 10 which , under the influence of the magnetic flux presented by the south magnetic pole positioned opposite the belt 10 , causes the toner powder to stand up , forming toner trees to bridge the space between the sleeve 26 and the belt 10 . with the d . c . voltage applied to the sleeve 26 , the toner powder is caused to be held on the belt 10 as it moves carrying the toner powder away from the sleeve 26 to the upstream side of the stylus 16 . the toner powder is then either removed from the belt 10 when it reaches the sleeve 19 where it is magnetically attracted to the sleeve or is redeposited on the belt 10 for the next image should it reach the sleeve 19 when a d . c . voltage is applied to sleeve 19 for operation of the apparatus to create a toner image . in this later case , removal of the toner powder brought on the belt 10 to the sleeve 19 and disposition of a layer of toner powder on the belt 10 at the sleeve 19 occurs simultaneously . in such case , the function of transporting toner collected on the downstream side of the stylus array 16 to the upstream side of the stylus array for reuse is accomplished even if the recirculated toner is not removed from the belt 10 . the use in an electrographic stylus recording apparatus of a doctor blade means for providing two different gaps at a magnet roll structure of the apparatus on the downstream side of the stylus array that is used to gather both the excess toner powder and background or non - imaging toner powder with the sleeve of the magnet roll connectable to a source of d . c . voltage for the purpose of returning such collected toner powder to the upstream side of the stylus array is not limited to the electrographic stylus recording apparatus shown in fig1 . such an arrangement can also be applied to an electrographic stylus recording apparatus of the type disclosed in u . s . pat . no . 4 , 460 , 907 , supra , to provide a simplified toner return arrangement for toner collected on the downstream side of the recording region . fig2 is a partial diagrammatic showing of such apparatus with the toner recirculation arrangement described above applied to the apparatus . referring to fig2 an electrographic stylus recording apparatus is shown wherein a rotatable , cylindrical sleeve 50 is positioned on the downstream side of a stylus array 51 . a receptor recording belt 52 is adapted for movement about three rollers 53 - 55 . the belt 52 moves counterclockwise as indicated by the arrow 56 when a toner powder image is to be recorded . the stylus array 51 is positioned close to the belt 52 to provide a recording region to which toner powder is delivered to the upstream side of the stylus array 51 when a toner powder image is to be formed such as in the manner previously described in connection with the apparatus of fig1 . the toner applicator for apparatus of fig2 is indicated generally at 49 . a magnetic flux producing means , such as a single magnet 57 or multiple magnetic pole magnet structure as described in connection with fig1 is positioned within the sleeve 50 to provide the desired magnetic flux at the recording ends of the styli of the stylus array 51 . as in the case of the apparatus of fig1 toner powder will be attracted to the sleeve 50 when the apparatus is operated to produce a toner powder image at the recording region using toner powder supplied to the recording region on the belt 52 which receives toner powder from the toner applicator at 49 . downstream of the sleeve 50 is a magnet roll structure which includes a non - rotatable cylindrical sleeve 58 within which a multiple magnetic pole structure 59 is positioned which is adapted for rotation clockwise as indicated by the arrow 65 . this magnet roll structure is positioned to attract toner powder from the sleeve 50 as well as background toner powder , i . e . toner powder that is held loosely to the belt 52 . in the case of the corresponding magnet roll structure in u . s . pat . no . 4 , 460 , 907 , supra , a dam structure mounted on the outside of the sleeve 58 directs toner powder to at least one end of the sleeve 58 where it falls via gravity along a chute to the toner powder hopper for the toner applicator 49 which is upstream from the stylus array 51 . the invention presented herein eliminates the need for the dam and chute in that a doctor blade member 60 is positioned which is arranged to provide a first gap at the sleeve 58 when the apparatus is operated to produce toner powder images so that background toner powder removed from the belt 52 will not build up on the sleeve 58 to disrupt the toner powder image . the doctor blade member 60 is also arranged to provide a larger gap at the sleeve 58 when the apparatus is operated to return toner powder to the upstream side of the stylus array . such operation , as has been described in connection with fig1 requires that a connection 61 be provided at the sleeve 58 to allow the necessary d . c . voltage to be applied to the sleeve 58 . the d . c . voltage is depicted by the battery 62 and is applied to the connection 61 via the switch means which is shown by the switch 63 . accordingly , when toner powder is to be moved from the sleeve 58 to the belt 52 and thence to the upstream side of the stylus array , the belt 52 is placed in motion , clockwise or counterclockwise with the large gap provided by the doctor blade member 60 and with the switch 63 operated to provide the d . c . voltage to the sleeve 58 . the large gap allows toner powder at the gap between the belt 52 and the sleeve 58 to form toner trees which bridge the gap and with the d . c . voltage applied to the sleeve 58 causes toner powder to be held on the belt 52 for return to the upstream side of the stylus array for reuse during operation of the apparatus for producing a toner image . the apparatus of fig2 has been described as disclosed in u . s . pat . no . 4 , 460 , 907 , supra , wherein the sleeve 58 does not rotate with the multiple magnetic pole structure 59 arranged for rotation . the preferred arrangement is one where the sleeve 58 is adapted for rotation counterclockwise with the multiple magnetic pole structure 59 stationary with a magnetic pole positioned directly opposite the belt 52 and another of the magnetic poles positioned directly opposite the sleeve 50 . this makes for more efficient transfer of toner powder from the sleeve 50 to sleeve 58 and also implements the formation of toner trees for bridging the gap between the belt 52 and the sleeve 58 when the apparatus is operated for return of toner powder to the upstream side of the stylus array 51 . when the apparatus is not operated for returning toner powder , the switch 63 is operated so the sleeve 58 is connected to ground . the doctor blade member 60 shown depicts a form that can be used to provide the two desired gap settings . it is shown in position for providing the smaller gap . upon rotation in a clockwise direction for a short distance the larger gap is provided . as in the case of the arrangement shown in fig1 a rotary or linear solenoid can be used to provide the two gap settings . solenoid 64 is shown in fig2 to operatively connect to the doctor blade member 60 for such purpose . the doctor blade member 60 is arranged for rotation about the point 66 . the &# 34 ; c &# 34 ;- shaped doctor blade member 31 used in the apparatus of fig1 could also be used as the doctor blade member 60 in fig2 . the use of the doctor blade member 31 in the apparatus of fig1 serves to provide sufficient toner powder on sleeve 26 so that toner powder presented to the belt 10 will be deposited when a d . c . voltage is applied to the sleeve 26 to enable use of the receptor recording belt for returning toner powder to the upstream side of the stylus array 16 . the doctor blade member 60 provides the same function in the apparatus of fig2 . it can then be appreciated that sufficient toner powder can also be provided on the sleeve 26 by moving the sleeves 26 closer to the belt 10 or by movement of the sleeve 26 toward the belt in conjunction with an increase in the gap provided by the doctor blade member 31 when it is desired that the apparatus be operated so that the toner powder at sleeve 26 be deposited on the belt 10 . while there has been described what is at present considered to be the preferred embodiments of the invention , it will be understood that various modifications , as noted above , may be made therein and it is intended to cover in the appended claims all such modifications as fall within the true spirit and scope of the invention .	6
in accordance with fig1 , a shaft ( not shown ) of a pair of conical disks of a belt - driven conical pulley transmission is surrounded by an inner bearing ring 2 . between the bearing ring and an outer bearing ring 4 , which is arranged concentrically relative thereto , are arranged roller elements 6 , so that components 2 , 4 , and 6 collectively form a roller bearing . it is understood that the outer surface of the inner bearing ring 2 , on which the roller elements 6 roll , can be formed directly by a correspondingly machined outer surface of the shaft ( not shown ). the outer bearing ring 4 is received in an annular recess of a base 8 , for example the housing of the transmission , which is closed on the right by a removable cover 10 , as shown in fig1 . the outer surface of the outer bearing ring 4 is not supported directly on the axially - extending wall of the annular recess , but rather by interposing different annular components and by a housing ring 12 optionally fit into the annular recess . more precisely , four ring - shaped radial ondular washers 18 a , between which are arranged stop rings 20 to secure the axial spacing , are arranged between the outer surface 14 of the outer bearing ring 4 and the inner surface 16 of the housing ring 12 in the example that is shown . spacing rings 22 are provided axially outside on both sides . the stiffness of the radial ondular washers is such that the desired stiffness of the bearing arrangement with respect to radial displacements of the shaft ( not shown ) is achieved via the four radial ondular washer rings or radial ondular washers . while the radial ondular washers 18 a are shaped in such a way that they are constantly in contact with outer surface 14 and with inner surface 16 , as shown in fig2 , which is a detail view of fig1 as viewed in the direction a - a , the stop rings 20 are dimensioned in such a way that a radial clearance d exists between them and the housing ring 12 . in that way , the outer bearing ring 4 in accordance with fig2 can be moved upward over a distance d by elastic deformation of the radial ondular washers 18 a until the stop rings 20 come into contact with the housing ring inner surface 16 . the housing ring 12 , which is manufactured of steel , for example , is optional and serves , for example , for preventing wear of the recess or the bore of the housing 8 , which can be made of a light metal . in the following exemplary embodiments , which will be described with reference to views similar to those shown in fig1 and 2 , only those components that are essential for the description are provided with respective reference numerals . while in the case of the exemplary embodiment in accordance with fig1 and 2 the radial ondular washers 18 a have an essentially constant cross section along the periphery and are provided with undulations only in the circumferential direction , the radial ondular washers 18 b in accordance with fig3 and 4 are provided with humps , but only spacing rings 22 are provided between the radial ondular washers 18 b and axially on the outside . as can be seen in fig4 , the radial ondular washers 18 b are provided with circumferentially - spaced supporting humps 24 on the inside and on the outside , which are formed in such a way that they are in constant contact with the outer surface 14 or the inner surface 16 . between the supporting humps 24 are stop humps 26 , so that between the humps 26 and the respective surfaces in the unloaded state of the bearing arrangement there is a clearance e toward the outside , and a clearance f toward the inside . as shown , the stop humps 26 are preferably located on the side of the radial ondular washers 18 b opposite to the supporting humps 24 . the stop humps 26 act as stops at a certain degree of deformation of the radial ondular washers 18 b so that , under high load , the supporting humps and also the stop humps form contact points for supporting the outer bearing ring 4 on the housing 8 , whereby a uniform support of the roller bearing is achieved . fig5 and 6 show an embodiment of the bearing arrangement or the decoupling of the outer bearing ring 4 from the housing 8 corresponding largely with the one shown in fig3 and 4 , by means of which the transmission of noise from the roller bearing into the housing is reduced . in the embodiment in accordance with fig5 and 6 , the stop humps 26 are formed with different heights . let it be assumed that the bearing is loaded or radially displaced vertically upward in the direction of the arrow s . if clearances e and f along the periphery are identical , the clearance f is used up completely at the contact point indicated by arrow s , whereas a residual clearance remains between the neighboring stop humps and the respective surfaces , since the approach between those locations corresponding with the peripheral angle φ is less . to ensure that the stops become effective at the same time , the radial clearances at the individual humps are adapted in accordance with the respective angular position . that leads to a more uniform distribution of the load on the bearing . the following equation applies to the individual clearances : x ( φ )= x max · cos ( φ ), wherein x max is the individual clearance at contact point s . it is advantageous in many regards to fix the radial ondular washers or spring rings in the peripheral direction . the positioning of the radial ondular washers in the peripheral direction can be accomplished in different ways . in accordance with fig7 and 8 , a pin 28 , which engages a recess 30 on the housing ring 12 , additionally engages with an axial slot 32 , with which the radial ondular washers 18 are formed . as can be seen immediately , the pin 28 is thus held immovably in the peripheral direction between the outer bearing ring 4 and the housing ring 12 , so that it fixes the radial ondular washer 18 in the peripheral direction . it is advantageous if the undulations or humps of neighboring radial ondular washers are offset relative to each other in the peripheral direction in order to achieve a loading of the bearing that is as uniform as possible . in order to realize a mutual displacement of the radial ondular washers that are fixed in the peripheral direction different radial ondular washers with a different relative arrangement of the slot and humps or undulations would have to be produced . in order to reduce the multitude of variants , it is advantageous to place the slot 32 in such a way between the humps that the desired positioning is achieved with an installation of the radial ondular washers that is alternatively reversed ; that is , with an installation of the radial ondular washers rotated by 180 °. it is advantageous to apply the slot 32 centrally between a radially outer supporting hump 24 and a radially inner supporting hump 24 as shown in fig9 and 10 , wherein fig1 shows an enlarged portion of fig9 . as can be seen immediately in fig1 , a radially outwardly directed supporting hump 24 is located to the left of the pin 28 , and a radially inwardly directed supporting hump 24 is located to the right of the pin 28 . in addition , a stop hump 26 is located to the left of the pin opposite the inner supporting hump 24 and directed radially inward , and a stop hump 26 is located to the right of the pin 28 , which is located opposite the supporting hump 24 and is directed radially outward . in the case of an installation of the radial ondular washer 18 that is rotated by 180 °, a supporting hump is adjacent to a respective stop hump . it is understood that there are numerous further possibilities of arranging the humps or undulations and the slots , with which a force distribution that is as uniform as possible is obtained with a small variety of components with regard to the radial ondular washer . because of the slight differences in the heights of the humps , it is difficult to determine the correct installation ; that is , the respective installation rotated by 180 ° in the configuration of the radial ondular washers in accordance with fig9 and 10 . that problem can be solved in that as shown in fig1 and 12 the slot 32 is formed with side walls 34 that are inclined relative to the radial direction . it can be easily seen in that way whether the axially adjacent radial ondular washers are mounted rotated by 180 °. the most widely different possibilities exist for fixing the radial ondular washers 18 circumferentially relative to the housing 8 . fig1 and 14 show a key 36 that is inserted into a groove in the housing 8 and passes through a slot in the housing ring 12 and slot 32 in the radial ondular washer 18 . fig1 shows an embodiment in which the housing ring 12 is provided with an inwardly - extending radial fin 38 that engages with the slot 32 of the radial ondular washer 18 . in the exemplary embodiment in accordance with fig1 , the radial ondular washer 18 is provided with a radially outwardly extending fin 40 , which engages with a recess in the housing ring 12 . the housing ring 12 is immovably held on the housing 8 in the circumferential direction . an additional arrangement for axially fixing the radial ondular washers is illustrated in fig1 . in that embodiment , each radial ondular washer 18 c ends in an axially - extending projection or peg 42 on one side of the slot 32 . the peg 42 of the axially outermost radial ondular washer engages with a recess 44 that is formed in a radial surface of the housing 8 . the pegs 42 of the axially adjacent radial ondular washers each engage with the slot 32 of an adjacent radial ondular washer , on the right hand side as shown in fig1 . the radial ondular washer rings can be manufactured inexpensively as stamped flexible components . additional advantageous embodiments of devices with which the bearing can be decoupled from the housing are described below with reference to fig1 through 25 . in the embodiment in accordance with fig1 and 19 , the outer surface of the outer bearing ring 4 is provided with a wide peripheral groove 46 in which radial ondular washers 18 b are arranged . radial ondular washers 18 b can be preinstalled in a similar manner , for example , like retaining rings that are installed in shaft grooves . the shoulders of the outer bearing ring 4 ( shown in enlarged illustration x ) that are axially outside of the peripheral groove 46 , can directly form a radial stop . in addition , o - rings 48 for the purpose of axial guidance of outer bearing ring 4 can be installed between the side walls of the housing 8 and of the annular cover 10 . the embodiment in accordance with fig2 and 21 differs from that of fig1 and 19 only in that several peripheral grooves 46 , in each of which a single radial ondular washer 18 b is arranged , are formed in the outer surface of the outer bearing ring 4 . in the embodiment in accordance with fig2 through 25 , the outer bearing ring 4 is provided with two peripheral grooves 46 , wherein three radial ondular washers 18 c are arranged in the left side peripheral groove in accordance with fig2 , and four radial ondular washers 18 c are arranged in the right side peripheral groove 46 . the opposite surface or inner surface 16 , which is formed in the housing 8 , has a step 50 against which the leftmost radial ondular washer is supported . the axially outermost radial ondular washer 18 c in the right side peripheral groove 46 is supported by a radially extending side surface 52 of the annular cover 10 . fig2 shows the detail x of fig2 in the form of an enlarged illustration . in terms of their radial span , the individual radial ondular washers 18 c are configured with humps in a similar manner , for example , to the embodiment in accordance with fig4 ( see fig2 ). in addition , the radial ondular washers 18 c are provided with undulations in the axial direction as can be seen in fig2 , which shows a top view of part of the axially adjacent radial ondular washers 18 c . an undocking or acoustic decoupling of the bearing from the housing is achieved in the radial and axial directions via the arrangement in accordance with fig2 through 25 . the nose 54 of the outer bearing ring 4 , which is formed between the peripheral grooves 46 , can be utilized as a stop . it is understood that the arrangement in accordance with fig2 through 25 can be modified in many ways in a similar manner as that of the other exemplary embodiments . the number of grooves , the undulations of the radial ondular washers , or their design with humps , the axial and radial guidance , and the stops can each be configured in ways that correspond to the intended purpose by modifying the number of radial ondular washers , grooves , additional axial undulations , the use of o rings , and the like . fig2 and 27 show the arrangement of radial ondular washers 18 a between the outer bearing ring 4 and an annular sleeve 54 that is fitted on the outer bearing ring 4 , which has , overall , a u - shaped cross section . the radial ondular washers 18 a are seated loosely on the outer bearing ring 4 and are held axially by positioning rings 22 that are arranged between the axially outermost radial ondular washers and the radial side walls 56 of the sleeve 54 . the sleeve can be produced inexpensively , for example , as a formed sheet metal component , and functions at the same time as an axial spring , similar to a disk spring , due to the arched configuration of the lateral walls 56 in accordance with the intended purpose . in that way , the bearing in accordance with fig2 and 27 is axially and radially uncoupled from the housing 8 . the embodiment in accordance with fig2 and 29 differs from that of fig2 and 27 in that radial ondular washers 18 b provided with humps are used instead of the radial ondular washers 18 a , and in that spacing rings 22 are arranged between each of the radial ondular washers 18 b . in the embodiment in accordance with fig3 through 33 , the outer bearing ring 4 is provided with two peripheral grooves 46 , which are enclosed by an annular sleeve ring 54 , and that open axially outward and in which radial ondular washers 18 c are arranged axially and radially . in the case of this embodiment , the sleeve 54 is doubly bent over in the region of the transition from its base to the radially innermost end of side walls 56 and serves for holding the radial ondular washers 18 c in an axially and radially preloaded manner . the sleeve itself does not have the function of an axial spring . the function of the axial spring or the axial decoupling is assumed by the radial ondular washers 18 c , which are likewise provided with axial undulations . the sleeve 54 serves merely as a stop . fig3 shows the enlarged section x of fig3 . fig3 shows a side view of a radial ondular washer 18 c , and fig3 shows a top view of a portion of the radial ondular washers 18 c , which are arranged side by side and are also provided with axial undulations . exemplary embodiments of decoupling devices in which the radial ondular washers are formed by an annular spring shell will be described below with reference to fig3 through 45 . in accordance with fig3 , an annular spring shell 18 d having an overall u - shaped cross section , surrounds the outer bearing ring 4 in the axial and radial directions . the base 60 of the spring shell 18 d has a radial undulation with an axial direction undulation arrangement , which is configured in such a way that a peripheral recess 58 is produced , which is visible from the outside . fig3 shows the portion x of fig3 in the form of an enlarged illustration . it can be seen clearly how the outer surface 14 of outer bearing ring 4 is also configured with a flat recess , so that the radial clearance d formed axially outwardly of the recess 58 is smaller between the inner surface of the spring shell 18 d and the radially outer surface 14 of the outer bearing ring 4 than the radial undulation of the spring shell 18 d . the clearance d is available for radial displacement of the outer bearing ring , and can be adjusted via the depth of the recess 58 and the height of the undulation in accordance with the intended purpose . the embodiment in accordance with fig3 and 35 is characterized relative to the previously described embodiments by its especially simple configuration with only a few parts . it should be understood that the configuration of the outer surface 14 of the outer bearing ring 4 with a circumferential recess or groove is not mandatory . with the aid of the flat recess in the outer surface 14 of the outer bearing ring 4 the height of the arch of the spring sleeve 18 d can be selected independently from the radial clearance d . as can also be seen in fig3 , the side walls 62 of the spring shell 18 d can additionally be arched outward , for example , in the region of the transition to the base 60 , so that the spring shell assumes the function of an axial spring and a radial spring . the spring shell 18 d in accordance with fig3 has a radial arch or undulation in the axial undulation direction . in contrast to this , the spring shell 18 e of the embodiment in accordance with fig3 and 37 has a radial undulation with an undulation length or pitch that extends in the circumferential direction , as can be seen in fig3 , wherein is shown a fragmentary side view in the direction of the arrows ii - ii of fig3 of a portion of spring shell 18 e broken away to show the circumferential undulations . with the embodiment in accordance with fig3 and 37 the advantage is achieved that a greater elastic flexibility is obtained with the greatest possible undulation lengths . fig3 and 39 show a combination of the embodiments of the spring shell in accordance with fig3 through 37 , wherein the spring shell of fig3 and 39 has an axially - extending radial undulation along with a radial undulation that extends in the circumferential direction . a still greater energy absorption capacity is achieved in that way because of the elastic deformations in larger regions of the material of the spring shell . fig4 and 41 show an embodiment of a spring shell 18 g , which corresponds basically to that of fig3 , but has several radial arches with an axial undulation length direction whose heights are different in magnitude . progressive characteristics can be achieved in that way . the spring shell 18 g does not have any resilient effect , but rather only a stopping effect with respect to the axial displacement of the bearing . the embodiment in accordance with fig4 and 43 shows a radial ondular washer 18 h having a radial undulation with an undulation direction in the circumferential direction , which extends over the entire width of the outer bearing ring 4 , and wherein the undulation heights are different . more flexible progressive characteristics can be achieved in that way . it should be understood that the radial ondular washer 18 h can be supplemented with side walls to form a spring shell . in addition , not only can the undulation heights be different , but the lengths of the undulations can be different as well . the embodiments in accordance with fig4 and 45 are similar to that of fig3 , wherein the outer surface of the outer bearing ring 4 is formed without a recess or groove , so that the undulation height of the spring shell 18 i is equal to the possible radial displacement of the bearing . the side walls of the spring shell 18 i shown in fig4 extend parallel to the side walls of the outer bearing ring 4 , so that the spring shell 18 i does not function as an axial spring . the spring shell 18 d of fig4 corresponds to that of fig3 , that is , the spring shell 18 d additionally functions as an axial spring . fig4 illustrates in the left side of the figure in longitudinal section and in the right side of the figure in side view a further embodiment of a radial ondular washer that is configured in the form of a spring shell . the outer bearing ring 4 is enclosed by a spring shell 18 j made from a sheet of spring steel and has an overall u - shaped cross section , and whose radial side walls 66 are supported radially on an annular step 68 , which is formed on the side face of the outer bearing ring 4 . radial flexibility is achieved by means of a curved cross - sectional shape or a radially - outwardly - extending arch in the base 70 of the spring shell 18 j . the basic stiffness can be influenced via the sheet thickness . the spring characteristic can be selected by choosing the curvature profile of the base , possibly with multiple undulations , and / or the contour of the side walls 66 , in accordance with the intended purpose . for example , the spring characteristic can be influenced so that the base 70 comes into contact with the outer surface of the outer bearing ring 4 after a specific radial deformation . moreover , the axial flexibility of the spring shell 18 k can be influenced by a corresponding form of the side walls 66 and the adjacent side surfaces of the outer bearing ring 4 . the radial side walls 66 can also contribute to the radial flexibility of the spring sleeve 18 j via an asymmetrical curvature within their plane . an increase in flexibility in the circumferential direction can be achieved via axially - extending radial slots 72 that pass through the base 70 and extend into part of the side walls 66 of the spring shell 18 j . its radial flexibility is also increased by interrupting the membrane stresses in the outer surface , or base , of the spring shell 18 j . because the radial side walls 66 extensively encompass or surround the outer bearing ring 4 , the radial demand for space is minimized on the one hand , and a relatively high axial flexibility is made possible on the other hand . a slipping off of the side walls 66 away from the outer bearing ring and along annular step 68 can be prevented , if required , by forming the step 68 with a corresponding undercut . the spring shell 18 j does not have to extend as one piece over the entire periphery of the outer bearing ring 4 . it can be in the form of two peripheral segments . in the installed state , the unity of the spring sleeve is ensured by the accommodating bore or recess in the housing 8 , wherein the installation of the spring shell is facilitated by its curved shape . a circumferentially - extending radial protrusion 74 of the spring shell 18 j , which engages with an annular groove 76 formed in the housing 8 , can serve for axially securing the bearing . the annular groove 76 , which is formed on the inner surface 16 of the housing 8 , can be provided by a grade or slope , which is laterally closed off by the annular cover 10 of the type shown in fig1 and that is attached to the housing 8 . it should be understood that in the case wherein small forces are to be absorbed , the spring shell 18 j can be radially formed in such a way in terms of flexibility , that it can be pressed from the side into the housing together with the inner bearing ring 2 and the outer bearing ring 4 and the roller elements 6 arranged between them , so that the radial protrusion 74 can extend into annular groove 76 in inner surface 16 of housing 8 . the embodiment of fig4 differs from that in fig4 primarily in that the axial securing of the spring shell 18 k occurs via the side surfaces of annular spacers 78 , by means of which the spring shell 18 k is supported on a radial side surface of the housing 8 and by the correspondingly formed annular cover 10 . the spacers 78 can be made of plastic , for example . an axial pinching of the spring shell 18 k as a consequence of a radial displacement can be prevented , if required , by means of an axial clearance , which can be very small , however . fig4 through 50 illustrate embodiments of the decoupling device that work with radial ondular washer segments that do not completely surround the outer bearing ring 4 ( fig1 ), which is not illustrated in fig4 through 50 , but only along a circumferential region of , for example , approximately 180 °, and that are arranged on the load - bearing side of the outer bearing ring . fig4 shows an end view of a radial ondular washer segment 18 l that extends over more than half of the periphery and is configured similarly with regard to its undulations as , for example , the radial ondular washer 18 b of fig4 . as shown in fig4 , several radial ondular washer segments 18 l are arranged axially side by side around the outer bearing ring of the bearing ( not shown ). a positioning element 82 , which can be in the form of a sleeve segment in such a way that together with the radial ondular washer segments 18 l the outer bearing ring is completely surrounded , serves for positioning the radial ondular washer segments 18 l in the circumferential direction . for securing it in the circumferential direction , the positioning element 82 has axial extensions 84 , which engage in recesses ( not shown ) that are formed on the housing 8 ( fig1 ). in the embodiment in accordance with fig4 the positioning element 82 is formed in such a way that all the radial ondular washer segments 18 l are arranged axially side by side without circumferential offset . in the embodiment in accordance with fig5 , the positioning element 82 a is provided with circumferential recesses and projections on its longitudinally - extending ends so that adjacent radial ondular washer segments 18 l are arranged offset from adjacent washer segments in the circumferential direction . that arrangement is advantageous to ensure that the supporting humps 24 and stop humps 26 that can be seen in fig4 ( see fig4 for more details ), are offset and arranged at gaps . one advantage that is achieved with the embodiments in accordance with fig4 through 50 is that the utilization of , for example , expensive stamping sheets for the radial ondular washers is clearly improved compared with the configuration of radial ondular washers that extend over the entire periphery ( if provided with a slot ). the patent claims that are submitted with the patent application are formulation proposals without prejudice for achieving more extensive patent protection . the applicants reserve the right to claim yet other combinations of features that were previously only disclosed in the specification and / or the drawings . the references made in the dependent claims indicate a further development of the object of the main claim by way of the features of the dependent claim in question ; they are in no way to be understood to mean an abandonment of the attainment of independent object - related patent protection for the combinations of features of the referenced dependent claims . since the objects of the dependent claims can constitute separate and independent inventions with reference to the prior art on the priority date , the applicant reserves the right to make these the object of independent claims or divisional applications . they can also contain independent inventions that have a configuration that is independent from the objects of the preceding dependent claims . the exemplary embodiments are not to be understood to constitute a limitation of the invention . rather , numerous alterations and modifications are possible within the scope of the present disclosure , in particular those variants , elements , and combinations , and / or materials that can be deduced by the person skilled in the art for attaining the object of the invention by combining or modifying , for example , features and elements or process steps described in the general specification , the embodiments as well as the claims , and illustrated in the drawings , and which can lead to a new object or to new process steps or process step sequences , also insofar as they concern production , testing , and operating methods .	5
with conventional sampling bottles , the sample is transferred at least once before analysis of the sample is undertaken and the conditions within the chamber cannot be monitored or maintained during transport or storage of the sample . the sample bottle in accordance with the present invention preferably allows monitoring of the physical and chemical parameters of the sample in the chamber whilst undergoing transport , and allows testing of the physical and chemical properties of the sample in situ within the chamber without exposure of the sample to conditions different to those downhole . in fig1 a receptacle 10 in accordance with the present invention is shown held on a wireline 12 within a cased well 14 . cased well 14 is defined by cased walls 18 , outside of which is formation rock 20 . flow of fluid within the well bore is indicated by arrow 16 . the receptacle 10 is in position ready to take a sample of downhole fluid so that the physical and chemical properties of the downhole fluid can be analysed to give information on the properties of the reservoir producing the fluid . the fluid being sampled is typically gas , or liquid hydrocarbons , or brine , or a mixture thereof . once the sample is taken , the wireline with attached receptacle is retrieved from downhole to surface . the receptacle , or sampling bottle , is capable of replicating and maintaining equivalent downhole conditions in an internal chamber where the sample is held , as discussed later . this ensures that once the sample is taken , it is kept stable at downhole conditions and physical and chemical changes that might occur to the sample during the trip to the surface and to a laboratory are prevented . the sample when analysed thus more accurately reflects the properties of downhole fluid . the physical and chemical properties of the fluid which are of interest when assessing the reservoir include viscosity , density , bubble and dew point , wax , asphaltene , scale precipitation conditions , hydrate formation , chemical composition . it is important to avoid physical and chemical changes to the sample as many of these changes are irreversible or effectively irreversible , and will alter the sample properties . effectively irreversible changes are those which in principle are thermodynamically irreversible but the kinetics of achieving equilibrium are so slow that it is not practical to reverse the change fully . where irreversible or effectively irreversible changes have occurred to the sample before analysis , the initial chemical and physical state of the sample , i . e . as in the reservoir , will generally not be precisely reconstructed even if the sample is put under reservoir temperature and pressure conditions during analysis . the sample properties will then not reflect downhole fluid properties . hence , for practical purposes it is always best to avoid any chemical or physical changes to the fluid sample prior to analysis whether the change is considered to be reversible or not . examples of various changes that can occur with reservoir fluids are summarized below : 1 . organic solids precipitation , for example asphaltenes and waxes , due to pressure and temperature drop ; 2 . degassing of a sample , for example , arising from the ( fluid ) liquid pressure falling below the bubble pressure and the evolved gas escaped , perhaps through a seal ; 3 . mineral precipitation ( barite , calcite ) due to temperature and / or pressure drop and degassing ; 4 . loss of gases ( mainly h 2 s , but also co 2 ) because of corrosion / reaction with sampling bottle ; the cylindrical sampling bottle of around 1 m in length is shown in detail in fig2 . the bottle 20 is preferably made from a high strength , corrosion - resistant steel alloy , such as ni alloys or ti alloys , and is of a thickness so as to withstand the extreme pressures downhole . alternatively , other materials could be used such as titanium and molybdenum alloys . the bottle 20 comprises a main chamber 22 having an internal volume of preferably around 5 - 700 cc and five minor chambers 24 , 26 , 30 , 32 , 34 in mating engagement with main chamber 22 so as to form a composite unit for taking samples which is sealed except when acquiring a sample . this modular structure allows the minor chambers to be chosen according to the characteristics that one wishes to analyse and thus the bottle can be designed to give any combination of sensors and equipment within the main chamber 22 or the minor chambers 24 , 26 , 30 , 32 , 34 depending on the particular conditions downhole and the particular reservoir of interest and particular analyses needed down hole and on the surface . these analyses undertaken include , for example , formation water ph and resistivity , hydrocarbon physical ( viscosity , density , refractive index , bubble / dew pressures ) and chemical ( chromatography ) properties . towards the base of vertical walls 40 , 42 of the main cylindrical chamber , there are provided two diametrically opposed apertures 44 , 46 which are sealed with valves 50 , 52 . when the valves 50 , 52 are opened , a passageway for conduit for through flow of fluid through the bottle is provided , with the valves 50 , 52 being operable to close and thus shut the apertures once a sample is taken . an insulating jacket 54 surrounds the chamber 22 , and this jacket 54 can also incorporate a heating coil , so as to heat the chamber 22 if so desired . a further heating element 58 is provided inside the chamber , together with selected sensors or devices 60 , 62 , 64 . in one vertical wall 40 of the chamber , there are provided two spaced apart optical windows 70 and 72 , which extend inwards from the insulating jacket 54 to an inner face of the chamber . these optical windows are preferably made of sapphire so as to withstand the extreme pressures found downhole , and allow the contents of the chamber 22 to be viewed when on surface . alternatively , other transparent materials could be used that are able to withstand the anticipated temperatures , pressures and sample chemistry . one of the modules 24 incorporates a light source 74 and a mini - spectrometer 76 and is provided with a fibre - optic cable 80 which passes into the interior of the chamber 22 so as to optically interrogate the interior of the chamber . spectroscopic analysis of any sample within the chamber 22 can then be undertaken , with the fibre - optic cable being covered with chemicals allowing optical chemical interrogation of a sample , for example , to determine the ph . an array of light conducting glass substrates containing chemicals for providing chemical interrogation of a sample can also be present in the chamber , and responsive to light from the optical fibre . the optical fibre can also be used to determine physical properties of the fluid ( for example , the formation of dew or bubbles arising from a phase transition ). a piston 82 supplied with hydraulic / electric power via a connector 84 is located within the chamber 22 and undergoes reciprocal movement along the chamber to alter the pressure within . an example of how piston operation can be achieved is discussed in u . s . pat . no . 5 , 329 , 811 . temperature and pressure sensors 86 , 90 are incorporated into the piston 82 , as are certain physical and chemical sensors such as those responsive to ph , h 2 s , acoustic waves and sensors to determine resistivity . all of these sensors are in contact with a fluid sample 92 , once the sample is acquired . power is supplied to the connector 84 either by an outside power source such as wireline , for example when the bottle is downhole , or by a battery module , or any other external power source which can be plugged in to the connector . any particular combination of sensors and equipment can be used within the chambers 22 , 24 , 26 , 30 , 32 , 34 to analyse physical and chemical properties of the sample , and the sensors and equipment discussed herein are exemplary combinations . the sample can thus be tested in a variety of different ways depending on the properties that need to be identified . u . s . pat . nos . 5 , 635 , 631 and 5 , 622 , 223 describe various ways of determining different characteristics of the fluid . some chemical sensors and miniaturized chemical analytical equipment ( for example , gas chromatography ( gc ), liquid chromatography ( lc ), and mass spectrometry ( ms )) are not in direct contact with the sampled fluid as they require sample preparation , but are held in the minor modules 30 , 32 , 34 where miniaturised sample treatment 100 , separation 102 and pumping equipment 104 is located . the various chemical sensors and chemical analytical equipment allow the following properties and information to be determined : ( ii ) provide information for downhole sample validation . thus the bottle allows contamination to be measured and this can be used to determine when the sample should be taken . reservoir fluid is either continuously pumped through the chamber or intermittently sampled for these measurements . ( iii ) record the evolution of a sample containment conditions and in - bottle chemistry during the trip to the surface and to the laboratory . ( iv ) provide extra analytical possibilities on - rig on the surface and in the laboratory as extra modules with different chemical sensors / analytical equipment can be placed in communication with the main chamber 22 . the bottle can thus act as a universal portable modular chemical laboratory which avoids any sample transfer once the sample has been acquired . where appropriate , specific chemicals are introduced into the chamber 22 for various purposes . these chemicals can be either introduced as liquids or as mixtures with polymers and retardation agents to ensure their continuous release and can either be placed in the bottle before it is placed downhole , or injected into the bottle when needed from minor auxiliary chambers / modules 30 , 32 34 . the contact of these chemicals with the sample 92 and the chemical and / or physical properties of the sample thereafter is recorded by sensors . the regulated injection of chemicals and recording of a sample &# 39 ; s chemical “ reply ” to this injection can be used for downhole chemical analyses ( titration ) of a sample downhole . specific chemicals can be introduced , for example , to : ( i ) absorb / remove aggressive gases ( for example h 2 s and / or co 2 ). ( ii ) provide an acidification to avoid mineral ( for example carbonate ) precipitation . ( iv ) calibrate chemical sensors . the bottle can be filled by a calibration solution to check sensors performance before being placed downhole other sensors that can be used include acoustic transducers and acoustic sources to determine fluid phase transition and physical properties , such as bubble and dew point , wax and asphaltenes deposition . these sensors can be placed in the piston or in the wall of the chamber , or as a changeable , plug - in module . acoustic measurements such as speed and attenuation of sound can be used for density and viscosity measurements . stirring devices 60 , such as an acoustic transducer , can be located within the chamber and when operated avoid phase separation , i . e . heavy fractions precipitation . vibrating objects 62 , such as a wire or plate , can also be fitted inside the chamber . these objects are used to determine density and viscosity of the fluid . resistivity and capacitance ( dielectric constant ) sensors 64 can also be installed in the chamber , as can sensors for detecting multiple phase fluid volumes which can comprise optical , acoustic , or surface sensors along the chamber walls . measurements of refractive index can be included , or example with the fibre optic cable 80 , to give density . the fibre optic cable can also be used to transmit near infrared energy for chemical characterisation . this analysis preferably uses a neural network . in fig2 one of the modules 26 contains various electrical / electronic equipment for signal processing and signal transfer and the bottle thus has electrical processing equipment which is capable of storing data acquired by the sensors , instructing the modules to undertake analytical tasks , for example by releasing chemicals into the main chamber , providing remote readout of data stored within memory , and controlling temperature and pressure of the main chamber . thus module 26 contains a signal converter block 110 , which converts signals from physical and chemical sensors , or from equipment in the minor modules , and sends these converted signals to a microprocessor 112 . the microprocessor records all data into a memory block 114 . the memory block 114 stores information from all sensors / equipment and also provides pre - programmed instructions to the sensors and equipment relating to the physical and chemical analysis that is to be conducted on the sample . thus for some modules , the memory block 114 sends instructions to release chemicals into the main chamber 22 , or tells the module to sample the fluid sample and then apply chemicals to a small amount of the fluid sample . all information on physical and chemical actions conducted upon the sample and all detected characteristics are held as a function of time . the memory 114 is readable through a cable and remotely interrogated by a scanner , and via a plug - in device linked to a computer . thus a record of all data relating to the sample and its conditions is maintained and is readily accessible , covering the period from when the sample is acquired downhole , brought to surface , transported to a laboratory , and possibly stored for a long period of time . [ 0063 ] fig5 is a flow chart showing various steps for acquiring a sample , according to a preferred embodiment of the invention . in step 200 , the bottle is placed downhole either on a wireline as in fig1 or as part of a downhole tool as in fig3 . if desired , a plurality of bottles can be placed downhole spaced along a common wireline string or located within the same tool . in step 202 , once downhole and at the required sample depth , valves 50 , 52 in the chamber 22 are opened and downhole fluid pumped through the bottle . in step 204 , for the wireline conveyed bottle , the fluid can be analysed as it flows through the chamber to quantify contamination and to determine when to acquire a non - contaminated sample . in step 206 , the valves 50 , 52 are then closed to seal a non - contaminated sample within the chamber 22 for subsequent analysis . in fig3 two bottles 120 , 122 are placed within a downhole tool 124 . tool 124 is shown positioned in a wellbore 24 which is defined by borehole wall 22 . note that wellbore 24 is either a cased or open hole . fluid is pumped through the bottles 120 and 122 using conduits 126 , 130 , and 132 , and valves 26 and 28 , until such time as a sample is acquired by closing off valves 50 , 52 . a clean - up curve can be generated from continuous readings of physical and chemical sensors in the chamber , or via analysing sampled and isolated portions of a fluid . this allows in - situ real time reservoir characterisation and to select when to sample to minimise contamination of the fluid . thus , the bottle is used to monitor continuously wellbore and reservoir ( formation ) fluid properties and the amount of contamination of the fluid with drilling mud . the bottle can also be used for zero - emission testing . referring again to fig5 in step 208 , once a sample is acquired , it is analysed physically and chemically in situ within the chamber 22 using any combination of physical and chemical sensors , chemical analytical equipment , and where desired chemical injection into the chamber and physical action upon the sample , such as change in temperature and / or pressure . after analysis , a sample is either discarded ( step 210 ) or kept for subsequent laboratory study ( step 212 ). the analysis of step 208 can be repeated either downhole or after the bottle is retrieved to surface , and can either be conducted continuously or as required . as the sample is hermetically sealed within the main chamber and testing is possible without interfering with the seal , the sample integrity is maintained indefinitely . in step 212 , the electrical processing equipment 110 , 112 , 114 continuously monitors conditions within the chamber using information received from sensors 86 , 90 , 60 , 62 , 64 and actively controls temperature and pressure by adjusting the amount of heating supplied by the thermal jacket and coil 58 , and by adjusting the position of the piston 82 within the chamber 22 to alter the pressure . thus the sample can be maintained at downhole conditions throughout its time within the chamber , ensuring that the sample accurately reflects the properties of the downhole fluid at all times as degradation of the sample due to fluctuations in temperature and pressure does not occur . thus , the samples initial physical and chemical state is maintained . in use , the chamber 22 is filled periodically with a calibration solution , such as before downhole deployment , during downhole job and during surface analyses . this allows the physical and chemical sensors and chemical analytical equipment in the bottle to be calibrated . instead of taking one sample and retrieving the bottle 20 to surface , in steps 210 and 216 , the bottle can be used for performing multiple physical and chemical analyses on borehole and formation fluids in multiple downhole locations before taking sample ( s ) for retrieval to the surface . these analyses provide real - time downhole reservoir fluid description and detect the conditions of minimum sample contamination allowing acquisition of a sample with the best possible quality . alternatively , after discarding the sample in step 210 , another sample can be taken at the same location . in this way , a multisample mode is provided where multiple samples are taken at a location , for example 10 samples . the sampling can continue until a sample can be obtained having acceptable characteristics and then that sample can be transported to the surface . when used in a flow through mode , or a multi - sample mode , the system can be used for emission free testing with a down hole drill stem tester ( dhdst ) or a modular formation dynamic tester ( mdt ). in step 212 , once a sample 92 has been collected in the chamber 22 , the bottle is retrieved to surface and detached from the wireline or logging tool . the bottle allows continuous monitoring , analysis and control over physical and chemical properties of the sample during the journey to the surface ( step 212 ) and to the laboratory ( step 218 ) using the sensors , electrical processors and analytical equipment contained within the various modules forming the bottle . the pressure and temperature of the sample can thus be maintained as the sample travels from downhole to surface and then on to the lab . at surface , the actions and analyses carried out upon the sample 92 can either be conducted using the modules used downhole , or minor modules 24 , 30 , 32 , 34 can be replaced with modules containing different physical and chemical equipment or chemicals . on - site near wellbore and before detachment of the bottle from a tool , instructions are given to processor 112 for further regulation of temperature / sample chemistry and data recording within the chamber . if necessary , an external power source can be connected to the power connector 84 . during surface transfer of the bottle from the rig to the laboratory ( step 218 ), the various elements contained in the modules in combination continuously monitor and control the physical and chemical properties of the sample . in step 220 , once the sample reaches a laboratory , the whole history of the sample &# 39 ; s physical and chemical properties is transferred to a corresponding laboratory file by interrogating the electrical processor / memory 112 , 114 of the bottle . various physical and chemical laboratory analyses are then performed directly in the chamber 22 using the bottle &# 39 ; s temperature and pressure regulation ability together with chemical injections and by connecting additional modules where necessary . alternatively the sample can be removed from the chamber for analysis , the sample history before reaching the laboratory being known as a result of the monitoring conducted whilst the sample was within the chamber . according to another embodiment of the invention , the bottle is used simply to convey samples from surface at a well to a laboratory . fig4 shows the transfer of a downhole sample from a standard bottle 130 to a bottle 132 in accordance with the invention is shown schematically . alternatively the bottle is used as part of an on - site ( on - rig ) portable physical and / or chemical laboratory for express analyses . electrical and hydraulic power is applied to the bottle through connectors 134 , 136 . the bottle 132 allows the sample to be monitored continually during transport and storage and analysis can be conducted if necessary . the bottle thus has a variety of different applications . in its more general form it provides a mini portable modular chemical / physical laboratory which allows analysis of a sample anywhere , avoiding the need to take the sample to a laboratory before analysis is undertaken . the bottle can also act as an integrated transport and analysis vessel , when a sample is placed into the chamber when on surface . the bottle then monitors , records and controls sample conditions and analyses the sample during transport and / or storage . in addition the bottle can act as an integral unit that acquires a sample , analyses a sample both downhole and on surface , and is a transport vessel . this ensures that a sample can be acquired , analysed and transported without any sample transfer between different containers . the sample integrity is thus maintained for as long a period as desired . the above - described embodiments are illustrative of the invention only and are not intended to limit the scope of the present invention .	4
as used herein , the term “ pulse ” refers to a single occurrence of an electrical signal that has a defined shaped and period . as used herein , the term “ waveform ” refers to a repeating electrical signal that may include one or more pulses . the pulses that make up the waveform may be the same or may differ in any one of shape , polarity , duration and amplitude . for example , a biphasic waveform may include an anodal pulse and a cathodal pulse . the anodal and cathodal components may differ only in polarity or may be differ in shape , polarity , duration and amplitude . pulses making up a waveform may differ in shape , polarity , duration , and amplitude but be equivalent in power . as used herein , the term “ sub - threshold waveform ” refers to a waveform that does not result in stimulating the heart to beat . a waveform may be sub - threshold because the amplitude of the waveform is below an amplitude threshold value necessary to stimulate a heartbeat . a waveform may be sub - threshold because the duration of the waveform is below a duration threshold value necessary to stimulate a heartbeat . a waveform may be sub - threshold because the power of the waveform is below a power threshold value necessary to stimulate a heartbeat . as used herein , the term “ pacing waveform ” refers to a waveform that stimulates a heartbeat , results in depolarization and is by definition equal to or greater than a threshold necessary to simulate a heartbeat . fig1 shows a representative tracing 10 of electrical activity in a typical heartbeat . a p wave 11 represents the wave of depolarization that spreads from the sa node throughout the atria . a period of time from the onset of the p wave to the beginning of a qrs complex is known as the p - r interval 12 . the p - r interval 12 represents the time between the onset of atrial depolarization and the onset of ventricular depolarization ( typically lasting 20 - 200 ms ). if the p - r interval is & gt ; 200 ms , there is an av conduction block , which is also known as a first - degree heart block if the impulse is still able to be conducted into the ventricles . a qrs complex 13 represents the period of ventricular depolarization , which normally occurs very rapidly ( e . g ., typically lasting 80 - 120 ms ). if the qrs complex is prolonged , conduction is impaired within the ventricles . the isoelectric period ( st segment 14 ) following the qrs complex 13 is the period of time ( typically lasting 80 - 120 ms ) at which the entire ventricle is depolarized and roughly corresponds to the plateau phase of the ventricular action potential . the st segment 14 is important in the diagnosis of ventricular ischemia or hypoxia because under those conditions , the st segment 14 can become either depressed or elevated . fig2 is a schematic representation illustrating a multi - phase cardiac stimulus generator 120 implanted in a patient according to an embodiment . in an embodiment , one or more sensors sense rhythm and contractions of the patient &# 39 ; s heart 105 using at least one of atrial sensing and ventricular sensing , such as at least one of atrial sensor 110 and ventricular sensor 112 . the atrial sensor 110 and / or ventricular sensor 112 provide sensor data to a rules engine 122 . in an embodiment , the rules engine includes a processor 126 and a memory 124 for storing rules and receiving sensor data . the rules engine 122 may poll the one or more of the atrial sensor 110 and the ventricular sensor 112 to obtain sensor data and to apply the rules to the sensor data in order to determine whether to deliver electrical waveforms to one or more electrodes , and , if electrical waveforms are to be delivered , which of the one or more electrodes is to receive the electrical waveforms . in an embodiment , the one or more electrodes may be an atrial electrode 114 and a ventricular electrode 116 , and may provide electrical waveforms to at least one of an atrial chamber and a ventricular chamber of the heart 105 . the multi - phase cardiac stimulus generator 120 may generate an anodal waveform , a cathodal waveform , and a biphasic waveform above or below threshold depending on the sensor data and the rules applied by the rules engine 122 . in an embodiment , the memory 124 of the rules engine 122 of the multi - phase cardiac stimulus generator 120 is configured to store one or more anodal waveforms , cathodal waveforms , and biphasic waveforms . a waveform or a combination of waveforms may be selected from the memory 124 by the processor 126 based on sensor data and based on rules also stored in memory 124 . in an embodiment , the memory 124 may also store information about the patient 100 . the processor 126 may further select a waveform or a combination of waveforms from the stored waveforms based on the sensor data and data about the user . in an embodiment , the stored waveforms comprise waveform data that are used by the multi - phase cardiac stimulus generator 120 to produce waveforms for applying to the heart . fig3 is a schematic representation illustrating a cardiac and vagus nerve stimulation device according to an embodiment . fig3 includes elements from fig2 and additionally includes a vagus electrode 310 for stimulating the vagus nerve 305 . in an embodiment , the vagus nerve 305 is accessed in the neck . the carotid sheath is dissected and the vagus electrode 310 is an encircling electrode that is wrapped around the vagus nerve 305 to receive electrical stimulation . in an embodiment of the present invention , the one or more of atrial sensor 110 and ventricular sensor 112 provide sensor data that indicates the onset of tachycardia . in response to the heart sensor data , the rules engine 122 may apply an electrical waveform to the vagus nerve 305 via the vagus electrode 310 . the rules engine 122 monitors the sensor data to determine when a sinus rhythm has been reestablished in the cardiac tissue . if a sinus rhythm has been reestablished in the cardiac tissue , the rules engine 122 halts the stimulus to the vagus electrode 310 . if a sinus rhythm has not been reestablished in the cardiac tissue , the rules engine 122 continues the stimulation of the vagus nerve 305 . in an embodiment , the electrical waveform may be low frequency or high frequency electrical signal or a waveform made up of trains of electrical pulses . in an embodiment , the electrical waveform is a biphasic waveform . in another embodiment , the stimulation of the vagus nerve may be combined with the application of a sub - threshold waveform to the heart as previously described . a system and method for reducing stroke work in an artificially paced heart have been disclosed . it will also be understood that the invention may be embodied in other specific forms without departing from the scope of the invention disclosed and that the examples and embodiments described herein are in all respects illustrative and not restrictive . those skilled in the art of the present invention will recognize that other embodiments using the concepts described herein are also possible . further , any reference to claim elements in the singular , for example , using the articles “ a ,” “ an ,” or “ the ” is not to be construed as limiting the element to the singular .	0
hereinafter , preferred embodiments of the invention will be described in detail with reference to the drawings . fig1 shows the arrangement of a camera system equipped with a focus detecting device according to a first embodiment of the invention . referring to fig1 a photo - taking lens 1 , which is an objective lens , contains therein a photo - taking optical system 2 , a driving means 3 arranged to adjust the focusing state of the photo - taking lens 1 by moving some of or all of the lenses constituting the photo - taking optical system 2 , a storage means 4 which is a rom or the like , and a lens control means 5 arranged to control all of the parts of the photo - taking lens 1 . on the other hand , a camera body 6 contains therein a main mirror 7 , a focusing screen 8 , a pentagonal prism 9 and an eyepiece 10 , which constitute a viewfinder system . the camera body 6 further contains therein a sub - mirror 11 , a focus detecting means 12 , a correction value computing means 13 , a camera control means 14 , and a film 15 which is used as a photo - taking medium . the photo - taking lens 1 and the camera body 6 are provided with contacts 16 . when the photo - taking lens 1 and the camera body 6 are coupled with each other , electric power is supplied and information is communicated between them through the contacts 16 . fig2 shows in detail the optical arrangement of the focus detecting means 12 . in fig2 reference numeral 17 denotes the optical axis of the photo - taking lens , i . e ., an objective lens , which is not shown . reference numeral 18 denotes a film which is equivalent to the film 15 shown in fig1 . reference numeral 19 denotes a semi - transparent main mirror disposed on the optical axis 17 of the photo - taking lens , which is equivalent to the main mirror 7 shown in fig1 . reference numeral 20 denotes a first reflection mirror which is obliquely arranged on the optical axis 17 of the objective lens to perform the same function as the sub - mirror 11 of fig1 . reference numeral 21 denotes a paraxial image forming plane which is conjugate to the film 18 for paraxial image forming by the first reflection mirror 20 . reference numeral 22 denotes a second reflection mirror . reference numeral 23 denotes an infrared cut filter . reference numeral 24 denotes a diaphragm having two apertures 24 - 1 and 24 - 2 . reference numeral 25 denotes a secondary image forming system having two lenses 25 - 1 and 25 - 2 which correspond to the two apertures 24 - 1 and 24 - 2 . reference numeral 36 denotes a third reflection mirror . reference numeral 26 denotes a photoelectric conversion element having two area sensors 26 - 1 and 26 - 2 . the first reflection mirror 20 has curvature to have a convergent power for projecting the images of the two apertures 24 - 1 and 24 - 2 of the diaphragm 24 on parts in the neighborhood of the exit pupil of the photo - taking ( objective ) lens which is not shown . further , the first reflection mirror 20 is coated by vapor deposition with a metal film of aluminum , silver or the like in such a way as to reflect light only from necessary areas and is thus arranged to perform also the function as a field mask which limits a range within which a focus detecting action is performed . the other reflection mirrors 22 and 36 have only minimum necessary areas of them coated by vapor deposition with a metal film for the purpose of lessening any stray light incident on the photoelectric conversion element 26 . a coating material having a light absorbing property may be applied to the areas of each of these reflection mirrors not acting as reflection surfaces . fig3 is a plan view showing the diaphragm 24 . the two apertures 24 - 1 and 24 - 2 which laterally extend are aligned in the direction of their narrower widths . in fig3 broken lines indicate the lenses 25 - 1 and 25 - 2 of the secondary image forming system 25 , which are disposed behind the diaphragm 24 in positions corresponding to the apertures 24 - 1 and 24 - 2 of the diaphragm 24 . fig4 is a plan view showing the photoelectric conversion element 26 . as shown in fig4 each of the two area sensors 26 - 1 and 26 - 2 shown in fig2 which are arranged to constitute the photoelectric conversion element 26 is composed of a two - dimensional array of picture elements . the focus detecting device configured in the above manner operates as follows . light fluxes 27 - 1 and 27 - 2 shown in fig2 come from the photo - taking lens ( not shown ). after passing through the main mirror 19 , the light fluxes 27 - 1 and 27 - 2 are reflected by the first reflection mirror 20 in the direction of the inclination of the main mirror 19 . the light fluxes 27 - 1 and 27 - 2 have their reflected directions changed by the second reflection mirror 22 to be condensed by the lenses 25 - 1 and 25 - 2 of the secondary image forming system 25 after passing through the infrared cut filter 23 and the two apertures 24 - 1 and 24 - 2 of the diaphragm 24 . the condensed light fluxes then reach respectively to the surfaces of the area sensors 26 - 1 and 26 - 2 of the photoelectric conversion element 26 through the third reflection mirror 36 . in the case of the illustration of fig2 the light fluxes 27 - 1 and 27 - 2 represent light fluxes to be imaged on the middle part of the film 18 . however , light fluxes to be imaged on other parts of the film 18 also reach the photoelectric conversion element 26 via the same optical path . as a whole , two light - quantity distributions which correspond to predetermined two - dimensional areas of the film surface 18 are obtained respectively on the area sensors 26 - 1 and 26 - 2 of the photoelectric conversion element 26 . in the case of the first embodiment , the light incident on the secondary image forming system 25 is prevented from being excessively refracted , by arranging the first surface of the secondary image forming system 25 to be in a concave surface shape . by virtue of this arrangement , the secondary image forming system 25 is capable of uniformly forming an image over a wide range of the two - dimensional area of the photoelectric conversion element 26 . incidentally , in taking a shot , the first reflection mirror 20 is retracted to the outside of a photo - taking optical path in the same manner as the main mirror 19 . the focus detecting means 12 shown in fig1 is arranged to compute the two light - quantity distributions to obtain a relation in the vertical direction between the relative positions of the two area sensors 26 - 1 and 26 - 2 for every position of the area sensors 26 - 1 and 26 - 2 on the same principle that is described in the foregoing with reference to fig9 . the focusing state of the photo - taking lens 1 is detected by this computing operation . the result of the computing operation is outputted as a focus deviation amount d . with the focus detecting means 12 arranged as described above , the focusing state of the photo - taking lens can be detected for almost any desired area of the film 18 corresponding to the photoelectric conversion element 26 , that is , for almost any desired point within the focus detecting area . further , referring to fig5 the focus detecting means 12 may be arranged to be capable of detecting focus only for specific positions dispersively located as indicated by rectangular shape within a focus detectable area 28 . in the case of this modification , a liquid crystal display element or the like having a rectangular pattern as shown in fig5 is disposed in the neighborhood of the focusing screen 8 shown in fig1 . then , areas for which focus detection is possible or an area for which focus detection is completed can be displayed at a viewfinder under driving control of the liquid crystal display element or the like . further , in a case where focus detection is to be dispersively made as shown in fig5 line sensors may be dispersively arranged , in place of the area sensors , in positions corresponding to focus detecting areas . as described in the foregoing , if the focus deviation amount d which indicates a focusing state obtained from the relation between the relative positions of two images formed on the area sensors is used as it is for control over the photo - taking lens , some error would arise to make accurate focusing impossible . therefore , the focus deviation amount d obtained at each of various focus detecting positions must be corrected with a correction value obtained for the applicable position . however , as apparent from the arrangement of the focus detecting means 12 described above , the focus detectable area 28 which is as shown in fig5 is axially symmetric only with respect to a vertical line 30 passing through the center 29 of the focus detectable area 28 and is not axially symmetric with respect to a horizontal line 31 nor has any rotational symmetry with respect to a line passing the center 29 perpendicularly to the paper surface of the drawing . therefore , the characteristic of each point located within the focus detectable area 28 cannot be defined solely on the basis of a distance from the center 29 . the above - stated correction value also cannot be allowed to be represented simply by a value related to the distance from the center 29 . therefore , the correction value computing means 13 shown in fig1 is arranged to compute a correction value c by using at least two parameters corresponding to an area for which focus detection is to be performed . for example , assuming that the current focus detecting area is an area 32 as shown in fig5 the coordinates ( x , y ) of the center 33 of the area 32 , obtained with the center 29 of the focus detectable area 28 set as an origin , are used as the parameters , and the correction value c is obtained by the following formula : ## equ1 ## in the formula ( 2 ) above , &# 34 ; i &# 34 ; and &# 34 ; j &# 34 ; represent continuous or noncontinuous integers within a prescribed range , &# 34 ; a ij &# 34 ; represents one or a plurality of coefficients determined by the integers &# 34 ; i &# 34 ; and &# 34 ; j &# 34 ;. the coefficients &# 34 ; a ij &# 34 ; are stored in the storage means 4 within the photo - taking lens 1 and delivered from the lens control means 5 to the camera control means 14 through the contacts 16 prior to the computing operation of the formula ( 2 ). incidentally , the coordinates ( x , y ) do not have to be coordinates on the predetermined focal plane or a film surface but may be coordinates on a plane equivalent to the predetermined focal plane . the unit of the coordinate values may be normalized to be most apposite to the computing operation of the formula ( 2 ). the camera control means 14 obtains a corrected focus detection signal d c by carrying out a computing operation similar to the formula ( 1 ) using the focus deviation amount d obtained by the focus detecting means 12 and the correction value c obtained according to the formula ( 2 ) by the correction value computing means 13 . the corrected focus detection signal d c is sent to the lens control means 5 through the contacts 16 either as it is or after it is converted into a lens driving amount or the like as necessary . upon receipt of the signal d c , the lens control means 5 controls the driving means 3 on the basis of the signal d c to adjust the focusing state of the photo - taking lens 1 by moving all of or some of the component lenses of the photo - taking lens 1 . fig6 is a bird &# 39 ; s - eye view showing correction values c of a certain photo - taking lens . correction values for a focus detectable area 34 are shown in the form of a continuous curved surface 35 . in the case of fig6 the curved surface 35 is obtained according to the formula ( 2 ). the values of the coefficients a ij are as shown below : a 20 =- 5 . 83510 × 10 - 4 a 21 =- 5 . 50092 × 10 - 5 a 22 = 3 . 89544 × 10 - 6 in this case , the correction values c are of a quadratic expression relative to x and y axes . however , due to symmetry with respect to the y axis , all primary coefficients a 1j of the x axis ( j = 0 , 1 , 2 ) are &# 34 ; 0 &# 34 ;. the correction values c for all points in the focus detectable area are , therefore , expressed in six coefficients . while the integers i and j are set within a range of &# 34 ; i = 0 , 2 and j = 0 , 1 , 2 &# 34 ; in the above - stated case , the range of the integers i and j is not limited to this range . further , in a case where the focus detecting area is divided into predetermined areas as shown in fig5 the part x i y j of the formula ( 2 ) for each area ( x , y ) is beforehand computed , and the values of x i y j , instead of parameters ( x , y ), are stored as parameters in a storage means disposed on the side of the camera body and are arranged to be read out at the time of computation according to the formula ( 2 ). by virtue of this arrangement , the length of time required for computation can be shortened to a great extent . in the first embodiment described above , the correction values c are assumed to be obtained according to the computing formula ( 2 ). however , the invention is not limited to the use of the formula ( 2 ). the correction values c may be obtained by using logarithmic functions , trigonometric functions or other functions or functions expressed by combinations of these functions . in a case where the error would increase if the correction values are expressed by one function for all parts of the focus detecting area , the focus detecting area is divided into some parts and correction values for these divided areas may be expressed by continuous spline functions . in a case where the correction values do not continuously vary over the whole focus detecting area , because different focus detecting means are arranged respectively for different focus detecting areas , it is possible to redefine functions for each of divided areas and to obtain a correction value for each of the areas by performing a computing operation suited for the area . further , in a case where it is impossible to limit the formula for obtaining the correction value c to one computing formula , with the invention applied to a system of using interchangeable lenses of varied kinds such as a single - lens reflex camera , the functions of a plurality of kinds are stored beforehand and information on the kind of the function to be used together with coefficients required for computing a correction value c a and on designated procedures for the computation is read out from the lens . fig7 shows the arrangement of a camera system according to a second embodiment of the invention . in fig7 the same parts as those of the first embodiment shown in fig1 are indicated by the same reference numerals . the second embodiment differs from the first embodiment in that the correction value computing means 13 which is disposed on the side of the camera body in the first embodiment as shown in fig1 is disposed on the side of the photo - taking lens 1 as correction value computing means 13 &# 39 ; as shown in fig7 . in the case of the second embodiment , the correction value is computed and the focus detection signal is corrected in the following manner . the lens control means 5 first receives coordinates ( x , y ) indicative of the position of a focus detecting area for which focus detection is to be performed , through the contacts 16 from the camera control means 14 disposed within the camera body 6 . then , the correction value computing means 13 &# 39 ; disposed on the side of the photo - taking lens 1 obtains a correction value c by performing the computation of the formula ( 2 ) using the coordinate values and applicable coefficient data a ij stored in the storage means 4 . the result of the computation is sent to the camera control means 14 of the camera body 6 through the lens control means 5 and the contacts 16 . after that , the focus detection signal is corrected and the photo - taking lens 1 is driven in the same manner as in the case of the first embodiment described above . in the case of the second embodiment , the correction value is computed on the side of the lens 1 . therefore , the correction value computing formula can be set as desired according to the lens in use , so that the focus detection signal can be corrected in a manner most apposite to the lens currently in use . fig1 is a block diagram schematically showing the arrangement of essential parts of a camera system equipped with a focus detecting device according to a third embodiment of the invention . referring to fig1 , a photo - taking lens 1 which is an objective lens contains therein a photo - taking optical system 2 which is composed of one or a plurality of lens groups and has a focal length arranged to be variable by moving all of or one of the component lens groups , a lens state detecting means 37 arranged to detect the focal length , i . e ., a zooming state , of the photo - taking optical system 2 , a driving means 3 arranged to adjust the focusing state of the photo - taking lens 1 by moving all of or one of the lens groups constituting the photo - taking optical system 2 , a storage means 4 which is a rom or the like , and a lens control means 5 arranged to control the above parts . the lens state detecting means 37 is arranged in a known manner to detect a moving state of the lens or an amount characterizing the moving state by using electrodes for an encoder provided on a lens barrel which rotates or moves for varying the focal length , i . e ., a zooming state , of the photo - taking optical system 2 and electrodes connected to the encoder electrodes . on the other hand , a camera body 6 contains therein a main mirror 7 , a focusing screen 8 arranged to have an object image formed thereon , a pentagonal prism 9 arranged to invert the image , and an eyepiece 10 , which constitute a viewfinder system . the camera body 6 further contains therein a sub - mirror 11 , a focus detecting means 12 , a computing means 13 , a camera control means 14 , and a photosensitive film 15 which is used as a photo - taking medium . the photo - taking lens 1 and the camera body 6 are provided with contacts 16 for communicating information of varied kinds between them and for supply of power with the contacts 16 connected to each other . fig1 shows in detail the optical arrangement of the focus detecting means 12 shown in fig1 . this arrangement is the same as the arrangement shown in fig2 . the diaphragm 24 and the photoelectric conversion element 26 are also arranged in the same manner as the arrangement shown in fig3 and 4 . with the focus detecting means 12 arranged as shown in fig1 , the second embodiment operates as follows . referring to fig1 , light fluxes 27 - 1 and 27 - 2 from the photo - taking lens 1 pass through the half - mirror surface of the main mirror 19 . after passing through the main mirror 19 , the light fluxes 27 - 1 and 27 - 2 are reflected by the first reflection mirror 20 in the direction of the inclination of the main mirror 19 . the light fluxes 27 - 1 and 27 - 2 have their reflected direction changed by the second reflection mirror 22 to be condensed by the lenses 25 - 1 and 25 - 2 of the secondary image forming system 25 after passing through the infrared cut filter 23 and the two apertures 24 - 1 and 24 - 2 of the diaphragm 24 . the condensed light fluxes then reach respectively to the surfaces of the area sensors 26 - 1 and 26 - 2 of the photoelectric conversion element 26 through the third reflection mirror 36 . in the case of fig1 , the light fluxes 27 - 1 and 27 - 2 represent light fluxes to be imaged on the middle part of the film 18 . however , light fluxes to be imaged on other parts of the film 18 also reach the photoelectric conversion element 26 through the same optical path . as a whole , two light - quantity distributions which correspond to predetermined two - dimensional areas of the film surface 18 are obtained respectively on the area sensors 26 - 1 and 26 - 2 of the photoelectric conversion element 26 . in the third embodiment , the light incident on the secondary image forming system 25 is prevented from being excessively refracted by arranging the first surface of the secondary image forming system 25 to be in a concave surface shape . by virtue of this arrangement , the secondary image forming system 25 is capable of uniformly forming an image over a wide range of the two - dimensional area of the photoelectric conversion element 26 . incidentally , in taking a shot , the first reflection mirror 20 is retracted to the outside of a photo - taking optical path in the same manner as the main mirror 19 . the focus detecting means 12 shown in fig1 is arranged to perform a computing operation on the two light - quantity distributions to obtain a relation in the vertical direction , i . e ., in the dividing direction of the object images , between the relative positions of the two area sensors 26 - 1 and 26 - 2 for every position of the area sensors 26 - 1 and 26 - 2 shown in fig4 on the basis of the principle of the known focus detecting method . the focusing state of the photo - taking lens 1 is thus detected by this computation . the result of the computation is outputted as a focus deviation amount d . with the focus detecting means 12 arranged as described above , the focusing state of the photo - taking lens 1 can be detected for almost any desired area of the film 18 corresponding to area sensors of the photoelectric conversion element 26 , that is , for almost any desired point within the focus detecting area . further , the focus detecting means 12 may be arranged to be capable of detecting focus only for specific positions dispersively located as indicated by rectangular shape within a focus detectable area , like the area 28 shown in fig5 . in the case of such a modification , a liquid crystal display element or the like having a rectangular pattern as shown in fig5 is disposed in the neighborhood of the focusing screen 8 shown in fig1 . then , areas for which focus detection is possible or an area for which focus detection is completed can be displayed at a viewfinder under driving control of the liquid crystal display element or the like . as described in the foregoing , if the focus deviation amount d which indicates a focusing state obtained from the relation between the relative positions of two images formed on the area sensors is used as it is for control over the photo - taking lens , some error would arise to make accurate focusing impossible . therefore , the focus deviation amount d obtained at each of various focus detecting positions must be corrected with a correction value obtained for the applicable position . however , as apparent from the arrangement of the focus detecting means 12 described above , the focus detectable area 28 which is as shown in fig5 is axially symmetric only with respect to a vertical line 30 passing through the center 29 of the focus detectable area 28 and is not axially symmetric with respect to a horizontal line 31 nor has any rotational symmetry with respect to a line passing the center 29 perpendicularly to the paper surface of the drawing . therefore , the characteristic of each point located within the focus detectable area 28 cannot be defined solely on the basis of a distance from the center point 29 . the above - stated correction value also cannot be allowed to be represented simply by a value related to the distance from the center point 29 . the third embodiment , therefore , computes a correction value and makes correction with the correction value in the following manner . referring to fig1 , the lens state detecting means 37 first detects a zooming state of the photo - taking lens 1 and sends a parameter indicating the zooming state detected , such as a focal length &# 34 ; f &# 34 ;, to the lens control means 5 . the lens control means 5 reads the focal length f and also an intrinsic constant ij b k which indicates the intrinsic characteristic of the photo - taking lens 1 and is stored beforehand in the storage means 4 . the lens control means 5 sends the information thus obtained to the camera control means 14 through the contacts 16 . here , an exponent attached to this intrinsic constant represents an integer within a certain range . the meaning of the integer will become apparent from a computing formula described below . the computing means 13 disposed on the side of the camera body 6 functions as a state constant computing means . the computing means 13 computes and obtains a state constant a ij corresponding to the state of the photo - taking lens 1 by the following formula using the focal length &# 34 ; f &# 34 ; and the intrinsic constant ij b k which are sent from the photo - taking lens 1 to the camera control means 14 . ## equ2 ## after the state constant a ij is obtained by the above - stated computing operation , the computing means 13 functions as a means for computing a correction value . the computing means 13 then uses the state constant a ij to obtain a correction value c through a computing operation which is performed according to the following formula : ## equ3 ## assuming that the area for which the focus detection is to be made is a rectangular area 32 as shown in fig5 &# 34 ; x &# 34 ; and &# 34 ; y &# 34 ; in the formula ( 4 ) above represent the coordinates of the center 33 of the area 32 obtained with the center point 29 of the focus detectable area 28 shown in fig5 used as an origin . as apparent from the formulas ( 3 ) and ( 4 ), the exponents k , i and j of the constants ij b k and a ij represent exponents of power related to the focal length f and the coordinates ( x , y ) of the area for which the focus detection is to be made and are continuous or noncontinuous integers within a predetermined range . their values do not have to be always unvarying and may be variable according to the characteristics of the photo - taking lens 1 . further , in the arrangement of the third embodiment , the computing means 13 is assumed to act as the state constant computing means and also as the correction value computing means . further , the coordinates ( x , y ) which are used as parameters indicating a focus detecting area do not have to be limited to the coordinates on the predetermined focal plane or a film surface but may be replaced with coordinates on a plane equivalent to the film surface or with coordinates undergone some converting process . the unit of the coordinate values may be normalized into some unit best suited for the computing formula ( 4 ). the camera control means 14 ( correction value computing means ) performs a computing operation in the same manner as the formula ( 1 ) by using the focus deviation amount d obtained by the focus detecting means 12 and the correction value c obtained from the formula ( 4 ) by the computing means 13 , to obtain a corrected focus detection signal d c . the corrected focus detection signal d c is sent to the lens control means 5 through the contacts 16 either as it is or , if necessary , after it is converted into a lens driving amount . upon receipt of this signal , the lens control means 5 controls and causes the driving means 3 to adjust the focusing state of the photo - taking lens 1 by moving all of or some of the lenses of the photo - taking optical system 2 . fig1 ( a ), 14 ( b ) and 14 ( c ) are bird &# 39 ; s - eye views respectively showing the correction values c for three focal length states ( 29 . 1 mm , 50 . 0 mm and 76 . 7 mm ) within a zooming area between a wide - angle end position and a telephoto end position of a zoom lens which has a focal length range from 28 mm to 80 mm . the correction values for a focus detectable area 34 are shown in curved surfaces 35 - 1 to 35 - 3 . changes taking place in the curved surfaces indicative of the correction values due to changes in focal length f can be closely approximated by the formulas ( 3 ) and ( 4 ). in the case of the third embodiment , the values of the intrinsic constant ij b k are as shown below : ______________________________________ . sub . 00 b . sub . 0 = . sub . 20 b . sub . 0 = 3 . 28948 × 10 . sup .- 3 . sub . 00 b . sub . 1 = - 2 . 42676 × 10 . sup .- 1 . sub . 20 b . sub . 1 = - 1 . 68544 × 10 . sup .- 4 . sub . 00 b . sub . 2 = . sub . 20 b . sub . 2 = - 2 . 32388 × 10 . sup .- 6 . sub . 00 b . sub . 3 = - 1 . 13286 × 10 . sup .- 4 . sub . 20 b . sub . 3 = 1 . 38408 × 10 . sup .- 7 . sub . 00 b . sub . 4 = . sub . 20 b . sub . 4 = - 1 . 12769 × 10 . sup .- 9 . sub . 01 b . sub . 0 = . sub . 21 b . sub . 0 = - 3 . 48085 × 10 . sup .- 3 . sub . 01 b . sub . 1 = - 1 . 05952 × 10 . sup .- 2 . sub . 21 b . sub . 1 = 3 . 05693 × 10 . sup .- 4 . sub . 01 b . sub . 2 = . sub . 21 b . sub . 2 = - 9 . 60849 × 10 . sup .- 6 . sub . 01 b . sub . 3 = - 4 . 39150 × 10 . sup .- 6 . sub . 21 b . sub . 3 = 1 . 28713 × 10 . sup .- 7 . sub . 01 b . sub . 4 = . sub . 21 b . sub . 4 = - 6 . 22562 × 10 . sup .- 10 . sub . 02 b . sub . 0 = . sub . 22 b . sub . 0 = - 1 . 07168 × 10 . sup .- 3 . sub . 02 b . sub . 1 = - 3 . 16184 × 10 . sup .- 3 . sub . 22 b . sub . 1 = 1 . 07038 × 10 . sup .- 4 . sub . 02 b . sub . 2 = . sub . 22 b . sub . 2 = - 3 . 04482 × 10 . sup .- 6 . sub . 02 b . sub . 3 = - 8 . 73344 × 10 . sup .- 7 . sub . 22 b . sub . 3 = 3 . 46466 × 10 . sup .- 8 . sub . 02 b . sub . 4 = . sub . 22 b . sub . 4 = - 1 . 40090 × 10 . sup .- 10______________________________________ by using these values of the intrinsic constant ij b k , not only the values of the state constant a ij for the focal lengths f in fig1 ( a ), 14 ( b ) and 14 ( c ) but also the values of the state constant a ij for other focal lengths f can be accurately computed in accordance with the formula ( 3 ). the values of the state constant a ij for each of the focal lengths in fig1 ( a ), 14 ( b ) and 14 ( c ) which are obtainable by the formula ( 3 ) are as shown below : ______________________________________fig . 14 ( a ) a . sub . 00 = - 1 . 92192 × 10 . sup .- 2 a . sub . 01 = - 3 . 53386 × 10 . sup .- 3 a . sub . 02 = - 9 . 99921 × 10 . sup .- 3a . sub . 20 = - 9 . 79780 × 10 . sup .- 4 a . sub . 21 = 3 . 34633 × 10 . sup .- 6 a . sub . 22 = 2 . 17978 × 10 . sup .- 4fig . 14 ( b ) a . sub . 00 = - 3 . 00709 × 10 . sup .- 2 a . sub . 01 = - 1 . 96670 × 10 . sup .- 3 a . sub . 02 = - 4 . 65863 × 10 . sup .- 3a . sub . 20 = - 6 . 94517 × 10 . sup .- 4 a . sub . 21 = - 1 . 93460 × 10 . sup .- 5 a . sub . 22 = 1 . 23437 × 10 . sup .- 4fig . 14 ( c ) a . sub . 00 = - 4 . 22666 × 10 . sup .- 2 a . sub . 01 = - 1 . 15450 × 10 . sup .- 3 a . sub . 02 = 6 . 03941 × 10 . sup .- 4a . sub . 20 = a . sub . 21 = - 2 . 74064 × 10 . sup .- 5 a . sub . 22 = 1 . 07257 × 10 . sup .- 5______________________________________ in the case of the third embodiment , each state constant a ij is expressed by a biquadratic power series of the focal length f . the correction value c is of a quadratic expression related to x and y axes . however , due to symmetry with respect to the y axis , all primary coefficients a 1j of the x axis ( j = 0 , 1 , 2 ) are &# 34 ; 0 &# 34 ;. the correction values c for all points in the focus detectable area are , therefore , expressed in six coefficients . in the third embodiment , as described above , for the state of the photo - taking lens at a certain fixed focal length f , the correction value is expressed by using six state constants a ij and each of the state constants a ij is computed from five intrinsic constants ij b k . therefore , in order to make a correction value available for the state of the photo - taking lens at any desired focal length f , a total of 30 (= 6 × 5 ) constants must be kept in store at the storage means . on the other hand , in a case where the state constants are not computed from intrinsic constants and the state constants are stored beforehand in a storage device for every divided area obtained by dividing a range of focal lengths into a plurality of areas , a total of p × q constants is necessary with the dividing number assumed to be p and the number of state constants necessary for obtaining correction values respectively for these divided areas assumed to be q . assuming that the number q is 6 like in the case of the third embodiment , in a case where the area dividing number p is more than 5 , the number of constants which must be kept in store becomes smaller according to the arrangement of the third embodiment . with regard to zoom lenses in general , in order to accurately obtain correction values , the focal length range must be divided at least into eight areas . in the event of a great fluctuations in aberration or a bright lens requiring a particularly high degree of precision , the focal length range is preferably divided into at least 16 areas . therefore , the correction value computing method of the invention disclosed permits reduction in number of constants to be stored for many zoom lenses . in a case where a focus detecting area is divided into predetermined divided areas as shown in fig5 the part of x i y j of the formula ( 4 ) is computed beforehand for the coordinates ( x , y ) of each of divided areas . the computed values of the part of x i y j are stored as parameters , instead of the coordinates ( x , y ), in the storage means on the side of the camera body . the values stored are read out when the computing operation is performed according to the formula ( 4 ), so that the time required for the computation can be shortened to a great extent . in the third embodiment described above , the correction values are assumed to be obtained according to the computing formulas ( 3 ) and ( 4 ). however , the invention is not limited to the use of these formulas . the correction values may be obtained by using logarithmic functions , trigonometric functions or other functions or functions expressed by combinations of these functions . in a case where the error would increase if a correction value is expressed only by one function for all parts of the focus detecting area , the focus detecting area is divided into some parts and correction values for these divided areas may be expressed by continuous spline functions . in a case where the correction value does not continuously vary over the whole focus detecting area , because different focus detecting means are arranged respectively for different focus detecting areas , it is possible to redefine functions for each of divided areas and to obtain a correction value for each of the areas by performing a computing operation suited for the area . further , in a case where it is impossible to limit the formula for obtaining correction values to one computing method , with the invention applied to a system using interchangeable lenses of varied kinds such as a single - lens reflex camera , computing methods of varied kinds are arranged beforehand and information designating the kind of functions to be used and computing procedures are read out from the side of the lens together with constants necessary for computing correction values . fig1 shows in a block diagram essential parts of a fourth embodiment of the invention . in fig1 , the same parts as those shown in fig1 are indicated with the same reference numerals . the fourth embodiment are arranged in the same manner as the third embodiment with the exception that the computing means 13 in the third embodiment which is disposed on the side of the camera body 6 as shown in fig1 is disposed as a computing means 13 &# 39 ; on the side of the photo - taking lens 1 . in the case of the fourth embodiment , the correction value is computed and the focus detection signal is corrected as described below . referring to fig1 , the computing means 13 &# 39 ; which is disposed on the side of the photo - taking lens 1 receives the result of a detection made by the lens state detecting means 37 through the lens control means 5 and reads the intrinsic constant ij b k from the storage means 4 . then , using the result of the detection - and the intrinsic constant ij b k , the computing means 13 &# 39 ; obtains the state constant a ij by performing a computing operation according to the formula ( 3 ). following this process , the computing means 13 &# 39 ; receives information on coordinates ( x , y ) indicative of the position of a focus detecting area for which focus detection is to be made , from the camera control means 14 through the contacts 16 and the lens control means 5 . then , the computing means 13 &# 39 ; obtains a correction value c through a computing operation according to the formula ( 4 ) using the coordinates ( x , y ) and the state constant a ij . the correction value c thus obtained is sent to the camera control means 14 on the side of the camera body 6 through the lens control means 5 and the contacts 16 . after that , a focus detection signal is corrected and the photo - taking lens 1 is driven in the same manner as in the case of the third embodiment . the third embodiment shown in fig1 is arranged to carry out the computing operations according to the formulas ( 3 ) and ( 4 ) for obtaining the correction value c on the side of the camera body 6 , whereas the fourth embodiment is arranged to carry out all the computing operations on the side of the photo - taking lens 1 . the arrangement of the fourth embodiment , therefore , permits setting the mode of carrying out the computing formulas as desired according to each of photo - taking lenses of varied types , so that the correction can be carried out in an optimum manner for each photo - taking lens . further , in the case of a fifth embodiment of the invention , a focus detecting device of a camera system is arranged to carry out the computation of the formula ( 3 ) on the side of the photo - taking lens 1 and the computation of the formula ( 4 ) on the side of the camera body 6 . this arrangement enables the fifth embodiment to compute , on each side in a closed manner , information apposite to the intrinsic conditions of the photo - taking lens and the camera body , such as the state of the photo - taking lens and the focus detecting area of the camera . therefore , the amount of communication between the photo - taking lens 1 and the camera body 6 can be curtailed and a computing load can be dispersed . thus , the speed of an eventual focusing action can be increased . each of the embodiments described above is arranged by paying attention to the fact that the focal length of the photo - taking lens ( a zooming state ) causes variations in aberration . however , the variations of aberration are not only caused by the focal length but also by the state of location of a focusing lens which is provided for adjustment of the focus of the photo - taking lens ( a focusable object distance &# 34 ; s &# 34 ;). fig1 is a block diagram showing essential parts of a sixth embodiment of the invention . the sixth embodiment is arranged by paying attention to the state of location of the focusing lens . referring to fig1 , a photo - taking optical system 2 &# 39 ; is a single focal length lens . unlike the lens state detecting means 37 in the third embodiment shown in fig1 which is arranged to detect the focal length ( zooming state ), a lens state detecting means 37 &# 39 ; in the sixth embodiment is arranged to detect the state of location of the focusing lens ( the focusable object distance &# 34 ; s &# 34 ;). in the sixth embodiment , the state of location of the focusing lens of the photo - taking optical system 2 &# 39 ; ( the focusable object distance &# 34 ; s &# 34 ;) is detected by an electrode for an encoder disposed on a lens barrel arranged to move one or a plurality of lenses for focusing and a detection electrode which is connected to the encoder electrode . after the state of the focusing lens is detected by the lens state detecting means 37 &# 39 ;, a correction value is computed and correction is carried out in the same manner as in the case of the third embodiment , except that the following formula ( 5 ) is employed in place of the formula ( 3 ): ## equ4 ## it is of course possible to arrange the sixth embodiment to perform all necessary computing operations on the side of the photo - taking lens or to have the computing operations shared by the photo - taking lens and the camera body . fig1 ( a ), 17 ( b ) and 17 ( c ) show in bird &# 39 ; s - eye views the correction values c for three states of location of the focusing lens , i . e ., for focusable object distances of 300 , 650 and 10000 cm , between a nearest object distance to an infinity object distance of a single focal length lens having a focal length of 300 mm . in fig1 ( a ), 17 ( b ) and 17 ( c ), the correction values for a focus detectable area 34 are shown respectively in the forms of continuous curved surfaces 38 - 1 , 38 - 2 and 38 - 3 . changes taking place in the curved surfaces indicative of correction values due to the state of location of the focusing lens ( focusable object distance ) can be closely approximated by the formulas ( 5 ) and ( 4 ). in the case of the sixth embodiment , the values of the intrinsic constant ij b k are as shown below : ______________________________________ . sub . 00 b . sub .- 3 = . sub . 20 b . sub .- 3 = - 1 . 82482 × 10 . sup . 5 . sub . 00 b . sub .- 2 = . sub . 20 b . sub .- 2 = 6 . 90714 × 10 . sup . 2 . sub . 00 b . sub .- 1 = . sub . 20 b . sub .- 1 = - 6 . 31244 × 10 . sup .- 1 . sub . 00 b . sub . 0 = - 8 . 80337 × 10 . sup .- 2 . sub . 20 b . sub . 0 = 1 . 26181 × 10 . sup .- 3 . sub . 01 b . sub .- 3 = . sub . 21 b . sub .- 3 = - 5 . 38152 × 10 . sup . 3 . sub . 01 b . sub .- 2 = - 1 . 29516 × 10 . sup .- 3 . sub . 21 b . sub .- 2 = 3 . 30042 × 10 . sup . 1 . sub . 01 b . sub .- 1 = . sub . 21 b . sub .- 1 = - 5 . 00475 × 10 . sup .- 2 . sub . 01 b . sub . 0 = - 2 . 16675 × 10 . sup .- 4 . sub . 21 b . sub . 0 = 4 . 97814 × 10 . sup .- 6 . sub . 02 b . sub .- 3 = - 1 . 71206 × 10 . sup . 5 . sub . 22 b . sub .- 3 = - 1 . 28248 × 10 . sup . 3 . sub . 02 b . sub .- 2 = . sub . 22 b . sub .- 2 = 3 . 21624 . sub . 02 b . sub .- 1 = - 8 . 76539 × 10 . sup .- 1 . sub . 22 b . sub .- 1 = - 9 . 65103 × 10 . sup .- 4 . sub . 02 b . sub .- 0 = . sub . 22 b . sub . 0 = - 1 . 45070 × 10 . sup .- 7______________________________________ by using these values of the intrinsic constant ij b k , not only the values of the state constant a ij for the object distances in fig1 ( a ), 17 ( b ) and 17 ( c ) but also the values of the state constant a ij for any desired focusable object distances &# 34 ; s &# 34 ; can be accurately computed in accordance with the formula ( 5 ). the values of the state constant a ij for each of the object distances &# 34 ; s &# 34 ; in fig1 ( a ), 17 ( b ) and 17 ( c ) obtainable by the formula ( 5 ) are as shown below : ______________________________________fig . 17 ( a ) a . sub . 00 = a . sub . 01 = 8 . 74587 × 10 . sup .- 5 a . sub . 02 = - 4 . 54790 × 10 . sup .- 4a . sub . 20 = a . sub . 21 = 5 . 55151 × 10 . sup .- 6 a . sub . 22 = - 1 . 51254 × 10 . sup .- 5fig . 17 ( b ) a . sub . 00 = - 8 . 90515 × 10 . sup .- 3 a . sub . 01 = 6 . 98959 × 10 . sup .- 4 a . sub . 02 = 1 . 20506 × 10 . sup .- 3a . sub . 20 = a . sub . 21 = - 1 . 34973 × 10 . sup .- 5 a . sub . 22 = 1 . 31262 × 10 . sup .- 6fig . 17 ( c ) a . sub . 00 = - 8 . 76691 × 10 . sup .- 2 a . sub . 01 = - 1 . 95856 × 10 . sup .- 4 a . sub . 02 = 1 . 64412 × 10 . sup .- 3a . sub . 20 = a . sub . 21 = 4 . 48096 × 10 . sup .- 6 a . sub . 22 = - 1 . 54401 × 10 . sup .- 7______________________________________ in the case of the sixth embodiment , each state constant a ij is expressed by a cubical power series of a reciprocal number of the object distance &# 34 ; s &# 34 ;. the correction value c for the state of one object distance is expressed as a quadratic expression related to x and y axes like in the case of the third embodiment by using six state constants , and each state constant is computed from four intrinsic constants . therefore , in order to obtain a correction value for a desired object distance , a total of 24 (= 6 × 4 ) intrinsic constants must be used . with the arrangement of the sixth embodiment applied to a lens wherein its aberration greatly varies in relation to variations of object distance , the number of constants to be stored can be lessened . incidentally , in the case of the sixth embodiment , object distances are expressed in cm . fig1 is a block diagram showing a seventh embodiment of the invention . the seventh embodiment is arranged to detect both the zooming state and the state of location of a focusing lens and to have intrinsic constants for combinations of the zooming state and the state of location of the focusing lens . the arrangement of the seventh embodiment is similar to the third and sixth embodiments shown in fig1 and 16 but differs from them in the following points . in the seventh embodiment , a photo - taking optical system 2 &# 34 ; has its aberration vary to a relatively great extent in relation to variations of both the zooming state and the state of location of the focusing lens , and a lens state detecting means 37 &# 34 ; is arranged to be capable of detecting both the zooming state of the photo - taking lens 1 ( focal length &# 34 ; f &# 34 ;) and the state of location of the focusing lens ( focusable object distance &# 34 ; s &# 34 ;). the storage means 4 is arranged to retain intrinsic constants ij b km related to both the focal lengths &# 34 ; f &# 34 ; of the photo - taking lens 1 and the focusable object distances &# 34 ; s &# 34 ;. in computing the state constant a ij , the following formula ( 6 ) is used in place of the formula ( 3 ) or ( 5 ): ## equ5 ## after the state constant a ij is obtained , the computing operations of the formulas ( 4 ) and ( 1 ) are performed to obtain a corrected focus detection signal and the focus of the photo - taking lens 1 is adjusted in the same manner as in each of the embodiments described in the foregoing . fig1 ( a )( i ) to 19 ( a )( iii ), 19 ( b )( i ) to 19 ( b )( iii ) and 19 ( c )( i ) to 19 ( c )( iii ) show in bird &# 39 ; s - eye views the correction values c for a zoom lens of a focal length range from 28 mm to 105 mm , covering combinations of three focal length states , i . e ., ( a ) 29 . 0 mm , ( b ) 68 . 3 mm and ( c ) 101 . 0 mm , and three states of location of the focusing lens , i . e ., ( i ) 51 . 2 cm , ( ii ) 140 . 7 cm and ( iii ) 10000 . 0 cm . changes taking place in the curved surfaces indicative of the correction values due to the zooming state and the state of location of the focusing lens can be closely approximated by the formulas ( 6 ) and ( 4 ). in the case of the seventh embodiment , the values of the intrinsic constant ij b km are as shown below : ______________________________________ . sub . 00 b . sub . 0 - 1 = 5 . 88471 . sub . 20 b . sub . 0 - 1 = - 6 . 39029 × 10 . sup .- 2 . sub . 00 b . sub . 00 = 7 . 74959 × 10 . sup .- 4 . sub . 20 b . sub . 00 = 2 . 86681 × 10 . sup .- 3 . sub . 00 b . sub . 01 = 6 . 94592 × 10 . sup .- 7 . sub . 20 b . sub . 01 = - 1 . 76853 × 10 . sup .- 7 . sub . 00 b . sub . 1 - 1 = - 4 . 10150 × 10 . sup .- 1 . sub . 20 b . sub . 1 - 1 = 5 . 00249 × 10 . sup .- 3 . sub . 00 b . sub . 10 = 6 . 16179 × 10 . sup .- 4 . sub . 20 b . sub . 10 = - 1 . 11384 × 10 . sup .- 4 . sub . 00 b . sub . 11 = - 5 . 17015 × 10 . sup .- 9 . sub . 20 b . sub . 11 = 1 . 07601 × 10 . sup .- 8 . sub . 00 b . sub . 2 - 1 = 1 . 19142 × 10 . sup .- 2 . sub . 20 b . sub . 2 - 1 = - 1 . 17816 × 10 . sup .- 4 . sub . 00 b . sub . 20 = - 5 . 43737 × 10 . sup .- 7 . sub . 20 b . sub . 20 = 9 . 97124 × 10 . sup .- 7 . sub . 00 b . sub . 21 = - 7 . 98055 × 10 . sup .- 10 . sub . 20 b . sub . 21 = - 1 . 90934 × 10 . sup .- 10 . sub . 00 b . sub . 3 - 1 = - 6 . 32142 × 10 . sup .- 5 . sub . 20 b . sub . 3 - 1 = 6 . 07171 × 10 . sup .- 7 . sub . 00 b . sub . 30 = - 5 . 07617 × 10 . sup .- 8 . sub . 20 b . sub . 30 = - 1 . 39154 × 10 . sup .- 9 . sub . 00 b . sub . 31 = 7 . 33230 × 10 . sup .- 12 . sub . 20 b . sub . 31 = 1 . 09570 × 10 . sup .- 12 . sub . 01 b . sub . 0 - 1 = 5 . 39853 × 10 . sup .- 2 . sub . 21 b . sub . 0 - 1 = - 7 . 83348 × 10 . sup .- 3 . sub . 01 b . sub . 00 = - 1 . 15261 × 10 . sup .- 2 . sub . 21 b . sub . 00 = 9 . 66035 × 10 . sup .- 5 . sub . 01 b . sub . 01 = 1 . 02897 × 10 . sup .- 7 . sub . 21 b . sub . 01 = - 6 . 81388 × 10 . sup .- 9 . sub . 01 b . sub . 1 - 1 = - 5 . 88806 × 10 . sup .- 3 . sub . 21 b . sub . 1 - 1 = 4 . 63538 × 10 . sup .- 4 . sub . 01 b . sub . 10 = 4 . 22937 × 10 . sup .- 4 . sub . 21 b . sub . 10 = - 4 . 86365 × 10 . sup .- 6 . sub . 01 b . sub . 11 = - 6 . 83787 × 10 . sup .- 9 . sub . 21 b . sub . 11 = 4 . 22758 × 10 . sup .- 10 . sub . 01 b . sub . 2 - 1 = - 1 . 31341 × 10 . sup .- 4 . sub . 21 b . sub . 2 - 1 = - 8 . 71871 × 10 . sup .- 6 . sub . 01 b . sub . 20 = 4 . 99035 × 10 . sup .- 6 . sub . 21 b . sub . 20 = 5 . 55889 × 10 . sup .- 8 . sub . 01 b . sub . 21 = 1 . 13793 × 10 . sup .- 10 . sub . 21 b . sub . 21 = - 7 . 25739 × 10 . sup .- 12 . sub . 01 b . sub . 3 - 1 = - 6 . 36666 × 10 . sup .- 7 . sub . 21 b . sub . 3 - 1 = 4 . 44998 × 10 . sup .- 8 . sub . 01 b . sub . 30 = 2 . 03401 × 10 . sup .- 8 . sub . 21 b . sub . 30 = - 1 . 94420 × 10 . sup .- 10 . sub . 01 b . sub . 31 = 5 . 81317 × 10 . sup .- 13 . sub . 21 b . sub . 31 = 3 . 88384 × 10 . sup .- 14 . sub . 02 b . sub . 0 - 1 = - 4 . 25322 × 10 . sup .- 1 . sub . 22 b . sub . 0 - 1 = 4 . 94371 × 10 . sup .- 4 . sub . 02 b . sub . 00 = 1 . 10636 × 10 . sup .- 3 . sub . 22 b . sub . 00 = - 1 . 04438 × 10 . sup .- 4 . sub . 02 b . sub . 01 = - 1 . 00001 × 10 . sup .- 7 . sub . 22 b . sub . 01 = - 3 . 45645 × 10 . sup .- 9 . sub . 02 b . sub . 1 - 1 = 2 . 36392 × 10 . sup .- 2 . sub . 22 b . sub . 1 - 1 = - 3 . 92619 × 10 . sup .- 5 . sub . 02 b . sub . 10 = - 9 . 54106 × 10 . sup .- 5 . sub . 22 b . sub . 10 = 5 . 49545 × 10 . sup .- 6 . sub . 02 b . sub . 11 = 5 . 49364 × 10 . sup .- 9 . sub . 22 b . sub . 11 = 1 . 91415 × 10 . sup .- 10 . sub . 02 b . sub . 2 - 1 = - 4 . 72316 × 10 . sup .- 4 . sub . 22 b . sub . 2 - 1 = 7 . 97269 × 10 . sup .- 7 . sub . 02 b . sub . 20 = - 2 . 35301 × 10 . sup .- 7 . sub . 22 b . sub . 20 = - 7 . 48773 × 10 . sup .- 8 . sub . 02 b . sub . 21 = - 9 . 93911 × 10 . sup .- 11 . sub . 22 b . sub . 21 = - 2 . 93468 × 10 . sup .- 12 . sub . 02 b . sub . 3 - 1 = 2 . 28178 × 10 . sup .- 6 . sub . 22 b . sub . 3 - 1 = - 3 . 37678 × 10 . sup .- 9 . sub . 02 b . sub . 30 = 1 . 05998 × 10 . sup .- 8 . sub . 22 b . sub . 30 = 3 . 00611 × 10 . sup .- 10 . sub . 02 b . sub . 31 = 7 . 46382 × 10 . sup .- 13 . sub . 22 b . sub . 31 = 1 . 26185 × 10 . sup .- 14______________________________________ by using these values of the intrinsic constant ij b km , not only the values of the state constant a ij which correspond to fig1 ( a )( i ) to 19 ( a )( iii ), 19 ( b )( i ) to 19 ( b )( iii ) and 19 ( c )( i ) to 19 ( c )( iii ) but also the values of the state constant a ij for any desired combination of the focal length &# 34 ; f &# 34 ; and the focusable object distance &# 34 ; s &# 34 ; can be computed in accordance with the formula ( 6 ). in the case of the seventh embodiment , each state constant a ij is expressed as a cubical power series for the focal length &# 34 ; f &# 34 ; and as a sum of three powers of negative first degree , zero degree and first degree for the object distance &# 34 ; s &# 34 ;. since there is a primary term related to the focusable object distance &# 34 ; s &# 34 ;, in the case of the seventh embodiment , the focusable object distance &# 34 ; s &# 34 ; includes values up to an infinity distance value which is , for example , 10000 cm . since the number of terms related to the focal length &# 34 ; f &# 34 ; is 4 , the number of terms related to the focusable object distance &# 34 ; s &# 34 ; is 3 and the number of state constants for each state is 6 , the correction value for an arbitrary state can be computed by using a total of 72 (= 4 × 3 × 6 ) intrinsic constants . in a case where the states of combining the focal length &# 34 ; f &# 34 ; and the object distance &# 34 ; s &# 34 ; are considered , like in the case of the seventh embodiment , adoption of a method of dividing each of these states into a plurality of areas tends to necessitate keeping an innumerably large number of constants in a storage device . therefore , in that case , the advantageous effect of the arrangement of the invention becomes more conspicuous . the values of the state constant a ij which can be obtained by the formula ( 6 ) and correspond to fig1 ( a )( i ) to 19 ( a )( iii ), 19 ( b )( i ) to 19 ( b )( iii ) and 19 ( c )( i ) to 19 ( c )( iii ) are as shown below : ______________________________________fig . 19 ( a ) ( i ) a . sub . 00 = a . sub . 01 = - 3 . 38456 × 10 . sup .- 3 a . sub . 02 = - 3 . 18985 × 10 . sup .- 3a . sub . 20 = a . sub . 21 = - 1 . 48921 × 10 . sup .- 5 a . sub . 22 = - 1 . 77876 × 10 . sup .- 6fig . 19 ( a ) ( ii ) a . sub . 00 = a . sub . 01 = - 3 . 11451 × 10 . sup .- 3 a . sub . 02 = - 2 . 18007 × 10 . sup .- 3a . sub . 20 = a . sub . 01 = - 6 . 95346 × 10 . sup .- 6 a . sub . 22 = - 1 . 08757 × 10 . sup .- 6fig . 19 ( a ) ( iii ) a . sub . 00 = a . sub . 01 = - 3 . 09873 × 10 . sup .- 3 a . sub . 02 = - 1 . 66981 × 10 . sup .- 3a . sub . 20 = a . sub . 21 = 3 . 83127 × 10 . sup .- 7 a . sub . 22 = - 1 . 33389 × 10 . sup .- 6fig . 19 ( b ) ( i ) a . sub . 00 = a . sub . 01 = 1 . 76466 × 10 . sup .- 3 a . sub . 02 = - 8 . 72790 × 10 . sup .- 3a . sub . 20 = - 2 . 06052 × 10 . sup .- 3 a . sub . 21 = - 9 . 01901 × 10 . sup .- 5 a . sub . 22 = 2 . 62943 × 10 . sup .- 5fig . 19 ( b ) ( ii ) a . sub . 00 = a . sub . 01 = 9 . 98550 × 10 . sup .- 4 a . sub . 02 = - 5 . 16203 × 10 . sup .- 3a . sub . 20 = - 1 . 08673 × 10 . sup .- 3 a . sub . 21 = - 5 . 70560 × 10 . sup .- 5 a . sub . 22 = 2 . 06361 × 10 . sup .- 5fig . 19 ( b ) ( iii ) a . sub . 00 = a . sub . 01 = 3 . 83031 × 10 . sup .- 4 a . sub . 02 = - 2 . 66758 × 10 . sup .- 3a . sub . 20 = - 3 . 75876 × 10 . sup .- 4 a . sub . 21 = - 3 . 26678 × 10 . sup .- 5 a . sub . 22 = 1 . 69464 × 10 . sup .- 5fig . 19 ( c ) ( i ) a . sub . 00 = a . sub . 01 = 4 . 07184 × 10 . sup .- 3 a . sub . 02 = - 9 . 78182 × 10 . sup .- 3a . sub . 20 = - 2 . 25168 × 10 . sup .- 3 a . sub . 21 = - 1 . 07082 × 10 . sup .- 4 a . sub . 22 = 1 . 95118 × 10 . sup .- 5fig . 19 ( c ) ( ii ) a . sub . 00 = a . sub . 01 = 2 . 28356 × 10 . sup .- 3 a . sub . 02 = - 3 . 47714 × 10 . sup .- 3a . sub . 20 = - 5 . 65797 × 10 . sup .- 4 a . sub . 21 = - 5 . 63192 × 10 . sup .- 5 a . sub . 22 = 4 . 59993 × 10 . sup .- 6fig . 19 ( c ) ( iii ) a . sub . 00 = a . sub . 01 = 1 . 00733 × 10 . sup .- 3 a . sub . 02 = 2 . 18201 × 10 . sup .- 3a . sub . 20 = a . sub . 21 = - 8 . 59663 × 10 . sup .- 6 a . sub . 22 = - 1 . 42778 × 10 . sup .- 5______________________________________ the embodiments have been described by way of example above on the assumption that variations in aberration of the photo - taking lens are caused by the focal length and the focusable object distance . however , other conceivable causes for variations in aberration include the diaphragm of the photo - taking lens . the correction can be accomplished also with respect to the diaphragm in the same manner as the arrangement of the embodiments described above . more specifically , in that case , the correction can be made by keeping intrinsic constants indicative of the lens characteristics relative to changes of aperture , and by detecting , with a lens state detecting means , a photo - taking aperture value decided on the basis of information inputted from outside and information from a light measuring system disposed within the camera body . in cases where the variations in state of photo - taking lenses bring about changes in aberration to such an extent that affects focus detection , the invention is applicable to such cases in general as long as such variations of states are detectable . further , in a case where there are a plurality of such state variations that must be noted , correction can be accurately carried out according to the invention by keeping in a storage device a limited number of intrinsic constants for a combination of two or three or more of such state variations .	6
in accordance with the present invention an aqueous solution containing a mixture of sodium silicate and nonionic surfactant , preferably basic h , is added to a premix for the preparation of concrete , and the resulting mixture blended until a mixture of substantially uniform consistency is obtained . the mixture is then sprayed , troweled or poured into molds of a desired shape and cured for periods of about 5 to 12 days . while the material has sufficient strength at the end of such time , it will continue to improve in compressive strength for some time thereafter . the mixture of sodium silicate and nonionic surfactant contains from about 30 to 65 percent by weight of sodium silicate and from about 70 to 35 percent by weight of nonionic surfactant . suitable pre - concrete mixes according to the present invention contain : 3 to 5 gallons of water having dissolved therein from 1 . 2 to 1 . 8 oz . of sodium silicate and 1 . 5 to 2 . 5 oz . of a nonionic surfactant . when sawdust or an equivalent thereof is added to the pre - concrete mix , suitable compositions according to the present invention contain : 8 to 12 gallons water having dissolved therein from 16 to 32 oz . sodium silicate and 4 to 6 oz . of a nonionic surfactant . the amount of sawdust or other fibrous material can be increased to about 50 to 60 percent by volume without effecting the strength and other desirable properties of the building material . the sawdust should be dry to avoid excessive curing times and is preferably derived from hardwoods such as oak or hickory . in preparing the building material , it is preferred that the sawdust be wetted with a small amount of the sodium silicate - basic h mixture and then be mixed with the clay to seal the sawdust from excessive wetting and to provide a good bond with the cement . unless the material is to be sprayed , lime is added , followed by cement and sufficient sodium silicate - basic h mixture to make a good mix for the purpose intended . the sawdust - containing concrete building material can be cast into blocks , bricks , sheets , posts and so forth . it may also be used for doors , burial vaults , flower pots or the like wherever concrete , wood or substitutes therefor are used today . in view of its considerably lighter weight , items made from such sawdust - containing building material are more easily handled than concrete blocks , sheets , bricks or the like and , unlike concrete , can be readily nailed , screwed , sawed or drilled without special tools and without cracking or chipping . sawdust - containing building blocks in accordance with the present invention , weighing from about 20 to 30 pounds , depending on size and the amount of sawdust and clay substituted for the sand and gravel , have good compressive strength and good insulative and soundproofing properties . they are also termite resistant and they can bend slightly and do not sweat like concrete . as such , they are useful in building walls , floors , chimneys and the like . a building constructed of such blocks need only be sealed inside and out to preserve its insulative properties , and can be finished with a spray - on stucco material to hide the seams for an attractive , low - cost commercial or residential building . top beams of 2 × 8 &# 39 ; s can be nailed , over polyethylene , directly to the top row of blocks without requiring bond blocks as with concrete blocks . paneling or siding , if desired , can be nailed directly onto the walls , and doors and windows can be directly secured thereto for a better and tighter fit . if desired , suitable dyes and pigments may be added to the building material before it is cast to provide desired colors in the finished items or they may be painted or otherwise coated as desired after they are cured . the invention will be more fully illustrated in the examples which follow . these examples are given by way of illustration and are not to be considered as limiting . a number of concrete blocks measuring 8 × 8 × 16 &# 34 ; were prepared from a mix consisting of : ______________________________________4 5 - gal . buckets sand3 5 - gal . buckets gravel2 5 - gal . buckets lime1 5 - gal . buckets portland cement3 to 5 gallons of water containing 1 . 9 oz . sodium silicate and 2 . 5 oz . basic h . ______________________________________ control blocks were similarly prepared except that the water did not contain sodium silicate and basic h . the concrete was mixed in a cement mixer in the customary manner and cast into blocks which were cured for periods of 8 to 21 days . the blocks were then tested for their compressive strength . the results are given in table i below . a (+) next to the identification number indicates that the blocks contained the sodium silicate - basic h mixture ; a (-) indicates an absence of the mixture . compressive strength is reported in pounds per square inch and the weight of the block is in pounds . table i______________________________________identification age ( days ) compressive strength wt ./ block______________________________________1 + 8 1159 38 . 12 + 8 1033 36 . 43 + 8 1109 38 . 54 + 21 1273 38 . 05 + 21 1449 38 . 36 - 21 676 38 . 07 - 21 584 36 . 8______________________________________ a number of sawdust corner blocks ( c ) measuring 8 × 8 × 16 &# 34 ; were made from a mix consisting of : ______________________________________ 10 5 - gal . buckets sawdust5 5 - gal . buckets portland cement2 5 - gal . buckets lime . 5 5 - gal . buckets missouri clay8 to 10 gallons water______________________________________ as shown in table ii below , the blocks cast from a mix wherein the water included 1 qt . per gallon 40 % sodium silicate ( 16 to 32 oz .) and 0 . 5 oz . per gallon basic h ( 4 to 5 oz .) are designated plus (+). those blocks made without the sodium silicate - basic h admixture are designated minus (-). other than for the presence or absence of the sodium silicate - basic h admixture in the water , all of the blocks were made in the same way : the ten buckets of sawdust were loaded into a suitably sized cement mixer and the mixer was started . as the sawdust was tumbled in the mixer , sufficient water was added to wet the sawdust . the powdered clay , lime and cement were added one - by - one in the order mentioned to the wetted sawdust . when this mixture had been thoroughly mixed , sufficient water was then added to provide a mix with a suitable texture for casting . the mixture was then filled into molds , the molds vibrated and the mixture compressed under 3 , 000 lbs . compressive force . the blocks were then released from the molds and cured under ambient conditions for 28 days . at the end of 28 days , the cured blocks were tested for compressive strength . the results are reported in table ii . compressive strength is reported as the total load in pounds and the weight of the blocks is in pounds . table ii______________________________________identification compressive strength wt ./ block______________________________________c + 69 , 800 27 . 2c + 69 , 500 27 . 75c + 71 , 000 28 . 5c - 63 , 000 27 . 8______________________________________ following the procedure of example ii , sawdust stretcher blocks ( s ) were made but were allowed to cure for only 5 or 12 days before testing . the results are reported in table iii . compressive strength is reported in pounds per square inch and the weight of the blocks is in pounds . table iii______________________________________identification age ( days ) compressive strength wt ./ block______________________________________s + 5 433 25 . 4s + 12 472 25 . 4s - 5 408 24 . 4s - 12 435 24 . 6______________________________________ in view of the above , it will be seen that the several objects of the invention are achieved and other advantageous results attained . as various changes could be made in the above products without departing from the scope of the invention , it is intended that all matter contained in the above description shall be interpreted as illustrative and not in a limiting sense .	2
illustrative embodiments of the present invention are illustrated in the figures , like numerals being used to refer to like and corresponding parts of the various drawings . fig1 shows multipoint gaseous fuel delivery system 10 that , in the illustrated embodiment , includes fuel metering valve assembly 12 . fuel metering valve assembly 12 includes a number of fuel metering valves , such as fuel injectors 14 , that inject a fuel into individual cylinders or combustion chambers of engine 16 . output from each fuel injector 14 passes through delivery tube 18 to mixer plate 20 . mixer plate 20 is positioned , for example , in the engine 16 intake manifold between manifold upper section 22 and manifold lower section 24 and provides a separate path of fuel from each fuel injector to each combustion chamber of engine 16 . engine control module ( ecm ) 26 receives numerous pressure , temperature and other operating signals from sensors 28 that sense operating parameters of engine 16 . ecm 26 processes these signals and , in response to the processed signals , directs the operation of each fuel injector 14 . fuel metering valve assembly 12 receives from pressurized fuel line 30 a pressurized fuel from pressure regulator 32 . pressure regulator 32 receives gaseous fuel from fuel storage container 34 via high pressure fuel supply line 36 . engine 16 may be a positive displacement or rotary engine having at least one cylinder or combustion chamber . placement of mixer plate 20 depends on the many possible embodiments of the present invention . for example , mixer plate 20 may be placed between the intake manifold of engine 16 and the intake ports to each combustion chamber of engine 16 . as defined herein , each intake port is that portion of the manifold that directs intake air and fuel is separated into one separate path per combustion chamber . alternatively , mixer plate 20 may be placed in the air / fuel path between the engine head and the intake manifold . essentially any place that can accommodate the size of mixer plate and that permits the selective introduction of fuel from fuel injectors 14 to the engine 16 combustion chambers is a practical position for mixer plate 20 and clearly within the scope of the present invention . although numerous devices may serve the function of ecm 26 to establish a microprocessor - based control system , one system adaptable to the system of the present embodiment is part no . 1707004 that is manufactured by mesa environmental ventures , co ., of fort worth , tex . ecm 26 may control the operation of fuel injectors 14 according to a predetermined control strategy . the optimal control strategy may vary for a particular engine and can be determined using test methodology familiar to engine development engineers of ordinary skill in the art . another controller for controlling the performance of fuel injectors 14 may be through the use of the onboard engine controller for a gasoline engine that is modified to control operation of the fuel injectors 14 . ecm 26 may also include a harness , sensors and other components to provide microprocessor - based control of fuel metering valve assembly 12 . in fig1 fuel storage container 34 may be a compressed or liquid natural gas cylinder , an liquid propane gas tank , or other form of fuel storage tank for gaseous fuels , where the term &# 34 ; gaseous fuel &# 34 ; means a fuel that is in a gaseous state under normal ambient conditions . fig2 illustrates fuel delivery assembly 40 of one embodiment of the invention . fuel delivery assembly 40 includes fuel metering valve assembly 12 and fuel delivery hose assembly 42 . fuel delivery hose assembly 42 protects the individual fuel delivery hoses 18 that go to the combustion chambers of engine 16 . in the embodiment of fig2 fuel delivery hose assembly 42 is bundled using a corrugated loom 44 that is flexible and that protects each individual fuel delivery hose 18 . this form of fuel bundled assembly 42 , however , is optional . fig3 shows in more detail fuel metering valve assembly 12 that includes fuel supply block 46 to which each individual fuel injector 14 attaches . each individual fuel injector 14 includes a connection 48 to ecm 26 . cross bars 50 and connecting shafts 52 hold each fuel injector 14 securely to fuel supply block 46 . referring now to both fig2 and 3 , fuel supply block 46 receives fuel at connection 54 and distributes gaseous fuel to each fuel injector 14 . in the preferred embodiment , each fuel injector 14 is solenoid - operated and outputs to hose connection 56 which also attaches to a cross bar 50 . fuel supply block 46 may also optionally include temperature sensor 58 , pressure sensor 60 , and fuel shut - off valve 61 . fig4 a and 4b show views of mixer plate 20 of the present embodiment . mixer plate 20 is formed to permit its placement between manifold upper section 22 and the manifold lower portion 24 of each combustion chamber of engine 16 ( see fig1 ). in the embodiment of fig4 a and 4b , mixer plate 20 is configured for a six - cylinder internal combustion engine 16 . that is , mixer plate 20 includes six intake openings 62 , each having a diameter equivalent to the diameter of the intake port for the associated combustion chamber of engine 16 . intake opening 62 also connects , via a cross passage , such as cross passage 64 , to through - hole 66 . for secure placement of mixer plate 20 between manifold upper section 22 and manifold lower portion 24 of engine 16 , screwholes 68 align to existing screwholes that bolt manifold upper portion 22 to manifold lower portion 24 . mixer plate 20 has a thickness of approximately one - quarter inch , in the embodiment of fig4 a and 4b , and may be made of an aluminum material . fig4 b illustrates a banjo - type fitting 70 that the present embodiment uses in conjunction with mixer plate 20 . banjo - type fitting 70 includes fuel delivery hose connector 72 that receives fuel delivery hose 18 and around which bevelled washer 74 fits . o - ring 76 fits within bevelled washer 74 and maintains an airtight seal with the top surface 78 of mixer plate 20 and connector 72 . along bottom surface 80 of mixer plate 20 and opposite banjo - type hose connector 72 is securing mechanism 82 . securing mechanism 82 includes o - ring 84 that maintains an airtight seal between bottom surface 80 and delivery hose connector 72 . nut 88 holds hose connector 72 and securing mechanism 82 firmly in place within mixer plate 20 . in operation of banjo - type fitting 70 , gaseous fuel flows from fuel delivery hose 18 ( fig1 and 2 ), through banjo - type fitting 72 and out passageway 90 . when banjo - type fitting 70 is placed within through - hole 66 , the second or alternative fuel , which is preferably a gaseous fuel , passes into the opening established by the fitting of beveled washers 74 and 86 and tightly sealed by o - ring 76 and 84 . fuel then passes into cross - passage opening 92 . as fig4 illustrates , from cross - passage opening 92 gaseous fuel passes to outlet 94 and then to associated intake opening 62 and into the manifold lower portion 24 of engine 16 . the introduction point for the second fuel that the present invention provides is at an optimal point relative to manifold dynamics . each one of the fuel injectors 14 may respond to a separate sensed signal associated with its respective combustion chamber and may provide more or less flow of the second fuel based on that particular combustion chamber &# 39 ; s power demand . as opposed to injecting the fuel into the engine intake manifold and then distributing the fuel to all combustion chambers , the present embodiment injects the fuel directly into the intake port of an associated combustion chamber . by selectively injecting fuel into an associated manifold lower portion 24 , the present embodiment more precisely delivers the alternative fuel to the engine . the result is a more responsive engine that is capable of improved driveability , less hesitation , and better emission control when compared to other types of engines that introduce fuel upstream of the intake manifold . in addition , placing the fuel supply at manifold lower portion 24 makes it possible for the engine to receive , alternatively , gasoline fuel or a gaseous fuel , such as compressed or liquid natural gas or liquid propane gas fuel . the result is either a monofuel engine with a dedicated multipoint fuel injection system or a bi - fuel engine with the selective capability of using two different types of fuel at least one of which is provided via multipoint injection . fig5 illustrates an alternative embodiment of the invention that includes mixer plate 100 for positioning between manifold upper section 22 and manifold lower portion 24 . mixer plate 100 includes fitting 102 into which gaseous fuel injector 14 connects . instead of fitting 102 , a boss or other mechanism for introducing fuel into mixer plate 100 may be used . fuel injector 14 includes connection 48 to ecm 26 ( see fig1 ). fuel to gaseous fuel injector 14 comes through connection 104 of fuel supply rail 106 . fuel supply rail 106 receives gaseous fuel directly from pressure regulator 32 and contains pressurized gaseous fuel in fuel supply passage 108 . pressure sensor 110 may detect and generate a signal indicating the pressure in fuel supply passage 108 . also , temperature sensor 111 may detect and generate a signal indicating the temperature in fuel supply passage 108 . fig6 a through 6c illustrate further alternative embodiments of the present invention . in particular , fig6 a shows injector adapter 120 to which gasoline fuel injector 122 attaches for delivering the liquid gasoline fuel . adapter 120 includes input 124 for receiving gas from an alternative fuel metering device such as fuel injector 14 of fig1 . adapter 120 substitutes for and eliminates the need for mixer plate 20 . fig6 b shows an alternative embodiment of the injector adapter 120 of fig6 a as injector adapter 126 that locates gasoline fuel injector 122 in its original position relative to the intake manifold . in other words , while injector adapter 120 of fig6 a slightly elevates gasoline fuel injector 122 , injector adapter 126 of fig6 b maintains constant the position of gasoline fuel injector 122 for engines that require such a design . injector adapter 126 also includes gaseous fuel input 128 . fig6 c shows a further embodiment in the form of injector adapter 130 that may receive in combination gasoline fuel injector 122 and natural gas fuel injector 14 , both as previously described . injector adapter 130 further eliminates the need for metering device tube assembly 40 and the associated metering device tube 18 . for injector adapter 130 , the second fuel flows directly from fuel injector 14 to adapter output 132 via gaseous fuel input 134 . fuel supply rail 106 provides gaseous fuel to gaseous fuel injector 14 . another embodiment of injector adapter 130 that includes the feature of maintaining constant the position of gasoline fuel injector 122 relative to the intake manifold ( similar to the feature of injector adapter 126 of fig6 b ) is also within the scope of the present invention . fig7 illustrates a further alternative embodiment 140 of the multipoint gaseous fuel delivery system of the present invention . in particular , from fuel metering valve assembly 12 , fuel delivery tube 18 connects to injector nozzle 142 . injector nozzle 142 fits within a formed hole or penetration 144 of intake manifold 146 . from injector nozzle 142 the fuel enters intake manifold 146 through passage 143 and passes directly into engine 16 . this embodiment may be desirable to overcome space limitations near engine 16 and where it is practical to remotely use fuel metering valve assembly 12 . in operation and with reference to fig1 through 4 , multipoint fuel delivery system 10 provides an alternative or second fuel to internal combustion engine 16 for improved control in both steady state and transient operations . to more fully understand the operation of alternative fuel delivery system 10 , consider the instance of steady state engine operation . engine pressure and temperature signals , as well as other engine control signal inputs , go to ecm 26 for the generation of control signals to each of fuel injectors 14 on fuel metering valve assembly 12 . based on control signals from ecm 26 , one or more of fuel injectors 14 will open to send fuel from line 30 through a respective fuel delivery tube 18 . as fuel enters tube 18 , it passes to mixer plate 20 where , using banjo - type fitting 70 , fuel passes into through - hole 66 and into cross passage 64 . from cross passage 64 , fuel passes to intake opening 62 . from intake opening 62 , the alternative fuel goes directly into the respective manifold lower portion 24 and into the engine combustion chamber . this provides the necessary fuel to respond to the engine 16 demand for the respective combustion chamber . this combustion chamber output directly affects the pressure temperature and other sensed parameters that go to engine control module 26 . in response , engine control module 26 will send adjusted signals to each of fuel injectors 14 on fuel metering valve assembly 12 . the other embodiments described in fig5 through 7 operate in an essentially similar manner . the result , irrespective of the embodiment , is a more responsive internal combustion engine with multipoint injection capability . the direct benefits of the present embodiment include improved driveability , improved tip - in response , and reduced emissions relative to throttle body and other forms of alternative fuel injection . this is due to the more immediate and direct control that the present embodiment provides . although the invention has been described with reference to the above - specified embodiments , this description is not meant to be construed in a limiting sense , various modifications of a disclosed embodiment , as well as alternative embodiments of the invention will become apparent to persons skilled in the art upon reference to the above description . it is therefore , contemplated that the appended claims will cover such modifications that fall within the true scope of the invention .	5
the illustration in the drawings is schematically and not to scale . in different drawings , similar or identical elements are provided with the same reference numerals . fig1 a shows a measurement setup for differential phase - contrast imaging ( dpci setup ). the imaging apparatus comprising a source of electromagnetic radiation , for example an x - ray source or an optical source , symbolized by the focal spot 401 . after the source , an absorption or source grating 300 ( g 0 ) is arranged for spatial beam coherence . the incoherent x - ray source used is symbolized by the focal spot 401 . the radiation beam emitted by the source has an optical axis 404 . first , the beam passes the absorption grating 300 . then , the beam passes the object of interest 403 and then the phase grating 100 ( g 1 ). after that , the beam passes a second absorption grating 200 ( g 2 ), which is arranged before the imaging detector 402 . the phase grating 100 is adapted for producing an interference pattern between g 1 and g 2 . fig1 b shows a cross - section of the imaging setup of fig1 a . the grating 300 has a first pitch p 0 , the phase grating 100 has a second pitch p 1 and the second absorption grating 200 has a third pitch p 2 . the distance between the gratings 300 , 100 is 1 and the distance between the gratings 100 and 200 is d which correspond to the talbot distance . fig1 c shows cross - sections of the three gratings 300 , 100 , 200 . as can be seen from fig1 c , the gratings 300 and 200 are filled with gold . wherein the phase grating 100 ( in the middle ) has trenches which are not filled , but etched into the silicon substrate . fig2 shows an interference pattern created between g 1 and g 2 , demonstrating the “ self - imaging ” effect of the grid in characteristic distances d 1 , d 2 and d 3 ( talbot effect ). the relative position of the minima and maxima depends on the phase - shift of the wave front incident on g 1 . in currently used dpci setups , d 1 is typically in the order of several cm . fig3 shows the detection of the “ differential phase - contrast ” by shifting the absorber grid g 2 in a direction x perpendicular to the optical axis and perpendicular to the orientation of the grating lines in a cross - sectional view perpendicular to the optical axis . the difference in the wave front phase at two positions “ 1 ” and “ 2 ” can be extracted from the phase - shift φ 2 − φ 1 of the measured moire pattern , here for four sampling positions x 1 to x 4 . one of the critical topics for the realization of a system for human imaging is the cone - beam geometry that is necessary for the imaging of larger objects like for example in mammography or neuro applications . in the case of non - focused gratings , typically a strong phase - contrast deterioration in regions outside the centre fov is seen , as a rectangular structure creates a trapezoid profile in a projection with a particular angle to the optical axis . for the adaption to the cone - beam geometry it may be necessary to have focused trench structures for the gratings g 0 , g 1 and g 2 . methods of wet etching ( e . g . with the help of heated potassium hydroxide ( koh ) solutions which can be used for crystallographic etching of silicon ) or drie ( deep reactive ion etching ) may be used to etch trenches with a high aspect ratio into a silicon wafer . the regular structure within a defined pitch is a critical parameter . as the requirements for the aspect ratio for the etching — but later also for the filling with an absorber material are quite demanding , the gratings are usually realized with a parallel structure ( see fig4 ). according to the invention , the structuring of the grating results in a focused grating geometry . as the etching process is an isotropic process it may be necessary to bring trenches in the preferred direction into the silicon . it is possible to drill holes in silicon and also to structure areas with a laser . however , the surface structure of a laser - drilled hole may be not as perfect as it is needed for the gratings . 1 . trenches are “ written ” into silicon wafer along the grating line direction but with a slight increased angle from trench to trench . this gives the rough “ focusing ” direction of the overall structure . during the trench “ writing ” process the laser ( or other appropriate source of electromagnetic radiation ) has to be focused to the different depth inside the silicon and also the beam shape has to be adapted to achieve an almost straight profile line at the side of the trench . 2 . the post - processing step is an etching step to “ clean ” and smoothen the surfaces and to optimize the grating structure . the following figures illustrate the geometries of the grating and the measurement setup . fig5 shows a measurement setup for an imaging apparatus according to an exemplary embodiment of the invention . in direction of the optical axis , the source grating 300 ( g 0 ) is arranged behind the x - ray source 401 . next in order , the beam transmits an object of interest 403 . next in order , the beam passes the phase grating 100 ( g 1 ) followed by the absorption grating 200 ( g 2 ) before being detected . fig6 shows a cross - section of a grating with parallel trenches . the angle between the optical axis 404 ( identical to the primary axis ) and the trenches is 0 degrees . in other words , the trenches are non - tilted trenches . fig7 shows a cross - section ( not to scale ) of angular tilted trenches which have been formed by a laser beam ( focusing to the depth and tilting ) and are located inside a wafer material 701 . each of the trenches 101 to 113 has a different tilted angle with respect to the optical or primary axis 404 . as can be seen from fig7 , the laser beam has an incident angle corresponding to the tilting angle of each trench . however , after laser beam writing the wall of the trenches may be not smooth enough for optimal image quality . fig8 shows a cross - section of the grating 100 , 200 depicted in fig7 after post - processing with an appropriate etching step . the walls of the trenches 101 to 113 are now smooth . another extension of the structuring technique results in a focused and trapezoid design of the g 0 grating 300 . in addition to a focused design , a trapezoid shape for each trench 901 - 908 allows x - rays or other beams of electromagnetic radiation to pass in a broader angular distribution , i . e . the output of such a g 0 grating is increased . this may be performed with deep reactive ion etching ( drie etching ) technology by reducing the parameter for etching in relation to the isolation step in the “ bosch ” process . in such a way a more closing ( or opening ) trench geometry can be realized . this is depicted in fig9 . an obstacle in the translation of x - ray differential phase - contrast imaging towards higher x - ray energies is the production of phase gratings and absorption gratings with high aspect ratio . if the distance between these two gratings is kept constant , the aspect ratio r of the phase grating increases like e 3 / 2 , wherein e is the x - ray energy . the limit in aspect ratio r of state - of - the - art fabrication of gratings made from silicon is currently between 15 and 20 , depending on many factors like pitch ( in the region of a few microns ), surface roughness , etc . therefore , the range of usable energies for dpc currently ends at about 30 to 40 kev . in other words , the trench depth is proportional to e for constant ( pi ) phase shift and the depth goes like 1 / sqrt ( e ) due to the talbot condition . in the following , a simple and effective way to overcome the above restrictions is disclosed , allowing the application at higher x - ray energies without the need to go to gratings with higher physical aspect ratios ( adaptive to energy ). especially the phase grating could be tilted adaptively to the selected mean energy of the x - ray spectrum . in the usual concept of dpc , the x - ray photons are incident perpendicular to the grating surface . the central idea of the above and in the following described invention consists of aligning the grating normal at a given angle with respect to the incoming x - rays by rotating the gratings around an axis perpendicular to both , the direction of the incoming x - rays and the direction determined by the lines of the gratings . this can be achieved by rotation of the gratings or , as depicted in fig1 c , by tilting the gratings with respect to the substrate surface and thus with respect to the primary axis . as can be seen from fig1 , the effective aspect ratio r eff is related to the physical aspect ratio r via r f = r / cos α , wherein α 1003 is the angle between the incident rays 1002 and the grating normal 1001 ( see fig1 ). the grating is referenced with numeral 1000 . in other words , the effective aspect ratio r f in the case of fig1 is higher by a factor of 1 / cos α with respect to the case depicted in fig1 where the incident beam is parallel to the surface normal 1001 . since the phase grating and the absorption grating are part of a talbot interferometer , both gratings should be tilted with respect to the incoming x - rays while staying parallel with respect to each other . for small angles α it may be feasible to keep also the detector parallel to the gratings ( see fig1 a ). however , for higher angles , the detectors 402 may be kept perpendicular to the optical or primary axis 404 of the system ( direction of x - ray propagation ). see for example fig1 b . in this case it may be necessary to correct for the different lengths of the propagation before and after phase / absorption grating pair 100 , 200 . as can be seen from fig1 c , both gratings 100 , 200 and the detector 402 are arranged perpendicular to the incoming x - rays 404 . however , the gratings 100 , 200 have trenches 101 , 102 , 103 , 104 etc ., which are tilted with respect to the optical axis 404 such that the walls of the trenches are not in the same plane as the optical axis 104 . reference numerals 1202 , 1203 show two walls of the trenches , which may be grown on the substrate 1201 . alternatively , the trenches may be etched in the above described etching process the embodiment of fig1 c reduces the distance between phase and absorption grating 100 , 200 and allows that the detector 402 can be positioned right after the absorption grating 200 ( g 2 ). fig1 shows a flow - chart of an exemplary embodiment of the invention . in step 1301 the trenches are pre - fabricated or “ written ” by a controlled laser beam or other radiation beam . in step 1302 the trenches are post - processed by etching in order to smooth the surfaces . the present invention applies to imaging systems that are based on the gratings interferometer type as disclosed in pfeiffer et al ., nature physics 2 , 258 ( 2006 ). in particular , an application of the invention can be found in all modalities related to differential phase - contrast imaging , i . e . in stationary transmission geometries ( i . e . mammography , fluoroscopy , etc . ), but also computed tomography and related rotational x - ray imaging technologies . it should be noted that the term “ comprising ” does not exclude other elements or steps and the “ a ” or “ an ” does not exclude a plurality . also elements described in association with different embodiments may be combined . it should also be noted that reference signs in the claims shall not be construed as limiting the scope of the claims .	0
an embodiment of the invention is explained below with reference to a case in which sip is used as a peer - to - peer communication session control protocol and cops as a policy distribution protocol . in embodying the invention , the session control protocol is not limited to sip , and the policy distribution protocol other than cops may be used . [ 0024 ] fig1 is a block diagram showing a block configuration of a session relay apparatus according to the invention . a session relay apparatus 10 according to the invention comprises a packet transmitter / receiver 100 for transmitting / receiving ip packets , a session control unit 110 for controlling the peer - to - peer communication session , a session storage unit 120 for holding the session status , a policy distribution unit 200 for distributing a policy to edge nodes , a policy generating unit 210 for generating a policy , a policy storage unit 220 for storing the policy generated , and a communication terminal - relay node correspondence storage unit 230 for holding the correspondence between each communication terminal and a corresponding edge node for accommodating the particular communication terminal . in this configuration , the session relay apparatus 10 receives a peer - to - peer communication session control message transmitted from the peer - to - peer communication terminal 15 on the ip network and transfers the peer - to - peer communication session control message to the session relay apparatus 10 for managing a destination communication terminal . the session relay apparatus 10 distributes the policy to the edge node 20 accommodating the communication terminal at the start and end of the session . [ 0025 ] fig2 is a diagram showing a mesh network configuration in which the session relay apparatus according to the invention is used with the ip network of diffserv as a qos - controllable ip network . the policy used for the network is not limited to the priority control using the dscp value based on diffserv but may be other policies for embodying the invention . more specifically , a mesh configuration configured of an edge node 20 providing a relay node and a core node 30 and the operation are shown for the peer - to - peer communication with a qos policy set by the dscp value between a peer - to - peer communication terminal 15 a having an ip address of 192 . 168 . 10 . 1 and a destination communication terminal 15 b having an ip address of 192 . 168 . 20 . 1 through an ip network capable of qos control based on the dscp value . in starting the peer - to - peer communication with the communication terminal 15 b , the first step is for the communication terminal 15 a to transfer a peer - to - peer communication session control message requesting the session relay apparatus 10 a having the ip addresses 192 . 168 . 100 . 10 to start the peer - to - peer communication with the communication terminal 15 b . the peer - to - peer communication session control message from the communication terminal 15 a is transmitted to the communication terminal 15 b through the relay apparatus 10 a according to the invention and the relay apparatus 10 b having the ip address 192 . 168 . 100 . 20 for managing the communication terminal 15 b . in the process , the relays apparatus 10 a and 10 b analyze the peer - to - peer communication session control message individually , and extracting the qos classification conditions for the peer - to - peer communication , generate a qos policy for communication between the communication terminals 15 a and 15 b . the term “ the qos classification conditions ”, as described later with reference to fig7 is defined as the conditions including the information for identifying a packet determined by the address value and the port number of the packet , and a packet satisfying the conditions is assigned a dscp value adapted for the particular conditions . the qos policy generated is set in the edge node 20 a of ip address 192 . 168 . 100 . 1 accommodating the communication terminal 15 a and the edge node 20 b of ip address 192 . 168 . 100 . 2 accommodating the communication terminal 15 b . by doing so , these edge nodes are governed by the policy for setting the dscp value predetermined for the packets meeting the qos classification conditions . the session relays apparatus according to the invention and an example of the operation of a communication network ( the qos - controlled peer - to - peer communication operation between the terminals ) using the same session relays apparatus is explained below with reference to fig3 to 9 . [ 0029 ] fig3 is a sequence diagram showing the communication process for the communication terminal a ( 15 a ) to start the peer - to - peer communication with the communication terminal b ( 15 b ). first , the communication terminal a ( 15 a ) sends an invite message 501 providing a session control message requesting the session relay apparatus a ( 10 a ) to start the peer - to - peer communication with the communication terminal b . fig4 shows the contents of the invite message sent from the communication terminal a ( 10 a ). the header of the control message provides the session information 800 , and the portion stored in the payload of the control message and described by sdp ( session description protocol ) provides the peer - to - peer communication information 801 . as described above , the session information contains information required to uniquely identify the session such as id information for the communication terminal , and the peer - to - peer communication information contains information required to specify the contents of the peer - to - peer communication such as the communication data type and the protocol used for communication of the particular data type . it is seen from fig4 that the transmitter ip address is 192 . 168 . 10 . 1 ( 810 ), the destination port number is 49170 ( 820 ), the communication data is audio , and rtp ( realtime transport protocol ) is used as a communication protocol . the session relay apparatus a ( 10 a ) that has received the invite message analyzes the contents of the invite message through the session control unit 110 , and transfers the invite message 503 to the session relay apparatus b ( 10 b ), while at the same time responding to the communication terminal a ( 15 a ) with a trying message 504 indicating the transfer of the invite message . the session control unit 110 also delivers to the policy generating unit 210 the session information 800 and the peer - to - peer communication information 801 stored in the invite message . the policy generating unit 210 holds the session information 800 and the peer - to - peer communication information 801 thus delivered ( 502 ). in this case , the policy generating unit 210 may hold either the whole or at least the required part of the session information 800 or the peer - to - peer communication information 801 . also , the session control unit 110 may deliver only at least the required part of the session information 800 and the peer - to - peer communication information 801 to the policy generating unit 210 . the session relay apparatus b ( 10 b ) that has received the invite message from the session relay apparatus a ( 10 a ) transfers the invite message 505 to the communication terminal b ( 15 b ) and responds to the session relay apparatus a ( 10 a ) with the trying message 506 . in the case where a ringing message 507 indicating that the communication terminal b ( 15 b ) that has received the invite message 505 is in preparation for communication is transmitted to the session relay apparatus b ( 10 b ) as a response , the session relay apparatus b ( 10 b ) transmits a ringing message 508 to the relay apparatus a ( 10 a ). the relay apparatus a ( 10 a ) that has received this ringing message 508 similarly transmits a ringing message 509 to the communication terminal a ( 15 a ). once the preparation for the peer - to - peer communication is over and the communication becomes possible , the communication terminal b ( 15 b ) transfers an ok message 510 to the session relay apparatus b ( 10 b ). fig1 shows the contents of the ok message 510 transmitted from the communication terminal b ( 15 b ). like the invite message shown in fig4 the header of the ok message constituting the session control message based on sip constitutes the session information 900 , under which the portion described by sdp ( session description protocol ) provides the peer - to - peer communication information 901 . fig1 indicates that the destination ip address is 192 . 168 . 20 . 1 . 820 ( 910 ), the transmitter port number is 49171 , the communication data is audio , and rtp ( 920 ) is used as a communication protocol . the session relay apparatus b ( 10 b ) that has received this ok message 510 extracts , through the session control unit 110 , the session information 900 and the peer - to - peer communication information 901 stored in the ok message and delivers them to the policy generating unit 210 . the session control unit 110 transfers the ok message 512 to the session relay apparatus a ( 10 a ) through the packet transmitter / receiver 100 . the policy generating unit 210 that has received the session information 900 and the peer - to - peer communication information 901 from the session control unit 110 holds the same information ( 511 ). in the process , the policy generating unit 210 may hold either the whole or at least the required part of the session information 900 or the peer - to - peer communication information 901 . also , the session control unit 110 may deliver either the whole or at least the required part of the session information 900 and the peer - to - peer communication information 901 to the policy generating unit 210 . upon similar transfer of the ok message 513 to the communication terminal a ( 15 a ) from the session relay apparatus a ( 10 a ) that has received the ok message 512 , the communication terminal a ( 15 a ) that has received the ok message transmits an ack message 514 indicating the start of the peer - to - peer communication to the session relay apparatus a ( 10 a ). upon receipt of the ack message 514 , the establishment of the session is notified from the session control unit 110 to the policy generating unit 210 in the session relay apparatus a ( 10 a ). the policy generating unit 210 that has received this notification registers in the policy management table 220 the session information and the peer - to - peer communication information held therein , while at the same time generating and delivering a qos policy to a qos policy distribution unit 200 ( 515 ). [ 0038 ] fig5 is a diagram showing a table configuration as an example table configuration of the policy storage unit 220 of the session relay apparatus . each entry is produced for each peer - to - peer communication , i . e . each time the session is established . the policy storage unit 220 shown in fig5 stores “ call - id ”, “ to tag ” and “ from tag ” of the session information 800 shown in fig4 for uniquely identifying the session in sip . also , the policy storage unit 220 stores the address and the port number of the transmitter and the address and the port number of the destination contained in the peer - to - peer communication information 801 shown in fig4 and further the dscp value indicating the priority relay control level of packets and the address of the next relay node for selecting a relay network . [ 0039 ] fig7 is a diagram for explaining an example of the policy generated by the policy generating unit 210 of the session relay apparatus . the policy is described in pib ( policy information base ) format indicating the rules of the conditional operation type according to sppi ( structure of policy provisioning information ). pib for diffserv , for example , is laid down in rfc3317 . according to the embodiment shown in fig7 the operation ( 1001 ) of rewriting the dscp value as 0 × 001010 is used for the packet meeting the conditions including the transmitter ip address of 192 . 168 . 10 . 1 , the transmitter port number of 49170 , the destination ip address of 192 . 168 . 20 . 1 and the destination port number of 49171 . in this way , the qos generated includes the qos control classification conditions 1001 and the packet processing 1001 under the same conditions . thus , the dscp value of the packet with the edge node 20 meeting the conditions is rewritten and the core node 30 executes the packet priority control based on the dscp value . the policy distribution unit 200 executes the process of setting the qos policy generated by the policy generating unit 210 , in the edge node 20 a using the cops protocol . for this purpose , the policy distribution unit 200 produces a decision message 516 in accordance with the cops protocol using the qos policy delivered from the policy generating unit , searches the communication terminal - relay node correspondence storage unit 230 by way of the transmitter ip address contained in the qos policy , and transmits the produced decision message 516 to the edge node a ( 20 a ) accommodating the communication terminal a ( 15 a ). the policy in pib format is encoded by ber ( basic encoding rules ) of asn . 1 ( abstract syntax notation one ) defined in iso ( international organization for standardization ), and transmitted to the edge node as a decision message . [ 0041 ] fig6 is a diagram showing a table configuration representing an example configuration of the communication terminal - relay node correspondence storage unit 230 of the session relay apparatus . in this example , each entry corresponds to one communication terminal . the communication terminal - relay node correspondence storage unit 230 shown in fig6 includes the ip address of a communication terminal , and the ip address of the edge node accommodating the particular communication terminal . the communication terminal - relay node correspondence storage unit is set manually by the network manager or automatically by communication between the session relay apparatus , the edge node and the communication terminal . the edge node a ( 20 a ) registers by retrieving the qos control classification conditions and the packet processing from the qos policy stored in the decision message 516 received on the one hand , and transmits a report message 517 indicating the complete registration as a response to the session relay apparatus a ( 10 a ). the session relays apparatus a ( 10 a ) that has received the report message 517 transmits an ack message 519 to the session relay apparatus b ( 10 b ) ( 518 ). in the session relay apparatus b ( 10 b ) that has received the ack message , the session control unit 110 notifies the policy generating unit 210 that the session has been established . the policy generating unit 210 that has received this notification registers in the policy storage unit 220 the session information 900 and the peer - to - peer communication information 901 stored therein ( 520 ), and in accordance with the cops protocol , generates and transmits the decision message 521 to the edge node b ( 20 b ) accommodating the communication terminal b ( 10 b ) through the policy distribution unit 210 . the edge node b ( 20 b ) that has received the decision message 521 similarly registers the qos control classification conditions and the packet processing and transmits a report message 522 to the session relay apparatus b ( 10 b ). the session relay apparatus b ( 10 b ) that has received this report message transmits an ack message 524 to the communication terminal b ( 15 b ) ( 523 ). the receipt of this ack message by the communication terminal b ( 15 b ) indicates that the session is established between the communication terminal a ( 15 a ) and the communication terminal b ( 15 b ). by the operation described above , the session is established between the communication terminals and the qos policy is completely set in the relay network . the communication terminal a ( 15 a ) transmits the peer - to - peer communication packet 525 , and the edge node a ( 20 a ) sets the qos control class , i . e . the dscp value of the particular packet ( 526 ). in similar fashion , the edge node b ( 20 b ) sets the qos control class for the peer - to - peer communication packet 528 sent from the communication terminal b ( 15 b ) ( 527 ). in the network 40 , the core node 30 executes the packet relay process by priority control in accordance with the order of priority set in the packet . [ 0046 ] fig8 is a sequence diagram showing the communication process executed in the case where the communication terminal b ( 15 b ) terminates the peer - to - peer communication with the communication terminal a ( 15 a ). the communication terminal b ( 15 b ) transmits a bye message 601 indicating the end of the session to the session relay apparatus b ( 10 b ). the session relay apparatus b ( 10 b ) that has received this bye message further transfers a bye message 602 to the session relay apparatus a ( 10 a ). the session relay apparatus a ( 10 a ) that has received this bye message similarly transfers a bye message 603 to the communication terminal a ( 15 a ). the communication terminal a ( 15 a ) that has received the bye message transmits an ok message 604 to the session relay apparatus a ( 10 a ). in the session relay apparatus a ( 10 a ) that has received the ok message , the session control unit notifies the policy generating unit that the session has ended . the policy generating unit 210 that has received this notification searches the policy management table 220 using “ call - id ”, “ to tag ” and “ from tag ” stored in the ok message , deletes the corresponding entry from the policy storage unit 220 , generates the qos policy indicating the cancellation of the qos control and delivers the qos policy to the policy distribution unit 200 . the policy distribution unit 200 , using the cops protocol , executes the process of setting in the edge node 20 a the qos policy generated by the policy generating unit 210 . the policy distribution unit 200 that has received the qos policy indicating the cancellation of the qos control generates a decision message 606 in accordance with the cops protocol , searches the communication terminal - edge node correspondence table 230 for the edge node a ( 20 a ) accommodating the communication terminal a ( 15 a ) and distributes a decision message 606 to the edge node a ( 20 a ). the edge node a ( 20 a ) that has received the decision message 606 deletes the corresponding qos policy setting ( 608 ), and sends a report message 607 indicating the complete deletion as a response to the session relay apparatus a ( 15 a ). the session relay apparatus a ( 10 a ) that has received the report message 607 transmits an ok message 609 to the session relay apparatus b ( 10 b ). in the session relay apparatus b ( 10 b ) that has received the ok message , the end of the session is notified from the session control unit 110 to the policy generating unit 210 . the policy generating unit 210 that has received this notification deletes the corresponding entry of the policy from the internal policy storage unit 220 based on the information contained in the ok message . the policy distribution unit 200 , in order to instruct the edge node 20 b to cancel the policy setting , prepares a decision message 611 in accordance with the cops protocol and sends it to the edge node b ( 20 b ) ( 610 ). the edge node b ( 20 b ) that has received the decision message 611 deletes the qos policy setting and transmits a report message 612 to the session relay apparatus b ( 10 b ). the session relay apparatus b ( 10 b ) that has received this report message transmits an ok message 614 to the communication terminal b ( 20 b ) ( 613 ). through these steps , the peer - to - peer communication is terminated and the corresponding qos control is canceled . [ 0052 ] fig9 is an operation flowchart showing the process executed by the policy generating unit 210 included in the session relay apparatus 10 according to the invention . the policy generating unit 210 initializes the policy storage unit 220 at the time of starting and then repeatedly executes the following - described process . the policy generating unit 210 first checks whether the establishment of a session has been detected or not . one method of detecting the session establishment consists in the notification from the session control unit 110 . upon detection of the session establishment , the policy generating unit 210 generates a policy for setting the dscp value , from the session information and the peer - to - peer communication information in the invite message providing the session control message . the policy generating unit 210 registers the generated policy in the policy storage unit 220 , and through the policy distribution unit 200 , sets a policy in the edge node 20 according to the cops protocol . in the case where the session is not established or after the aforementioned process is executed upon detection of the session establishment , the policy generating unit 210 checks whether the end of the session has been detected or not . one method of detecting the end of a session consists in the notification from the session control unit 110 . upon detection of the end of a session , the policy generating unit 210 searches the policy storage unit 220 with the session information in the ok message providing the session control message as a key . the policy generating unit 210 generates a policy for clearing the dscp value using the entry of the search result , and through the policy distribution unit 210 , cancels the policy setting in the edge node 20 according to the cops protocol . the corresponding entry of the policy storage unit 220 is deleted subsequently by the policy generating unit 210 . [ 0055 ] fig1 shows a mesh configuration of the network using the session relay apparatus 10 according to the invention as a communication network with a selectable relay network . networks 40 a , 40 b , 40 c exist as relay networks . the band of each network can be secured by selecting a relay network in accordance with the type of the peer - to - peer communication data . in the case where the relay network designated by numeral 40 a is selected by policy setting , for example , the address of the relay node 30 aa connected to the relay network 40 a is registered in the “ relay network ” item of the policy storage unit 220 shown in fig5 . as a result , the session relay apparatus 10 a transfers to the relay node 30 aa those packets received from the communication terminal 15 a which meet the required conditions , and transmits them through the relay network 40 a to the communication terminal 15 b . this embodiment is effectively applicable to a case in which with different policies preset in the networks 40 a , 40 b and 40 c , for example , a network using a policy conforming with the packet transmitted from the communication terminal a 15 a to the communication terminal b 15 b is selected . it will thus be understood from the foregoing description that according to this invention , the start and end of the policy settable peer - to - peer communication are detected by a session relay apparatus , so that a policy can be set in each edge node accommodating a communication terminal at the start of communication , while the policy setting can be canceled at the end of communication . also , the need of the policy - setting operation by the operator is eliminated , thereby making it possible to prevent the packet relay delay which otherwise might occur in an edge node by the unrequited policy setting . embodiments of the invention are described above . nevertheless , this invention is not limited to these embodiments , but as obvious to those skilled in the art , can be variously modifiable within the scope of the appended claims without departing from the spirit of the invention .	7
as required , a detailed embodiment of the present invention is disclosed herein ; however , it is to be understood that the disclosed embodiment is merely exemplary of the invention , which may be embodied in various forms . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriately detailed structure . referring now to the drawings , there is shown an embodiment of the spreader assembly with surface - clearing blower of the present invention indicated by the reference numeral 100 . the spreader assembly 100 includes a mobile support element or base such as a metal frame 105 . the metal frame 105 is typically horizontally disposed and generally rectangular . the frame 105 has a horizontally disposed longitudinal axis running from the front 110 of the frame 105 to the back 115 of the frame 105 , and a horizontally disposed transverse axis perpendicular to the longitudinal axis . a rotary spreader 120 , otherwise known as a broadcast spreader , is mounted to and above the frame 105 by any sufficiently operable means such as a metal post 125 attached to and projecting upward from the frame 105 . metal brackets or flanges 130 may be used to attach the spreader 120 to the post 125 . a rotary spreader 120 of the type shown in the figures typically includes a hopper 135 for storing granular material to be distributed by the spreader 120 . an aperture ( not shown ) at or near the bottom of the hopper 135 allows the stored material to drop under force of gravity to a rotary impeller 140 . the rotary impeller 140 rotates about a vertical axis and includes fins or flanges 145 for flinging granular material radially outward from the rotary impeller 140 as it rotates at sufficient speed . the rotary impeller 140 may therefore distribute granular material from the hopper 135 in an approximately 360 ° radial arc about the spreader 120 and upon a selected application surface such as a lawn . shields ( not shown ) placed proximate the impeller 140 may be used to narrow the arc and , in particular , to prevent material from being directed toward the operator . a sliding gate or other apparatus ( not shown ) located at the bottom of the hopper 135 may be provided to adjust the hopper aperture size for varying the material feed rate from the hopper 135 to the rotary impeller 140 . the rotary impeller 140 is typically rotated under power provided by an electric motor 165 . since a rotary spreader 120 will typically distribute material from the hopper 135 in relatively wide arc about the spreader 120 , the spreader assembly 100 of the present invention provides a means for producing a directed stream of air flowing at relatively high velocity , such as a forced - air blower 150 , and one or more means for directing the stream of air downward toward a surface to be cleared of granular material deposited by the spreader 120 , such as a hose 155 or duct 160 with a distal opening 280 located proximate the surface to be cleared . the spreader assembly 100 may include means for selectively opening or closing one or more of the hoses 155 or ducts 160 , such as valves 170 controlling the flow of air through hoses 155 or ducts 160 . the spreader assembly 100 with surface - clearing blower 150 may further include a powered drive unit 200 including an engine 205 and driven wheels 210 powered by the engine 205 . the powered drive unit 200 is typically provided by removing the mower deck from a conventional walk - behind mower and replacing the mower deck with the spreader frame 105 described above . in such case , the frame 105 is typically provided with two , freely rotating , swiveling , front wheels 175 attached to the front end 110 of the frame 105 . the back end 115 of the frame 105 is bolted or otherwise attached to the powered drive unit 200 , which is typically provided with two , transverse , engine - driven wheels 210 . the spreader assembly 100 is therefore supported by two driven wheels 210 at the rear of the spreader assembly 100 and two swiveling wheels 175 at the front of the spreader assembly 100 that allow the spreader assembly 100 to be rolled along the ground . the electric motor 165 receives power to drive the rotary impeller 140 from the powered drive unit 200 electrical system which may comprise a battery or engine - powered electrical generator . as shown in fig1 , a switch 215 is typically mounted on the powered drive unit console 220 or handle 225 for turning the electric motor 165 on or off , causing the rotary impeller 140 to rotate or cease rotating , respectively . a lever 227 , mounted on or near the console 220 or handle 225 , is attached through linkages to the above - referenced gate so that the operator may move the lever 227 to open or close the gate , thereby providing a ready means for initiating or halting distribution of the granular material by the spreader 120 . a source of power is provided to rotate the fan 250 of the blower 150 . this may comprise an electric motor or other means , however , the blower 150 is typically powered by a belt and pulley drive system that engages an engine - powered driving pulley 230 on the powered drive unit 200 ( see fig2 and 3 ). the driving pulley 230 is typically the same pulley previously used to power the mower blade of the disengaged mower deck and is provided with the powered drive unit 200 . a belt 235 runs between the powered pulley 230 and a driven blower pulley 240 attached to the shaft of the blower fan 250 . see fig2 wherein the housing of the blower 150 is partially broken away to show the fan 250 inside the blower 150 . controls , such as a control lever 255 , on the powered drive unit 200 previously used to engage and disengage power to the mower blade are now used to engage and disengage power to the blower 150 . the blower 150 may therefore be selectively operated during a spreading operation to initiate or halt airflow from the blower 150 as desired . typical means for engaging or disengaging power to the blower 150 include an electric clutch 260 ( see fig3 ) positioned in the power train between the power drive unit engine 205 and the driving pulley 230 . the same controls on the power drive unit 200 provided for engaging or disengaging power to the previously attached mower deck may be used to control the electric clutch 260 . another means for engaging or disengaging power to the blower 150 includes a tensioning or idler pulley 270 ( see fig2 ) that may be moved relative to the belt 235 running between the engine pulley 230 and blower pulley 240 . the tensioning pulley 270 may be moved to a first position wherein tension is increased upon the belt 235 thereby tightening the belt 235 upon the engine and blower pulleys sufficiently to cause the belt 235 to grip both the engine and blower pulleys so that rotation from the engine pulley 230 is transmitted from the rotating belt 235 to induce rotation in the blower pulley 240 . the tensioning pulley 270 may be moved to a second position wherein tension is released upon the belt 235 thereby loosening the belt &# 39 ; s frictional engagement with the engine pulley 230 and blower pulley 240 so that one or both pulleys slip relative to the belt 235 and rotation is not transmitted from the engine pulley 230 to the blower pulley 240 . the tensioning pulley 270 is typically selectively moved between the first position and second position by moving the lever 255 engaged via linkages with the tensioning pulley 270 and mounted near the handle 225 and / or console 220 of the powered drive unit 200 . the blower 150 includes a casing or housing that houses the fan 250 or impeller . a first opening ( not shown ) in the blower housing allows air to enter the housing as the fan 250 is rotated . a second opening ( nozzle aperture 280 ) allows air to be expelled from the blower 150 as the fan 250 is rotated . the second opening 280 is generally located at the terminal or distal end of an air duct 160 or air hose 155 . therefore , as the fan 250 is rotated air is expelled from the blower 150 through the nozzle aperture 280 and replacement air is drawn into the blower 150 from the first opening proximate the fan 250 . the fan 250 and blower housing are typically arranged to form what is generally known in the art as a squirrel cage fan or blower . in one embodiment of the spreader assembly 100 , a duct 160 is attached to the blower 150 and extends generally transversely outward to the lateral edge of the frame 105 . the duct 160 is also angled downward to direct a stream of air produced by the blower 150 at an area of the application surface selected to be cleared of deposited granular material . as the spreader assembly 100 is rolled past the selected surface , the nozzle aperture 280 , passes over or in close proximity to the selected area and the force of the stream of air emitted from the nozzle aperture 280 blows the deposited granular material off of the proximate selected area . for example , after using the spreader assembly 100 to distribute and deposit granular fertilizer upon a lawn , the spreader assembly 100 may be passed near a sidewalk adjacent to the lawn so that the blower cleans the sidewalk of deposited fertilizer granules . in another embodiment of the spreader assembly 100 , a manifold 285 is connected to the blower 150 for distributing air flow from the blower 150 to several ducts or hoses 155 ( see fig1 ). if three hoses 155 are used , as shown in fig1 , they are typically positioned so that a first hose 155 a projects forward of the spreader assembly frame 105 , a second hose 155 b projects leftward of the frame 105 ( as viewed from the front of the spreader assembly 100 ), and a third hose 155 c projects rightward of the frame 105 . the terminal end of each hose 155 may be referred to as a nozzle . each nozzle is positioned within approximately 12 inches of the selected surface . air flow may be selectively directed to any or all of the three hoses 155 by manipulating valves 170 placed along each hose 155 . in fig1 , ball valves 170 are shown positioned along each hose 155 so that valve actuators or levers 290 associated with each valve 170 project upward from the valve 170 . each lever 290 may be turned to move the valve 170 from an open to a closed position or any selected intermediate position . alternatively , the valves 170 may be controlled electronically by electromechanical devices known in the prior art such as solenoids . in one embodiment , the rotations per minute ( rpm ) of the powered drive unit engine 205 is approximately 3300 , the engine pulley 230 is about 7 ″ in diameter , the blower pulley 240 is about 5 ″ in diameter , and the blower fan &# 39 ; s 250 rpm are between approximately 4 , 400 and 5 , 500 , as determined by engine rmp and the pulley diameter ratios . the blower fan 250 is approximately between 9 and 10 ″ in diameter and typically has between 40 and 60 blades . this embodiment will provide sufficient air flow to move most granular material typically applied by broadcast spreaders when the nozzle or nozzles are positioned within about 10 ″ of the selected surface . the spreader assembly 100 may be used to spread granular material , such as fertilizer , insecticide , or various soil amendments , upon an application surface , such as a lawn , while clearing nearby surfaces , such as sidewalks and driveways , of deposited material according to the following steps . note that certain steps may be performed in an order varying from those given here , as long as the objective of clearing selected surfaces is accomplished . first , the hopper 135 is partially filled with material to be distributed by the spreader 120 . before adding the material to the hopper 135 , lever 227 should be moved as required to close the hopper gate . next , the engine 205 of the powered drive unit 200 is started and power is provided to the driven wheels 210 to begin forward motion of the spreader assembly 100 along a selected application lane upon an application surface . as the spreader assembly 100 moves forward , the operator typically walks behind the powered unit 200 , holding onto the handle ( s ) 225 . the switch 215 controlling power to the spreader motor 165 is turned , pushed , pulled or otherwise manipulated to an “ on ” position so that the spreader motor 165 is energized and begins turning the rotary impeller 140 . the gate lever 227 is manipulated to open the gate so that material may flow from the hopper 135 , through the hopper aperture and gate , and onto the rotary impeller 140 . while material is flung from the rotary impeller 140 , some material may land on surfaces adjoining the application surface . to clear material from such surfaces , the blower 150 is engaged with the engine 205 by manipulating the clutch lever 255 . if an electric clutch 260 is used , proper manipulation of the clutch lever 255 ( or electrical switch as may be provided ) causes the electric clutch 260 to engage the driving pulley 230 with the engine 205 . if a slack clutch is used , proper manipulation of the lever 255 moves the tensioning pulley 270 against the belt 235 to increase belt tension against the driving and driven pulleys 230 and 240 . in either case , power from the engine 205 is thereby provided to the blower fan 250 . the operator may then position the spreader assembly 100 , and particularly the hose or duct nozzle apertures 280 , proximate a surface to be cleared of deposited material . this operation may occur while spreading material with the spreader 120 or afterwards , after the spreading operation is complete . if a spreader assembly 100 with multiple hoses 155 is used , the hose valves 170 may be set to open or closed positions as needed . for example , to clear a surface to the right of the spreader assembly 100 , hose 155 b would be utilized and the associated valve 170 opened . to clear a surface to the left of the spreader assembly 100 , hose 155 c would be similarly used . to clear a surface directly in the path of the spreader assembly 100 , hose 155 a would be used . in a further embodiment of the spreader assembly 100 , the blower 150 and duct 160 shown in fig2 and 3 are mounted upon the frame 105 so that the blower 150 and associated duct 160 may be swiveled about an axis typically coincident or parallel to the fan axis to direct the duct nozzle any selected radial position . it is to be understood that while certain forms of this invention have been illustrated and described , it is not limited thereto except insofar as such limitations are included in the following claims and allowable equivalents thereof .	4
methods will be disclosed for creating communications overlays , where an overlay will be described in more detail hereinbelow . it will be understood that electronic messages include , but are not limited to , voice mail , electronic text mail , electronic images , and data . an action taken sua sponte will be understood to be unilaterally taken by a sponsor without requirements from the user , e . g ., no registration or password requirements . implementation breaks down into two major systems requirements . creation of a communications overlay requires a unique identifier for each cell . the identifier must be generated by a simple algorithm which can be understood by the masses without individual registration or ambiguity . hardware and software must be provided at minimal expense and preferably maximizing off the shelf elements and / or preexisting resources . modern electronic communications in the form of the telephone system and the internet provide an architecture for providing a large - scale communications system overlayed on the existing subscriber telephone and email systems , e . g ., but not limited to , creating a temporary large - scale block of telephone voice mail boxes and / or email accounts . this requires a plurality of electronic access addresses where it is understood that an electronic access address could be a telephone number , email address , or other electronic address . in the preferred embodiment , the overlayed system should not affect the functioning communications system , but should augment by providing a default contingency plan . in the preferred embodiment , the system should be capable of being activated in a time frame of less than one hour . the united states telephone number system is comprised of a 3 digit area code , 3 digit exchange , and a 4 digit subscriber number . in combination , the 10 digit number uniquely directs a call to a specific subscriber . by default , a call can be placed within an area code by only dialing the last 7 digits of a number . alternately , a number in another country may be called directly by preceding the call with the international access code 011 , followed by the country code , i . e ., a 10 digit number in the united states may be duplicated in another country , but by default the call is routed within the united states , unless preceeded by the requisite prefix numbers . likewise , the least significant 7 digit numbers may be duplicated between area codes , i . e ., the numbers are overlayed . a 7 digit number provides 10 7 , or 10 , 000 , 000 unique phone numbers . all numbers are not in active use by subscribers and not all combinations are available , e . g ., 911 can not be a valid area code . so in practice the number of usable combinations is less than 10 7 . in a large - scale event such as the flooding of new orleans , 10 7 candidate phone numbers would be more than adequate to accommodate the number of displaced , or nomadic , people . a central planning sponsor such as the federal emergency management agency ( fema ), the american red cross , or a state emergency planning authority , could assume responsibility for emergency person - to - person communications . this would avoid overloading the communications systems with useless attempts , needless duplication of resources , and ambiguity as to how the individual is to respond to an emergency . it will be understood that while a united states government or established emergency agency is a preferred sponsor , a corporate sponsor , or a foreign government could also act . it will be apparent to those skilled in the art that implementing a large - scale block of electronic access addresses is a minor software program . the significant obstacle is pairing individuals with the resources through the electronic access addresses in a unilateral method , i . e ., the authority unilaterally builds a system , and the individual elects to accesses the system , or not . in other words , the sponsor builds a system and the individuals use it if they so choose . in this respect , the 911 emergency phone system disclosed by connell et al . in u . s . pat . no . 3 , 881 , 060 is a good example . a traveler anywhere in the united states knows by default that they can call the universal number 911 in an emergency , without need to know under which authority they actually need to call , i . e ., city , county , state , or a specific unique phone number for that locality . either an unused area code , or some other unique prefix known in the art , such as the method used by prepaid calling cards ( caller dials a universal toll free number and then directs the call to the desired subscriber ), could be assigned to create a virtual overlay of the 7 digit subscriber telephone number system . hereinafter virtual overlay is defined to be an electronic communications system residing in memory in which at least a portion of the electronic access address is comprised of an event designated default portion of preferably at least 3 digits ; in combination with a number of at least 4 digits and preferably at least 7 digits , e . g ., a virtual overlay could designate an unused 3 digit area code combined with a 7 digit user identifier code . the sponsor could broadcast the event identifier to the individuals , and the individuals would combine that with their subscriber telephone number , acting as a user identifier , to construct an electronic access address that would be unique to the event at hand . the elegance of the method will become apparent to those skilled in the art from the figures and details of the preferred embodiments . the first preferred embodiment employs an architecture based on the telephone infrastructure and electronic voice mail as shown in fig1 and fig2 . the virtual overlay system provides capability for recording and playing voice messages , i . e ., voice mail . the system is activated 14 by connecting to the public telephone network by the responsible sponsor and requires no access password . in a typical scenario , a sponsor would publicize the system existence prior to an emergency , and activate the system prior to a known threat , such as a hurricane , or immediately after an event . for example , an unused area code , which will be designated abc , hereinafter will be understood to mean a 3 digit symbol available on the conventional 12 button telephone , 0 - 9 , *, and #, would be designated for the event as the event identifier 11 . the public would be advised that in an interruption of telephone services , or in a nomadic situation , they should call the electronic access address 21 constructed of the event identifier 11 abc , followed by their subscriber 7 digit phone number user identifier 12 . the caller would be given the option of recording a message 13 or playing back messages 13 , but could not delete messages 13 , i . e ., the messages would be managed by the sponsor in a methodical manner to conserve resources and avoid conflicts . the system would be available to anyone on a toll free basis with no expectation of privacy or preferential ownership privileges . it will be apparent that by such a system , people could establish person - to - person messaging and thereby establish more direct alternate means of communication , e . g ., a hotel name , cell phone number , etc . the sponsor could limit the length of messages to help free communications systems . it could also limit the memory available by pushing out older messages ( first in first out ) as the allocated memory is exceeded . it will be apparent to those skilled in the art that 10 7 voice mail boxes would far exceed the requirement for most emergencies . rather than providing the full capability by default , it would conserve hardware requirements by dynamically allocating boxes . for example , when a number is called the computer could check to see if it has been initiated . if so , simply route the call to that box . if this is the first call to that number , automatically allocate a box to that number and route the call to that box . it will also be apparent to those skilled in the art , that an event would likely involve more than one area code . in that event , callers will simply share the same box in a party line arrangement with no expectation of privacy . it will be apparent to those skilled in the art that such a system would be subject to spam calls . spam filters are well known in the art and it would be desirable to include such a filter at the head end . it would also be desirable to include the entire abc prefix under the national do not call registration protection . in the case of the internet , a domain could be used to differentiate the emergency system from the existing email system , i . e ., the abc prefix would not be required . for example , as shown in fig3 , email addresses could be created using all possible 7 digit telephone numbers as the user identifier 12 in combination with a unique domain as the event identifier 11 to construct the electronic access address 21 , such as 8675309 @ katrina . gov . individuals would go to the default email address 21 to check for all messages 13 and email could be sent from any email address to the designated email address . no password would be required to log into the email , so all messages would be available to all interested parties . email could be forwarded , or replied to , but not deleted . addresses could be dynamically allocated as in the first preferred embodiment , or simply created for all possible combinations . it will be recognized that spam and message length could be controlled by techniques well know in the art . the third preferred embodiment employs an architecture based on integrating the telephone system and the internet and electronic mail ( email ) as described hereinafter . in u . s . pat . no . 7 , 330 , 537 frifeldt et al . discloses an integrated messaging server directory service with a communication system voice mail message interface , which is incorporated by reference hereinabove . this system , sold by adomo incorporated of cupertino , calif ., is described in the adomo voice messaging getting started manual which is incorporated by reference herein . section 8 describes a system that integrates voice messages into microsoft outlook whereby voice messages are accessed by a personal computer . an incoming message is routed to the designed pc outlook account . messages generate an email message listing the incoming voice messages by sender and time . the messages can then be played in the selected order . it will be apparent to those skilled in the art that such a system my be exploited by the first preferred embodiment for voice message management and playback on a pc in parallel with telephone access , as well as integrating the second preferred embodiment for email messages . having described the methods , many variations of the invention will become apparent to those skilled in the art , which are disclosed in the claim limitations . for example , lost pet owners will be more easily contacted by including a telephone number identification on the pet . schools and teachers can rapidly contact children &# 39 ; s parents by simply asking the children for their phone numbers . identification of bodies can be expedited by expanding the contact to extended family and friends that would otherwise not be located without extensive research . neighbors can more easily check on each other and provide assistance , even under nomadic conditions . the communications systems would be freed of needless traffic which would expedite more pressing emergency use . the psychological impact of a terrorist attack would be lessoned , and possibly deterred .	8
the present invention relates , according to our embodiment , to processes for removing eo from ambient air streams over a wide rh range , e . g ., from less than 15 % to greater than 80 % relative humidity at temperatures of about 75 ± 50 ° f . according to one embodiment of the present inventive process , the ambient air stream containing eo is passed through a filtration device in a manner that allows for contacting the eo contaminated process stream with a zeolite , preferably , h - zsm - 5 . eo is removed from the ambient air stream via adsorption of eo into the pores of the zeolite followed by chemical reaction . the filtration device employing the zeolite may take on many shapes and geometric forms depending upon the application , so long as the filtration device promotes contact between the stream being treated and the zeolite . the linear velocity by which the eo contaminated air stream passes through the zeolite , e . g ., filter bed , will be a function of the many parameters , such as , for example , the bed depth , the ambient concentration of eo , flow rate , etc . examples of filtration devices which may utilize the present invention include but are not limited to , for example , gas mask canisters , respirators , filter banks such as those employed in fume hoods , ventilation systems , etc . a blower motor , fan , etc . may be used as a means of forcing ambient air through the device , if desired . the acidified zeolite of the present invention functions effectively at water contents of the ambient air between about 5 % and about 95 % relative humidity ( rh ). at rh below about 5 %, insufficient water may be present in the process stream to effectively remove eo . as the rh is increased above 95 %, the effectiveness of the removal media becomes less than optimum . should the rh fall below the specified range , water may be added to the process to increase the rh . alternatively , should the rh level be too high ( greater than about 95 % rh ), the ambient stream may be mildly heated to decrease the rh . the temperature of the ambient air ranges from about − 25 ° f . to about 125 ° f . the contact time between the zeolite and the ambient air stream being treated can vary greatly depending on the nature of the application , such as for example , the desired filtration capacity , flow rates and concentration of eo in the ambient air stream . however , in order to achieve a threshold level of eo removal , the contact time ( e . g ., bed depth divided by the linear velocity ) should be greater than about 0 . 025 seconds . a contact time of greater than 0 . 2 seconds is preferred for most applications , and a contact time of greater than 0 . 5 seconds is even more preferred for applications involving high concentrations of eo , or for applications where it is desired to achieve a high eo capacity in , e . g ., a filter bed . preferably , the zeolite of the present invention is employed in an acid form . the preferred zeolite of the present invention , zsm - 5 , may be purchased from commercial sources , such as for example uop . alternatively , zsm - 5 may be synthesized using techniques known to one skilled in the art . preparation of zsm - 5 was first reported in u . s . pat . no . 3 , 702 , 886 . zsm - 5 is a high silica zeolite consisting of a series of interconnecting parallel and sinusoidal channels approximately 5 . 8 å in diameter ( szostak , molecular sieves : principles of synthesis and identification , 1989 , p . 14 , 23 - 25 ). zsm - 5 is a member of the pentisil family of zeolites which includes zeolitic materials whose structure consists of 5 - membered rings . additional zeolites belonging to the pentisil family include zsm - 8 , zsm - 11 , etc . zsm - 5 can be prepared with a range of sio 2 / al 2 o 3 ratios , from greater than or equal to about 10 , 000 to less than or equal to about 20 . because of its high silica content and small pores , zsm - 5 is hydrophobic , adsorbing a relatively small amount of water under high rh conditions . acidification of zsm - 5 is performed using techniques well known to one skilled in the art , such as for example ion exchange . acidification of zsm - 5 provides the necessary acid sites to catalyze the hydrolysis of eo . as prepared , zsm - 5 is a powder consisting of crystals typically less than about 50 μm in length . as prepared zsm - 5 is generally neutral or mildly basic . acidification of zsm - 5 is typically accomplished through cation exchange reactions using techniques known to one skilled in the art . for example , cation exchange may be performed by slurrying as - synthesized zsm - 5 powder in water , heating the water to about 50 ° c . to about 80 ° c ., then adding an ammonium salt solution , such as for example ammonium chloride , ammonium bisulfate , etc ., to the slurry . after slurrying , the cation exchanged zsm - 5 is filtered from the solution , dried and calcined at an elevated temperature , such as for example 550 ° c . calcination of the zeolite results in decomposition of the ammonium complex , resulting in a proton as the charge balancing cation ; whereby the proton constitutes the acid site . the aluminum content of the zsm - 5 employed in this invention will greatly affect the performance of the resulting eo removal media . for example , acidified zsm - 5 containing a minimal amount of aluminum ( sio 2 / al 2 o 3 greater than about 1 , 000 ) will not effectively filter eo because of the small number of acid sites . therefore , it is desired that that the sio 2 / al 2 o 3 ratio of the zsm - 5 employed in this application be less than about 200 , with the preferred sio 2 / al 2 o 3 ratio between about 90 and about 30 . as - synthesized and subsequent ion exchange , h - zsm - 5 exists as small crystals . according to various embodiments of the present invention , the zeolite may be configured in the form of particles , rings , cylinders , spheres , etc . alternatively , the zeolite , e . g ., h - zsm - 5 , may be configured as a monolith , or coated onto the walls of a ceramic material , such as for example honeycomb corderite . failure to configure the zeolite ( e . g ., h - zsm - 5 crystals ) as described above will result in excessive pressure drop across the filtration media . configuring the zeolite , preferably h - zsm - 5 crystals , into various geometrical shapes can be performed using operations well known to one skilled in the art . these techniques include pilling , extruding , etc . binders , such as for example clays , silicates , plastics , etc ., may or may not be required for the given application ; however , the use of binders in the formation of zeolite rings , particles , etc ., is preferred . the acidified forms of zeolites of the pentisil family , such as , for example h - zsm - 8 , h - zsm - 11 , etc . are also within the scope of the present invention . however , zsm - 5 is the preferred zeolite . often times , it is desired that the removal material be capable of removing a range of chemicals from streams of air , such as for example epoxides , basic chemicals , etc . because the novel process described herein is able to filter eo , and epoxide , the novel process can also be applied to the removal of additional epoxides , such as for example propyleneoxide , etc . further , because the novel process described herein employs acid sites to remove eo , the novel process can also be applied to the removal of basic chemicals ; such as , for example ammonia , from streams of air . further , the novel process can be applied to multi - use applications , such as for example applications requiring the removal of multiple epoxides , or removal of eo plus additional basic chemicals from streams of air . should it be desired that the novel process described herein be employed in a multi - use application , such as for example a process requiring the removal of eo and nh 3 , a preferred process will involve use of h - zsm - 5 particles prepared using an acidified binder material , or particles that are impregnated with acids or acid precursors , such as for example sulfuric acid , hydrochloric acid , ammonium bisulfate , ammonium chloride , ammonium fluoride , ammonium nitrate , citric acid , formic acid , etc . acidification of binder material can be performed using techniques known to one skilled in the art , such as for example impregnating the preferred h - zsm - 5 particles with ammonium bisulfate , ammonium chloride , etc . solutions , followed by calcination at an elevated temperature sufficient to decompose the ammonium complex . organic acids , such as for example citric acid , can also be impregnated into the zeolite particles . such a treatment will result in zeolite particles with an acidic binder , with the acidity of the binder resulting from the presence of for example sulfate , chloride , etc . alternatively , the binder material can be acidified through the addition of acid precursors to the binder , such as for example the addition of aluminum sulfate to the binder . additionally , basic chemical filtration performance can be added to the particles via impregnation with metal sulfates , chlorides , etc . laboratory scale tests were performed to evaluate the ability of the present inventive zeolite to remove eo from ambient air streams . a description of the laboratory scale test stand follows : a stream of compressed air delivered from a mass flow controller is delivered to a water sparger located within a temperature controlled water bath . a second stream of compressed , dry air ( dew point temperature less than about minus 20 ° f .) is delivered from a second mass flow controller and is blended with the humid air stream from the water sparger . the water content of the air stream is controlled by controlling flow rates of the two process streams . an rh meter is located downstream of the point where the dry air stream and humid air stream are mixed . the rh meter is used to measure and record the humidity of the air stream . an eo / air mixture delivered from a mass flow controller is blended with the process stream downstream of the rh meter . the resulting eo / humid air stream is delivered to the filtration test assembly . the filtration test assembly consists of a glass tube fitted with a small mesh screen sufficient to support the bed of filtration material . a portion of the effluent stream is delivered to an ir analyzer used to quantitatively determine the concentration of eo in the filter effluent stream . a portion of the feed stream is delivered to a second ir analyzer used to quantitatively determine the concentration of eo in the feed stream during the run . when performing tests under conditions of high rh , the zeolite was pre - humidified overnight in an environmental chamber at 27 ° c ., 80 % rh . all tests were performed at 80 ° f . at either 15 % rh or 80 % rh . all breakthrough times are reported corresponding to an effluent eo concentration of 1 . 8 mg / m 3 . cws carbon having a surface area of 1 , 200 m 2 / g was obtained from calgon carbon corporation ( pittsburgh , pa .) as 12 × 30 mesh granules . 100 g of the granules were dried in an oven at 110 ° c . overnight , then impregnated to incipient wetness using an 8 % h 2 so 4 / water solution . the resulting material was then dried in a forced convection oven overnight at 110 ° c . product material had a sulfate content of nominally 10 % by weight . 15 cm 3 of the 10 % so 4 / cws material was placed in the filter tube as described above . the bed depth was 2 . 0 cm . the material was challenged with 1 , 000 mg / m 3 eo in 15 % rh air at a linear velocity of 6 cm / s ( contact time = 0 . 33 seconds ). the eo breakthrough time was 187 minutes . the above test was repeated using an additional 15 cm 3 of the 10 % so 4 / cws . the material was pre - humidified overnight at 27 ° c ., 80 % rh . following pre - humidification , the moisture pick - up of the material was determined to be 0 . 3 g of water per g of material . the pre - humidified material was challenged with 1 , 000 mg / m 3 eo in humid air ( 27 ° c ., 80 % rh ) at a linear velocity of 6 cm / s ( contact time = 0 . 33 seconds ). the eo breakthrough time was 1 . 5 minutes . the above example demonstrates the inefficiency of acidified carbon to filter eo under conditions of high rh . zsm - 5 with a sio 2 / al 2 o 3 ratio of 45 was prepared by combining 1 , 200 g of colloidal silica solution ( ludox as - 40 , 40 wt % sio 2 ) with 131 g of tetrapropylammonium bromide dissolved in 350 ml of di water . to this mixture was added a solution consisting of 125 g of sodium hydroxide and 29 g of sodium aluminate . the resulting solution was thoroughly mixed , then added to two , 2 - liter teflon lined autoclave . the autoclaves were placed within a forced convection oven at 180 ° c . for 3 days . upon completion , the resulting material was removed from the autoclaves , filtered and washed to neutrality . resulting material was then calcined at 650 ° c . for 6 hours in order to remove the organic cation . product zsm - 5 was in the form of a powder consisting of approximately 2 μm particles . product zsm - 5 was acidified by ion exchange with ammonium chloride . 180 g of product zsm - 5 was slurried in a 1 liter glass beaker containing 550 ml of deionized water . the slurry was heated to 80 ° c . a second solution consisting of 8 . 53 g of ammonium chloride dissolved in 80 ml di water was added dropwise to the slurry . following 4 hours , the zsm - 5 was filtered from the slurry , dried and calcined at 550 ° c . for 4 hours . the above ion exchange procedure was repeated a second time . the acidity of the ion exchanged h - zsm - 5 was verified by slurrying 1 g of calcined zsm - 5 in 50 ml of deionized water . the ph of the resulting slurry was 4 . 2 . 153 g of the powdered h - zsm - 5 from above was mixed with 115 g of colloidal silica ( ludox as - 40 , 40 wt % sio 2 ) for the purpose of preparing particles of h - zsm - 5 , with the colloidal silica serving as a binder . the resulting paste was dried at 80 ° c ., then calcined at 450 ° c . for 2 hours . the resulting material was then crushed and sieved to 12 × 30 mesh particles . 15 cm 3 of 12 × 30 mesh particles of h - zsm - 5 described above was placed in the filter tube as described previously . the bed depth was 2 . 0 cm . the material was challenged with 1 , 000 mg / m 3 eo in dry air ( 15 % rh ) at a linear velocity of 6 cm / s ( contact time = 0 . 33 seconds ). the eo breakthrough time was greater than 180 minutes . the above test was repeated using an additional 15 cm 3 of the 12 × 30 mesh particles of acidified zsm - 5 . the bed depth was 2 . 0 cm . the material was pre - humidified overnight at 27 ° c ., 80 % rh . following pre - humidification , the material picked up approximately 0 . 07 g of water per g of material . the pre - humidified material was challenged with 1 , 000 mg / m 3 eo in humid air ( 27 ° c ., 80 % rh ) at a linear velocity of 6 cm / s ( contact time = 0 . 33 seconds ). the eo breakthrough time was 130 minutes . the above test demonstrates the ability of h - zsm - 5 to filter eo under conditions of low and high humidity . commercial zsm - 5 was purchased from uop ( product ae - 10 ) as crystals . product ae - 10 was calcined at 600 ° c . for 6 hours as per manufacturer &# 39 ; s instructions to produce the acid form of the zeolite . following calcination , 1 . 0 g of ae - 10 was slurried in 50 ml of di water . the ph of the slurry was determined to be 3 . 50 . calcined ae - 10 particles were prepared by adding 886 g of calcined ae - 10 to a 1 gallon pail . a solution was next prepared by adding 997 g of zirconium oxynitrate ( 20 % by weight zro 2 ) and 100 g of ludox as - 40 colloidal silica solution ( 40 % by weight sio 2 ) to a 1 liter beaker . the resulting solution was mixed , then added to the calcined ae - 10 along with 38 . 0 g of catapal d pseudo - boehmite ( 70 % by weight al 2 o 3 ). the resulting dough was kneaded by hand , then dried at 70 ° c . following drying , the resulting material was calcined at 550 ° c . for 4 hours . following calcination , the material was crushed and sieved to 20 × 40 mesh particles , then wet - sieved to remove fines and dried at 110 ° c . the density of the resulting material was 0 . 71 g / cm 3 . the ph of the resulting particles was recorded by slurrying 1 . 0 g of particles in 50 ml di water . the ph of the resulting slurry was 4 . 3 , indicating that the resulting particles were acidic . 7 . 5 cm 3 of the 20 × 40 mesh particles of h - zsm - 5 described above were placed in the filter tube as described previously . the bed depth was 1 . 0 cm . the material was pre - humidified overnight in an environmental chamber at 27 ° c ., 80 % rh . moisture pick - up by the material following pre - humidification was less than 0 . 1 g moisture per 9 material . following pre - humidification , the particles were challenged with 1 , 000 mg / m 3 eo at 27 ° c . in 80 % rh air at a linear velocity of 6 cm / s ( contact time = 0 . 33 seconds ). the eo breakthrough time was 95 minutes . 7 . 5 cm 3 of the 20 × 40 mesh particles of h - zsm - 5 described above were placed in the filter tube as described previously . the bed depth was 1 . 0 cm . the particles were challenged with 1 , 000 mg / m 3 nh 3 at 27 ° c . in 15 % rh air at a linear velocity of 6 cm / s ( contact time = 0 . 33 seconds ). the nh 3 filtration test was performed under conditions of low rh because these conditions represent a greater challenge to the filtration media , due to the solubility of nh 3 in water . the nh 3 breakthrough time ( to 35 mg / m 3 ) was 46 minutes . 50 . 0 g of 20 × 40 mesh zsm - 5 particles prepared in example iii were impregnated to incipient using 50 . 0 ml of a solution prepared by dissolving 4 . 05 g of ( nh 4 ) 2 so 4 ( ammonium bisulfate ) in 50 ml of di water . the resulting material was dried at 70 ° c ., then calcined at 550 ° c . for 3 hours in order to decompose the ammonia salt . the resulting material had a nominal sulfate content of 6 %. the resulting 6 % so 4 / h - zsm - 5 particles were evaluated for their ability to remove eo and nh3 from streams of air as described in example iii . at 80 % rh and 27 ° c ., the eo breakthrough time was 92 minutes . at 15 % rh and 27 ° c ., the ammonia breakthrough time was 58 minutes . the above example illustrates that sulfating the binder material increases the nh 3 breakthrough time while not significantly affecting the eo breakthrough time . h - zsm - 5 particles prepared according to the method described in example iii were evaluated for their ability to filter formaldehyde . 7 . 5 cm 3 of the 20 × 40 mesh particles of h - zsm - 5 were placed in the filter tube as described previously . the bed depth was 1 . 0 cm . the material was pre - humidified overnight in an environmental chamber at 27 ° c ., 80 % rh . moisture pick - up by the material following pre - humidification was less than 0 . 1 g moisture per g material . following pre - humidification , the particles were challenged with 1 , 000 mg / m 3 formaldehyde in 80 % rh air at a linear velocity of 6 cm / s ( contact time = 0 . 33 seconds ). the formaldehyde breakthrough time ( to 1 . 2 mg / m 3 ) was 30 minutes . the test was repeated using as - received material and performed in 15 % rh air at 27 ° c . the formaldehyde breakthrough time was 74 minutes . 50 . 0 g of 20 × 40 mesh zsm - 5 particles prepared in example iii were impregnated to incipient using 50 . 0 ml of a solution prepared by dissolving 5 . 0 g of citric acid in 50 ml of di water . the resulting material was dried at 80 ° c . to remove the moisture . the resulting material had a nominal citric acid content of 6 %. the resulting 6 % citric acid / h - zsm - 5 particles were evaluated for their ability to remove eo and nh 3 from streams of air as described in example iii . at 80 % rh , the eo breakthrough time was 70 minutes . at 15 % rh , the ammonia breakthrough time was 60 minutes . the above example illustrates that adding citric acid to the particles will increase the nh 3 breakthrough time while slightly reducing the eo breakthrough time . the form of the invention described herein represents illustrative preferred embodiments and certain modifications thereto . it is understood that various changes / modifications / additions may be made without departing from the invention as defined in the claimed subject matter that follows .	8
in the following , embodiments of the present invention will be described with reference to the accompanying drawings . [ 0026 ] fig1 is a sectional view showing a schematic configuration of an image forming apparatus provided with a large - scale paper supply apparatus and a finisher . fig2 is an illustrative drawing showing portions where the image forming apparatus and the large - scale paper supply apparatus are connected together . fig3 is a schematic side view for explaining a paper transfer mechanism between the image forming apparatus and the large - scale paper supply apparatus according to a first embodiment of the present invention . fig4 is an illustrative drawing showing the paper transfer mechanism of fig3 . as shown in fig1 an image forming apparatus 100 is provided with optional units that are a large - scale paper supply apparatus 107 and a finisher 3 . the present invention is directed to a paper transfer apparatus that transfers paper between an image forming apparatus and an optional unit , and is applicable to a unit for receiving printed sheets from the image forming apparatus as well as a unit for supplying paper sheets to the image forming apparatus . in this example of fig1 a description will be given with regard to the paper transfer mechanism between the large - scale paper supply apparatus 107 and the image forming apparatus 100 . as shown in fig1 the image forming apparatus 100 has a document reader 110 at the top that includes a double - sided document feeding means and a document reading means for performing optical reading of documents . under the document reader 110 , an image forming unit is provided that includes a photosensitive drum 101 , an electric charger 102 , an exposure unit 103 , a conveyor belt 104 , a drum cleaning unit 105 , and a development unit 106 . a paper sheet on which an image is formed by the image forming unit is subjected to fixing process by a fixing unit 108 , and is then supplied by a path selecting nail 116 to the finisher 3 through ejection rollers 1 or to a paper sheet returning unit 109 used for printing on both sides of a paper sheet . under the paper sheet returning unit 109 , a paper sheet supply unit comprised of four sheet supply trays 113 . paper sheets p stored in the sheet supply trays 113 are transferred to the image forming unit through transfer rollers 111 and resist rollers 112 . the image forming apparatus 100 is provided with casters 115 that support all the weight thereof . the finisher 3 includes a punch unit 4 for making holes through the paper sheets p supplied through the ejection rollers 1 and a staple unit 7 for stapling the paper sheets p supplied to a stable tray 8 . the paper sheets p that are not undergoing stapling are ejected onto an ejection tray 5 situated at the top after being guided thereto by a path selection nail 9 . when stapling is necessary , the paper sheets p are supplied to the staple tray 8 by the path selection hooks 9 and 10 , and are stabled by the staple unit 7 , followed by being ejected onto a paper stack tray 6 . the large - scale paper supply apparatus 107 stores therein a large number of paper sheets p as a stack of paper sheets , and includes a sheet supply tray 113 a , which has a vertical position thereof adjustable by a powered adjustment mechanism . paper sheets p supplied from the sheet supply tray 113 a are ejected from the large - scale paper supply apparatus 107 through ejection rollers 111 , and are fed into the image forming apparatus 100 through a paper - sheet inlet . the large - scale paper supply apparatus 107 are provided with casters 125 that support all the weight thereof . relative positioning between the image forming apparatus 100 and the large - scale paper supply apparatus 107 is made by engaging pins 120 a and 120 b of the image forming apparatus 100 in the vertically elongated holes 121 a and 121 b of the large - scale paper supply apparatus 107 as shown in fig2 . the pins 120 a and 102 b project horizontally from the side panel of the image forming apparatus 100 , and the elongated holes 121 a and 121 b are formed on the side panel of the large - scale paper supply apparatus 107 . with this configuration , horizontal positioning is fixed , while vertical positioning is not fixed in fig1 . this makes it easier to attach / detach the large - scale paper supply apparatus 107 to / from the image forming apparatus 100 . in the first embodiment of the present invention , as shown in fig3 and fig4 an upper guide plate 26 of the image forming apparatus 100 is configured to swing around a pivot point 26 b whereas upper and lower guide plates 126 and 127 of the large - scale paper supply apparatus 107 are provided as fixed members . the upper guide plate 126 is provided with a positioning rod 126 a , and the upper guide plate 26 of the image forming apparatus 100 has a positioning guide 26 a that receives the positioning rod 126 a . further , the upper guide plate 26 has a stopper 26 c extending downward and formed as an integral part thereof , which comes in contact with the lower guide plate 27 . the stopper 26 c serves to prevent the upper guide plate 26 from dropping exceedingly when the image forming apparatus 100 stands alone . in this embodiment as described above , the upper guide plate 26 of the image forming apparatus 100 on the sheet receiving side is configured to swing freely . this design takes into account weight difference between the image forming apparatus 100 and the large - scale paper supply apparatus 107 . if the floor surface is soft in the place where the image forming apparatus 100 is installed , the image forming apparatus 100 heavier than large - scale paper supply apparatus 107 may sink deeper after an extended period of time . in such a case , the upper and lower guide plates 26 and 27 of the image forming apparatus 100 are displaced downward . in the related - art configuration of fig1 , the upper guide plate 36 of the image forming apparatus 100 would not provide a sufficient sheet transfer angle . in this embodiment , however , the upper guide plate 26 of the image forming apparatus 100 swings about the pivot point 26 b as shown in fig3 and fig4 and the positioning rod 126 a of the upper guide plate 126 fixed to the large - scale paper supply apparatus 107 is pressed against the positioning guide 26 a of the upper guide plate 26 of the image forming apparatus 100 . through this pressing movement , the upper guide plate 26 swings so as to provide a sufficient sheet transfer angle on the side of the image forming apparatus 100 . [ 0034 ] fig5 a and 5b are illustrative drawings for explaining the function of the stopper 26 c formed as part of the upper guide plate 26 . fig5 a shows the way the guide plates are positioned when the large - scale paper supply apparatus is attached to the image forming apparatus , and fig5 b shows the way the guide plates are positioned when the large - scale paper supply apparatus is detached from the image forming apparatus . as shown in fig5 a , when the image forming apparatus 100 stands alone before the large - scale paper supply apparatus 107 is attached to the image forming apparatus 100 , the upper guide plate 26 of the image forming apparatus 100 is supported by the lower guide plate 27 as the stopper 26 c is pressed against it . when the large - scale paper supply apparatus 107 is brought closer as shown by an arrow a , the positioning rod 126 a of the upper guide plate 126 fixed to the large - scale paper supply apparatus 107 comes in contact with and then slides on the positioning guide 26 a of the upper guide plate 26 of the image forming apparatus 100 . as a result , the upper guide plate 26 of the image forming apparatus 100 swings in the direction indicated by an arrow d in fig5 b , and comes to a halt . when this happens , the image forming apparatus 100 and the large - scale paper supply apparatus 107 are fixed with each other through connecting means ( not shown ). when the image forming apparatus 100 is detached from the large - scale paper supply apparatus 107 , the connecting means is disengaged , and the large - scale paper supply apparatus 107 is moved away in the direction shown by an arrow b in fig5 b . in conjunction with this movement , the positioning rod 126 a of the upper guide plate 126 fixed to the large - scale paper supply apparatus 107 is detached from the positioning guide 26 a of the upper guide plate 26 of the image forming apparatus 100 after sliding thereon . this results in the stopper 26 c of the upper guide plate 26 coming into contact with the lower guide plate 27 fixed in the image forming apparatus 100 . the embodiment described above has been described by referring to an example in which paper sheets are transferred between the image forming apparatus 100 and the large - scale paper supply apparatus 107 . it should be noted that the same configuration as described above may be used for sheet transfer between the image forming apparatus 100 and the finisher 3 . [ 0037 ] fig6 is an illustrative drawing showing the configuration of guide plates of the image forming apparatus and the large - scale paper supply apparatus according to a second embodiment of the present invention . in the second embodiment of the present invention , as shown in fig6 a lower guide plate 227 of the image forming apparatus 100 is configured to swing around a pivot point 227 b whereas upper and lower guide plates 326 and 327 of the large - scale paper supply apparatus 107 are provided as fixed members . the lower guide plate 327 is provided with a positioning rod 327 a , and the lower guide plate 227 of the image forming apparatus 100 has a positioning guide 227 a that receives the positioning rod 327 a . the lower guide plate 227 has a hooking part 227 d , to which a coil spring 231 is hooked at one end thereof . the other end of the coil spring is fixed to a spring fixing part 230 that is situated at a predetermined position inside the image forming apparatus 100 . the coil spring 231 serves to pull up the lower guide plate 227 at all times , thereby preventing the lower guide plate 227 from dropping from its own weight . the lower guide plate 227 has a stopper 227 c extending upward and formed as an integral part thereof , which comes in contact with the upper guide plate 226 . the stopper 227 c serves to prevent the lower guide plate 227 from being lifted exceedingly when the image forming apparatus 100 stands alone . in this embodiment as described above , the lower guide plate 227 of the image forming apparatus 100 on the sheet receiving side is configured to swing freely . with this provision , even if the large - scale paper supply apparatus 107 sinks lower than the image . forming apparatus 100 , proper sheet transfer can be achieved from the large - scale paper supply apparatus 107 to the image forming apparatus 100 . [ 0040 ] fig7 is an illustrative drawing showing the configuration of guide plates of the image forming apparatus and the large - scale paper supply apparatus according to a third embodiment of the present invention . in the third embodiment of the present invention , as shown in fig7 an upper guide plate 426 of the image forming apparatus 100 is configured to swing around a pivot point 426 b , and a lower guide plate 427 is also configured to swing around a pivot point 427 b . in the large - scale paper supply apparatus 107 , an upper guide plate 526 is secured in a fixed position and provided with a positioning rod 526 a , and a lower guide plate 527 is secured in a fixed position and provided with a positioning rod 527 a . in the image forming apparatus 100 , the upper guide plate 426 has a positioning guide 426 a that receives the positioning rod 526 a , and the lower guide plate 427 has a positioning guide 427 a that receives the positioning rod 527 a . the lower guide plate 427 has a hooking part 427 d , to which a coil spring 431 is hooked at one end thereof . the other end of the coil spring 431 is fixed to a spring fixing part 430 that is situated at a predetermined position inside the image forming apparatus 100 . the coil spring 431 serves to pull up the lower guide plate 427 at all times , thereby preventing the lower guide plate 427 from dropping from its own weight . the upper guide plate 426 has a stopper 426 c extending downward and formed as an integral part thereof , which comes in contact with an opposite stopper 442 fixedly provided at a predetermined location inside the image forming apparatus 100 . the stopper 426 c serves to prevent the upper guide plate 426 from dropping exceedingly when the image forming apparatus 100 stands alone . by the same token , the lower guide plate 427 has a stopper 427 c extending upward and formed as an integral part thereof , which comes in contact with an opposite stopper 441 fixedly provided at a predetermined location inside the image forming apparatus 100 . the stopper 427 c serves to prevent the lower guide plate 427 from being lifted exceedingly when the image forming apparatus 100 stands alone . in this embodiment as described above , the upper and lower guide plates 426 and 427 of the image forming apparatus 100 on the sheet receiving side are configured to swing freely . with this provision , even if the large - scale paper supply apparatus 107 is displaced lower than or higher than the image forming apparatus 100 , proper sheet transfer can be achieved from the large - scale paper supply apparatus 107 to the image forming apparatus 100 . [ 0044 ] fig8 is an illustrative drawing showing the configuration of guide plates of the image forming apparatus and the large - scale paper supply apparatus according to a fourth embodiment of the present invention . in the fourth embodiment of the present invention , as shown in fig8 upper and lower guide plates 626 and 627 of the image forming apparatus 100 are fixed whereas upper and lower guide plates 726 and 727 of the large - scale paper supply apparatus 107 are configured to swing about a pivot point 730 . the upper and lower guide plates 726 and 727 are connected together by a connecting member 731 so that a space between the guide plates does not vary with swinging movement . the lower guide plate 727 has a positioning rod 727 a formed thereon . in the image forming apparatus 100 , the fixed lower guide plate 627 has a positioning guide 627 a formed thereon for the purpose of receiving the positioning rod 727 a . in this embodiment , the upper and lower guide plates 726 and 727 of the large - scale paper supply apparatus 107 on the paper supply side are connected together through the connecting member 731 and configured to swing around the pivot point 730 , so that the upper and lower guide plates 726 and 727 swing together as one coherent unit without causing a change in the gap space between the guide plates , thereby shifting the position of sheet ejection in a vertical direction . with this provision , even if the large - scale paper supply apparatus 107 is displaced lower than or higher than the image forming apparatus 100 , proper sheet transfer can be achieved from the large - scale paper supply apparatus 107 to the image forming apparatus 100 . [ 0047 ] fig9 a and 9b are illustrative drawings showing the configuration of guide plates of the image forming apparatus and the large - scale paper supply apparatus according to a fifth embodiment of the present invention . in the fifth embodiment of the present invention , as shown in fig9 a , upper and lower guide plates 826 and 827 of the image forming apparatus 100 are fixedly mounted , and upper and lower guide plates 926 and 927 of the large - scale paper supply apparatus 107 are also fixedly mounted . the upper and lower guide plates 826 and 827 of the image forming apparatus 100 are made of elastic material , and can change their shapes elastically in response to a stress applied thereto . on the other hand , the upper and lower guide plates 926 and 927 of the large - scale paper supply apparatus 107 are not elastic . with this provision , if the large - scale paper supply apparatus 107 is displaced upward relative to the image forming apparatus 100 , the upper guide plate 826 of the image forming apparatus 100 is elastically bent as shown in fig9 b , thereby providing a sufficient paper transfer angle . by the same token , if the large - scale paper supply apparatus 107 is displaced downward relative to the image forming apparatus 100 , the lower guide plate 827 of the image forming apparatus 100 is elastically bent , thereby providing a sufficient paper transfer angle . the above description was provided with respect to a case in which the guide plates of the image forming apparatus 100 are elastically bendable . alternatively , the upper and lower guide plates of the large - scale paper supply apparatus 107 may be configured in such a manner as to be elastically bendable without changing the gap space between the guide plates . further , the present invention is not limited to these embodiments , but various variations and modifications may be made without departing from the scope of the present invention . the present application is based on japanese priority applications no . 2001 - 117343 filed on apr . 16 , 2001 and no . 2002 - 097467 filed on mar . 29 , 2002 , with the japanese patent office , the entire contents of which are hereby incorporated by reference .	1
an illustrative embodiment of prosthetic heart valve delivery apparatus 10 in accordance with the invention is shown in fig1 . fig1 and several subsequent figs . omit all depiction of the prosthetic valve , but several still later figs . do show examples of such valves . the components of apparatus 10 that are visible in fig1 include handle 20 , control wheel 30 , outer shaft 40 , inner shaft 50 , distal tip 60 , and proximal ( back ) manifold connector 70 . elements 40 and 70 are both fixed to handle 20 . control wheel 30 is rotatable about an axis ( perpendicular to the plane on which fig1 is drawn ) to cause shaft 50 ( and distal tip 60 ) to advance or retract relative to shaft 40 , depending on the direction of rotation of the control wheel . distal tip 60 is fixed on the distal end of shaft 50 . connector 70 may include one or more lumens that communicate with one or more lumens through other components of the apparatus . elements 20 , 30 , and 70 remain outside the patient at all times . elements 40 , 50 , and 60 are designed for insertion into a patient &# 39 ; s body in a low invasiveness manner to deliver a prosthetic heart valve into the patient and to deploy ( implant ) that prosthetic heart valve in the patient . more particularly , the prosthetic heart valve is initially contained ( in a collapsed condition ) in a distal portion of apparatus 10 ( i . e ., inside shaft 40 , concentrically around shaft 50 , and abutting distal tip 60 ). in this condition of the apparatus , shaft 40 may help to keep the valve collapsed , and distal tip 60 ( which is proximally retracted ) may help to keep the valve inside shaft 40 . when the distal portion of the apparatus reaches the desired implant site for the valve in the patient , wheel 30 can be rotated to extend distal tip 60 , a distal portion of shaft 50 , and the prosthetic heart valve from the distal end of shaft 40 . this allows the prosthetic heart valve to expand radially outwardly from shaft 50 to its full operating size , which also causes the valve to engage surrounding native tissue of the patient and thereby implant in the patient . the apparatus can then be withdrawn ( proximally ) from the patient . in particular , distal tip 60 comes out through the center of the now - expanded valve . more details regarding the foregoing will be provided later in this specification . it should be noted that in the fig1 embodiment , shaft 40 is off - center relative to handle 20 ( i . e ., shaft 40 is somewhat below the top - to - bottom center of handle 20 ). on the other hand , wheel 30 is centered on handle 20 and is exposed for operation from either above or below the handle . fig2 and 3 show other views of apparatus 10 . fig3 shows apparatus 10 with half of handle 20 removed . this exposes the connection between wheel 30 and shaft 50 . in particular , it shows that there is a spur gear 32 on wheel 30 concentric with the axis of rotation of wheel 30 . this spur gear engages with a rack 52 on shaft 50 . these features allow rotation of wheel 30 to cause translation of shaft 50 along its longitudinal axis . ( features of this kind may be seen even more clearly for another embodiment in fig5 .) an alternative embodiment of device 10 is shown in fig4 . even though the fig4 embodiment is somewhat different than the fig1 - 3 embodiment , the same reference numbers continue to be used for generally similar elements . thus additional information for such elements can be gleaned from earlier description of those elements , and it will not be necessary to repeat everything previously said for elements that are used again ( at least in generally similar form ) in different embodiments . the fig4 embodiment is different from the fig1 - 3 embodiment in that in fig4 shaft 40 is centered ( from top to bottom ) on handle 20 . another difference is that in fig4 , control wheel 30 is only operable from the top of handle 20 . fig4 shows the possible addition of a toroidal or donut - shaped sealing ring 80 disposed concentrically around an intermediate portion of the length of shaft 40 . ring 80 fits relatively closely around the outside of shaft 40 , but ring 80 is also axially slidable along shaft 40 . if ring 80 is moved in the proximal direction from the approximate starting position shown in fig4 , coil spring 90 ( also disposed concentrically around shaft 90 ) acts to resiliently urge it back toward the starting position . ring 80 can be located along shaft 40 so that when the distal portion of shaft 40 is pushed through an opening ( aperture ) in the apex of the patient &# 39 ; s heart or other access to the patient &# 39 ; s circulatory system , ring 80 bears against the outer surface of the tissue around the aperture and helps to reduce blood leakage from the circulatory system via the aperture . spring 90 keeps ring 80 resiliently pressed against the outside of the tissue for this purpose . ring 80 may be made of a softer material than other components of apparatus 10 . for example , ring 80 may be made of silicone . fig5 shows an enlargement of a portion of the fig4 embodiment with part of handle 20 removed . thus fig5 shows the spur gear 32 on wheel 30 engaging the rack 52 on shaft 50 as described earlier in connection with fig3 . fig5 also shows a tube 100 that may extend from connector 70 to a distal portion of the apparatus . for example , tube 100 may extend to opening 62 in the distal end of tip 60 for allowing fluid introduced via connector 70 to be released into the patient from the distal end of tip 60 for such purposes as providing fluoroscopically visible contrast in the patient . there may be more than one such tube 100 , which may go to different destinations in the device , and which may be for different purposes . note that shaft 50 may be translatable axially ( i . e ., lengthwise ) relative to tube 100 . fig6 shows portions of elements 40 and 50 and element 60 on a larger scale . fig7 does the same for a portion of element 20 and element 70 . fig7 also shows that element 70 may include a valve 72 for selectively closing a lumen through that element . in particular , valve 72 may be controlled by the operator of the apparatus to close a lumen through connector 70 , e . g ., to prevent blood from escaping from the patient via that lumen . when desired , the operator may open valve 72 , e . g ., to allow fluid or some other auxiliary material or apparatus to be introduced into the patient via the associated lumen . depicted valve 72 may be repeated for other lumens if desired . fig8 shows an illustrative embodiment of a possible addition to what has been shown before . in particular , fig8 shows that a plurality of fingers 110 may be selectively deployed from the distal end of shaft 40 ( when distal tip 60 is moved somewhat away from that distal shaft end ) to push back native leaflets of a patient &# 39 ; s native heart valve ( which is going to be replaced by the prosthetic heart valve delivered by device 10 ). fingers 110 may be initially confined in an annular array inside a distal portion of shaft 40 . when it is desired to deploy them ( typically when the distal portion of the apparatus is appropriately positioned relative to the native valve that is to be replaced ), fingers 110 can be pushed ( part way ) from the distal end of shaft 40 , and they then resiliently extend ( radially ) out farther from central shaft 50 , albeit still in an annular array as shown in fig8 . in this condition , fingers 110 push back the leaflets of the native valve ( e . g ., into the patient &# 39 ; s native valsalva sinus ) in order to help make appropriate room for deployment of the prosthetic valve within the native valve . as shown in fig3 , fingers 110 may be attached to a shaft 112 that runs longitudinally inside shaft 40 into handle 20 . fingers 110 and their shaft 112 can be advanced or retracted relative to shaft 40 via a sliding control , lever , or the like that is on the outside of handle 20 . for example , fig3 shows a control member 114 attached to the proximal end of shaft 112 . control member 114 can project from a slot in a side of handle 20 , where it can be manipulated by the user of the apparatus to advance or retract fingers 110 . alternatively , control member 114 may connect to another actuator element on handle 20 for the same purpose as described in the preceding sentence . fig9 shows a structure similar to what is shown in fig8 , with the addition of prosthetic valve 200 now deployed from near the distal end of the apparatus . subsequent figs . show valve 200 and its deployment on a larger scale and in more detail , so more detailed discussion of the valve will be provided later in connection with those other figs . here it is preliminarily noted that the principal components of valve 200 include an annular framework 210 ( e . g ., of metal ) and a plurality of flexible valve leaflets 220 disposed within and mounted on that framework . framework 210 and leaflets 220 are radially collapsible to a circumferential size that can fit inside shaft 40 . however , when shifted beyond the distal end of shaft 40 as shown in fig9 , framework 210 can resiliently expand ( as shown in fig9 ), carrying leaflets 220 with the frame and positioning those leaflets relative to one another so that they can operate as a one - way , blood flow , check valve ( like the native heart valve being replaced ). fig1 shows elements 80 and 90 ( and portions of neighboring elements ) on a still larger scale . fig1 does the same for elements 110 and portions of neighboring elements . note the opening 62 in the distal end of tip 60 , which opening may communicate with a lumen through above - described tube 100 . fig1 - 20 show an illustrative embodiment of how valve 200 may be deployed . these figs . focus on valve 200 and the distal portion of delivery apparatus 10 . fig1 shows this portion of the apparatus in the condition that it has as it is being introduced into the patient ( e . g ., via an aperture in the apex of the patient &# 39 ; s heart ). note that tip 60 is against the distal end of shaft 40 to give this portion of the apparatus a smooth exterior surface . when the distal portion of apparatus 10 reaches the desired location in the patient ( i . e ., the desired location for implanting the prosthetic heart valve ), distal tip 60 and some associated structure may be displaced distally from the distal end of shaft 40 as shown in fig1 . this may be done by rotating wheel 30 . in addition to what has been shown in earlier figs ., fig1 shows that the apparatus may include a sleeve 120 around the outside of collapsed valve 200 , but inside collapsed fingers 110 . this sleeve may help to protect valve 200 from fingers 110 , and it may also facilitate the staged deployment of valve 200 . as fig1 shows , sleeve 120 initially moves in the distal direction with tip 60 and other elements that are inside sleeve 120 . the next step is shown in fig1 . in this step , fingers 110 are pushed part way out of the distal end of shaft 40 so that these distal portions of fingers 110 can spread radially outwardly and thereby push back the leaflets of the patient &# 39 ; s native heart valve . a point should be made here as follows . fig1 and subsequent figs . may show the apparatus that is inside deployed fingers 110 at locations that are more distal to fingers 110 than would actually be the case . for example , elements 120 and 60 may not be distally as far from fingers 110 after deployment of those fingers as is shown in fig1 ( and subsequent figs .). instead , valve 200 may be deployed closer to deployed fingers 110 than the figs . alone may suggest . the figs . deviate from what may be the actual practice in this respect so that various parts can be seen more clearly ( i . e ., without overlapping and thereby obscuring one another ). the next step is illustrated by fig1 . in this step , sleeve 120 is pulled back proximally to begin to expose prosthetic heart valve 200 . although not shown in full detail in fig1 to avoid over - complicating the drawing , the distal portion of heart valve 200 typically begins to deploy ( i . e ., expand radially outwardly as indicated by arrows 202 ) as it is released from confinement within sleeve 120 . thus the actual condition of valve 200 in fig1 is typically more like what is shown in fig2 ( i . e ., distal portion of valve ( beyond sleeve 120 ) expanded radially out ; proximal portion of valve ( still within sleeve 120 ) still prevented by sleeve 120 from expanding radially out ). fig1 shows sleeve 120 pulled proximally back even farther so that valve 200 is now completely exposed . once again , to avoid over - complicating the drawing , fig1 omits the fact that at this stage heart valve 200 is typically expanded radially outwardly along its entire length as indicated by the arrows 202 and 204 in fig1 and as is actually shown in fig1 . fig1 does , however , serve to illustrate the point that prior to the deployment of valve 200 ( i . e ., prior to its radial outward expansion ), the axial position of the collapsed valve is maintained in the apparatus by positioning the valve between distal tip 60 and a more proximal collar 140 on shaft 50 . fig1 and 18 show additional structure that may be included in accordance with the invention . this is a system of flexible strands 130 that may be used ( in conjunction with distal re - advancement of sleeve 120 ) to re - collapse valve 200 ( either partly or wholly ) in the event that it is found desirable or necessary to reposition the valve in the patient or to completely remove the valve from the patient after the valve has been partly or wholly expanded radially outwardly in the patient . fig1 and 18 show the routing of strands 130 in this embodiment . a typical strand 130 comes from a proximal portion of the apparatus between shaft 50 and sleeve 120 . the strand 130 passes through an aperture in collar 140 , and then runs along the outside of valve 200 to an aperture in distal tip 60 . the strand passes through the interior of tip 60 , and then through the central lumen of shaft 50 , extending proximally all the way to the handle , where the strand ends can be controlled by the operator of the apparatus . there can be any number of similarly routed strands 130 spaced in the circumferential direction around the apparatus and valve 200 . strands 130 are shown in a relatively loose or relaxed condition in fig1 and 18 . however , they can be tightened by pulling on their proximal portions . an example of how strands 130 may be used is as follows . the gradual proximal retraction of sleeve 120 ( described in earlier paragraphs ) allows heart valve 200 to gradually deploy radially outwardly . strands 130 are relaxed or loose at this time . the gradual deployment of valve 200 may be observed by the operator of the apparatus ( e . g ., via x - ray , fluoroscopy , or the like ). if the valve is not going in as desired , expansion of the valve can be stopped by stopping the proximal retraction of sleeve 120 . strands 130 can then be tightened by pulling proximally on their proximal portions , and at the same time sleeve 120 can be pushed in the distal direction . this combination of tightening strands 130 and pushing distally on sleeve 120 causes valve 200 to collapse back into the sleeve . the apparatus can then be repositioned to reposition valve 200 in the patient ( after which the valve can be deployed again ), or alternatively the valve can be completely removed from the patient with all of the surrounding instrumentation . assuming that the valve remains in the patient , then when the operator of the apparatus is satisfied with its deployed position and condition , strands 130 can be removed ( or effectively removed ) by pulling on one proximal portion of each strand until the other end of that strand has been past valve 200 two times ( once going in the distal direction , and then going in the proximal direction ). fig1 and 20 show the condition of the apparatus after strands 130 have thus been removed ( or effectively removed ). strands 130 can be made of any suitably tensilely strong but laterally ( transversely ) flexible material . examples include suture material , metal wire , or the like . because fig1 and 20 show valve 200 in the fully deployed condition and after strands 130 have been removed , these figs . offer the clearest views of valve 200 and therefore afford the best reference for the following further description of the valve . although this description is provided in connection with fig1 and 20 , it will be understood that the valve can be the same in all of the earlier - discussed figs . herein . on the other hand , it will also be understood that this particular construction of the prosthetic heart valve is only an example , and that many modifications , variations , and alternatives are also possible for the valve . as was mentioned earlier in this specification , principal components of valve 200 include frame 210 ( e . g ., of a highly elastic metal such as nitinol ) and a plurality of leaflets ( e . g ., three leaflets ) 220 of a flexible material such as tissue that has been rendered effectively inert and otherwise made suitable for long - term , non - reactive use in a patient &# 39 ; s body . leaflets 220 are secured to frame 210 in such a way that the leaflets can open ( to allow blood to flow through the valve from left to right as viewed in fig1 and 20 ) and close ( to prevent blood from flowing through the valve from right to left as viewed in these figs .). the illustrative configuration of valve 200 that is shown in the figs . herein is particularly adapted for use as a prosthetic aortic valve . details of valve 200 will therefore be described in that context . it will be understood , however , that this is only an example , and that the prosthetic valve can be alternatively configured differently in some respects to adapt it for use as a replacement for other valves in the heart or circulatory system . frame 210 is preferably a continuous , one - piece , annular ( ring - like ) structure ( e . g ., a structure that has been cut ( using a laser ) from a tube and then further processed to achieve a desired shape ). frame 210 has a “ lower ” ( upstream or blood inflow ) portion 212 that extends in a serpentine ( undulating or zig - zag ) fashion all the way around the valve . this portion of frame 210 may be designed for implanting in or near the patient &# 39 ; s native valve annulus . frame 210 also includes an “ upper ” ( downstream or blood outflow ) portion 216 that also extends in a serpentine ( undulating or zig - zag ) fashion all the way around the valve . this portion of frame 210 may be designed for implanting in the patient &# 39 ; s aorta downstream from the valsalva sinus of the patient . frame portions 212 and 216 are connected to one another by a plurality of links or struts 214 that extend between those other frame portions at locations that are spaced from one another around the valve . struts 214 may bow or bulge radially outwardly ( as shown ) to follow the inner surface of lobes of the valsalva sinus . frame 210 may include commissure post members 218 that extend up from lower portion 212 at appropriate locations around the valve ( analogous to the commissures of the patient &# 39 ; s native heart valve ). these posts 218 can form important portions of the frame structure to which leaflets 220 are attached . frame 210 may also include other structures 219 that extend up and incline radially out from lower portion 212 to help hold back the patient &# 39 ; s native valve leaflets , which ( to the extent left remaining in the patient ) are no longer functional . frame 210 may also include barbs ( e . g ., 211 ) at various locations to engage ( and possibly penetrate ) the patient &# 39 ; s native tissue to help hold the valve in place where deployed in the patient . the point of making annular frame portions 212 and 216 serpentine is to facilitate annular ( circumferential , radial ) collapse and subsequent re - expansion of the valve . such collapse is preferably elastic , and the subsequent re - expansion is preferably resilient . although not shown herein , it will be understood that valve 200 may also include other components such as one or more layers of fabric and / or tissue on various parts of the valve . such additional layers may be for such purposes as to promote tissue in - growth , to reduce the amount of contact between frame 210 and surrounding native tissue , to prevent moving portions of leaflets 220 from contacting frame 210 , etc . illustrative details for collar 140 are shown in fig2 and 22 . these features may include a distally extending , radially outer rim 142 , within which a proximal portion of valve 200 can be received when the valve is in the collapsed condition . this structure 142 can help to keep valve 200 confined to its collapsed condition prior to deployment . other features of collar 140 may include recesses or sockets 144 , into which extreme proximal portions ( e . g ., 211 ) of frame 210 may extend when valve 200 is in the collapsed condition . such engagement between frame 210 and collar 140 can help ensure that valve 200 always maintains a known rotational ( angular ) orientation about the longitudinal axis of the apparatus . this can be helpful to ensure that rotation of apparatus 10 about its longitudinal axis produces exactly the same rotation of valve 200 about that axis . this may be important , for example , to help the operator of the apparatus position valve 200 for deployment with commissure posts 218 in a desired rotational or angular position relative to the patient &# 39 ; s native valve commissures . as a specific example , it may be desirable for each commissure post 218 to be aligned with and inside a respective one of the patient &# 39 ; s native valve commissures . this may necessitate rotation of apparatus 10 about its longitudinal axis , and features like 144 ( with certain valve frame features received within those features 144 ) can help ensure that valve 200 has a known angular relationship to apparatus 10 , and that this angular relationship is always maintained until the valve is deployed from the apparatus . snug engagement between collar 140 and shaft 50 is also part of this aspect of the invention in this embodiment . still other possible features of collar 140 are apertures 146 for passage of above - described strands 130 through the collar . fig2 - 26 illustrate another possible feature of the apparatus . this is an embolic protection structure 300 , which may also include features for pushing back the leaflets of the native heart valve that is to be replaced by the prosthetic valve . structure 300 will now be described . a purpose of apparatus 300 is to capture any debris ( e . g ., emboli ) that may be dislodged from inside the patient during deployment of prosthetic heart valve 200 and / or the expansion of fork fingers 110 . thus embolic protection apparatus 300 is typically deployed in the patient , early in the procedure , downstream from the location at which valve 200 will be deployed . for example , assuming that valve 200 is a replacement for the patient &# 39 ; s native aortic valve , apparatus 300 may be deployed in the patient &# 39 ; s aorta downstream from where the prosthetic valve will be employed . apparatus 300 acts like a blood filter . it allows blood to flow through , but it captures any particles or the like that should not be allowed to remain in the patient &# 39 ; s blood stream . after prosthetic valve 200 has been implanted , apparatus 300 is collapsed ( still retaining any debris it has captured ) and removed from the patient in the opposite way from which it was introduced . in this embodiment , apparatus 300 is a structure somewhat like an umbrella . in particular , structure 300 has a central shaft 310 , and a plurality of ribs or spokes 320 that are attached to a distal portion of shaft 310 and that can either collapse inwardly against ( parallel to ) shaft 310 or that can incline radially outwardly from shaft 310 . another element of structure 300 is a flexible , emboli - catching web or mesh ( blood filter ) 330 attached to ribs 320 . still other components of structure 300 are tethers 340 ( shown only in fig2 to avoid over - complicating the other figs .). tethers 340 run inside the proximal portion of shaft 310 and come out of apertures in the side wall of shaft 310 at locations that are adjacent to ribs 320 . each tether 340 is attached to a respective one of ribs 320 . before deploying valve 200 , apparatus 300 may be introduced into the patient in a collapsed condition via proximal connector 70 , a lumen through tube 100 , and distal tip aperture 62 . when apparatus 300 is at the desired location in the patient &# 39 ; s circulatory system downstream from where valve 200 is to be implanted , the proximally directed tension on proximal portions of strands 340 may be released . this allows ribs 320 to resiliently deflect outwardly into an array somewhat like the ribs or spokes of an open umbrella . ribs 320 carry out with them , and thus also open , blood filter web 330 . these structures ( i . e ., 320 and 330 ) preferably bear against an annular portion of the inner surface of a blood vessel ( e . g ., the aorta ) downstream from where valve 200 will be implanted in the patient . after valve 200 has been deployed , embolic protection apparatus 300 may be collapsed again by pulling proximally on tethers 340 . this causes ribs 320 to again become parallel to and against central shaft 310 . blood filter 330 ( with any captured debris ) is thereby also collapsed against central shaft 310 . this allows apparatus 300 to be pulled back into device 10 via the aperture 62 in distal tip 60 . note that apparatus 300 may include ribs 320 that extend proximally back from blood filter 330 per se . these rib extensions may serve the additional function of pushing back ( radially outwardly ) the leaflets of the patient &# 39 ; s native heart valve prior to deployment of prosthetic valve 200 . after apparatus 300 ( with above - mentioned , optional , proximal , rib extensions ) has been deployed , the distal portion of device 10 may be moved distally closer to apparatus 300 . the distal portion of device 10 may then be opened and valve 200 may be deployed as shown in fig2 - 25 . because in this embodiment , deployed valve 200 may somewhat axially overlap with the proximal extensions of ribs 320 , after deployment of valve 200 , apparatus 300 may first be pushed in the distal direction to eliminate this overlap so that apparatus 300 can be re - closed without disturbing implanted valve 200 . this is also a convenient point to mention that after valve 200 has been deployed ( in any embodiment , with or without apparatus 300 ), shaft 40 may be pushed distally through the implanted valve to again close against distal tip 60 . this restores the smooth outer surface to device 10 , which facilitates proximal withdrawal of device 10 through the implanted valve without disturbing the valve . if apparatus 300 is employed , it is preferably collapsed and returned to the interior of device 10 ( or completely removed via device 10 ) prior to full withdrawal of device 10 through the implanted valve . fig2 shows that a lumen through elements 70 , 100 , 60 , 62 can be used for passage of a guide wire 400 through the apparatus . thus a guide wire 400 can first be placed in the patient , and device 10 can thereafter be introduced into the patient by following along this guide wire . this guide wire lumen and / or other similar lumens through device 10 can alternatively or additionally be used for other purposes such as flushing , introduction and / or removal of other ancillary devices ( e . g ., embolic protection apparatus 300 ), etc . fig2 shows other possible aspects of valve deployment and retrieval . fig2 shows the upstream end of valve 200 inside sheath 120 and bearing on collar 140 . suture or wire strands 500 pass through collar 140 and are looped through upstream portions 212 of valve frame 210 . strands 500 can be pulled in the proximal direction to hold the proximal ( upstream ) end of valve 200 against collar 140 . this also prevents the proximal end of valve 200 from expanding radially outwardly ( even when sheath 120 is retracted proximally ). however , when sheath 120 is retracted proximally past the proximal end of valve 200 and the tension on strands 500 is relaxed , the proximal end of valve 200 can expand resiliently outwardly . ( fig2 shows this structure again ( although it omits depiction of strands 500 to avoid over - complicating the drawing ) with the distal ( downstream ) portion of valve 200 released from sheath 120 and resiliently expanded outwardly , but with the proximal portion of the valve not yet released .) fig2 and 29 show that the distal end of sheath 120 may flare radially outwardly as shown at 122 . this feature and strands 500 can be used to re - collapse valve 200 prior to its final release from device 10 if for any reason it is desired to reposition the valve in the patient or remove the valve from the patient . a combination of pulling proximally on strands 500 and pushing sheath 120 distally can be used to collapse valve 200 back down into sheath 120 with the proximal end of the valve seated against collar 140 . the valve can then either be positioned differently in the patient and again deployed , or the valve can be completely removed from the patient with device 10 . assuming that valve 200 is going to be implanted in the patient , when the operator of the apparatus is satisfied with the placement of the valve in the patient , the valve is finally released from device 10 by allowing the downstream end of the valve to deploy and anchor against the aortic wall , and then deploying the upstream valve end . finally , strands 500 are removed by releasing one end of each strand loop and using the other end of that loop to pull the released end sufficiently far so that the strand no longer prevents release of the valve from device 10 . it will be understood that the foregoing is only illustrative of the principles of the invention and that various modifications can be made by those skilled in the art without departing from the scope and spirit of the invention . for example , the shapes and sizes of various components can be different from the shapes and sizes employed in the illustrative embodiments shown herein . as another example , the lateral stiffness of shaft 40 and / or other longitudinal elements within shaft 40 can be selected to render the apparatus suitable for different possible uses and / or preferences . thus in some embodiments it may be desirable for the shaft portion of the apparatus to be relatively stiff or even rigid or substantially rigid ( i . e ., not flexible or bendable transverse to or laterally of its longitudinal axis ). on the other hand , in other embodiments it may be desirable for the shaft portion of the apparatus ( or certain parts of the shaft portion ) to be more laterally flexible .	0
with reference now to the drawings , and in particular to fig1 - 7 thereof , a new clam and oyster opener embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . more specifically , it will be noted that the clam and oyster opener 10 comprises a base plate 12 positionable upon a support surface and preferably including at least one aperture 14 extending therethrough , as shown in fig7 which permits the passage of a threaded fastener 16 through the base plate 12 to secure the base plate to an underlying support surface . a support channel 18 is secured to a top surface of the base plate 12 and is defined by a first planar member 20 ( see fig6 ) secured to an upper surface of the base plate 12 and oriented at an oblique angle relative thereto , with a second planar member 22 similarly secured to the upper surface of the base plate 12 and oriented at an oblique angle relative to both the base plate and the first planar member 20 . the orientation of the first planar member 20 relative to the second planar member 22 defines the substantially v - shape of the support channel 18 . by this structure , the clam or oyster can be positioned within the support channel 18 and oriented such that the opening crack of the oyster or clam is positioned within a substantially vertical plane extending through a juncture of the first and second planar members 20 , 22 . as best illustrated in fig1 through 3 , the clam and oyster opener 10 further comprises a pair of spaced vertical stanchions 24 which extend upwardly from an end of the base plate 12 and cooperate to support an axle 26 therebetween . a pair of brace plates 28 are coupled to vertical edges of the vertical stanchions 24 and to the base plate 12 and cooperate to support the vertical stanchions 24 in a fixed position relative to the base plate . a rotatable tube 30 is concentrically disposed about the axle 26 . a lever arm 32 having first and second ends is fixedly secured to the rotatable tube 30 at the first end of the lever arm , and is provided with a handle 34 at the second end thereof , whereby an individual can grasp and manipulate the handle 34 to effect pivotal movement of the lever arm 32 through the vertical plane extending through the support channel 18 . preferably , a length of the rotating tube is substantially less than a distance between the vertical stanchions , as shown in fig1 such that the lever arm can be axially translated laterally as desired to center the lever arm over an oyster or clam . an engaging tip 36 is fixedly secured to the lever arm 32 and is positioned so as to extend into the support channel 18 to engage and open an oyster or clam positioned therewithin as described above . as best illustrated in fig4 it can be shown that the engaging tip 36 comprises a depending projection 38 which is fixedly secured to the lever arm 32 and includes a plurality of spaced transverse slots 40 extending partially therearound . a single longitudinal slot 42 extends into contiguous communication with the spaced transverse slots 40 and permits an adjustable plate 44 to be movably positioned into any one of the spaced transverse slots . as shown in fig5 the adjustable plate 44 is concentrically disposed about the depending projection 38 and includes a radial projection 46 projecting radially inward and into one of the transverse slots 40 . by this structure , the adjustable plate 44 can be rotated so as to position the radial projection 46 into the longitudinal slot 42 , whereby axial movement of the adjustable plate 44 relative to the depending projection 38 can be accomplished to position the radial projection 46 into another one of the transverse slots 40 . such movement of the adjustable plate 44 allows the same to be positioned at a desired location along the depending projection 38 to limit a distance that the engaging tip 36 extends into the clam or oyster during cracking or opening thereof . the device operates appropriately when the adjustable plate is positioned approximately one and one - half inches from a lower most portion of the engaging tip to preclude damage to the oyster or clam being opened . the engaging tip 36 continues past the adjustable plate 44 into a mounting projection 48 having an annular groove 50 extending circumferentially thereabout . the mounting projection 48 is operable to receive any one of a plurality of tips for mounting thereto . the tips , as shown in fig4 include a blunt tip 52 , a sharp tip 54 , and a blade tip 56 . the tips 52 - 56 each include a threaded set screw 58 directed therethrough which can be rotatably advanced into engagement with the annular groove 50 to effect securement of the respective tip to the mounting projection 48 of the engaging tip 36 . by this structure , a desired tip 52 - 56 can be selectively coupled to the engaging tip 36 as desired . in use , the clam and oyster opener 10 of the present invention operates to quickly and easily open the shell of the clam or oyster . an individual operating the device 10 can simply place the oyster within the support channel 18 with the lever arm 32 in a raised position , whereby a pivotal motion of the lever arm 32 towards the base plate 12 causes the engaging tip 36 to engage the oyster within the support channel 18 to effect cracking and opening of the oyster . the device 10 is particularly useful in an assembly line operation wherein a first individual hands the clams or oysters to a second individual operating the clam and oyster opener 10 to effect continuous opening of the clam and / or oysters . as to a further discussion of the manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	0
the custom key panel in accordance with the invention is an assembly of parts that preferably allows an interchangeable key pad assembly to be associated with system keyboard means to provide one of a variety of sets of key functions available to the user . the custom key panel provides direct execution of commands that typically are most frequently selected by the user . in one embodiment , the custom key panel does not make an electrical connection when plugged in . it mechanically actuates switches for addressing a processor in the system with a unique identification code for each interchangeable assembly . this provides a very reliable system . one embodiment of the custom key panel in accordance with the invention is generally indicated by the numeral 10 , as shown in fig1 . the custom key panel 10 preferably comprises switch means 12 ( see also fig2 a and 2b ) in the form of user selectable key means 14 and actuable key decoding means 16 ( see also fig3 a , 3b , and 3c ), as shown in more detail in fig8 ). the custom key panel 10 also preferably comprises key means 18 ( see also fig8 ) selectively mountable in relation to the switch means 12 for actuating the switch means . the key means 18 preferably comprises mechanical switch actuating means comprising at least one key 20 ( see also fig5 a , 5b , and 8 ) which is selectively actuable by the user . the key means 18 also comprises key encoding means 22 ( see also fig8 ) which actuates the key decoding means 16 when the key means is mounted in relation to the switch means 12 for identifying the function selectable by the user when at least one key 20 is actuated by the user . the switches 14 and 16 are preferably conductive rubber members 24 or pellets compression molded into a sheet 26 of non - conductive rubber , forming the keypad or matrix of switches , as shown in fig3 b , 3c , and 8 . the conductive members 24 are held above traces 28 on a printed circuit board 30 ( see also fig8 ) by the non - conductive rubber sheet 26 . when a switch 14 or 16 is depressed , the conductive member 24 shorts the traces for that location and is acknowledged by the processor as a closed switch . there are preferably six binary address switches , which allow 64 possible custom key panel key function options . the six address switches are arranged in the same matrix as hole locations on a subpanel 32 ( see also fig5 and 8 ) of the custom key panel assembly . the subpanel 32 can hold down an address switch 16 ( ensuring closure ) when there is no hole . the configuration of each address switch 16 allows overtravel or compression of the rubber actuator without exerting excessive force on the assembly . this ensures switch closure under worst case tolerance stack - up and bowing of the subpanel 32 and the keyboard . the address switches 16 preferably have a small travel of 0 . 5 mm to closure , then a large overtravel of 3 . 0 mm . the travel of standard key switches is typically 1 . 7 mm with no overtravel . as shown in fig5 the custom key panel 10 preferably allows an interchangeable key pad assembly 18 to be plugged into a front bezel 40 of an electronic instrument , such as the hp 70004a modular measurement system display / mainframe , to provide one of a variety of sets of key functions available to the user . the key pad assembly 18 is preferably retained in the bezel 40 by a mechanical spring 42 , as shown in fig6 and 8 . the spring 42 is installed from the backside of the bezel 40 and is retained by 10 the key pad . the spring 42 latches over the edge of the subpanel 32 to retain the right side of the assembly . the left side is sandwiched around a shelf 44 in the bezel 40 , as shown in fig8 . the key pad assembly 18 is installed by aligning the left side to the shelf 44 on the bezel 40 , then rotating the assembly , around the shelf like a hinge until the spring 42 latches . the operation is similar to closing a door . to remove the key pad assembly 18 , an opening 46 ( see also fig4 a and 4b ) is provided in the front panel to insert a tool , such as a screwdriver blade . as the screwdriver is pushed into the opening 46 , the spring 42 is forced away from the subpanel 32 , which disengages the key pad assembly 18 . the key pad assembly 18 is then forced away from the key pad by another portion of the spring , and any residual force from the depressed address switches 16 . the key pad assembly 18 comes to rest at a sufficient distance away from the bezel 40 to provide finger clearance to grab the key pad assembly 18 for removal . the key pad assembly 18 preferably utilizes conventional keycaps 50 . the keycaps 50 are typically double shot injection molded keys with nomenclature integral to the keycap . each keycap presses onto an adapter 52 shown in more detail in fig7 allowing the keycap to function in the key pad assembly 18 . designers of custom key panels can modify these tools to create unique keycaps for each application . this affords a great amount of flexibility to the design of future key panels . there can be , for example , fifteen separate keys . these can be either half wide keycaps or quarter wide keycaps . or there can be as many as three double wide keycaps used in the far left column ( major user keys ) with the remaining nine locations either half or quarter keys . the front panel can be screen - printed to provide any required identification of the key functions . when the custom key panel is removed from the instrument , the keycaps are preferably captivated and can not fall out . this is accomplished by providing the subpanel 32 with apertures 60 ( see also fig5 ) into which the keycaps 50 connected to the adapters 52 are deposited . a front panel 62 having apertures 64 ( see also fig4 a , 4b , and 4c ) is then placed over the subpanel 32 and the keycaps 50 so that the apertures 64 align with the keycaps . the front panel 62 also includes welded studs 66 on which are fitted spacers 68 ( see also fig4 b , 4c , 5a , and 5b ). the studs 66 extend through holes 70 ( see also fig5 ) in the subpanel 32 , and nuts 72 ( see also fig5 a and 5b ) are threaded on the studs to hold the key pad assembly 18 together . the key pad assembly is rugged and durable enough to withstand damage during abusive handling outside of the instrument . this invention has many advantages beyond what overlays can offer . where flexibility , reliability , durability , and optimized human interface are desired , this invention is an ideal solution . there are numerous applications that can benefit from using a custom key panel in accordance with the present invention . the foregoing description is offered primarily for purposes of illustration . one modification is to mold the entire key pad assembly 18 from a plastic material . in another contemplated embodiment , the address switches can be replaced by electrical address coding means , such as a diode matrix or read only memory . while a variety of embodiments has been disclosed , it will be readily apparent to those skilled in the art that numerous other modifications and variations not mentioned above can still be made without departing from the spirit and scope of the invention as claimed below .	7
referring now to fig1 , there is illustrated a chuck 10 in accordance with the present invention . the chuck 10 includes a front sleeve member 12 , an optional rear sleeve member 14 , a body member 16 and jaws 18 . as shown more clearly in fig2 , the body member 16 is generally cylindrical in shape and comprises a nose or forward section 20 and a tail or rearward section 22 . the nose section 20 is , preferably , chamfered at its outer end . an axial bore 24 is formed in the nose section 20 of the body member 16 . axial bore 24 is somewhat larger than the largest tool shank which the chuck is designed to accommodate . a threaded bore 26 is formed in the tail section 22 of the body 16 and is of a standard size to mate with the threaded drive shaft of a powered or hand driver ( not shown ). the bores 24 , 26 may communicate at the central region 28 of the body member 16 . if desired , the threaded bore 26 may be replaced by a tapered , unthreaded bore of a standard size to mate with a tapered drive shaft . passageways 30 are formed in the body member 16 to accommodate each jaw 18 . preferably , three jaws 18 are employed and each jaw 18 is separated from the adjacent jaw by an arc of 120 degree . the axes of the passageways 30 and the jaws 18 are angled with respect to the chuck axis but intersect the chuck axis at a common point ahead of the chuck body 16 . each jaw 18 has a tool engaging face 32 which is generally parallel to the axis of the chuck body 16 and threads 34 on its opposite or outer surface . in accordance with a feature of the present invention , the threads 34 have a relatively fine pitch , i . e ., a pitch greater than 20 threads per inch , e . g ., 32 threads per inch , and the threads , preferably , are of the buttress type though other thread forms may be employed . by employing the buttress thread form the tightening force applied to the jaw threads 34 is substantially axial to the jaw 18 so as to maximize the conversion of the tightening torque applied to the chuck into a gripping force applied to the tool shank . the use of a relatively fine pitch thread results in two advantages for the chuck in accordance with the present invention . first , the relatively fine pitch results in a greater mechanical advantage so that a given tightening torque is converted into a larger gripping force . second , it becomes possible to use interchangeable jaws 18 of identical design rather than slightly different jaws that must be selected and assembled as a set . the small eccentricity which results from the use of identical jaw pieces in accordance with the present invention can be counteracted by a grinding step as more fully described below . a circumferential groove 36 is formed in the body member 16 and extends into the passageways 30 . a split nut 38 having female threads 40 is located in the circumferential groove 36 and secured therein by the front sleeve member 12 . the split nut 38 is preferably formed with circumferential serrations or teeth 44 and the outer edges are provided with a small chamfer to facilitate press fitting of the split nut 38 into the bore 42 of the front sleeve 12 . preferably , the front sleeve is formed from a structural plastic such as a polycarbonate , a filled polypropylene , e . g ., glass - filled polypropylene , or a blend of structural plastic materials . the serrations or teeth on the split nut 38 assure that the front sleeve 12 will hold the split nut 38 securely without being subjected to an excessive hoop stress . a circumferential race 46 , which may be grooved or a flat surface , is formed on the rear face of split nut 38 to accommodate an anti - friction bearing , for example , ball bearing assembly 48 . if desired , the bearing assembly 48 may include a bearing retainer 49 ( see fig4 ) which locates the plurality of balls while permitting them to roll . a bearing thrust ring 50 is provided with a central hole 52 sized to be press fitted on the body member 16 . one face of the bearing thrust ring 50 has formed thereon a bearing race 54 , which may be grooved or flat , against which the bearing assembly 48 rides . a plurality of jaw guideways 56 are formed around the circumference of the central hole 52 in the thrust ring 50 to permit the retraction of the jaws 18 therethrough . the guideways are shaped to conform with the toothed area of the jaws 18 so as to reduce or prevent toggling of the jaws 18 . to perform this function , the axial length of the guideways 56 must be greater than the pitch of the threads 34 on the jaws 18 . the outer circumference of the bearing thrust ring 50 may have formed thereon serrations or teeth 58 and the outer edges may be chamfered so as to facilitate pressing of the bearing thrust ring 50 into a bore 60 formed in the rear sleeve member 14 . the rear sleeve member 14 also contains a bore 62 adapted to mate with the tail section 22 of the body member 16 . if desired , the rear sleeve member 14 may be omitted and the front , sleeve member 12 extended to the tail end of the body 16 . this alternative is feasible when a spindle lock is provided on the driver or when the driver is used to tighten or loosen the jaws . the circumferential surface of the front sleeve member 12 may be knurled as suggested at 63 or may be provided with longitudinal ribs or other protrusions to enable the operator to grip it securely . in like manner , the circumferential surface of the rear sleeve member 14 , if employed , may be knurled or ribbed , if desired . it will be appreciated that the rear sleeve member 14 is fixed to the body member 16 while the front sleeve member 12 is fixed to the split nut 38 . thus , relative movement of the front and rear sleeve members 12 , 14 will cause the jaws 18 to be advanced or retracted , depending upon the direction of the relative motion . as the bearing 48 is interposed between the relatively moving parts , the frictional losses are minimized and a maximum portion of the applied tightening torque is converted to a tightening force on the tool shank . while the chuck , of fig2 and 3 may be operated manually , it may also be operated by the power driver . as noted above , the jaws 18 are preferably formed so as to be identical to each other . in threejaw geared chucks , it is common practice to offset the threads proportional to the thread pitch so that when the jaws contact each other they will meet on the axis of the chuck . by making the jaws identical a degree of eccentricity will result but this is minimized by the fine pitch of the threads . in accordance with the present invention , a grinding procedure may be performed after the chuck is assembled to remove the eccentricity resulting from the small axial displacement of the jaws relative to each other . when the eccentricity is removed , the centering accuracy of the chuck will be the same as if custom sets of jaws had been provided . reference is now made to fig4 and 5 which illustrate an alternative form of the present invention containing a torque limiting mechanism and a bit holding and centering device . parts which are substantially the same as in the embodiment shown in fig2 and 3 are identified by the same designators while modified parts are designated with the additional letter “ a .” in the embodiment shown in fig4 and 5 a torque limiting mechanism is provided which produces an audible “ click ” when the chuck has attained its maximum tightness . this may be accomplished by providing a toothed annulus 64 having a bore 66 which engages the outside diameter of , or the teeth or serrations 44 on , the split nut 38 so as to lock the split nut 38 in place . a series of flexible teeth 68 are formed on the circumference of the annulus 64 which engage ribs 70 formed on the lateral surface of a bore 72 in the front sleeve member 12 a . as most clearly shown in fig5 the flexible teeth 68 have a sloping forward edge 68 a which engages the ribs 70 during tightening of the chuck . when a predetermined tightening torque is reached , the ribs 70 pass over the flexible teeth 68 producing an audible “ click .” however , when the front sleeve 12 a is turned so as to loosen the chuck jaws 18 , the ribs 70 lock with the teeth 68 to transfer all the applied torque to the split nut 38 . it will be noted that the front sleeve 12 a extends beyond the nose 20 of the body member 16 to the region where the jaws 18 meet in their fully closed position . a grip boot 74 may be fastened to the front sleeve 12 a by ribs 76 , 78 and prevented from turning relative to the front sleeve 12 a by longitudinal ribs ( not shown ). the grip boot 74 is preferably made from an elastomeric material such as natural or synthetic rubber and has a relatively small flexible orifice 80 aligned with the axis of the chuck body member 16 . preferably , the grip boot 74 is made from a relatively soft material having a shore a hardness of from 40 to 70 . the orifice 80 is sized so that it will stretch to grip the shank of a drill or other tool inserted in the chuck and temporarily center and restrain the tool during chucking or unchucking operations . in the embodiment of the invention shown in fig2 and 3 , the front sleeve 12 is held in place because it is press fitted to the split nut 38 . in the embodiment shown in fig4 and 5 other means are required to locate the front sleeve 12 a . a circumferential groove 82 is formed in the nose section 20 of the body member 16 to receive a retainer disc 84 which is pressed into the bore 72 of the front sleeve 12 a . fig6 a shows a plan view of the retainer disc 84 having circumferential teeth 86 and flexible engaging tabs 88 formed by a series of slots 90 stamped in the disc 84 around its center hole 92 . as shown in fig6 b , the retainer disc 84 is flat and relatively thin so as to enable it to be pressed on to the body member 16 and turn freely in the groove 82 . the retainer disc 84 is sized so that the teeth 86 firmly grip the bore 72 of the front sleeve member 12 a . fig6 c illustrates an alternative form of a toothed retainer disc 84 c having a beveled rim 94 . fig6 d shows a toothless retainer disc 84 d in plan view . like the toothed retainer disc 84 , the center hole 92 has slots 90 formed around its edge to define flexible engaging tabs 88 . fig6 e shows the beveled rim 96 which forms a deformable gripping member . as noted above with reference to fig5 , the toothed annulus 64 performs two functions : first , it holds the split nut 38 in place , and , second , it forms one part of the torque limiting mechanism . fig5 a – 5g illustrate a number of alternative designs for the toothed annulus 64 . in fig5 a the annulus 64 a is formed with a series of axial slots 98 located intermediate its inner and outer surfaces . a tooth 100 is located midway between the ends of each slot 98 which engages with the ribs or teeth 70 formed on the bore 72 of the front sleeve member 12 a . the slots 98 provide the flexibility required for the tooth action while still maintaining the strength of annulus . in fig5 b – 5g further variations are shown in the design of the annulus . in fig5 b the annulus 64 b is provided with a series of open slots 102 which result in a series of pawls 104 having a tooth 106 at the end thereof which engages the teeth 70 b on the bore 72 of the front sleeve 12 a . in fig5 b the tooth 106 has a square profile so that limited torque is transmitted when the sleeve 12 a is rotated in a clockwise direction relative to the body 16 as viewed in fig5 b but unlimited torque is transmitted with counterclockwise rotation . this difference is due to the asymmetrical shape of the tooth 70 b . fig5 c is similar to fig5 b except that the tooth 108 has a round rather than a square shape and the rear face of the tooth 70 c has correlative shape . fig5 d is likewise similar to fig5 b except that the tooth 110 has a triangular rather than a square shape and the tooth 70 d has a correlative asymmetric shape . fig5 e – 5g show modifications of the structures respectively shown in fig5 b – 5d . in these modifications the tooth 70 e , 70 f , or 70 g is designed to be substantially symmetrical about a radius of the front sleeve 12 a so that the tightening torque and the loosening torque are substantially equal . it will be understood that the torque transmitted through the mechanism is principally a function of the angle of the surface of the teeth 70 and 68 , 100 , 106 , 108 or 110 , the coefficient of friction between the teeth , the force required to depress or deform the teeth 68 , 100 , 106 , 108 or 110 , and the number of teeth in contact . the torque increases as the tooth surface approaches a radius of the front sleeve , as the coefficient of friction increases , as the stiffness of the teeth on the annulus 64 increases , and as the number of teeth in contact increases . by appropriately controlling these variables , the desired tightening and loosening torque may be predetermined . reference is now made to fig7 and 8 which show an embodiment of the present invention which is particularly adapted for manual operation . again , parts which are substantially the same as in the earlier embodiments bear the same designations while modified parts are designated by “ a ” or “ b .” the embodiment of fig7 is characterized by the location of the torque limiting mechanism in the rear sleeve member 14 a . the basic structure of the body member 16 , the jaws 18 , and the split nut member 38 upon which the front sleeve member 12 b is pressed is similar to that shown in fig2 except that a grip boot 74 a is applied to the surface of the front sleeve member 12 b to enhance the grippability of the sleeve member . grip boot 74 a does not provide the tool holding feature shown in fig4 but it is apparent that this feature could be added , if desired . the arrangement of bearing 48 and bearing thrust ring 50 a is also similar to that shown in fig2 and 4 except that no serrations or teeth are formed on the outer periphery of the bearing thrust ring 50 a . in the embodiment of fig7 , the bore 60 a is sized for a sliding fit with the bearing thrust ring 50 a and accommodates a belleville or other form of compression spring 112 which biases the rear sleeve member 14 a toward a back plate 114 which is press fitted onto the tail section 22 of the body member 16 . as shown in fig8 , the back plate 114 may be provided with a plurality of teeth 116 and the rear sleeve member 14 a provided with a plurality of radial ribs 118 . it will be appreciated that during a chucking operation the rear sleeve 14 a will be held while the front sleeve 12 b is turned in a clockwise direction as viewed from the jaw end of the chuck . at a predetermined torque , the ribs 118 will ride over the teeth 116 while the rear sleeve 14 a is displaced in a forward direction against the bias of the spring 112 . the teeth 116 on the back plate 114 are designed to produce a limited tightening torque and an unlimited loosening torque . by varying the angle of the teeth faces and the spring rate of the compression spring 112 the tightening and loosening torque may be varied as desired and as explained above . of course , the teeth 116 and the ribs 118 may be interchanged , if desired , and various shapes of teeth may be employed as suggested in fig5 – 5g . the chuck in accordance with the present invention has a number of advantages with respect to the ease and cost of manufacture . the body member 16 may be machined from a relatively small diameter bar since the bearing thrust ring 50 is made separately and then pressed onto the body member . this reduces the machining costs for the body member . certain parts , such as the split nut and bearing thrust ring may be formed from powdered metal or stamped or otherwise cold formed with limited machining steps . with this design of the load - bearing parts , the more massive front and rear sleeves may be formed from structural plastic materials thereby reducing weight and manufacturing costs while providing the ability to customize the chuck through the use of colors , rib shapes , knurling , or identification logos . the terms and expressions which have been employed are used as terms of description and not of limitation and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof , but it is recognized that various modifications are possible within the scope of the invention claimed .	8
a refrigerant system 20 is illustrated in fig1 , having a compressor 22 compressing refrigerant and delivering it downstream to a condenser 24 . an expansion device 26 is positioned downstream of condenser 24 , and an evaporator 28 is located downstream of the expansion device 26 . an economizer tap 30 taps a portion of refrigerant through an economizer expansion device 32 , and then through a common heat exchanger 31 . refrigerant also passes through the common heat exchanger 31 from a main liquid refrigerant line 36 downstream of the condenser 24 . a supply line 48 delivers refrigerant from tap 30 through the common heat exchanger 31 when a valve 46 is open . thus , to provide an economizer function , refrigerant passes through the economizer expansion device 32 , and through the opened valve 46 into the common heat exchanger 31 . it should be noted that the valve 46 may not be needed in case the economizer expansion device 32 can be controlled to an entirely closed position . another tap 40 is tapped from a point 42 downstream of the evaporator 28 . the tap 40 also communicates with the supply line 48 passing through the common heat exchanger 31 . a valve 54 downstream of the evaporator 28 is closed and a valve 56 is opened to deliver the refrigerant through the tap 40 to the common heat exchanger 31 . in addition , a valve 50 is placed on an economizer return line 34 delivering refrigerant back to the compressor 22 at some intermediate ( between suction and discharge ) pressure . another valve 52 is placed on a bypass line 38 communicating refrigerant flowing in the return line 34 back to a point 44 and then returning it through a suction line 45 to the suction port of the compressor 22 . the refrigerant system can operate in a conventional non - economized mode , and without a liquid - suction heat exchanger function by closing the valves 46 and 56 and opening the valve 54 . also , at least one of the valves 50 or 52 has to be closed to prevent the refrigerant bypass flow from an intermediate compressor port back to suction . refrigerant will then flow through a basic conventional cycle . if an unloader function is desired , the valves 50 , 52 and 54 are opened and the valves 46 and 56 are closed . if an evaporator bypass function is desired , the valves 46 , 54 and 56 are opened with the valves 50 and 52 are closed . if an economizer function is desired , the valves 46 , 50 and 54 are opened and the valves 52 and 56 are closed . in case an unloader function is desired in the economized mode of operation , the valves 46 , 50 , 52 and 54 are opened and the valve 56 is closed . if instead of an economizer function , a liquid - suction heat exchanger function is desired , the valves 46 , 50 and 54 are closed and the valves 52 and 56 are opened . refrigerant will now flow through the tap line 40 , into the supply line 48 , through the common heat exchanger 31 , and will subcool the refrigerant in a main line 36 . that refrigerant will pass back through the return line 34 , through the bypass line 38 , and return to the point 44 in the suction line 45 leading back to the suction port of the compressor 22 . the unloader function can also be achieved in combination with the liquid - suction heat exchanger function by opening the valve 50 . the above embodiment utilizes a single common heat exchanger to provide the function of either an economizer heat exchanger , or a liquid - suction heat exchanger . thus , more flexibility is given to the refrigerant system designer , without the requirement of two distinct auxiliary heat exchangers . of course , an appropriate control with the appropriate programming to actuate the proper flow control devices to achieve desired operating conditions in a desired mode of operation is to be included . also , a combination of the operating modes described above can be executed by opening and closing appropriate flow control devices . for instance , an evaporator bypass may be simultaneously provided with the economizer function , if desired . furthermore , as known , the economizer tap can be located downstream of the heat exchanger 31 providing identical benefits to a system designer . it should also be pointed out that a function of two separate valves adjacent to a common piping junction can be substituted by a single multi - functional valve that can route the flow of refrigerant through the junction in the appropriate directions . fig2 a shows another embodiment 60 with the economized compressor 62 . refrigerant downstream of the compressor 62 passes through a condenser 68 , a main expansion device 70 , and an evaporator 72 . a common heat exchanger 74 receives refrigerant from an economizer circuit tap line 76 through an economizer expansion device 78 . the tapped refrigerant would flow through an economizer circuit return line 80 back to the economizer port of the compressor 62 at some intermediate pressure . the main liquid refrigerant line 82 downstream of the condenser also passes through the common heat exchanger 74 . a line 84 downstream of the evaporator 72 passes through the common heat exchanger 74 as well , and then back to a suction line 86 that returns refrigerant to the suction port of the compressor 62 . this schematic selectively provides an economizer function by opening or closing the economizer expansion device 78 . in case the economizer expansion device 78 is not equipped with a shutoff capability , a separate shutoff valve is needed . the liquid - suction heat exchanger function will always take place , as the line 84 is a dedicated line passing through the common heat exchanger 74 . in the common three - stream heat exchanger 74 , heat transfer interaction occurs between liquid refrigerant in the line 82 , a two - phase refrigerant in the line 76 ( when the valve 76 is open ) and a vapor refrigerant in line 84 . as a result , liquid refrigerant is subcooled and system performance is enhanced . furthermore , the economizer function may be only activated when an additional performance boost is desired . fig2 b shows an option wherein a valve 89 ( when closed ) forces vapor refrigerant flow through a bypass line 88 to the suction line 84 . this causes the refrigerant to bypass the common heat exchanger 74 when the liquid - suction heat exchanger function is not desired . that is , when the liquid - suction heat exchanger function is desired , a valve 90 is closed and a valve 89 is opened . on the other hand , when the liquid - suction heat exchanger function is not desired , the valve 89 is closed and the valve 90 is opened . it should be understood that a function of the two valves 89 and 90 can be combined into a single three - way valve that would selectively route the refrigerant into the line 88 by - passing the common heat exchanger 74 , or block the refrigerant from entering the line 88 to route it through the common heat exchanger 74 . another embodiment 100 shown in fig2 c is a variation of the configuration presented in fig2 b . in this embodiment , an economizer function and a liquid - suction heat exchanger function are provided by separate units , 112 and 124 respectively , while a three - way valve 114 selectively routes the refrigerant through or around the liquid - suction heat exchanger 124 . an economized compressor 102 delivers refrigerant to a downstream condenser 104 . a tap 106 from a main liquid refrigerant line 108 passes through an economizer expansion device 110 , which is also utilized as a shut - off valve in this schematic . the refrigerant from both the tap 106 and main liquid refrigerant line 108 flows through the economizer heat exchanger 112 . in fact , while the two are shown flowing in the same direction , in practice , it would be preferable if they were in a counter - flow relationship . if no economizer function is desired , then valve 110 is shut . the three - way valve 114 receives the refrigerant downstream of the economizer heat exchanger 112 . the three - way valve 114 directs the refrigerant to a line 116 , and then to a line 118 leading to a main expansion device 120 , and an evaporator 122 . the flow position of the three - way valve 114 for the line 116 is selected when no liquid - suction heat exchanger function is desired . downstream of the evaporator 122 , refrigerant passes through a liquid - suction heat exchanger 124 , to a suction line 126 , and then back to the compressor 102 . since there is no other refrigerant flow passing through the liquid - suction heat exchanger 124 , no liquid - suction heat exchanger function is achieved when the valve 114 is in this position . when a liquid - suction heat exchanger function is desired , the valve 114 directs the refrigerant into a line 128 . the line 128 directs the refrigerant through the liquid - suction heat exchanger 124 for the heat transfer interaction with the refrigerant exiting the evaporator 122 . the refrigerant having passed through the line 128 , through the liquid - suction heat exchanger 124 , then passes into the line 118 , through the main expansion device 120 , and then to the evaporator 122 . as was mentioned above , the refrigerant downstream of the evaporator 122 flows through the liquid - suction heat exchanger 124 once again and then returns to the suction port of the compressor 102 . as in previous embodiments , this schematic achieves the benefits of an economizer function and a liquid - suction heat exchanger function . in all the embodiments , the economizer flow can be tapped downstream of the common / economizer heat exchanger , not altering any of the benefits of the invention . also , it is well understood by a person ordinarily skilled in the art that a single economized compressor can be replaced by a compound compressor or a two - stage compression system that would provide the same benefits as described above . the present invention provides a few schematics that would achieve the function of both a liquid - suction heat exchanger and an economizer heat exchanger with a single common heat exchanger . obviously , a worker of ordinary skill in the art would recognize that many schematics would also be able to provide the function , as long as a single heat exchanger provides both functions , it would be within the scope of this invention .	5
with reference to the figures generally , exemplary embodiments of a method and a photo resist coater tool system 1 for photo resist dispensing according to the invention are now described . as shown in fig1 , the photo resist coater tool system 1 includes a movable dispensing nozzle 2 having a nozzle tip 4 for dispensing fluid . movement of the dispensing nozzle 2 is effected by a nozzle positioning mechanism 3 . the system may be configured to have multiple nozzles such as nozzle 2 . for simplicity , only one such nozzle 2 is shown while it is to be understood that the principles of this invention may be applied to multiple nozzles in photo resist coater tools . a switching mechanism , such as a valve 20 , is positioned to selectively control flow of fluid through dispensing nozzle 2 to the nozzle tip 4 . the valve 20 is conventional and may be of the electronic , electromagnetic , pneumatic or hydraulic type and is shown as a three - way valve . a first input port 21 of the valve 20 is connected to a photo resist flow line 22 which can send photo resist 29 to the dispensing nozzle 2 from a photo resist source 24 . an in - line photo resist pump 26 facilitates the transfer of photo resist . a second input port 23 to the valve 20 is connected to a solvent flow line 18 along which solvent 19 is sent to the dispensing nozzle 2 from a solvent source 14 via an in - line solvent pump 16 . an output port 27 of the valve 20 is connected to the dispensing nozzle 2 to selectively dispense photo resist 29 or solvent 19 through the nozzle tip 4 depending on which of the input ports 21 , 23 the valve 20 is configured to receive fluid from . a main controller 6 is configured to effect the movement of the dispensing nozzle 2 through communication with the nozzle positioning mechanism 3 and to control the input of fluid through one of the input ports 21 , 23 of the valve 20 . the main controller 6 also controls the activation of the solvent pump 16 and the photo resist pump 24 through communication with the pump controller 12 . a valve control line 33 indicates communication from the main controller 6 to the valve 20 , while a positioning control line 34 indicates communication from the main controller 6 to the nozzle positioning mechanism 3 . a pump control line 35 indicates communication from the main controller 6 to the pump controller 12 . photo resist pump control line 36 and solvent pump control line 37 indicate communication between photo resist pump 26 and the solvent pump 16 to the pump controller 12 . referring next to the schematic view of fig2 , alternate positions of the dispensing nozzle 2 are illustrated . the dispensing nozzle 2 will typically be in a production position 8 ( illustrated with phantom lines ) for dispensing photo resist 29 on to a semiconductor wafer 25 positioned on a coater plate 28 . when the production photo resist dispensing process is complete , the dispensing nozzle 2 is rotated to an idle position 10 over a solvent drain 30 . dispensing nozzle rotation is effected about axis 38 by the nozzle positioning mechanism 3 as illustrated by the arrows numbered 40 and 42 . again , referring to fig1 , when a production photo resist dispensing step is about to occur , the main controller 6 directs the nozzle positioning mechanism 3 to position the dispensing nozzle 2 over a semiconductor wafer 25 positioned on coater plate 28 . the main controller 6 then actuates the valve 20 to receive input fluid from the photo resist flow line 22 and , via the pump controller 12 , activates the photo resist pump 26 to send photo resist 29 from the photo resist source 24 through the photo resist flow line 22 through valve 20 to the nozzle tip 4 to be dispensed on to the wafer 25 . when the dispensing nozzle 2 has completed a production photo resist dispensing operation , the main controller 6 signals the pump controller 12 to stop sending photo resist 29 and close the input 21 to valve 20 . the main controller then activates the nozzle positioning mechanism 3 to rotate the dispensing nozzle 2 to the idle position 10 over a solvent drain 30 . because the invention is based on a different principle than the interaction of solvent vapors with photo resist , the solvent drain 30 does not require that a solvent feed line be connected to fill the solvent drain 30 as present in a conventional the solvent cup , although the invention may incorporate this feature to provide solvent vapors about the dispensing nozzle 2 . in the idle position 10 , the nozzle tip 4 typically retains some photo resist 29 thereabout , as residual from the previous production dispensing operation . the dispensing nozzle 2 may remain in the idle position 10 with photo resist 29 in the dispensing nozzle 2 and nozzle tip 4 in preparation for a subsequent production photo resist dispense operation . after a predetermined amount of time in the idle position 10 , with no further wafers in queue for the production photo resist dispense operation , the main controller 6 actuates the valve 20 to open the input port 23 to the solvent flow line 18 . the main controller 6 also signals the pump controller 12 to activate the solvent pump 16 to send solvent 19 from a solvent source 14 through the solvent flow line 18 through the valve 20 to the nozzle tip 4 to flush residual photo resist 29 through the nozzle tip 4 and fill the dispensing nozzle 2 and nozzle tip 4 with solvent . solvent 19 remains in the dispensing nozzle 2 until the next production photo resist dispense operation is initiated , thus eliminating the need for a dummy dispense operation . when a subsequent group of wafers , referred to herein as a next production lot , become available for a production photo dispense operation , the main controller 6 signals the photo resist pump to fill the dispensing nozzle 2 with photo resist 29 , thereby replacing the solvent 19 with photo resist 29 . fig3 , a flow control diagram , provides a more detailed sequence of steps applicable to the embodiment of the invention shown in fig1 and 2 . the sequence , beginning at step 80 assumes that the photo resist coater tool system 1 has the dispensing nozzle 2 in the idle position 10 with the valve 20 open to the photo resist flow line 22 . the sequence of steps will typically be initiated and controlled by signals from the main controller 6 , with secondary instructions sent to the pumps from the pump controller 12 . if a production lot has entered the queue for a production photo resist dispense , the system 1 begins a production dispense operation in which the main controller 6 sends a signal to move the dispensing nozzle 2 to the production position 8 ( step 85 ) and a wafer is loaded onto the coater plate 28 ( step 90 ). the main controller 6 then sends a signal to the pump controller 12 to actuate the photo resist pump 26 to dispense photo resist 29 onto the wafer 25 . the photo resist pump 26 is subsequently shut off when the dispense operation for the wafer is complete ( step 95 ). if other wafers in the production lot remain in queue , the system 1 sequentially loads the remaining wafers on to the coater plate 28 ( step 90 ) and continues with the production dispense operation ( step 95 ). otherwise , the dispensing nozzle 2 moves to the idle position 10 ( step 110 ) and a time period is counted by the main controller 6 ( step 115 ). if it is determined at step 80 , that there are no further wafers in queue , the dispensing nozzle 2 remains in the idle position 10 and the time period is counted ( step 115 ). a reasonable time period for the photo resist coater tool to remain in the idle position 10 before beginning the solvent flush is 30 minutes , but the period may range from less than 10 minutes to over 60 minutes . the length of the time period may depend on factors , such as the type of photo resist and solvent , viscosity of the photo resist , and the configuration of the dispensing nozzle 2 and nozzle tip , as well as , environmental conditions such as room temperature and humidity . if wafers arrive in queue before the time period lapses ( step 120 ), the dispensing nozzle 2 is moved into the production position 8 ( step 85 ) to begin another production dispense operation . if no subsequent lot enters the queue before the time period ends ( step 120 ), the main controller 6 sends a signal to open the valve 20 to the solvent flow line 18 ( step 125 ) and the pump controller 12 actuates the solvent pump 14 to send solvent 19 to the dispensing nozzle 2 and nozzle tip 4 ( step 130 ) to clear them of photo resist 29 . after flushing the dispensing nozzle 2 and nozzle tip 4 with solvent , the pump controller 12 shuts off the solvent pump 14 ( step 135 ). the photo resist coater tool 1 remains in this state with the dispensing nozzle 2 in idle position 10 until a subsequent lot arrives in queue for the production dispense operation . when the subsequent lot arrives , the main controller 6 opens the valve 20 to the photo resist flow line 22 ( step 140 ) and sends a signal to the pump controller 12 to actuate the photo resist pump 24 to fill the dispensing nozzle 2 and nozzle tip 4 with photo resist 29 ( step 145 ). after the dispensing nozzle 2 and nozzle tip 4 are filled with photo resist , the pump controller 12 sends a signal to disable the photo resist pump 24 ( step 150 ). the dispensing nozzle 2 then moves to a production position 8 to perform for another production dispense operation on the next wafer in queue ( step 85 ). it is to be understood that the above description of the invention is intended to be illustrative and not restrictive . many additions and modifications will be apparent to those of skill in the art . the invention may be practiced in a number of industries pertaining to electronics manufacturing where a photo resist coating process is used . accordingly , the scope of the invention is only limited by the claims which follow .	6
fig1 is a block diagram of a private mobile network system cooperating with a plmn . the private mobile network cooperates with not only the plmn , but also with a public switched telephone network and integrated services digital network ( pstn / isdn ) 16 and an internet protocol ( ip ) network 18 . the plmn includes a plurality of mobile switching centers ( mscs ) 2 - 1 to 2 - n , a plurality of base station controllers ( bscs ) 4 - 1 to 4 - m connected to the msc 2 - 1 , and a plurality of base transceiver stations ( btss ) 6 - 1 to 6 - k , and 8 - 1 connected to the bsc 4 - 1 or 4 - m . the bts , which is a wire connection terminal , wirelessly communicates with mss 20 , 22 , and 24 . in addition , each of the mscs 2 - 1 to 2 - n includes a home location register / visitor location register ( hlr / vlr ) 10 , thereby constructing an entire system . the private mobile network cooperating with the plmn includes a public / private communication service apparatus 12 and a plurality of private btss ( pbts ) 8 - k cooperating with the public / private communication service apparatus 12 , thereby providing a mobile communication service through the plmn and the private mobile network to the ms 24 which has joined the plmn and the private mobile network . also , the private mobile network is connected to the pstn / isdn 16 and the ip network 18 through the public / private communication service apparatus 12 . in fig1 , a first communication service area of the bts 8 - 1 in a plmn system is represented as a dedicated public cell area 15 so as to show that the first communication service area is separated from a second communication service area of a public / private shared cell area 14 . fig2 is a block diagram of the public / private communication service apparatus 12 of fig1 . the public / private communication service apparatus includes a private branch exchange ( pbx ) 230 , a private bsc ( pbsc ) 240 , and a private hlr ( phlr ) 250 . the pbx 230 includes a switch 244 and an e1 - interface 243 , and the pbsc 240 includes a pbts message router ( pbtmr ) 241 and a transcoder and selector bank ( tsb ) 242 . the pbtmr 241 is a module for routing all messages which must be processed by the pbts 8 - k . to be more specific , the pbtmr 241 is a software module which routes control messages for public / private incoming and outgoing call services of the ms 24 with reference to an interior router table . also , the pbtmr 241 may route control messages of a plmn 1 including a bsc 4 - m , an msc 2 - 1 , and a bts 8 - 1 which are used to provide incoming and outgoing call services for the ms 22 in the dedicated public cell area and the ms 24 in the public / private shared cell area 14 . while the msc 2 - 1 and each of the bscs 4 - 1 to 4 - m are connected to each other by a standard protocol , not only the pbsc 240 and each of the bscs 4 - 1 to 4 - m but also the each of the bscs 4 - 1 to 4 - m and each of the bts 6 - 1 to 6 - k , and 8 - 1 are connected to each other by an interprocess communication scheme . the pbsc 240 and the pstn / isdn 16 communicate with each other by a t1 pri ( primary rate interface ), an e1 pr1 , ss7 , or the like , and the pbsc 240 and the ip network 18 communicate with each other by a tcp / ip ( transmission control protocol / internet protocol ) or voip ( voice over internet protocol ) scheme . in order for an ms to be provided with services from both a plmn and a private mobile network in the mobile communication system having a construction as described above , the ms must have been registered with both the plmn and the private mobile network . for the register of the ms , a mobile directory number ( mdn ), an international mobile station identity ( imsi ), a mobile identification number ( min ), and an electronic serial number ( esn ) are used . the mdn is a number to be used by the ms when a message is incoming / outgoing , the imsi ( or min ) is a number used to distinguish mss in the mobile communication system , and the esn is a special serial number for distinguishing mss . the min is included in the imsi , and the imsi or the min can be selectively used according to the requests of public mobile communication service providers . when ms information is registered in the private mobile network cooperating with the plmn , the mdn of which a relevant user is aware and a private mobile network number numbered by a private network manager can be directly registered . however , since the user does not know the imsi ( or min ) and the esn , it is necessary to ask a public mobile communication provider about registered user information or to find out the imsi ( or min ) and the esn by ms debug so as to register the imsi ( or min ) and the esn in the private mobile network . in this case , since there are many various debugging schemes used according to ms manufacturers , it is impossible for a manager needing to register mss to be fully aware of all debugging schemes used by the ms manufacturers . also , querying the public mobile communication provider as to the imsi ( or min ) of subscribers frequently occurs for each site , thereby excessively increasing work load . hereinafter , an embodiment according to the present invention will be described in detail with reference to the accompanying drawings . it is to be noted that the same elements are indicated by the same reference numerals throughout the drawings . in the following description of the present invention , a detailed description of known functions and configurations incorporated herein has been omitted when it may obscure the subject matter of the present invention . fig3 is a block diagram of an ms registration apparatus 30 according to an embodiment of the present invention . a private base transceiver station ( pbts ) 8 - k transmits an outgoing message from an ms 24 to a private base station controller ( pbsc ) 240 in a private mobile network . all of the messages transmitted to the pbsc 240 are routed by a pbts message router ( pbtmr ) 241 , which separates a public network call from a private network call , in the pbsc 240 . an origination message ( orm ) is also transmitted to the pbtmr 241 . the orm is one of the messages transmitted from an ms to a bts when the ms attempts a first call , and is defined in standard spec . 3gpp2 . tsg - c c . s0005 , and includes a function code , an mdn , an imsi or min , and an esn . the function code and the mdn are numbers dialed by a user . for example , when a user dials “### 0103003000 ”, “###” is a function code and “ 0103003000 ” is an mdn . a data extraction unit 31 extracts a function code , an mdn and ms information , needed for the registration of the ms on a private mobile network , from the orm transmitted from the ms desiring to register , and transmits the extracted data to a function code checking unit 32 . the ms information includes an imsi ( or msi ) and an esn . the function code checking unit 32 checks whether or not the function code of the data transmitted from the data extraction unit 31 is a registration function code , and transmits the data received from the data extraction unit 31 to a control unit 33 when the received function code is a registration function code . the control unit 33 examines registration information of the ms stored in a phlr 250 using the mdn of the data received from the function code checking unit 32 , and updates and registers the examined ms registration information in the phlr 250 using the ms information of the received data when the examined ms registration information is stored in a registration initialization pattern . all ms registration information includes at least an mdn and an extension number pre - stored by a private network manager , of which both the user and the manager are aware . a state stored in a registration initialization pattern means that an imsi ( or min ) and an esn , except for the pre - stored mdn and the extension number , are not determined within ms registration information , in which a predetermined pattern ( i . e ., a specific pattern such as ‘ fffff ’) is stored in a data field of actual ms registration information . in this case , an imsi ( or min ) and an esn are represented as blanks on an interface . the phlr 250 stores ms registration information of a private mobile network 11 subscriber and location information thereof . hereinafter , ms registration service operations in a private mobile network cooperating with a plmn will be described with reference to fig4 according to an embodiment of the present invention . the ms registration apparatus shown in fig3 can be realized by the pbtmr 241 included in the pbsc 240 . fig4 is a flowchart of a method of registering an ms according to an embodiment of the present invention . in a private mobile network cooperating with a plmn , the mdn and the extension number of an ms to be registered are stored in ms registration information of the phlr 250 by a private network manager . when the ms desiring registration outputs a call including a function code and an mdn , the pbts 8 - k receives the call and transmits the received call to the pbsc 240 . the pbsc 240 receives an orm included in the call ( step 400 ) and extracts the function code , the mdn , and ms information from the orm ( step 402 ). the ms information includes an imsi ( or min ) and an esn . in step 404 , the pbsc 240 determines whether or not the function code of the extracted data is an ms registration function code . as a result , when it has been determined that the function code is an ms registration function code , the pbsc 240 examines ms registration information pre - stored in the phlr 250 using the mdn of the extracted data ( step 406 ). in contrast , when it has been determined that the function code is not an ms registration function code , an ms registering process according to the present invention ends . after step 406 , a determination is made as to whether or not there is registration information about the relevant ms in the examined ms registration information ( step 408 ). as a result , if it has been determined that there is registration information about the relevant ms , a determination is made as to whether or not the registration information about the relevant ms is in a registration initialization pattern ( step 410 ), and if not , the ms registering process according to the present invention ends . when it has been determined in step 410 that the registration information about the relevant ms is in a registration initialization pattern in step 410 , the registration information about the relevant ms without being specified in the ms registration information is updated with the extracted data and the registering process is completed ( step 412 ). in contrast , when it has been determined in step 410 that the registration information about the relevant ms is not in a registration initialization pattern , the ms registering process according to the present invention ends . hereinafter , a detailed example of the ms registration method according to an embodiment of the present invention will be described . in a case of desiring to use an ms using a number of ‘ 0163003000 ’ in a plmn in a private mobile network cooperating with the plmn , a private network manager inputs ‘ 0163003000 ’ used by the ms in the plmn and a private network number ( e . g ., ‘ 2580 ’) in ms registration information of the phlr 250 so as to register the ms . herein , the number of ‘ 0163003000 ’ is an mdn . when the ms outputs ‘### 0163003000 ’ obtained by combining ‘###’ which is a registration function code and ‘ 0163003000 ’ which is an mdn so as to register the ms , the pbts 8 - k receives the call and transmits the received call to the pbsc 240 . the pbtmr 241 in the pbsc 240 receives an orm included in the call . herein , the orm includes the function code , the mdn , an imsi ( or min ), and an esn . table 1 diagrammatically illustrates a format of the orm . that is , table 1 illustrates a case in which an ms using a number of ‘ 0163003000 ’ changes the public network mobile communication service provider thereof through a change of a mobile station number and thus the value of the min field is set to be ‘ 0114004000 ’. the pbtmr 241 having received an orm having the format as shown in table 1 extracts the function code , the mdn , the imsi ( or the min ), the esn , which are necessary data fields . then , a determination is first made as to whether or not the value of the function code field from among the extract data accords with the registration function code of ‘###’ ( which is only an example and by which the present invention is not limited ). as a result , when it has been determined that the value of the function code field from among the extract data accords with the registration function code of ‘###’, ms registration information pre - stored in the phlr 250 is examined using ‘ 0163003000 ’ which is the value of the mdn . when an according ms registration information is found and the according ms registration information is in a registration initialization pattern , that is , when values of an imsi ( or min ) and an esn in the according ms registration information are not determined , the ms registration information is updated with the extracted imsi ( or min ) and esn , thereby completing a relevant registering process . at this time , the private network may output a predetermined confirmation tone to notify the ms of the completion of registration . fig5 a and 5b are views for explaining an interface of ms registration information stored in the phlr 250 according to an embodiment of the present invention . fig5 a shows a state of ms registration information which is in a registration initialization pattern before a relevant ms is registered , in which values of a private network number ( ms tel ) 51 and an mdn 52 are stored but values of an esn 53 and an imsi 54 are not yet determined . in addition , fig5 a shows a case in which a relevant provider utilizes not an min but an imsi as ms information . to be more specific , an interface screen 50 for ms registration information of the phlr 250 exists , in which items of information about an ms which has a number of ‘ 0169707701 ’ as the mdn 52 and is assigned a number of ‘ 7022 ’ as the private network number ( ms tel ) 51 are stored by the private network manager . the esn 53 and the imsi 54 are not yet specified and remain blank on the interface . in this case , it is possible to utilize an min instead of the imsi according to providers . fig5 b shows a state in which the registration of the ms registration information existing in a state as described with reference to fig5 a is completed by the ms registration method of the present invention , in which the values of the imsi and the esn are updated , thereby enabling the ms to be used in the private mobile network cooperating with the plmn . to be more specific , the values of the esn and the imsi from among items included in the screen , which were not specified , are updated with an esn value of ‘ b0 15 75 fc ’ and an imsi value of ‘ 450000169707701 ’ included in the orn , so that the ms has been registered to be used in the private mobile network as well . as described above , according to embodiments of the present invention , when an ms is registered on a private mobile network cooperating with a plmn , it is possible to automatically determine an imsi ( or min ) and an esn ( which are necessary information ) by an originating call and to register the ms , without asking a public mobile communication provider nor performing an ms debug , thereby increasing the convenience of private network managers and decreasing management errors . although the present invention has been described with reference to the registration an ms on a private mobile network cooperating with a plmn , it will be easily understood by those skilled in the art that the construction of the present invention can also be applied to a plmn including a bts , an hlr , and a bsc . while the present invention has been shown and described with reference to certain embodiments thereof , it will be understood by those skilled in the art that various modifications in form and detail may be made therein without departing from the spirit and scope of the invention as defined by the appended claims .	7
referring in more detail to the drawings , as shown in fig1 - 3 , a preferred embodiment of the present invention is described . generally , the scanner device 10 attaches to a standard crane system 1 for unloading and loading cargo 2 , such as containers 3 and pallets from a ship at a seaport . the crane is designated to lift cargo from one location to another location . the scanner device 10 of the present invention is attached to the crane in such a way as to not interfere with the function of the crane . the scanner device 10 inspects the cargo during normal crane operation to provide for uninterrupted loading and unloading of cargo , a time efficient scanning system . fig1 shows the crane system 1 including opposing vertical structures which support a boom arm . a conveying system is supported by the boom arm . the conveying system includes a carriage or spreader bar 4 which is suspended from a chain or metal rope . the chain is driven around pulleys by a motor to lift and lower the spreader bar 4 . the spreader bar 4 is used to secure the cargo 2 to the crane system 1 . the spreader bar 4 lifts the cargo off of the ship vertically and moves the container 3 horizontally along the boom arm toward the seaport . the container 3 is then lowered vertically onto a truck , seaport dock or railcar . the spreader bar 4 releases the container 3 and returns to the ship to secure another piece of cargo to remove from the ship . the process is reversed to load cargo from the dock , trucks or railcars onto a ship . the scanner device 10 of the present invention is attached to the spreader bar 4 . during the transportation of the cargo by the spreader bar 4 , the scanner device 10 inspects the contents of the cargo . this provides for uninterrupted loading / unloading of the cargo and scanning of the cargo simultaneously . fig2 and 3 show the scanner device 10 includes a main body 12 which contains geared system . the geared system includes a gear wheel 14 which runs along a geared track . the gear wheel 14 engages with the geared track 16 to provide for movement of the scanner along the length of the cargo contained in the direction of vector a and vector b . on either side of the main body 12 is a hydraulic piston 18 connected thereto . the hydraulic piston 18 is used to move a scanning arm 20 and / or an x - ray back stop 22 toward or away from the main body 12 in the direction of vector c or vector d . the scanning arm 20 is located on one side of the main body 10 and the x - ray back stop 22 is located on the other side of the main body 10 . the scanning arm 20 is a scanning wand which contains a scanning eye to x - ray the container located between the scanning arm 20 and x - ray back stop 22 . the x - ray back stop 22 provides a surface for the scanner to reflect and / or receive the x - rays as well as prevent x - rays from traveling beyond the back stop 22 . further included in the scanner device 10 is a counterweight system 24 . the counterweight system 24 includes a counterweight 26 and a counterweight arm 28 . the counterweight 26 travels along the arm 28 to counterbalance the main body 12 of the scanner device 10 as it moves along the geared track 16 . generally , during transit of a container 3 on the gantry crane 1 , the scanner device 10 will make one pass over the container 3 . the scanner device 10 will be incorporated into the spreader bar 4 as the container 3 is moved . the scanner device 10 will quickly scan and the image will be sent to a special network . the network could have the shippers &# 39 ; information on the cargo appear on the screen next to the digital scan images to provide a side by side comparison which a trained operator could determine to be consistent or inconsistent . an inconsistent comparison would flag the container to be brought to the customs inspection area . in operation , the spreader bar 4 secures the cargo 2 between the scanning arm 20 and the backstop 22 . the scanning arm 20 emits radiation beams onto the container 3 and the backstop detects radiation transmitted through the container 3 . the main body 12 of the scanning device 10 moves along the gear track 16 to scan the entire container 3 during standard loading / unloading procedures by the crane . the radiation beam is a horizontally diverging beam . the radiation beam may be a fan beam having only one dimensional direction or a cone beam having two dimensional directed beams , i . e ., horizontal and vertical . the cone beam may vary in dimension , for example , having an outer edge cross - section of a square , rectangle , circular , or other geometric shape . the radiation source of the scanner arm 20 may be x - ray radiation , i . e . bremsstrahlung radiation ; a linear accelerator , i . e . linatron ®; electrostatic accelerators , microtrons and betatrons ; and x - ray tubes may be used . the backstop 22 is used to detect the beam emitted from the scanner arm 20 . the backstop 22 may be a one dimensional detector array comprising modules of detection elements as known in the art . the elements may include a radiation sensitive detector , a photosensitive detector or other surveillance and scanning detectors as known in the art . the backstop 22 is electronically coupled to or wirelessly conjoined to a processor , i . e . computer . the processor reconstructs the data output by the backstop 22 into images which can be displayed on a monitor , data output or other source of useable real - time output for an operator to verify the contents within the cargo container . the data may be further used to compare the manifest documents identifying the contents of that container , or loading slips either electronically or manually for verification of cargo . the scanner device 10 may further include a shielding portion to capture scattered radiation . for example , a lead curtain may be incorporated with the backstop 22 to prevent scattered radiation and protect workers during the scanning process . the scanning device 10 may further provide for the scanning arm 20 and back stop 22 to be lowered into position during use , i . e . either side of the container 3 , and moved out of the way during nonuse of the scanning device 10 . moving the scanning arm 20 and back stop 22 provides for clearance below the spreader bar 4 during nonuse and protects the arm 20 and back stop 22 from damage . for example , the scanning arm 20 and backstop 22 may be rotated about the piston 18 to align with the main body 10 during nonuse . another alternative is the scanning arm 20 and back stop 22 may be vertically raised above the main body 10 and the lower portion of the spreader bar 10 to provide clearance below the spreader bar 10 . the scanning device 10 of the present invention is designed to examine cargo as fast as they can be moved by the crane system 1 . the scanning process is performed once the cargo is lifted and clears the ship and before it is placed on the truck of loading dock . the radiation activity of the present invention is a safer operation then those known in the art because the scanning is being performed during the loading / unloading instead of on the dock or ship exposing workers to radiation . the present invention provides for a more efficient use of a scanning device at a seaport . the unloading / loading of cargo onto a ship and the scanning of that cargo becomes a one step process . further , the scanning device 10 is easily attached to and supported by the crane system to allow for easy attachment and removal of the scanning device . furthermore , dock space is maximized by having this scanning system off the dock as well as the crane . the scanning device 10 describes a radiation scanner that provides images of the interior of various containers . however , the present invention includes various scanning devices used for identification and inspection of cargo including but not limited to detecting of radiation , detecting biochemical contamination , detecting chemical hazards , detecting nuclear emissions , detecting nuclear material , detecting x - ray , gamma ray and / or neutron emissions , detecting specific vapor or gas emissions produced , and the like . the scanning device may include a combination of various inspection devices . all the various types of scanning devices are attached to the spreader bar as above - described to provide the benefits discussed including time savings , reliability and user friendly way of scanning while limiting exposure to workers of various hazards and without limiting dock space . having described the preferred embodiments herein , it should now be appreciated that variations may be made thereto without departing from the contemplated scope of the invention . accordingly , the preferred embodiments described herein are deemed illustrative rather than limiting , the true scope of the invention being set forth in the claims appended hereto .	6
fig5 shows a perspective view of a nozzle 30 in accordance with one embodiment of the present invention . the nozzle 30 has an inlet located at an upstream side of the nozzle . adjacent the inlet , at the interior of the nozzle 30 , within the entry chamber 32 , there is a connection tab 36 , a diffuser mating surface 38 and an internal raised surface 52 . the connection tab 36 is made up of a “ twist - lock ” feature arrayed either singularly or plurally about the inner surface of the nozzle 30 . other ways for connection include snap , friction , screw , and compression , among others . when the nozzle is connected to a beverage - dispensing system diffuser , an o - ring ( not shown ) may be used between the diffuser and the diffuser mating surface 38 and the raised surface 52 , to create a liquid proof seal . an expansion chamber 42 adjoins the entry chamber . at the bottom of the expansion chamber is a disruption plate 40 , seen in fig6 , that extends across the ordinary fluid path that a beverage fluid flows through the nozzle . the configuration of the disruption plate in conjunction with the expansion chamber , allows for the flow of the beverage fluid through the entry chamber region and then into the expansion chamber to disperse and expand after the beverage fluid has interacted with the disruption plate 40 . fig6 shows a turbulence - inducing surface 50 on the disruption plate 40 which aids in further slowing the flow of the fluid and induces mixing of the distinct and / or partially mixed beverage base and beverage additive fluids . the turbulence - inducing surface 50 is formed to create sufficient turbulence to mix the beverage base and beverage additive fluids without overmixing the beverage combination to lower the carbonation content of the beverage too much , resulting in a “ flat ” beverage . there are also turbulence - inducing surfaces 50 on the upper portion of the expansion region sidewall 48 as can be seen in fig7 . here , the turbulence - inducing surface 50 are a plurality of terraces or steps , defined by edges that decrease in diameter in the flow direction . however , the shape of the turbulence - inducing surface 50 is not limited to the circular terraces and can take other forms , such as a roughened or dimpled surface . fig7 shows a section view of the beverage dispensing nozzle 30 as identified by section a - a of fig6 . in this view , the turbulence - inducing surfaces 50 on the expansion region 42 , both on the top and bottom of the expansion region 42 , and on the disruption plate 40 , can be seen . moreover , the cross - section of the fluid disruption plate 40 can be seen in greater detail . fig8 shows a close - up of the turbulence - inducing surface 50 on the upper portion of the expansion region sidewall 48 and the fluid disruption plate 40 . the fluid stream disruption plate 40 is angled in a funneling fashion toward the central axis of the nozzle in the direction of the fluid discharge , thus , allowing mixed fluid to flow towards a central opening 54 . in addition to a central opening 54 of the disruption plate , a plurality of vents 56 penetrate the disruption plate 40 to ensure mixed beverage fluid does not back up or clog the nozzle , ensuring adequate drainage from the expansion region 42 . as can be seen in fig5 , the plurality of openings 7 are elongated curved slots which are circumferentially located around , but apart from , the central opening 54 . as can be seen , there are four equally sized and spaced slots but other embodiments are possible and a different configuration of vents and openings can be used . after the beverage components are mixed within the expansion chamber , they flow past the exit region 36 , where further mixing is performed as the fluid funnels to the discharge point 34 of the nozzle by virtue of angled internal wall 48 of the exit region 36 which also has a turbulence - inducing surface 50 . here , the turbulence - inducing surface 50 of the expansion region 40 , the disruption plate 40 and the upper internal wall 48 of the exit region are stepped surfaces , as can be seen in the cross - section of the nozzle in fig8 , however it can be appreciated by one skilled in the art that a variety of different surfaces may be utilized on all or separately on each of the turbulence - inducing surface 50 of the expansion region 40 , the disruption plate 40 and the upper internal wall 48 of the exit region . fig9 a and 9b illustrate the flow of a beverage from both a prior art nozzle , as seen in fig9 a , and from the nozzle of the present invention , as seen in fig9 b . as can be seen , the flow of mixed beverage from the prior art nozzle in fig9 a has a streaking or unmixed appearance leading some users to misinterpret whether the final beverage is thoroughly mixed , which may lead to the user discarding an otherwise good beverage causing waste . the appearance of the dispensed beverage flow from a nozzle in conformance with the present invention , as shown in fig9 b , is uniform since thorough mixing occurs given the configuration of the mixing nozzle and users are not unnecessarily tempted to waste dispensed beverage given the appearance of the dispensed beverage flow from the mixing nozzle in conformance with the present invention . the above description is illustrative and is not restrictive . a recitation of “ a ”, “ an ” or “ the ” is intended to mean “ one or more ” unless specifically indicated to the contrary . many variations of the disclosure will become apparent to those skilled in the art upon review of the disclosure . one or more features from any embodiment described herein may be combined with one or more features of any other embodiment without departing from the scope of the disclosure . the scope of the disclosure should , therefore , be determined not with reference to the above description , but instead should be determined with reference to the pending claims along with their full scope or equivalents .	1
more particularly according to this invention , by the term &# 34 ; ethylene terephthalate recurring units &# 34 ; there is also intended that small amount of di - and triethylene glycol terephthalate inevitably formed during the polycondensation . the preparation of polyesters from aromatic dicarboxylic acids , or their functional derivatives , and from aliphatic diols by direct esterification or by transesterification , followed by polycondensation in the presence of catalysts , is a very well known process . in a first reaction step , the dicarboxylic acid is esterified , or its dimethyl ester is transesterified with glycol . in a second step , the diglycol ester formed is subjected to polycondensation . this yields a polyester of low molecular weight , which will be designated hereafter by the term &# 34 ; precursor ,&# 34 ; or precursor prepolymer . to obtain polyesters of high molecular weight , the precursor is dried , crystallized and then subjected to post - condensation in solid or molten state until the desired final viscosity is obtained . for the preparation of the poly ( ethylene glycol ) terephthalate according to the invention , such process is characterized in that , for the formation of the precursor prepolymer having an intrinsic viscosity of between 0 . 55 and 0 . 70 dl / g , the polycondensation is carried out in the presence of at least one comonomeric , copolymerizable modifier for retarding crystallization , in an amount of between 1 . 5 and 7 . 5 mol %, relative to the combination of the diacids or diesters and the retardant used , at a temperature below 290 ° c ., and is limited to a degree of between 75 and 90 % of the maximum accessible degree of polycondensation , evaluated according to the intrinsic viscosity of the polymer . the copolymerizable modifiers for retarding crystallization can be aromatic and / or aliphatic polybasic carboxylic acids and / or polyhydric alcohols . for example , representative such retardants are isophthalic , naphthalenedicarboxylic , adipic and sebacic acids , or their ester - forming derivatives thereof . exemplary driols are neopentyl glycol , hexane - 1 , 6 - diol , bis - 1 , 4 - hydroxymethylcyclohexane , diethylene glycol and triethylene - glycol . in the case of di - and / or triethylene glycol , it is essential that the total amount , which can either be added or can result from its formation in situ by the dehydration of the excess ethylene glycol , remains less than 3 . 5 mol % per mol of diacid radicals present in the chain . the use of very small amounts of trifunctional acidic or alcoholic compounds is possible , insofar as this addition does not increase the rate of crystallization of the polymer . the particular catalyst system employed can influence the formation of the acetaldehyde . it is inadvisable to use the catalysts in excessive amounts . the use of antimony compounds as polycondensation catalysts , at concentrations below 250 ppm ( expressed by weight of metal relative to the weight of all the constituents ) has been found to be particularly favorable . the degree of polycondensation of the precursor depends on factors such as the nature and the proportion of the catalyst system , the performances of the equipment and the temperature and pressure of the polycondensation . this degree of polycondensation can be determined by measuring the intrinsic viscosity of the polymer . under given operating conditions , there is a maximum polycondensation threshold beyond which the viscosity can no longer be increased , the degradation reactions dominating the polycondensation reaction . according to one of the essential features of this invention , the intrinsic viscosity of the precursor , vi p , is limited to a value of between 0 . 75 and 0 . 90 of the maximum possible viscosity vi . sub .∞, namely , a value reflected by the relationship : if the viscosity attained is limited to less than 0 . 75 vi . sub .∞, the process is not a high - performance process . if the polycondensation is continued beyond the value of 0 . 90 vi . sub .∞, an increase in the rate of reformation of acetaldehyde is observed . after crystallization and drying of the precursor prepolymer obtained in accordance with the process of the invention , the post - condensation can be carried out by any known process in order to obtain a final intrinsic viscosity of between about 0 . 65 and 1 . 05 . the post - condensation is preferably carried out in the solid state , under a high vacuum or under an inert gas , at between 190 ° and 230 ° c ., for a period which can vary from 5 to 25 hours . the product obtained can be converted to chips , granules or pellets by any known means . the polyterephthalates obtained according to the invention can be molded by any process to form containers / packages / bottles . they can be molded by injection molding , blow molding , extrusion , injection - blowing or extrusion - blowing , either directly to give a finished product or shaped article or indirectly to provide a tube or preform , which will subsequently be molded to the desired shape of the container . by virtue of reduced rates of recrystallization during quenching , the subject polyesters make it possible to mold transparent articles having relatively thick walls , such as preforms for bottles , with minimum degradation of the resin . same are particularly valuable for the production of bottles intended for the packaging of mineral water , which can be stored for a prolonged period of time without the taste being substantially impaired . in order to further illustrate the present invention and the advantages thereof , the following specific examples are given , it being understood that same are intended only as illustrative and in nowise limitative . the following measurements and determinations were used to characterize the product obtained according to the invention . residual acetaldehyde content : residual aa . the sample , cooled in liquid nitrogen , was ground to a fine powder having a particle size of less than 800 microns . the powder was heated for 1 hour , 30 minutes at 160 ° c . in a closed flask , under nitrogen , and the amount of acetaldehyde released or evolved was determined by vapor phase chromatography ( vpc ). rate of reformation of acetaldehyde at 220 ° c . : this measurement was carried out on the powder ground as above . the powder was heated for 30 minutes at 220 ° c . to remove the residual acetaldehyde initially present . the flask was purged with nitrogen and closed . a sample of gas was taken after heating for 1 , 2 and 3 hours and the acetaldehyde was determined in each sample by vpc . the total amount was divided by the time ( 3 hours ) to give the number of parts by weight of acetaldehyde per million parts by weight of polyester per hour . intrinsic viscosity vi in dl / g : this measurement was carried out at 25 ° c . in a 1 % strength ( weight / volume ) solution in a 47 / 53 mixture of phenol / ortho - chlorophenol . crystallization : the dry polymer was plasticized at 290 ° c . such as to destroy any crystallization nucleus . the molten product was injected into a series of molds of progressively varying thickness in order to obtain test plates having a thickness of between 2 and 5 mm . the temperature of the walls of the mold was conditioned at 37 ° c . the thickness e at which a slight turbidity appeared , corresponding to the commencement of crystallization , was noted . the higher the thickness e of the totally transparent , amorphous moldings , the slower the rate of recrystallization . diethylene glycol concentration ( deg %): the sample was ground and saponified by potassium hydroxide in ethanolic solution . analysis was carried out by gas chromatography in the presence of an internal standard . the results are expressed in mols , relative to the diacid radicals . a precursor was prepared by the transesterification of a mixture of dimethyl terephthalate / ethylene glycol and polycondensation thereof in the presence of 3 % of isophthalic acid ( in mols ). a catalyst system based on manganese , phosphorus and antimony , containing 200 ppm of antimony , was used . the polycondensation was terminated when the intrinsic viscosity of the precursor , vi p , attained a value of 0 . 61 dl / g , it being possible for the limiting viscosity vi . sub .∞ to be brought to a value of 0 . 72 dl / g . after drying and crystallization , the granules were subjected to post - condensation in the solid state under 66 . 66 pa , for 12 hours , at 217 ° c ., in order to obtain a vi of 0 . 81 dl / g . example 1 was repeated , except that 2 % of isophthalic acid was added . the polycondensation was terminated at a vi p value of 0 . 65 dl / g . the vi . sub .∞ was 0 . 75 dl / g . after post - condensation in the solid state until a vi of 0 . 81 dl / g was obtained , the granules possessed the following characteristics : a homopolymer was prepared by the transesterification of dimethyl terephthalate and ethylene glycol and then polycondensation thereof using the same catalyst system as in the preceding example . the polycondensation was terminated at a vi p value of 0 . 60 , the vi . sub .∞ being 0 . 72 . the precursor was treated under the conditions of example 1 until a final viscosity of 0 . 75 dl / g was obtained . the following characteristics were obtained : the procedure of example 1 was repeated ( addition of 3 % of isophthalic acid ), but the viscosity vi p was increased to the maximum possible value , namely , 0 . 72 . after post - condensation under the same conditions , the following results were obtained : example 1 was repeated , 4 mol % of diethylene glycol being added to the reaction products . the polycondensation was terminated at a vi p value of 0 . 60 dl / g ; vi . sub .∞ is 0 . 70 dl / g . after drying , crystallization and post - condensation under the conditions described , the following results were obtained : the polyesters obtained in accordance with examples 1 to 5 were used for the manufacture of biaxially oriented bottles . for this purpose , the granules were dried to a moisture content of less than 50 ppm and injected in the molten state , with the aid of an injection - molding press , into a preform mold with hot channels , such as to obtain amorphous preforms weighing 47 g and having a wall thickness of 3 . 8 mm . the acetaldehyde concentration was measured on a sample taken from the wall of the preform . for each of the experiments , the injection temperature of the material and the % of aa measured on the preform ( weight / weight of polyester ) were noted . table i______________________________________ t ° of injectionexample in ° c . aa in ppm______________________________________1 285 3 . 52 290 4 . 53 310 84 285 65 300 9 . 1______________________________________ the preforms were blown at biaxial orientation temperature to shape bottles having a capacity of 1 . 5 liters . the bottles were filled with aerated mineral water and stored at 45 ° c . in the case of the bottle obtained from the polyterephthalate according to examples 1 and 2 , an organoleptic test carried out by comparison with a mineral water stored in a glass bottle does not reveal any modification of the taste , which may result from migration of the acetaldehyde , after storage for one month . in all the other cases , a substantial impairment of taste was detected after storage for 8 days or more , which made the mineral water unsuitable for consumption . while the invention has been described in terms of various preferred embodiments , the skilled artisan will appreciate that various modifications , substitutions , omissions , and changes may be made without departing from the spirit thereof . accordingly , it is intended that the scope of the present invention be limited solely by the scope of the following claims .	8
the making , functionalization and use of nanostructured chemosensor and biosensor devices is described in considerable detail in the patent applications incorporated by reference above . a number of preferred sensor embodiments employ nanostructures , such as nanotubes . fig2 a . shows an electronic sensing device 10 for detecting a liquid or gaseous analyte 11 , comprising a nanostructure sensor 12 . device 12 comprises a substrate 1 , and a conducting channel or layer 2 including nanostructured material disposed upon a substrate 1 . the nanostructured material may contact the substrate as shown , or in the alternative , may be spaced a distance away from the substrate , with or without a layer of intervening material . as used herein , a “ nanostructured material ” includes any object or objects which has at least one dimension smaller than about 100 nm and comprises at least one sheet of crystalline material with graphite - like chemical bands . examples include , but are not limited to , single - walled nanotubes , double - walled nanotubes , multi - walled nanotubes , and “ nanoanions .” chemical constituents of the crystalline material include , but are not limited to , carbon , boron nitride , molybdenum disulfide , and tungsten disulfide . preferably a nanotube is a carbon nanotube , and more preferably it is a single - walled carbon nanotube . in an embodiment of the invention , conducting channel 2 may comprise one or more carbon nanotubes . for example , conducting channel 2 may comprise a plurality of nanotubes forming an interconnecting mesh , film or network typically , a “ nanotube network ” is a film of nanotubes disposed on a substrate in a defined area a film of nanotubes comprises at least one nanotube disposed on a substrate in such a way that the nanotube is substantially parallel to the substrate . the film may comprise many nanotubes oriented generally parallel to each other . alternatively , the film may comprise many nanotubes , each oriented substantially randomly with respect to adjacent nanotubes , or the nanotubes may be oriented substantially perpendicular to the substrate , e . g ., as in a “ nano - turf ” configuration . the number of nanotubes in as area of substrate is referred to as the density of a network . preferably , the film comprises many nanotubes oriented substantially randomly , with the density high enough that electric current may pass through the network from one side of the defined area to the other side . methods for disposing a high density of nanotubes are disclosed in u . s . application ser . no . 10 / 177 , 929 , filed jun . 21 , 2002 by gabriel et al . ( equivalent to w02004 - 040 , 671 ), which is incorporated by reference . solvent / suspension deposition nanoparticle network . alternatively , a nanotube network may be deposited on a device substrate by spray deposition and the like . such methods as spin coating , spray deposition , dip coating and ink jet printing may be employed to deposit the solution or suspension of nanostructures , such as nanotubes . for example , single wall carbon nanotubes ( swnts ) and / or other nanoparticles may be suspended in a suitable fluid solvent , and sprayed , printed or otherwise deposited in a substrate . the swnts or other nanoparticles may optionally have additional functionalization groups , purification and / or other pre - deposition processing . for example swnts functionalized with poly m - aminobenzene sulfonic acid ( pabs ) show hydrophilic properties and may be dispersed in aqueous solutions . one or more conductive traces or electrodes may be deposited after deposition , or alternatively , the substrate may include pre - patterned electrodes or traces exposed • on the substrate surface . similarly , alternative embodiments may have a gate electrode and a source electrode supported on a single substrate . the substrate may include a flat , sheet - like portion , although one skilled in the art will appreciate that geometric variations of substrate configurations ( rods , tubes or the like ) may be employed without departing from the spirit of the inventions . the density of a network of nanotubes ( or other nanostructure elements ) maybe adjusted to achieve a selected conductivity in an electrically continuous network via interconnections between adjacent nanotubes ( e . g ., a cnt film of density close to but greater than the percolation limit ). for example , this may be achieved through controlled cvd conditions , e . g ., catalyst particle density , deposition environment , duration , or the like ( see ser . no . 10 / 177 , 929 , filed jun . 21 , 2002 ). in another example , density of a network of nanotubes may be controlled by flow through a filter membrane . in such embodiments , a micro - porous filter , membrane or substrate may be employed in deposition of a nanotube ( or other nanoparticle ) network channel from suspension or solution . a porous substrate can accelerate deposition by removing solvent so as to minimize “ clumping ”, anal can assist in controlling deposition density . the deposition may be carved out by capillary absorption , or using suction or vacuum deposition across the porous substrate or membrane , as described in the above referenced application ser . no . 10 / 846 , 072 ( e . g ., see description of fig3 and example b of that application ); in u . s . provisional application no . 60 / 639 , 954 filed dec . 28 , 2004 entitled ‘ nanotube network on - top architecture for biosensor ’; and in l . hu et al ., percolation in transparent and conducting carbon nanotube networks , nano letters ( 2004 ), 4 , 12 , 2513 - 17 , each of which application and publication is incorporated herein by reference . the network thus formed may be separated from the deposition membrane using a method such as membrane dissolution or transfer bonding , and included in a sensor device structure as a conducting channel ( e . g ., disposed on a device substrate , contact grid , or the like ). in a spray - deposition example , multiple light , uniform spray steps may be performed ( e . g ., with drying and resistance testing between spray steps ) until the network sheet resistance reaches a target value ( implying a target network density and conductivity ). in one example , p2 - swnts produced by carbon solutions , inc of riverside , calif . were spray - deposited on a portion of a pet sheet substrate with pre - patterned traces until a sheet resistance about 1 ks1 was reached . dispersed networks of nanotubes and methods of formation are further described in u . s . application ser . no . 11 / 636 , 360 filed dec . 8 , 2006 ( published us ), u . s . application ser . no . 11 / 274 , 747 filed nov . 14 , 2006 ( published us ); and u . s . application ser . no . 10 / 846 , 072 filed may 14 , 2004 ( published us 2005 - 0184 , 641 ), each of which is incorporated by reference . substrates may be flat objects that are electrically insulating . substrates have a chemical composition , of which examples include , but are not limited to , silicon oxide , silicon nitride , aluminum bride , polyimide , and polycarbonate . preferably the substrate is a silicon oxide film on a silicon chip . one or more conductive elements or contacts 3 a , 3 b may be disposed over the substrate and electrically connected to conducting channel 2 . elements 3 a , 3 b may comprise metal electrodes in direct contact with conducting channel 2 . in the alternative , a conductive or semi - conducting material ( not shown ) may be interposed between contacts 3 ; 3 b and conducting channel 2 . contacts 3 a , 3 b may comprise a source electrode s and a drain electrode d upon application of a selected and / or controllable source - drain voltage vsd ( note that the voltage and / or polarity of source relative to drain may be variable , e . g ., current may be dc , ac and / or pulsed , and the like ). in such case , the contacts are arranged so that the nanotube network comprises at least one conductive path between at least a pair of conductors . alternatively , a contact or electrode may be employed to provide a charge to the channel 2 relative to a second electrode , such that there is an electrical capacitance between the second electrode and the channel 2 . the second electrode may be a gate electrode , a discrete bottom electrode ( e . g . embedded in , under , and / or doped within the substrate ), a top gate electrode , a liquid medium electrode , and the like . in another exemplary preferred embodiment , the gate electrode is a conducting element in contact with a conducting liquid , said liquid being in contact with the nanotube network . in other embodiments , the device includes a counter electrode , reference electrode and / or pseudo - reference electrode . in one exemplary preferred embodiment , the gate electrode is a conducting plane within the substrate beneath the silicon oxide . examples of such nanotube electronic devices are provided , among other places , in application ser . nos . 10 / 656 , 898 , filed sep . 5 , 2003 ( us 2005 - 0279987 ) and 10 / 704 , 066 , filed nov . 7 , 2003 ( us 2004 - 0132 , 070 ), both of which are incorporated by reference . fig2 a , the device 10 may operate as a gate - controlled field effect transistor via the effect of gate electrode 4 . in this example , the gate 4 comprises a base portion of the substrate , such as doped - silicon wafer material isolated from contacts 3 a , 3 b and channel 2 by dielectric 5 , so as to permit a capacitance to be created by an applied gate voltage vg . for example , the substrate 1 may comprise a silicon back gate 4 , isolated by a dielectric layer 5 of sio2 . such devices are generally referred to herein as nanotube field effect transistors ( ntfet ). embodiments of an electronic sensor device having aspects of the invention may include an electrical circuit configured to measure one or more properties of the nanotube sensor , such as measuring an electrical property via the conducting elements . for example , a conventional power source may supply a source drain voltage vsd between contacts 3 a , 3 b . measurements via the sensor device 10 may be carried out by circuitry represented schematically by meter 6 connected between contacts 3 a , 3 b . in embodiments including a gate electrode 4 , a conventional power source may be connected to provide a selected and / or controllable gate voltage vg . device 10 may include one or more electrical supplies and / or a signal control and processing unit ( not shown ) as known in the art , in communication with the sensor 12 . any suitable electrical property may provide the basis for sensor sensitivity , for example , electrical resistance , electrical conductance , current , voltage , capacitance , transistor on current , transistor off current , and / or transistor threshold voltage . alternatively , sensitivity may be based . on measurements including a combination , relationship , pattern and / or ratios of properties and / or the variation of one or more properties over time . for example , the capacitance or impedance of the nanostructures relative to a gate or counter electrode . similarly , a breakdown voltage or electron emission voltage and / or current may be measured between nanostructures and a reference electrode . in certain embodiments , a transistor sensor may be controllably scanned through a selected range of gate voltages , the voltages compared to corresponding measured sensor current flow ( generally referred to herein as an i - vg curve or scan ). such an i - vg scan may be through any selected gate voltage range and at one or more selected source - drain potentials . the vg range is typically selected from at least device “ on ” voltage through at least the device “ off ” voltage . the scan can be either with increasing vg , decreasing vg , or both , and may be cycled +− at any selected frequency . from such measurements , and from derived properties such as hysteresis , time constants , phase shifts , and / or scan rate / frequency dependence , and the like , correlations may be determined with target detection and / or concentration and the like . the electronic sensor device may include and / or be coupled with a suitable microprocessor or other computer device of known design , which may be suitably programmed to carry out the measurement methods and analyze the resultant signals . those skilled in the art will appreciate that other electrical and / or magnetic properties , and the like may also be measured as a basis for sensitivity . accordingly , this list is not meant to be restrictive of the types of device properties that can be measured . in certain embodiments , sensor 12 may further comprise a layer of inhibiting or passivation material 6 covering regions adjacent to the connections between the conductive elements 3 a , 3 b and conducting channel 2 . the inhibiting material may be impermeable to at least one chemical species , such as the analyte 11 . the inhibiting material may comprise a passivation material as known in the art , such as silicon dioxide , aluminum oxide , silicon nitride , and the like . further details concerning the use of inhibiting materials in a ntfet are described in prior application ser . no . 10 / 280 , 265 , filed oct . 26 , 2002 ( us 2004 - 0043527 ), which is incorporated by reference herein . the conducting channel 2 ( e . g ., a carbon nanotube layer ) is typically functionalized to produce a sensitivity to one or more target analytes 11 . although nanoparticles such as carbon nanotubes may respond to a target analyze through charge transfer or other interaction between the device and the analyte , more generally a specific sensitivity can be achieved by employing recognition material 7 that induces a measurable change the device characteristics upon interaction with a target analyze . typically , the sensor functionalization layer 7 is selected for a specific application . the analyte may produce the measurable change by electron transfer , and / or may influence local environment properties , such as ph and the like , so as to indirectly change device characteristics . alternatively or additionally , the recognition material may induce electrically - measurable mechanical stresses or shape changes in the conducting channel 2 upon interaction with a target analyte . in a typical embodiment having aspects of the invention , the sensitivity is produced and / or regulated by the association of the nanotube layer 2 with a functionalization material , e . g . disposed as a functionalization layer 7 adjacent channel 2 . the functionalization layer 7 may be of a composition selected to provide a desired sensitivity to one or more target species or analytes . the functionalization material may be disposed on one or more discrete portions of the device , such as on all or a portion of the channel 2 , or alternatively may be dispersed over the sensor 12 , such as on contacts 3 and / or exposed substrate 1 . optionally device 10 may comprise a plurality of sensors 12 disposed in a pattern or affray , as described in u . s . patent application ser . no . 10 / 388 , 701 filed mar . 14 , 2003 entitled “ modification of selectivity for sensing for nanostructure device arrays ” ( now published as us 2003 - 0175161 ). each device in the array can be functionalized with identical or different functionalization . identical device in an array can be useful in order to multiplex the measurement to improve the signal / noise ratio or increase the robustness of the device by making redundancy . the above described sensor embodiments , such as a preferred embodiment of a carbon nanotube network transistor , may be treated or engaged with many alternative functionalization materials , probes , molecular transducers , coatings and the like . in one example of a glucose sensor , the network is functionalized using the enzyme glucose oxidase ( gox ), so as to provide glucose - specific sensitivity . fig2 b diagrammatically illustrates the functionalization . in one preferred example , the gox ( or an alternative biomolecule probe ) may be bonded to a linker molecule , such as pyrene , polymer or the like . ( see patent application ser . no . 10 / 345 , 783 incorporated by reference above ). the linker molecule , in turn , is selected to have properties which cause it to associate with the lattice of the carbon nanotube , such as by non - covalent pi - pi stacking between the graphitic nanotube lattice and the flat ring pyrene structure . ( see besteman , et al ., enzyme coated carbon nanotubes as single molecule biosensors , nano letters , 2003 vol . 3 , no . 6 , 727 - 730 ) such a functionalization structure is referred to as a molecular transducer . in operation of the sensor , the immobilized gox reacts with glucose presented in the contacting medium so as to alter the electrical properties of the nanotube device . fig3 shows a plot of the response of a nt sensor device ( in this example the device is a ntfet generally as shown in fig2 a ) with vgate = 0 ). initially , in a water medium without glucose , the conductance is about 1200 - 1250 mus . upon injection of a glucose sample ( at arrow ) the conductance rises to a stable level of about 1450 mus . there is an very brief transient at injection , which is believed to be an artifact of the injection process ( brief exposure to air ). the change in conductance may be correlated with the concentration of glucose . the response time and transient may be controlled by appropriate sample presentation , such as by rapid mixing to equilibrium concentration in contact with functionalized nanotube network . the response of the nt sensor toward an increased conductance is indicative of the effect of the biochemical environment ( gox reacting with aqueous glucose solution ) on the conductance of the nanotube network channel 2 as measured between source 3 a and drain 3 b . alternative enzymes may be employed for chemodetection and biodetection in a manner similar to that described above . for example , an alternative glucose sensor system embodiment is functionalized using the enzyme methane reductase , so as to provide sensitivity to methane for methane measurement and detection . in addition other reactive or receptive biomolecules can target particular species , such as direct or indirect antibody reactions . for example , the probe may be a commercially available anti - hiv antibody which is reactive to target components of the hiv virus in a patient sample . alternatively the probe may be a commercially available hiv antigen component , reactive to target human anti - hiv antibodies ( from patient sample ). one of ordinary skill in the art can readily identify useful known probe - target combinations of biomolecules , such as enzymes and their substrates , antibodies and their specific antigens , and the like , which may be used to produce the molecular transducers for alternative embodiments , without departing from the spirit of the invention and without undue experimentation . note that the sensor arrays described above may be included in system embodiments sensitive to multiple targets . alternatively , the arrays may providing multiple differently functionalized sensors for the same target species , to enhance selectivity , sensitivity , dynamic range , and the like . fig4 a is a diagram of an alternative exemplary embodiment of a nanosensor 20 having aspects to the invention , including a network of carbon nanotubes . certain elements are generally similar to those of fig2 a , and the same reference numbers are indicated . sensor 20 comprises a substrate 9 , which preferably comprises a flexible sheet - like material such a polyester polymer ( e . g ., pet sheet ). one or more electrodes ( 3 a and 3 b are shown ) are arranged on the substrate . the electrode may comprise a metal , or may be ’ formed from a paste or ink - like composition , such as carbon , graphite , conductive polymer , metallic ink compositions , and the like . a nanostructure layer 2 ( in this example a film including swnts ) is deposited contacting the electrodes 3 a ( and 3 b in this example ). an optional functionalization or recognition layer 7 may be included in association with the layer 2 , for example applied following deposition of swnt film 2 . an optional passivation , protective or inhibiting layer 8 may cover electrodes 3 and all or a portion of layers 2 and 7 . in a preferred embodiment , substrate 9 is a flexible sheet having pre - pattered printed electrodes 3 , permitting simplicity and cost reduction . preferably the nanostructure layer 2 is formed by spraying or otherwise coating the patterned substrate with an liquid suspension of nanotubes . for example , swnts or mwnts may be conveniently dispersed in aqueous suspension at a desired concentration , particularly where functionalization treatment of the swnts assist in making the nanotubes hydrophilic ( see examples d - f below ). alternatively organic solvents may likewise be used to disperse and apply the nanotube film 2 . see u . s . patent ser . no . 10 / 846 , 072 ; and l . hu et al ., percolation in transparent and conducting carbon nanotube networks , nano letters ( 2004 ), 4 , 12 , 2513 - 17 , each of which is incorporated herein by reference . in certain embodiments , recognition or detection material is deposited , reacted or bound to the nanotubes ( or alternative nanostructures ) prior to deposition of layer 2 . depending on the selected detection chemistry and analyte target , such pre - functionalization may eliminate the need for any distinct recognition layer 7 . alternative nanotube dispersion techniques may also be employed , see for example , u . s . patent application ser . no . 10 / 846 , 072 entitled “ flexible nanotube transistors ”; and l . hu et al ., percolation in transparent and conducting carbon nanotube networks , nano letters ( 2004 ), 4 , 12 , 2513 - 17 , each of which application and publication is incorporated herein by reference . the nanostructure layer 2 may be deposited stepwise , with intermediate drying , to permit the density and conductivity of the layer 2 to be accurately controlled , such as by probe - testing the layer resistance or conductance between deposition steps , until a selected layer conductivity or resistance is achieved . in the example of fig4 a , the electrodes 3 a , 3 b are shown deposited upon substrate 9 beneath the swnt film 2 , as this advantageously permits the use of substrates having pre - printed or pre - patterned electrode material , which permits substantial costs savings in volume production . however , other electrode configurations are possible without departing from the spirit of the invention . in the example shown in fig4 b , a layer of recognition material 7 ′ is deposited upon the substrate or to application of the nanotube film 2 , and is disposed underneath , film 2 . in either of the examples of fig4 a and 4b , a recognition material may penetrate the nanotube network 2 so as to be incorporated as a mixture . in certain embodiments , recognition or detection material is deposited , reacted or bound to the nanotubes ( or alternative nanostructures ) prior to deposition of layer 2 . depending on the selected detection chemistry and analyte target , such pre - functionalization may eliminate the need for any distinct recognition layer 7 . in the example shown in fig4 c , a layer of pre - functionalized nanotubes 12 is deposited upon the substrate , without arty separate application of a recognition or functionalization material . the nanostructure layer 2 may be deposited stepwise , with intermediate drying , to permit the density and conductivity of the layer 2 to be accurately controlled , such as by probe - testing the layer resistance or conductance between deposition steps , until a selected layer conductivity or resistance is achieved . suitable measurement circuitry is included in communication with electrodes 3 a and 3 b ( and any optional additional electrodes ), here represented by meter 6 and source - drain power source w . fig5 shows a ntfet alternative sensor 60 having space - apart source and drain traces 3 a and 3 b disposed on substrate 9 . an additional intermediate trace 14 is coated with a thin layer of dielectric or insulating material 15 ( organic film or inorganic deposit ) prior to deposition of nanotube layer 12 , so as to form a gate electrode ( permitting operation as a transistor ). in one example , dielectric material 15 is a ald layer comprising al203 , zro2 , or the like . material 15 may be only a few nanometer in thickness ( e . g ., between about 10 and about 100 nm ). further description of ald methods may by found in p . chen , et al , “ atomic layer deposition to fine - tune the surface properties and diameters of fabricated nanopores ” , nano lett ( june 2004 ) vol . 4 , no . 7 , pp 1333 - 37 ; d . farmer et al , “ atomic layer deposition on suspended single - walled carbon nanotubes via gas - phase noncovalent functionalization ”, nano lett ( march 2006 ) vol . 6 , no . 4 , pp 699 - 703 ; and m . groner et al , “ gas diffusion barriers on polymers using a 1203 atomic layer deposition ” , appl . phys . lett . ( 2006 ) vol . 88 , pp 051907 - 1 to - 3 ; which publications are incorporated by reference . sensor fabrication . fig6 shows an exemplary embodiment of a sensor device 50 having aspects of the invention and including a nanotube networks fabricated by deposition of a solution or dispersion of nanotubes upon a substrate 9 to form a nanotube film 12 . in an exemplary embodiment shown in fig6 , the nanotubes ( or other nanostructures ) are dispersed in a volatile solvent which evaporates following deposition to leave the nanotubes configured as an open network 12 . although electrical contacts may be deposited or applied subsequent to nanotube deposition , it is convenient and advantageous to pattern desired electrode or contact material 3 upon the substrate 9 prior to nanotube deposition ( four contacts 3 a - 3 d are shown ). for example , substrates ( e . g ., polymer sheets such as pet , polystyrene , polycarbonate and the like ) are commercially made having printable conductor material applied in a selected pattern ( e . g ., carbon , silver , gold , silver / silver chloride , mixtures and the like ). a suitable flexible pet substrates with a pattern of printed conductive carbon traces may purchased from conductive technologies , inc ., of york , pa ., for example , a flexible pet substrate with screen - printed carbon paste electrodes , with spacing between the conductive traces of about 1 mm . a plurality of devices may conveniently be fabricated on a sheet of substrate material , and may subsequently be partitioned and packaged as desired , either as single sensor devices , or as arrays of sensors , and the no . in an exemplary embodiment having aspects of the invention , the nanotube network was formed from swnts which were functionalized by covalently bonded poly -( m - aminobenzene sulfonic acid (“ paws ”). c ′- bon nanotubes , preferably swnts , may be reacted and treated with paws ( composite referred to as “ st - paws ”) by the methods as described in b mao et al , “ synthesis and properties of a water - soluble single - walled carbon nanotube poly -( m - aminobenzene sulfonic acid ) graft copolymer ”, adv funct mater ( 2004 ) vol 14 , no 1 pp 71 - 76 , which article is incorporated by reference . a suitable nanotube composite material (“ swnt - pabs ”) may be obtained from carbon solutions , inc . of riverside , calif . in the form of a dry powder . a variety of alternative functionalization species may be included , such as conductive polymeric materials , polyaniline ( pant ), polypyrrole , polyaniline derivatives , and the alternative materials described above in table 3 of u . s . application ser . no . 11 / 636 , 360 filed dec . 8 , 2006 ( published us 2008 / 0093226 ), which is incorporated by reference . see , for example , the electrochemical treatments described in t zhang et al , “ nanonose : electrochemically functionalized single - walled carbon nanotube gas sensor array ” , proc . 208th meeting of electrochemical society ( los angeles , calif . oct . 16 - 21 , 2005 ), which is incorporated . by reference . a suitable aqueous deposition solution may be made by suspending swnt - pabs powder in water ( preferably at a concentration of about 1 mg / ml . ), and ultrasonication may be employed to assist in making a homogeneous dispersion . the carbon nanotube dispersion may be sprayed with an air brush to coat the substrate . preferably the deposition is done in several light coating as with intermediate drying ( for example on a hotplate with the temperature of about 55 to 75 degree c .). the film resistance may be measured between steps until the selected resistance is obtained ( the measurement may be between printed traces , or may be by pin probes on the network coating . for example , the deposition may be continued until resistance with a half - inch pin probe spacing is about 15 k ohm . fig7 shows schematic architecture of a sensor device embodiment having aspects of the invention for detection and measurement of biomolecular species , as described in further detail in u . s . provisional applications no . 60 / 850 , 217 filed oct . 6 , 2005 , and no . 60 / 901 , 538 filed feb . 14 , 2007 , each entitled “ electrochemical nanosensors for biomolecule detection ”, which are incorporated by reference . in a particular example , device 10 may be employed detection of a molecular species of biological origin . the device 10 comprises a sensor substrate 12 ( e . g ., comprising pet , polycarbonate , flexible polymers , or the like ) having a reaction or sensor tip portion of its surface 20 on which an interconnecting carbon nanotube ( cnt ) network 14 is disposed . in the example of fig1 , a conductive trace or drain 15 electrically communicates with the network 14 ( e . g ., silver ink may be deposited on the substrate 12 so as to contact a portion of the network 14 ). device 10 includes a well or container 17 holding buffer or fluid media 19 in which both sensor tip 20 and a gate electrode 18 are immersed . in certain embodiments , gate electrode 18 may include a reference electrode , such as a ag / agcl reference electrode , saturated calomel electrode , or the like . one skilled in the art will appreciate that container 17 may comprise one or more microfluidic elements , capillaries , sampling devices , incubators , and the like , without departing from the spirit of the invention . an encapsulation material 16 ( e . g ., polymers such as epoxy , al 2 o 3 , si 4 n 3 , sio 2 , ald layers , and the like ) may be deposited so as to isolate portions of the device from the medium or buffer 19 , while not covering at least a portion of the cnt network 14 . with reference to encapsulation material 16 and to other encapsulation layers , dielectric layers and / or isolation layers or multi - layer structures included in alternative embodiments having aspects of the invention described herein , it may be advantageous to produce layers that are extremely flan and uniform , while at the same time avoiding pores , shadowing or other discontinuities / irregularities in the coating . it may also be desirable in certain elements to avoid damage to underlying elements , such as carbon nanotube networks . atomic layer deposition methods provide alternative approaches to producing a layer or coating having the desirable qualities , and may be employed to deposit a layer of an oxide , nitride or other compound , or combinations or multiple layers of these . alternative methods may be used , such as thermal and e - beam evaporation . additional process elements may be included to improve ‘ coating properties , such as rotating and / or tilting a substrate during evaporation . further description of ald methods may by found in p . chen , et al , “ atomic layer deposition to fine - tune the surface properties and diameters of fabricated nanopores ” , nano lett ( june 2004 ) vol . 4 , no . 7 , pp 1333 - 37 ; d . farmer et al , “ atomic layer deposition on suspended single - walled carbon nanotubes via gas - phase noncovalent functionalization ” , nano lett ( march 2006 ) vol . 6 , no . 4 , pp 699 - 703 ; and m . groner et al , “ gas diffusion barriers on polymers using al 203 atomic layer deposition ”, appl . phys . lett . ( 2006 } vol . 88 , pp 051907 - 1 ; which publications are incorporated by reference . drain 15 and gate 18 are connected to suitable measurement circuitry 13 , which may comprise one or more of a number of devices conventionally used for signal measurement , recordation , display , power supply , signal processing and / or logic operations , and the like , as described farther herein . additional or substitute electrodes may also be included in device 10 , such as counter electrodes , reference electrodes and the like , such as ag / agcl reference electrodes described herein . a cnt network may be made by methods described above with respect to examples a - c , such as by cvd formation of cnt from catalyst nanoparticles ( see ser . no . 10 / 177 , 929 ), by spray deposition , or the like . one or more conductive traces or electrodes may be deposited after deposition , or alternatively , the substrate may include pre - patterned electrodes or traces exposed on the substrate surface . similarly , alternative embodiments may have a gate electrode and a source electrode supported on a single substrate . the substrate may include a flat , sheet - like portion , although one skilled in the art will appreciate that geometric variations of substrate configurations ( rods , tubes or the like ) may be employed without departing from the spirit of the inventions . analyte - specific functionalization may be included on or adjacent to network 14 , such as redox enzymes capable of producing an electroactive species when bound to an analyte as a substrate ( e . g ., glucose oxidase active on a glucose substrate ). alternative functionalization includes analyte - specific receptors or binding probes , such as antibodies , oligonucleotides , and the like . fig8 shows an example of square wave voltammetry ( swv ) response of a nanotube electrode such as shown in fig7 in buffer alone ( lower curve ), as compared with the response in a buffer with added redox couple ( upper curve ). in this example , the redox couple includes 10 mm solution of fe ( cn ) 6 3 −/ 4 − added to ap buffer . as it can be seen from fig2 , the ferrocyanide / ferricyanide redox couple produces more than 100 fold increase of electron transfer between solution and the device as indicated by square voltammetry method . the device shows purely electrochemically capacitive behavior in buffer alone , but converts to ‘ resistor ’ in the presence of ferrocyanide / ferricyanide redox couple . square voltammetry methods are further described in a j bard and l faulkner , electrochemical methods : fundamentals and applications ( wiley and sons , new york , 2001 ); and j wang , analytical electrochemistry ( wiley and sons , new york , 2000 ), which publications are incorporated by reference . as shown in fig9 , further amplification of the dynamic range can be achieved by differentiating cyclic voltagrams ( cv ): the maximum of the derivative of the totally reversible system is close to the half - potential value , which happens to be around − 230 mv versus ag / agc reference electrode . with this approach the response is extended to three orders of magnitude , comparing the response with buffer alone ( lower curve ) versus buffer with ferrocyanide / ferricyanide redox couple ( upper curve ). in addition or in substitution to the ferrocyanide / ferricyanide redox couple described , alternative redox couple species may be employed without departing from the spirit of the invention . an alternative exemplary embodiment of an electrochemical sensor include single walled carbon nanotubes ( swnts ) having aspects to the invention , configured in one example as a test strip for detection of glucose . fig1 , views a - c illustrate an exemplary electrochemical sensor 40 , in this example configured as a blood test strip . a first substrate 41 a ( view a ) and a second substrate 41 b ( view b ) comprise a flexible sheet material such as pet polymer . a counter electrode 42 ( preferably comprising a conductive ink ) is printed , screen printed , shadow masked , or otherwise deposited on substrate 41 a . additional optional electrodes such reference electrode 43 and / or calibration electrode 44 may be deposited adjacent counter electrode 42 . a conductive nanostructured film electrode 45 is deposited on substrate 41 b . film 45 may be printed , or may be spray deposited in the manner described with respect to the sensor 20 of fig4 a . substrates 41 a and 41 b are preferably shaped so that they may be counter - posed and attached to one - another , such as by adhesive layer 46 to form a multilayer assembly ( view a + b ). adhesive layer 46 may serve as an insulator to electrically isolate the counter electrode 42 ( and also 43 - 44 ) from nanotube film 45 in the assembly , and the adhesive may also serve as a space to maintain a space between the substrate layers 41 a - 41 b ( best seen in cross - section view c ). a gap or space in the adhesive layer 46 adjacent one end or other portion of the substrates 41 may serve to create sample well 47 , comprising a void between the layers , the well 47 communicating with one or more sample ports 49 ( in this example , ports 48 a , 48 b in the sides of sensor strip 40 ). additional functionalization material 49 ( e . g ., comprising gox for an exemplary glucose detector ) may be deposited on either or both of electrode 42 and / or film 45 in line with sample well 47 . as seen in fig1 , view c ( detail ), a blood sample 11 may be drawn by capillary action into sample well 47 so as to contact both counter electrode 42 and film 45 , and so as to dissolve associated functionalization 49 . a signal ( e . g ., an electrochemically generated current ) is measured by monitor circuitry 50 ( diagrammatically indicated by a meter ), so as to produce a measurement of the glucose concentration ( or other target analyte ) in sample 11 . advantageously , the nanotube film 45 may be pre - functionalized or to deposition with nanoscale pt particles . for example , surface oxidized swnts may be suspended ( e . g ., with sonification ) in a solvent such as ethylene glycol - water mixture , containing a selected concentration of hexachloroplatinic acid preferably , the ph is adjusted ( e . g . with naoh ) to about 13 . the solution may be heated to about 140 deg . c . in an oxygen - free atmosphere for an period to permit pt reduction . the treated swnts may be centrifuged to remove solvent , and re - suspended in a desired deposition solvent prior to applying to substrate 41 b . the concentrations of reagents and treatment temperature and time may be adjusted to produce the desired pt content in the final film . the conductive nanostructured film electrode 45 preferably comprise a film of carbon nanotubes , and more preferably comprises a highly - uniform network of swnts . in comparison to conventional glucose test strips ( e . g ., the freestyle ™ system , and others ) employing other conductive materials , the film 45 is configured to provide at least the following advantages : ( a ) accelerated response of sensor 40 to sample 11 — film 45 provides a faster electrochemical response signal to reaction products ( e . g ., hydrogen peroxide and gluconic acid ) from the enzymatic reaction to the glucose substrate . ( b ) film 45 provides a smooth , consistent surface for binding gox ( or other catalysts or cofactors ), so as to produce a test strip with more consistent response to samples , so as to greatly reduce system calibration problems , leading to reduced costs , improved reliability and greater convenience of use . the inclusion of platinum or pt ( or other metal catalyst ) in the conductive nanostructured film electrode 45 is preferably as nanoscale particles of a size generally on the order of the diameter of the nanotubes or smaller . in comparison to a film 45 without pt functionalization , the pt containing ; film provide at least the following advantages : ( a ) the pt nanoparticles provide an even faster electrochemical response signal to reaction products ( e . g ., hydrogen peroxide and gluconic acid ). ( b ) the pt nanoparticles provide an even better binding point for immobilizing gox ( or other catalysts or cofactors ), so as to advantageously produce a test strip with more consistent response to samples . ( c ) the described process for pre - functionalizing the nanotubes with pt ( or other metal catalyst ) permits convenient fabrication and a much more advantageous control of pt particle size , distribution and content than other methods of applying or depositing pt to a previously formed nanotube network , thus improving the value of ( a ) and ( b ) above . in this exemplary embodiment , the nanotubes are treated with a polymeric functionalization material . in this novel embodiment , the functionalization material includes poly ( m - aminobenzene sulfonic acid ) or pabs covalently attached to swnts ( swnt - pabs ). the functionalized nanotubes may be included in any of the suitable sensor embodiments having aspects of the invention , such as the sensors described and shown in fig2 a , fig4 a - c , and fig1 . in this example , the pabs - functionalized nanotubes were included in an electrochemical test strip generally similar to that shown in fig1 . a composition of swnt - pabs powder is commercially available from carbon solutions , inc . of riverside calif ., and may be made as described in b zhao et al , “ synthesis and properties of a water - soluble single - walled carbon nanotube poly ( m - aminobenzene sulfonic acid ) graft copolymer ” , adv funct mater ( 2004 ) vol 14 , no 1 pp 71 - 76 , which article is incorporated by reference . an aqueous solution of swnt - pabs may be prepared by ultrasonication ( e . g ., 1 mg / ml ). after brief sonication , a homogeneous dispersion of carbon nanotubes was obtained . the sensor in this example includes a flexible substrate comprising pet sheet ( which are commercially available from mcmaster - carr supply company of chicago ill .). the carbon nanotubes dispersion was sprayed with an air brush in several steps with intermediate drying until the desired resistance was obtained . in this example , the deposition was carried out on with the substrate on a hot - plate with the temperature of about 75 degree c ., and the dispersion was deposited step - wise until the half - inch resistance obtained using the pin probe reached a target resistance ( for example , from about 1 to about 15 k ohm ). the response of the sensors to glucose was demonstrated using the h2o2 solution as a simulant to glucose ( note that the reaction of gox with blood glucose produces peroxide , which in turn generates the measurement current ). the 2 . 5 mm h2o2 solution was prepared corresponding to the 400 mg / dl of glucose concentration . a meter from hypogard was used to record the reading of the glucose . the meter was calibrated based on the conductivity of cnt film . the response of pabs - swnt strip sensor to 400 mg / dl glucose is as shown in fig1 . the meter records 367 mg / dl giving less than 10 % error in the measurement of actual glucose concentration . also the time (& lt ; 2 seconds ) required for measurement is less than in a conventional test strip , demonstrating that the exemplary sensor is a faster sensor for ‘ glucose detection . the molecular sensing mechanism of glucose for the swnt - pabs can be understood considering the chemistry of polyaniline ( pani ). panis are appealing for sensor applications because their electronic properties can be reversibly controlled by doping / dedoping at room temperature . the chemical modification of swnts significantly affected the sensitivity and reversibility of the behavior of the sensors . pabs is a water - soluble conducting polymer . the presence of so3h groups improved the solubility and processability of this sulfonated polyaniline derivative , and it is especially attractive for introducing acid - base sensitivity together with a further doping response into sensor devices . glucose chemically binds to the benzene sulfonic acid groups , which greatly influences the electrochemical activity of the polyaniline backbone due to steric effects . the carbon nanotubes in the composite not only increase the effective electrode surface area ( thereby increasing the density of benzene sulfonic acid groups for glucose binding ), they also greatly increase the stability of the film . in this concept , the conducting polymer ( pabs ) acts as the immobilization matrix as well the physio - chemical transducer to convert a chemical signal ( change of chemical potential of the microenvironment ) into an electrical signal . the conducting polymer acts as the electron mediator while the carbon nanotubes provide enhanced surface area . the sensors in this example may be made from pre - functionalized nanotubes , thus eliminating an additional step to functionalize nanotubes with polymers . unlike conventional glucose biosensors , no electrochemical deposition is required in this case making it easy - to - fabricate sensor process . alternative techniques may be employed to functionalize nanotubes with other suitable conductive polymeric materials , such as pani or may be employed . see , for example , the electrochemical treatments described in t zhang et al , “ nanonose : electrochemically functionalized single - walled carbon nanotube gas sensor array ” , proc . 208th meeting of electrochemical society ( los angeles , calif . oct . 16 - 21 , 2005 ), which is incorporated by reference . similarly , different polymer like poly ( aniline boronic acid ); various functionalized tubes can also be used to functionalize cnts for non - enzymatic glucose detection . the swnts ( or alternative nanostructures ) functionalized with pabs ( other alternative conductive polymers such as other polyaniline derivatives ) are advantageously employed to comprise the nanostructured film electrode 45 as shown in fig1 . in comparison to conventional glucose test strips ( e . g ., the freestyle ™ system , and others ) employing other conductive materials , the film 45 comprising is configured to provide at least the following advantages : ( a ) the example electrode film 45 having conductive polymer functionalization ( e . g ., pars ) provides a faster electrochemical response signal to reaction products ( e . g ., hydrogen peroxide and gluconic acid ) from the enzymatic reaction to the glucose substrate . in addition , where , as in this example , there is a covalent bend between the conductive polymer ( e . g ., pabs ) and the conductive nanostructure ( e . g ., swnts ), the accelerated response is particularly notable . ( b ) the example electrode film 45 having conductive polymer functionalization provides a smooth , consistent surface for binding gox ( or other catalysts or cofactors ), providing the advantageous described above with respect to pt functionalized nanotube films . ( c ) in many cases , the example electrode film having conductive polymer functionalization of this example e provides better sensor properties and response , in comparison to the alternative film having pt functionalization as described in example e ( d ) an additional alternative electrode film 45 may advantageously have conductive polymer functionalization in combination with pt functionalization . for example , swnts ( or other nanostructures ) may be pre - functionalized with both pabs and pt , and then deposited as a film electrode . in yet other alternative examples , a film electrode may be deposited from a mixture of differently - functionalized nanotubes ( e . g . swnt / pabs + swnt / pt ); or a film electrode may be deposited in layers ( e . g ., stepwise deposition ) of differently - functionalized nanotubes ( e . g . swnt / pabs layered with swnt / pt ). fig1 a - 12b illustrate an exemplary electrochemical test strip 50 having a cnt working electrode 55 and a sample volume 56 communicating with a capillary vent 57 . substrate 51 ( e . g ., pet ) supports a pair of traces 52 a , 52 b which lead sample volume enclosure 56 . the working electrode comprises , for example , a conducting carbon path with cnts deposited on top of it . traces 52 a , 52 b communicate with working electrode 55 and counter electrode 58 , which are exposed within sample volume enclosure 56 . in this example , sample volume enclosure 56 may be formed by a layer of insulating material 53 which serves to : enclose the sides of volume 56 ; electrically isolate traces 52 a , 52 b , and define a capillary entrance 59 at the tip or margin of strip 50 . the upper bound of sample volume 56 is formed by plate 60 ( e . g ., a thin plastic piece on the active electrode area using a pressure sensitive adhesive ), which includes a downstream capillary vent 57 . although trace 52 a and working electrode 55 may be integral , conveniently trance 52 a may comprise screen - printed ag and electrode 55 may comprise printed carbon . a layer including a cnt network is deposited on the surface of electrode 55 . preferably , trance 52 b comprises screen - printed ag and counter / reference electrode 58 comprises a ag and agcl mixture . traces 52 a , 5211 ; may alternatively comprise suitable conductive materials . an analyte - selective redox enzyme ( and suitable cofactors and / or mediators ) are deposited on or adjacent working electrode 55 . alternatively or additionally , enzyme and cnts may be deposited simultaneously to form the surface layer of electrode 55 a sample , such as a droplet of blood , is applied to entrance 59 , where it moves by capillary forces to fill volume 56 . suitable circuitry ( not shown ) detects an analyte via a signal transmitted via traces 52 a , 52 b ( amperometric , coulometric , or the like ). carboxylic acid functionalized cnts may be suspended in water by sonicating the mixture for about 1 hour or more . the concentration of cnt may be about 0 . 1 mg / ml . the concentration and sonication time depends on the type of cnts and solvents . the next step is to put this suspension on the carbon conducting layer to form the working electrode 55 . for example , this may be performed using the moving head type biodot instrument . about 40 nl of the cnt suspension drops may be cast on the electrode in one cycle of the instrument . this may be repeated with small changes in spacing until the desired cnt amount and extent of coverage is obtained on the electrode . biosensors used for monitoring analytes such as glucose in real samples such as blood are susceptible to interferences from other species e . g . ascorbic acid , uric acid , other saccharides such as galactose etc . likely to be present in the sample . additionally , depending on the enzyme and mediator used oxygen dependence could also arise . hematocrit , which is the amount of red blood cells in the sample may also influence the glucose measurement . these interfering factors adversely affect the accuracy of glucose measurement . various methods may be employed to increase the accuracy of glucose monitoring . using an electro - catalyst such as carbon nanotubes ( cnt ) to lower the voltage of glucose detection may be used to eliminate some of these interferences . in addition the faster reaction may reduce the hematocrit and oxygen sensitivity . alternatively , hematocrit sensitivity may be addressed , in particular , by measuring the hematocrit by some other method such as electrochemical impedance spectroscopy ( eis ) and initial glucose concentration by electrochemical measurement and then estimating the corrected glucose concentration based on these two measurements based on a calibration algorithm . one aspect of the invention includes the use of cnts to improve the hematocrit estimation using a technique such as eis and the glucose measurement using amperometry / coulometry resulting in an overall accuracy better than that can be achieved without using cnts . cnts have high surface area and according to various embodiments have various functionalization chemistries . in combination with a suitable enzyme - mediator system cnts provide a highly accurate sensor in the following way : various parameters such as phase shift and impedance can be measured for determining the hematocrit levels at one or different frequencies of the ac waveforms varying in voltage , set up for the particular enzyme - mediator system . the hematocrit estimation can be done by ac measurement while the glucose detection may be performed at a fixed potential . for an effective measurement of hematocrit it is useful to have a good dependence of phase shift and or magnitude of impedance on hematocrit concentration . it is also desirable to have as accurate as possible early glucose estimation at a low potential , which can be further corrected for hematocrit bias . this depends on the mediator - enzyme system ; in one example , potassium ferricyanide - glucose oxidase system is at 300 mv vs agcl or less . cnt have high surface area and may have various functionalization chemistries . different hydrophobic / hydrophilic behavior is tailored to achieve good hematocrit dependence by eis at particular frequencies . this combined with the cnt enables fast reaction of the mediator . consequently inherently low hematocrit dependence results in an insensitivity to a wide range of hematocrit ( packed cell volume ) values . cnt - based sensors having a enzyme - mediator chemistry , are particularly useful for measuring glucose in neonates who have high hematocrit ( 55 %- 65 %) concentration and whose hypoglycemic limit is lower than for adults ( 40 mg / dl as opposed to 60 mg / dl ), wherein high inaccuracies may result using conventional glucose sensors . one aspect of the invention provides improved electrochemical performance using carbon nanotubes ( cnts ) and heme containing dehydrogenase enzymes such as glucose dehydrogenase ( gdh ) along with a suitable mediator for glucose monitoring . advantages of using fad - gdh include good stability , higher substrate specificity and oxygen insensitivity . direct electron transfer between fad and an electrode using cnts as molecular wires provides a mediator - free sensor if desired . the electrocatalytic nature of carbon nanotubes provides improved electrochemistry — higher current at low potential , higher reversibility as shown by reduced peak separation , for a redox mediator such as potassium ferricyanide using cnt . combining all the advantages of cnt for the mediator ( e . g ., ferricyanide ), the enzyme with the above - mentioned advantages of fadgdh provides an excellent biosensor with the advantages described herein . carbon nanotubes ( cnts ) have unique electronic and topological properties . one aspect of the invention provides improved electrochemical performance of cnt modified electrodes for various analytes such as h 2 o 2 , potassium ferricyanide , nadh and as wells as others such as pqq , osmium complex etc . monitoring these compounds is very important for biosensor applications such as glucose monitoring . this is because these compounds are used as mediators , co - factors or analytes and are the targets of detection for glucose monitoring . the analytical utility of the improved electrochemical performance includes : lower applied potentials and higher signal lower interferences better electrode surface morphology — cnts are nanometer in size as compared to micron sized carbon particles used in screen printed electrodes . this along with the electrocatalytic activity of cnts generating higher signals enables obtaining a more reproducible biosensor . better accuracy in the low ranges of glucose concentration more consistent electrochemical responses enabled by better surface morphology and electrocatalytic activity decreased hematocrit and oxygen dependence direct electron transfer between the enzyme and electrode aspects of the invention provide enhancement in the electrochemical performance that can be achieved by using cnts , which can be increased further by using another electro - catalyst such as ( but not limited to ) metals or metal oxides . alternative electrocatalyst may include metals / metal derivatives such as pt , pd , au , fe 2 o 3 , and the like which will be apparent to ones skilled in the art . such electro - catalysts can be deposited on a cnt - modified electrode by techniques such as sputter coating , electrochemical methods , e . g . by reducing the corresponding metal salts or simply by suspending the compound in a solvent and casting it on the electrode to achieve deposition of particles of various dimensions . alternatively cnts can be deposited on the electro - catalyst modified electrode . see for example , u . s . application ser . no . 10 / 945 , 803 filed sep . 20 , 2004 entitled “ multiple nanoparticles electrodeposited on nanostructures ” ( published 2005 - 0157445 ), which is incorporated by reference . the advantages of using the additional electro - catalyst in a cnt - based sensor include : synergistic effect between cnt and the other electro - catalyst resulting in performance better than the individual components commercial availability a low cost of a metal / metal oxide / other electrocatalyst based electrode and further enhancement can be realized by combining it with cnt with manufacturing simplicity . savings in materials cost . the morphology of the electrode can be modified by appropriate placement of cnts on the electrode , realizing other advantages such as faster response , easy diffusion of the analytes , better stability , reduced leaching for continuous monitoring etc . if other techniques are used for determining the effect of interferences such as ascorbic acid , hematrocrits , etc . combined with the electrochemical glucose measurement , improvement can be realized in those measurements too , the result being better accuracy . advantages are realized with various mediator - enzyme systems depending on the interaction of cnts and the electrocatalyst with the system . the systems may be ( but not limited to ) those using glucose dehydrogenase - pqq and nad dependent , glucose oxidase and mediators such as ferricyanide , osmium based mediators and others . a glucose sensor using cnt with an osmium - based mediator and pyrroloquinoline quinone ( pqq ) and glucose dehydrogenase enzyme ( gdh ) aspects of the invention provide a biosensor including an osmium polymer based mediator e . g . osmium poly ( pyridyl ) derivative and the enzyme pyrroloquinoline quinone ( pqq )- glucose dehydrogenase ( gdh ). see additional description in u . s . pat . no . 7 , 052 , 591 entitled “ electrodeposition of redox polymers and co - electrodeposition of enzymes by coordinative crosslinking ”; and us patent publication 2006 - 0169599 entitled “ small volume in vitro analyte sensor ,” each of which are incorporated by reference . this unique system combines highly desirable attributes of cnts , pqq - gdh and osmium complex with the following advantages : direct electron transfer between the enzyme and cnt combined with the highly efficient osmium based mediator . very high sensitivity , high signal to noise ratio , lower applied potentials and higher signal , lower interferences , better electrode surface morphology , better accuracy in the low ranges , more consistent electrochemical responses , decreased hematocrit and oxygen dependence , faster response , reduced calibration code requirements etc . the redox behavior of pqq is improved by cnt the electron transfer ability of the osmium based mediator may be improved by the use of cnts . cnts functionalized with different chemistries and suspended in different solvents influence the interaction of cnt with osmium based mediator and pqq - gdh , the optimum combination depends on the particular electrode design , types of ink , method of measurement such as amperometric or coloumetric etc . and may be optimized for manufacturing . the cnts may be mixed with the mediator and enzyme or deposited sequentially for manufacturing simplicity — cnt followed by the mediator followed by the enzyme or any combination thereof or the cnts may be covalently attached to the enzyme using chemistry such as the carbodiimide chemistry . aspects of the invention provide a method of preparation of a stable suspension of functionalized carbon nanotubes ( cnt ) in water aided by sonication , with addition of the enzyme glucose oxidase to the suspension and deposition of the suspension on a substrate , such as a polymer substrate with screen - printed ag / agcl electrodes , so as to form an electrochemical sensor for monitoring of d - glucose in whole blood . other alternatives include using an electron transfer mediator such as pt nanoparticles , ferrocence etc . deposited along with the working electrode followed by enzyme immobilization . this leads to a multi step process and can contribute to the problem with precision of the electrodes . due to the use of hydrophilic cnt functionalization , aqueous dispersion of cnt is convenient . this enables the incorporation of enzyme in the suspension . this one step process avoids solvents or binders which are not compatible with enzymes . the new method described reduces cost and improve precision of measurement . advantages of the inventive enzyme immobilization method include single step deposition of carbon nanotubes ( electrode material ) and the enzyme ( or other functional biomolecule ) on the sensor surface . the enzyme retains its activity and stability after immobilization on the electrode . in certain embodiments , depositing the biomolecule and carbon nanotubes together in a single step involves pabs - cnt chemistry used for the functionalization of cnts . this method leads to a decrease in the number of steps for the sensor fabrication which improves reproducibility and improves precision in the manufacture of glucose strips on a commercial scale . other advantages include improved stability of the cnt suspension ( due to the biomolecule - nanotube interaction ), reduced mass transport limitation for the oxidation of enzymatically generated hydrogen peroxide , better chance of direct electron transfer between the cnt electrode and the enzyme ( due to the positioning of cnts within the tunneling distance of the cofactors ). this can make the sensor more sensitive , selective and faster responding . various combinations / variables and more general applications that are covered under this application : types of carbon nanotubes : processed single walled nanotubes ( swnt ) containing carbonaceous and catalyst related impurities such as the metal / metal oxide and other materials remaining from manufacturing , carboxylic acid functionalized swnt , poly ( m - aminobenzene sulfonic acid ) or pabs functionalized swnt and pristine as well as carboxylic acid functionalized multi - walled carbon nanotubes ( mwnt ) can be used along with the enzyme . functionalization chemistries may be used to facilitate solubilization of the cnts in water . these include carboxylic acid , pabs , and other hydrophilic chemistries . in other embodiments , pristine ( no functionalization ) swnts and mwnts are used . using pristine nanotubes in embodiments wherein attachment of the biomolecule alone is sufficient to solubilize the nanotubes simplifies the manufacturing process . for example , proteins such as streptavidin , different antibodies or antibody fragments , peptides , glycans , carbohydrates , aptamers , nucleic acids — example single stranded deoxyribonucleic acid ( dna ) may be sonicated with pristine nanotubes to prepare the suspension . in other embodiments , a solubilization chemistry is necessary to achieve desired suspension . process of preparing the suspension : in certain embodiments , the methods involve sonication of the ( cnt + enzyme ) together . in other embodiments , the methods involve sonication of cnt first , and the enzyme added later ( for example , if prolonged sonication causes the enzyme to denature ) with or without further sonication to disperse the biomolecule . in other embodiments , the cnt is suspended in a suitable buffer , for example , if the enzyme will denature in water . in certain embodiments , one or more other forms of mixing , stirring , vortexing etc . may be used in addition to or instead of sonication . immobilization method for the mixture — using biodot &# 39 ; s biojet plus instrument ( moving head type ): using the biojet ( spray ) along with shadow mask to cover appropriate areas ; using the biodot option ( drop casting ). other methods include screen printing , piezoelectric methods and dip coating . types of biomolecules : as indicated above , the functionalized biomolecule is attached to the cnts to interact with the analyte . in addition to enzymes ( with or without mediators ) that interact with glucose ( e . g ., glucose oxidase ), this method is applicable to various enzymes such as horseradish peroxidase and other oxido - reductase enzymes for incorporation in sensing devices . other functional biomolecules that may be immobilized using the methods described herein include antibodies and nucleic acids . specific examples include proteins such as streptavidin , different antibodies or antibody fragments , peptides , aptamers , dna and rna different feature sizes ( width , pitch and thickness ) of the electrodes which determine the microstructure of the conducting paths can be fabricated using the method described here . various substrates for deposition — polyethylene terephthalate , polyimide , alumina ceramic , polycarbonate etc . in certain embodiments , there may be a silver contact layer underneath the cnt layer . according to various embodiments , the methods may be used to make sensors as described above , e . g ., with a 2 or 3 electrode configuration ( a separate counter electrode or not ). in depositing the cnt - biomolecule , the cnts may be randomly sprayed or aligned . during sonication , the biomolecules attach to the cnts , thereby solubilizing them and allowing them to form a stable solution that may be deposited on the electrode surface . without solubilization , the hydrophobic cnts are not suspended within the solution and will settle down at the bottom of the vial or other container . by attaching the biomolecules the cnts disperse throughout the solution , ready for deposition on the electrode surface . depending on the particular biomolecule , attachment may involve non - covalent interaction , covalent bonding , hydrophobic interaction , and it stacking . for example , dna attaches to the nanotubes via n bonding . proteins such as bovine serum albumin ( bsa ), streptavidin , glucose oxidase , etc . attach via non - covalent electrostatic / hydrophobic interaction with the nanotubes . in this manner , the cnts are solubilized and bio - functionalized for interaction with the analyte in a single step . the resulting suspension is stable , i . e ., the cnts do not fall out of the suspension . suspensions of enzyme - cnt conjugates have been demonstrated to be stable for at least up to a week . the cnt - biomolecule conjugates remain intact during the deposition onto the electrode , providing bio - functionalized cnts on the electrode . in certain embodiments , a separation operation ( e . g ., centrifugation , decantation , dialysis , filtration , gel chromatography ) is performed between the sonication and deposition operations , to separate unattached and loosely attached biomolecules and cnts from the stable suspension . in other embodiments , no separation operation is required or performed between these operations , further simplifying the method . relatively low concentrations of cnts facilitate the suspension being deposition - ready after sonication ; in certain embodiments , the concentration of cnts in solution is between about 0 . 01 mg / ml - 1 mg / ml , or 0 . 1 - 1 mg / ml , e . g ., 0 . 1 mg / ml . application of disposable sensors for self monitoring of glucose is important due to the frequent use of strips required and the growing number of diabetics . the greater control of surface morphology afforded by the use of nanotubes combined with the one step process of enzyme immobilization could significantly improve the precision of the electrodes manufactured on a commercial scale . the one step process could also lead to an easier fabrication process and save manufacturing costs . improved sensitivity , a faster response , and selectivity against interferences such as due to ascorbic acid , uric acid could lead to greatly improved and consistent performance at a lower cost . reduced oxygen and hematocrit bias for glucose sensors using carbon nanotubes variation in response due to the change in the levels of hematocrit and oxygen is an important consideration for biosensors used to monitor substances in whole blood such as sensors for glucose monitoring . this is not well understood in the prior art , see us patent application 2004 - 0079 , 653 entitled “ biosensor having improved hematocrit and oxygen biases ”, which is incorporated by reference . hematocrit bias can be caused by a variety of factors , system specific , such as : volume exclusion — higher level of hematocrit , artificially lower sensor response decreased diffusion of the analyte increased solution resistance a reaction going to completion utilizing all the analyte in the sample , decreases hematocrit sensitivity slow reaction rate of the mediator may be responsible for significant hematocrit sensitivity . oxygen bias ( capillary , venous , arterial blood sample ) is caused for the following reasons : for enzymes such as glucose oxidase — oxygen is a co - substrate for enzymes such as glucose dehydrogenase ( gdh ), which are not oxygen dependent , this bias can be caused by the slow mediator reaction . the slow reaction increases the susceptibility of the intermediates to oxygen quenching . it depends on the type of enzyme and mediator . aspects of the invention include embodiments in which catalytic activity and greatly improved electrochemical behavior of carbon nanotubes provides advantages for important compounds including hydrogen peroxide and redox mediators such as potassium ferricyanide . the faster electron transfer and redox behavior of these molecules with cnt provides a method of improved hematocrit and oxygen bias reduction using cnt for sensors , such as using nicotinamide adenine dinucleotide ( nad ′), pyrroloquinoline quinone ( pqq ), as the cofactors / coenzymes or having an active site such as fad and various mediators such as osmium complex , 1 , 10 - phenanthroline quinone ( pq ), potassium ferricyanide or others . in addition the porous structure of cnt film and its interaction with the enzyme may improve the diffusion of the analyte to the enzyme and the electrical communication between the enzyme cofactor and the electrode further reducing the hematocrit and oxygen bias . the following provides details illustrating aspects of the present invention . these experimental examples are provided to exemplify and more clearly illustrate these aspects of the invention and are in no way intended to be limiting . another advantage to the cnt sensors described above over conventional ( non - cnt ) sensors is reduced sensor - to - sensor variation . the below table contains data showing reduced variation ( as indicated by lower coefficient of variation (% cv )) with cnts deposited on screen printed electrodes . method of analysis was based on capacitance measurement in pbs by alternating current ( ac ) techniques . cnt sensors , n = 20 formulation formulation formulation control , n = 20 a b c average ( f ) 9 . 29e − 09 4 . 20e − 06 5 . 18e − 06 4 . 26e − 06 sd 2 . 83e − 10 8 . 03e − 08 6 . 42e − 08 5 . 80e − 08 cv % 3 . 05 % 1 . 91 % 1 . 24 % 1 . 36 % the control sensor was sensor without cnts . as can be seen , the variation across the 20 sensors is less than 2 % for each of the cnt sensors , as compared to over 3 % for the control . fig1 shows cyclic voltammmetry data with 10 mm potassium ferricyanide for strips having cnt - functionalized conductive carbon layer and strips having a conductive carbon layer without cnts . ( supporting electrolyte - 50 mm ph 7 . 4 phosphate buffer + 0 . 1 m kcl , scan rate 100 mv / sec , 10 mm potassium ferricyanide . experimental set up — cyclic voltammetry ( cv ) with standard three electrode electrochemical cell , working electrode — screen printed electrode with and without cnt functionalization , ag / agcl reference electrode , pt wire counter electrode .) no electrochemical signal is recorded for control strips without cnts . ( 1301 shows ferricyanide at cnt - spe ( carbon nanotube - screen printed electrode ); 1303 shows cnt - spe alone ; and 1305 shows ferricyanide ( no cnts ). fig1 shows that highly enhanced electrochemical performance is obtained with cnt functionalized conductive carbon layer . fig1 a shows glucose detection in blood spiked with various concentrations of glucose using glucose oxidase enzyme and potassium ferricyanide mediator with a cnts modified electrode . potential 300 mv vs . ag / agcl . fig1 b shows glucose detection in pbs spiked with various concentrations of glucose using glucose oxidase enzyme and potassium ferricyanide mediator . potential 300 mv vs . ag / agcl . enhanced electrochemistry does not increase background as seen by low signal for interfering species ( ascorbic acid , acetaminophen ) compared to glucose . no signal obtained without cnts on these electrodes . fig1 a and 15b show that antibodies used to suspend pristine cnts retain their functionality . 3 μl of 0 . 33 mg / ml pristine cnts + 1 . 5 mg / ml anti - horseradish peroxidase ( hrp ) antibody suspended in water by sonication for 60 min dropcast on a screen printed carbon electrode . screen printed agcl electrode was the reference electrode . the electrodes were treated with starting block solution from pierce for 1 hr at room temperature to prevent non specific adsorption of the reporter hrp . for background data the bare carbon electrodes were used after blocking by a similar procedure . the reporter solution was 167 ng / ml anti human chorionic gonadotropin ahcg - hrp ( dilution from stock in starting block ). fig1 a shows the electrochemical signal for the background and ahrp antibody - functionalized cnts . the electrochemical signal was obtained by adding 2 ml tmbb ( 10 % dimethyl sulfoxide in phosphate citrate buffer + 417 nm 3 , 3 , 5 - tetramethyl - benzidine + 10 mm nacl ) and 20 . 0 ul 250 mm hydrogen peroxide . applied potential was 150 mv . 3 ul of 0 . 1 mg / ml pristine cnts + 0 . 1 mg / ml anti - streptavidin ( sav ) antibody suspended in water by sonication for 60 min dropcast on a screen printed carbon electrode . screen printed agcl electrode was the reference electrode . the electrodes were treated with starting block solution from pierce for 1 hr at room temperature to prevent non specific adsorption of the reporter sav - hrp . for background data the bare carbon electrodes were used after blocking by a similar procedure . the reporter solution was 500 ng / ml sav - hrp . the electrochemical signal was obtained by adding 2 ml tmbb ( 10 % dimethyl sulfoxide in phosphate citrate buffer + 417 nm 3 , 3 , 5 - tetramethyl - benzidine + 10 mm nacl ) and 20 . 0 ul , 250 mm hydrogen peroxide . applied potential was 150 mv . results are shown in fig1 b .	8
hereinafter , exemplary embodiments of the present invention will now be described in detail with reference to attached drawings . fig3 is a functional block diagram schematically showing an exemplary embodiment of a recording medium copying apparatus 100 according to the present invention . as shown in fig3 , the copying apparatus 100 according to is the present invention includes a file reading unit 110 for forwardly and / or reversely reading and managing data of a file recorded on a original recording medium desired to be copied , a file comparing and identifying unit 112 for comparing files read from the original recording medium and identifying files whether they are identical to each other or not , an address processing unit 114 for collecting addresses of the files with regard to the original recording medium and generating and assigning addresses for recording the files on a duplicate recording medium and a file recording unit for recording the files at the addresses assigned by the address processing unit 114 on the duplicate recording medium . when an original recording medium of a structure as shown in fig2 b is put inside the copying apparatus 100 , the file reading unit 110 reads data on the original recording medium in a direction ( hereinafter referred to as a “ forward direction ”) which is from a position ( hereinafter referred to as a “ head of recording medium ”) whose address has the smallest value to a position ( hereinafter referred to as an “ end of recording medium ”) whose address has the largest value and retrieves files recorded on the recording medium . these files retrieved in the forward direction as above will be referred to herein as “ forward direction files ”. the files read by the file reading unit 110 in the forward direction are stored and managed in a memory ( not shown ) in a retrieved order together with their addresses . to store and manage in a memory in a retrieved order can be realized by a manner of , e . g . assigning the lowest number to the identification number of a file first retrieved from the original recording medium while assigning the highest number to the identification number of a last retrieved file . therefore , to store in order does not always mean to store files retrieved later at areas whose physical or logical addresses of a memory are high . in addition , the file reading unit 110 reads data on the original recording medium in a direction ( hereinafter referred to as a “ reverse direction ”) opposite to the forward direction , i . e . from the end of recording medium to the head of recording medium and retrieves files on it . the files ( hereinafter referred to as “ reverse direction files ”) retrieved in the reverse direction are stored in the memory in an order opposite to the retrieved order together with their addresses . to store and manage in a memory in a reverse order can be realized by a manner of , e . g . assigning the lowest number to the identification number of a file last retrieved from the original recording medium while assigning the highest number to the identification number of a first retrieved file . therefore , to store in order does not always mean to store files retrieved later at areas whose physical or logical addresses of a memory are low . further , as shown in fig3 , the forwardly or reversely reading operation of files and the storing and managing operation of retrieved files may be performed by a forward direction file reading unit 1102 and a reverse direction file reading unit 1104 in parallel respectively . the storage and management of retrieved files will be described in detail later referring to fig4 and 5 . next , the file comparing and identifying unit 112 compares the forward and reverse direction files that correspond to each other and judges whether the compared files are identical to each other or not . in addition , as the result of the judgment , the file comparing and identifying unit 112 discriminates files judged to be identical from files judged not . next , the address processing unit 114 collects and stores the addresses of the files read by the file reading unit 110 from the original recording medium . in addition , when the address processing unit 114 records the files onto the duplicate recording medium , it assigns addresses at which the files are recorded on the duplicate recording medium in order that the duplicate recording medium can have the same address structure as that of the original recording medium . in this case , the address processing unit 114 assigns addresses of the duplicate recording medium in order that the forward and reverse direction files judged by the file comparing and identifying unit 112 not to be identical to each other can have the same address respectively , and thus it makes the address structures of the duplicate recording medium and the original recording medium the same as shown in fig2 b . next , the file recording unit 116 records the forward and reverse direction files on the duplicate recording medium at the addresses assigned by the address processing unit 114 . in other words , the file recording unit 116 records either the forward or reverse direction file judged to be identical to each other on the duplicate recording medium . meanwhile , the file recording unit 116 records the forward direction file judged not to be identical on the duplicate recording medium in advance and then successively records the corresponding reverse direction file judged not to be identical . recording of files is performed in order that the duplicate recoding medium can surely have the same structure as that of the original recording medium . the physical positions of the duplicate and original recording medium where a certain file is recorded do not need to be identical to each other . although the addresses of the duplicate and original recording medium assigned to a certain file are preferably the same value , they are not be limited to this case and it should be noted that it might be enough for overall address structures to be identical to each other . next , the operation of the copying apparatus of the present invention will be described in detail referring to fig4 and 5 . fig4 is a flowchart showing an exemplary embodiment of the operation of the copying apparatus according to the present invention . when the operations begin with an instruction of a user upon inserting the original recording medium ( step s 400 ), the original recording medium is read in the forward and / or reverse direction so that files can be retrieved ( steps s 402 and s 408 ). the operations of reading files in the forward and / or reverse direction may also be performed sequentially or in parallel as described above . then , the files retrieved in the forward direction are stored in a memory ( not shown ) in a retrieved order . if the firstly retrieved forward direction file is represented by “ f . file . 1 ”, the secondly retrieved forward direction file is represented by “ f . file . 2 ” and the n - thly retrieved forward direction file is represented by “ f . file . n ”, these are stored in the memory in order to be identified in the retrieved order . in this embodiment , to identify them in the retrieved order , an example using a manner of assigning identification numbers consecutively increasing is shown ( step s 4042 ). “ 1 ), 2 ) . . . n )” shown in the step s 4042 means the retrieved order . in addition , as shown in fig4 , the addresses ( i . e . a 1 , a 2 . . . an ) on the original recording medium are preferably stored together with the files . on the other hand , the reverse direction files retrieved in the reverse direction are stored in a memory ( not shown ) in an order opposite to the retrieved order . if the firstly retrieved reverse direction file is represented by “ r . file . 1 ”, the secondly retrieved reverse direction file is represented by “ r . file . 2 ” and the n - thly retrieved reverse direction file is represented by “ r . file . n ”, these are stored in the memory in order to be identified in the order opposite to the retrieved order . to identify them in the order opposite to the retrieved order , a manner of assigning identification numbers consecutively decreasing as described above may be used . in this embodiment , to identify them in the order opposite to the retrieved order , an example using a manner of assigning identification numbers consecutively decreasing is shown ( step s 4042 ). “ 1 ), 2 ) . . . n )” shown in the step s 4042 means the retrieved order . in addition , as shown in fig4 , the addresses ( i . e . an , a ( n − 1 ) . . . a 1 ) on the original recording medium are preferably stored together with the files . then , reading files from the original recording medium is completed upon reaching the head or end of the original recording medium ( step s 406 or s 412 ), and the retrieved files are copied to the duplicate recording medium in order to maintain the same address structure as that of the original recording medium . to perform copying , whether the retrieved forward and reverse direction files are identical or not is judged comparing these files each other ( step s 414 ). here , to help understanding , it is assumed that b 12 files are recorded on the original recording medium altogether and three of them are recorded on the overlap zone in fig5 . fig5 shows a file structure of the original recording medium and a result of judging whether the corresponding forward and reverse direction files retrieved from the medium are identical to each other or not . according to the example shown in fig5 , 12 files are recorded on the original recording medium in total , and when reading them in the forward direction nine forward direction files , i . e . f . file . 1 to f . file . 9 are retrieved , while in the reverse direction nine reverse direction files , i . e . r . file . 1 to r . file . 9 are retrieved . amongst them , it was assumed that three files , i . e . r . file . 5 to r . file . 7 are recorded in the overlap zone where the addresses overlap , and three files , i . e . f . file . 5 to f . file . 7 are also recoded in the zone b . as shown in fig5 , if the forward and reverse direction files whose identification numbers or whose addresses on the original recording medium are identical to each other are compared ( step s 414 ), it is verified that there are six pairs of forward and reverse direction files that are identical to each other , i . e . four pairs that are f . file . 1 to f . file . 4 and r . file . 1 to r . file . 4 and two pairs that are f . file . 8 and f . file . 9 and r . file . 8 and r . file . 9 . in addition , it is verified that f . file . 5 to f . file . 7 amongst the forward direction files and r . file . 5 to r . file . 7 amongst the reverse direction files don &# 39 ; t have any identical counterparts ( step s 416 ). accordingly , after completing identification of files the identified files are recorded on the duplicate recording medium in order to have the same address structure as that of the original recording medium ( step s 418 ). in other words , the forward direction files are first recorded ( step s 418 ). at this time , the address structure of the duplicate recording medium is also formed to copy the address structure of the original recording medium . then , the reverse direction files not having any identical counterparts ( r . file . 5 to r . file . 7 in this embodiment ) are recorded on the duplicate recording medium . at this time , it is particularly noted that the address structure of the reverse direction files not having any identical counterparts should be formed to be the same as that of the original recording medium ( step s 420 ). fig6 shows a file structure of the original recording medium according to another exemplary embodiment of the present invention and a result of judging whether the corresponding forward and reverse direction files retrieved from the medium are identical to each other . as shown in fig6 , b 1 files are recorded on the original recording medium in total , and when reading them in the forward direction , nine forward direction files , i . e ., f . file . 1 to f . file . 9 , are retrieved , while in the reverse direction eight reverse direction files , i . e ., r . file . 1 to r . file . 8 , are retrieved . amongst them , it is assumed that two files , i . e ., r . file . 5 and r . file . 6 , are recorded in the overlap zone where the addresses overlap , and three files , i . e ., f . file . 5 to f . file . 7 , are also recorded in the zone b . although it was assumed that the number of the forward direction files and the number of the reverse direction files are not the same in this embodiment , whether the identical counterparts exist can also be verified by referring to the addresses of files retrieved and comparing the addresses to each other . accordingly , all the description in relation to fig5 can be applied to this embodiment similarly . fig7 a shows a file structure of the original recording medium according to another embodiment of the present invention , and fig7 b shows a result of judging whether the corresponding forward and reverse direction files retrieved is from the medium are identical to each other or not . as shown in fig7 a , 22 files are recorded on the original recording medium in total , and when reading them in the forward direction 18 forward direction files , i . e . f . file . 1 to f . file . 18 are retrieved , while in the reverse direction 16 reverse direction files , i . e . r . file . 1 to r . file . 16 are retrieved . as shown in fig7 a , two overlap zones are formed in this present embodiment and four files , i . e . r . file . 5 , r . file . 6 , r . file . 13 and r . file . 14 are recorded in the overlap zones respectively . in addition , two of the zones b corresponding to these overlap zones are also formed , and it is assumed that 6 files , i . e . f . file . 5 to f . file . 7 and f . file . 14 to f . file . 16 are recorded there . although it was also assumed that the number of the forward direction files and the number of the reverse direction files are not the same in this embodiment , whether the identical counterparts exist or not can also be verified by referring the addresses of files retrieved and comparing the addresses each other . accordingly , all the description in relation to fig5 can be applied to this embodiment similarly . further , although the information recorded on the original recording medium is retrieved , managed , and processed in the unit of files , any proper units ( e . g . blocks ), though they are in the form of files , may also be retrieved , managed , and processed depending upon embodiments . accordingly , as used herein , the term “ file ” should be interpreted and understood to means a “ unit per which a process is performed ” in the description above and in the claims below . the copying method according to the present invention can be realized a computer program for copying a recording medium including modules programmed for performing the functions of the units 110 to 116 included in the copying apparatus 100 of the present invention as described above , i . e . a file reading module ( not shown ), a file comparing and identifying module ( not shown ), an address processing module ( not shown ) and a file recording module ( not shown ). this computer program for copying a recording medium according to the present invention realizes technical ideas of the present invention by interacting with the hardware and / or software of a computer system for executing the program . programming the above modules included the computer program for copying a recording medium of the present invention will not be described in detail because it is already widely known in the art of the present invention as well as being an optional matter in design for carrying out the present invention . according to present invention , it is possible to provide a lawful user with a copying apparatus , a method and a computer program thereof capable of copying a recording medium including an overlap zone where addresses overlap . those skilled in the art will readily observe that numerous modifications and alterations of the device and method may be made while retaining the teachings of the invention . accordingly , the above disclosure should be construed as limited only by the metes and bounds of the appended claims .	7
fig1 schematically illustrates a gas turbine engine 20 . the gas turbine engine 20 is disclosed herein as a two - spool turbofan that generally incorporates a fan section 22 , a compressor section 24 , a combustor section 26 and a turbine section 28 . alternative engines might include an augmentor section ( not shown ) among other systems or features . the fan section 22 drives air along a bypass flow path b in a bypass duct defined within a nacelle , while the compressor section 24 drives air along a core flow path c for compression and communication into the combustor section 26 then expansion through the turbine section 28 . although depicted as a two - spool turbofan gas turbine engine in the disclosed non - limiting embodiment , it should be understood that the concepts described herein are not limited to use with two - spool turbofans as the teachings may be applied to other types of turbine engines including three - spool architectures . the exemplary engine 20 generally includes a low speed spool 30 and a high speed spool 32 mounted for rotation about an engine central longitudinal axis a relative to an engine static structure 36 via several bearing systems 38 . it should be understood that various bearing systems 38 at various locations may alternatively or additionally be provided , and the location of bearing systems 38 may be varied as appropriate to the application . the low speed spool 30 generally includes an inner shaft 40 that interconnects a fan 42 , a first ( or low ) pressure compressor 44 and a first ( or low ) pressure turbine 46 . the inner shaft 40 is connected to the fan 42 through a speed change mechanism , which in exemplary gas turbine engine 20 is illustrated as a geared architecture 48 to drive the fan 42 at a lower speed than the low speed spool 30 . the high speed spool 32 includes an outer shaft 50 that interconnects a second ( or high ) pressure compressor 52 and a second ( or high ) pressure turbine 54 . a combustor 56 is arranged in exemplary gas turbine 20 between the high pressure compressor 52 and the high pressure turbine 54 . a mid - turbine frame 58 of the engine static structure 36 is arranged generally between the high pressure turbine 54 and the low pressure turbine 46 . the mid - turbine frame 58 further supports bearing systems 38 in the turbine section 28 . the inner shaft 40 and the outer shaft 50 are concentric and rotate via bearing systems 38 about the engine central longitudinal axis a which is collinear with their longitudinal axes . the core airflow is compressed by the low pressure compressor 44 then the high pressure compressor 52 , mixed and burned with fuel in the combustor 56 , then expanded over the high pressure turbine 54 and low pressure turbine 46 . the mid - turbine frame 58 includes airfoils 60 which are in the core airflow path c . the turbines 46 , 54 rotationally drive the respective low speed spool 30 and high speed spool 32 in response to the expansion . it will be appreciated that each of the positions of the fan section 22 , compressor section 24 , combustor section 26 , turbine section 28 , and fan drive gear system 48 may be varied . for example , gear system 48 may be located aft of combustor section 26 or even aft of turbine section 28 , and fan section 22 may be positioned forward or aft of the location of gear system 48 . the engine 20 in one example is a high - bypass geared aircraft engine . in a further example , the engine 20 bypass ratio is greater than about six ( 6 ), with an example embodiment being greater than about ten ( 10 ), the geared architecture 48 is an epicyclic gear train , such as a planetary gear system or other gear system , with a gear reduction ratio of greater than about 2 . 3 and the low pressure turbine 46 has a pressure ratio that is greater than about five . in one disclosed embodiment , the engine 20 bypass ratio is greater than about ten ( 10 : 1 ), the fan diameter is significantly larger than that of the low pressure compressor 44 , and the low pressure turbine 46 has a pressure ratio that is greater than about five 5 : 1 . low pressure turbine 46 pressure ratio is pressure measured prior to inlet of low pressure turbine 46 as related to the pressure at the outlet of the low pressure turbine 46 prior to an exhaust nozzle . the geared architecture 48 may be an epicycle gear train , such as a planetary gear system or other gear system , with a gear reduction ratio of greater than about 2 . 3 : 1 . it should be understood , however , that the above parameters are only exemplary of one embodiment of a geared architecture engine and that the present invention is applicable to other gas turbine engines including direct drive turbofans . a significant amount of thrust is provided by the bypass flow b due to the high bypass ratio . the fan section 22 of the engine 20 is designed for a particular flight condition — typically cruise at about 0 . 8 mach and about 35 , 000 feet ( 10 . 67 km ). the flight condition of 0 . 8 mach and 35 , 000 ft ( 10 . 67 km ), with the engine at its best fuel consumption — also known as “ bucket cruise thrust specific fuel consumption (‘ tsfc ’)”— is the industry standard parameter of lbm of fuel being burned divided by lbf of thrust the engine produces at that minimum point . “ low fan pressure ratio ” is the pressure ratio across the fan blade alone , without a fan exit guide vane (“ fegv ”) system . the low fan pressure ratio as disclosed herein according to one non - limiting embodiment is less than about 1 . 45 . “ low corrected fan tip speed ” is the actual fan tip speed in ft / sec divided by an industry standard temperature correction of [( tram ° r )/( 518 . 7 ° r )] 0 . 5 . the “ low corrected fan tip speed ” as disclosed herein according to one non - limiting embodiment is less than about 1150 ft / second ( 350 m / second ). the example gas turbine engine includes the fan 42 that comprises in one non - limiting embodiment less than about twenty - six ( 26 ) fan blades . in another non - limiting embodiment , the fan section 22 includes less than about twenty ( 20 ) fan blades . moreover , in one disclosed embodiment the low pressure turbine 46 includes no more than about six ( 6 ) turbine rotors schematically indicated at 34 . in another non - limiting example embodiment the low pressure turbine 46 includes about three ( 3 ) turbine rotors . a ratio between the number of fan blades 42 and the number of low pressure turbine rotors is between about 3 . 3 and about 8 . 6 . the example low pressure turbine 46 provides the driving power to rotate the fan section 22 and therefore the relationship between the number of turbine rotors 34 in the low pressure turbine 46 and the number of blades 42 in the fan section 22 disclose an example gas turbine engine 20 with increased power transfer efficiency . the example gas turbine engine 20 includes the geared architecture 48 that drives the fan section 22 . the geared architecture 48 is driven by the turbine section 28 through a shaft 40 . a coupling shaft 62 is disposed between the shaft 40 and the geared architecture 48 . the coupling shaft 62 includes features that can accommodate movement and misalignment of the shaft 40 relative to the geared architecture 48 . the ability to accommodate this misalignment enables the geared architecture 48 to function and increases the efficiency of the geared architecture by reducing the amount of wear that may occur due to misalignment . an interface between the coupling shaft 62 that transfers power into the geared architecture 48 and the turbine shaft 40 is provided after the low pressure compressor 44 and prior to the geared architecture 48 . the coupling shaft 62 is connected to the geared architecture 48 . the coupling shaft 62 is supported by a bearing assembly 64 . the bearing assembly 64 is mounted outboard of the interface of the shaft 62 and the turbine shaft 40 . it should be appreciated that assembly of the coupling shaft 62 to the shaft 40 is provided as a disclosed example , and that the method and structures disclosed are contemplated for use with any interface where two shafts or other structures are assembled together . referring to fig2 with continued reference to fig1 , the shaft 40 is coupled to the coupling shaft 62 through a splined interface 88 . in this example , the shaft 40 includes splined portion 86 ( fig5 ) disposed about an outer surface of a portion of the shaft 40 . the coupling shaft 62 includes an inner cavity 68 that includes a plurality of interior splines 70 ( fig3 and 5 ) that mate with the splined portion 86 on the shaft 40 . assembly of the shafts is provided as a tight press fit sometimes referred to as a snap fit . the press fit between the shaft 40 and the coupling shaft 62 is accomplished by heating the coupling shaft 62 to expand the cavity 68 that enables insertion of the splined portion 86 of the shaft 40 . the assembly sequence for assembling the gas turbine engine requires that a bearing assembly 64 is first assembled to an outer surface of the coupling shaft 62 . in this example , the bearing assembly 64 includes an inner race 72 that is supported on an outer surface of the coupling shaft 62 . the bearing assembly 64 further includes an outer race 74 and a bearing 76 disposed between the inner and outer races 72 , 74 . the bearing 76 may include bearings disposed within a cage . the outer race 74 is in turn supported by a housing 66 . the housing 66 supports the bearing assembly 64 that in turn supports rotation of the coupling shaft 62 . heating of this complex stack of parts complicates the assembly process . heating the coupling shaft 62 causes a thermal expansion . because the inner bearing race 72 and the outer bearing race 74 are not uniformly heated , they do not expand in a uniform manner and can induce stresses on and between the inner race 72 and the outer race 74 . the non - uniform heating can induce undesired stresses on the bearing assembly . accordingly , the example method provides steps for expanding the coupling shaft 62 to receive a portion of the turbine shaft 40 without damaging or otherwise imparting undue stresses and strains on the example bearing assembly 64 . the temperature range is defined to provide a desired temperature differential that is does not damage the bearing assembly 64 . referring to fig3 with continued reference to fig1 , the example method begins by inserting inductive coils 78 into the cavity 68 of the coupling shaft 62 . a second set of inductive coils 80 are disposed about an outer surface of the housing 66 at an axial location that corresponds to the position of the bearing assembly 64 on the coupling shaft 62 . a power source 82 powers the inductive coils 78 , 80 . it should be understood that inductive coils 78 , 80 are shown by way of example , and other heating devices and structures could be utilized and are within the contemplation of this disclosure . the disclosed example assembly method includes the initial step of assembling the bearing assembly 64 to the outer surface of the coupling shafts 62 . the interior inductive coil 78 is then inserted into the cavity 68 of the coupling shaft 62 . in this example , the inner cavity 68 includes the splines 70 that mate with the corresponding splined portion 86 of the shaft 40 . an outer or second inductive coil 80 is placed against the housing 66 at an axial location proximate to the bearing assembly 64 . application of heat with both the inner and outer inductive coils 78 , 80 provides a uniform thermal expansion of the coupling shaft 62 and the bearing assembly 64 . the second inductive coil 80 heats the housing 66 and also the outer bearing race 74 such that the coupling shaft 62 , the inner bearing race 72 and the outer bearing race 74 are all expanded uniformly . the shaft 62 may be of a different material than the material utilized for the bearing races 72 , 74 and therefore include different thermal properties . accordingly , the specific energy and heat induced by the second conductive coil 80 may be different than the heat induced by the first inductive coil 78 . in this example , heat imparted into the coupling shaft 62 and the inner and outer bearing races 72 and 74 is matched to provide a uniform amount of the thermal expansion that does not incur undue stresses on any of the components . the amount of thermal expansion is dependent on the thermal properties of each of the components and therefore the heat induced by the first coil 78 may be different than the heat induced by the second coil 80 . moreover , the second coil 80 may impart an increased amount of heat to expand the outer race 74 in a manner that will relieve stresses and not impart undue strain on the bearings 76 that is disposed between the inner and outer races 72 , 74 . a sensor 84 is disposed proximate to the coupling shaft 62 and bearing assembly 64 . the sensor 84 can be utilized to detect a range of expansion to determine if the coupling shaft 62 is expanded sufficiently to receive the shaft 40 or the sensor 84 may be utilized to determine when a specific temperature has been obtained by each of the components . as appreciated , a specific temperature can be correlated with a desired expansion rate and thereby determining a temperature of a specific component can provide information indicative of the amount of expansion that has occurred . once the coupling shaft 62 is expanded to a desired diameter determined to provide for acceptance of the splined portion 86 , the inductive coils 78 and 80 are removed and the spline portion 86 of the shaft 40 is inserted into the cavity 68 . it should be understood that although a splined interface is disclosed , other interfaces as are known within the art are within the contemplation of this disclosure . once the shaft 40 is inserted into the coupling shaft 62 , the shafts 40 , 62 and bearing assembly 64 are cooled such that coupling shaft constricts around the shaft 40 to form a snap or tight press fit . the tight press fit is desirable as it provides for a secure inner connection between the torque transferring shafts . accordingly , the example method of assembling mating shaft components enables assembly of two shaft components in complex tolerance stack up conditions . although an example embodiment has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this disclosure . for that reason , the following claims should be studied to determine the scope and content of this disclosure .	5
in carrying out the process of the present invention , a chocolate material employed may be dark , milk or white chocolate . fat containing confectionery materials may include sugar , milk derived components , and fat and solids from vegetable or cocoa sources in differing proportions having a moisture content less than 10 %, more usually less than 5 % by weight . they may be chocolate substitutes containing direct cocoa butter replacements , stearines , coconut oil , palm oil , butter or any mixture thereof ; nut pastes such as peanut butter and fat ; praline ; confectioner &# 39 ; s coatings used for covering cakes usually comprising chocolate analogues with cocoa butter replaced by a cheaper non - tempering fat ; or caramac sold by nestle comprising non - cocoa butter fats , sugar and milk . the temperature of the screw may be controlled , for instance , by a fluid such as water at the appropriate temperature flowing through the interior of the screw . for example , the fluid may enter at the upstream end and flow to the downstream end through one or more longitudinal channels and return through one or more longitudinal channels to the upstream end where it exits . the temperature of the barrel wall may be controlled , for instance , by a fluid such as water or glycol or a mixture thereof at the appropriate temperature flowing through a jacket surrounding the barrel wall . the temperatures of the screw and the barrel wall may be controlled according to the type of fats present in the material being extruded . for example , fats having higher melting points usually require a warmer barrel wall and screw than fats having lower melting points . the degree of flexibility of the extruded product may be affected by the temperature and the melting point of the fats present in the material being extruded . with regard to the screw temperature , if the temperature is too low , the chocolate will adhere to the screw and will not advance along the screw , whereas if the temperature is too high , the chocolate melts causing blockages . depending on the type of fats present in the material being extruded , the temperature of the screw may be from 10 ° to 35 ° c ., and more usually from 15 ° to 30 ° c . with regard to the barrel wail temperature , if the temperature of the barrel wall is too high , the chocolate may melt and slip against the wall and may not extrude efficiently . depending on the type of fats present in the material being extruded , the temperature of the barrel wall may be from - 50 ° to + 20 ° c ., more usually from - 25 ° to + 15 ° c . often , the temperature of the barrel wall may conveniently be lower than the incoming chocolate or fat - containing confectionery material but , in some circumstances , the temperature of the barrel wall may be higher than the incoming chocolate or fat - containing confectionery material . the slippage of the fat - containing confectionery material against the barrel wall may also be reduced by roughening the barrel wall , e . g . by rifling such as forming longitudinal or spiral grooves in the wall . the spiral grooves preferably run in the opposite direction to the pitch of the screw and preferably have a longer pitch than that of the screw . conveniently , the temperature of the screw is greater than the temperature of the barrel wall , for instance , by from 5 ° to 50 ° c ., preferably from 10 ° to 40 ° c . and more preferably from 12 ° to 30 ° c . in one advantageous embodiment the diameter of the screw root increases from the upstream to the downstream end while the pitch remains constant . in another advantageous embodiment the pitch of the screw decreases from the upstream to the downstream end while the diameter of the screw root remains constant . the compression ratio of the screw may be from 1 : 1 to 5 : 1 and preferably from 1 . 5 : 1 to 3 : 1 . compression ratios above 5 : 1 may cause blockages of the material being extruded . the ratio of length to diameter of the screw may be , for instance , from 5 : 1 to 30 : 1 and preferably from 10 : 1 to 25 : 1 . the diameter of the screw may be , for example from 20 to 500 mm . the screw speed may be , for example , from 1 to 500 rpm . the actual screw diameter and screw speed may be selected by the person skilled in the art according to the requirements . the throughput depends on the screw speed and may be , for instance , from 1 to 5000 kg / hr according to requirements . as also described in the afore - noted european &# 39 ; 467 application , the sectional geometry of the die may be of a square or profiled form . typically , it might be a conical entry with an inlet cone angle of from 10 ° to 90 °. the flow rate of the chocolate through the extruder die will depend amongst other things on extrusion pressure , temperature , die configuration and material formulation . extrusion rates may vary from 0 . 1 cm / second to in excess of 1 meter / second , for instance . a wide variety of die shapes may be used and the extruded fat - containing confectionery material may have a solid , profiled or hollow section and essentially has the same shape as the die , e . g . rods , spirals , twists , springs , hollow sections such as tubes and more complex shapes such as the letters of the alphabet as well as thin films having a thickness which may be as little as 100 microns . the dimensions of the die depend on the desired size of the extruded product . if desired , two or more fat - based confectionery materials may be extruded in accordance with the process of the present invention . in addition , the chocolate or fat - containing confectionery material may be co - extruded with other food materials such as ice cream , sorbet , yoghurt , mousse , fondant , praline , marshmallow , nougat or jelly , etc ., such being advantageous when the fat - containing confectionery material is extruded in a hollow or tubular form . hence , in such embodiments , a multi - orifice die and / or associated equipment , as are known to those skilled in the art , may be employed . if desired , a twin screw extruder may be used and may be either one using counter - rotating screws or one using co - rotating screws . the temperature of the chocolate or fat - containing confectionery material as it is extruded may conveniently be from 15 ° to 28 ° c ., more usually from 18 to 25 ° c ., e . g . from 20 ° to 23 ° c . the present invention is further described by way of example only with reference to the accompanying drawing . the accompanying drawing figure schematically illustrates a continuous extrusion system for practice of the present invention . referring to the accompanying drawing figure , the extruder generally designated 10 comprises a barrel 11 provided with a cooling jacket 12 having an inlet for cooling fluid 13 and an outlet for cooling fluid 14 , an inlet for the feed material to be extruded 15 , a die 16 having a circular cross - section and a diameter of 6 . 5 mm , and a screw 17 whose root diameter increases from the upstream end to the downstream end and which is provided with threads 18 whose pitch is constant from the upstream end to the downstream end . the screw 17 is provided with a channel 19 for heating fluid which extends from the upstream end to the downstream end and has an inlet 20 connected with a concentric channel 21 which leads to an outlet for the heating fluid 22 . the operation of the above described single screw extruder is described in the following examples . milk chocolate buttons having a temperature of 22 ° c . are fed into the barrel 11 of the extruder 10 through the feed inlet 15 . the screw 17 has a diameter of 32 mm , a length to diameter ratio of 24 : 1 , a 2 : 1 compression ratio and a screw speed of 65 rpm . a 50 : 50 mixture of water and glycol at - 5 ° c . flows through the cooling jacket 12 of the barrel and water at 20 ° c . flows through the channels 19 and 21 of the screw . as the screw rotates , the solid chocolate advances at a rate of 15 kg / hr and is extruded through the die 16 with a configuration conforming to that of the die and has a temporary flexibility which lasts for about 1 hour . milk chocolate buttons having a temperature of 22 ° c . are fed into the barrel 11 of the extruder 10 through the feed inlet 15 . the screw 17 has a diameter of 50 mm , a length to diameter ratio of 20 : 1 , a 2 : 1 compression ratio and a screw speed of 70 rpm . a 50 : 50 mixture of water and glycol at - 10 ° c . flows through the cooling jacket 12 of the barrel and water at 25 ° c . flows through the channels 19 and 21 of the screw . as the screw rotates , the solid chocolate advances at a rate of 50 kg / hr and is extruded at 21 ° c . through the die 16 with a configuration conforming to that of the die and has a temporary flexibility which lasts for about 1 hour . milk chocolate buttons having a temperature of 22 ° c . are fed into the barrel 11 of the extruder 10 through the feed inlet 15 . the screw 17 has a diameter of 90 mm , a length to diameter ratio of 15 : 1 , a 2 : 1 compression ratio and a screw speed of 35 rpm . water at 5 ° c . flows through the cooling jacket 12 of the barrel and water at 20 ° c . flows through the channels 19 and 21 of the screw . as the screw rotates , the solid chocolate advances at a rate of 280 kg / hr and is extruded through the die 16 with a configuration conforming to that of the die and has a temporary flexibility which lasts for about 1 hour .	0
fig1 and 2 show a panel 1 obtained by different successive steps done during implementation of a panel manufacturing process according to a first preferred embodiment of this invention . in this embodiment , the shape of the panel obtained is approximately plane and for example is globally square or rectangular with a thickness e of the honeycomb body between 10 and 100 mm , and length l and width l each between 0 . 5 and 3 metres or possibly more . for example , note that one particular application of the panel in the aeronautical field is for an aircraft fuselage and wing panel . naturally , as mentioned above , it could be a single or double curvature panel without going outside the scope of the invention . the core of the panel 1 , called a “ sandwich ” panel is formed from a honeycomb body 2 , which may have an arbitrary shape . in the embodiment shown , all sections of the body 2 parallel to the axes of the cells 4 of the honeycomb are trapezoidal in shape with small and large bases of the trapezium arranged approximately perpendicular to the axes of the cells 4 . furthermore , the vertices formed by the edges of the body 2 are radial so as to give a progressive transition of fibre layers between the different faces of this body , given that these layers are intended to be placed in close contact with the honeycomb , as will be described later . for example , the radius adopted in this layout to prevent the presence of sharp edges and consequently to facilitate the progressive transition of fibre layers , is at least 20 mm . the panel 1 also comprises a first or upper skin 6 made from composite material matching the small upper base of the trapezium and its two lateral sides , while a second or lower skin 8 made from a composite material matches the shape of the lower base of the trapezium . the peripheries of the two skins 6 , 8 are preferably in contact , thus forming a monolithic peripheral overlap zone 10 . for guidance , even if it was not shown , the panel could include several honeycomb bodies distributed over the surface of the panel , without going outside the scope of the invention . the process for manufacturing such a panel begins with making a stacked structure that will subsequently be passed through a baking step . fig3 a shows that the stacked structure will include the honeycomb body 2 , in its final form and with its final dimensions . a first operation consists of surrounding this body 2 by a film 12 pre - impregnated with a first resin with a polymerisation temperature t 1 , this film very preferably being adhesive . the envelope made is preferably such that the film 12 surrounds the entire outer surface of the body 2 with which it is preferably in contact , any section of the film 12 parallel to the axes of the cells 4 of the honeycomb therefore also being trapezoidal in shape , with the small and large bases of the trapezium being approximately perpendicular to the axes of the cells 4 . nevertheless , although this configuration of the film 12 causes the formation of a completely closed space within which the body 2 is located , as an alternative it would be possible to have another embodiment in which the space formed by the film would remain opened , for example at the two opposite lateral faces of the body 2 . it is more generally arranged so that the film has upper and lower parts matching the upper and lower faces respectively of the body 2 , with the upper and lower parts of the film being connected to each other on each side of this body . the film 12 may be made from one or several strips , possibly partially overlapping each other . the first resin is preferably chosen from among dual cure resins polymerising at temperature t 1 , with no risk of degradation until a temperature t 2 corresponding to a polymerisation temperature of a second resin used in the stacked structure , as will be described below . the polymerisation temperature t 1 of this resin , preferably an epoxy type resin is preferably approximately 120 ° c . for guidance , it could be the resin reference “ hysol ® ea 9695 , epoxy film adhesive ” marketed by the henkel company . in a similar manner to what has been described above , the body 2 surrounded by the film 12 is once again surrounded by an adhesive film 14 polymerising at temperature t 2 . thus , it also preferably forms a closed space in which the body 2 surrounded by the film 12 is housed , in contact with the adhesive film 14 . for example , it could be a film reference fm300m ® marketed by the cytec company . with reference to fig3 b , the stacked structure 16 is completed by a first stack 18 of fibre layers 18 a pre - impregnated with a second resin with a polymerisation temperature t 2 greater than t 1 , the temperature t 2 preferably being of the order of 180 ° c . therefore the layers or laminates 18 a , preferably made from thermosetting composite materials , for example with an epoxy matrix and continuous , single - directional and / or two - directional carbon fibres , are arranged above each other along a stacking direction 21 of the structure 16 . the number of these layers each forming a stacking layer is determined as a function of the final required thickness for the upper skin of the panel . as can be seen in fig3 b , this stack 18 or upper stack covers the upper face and side faces of the honeycomb body 2 , before being extended by a peripheral edge 20 extending laterally beyond and all around this body 2 . thus , the stack 18 is in contact with part of the adhesive film 14 . similarly , the stacked structure 16 is completed by a second stack 22 of fibre layers 22 a pre - impregnated with the second resin , these layers preferably being identical to the layers in the first stack 18 and the number of layers being determined as a function of the required final thickness for the lower skin of the panel . as can be seen in 3 b , this stack 22 or lower stack covers the lower face of the honeycomb body 2 , before being extended by a peripheral edge 24 extending laterally beyond and all around this body 2 . thus , the stack 18 is in contact with the other part of the adhesive film 14 . the peripheral edges 20 , 24 are also in contact over an overlap zone 25 that preferably extends around the entire periphery of stacks 18 , 22 , in other words continuously around the honeycomb body 2 . therefore , the stacked structure 16 is made so as to obtain the second stack 22 of layers 22 a , the adhesive film 14 , the pre - impregnated film 12 , the honeycomb body 2 , the pre - impregnated film 12 , the adhesive film 14 and the first stack 18 of layers 18 a , in sequence along the stacking direction 21 . this structure 16 may be made directly on a special tooling by successively stacking its component elements as shown in fig4 . this tooling includes firstly a support 26 for the structure 16 . a plurality of orifices 28 pass through this steel support 26 , perpendicular to the plane in which these orifices are located . the through orifices 28 are connected to vacuum creation means 29 through a conventional fluid communication network ( not shown ) in any form known to those skilled in the art . once the stacked structure 16 in fig3 b has been put into place on the support 26 in fig4 , a separator film 30 is put into place above the stack , this film for example being of the deformable fluoroplastic type resistant to high temperature . a retaining foil 32 is then put into place bearing on the overlap zone 25 , this preferably thin metallic foil therefore being in close contact with the superposed edges 20 , 24 parallel to the bearing surface of the support 26 . therefore the foil 32 made from a single part or made using several adjacent parts continuously follows the peripherals in contact with the first and second stacks 18 , 22 . the function of this foil is to intensify the pressure in the monolithic overlap zone 25 during the subsequent pressure step , which holds the layers 18 a , 22 a in position relative to each other and therefore prevents their movement and movement of the honeycomb body 2 . the next step is to place a draining fabric 34 above the separator film and the foil 32 , this fabric being for example of the polyester or glass fibre type . the process continues by the formation of a sealed chamber 40 using the steel support 26 on which a sealed bladder 42 is installed covering all the above - mentioned elements as can be seen in fig4 . to achieve this , the bladder 42 is put in close contact with the support 26 , all around the stacked structure 16 and elements covering it , for example using one or several pressure screws not shown screwed into the support . in this case , it is arranged such that the screw head crushes a seal 44 placed in contact on this same support 26 . thus , the steel support 26 and the sealing bladder 42 of the tooling jointly form a sealed chamber 40 within which the stacked structure 16 is located , and on which the baking step aimed at globally consolidating this structure 16 can then be done so as to obtain the panel 1 already described . the bladder 42 is covered by a thermal insulation blanket 45 to make the temperature inside the chamber 40 uniform . thus , due to the presence of this blanket 45 , the temperature inside the chamber 40 at any time t during the baking step varies by not more than 15 to 20 ° c ., consequently assuring uniform polymerisation of the resins . this baking step , called a single baking step , is done by placing the assembly shown in fig1 in an autoclave so as to apply the required temperatures and pressures . fig5 shows the resulting baking cycle . the first step is to perform a preheating step designed to increase the baking temperature to t 1 , namely to around 120 ° c ., at a rate of the order of 0 . 8 ° c . per minute . at the same time , a vacuum of about − 0 . 2 bars is applied using the means 29 within the chamber 40 , this vacuum preferably being maintained throughout the baking step . furthermore , a first baking step is fixed at a lower value of between 1 and 1 . 5 bars . the first baking phase can begin at time t 1 at which all these baking parameters are reached , and will be maintained for about 30 minutes until time t 2 . the first phase is intended to polymerise the first resin starting from film 12 to create a rigid barrier and provide a seal for the second resin . the first resin polymerises because the baking temperature applied by the autoclave is approximately equal to its polymerisation temperature . consequently , the film 12 progressively transforms into a rigid sealing barrier during the first baking phase , taking the form of the stiffening shell 50 surrounding the honeycomb body 2 and becoming fixed to it due to its adhesive nature . this shell 50 , in contact with and sealed to the body 2 , has exactly the same geometry as the initial geometry of the film 12 surrounding this same body , as can be seen partially in fig6 a . the temperature during this first phase is not sufficiently high to polymerise the second resin which then maintains a high viscosity so that it can be held in place on its corresponding layers , preventing it from migrating to the honeycomb body . the same applies for the resin used for adhesive film 14 . then , before performing the second baking phase , the stacked structure that is already partially polymerised is kept in the autoclave in which the temperature and pressure are increased . the pressure is effectively fixed at a high value greater than or equal to 3 bars , while the temperature is higher than t 2 , in other words its value is about 180 ° c ., maintaining the rate of temperature rise equal to the order of 0 . 8 ° c . per minute , starting from 120 ° c . the second baking phase can begin at time t 3 at which all these new baking parameters are reached , and will be maintained for about 2 hours until time t 4 . the second phase is intended to make the outer skins of the panel starting from stacks 18 , 22 , by polymerisation of the second resin . the second resin polymerises due to the fact that the baking temperature applied by the autoclave is approximately equal to its polymerisation temperature , while the intrinsic properties of the sealing barrier 50 at this temperature are such that it does not degrade . consequently , the second resin that reaches its minimum viscosity at which polymerisation can occur , is prevented from migrating towards the cells in the honeycomb body due to the presence of this barrier 50 that retains it . thus , the skins of the panel are obtained with no risk of the resin penetrating into the honeycomb , resulting in higher mechanical strength . furthermore , due to the polymerisation of the adhesive film 14 at this temperature t 2 , the outer skins 6 , 8 are bonded to the body 2 at the end of the second baking phase as can be partially seen in fig6 b . once the baking step is complete , the panel 1 obtained is extracted from the sealed chamber 40 , and the drain fabric 34 , the foil 32 and the separator film 30 are then removed in turn . note in this respect that it would be possible to place a pull - off fabric in the structure 16 between the first stack 18 and the separator film 30 , to facilitate elimination of excess resin accumulated around the edge of the foil 32 on the panel during the second high pressure baking phase . obviously , those skilled in the art could make various modifications to the invention that has just been described through non - limitative examples only .	8
fig1 is an exploded perspective view of a valve assembly 10 . fig2 is a cross - sectional view of valve assembly 10 installed in a conventional mounting boot 12 which is , in turn , installed in a conventional raft bladder 14 . the valve assembly 10 comprises a valve body 20 having a central longitudinal axis aa and having an axially extending bore 22 with a central bore axis extending coaxially of axis aa . the bore has a first end opening 24 positioned exteriorly of the raft bladder 14 and a second end opening 26 positioned interiorly of the raft bladder . bore 22 may be defined , in part , by a first annular sidewall portion 30 having a cylindrical shape , and a second annular sidewall portion 32 having a cylindrical shape and having a larger , e . g . 10 % larger , diameter than portion 30 . the first annular sidewall portions 30 , 32 are connected by a generally radially extending upper lip portion 31 . the bore is further defined by a third downwardly and inwardly tapering annular sidewall portion 33 . a fourth generally cylindrical annular sidewall portion 34 is connected to the third annular sidewall portion 33 . the bore is further defined by a fifth generally cylindrical annular sidewall portion 35 which terminates at a generally radially extending intermediate lip surface 36 and lower lip surface 37 . surface 37 is connected to a sixth generally cylindrical annular sidewall portion 38 . annular sidewall 38 terminates at a bottom lip surface 39 . the valve body may comprise an upper exterior threaded portion 42 , an intermediate radially extending flange portion 44 having a plurality of axially extending screw holes 46 therein , and first and second generally cylindrical lower body portions 48 , 49 which are adapted to conform with the interior configuration of an associated mounting boot 12 . portion 49 may have a plurality of openings 50 extending radially therethrough which facilitates insertion of a biasing spring 90 described below . the valve body 20 is adapted to be secured to an associated mounting boot 12 as by screws 54 received through screw holes 46 therein and corresponding screw holes provided in the mounting boot 12 . the valve assembly comprises a plunger member 60 having a plunger shaft portion 64 terminating in a first end 62 which may have a plurality of peripheral prongs 65 formed therein . the plunger shaft has a second end 66 attached to a plunger base portion 68 . the plunger base portion may comprise a generally upwardly and inwardly tapering annular surface 70 , a generally axially extending cylindrical surface 72 , and a generally radially extending surface 74 which is adapted to urged against valve body radially extending lip surface 37 to prevent discharge of air through the valve assembly . the base portion further comprises a cylindrical surface 76 , and a recessed cylindrical surface 78 which is adapted to receive an upper portion 91 of a biasing spring 90 thereon . the biasing spring 90 may be a conventional coil spring having a truncated cone shape . the biasing spring 90 has an upper portion adapted to receive plunger portion 78 therein and a lower portion 93 which is adapted to be engaged by valve bottom lip 39 . a gasket ring 100 may be mounted on the plunger member surface portion 74 to facilitate sealing engagement between the plunger member and the valve body lip surface 37 . a gasket receiving recess 75 may be provided on the plunger assembly to facilitate mounting of the gasket ring 100 . a conventional threaded cap 110 having an upper gasket 112 may be provided which is threadingly engageable with the valve body upper threaded portion 42 . the biasing spring 90 has a sufficient axial length such that the plunger member 60 is normally positioned as illustrated in solid lines in fig2 in engaged , sealing relationship with the valve body 20 . the first end 64 of the plunger member shaft may be axially downwardly deflected and radially outwardly deflected as through finger pressure so as to position the shaft end 64 beneath valve body upper lip portion 31 . the first end 64 abuttingly engages the lip portion 31 after release of finger pressure , causing the plunger base portion 68 to remain in relatively opened relationship with respect to the valve body , as illustrated in phantom in fig2 . in order to again place the valve in a sealed operating state , it is necessary to again exert downward finger pressure on the plunger shaft first end 64 and to move it towards a radially centered position . thereafter , release of finger pressure enables the biasing spring to urge the plunger member into the sealed relationship with the valve body illustrated in solid lines in fig2 . while an illustrative and presently preferred embodiment of the invention has been described in detail herein , it is to be understood that the inventive concepts may be otherwise variously embodied and employed and that the appended claims are intended to be construed to include such variations except insofar as limited by the prior art .	8
the above and other advantages of the present invention will become more apparent by describing in detail embodiments thereof with reference to the attached drawings in which . the present invention is not restricted by the following embodiments . it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims . fig1 illustrates a perspective view of a fabric treating apparatus in accordance with an exemplary embodiment of the present invention . fig2 illustrates a partial enlarged perspective view of fig1 a fabric treating apparatus 100 according to an exemplary embodiment of the present invention includes a outside cabinet 111 , which forms the exterior of the fabrics treating apparatus , and a inside cabinet 112 , which is disposed in the outside cabinet 111 . a treating chamber 110 is disposed in the inside cabinet 112 . the treating chamber 110 has an opening at the side , and thus , a fabric can be loaded in the treating chamber 110 through the opening . a door 115 is disposed so as to be able to open or close the opening . if the door 115 is closed , the treating chamber 110 is isolated from the exterior . if the door 115 is opened , the treating chamber 110 is exposed to the exterior . a control panel 116 is disposed at the door 115 . the control panel 116 allows a user to input an operation order and displays an operation condition of the fabrics treating apparatus . the control panel 116 includes a control unit 190 and an alarm unit 177 . the control unit 190 and the alarm unit 177 will be said later . the user may select and set a treating course by using the control unit 116 . the treating chamber 110 is a space for treating a fabric to be changed the physical or chemical properties of the fabrics by supplying a steam or hot wind . namely , the treating chamber 110 is a space for treating the fabrics by using different method . for example , in the treating chamber 110 , the fabrics can be dryed by using a hot wind , or the wrinkles of the fabrics can be removed by using a steam , or the fabrics can be supplied aroma by spraying an aromatic , or the generation of static electricity of the fabrics can be prevented by spraying an antistatic . a heating unit 120 is diposed the bottom of the treating chamber 110 . more specifically , the heating unit 120 is disposed between the outside cabinet 111 and the inside cabinet 112 . the heating unit 120 is able to heat the air inhaled from the treating chamber 110 , and to supply the hot wind to the inside of the treating chamber 110 . also , the heating unit is able to generate a steam by heating the water , and to supply the steam to the inside of the treating chamber 110 . of course , the heating unit 120 is able to supply both the hot wind and the steam . also , the heating unit 120 is able to supply any one between the hot wind and the steam . the heating unit 120 is variously embodied by those of ordinary skill in the scope of the present invention the heating unit 120 in accordance with an exemplary embodiment of the present invention includes an air inlet 121 for inhaling the air from the inside of the treating chamber 110 , and a heater for heating the air inhaled , and an outlet 122 for discharging the hot wind heated by the heater to the inside of the treating chamber 110 , and an injection nozzle 123 for injecting steam to the inside of the treating chamber 110 . the hot wind or the steam generated by the heating unit 120 supplies to the fabricss loaded in the treating chamber 110 , and has an influence on the physical property or the chemical property of the fabricss . namely , the hot wind or the steam makes the structure of the fabricss to be relaxed , so that the wrinkles of the fabrics can be removed . the steam reacts to the smell particles of the fabricss , so that an unpleasant smell can be removed . also , the hot wind or the steam generated by the heating unit 120 has a sterilization effect on bacteria of the fabricss . a motor 130 generates rotatory power for driving a hanger rack 150 . a power transmission unit 140 transmits the rotatory power generated by the motor to a power transformation unit 160 . the motor 130 is controlled by the electric current . a sensor 175 for sensing a number of rotations is disposed on the motor 130 . the motor 130 is disposed the upper part of the treating chamber 110 . the motor 130 is disposed between the inside cabinet 112 and the outside cabinet 111 . the motor 130 is built into a motor frame 113 fixed between the inside cabinet 112 and the outside cabinet 113 . the motor frame 113 fixes the motor 130 and absorbs the vibrations generated by the driving of the motor 130 . a control unit 190 and a power supply 171 are described at the following section are disposed on the motor frame 113 . the power transmission unit 140 transmits the rotatory power generated by the motor to the power transformation unit 160 . the power transmission unit 140 transmits a rotary motion of the one unit to another unit . the power transmission unit 140 is variously embodied by those of ordinary skill in the scope of the present invention the power transmission unit 140 includes a driving pulley 141 rotating by the motor 130 , and a driven pulley 142 rotated by a belt 143 which connects the driving pulley 140 and the driven pulley 142 , and a rotary shaft 144 inserted into the driven pulley 142 and rotated by the driven pulley 142 . the power transmission unit 140 may includes a driving sprocket , a driven sprocket , and a chain , instead of said driving pulley 141 , said driven pulley 142 and said belt 143 . and besides , the power transmission unit 140 may includes a driving gear , a driven gear , a belt , and so on . thus , the power transmission unit 140 is variously embodied . the power transformation unit 160 transforms a rotary motion received from the power transmission unit 140 into a reciprocating motion of the hanger rack 150 . the power transformation unit 160 may use a cam which transforms a rotary motion into a reciprocatin motion . the hanger rack 150 is disposed in the treating chamber 110 . a hanger 200 hangs over the hanger rack 150 . a fabric , such as clothes , hangs over the hanger 200 . the hanger rack 150 reciprocates from left to right . a supporter 180 is connected to the treating chamber 110 . a supporter 180 supports the hanger rack 150 . one side of the supporter 180 is connected to the motor frame 113 . the other side of the supporter 180 is connected to the hanger rack 150 . the supporter 180 is made with elastic material to support a reciprocating motion of the hanger rack 150 . fig3 illusrtates a block diagram of a fabric treating apparatus in accordance with an exemplary embodiment of the present invention . the fabric treating apparatus according to an exemplary embodiment of the present invention includes a control unit 190 , a power supply 171 , a sensor 175 , a alarm unit 177 . the control unit 190 controls the motor 130 according to the electric current flowing the motor 130 and rotates the motor 130 by a target number of rotations . the control unit 190 is disposed on a control panel 116 or the motor frame 113 . the control unit 190 includes a microcomputer 191 including a memory 195 which outputs a control command according to a setting data set by a user and a measurement data and so on , and a motor drive 193 which supplies a power regulated according to the control command outputted from the microcomputer 191 . the microcomputer 191 outputs a control command decided according to a command inputted by a user and the number of reotations sensed by the sensor 175 and an electric current sensed by the motor drive 193 to the motor drive 193 the microcomputer 191 controls the motor 130 to be rotated by the target number of rotations set by the selected course by a user . and then , the microcomputer 191 regulates the target number of rotations according to the sensed electric current . also , the microcomputer 191 outputs a control command according to a number of rotations of motor 130 . refer to fig4 for further details . the motor drive 193 regulates an electric power according to the control command outputted from the microcomputer 191 , so that it may controls the motor 130 . the motor drive 193 regulates a pulse width modulation ( pwm ) inputted from the power supply 171 , so that it may regulates a number of rotations of motor 130 . thus , the motor drive 193 controls the pulse width modulation duty ( pwm duty ), so that it may regulates a number of rotations of motor 130 . the motor drive 193 transmits an electric current of the motor 130 to the microcomputer 191 , wherein the electric current of the motor 130 reflects a load of the motor 130 . the microcomputer 191 may outputs a control command according to the load of the motor . the sensor 175 measures a number of rotations of the motor 130 . the sensor 175 may a hall sensor or an optical encoder . the sensor 175 transmits the measured number of rotations to the microcomputer 191 . the alarm unit 177 warns overload of the motor 130 to the outside . the alarm unit 177 is able to warn to the outside by using a visual method or an auditory method . the alarm unit 177 is disposed on the display panel 116 . refer to fig4 for further details about the alarm unit 177 . fig4 illusrtates a flow chart of a method for controlling a fabric treating apparatus in accordance with an exemplary embodiment of the present invention . if the user selects a course by using the control panel 116 , the control unit 190 controls the motor 130 to be rotated by the target number of rotations set by the selected course . ( s 211 ) the user selects a course according to a quantity of the fabric or the dirty condition of the fabric . the course is divided into a strong , medium , weak , and night mode . as the course is changed from the strong mode to the night mode , the target number of rotations is controlled to be decreased . the control unit 190 controls the motor 130 to be rotated by the target number of rotations set by the selected course . the control unit 190 senses an electric current of motor . ( s 212 ) the more load is applied to the motor , the higher electric current is applied . the control unit 190 compares the sensed electric current of the motor 130 with a maximum permissible limit of an electric current . ( s 213 ) if the sensed current of the motor is higher than a maximum permissible limit , the control unit 190 controls the motor 130 to be stopped . ( s 214 ) the maximum permissible limit is an electric current when the motor 130 is overloaded . if the motor is overloaded , the control unit 190 controls a power supply to stop an electric power supply to the motor 130 . the control unit 190 checks if the electric current of the motor 130 exceeds a maximum permissible limit less than 3 times . ( s 215 ) if the excess number is less than 3 times , the control unit 190 controls the motor to be rotated in reverse direction . ( s 216 ) the motor 130 may be overloaded , if one among the power transmission unit 140 , the power transformation unit 160 and the hanger rack 150 is in a temporary trouble . therefore , the control unit 190 controls the motor to be rotated in reverse direction , and then to be rotated by the target number of rotations . ( s 211 ) if the excess number of times is more than three times , the control unit 190 informs the outside of the warning message . ( s 217 ) if the fabrics are so many in the treating chamber 110 , or if one of among the motor 130 , the power transmission unit 140 , the power transformation unit 160 has a trouble , the excess number is more than 3 times . then , the control unit 190 controls the alarm unit 177 to warn the trouble by using a visual method or an auditory method . if an electric current of the motor 130 is lower than the maximum permissible limit , the control unit 190 compares the electric current of the motor 130 with a standard value . ( s 218 ) and then , the control unit 190 regulates the target number of rotations of the motor 130 . ( s 219 ) the standard value is an electric current of the motor 130 when the motor 130 rotates by the target number of rotations in the normal conditions . in other words , the standard value is an electric current of the motor 130 when the motor 130 has a reasonable load in this case that the fabrics is hanged on the hanger rack 150 in modulation . if the sensed current of the motor 130 is higher than the standard value , the control unit 190 controls the target number of rotations to be decreased . if the sensed current of the motor 130 is lower than the standard value , the control unit 190 controls the target number of rotations to be increased . the sensed current of the motor 130 reflects the load of the motor 130 . therefore , if the load of the motor 130 is high , the target number of rotations is regulated to be decreased so that an overload of the motor 130 can be prevented . if the load of the motor 130 is low , the target number of rotations is regulated to be increased so that the load of the motor can be high . the control unit 190 regulates the target number of rotations by regulating the pulse width modulation duty . the control unit 190 compares the number of rotations sensed by the sensor 175 with the target number of rotations ( s 220 ), and then regulates the pulse width modulation duty . there is a difference between the target number of rotations and the realtime number of rotations because of the external condition as a fabric load . the control unit 190 controls the pulse width modulation duty to be increased when the sensed number of rotations is lower than the target number of rotations . also the control unit 190 controls the pulse width modulation duty to be decreased when the sensed number of rotations is higher than the target number of rotations . while the present invention has been particularly shown and described with reference to exemplary embodiments thereof , it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims . according to the present invention , there are one or more effects as described by the following . the first , it is possible to prevent a trouble of a motor for moving a fabric . the second , it is possible to prevent a restraint of a motor for moving a fabric . the third , it is possible to control a motor for moving a fabric according to a load , effectively . the fourth , it is possible to drive a motor according to the demand of a user without an overload of the motor .	3
fig1 is a circuit diagram showing an embodiment of the present invention . shown by 1 and 2 are photodetectors for write and read modes , respectively . each of the photodetectors 1 and 2 comprises two spaced schottky electrodes that are disposed to face each other on a semiconductor substrate in a symmetric way . these photodetectors operate so that they become conducting only when a predetermined amount of light is incident thereon . for details of the construction of these photodetectors 1 and 2 , see &# 34 ; metal - semiconductor - metal photodetector for high - speed optoelectronic circuits &# 34 ; by t . sugeta , t . urisu , s . sakata and y . mizushima in jpn . j . of appl . phys ., 19 ( 1980 ) supplement 19 - 1 , pp . 459 - 464 . the symbol marks used for the photodetectors 1 and 2 in fig1 were originally conceived by the present inventors . one end of the photodetector 1 is connected to the positive electrode of a bias voltage source 3 having its negative electrode grounded . the other end of the photodetector 1 is connected to one end of the photodetector 2 via a signal conductor 7 . a resetting switch 4 , having one end grounded , is connected at the other end to the middle point of the signal conductor 7 . the other end of the photodetector 2 is connected both to a load resistance 5 , having one end grounded , and to an output terminal 6 . as long as an optical write signal s w is incident on the photodetector 1 , the latter remains conducting and a potential of the signal conductor 7 is raised to the level equal to the potential of the bias voltage source 3 . thereafter , in response to a decrease in the write signal s w , the photodetector 1 becomes non conducting and the voltage at that time is held in the signal conductor 7 . if , under this condition , an optical read signal s r is incident on the photodetector 2 , the latter becomes conducting and a current flows through the load resistance 5 , thereby producing a signal at the output terminal 6 . no output signal will be produced unless a potential has built up in the signal conductor 7 when read signal s r is incident on the photodetector 2 . thus , in the circuit being described , the signal conductor 7 is normally held at high impedance or floating potential to realize a 1 - bit memory circuit . the resetting switch 4 is an optional element and may be employed , for instance , to initialize the state of memory . if necessary , a switching element incorporating a bias source may be used as the resetting switch 4 and specific examples of such element are a transistor that operates on a gate electric signal and a photodetector that operates on an optical signal . these switching elements may be replaced by a cr element having a large time constant . in this latter case , memory is held within an operating range effectively defined by the time constant . as described above , a potential storing function is realized by making the time constant of the signal conductor 7 substantially long , and in order to reset it at a substantially long time constant , a transistor , etc . may be used . fig2 is a perspective view showing an optical memory circuit device in which the circuit shown in fig1 is actually integrated monolithically . in fig2 the elements which are the same as those shown in fig1 are identified by like numerals or symbols . a semiconductor substrate shown by reference numeral 11 is made of a semiconductor material such as si or gaas . there are provided on the surface of the semiconductor substrate 11 a photodetector 1 for write mode , a photodetector 2 for read mode , a resetting switch 4 , a load resistance 5 , signal conductors 7 - 9 , and a grounding conductor 10 . the grounding conductor 10 taken together with the signal conductors 7 - 9 form a strip line . an insulating thin film is provided between the semiconductor substrate 11 and each of the signal conductors 7 - 9 and the grounding conductor 10 except in the areas where the photodetectors 1 and 2 , resetting switch 4 and load resistance 5 are formed . the photodetector 1 is formed of two schottky junctions between the edges of the signal conductors 7 and 8 and the semiconductor substrate 11 . the photodetector 2 is formed of two schottky junctions between the edges of the signal conductors 7 and 9 and the semiconductor substrate 11 . in both cases , the surface of the semiconductor substrate between the two schottky junctions serves as a light - receiving surface . the resetting switch 4 is also constructed as a photodetector having a similar design to the photodetectors 1 and 2 , that is , two schottky junctions are formed between the edges of the signal conductor 7 and grounding conductor 10 and the semiconductor substrate 11 . the load resistance 5 is a n + high - density - doped region formed by doping impurities in the surface region of the semiconductor substrate 11 , and opposite ends of this resistance 5 are connected to the signal conductor 9 and the grounding conductor 10 . the signal conductor 8 is connected to an external bias voltage source 3 whereas the signal conductor 9 is connected to the output terminal 6 . the circuit system shown in fig2 will operate as follows . when an optical write signal s w is supplied to the photodetector 1 , a potential of the signal conductor 7 is raised to a level equal to the potential of the bias voltage source 3 . in response to a decrease in the incident write signal s w the potential at that time is held in the signal conductor 7 . thereafter , when an optical read signal s r is supplied to the photodetector 2 , a current flows through the load resistance 5 and a signal is produced at the output terminal 6 . when an optical reset signal s rt is incident on the photodetector 4 which is a resetting switch , the potential of the signal conductor 7 is erased to reset the overall circuit . fig3 is a circuit diagram showing another embodiment of the present invention . this embodiment differs from the first embodiment in that the photodetectors 1 and 2 arranged in a symmetric electrode layout are replaced by pn - junction photodiodes 21 and 22 which serve as photodetectors for a write and a read mode , respectively . another difference is that the bias voltage source 3 is not included in the second embodiment . the cathode of the photodetector 21 is grounded , and its anode is connected to the cathode of the photodetector 22 via a signal conductor 7 . the anode of the photodetector 22 is connected to both a load resistance 5 and an output terminal 6 . the signal conductor 7 is also connected to a resetting switch 4 . if necessary , a bias voltage source may be added to the circuit of this second embodiment . when an optical write signal s w is incident on the photodetector 21 , carriers are generated and the current due partly to holes generated in the n - type region and partly to electrons generated in the p - type region will flow to change the potential of the signal conductor 7 . the resultant potential will be held in the signal conductor 7 after termination of the optical write signal s w . thereafter , when an optical read signal s r is incident on the other photodetector 22 , the latter becomes conducting and a current flows through the load resistance 5 to produce a signal at the output terminal 6 . in the two embodiments described above , each of the photodetectors are formed either of two spaced schottky junctions that face each other on a semiconductor substrate or of a pn - junction photodiode . other designs may of course be employed to construct photodetectors , such as by forming a schottky electrode and an ohmic electrode that are spaced to face each other on a semiconductor substrate , or by arranging two ohmic electrodes in a symmetric way . in the embodiment shown in fig2 the load resistance 5 is formed by doping impurities into the semiconductor substrate . it should , however , be noted that this is not the only method of forming the load resistance 5 and that a film resistor may be employed . in the embodiment shown in fig1 and 2 , the photodetector 1 is connected to the positive electrode of the bias voltage source 3 but the device operation is in no way dependent upon the polarity of the bias voltage . as will be understood from the foregoing description , the optical memory circuit of the present invention has the advantage that it is capable of performing a memory operation on optical input signals with a simple configuration in which two photodetectors are connected in series by an intermediate signal conductor which has a time constant of potential set to an appropriately large value . in addition , the optical memory circuit of the present invention which does not use any slow active devices such as a transistor is capable of very fast memory operation . this would be a great benefit to optical wiring which is becoming popular as a means for increasing the operating speed of computers , because , with this invention , data storage processing can be accomplished with the high - speed characteristic of light being utilized to the fullest extent .	6
in earlier work , for example in u . s . patent application ser . no . 09 / 846330 filed apr . 30 , 2000 , the contents of which is herein incorporated by reference , raw sera was obtained and mixed with formic acid and extracted the peptides with c18 reversed phase ziptips . in the instantly disclosed invention , we deal with proteins generally having a molecular weight of about 20 kd or more . in general , proteins of greater than 20 kd can reliably be fragmented by trypsin or other enzymes . the instant technology incorporates sufficient sensitivity to deal with even the low production of peptides from proteins less than 20 kd clipped from gel . proteins differ from peptides in that they cannot be effectively resolved by time of flight ms and they are too large (& gt ; 3 kd ) to be effectively fragmented by collision with gases . the most commonly used solution to these problems is to resolve the proteins by polyacrylamide gel electrophoresis followed by staining with silver , or coomasie brilliant blue or rubidium dyes or counter staining with zinc - sds complexes . once the proteins have been resolved and visualized with stains the proteins that differ between disease states can then be excised from the gel and the protein purified in the 1 - d gel band or 2 - d gel spot can be cleaved into fragments less that 3 kd by proteolytic enzymes . once protein has been resolved by gel and cleaved by enzymes , the protein is considered in the form of peptides and therefore can be dealt with as per earlier work ( 09 / 846330 ). the peptide is either collected and purified with c18 reversed phase chromatography or by some other form of chromatography prior to reversed phase separation . the peptide can also be collected in ammonium carbonate buffer that is subsequently evolved by reaction with acid or by removal in organic solvents . once the peptides are collected they can be sequenced , e . g . with a maldi - qq - tof but also with a tof - tof , and esi - q - tof or an ion - trap . other types of ms analysis which may be employed are seldi ms and ms / ms . the peptides are fragments of the original protein . the peptides are sequenced by fragmentation to produced a spectrum composed of the parts of the peptide . the peptide fragments can be produced by a strong ionization energy with a laser , temperature , electron capture , collision between the peptides themselves or with other objects such as gas molecules . the spacing in terms of mass between the parts of the peptides is a fragmentation pattern . the fragmentation pattern of each peptide from the starting mass to the last remaining amino acid ( from either end ) is unique . the human genome contains the genes that encode all proteins . the proteolytic cut sites within all these proteins can be predicted from the translated amino acid sequence . the mass of the peptides that result from the predicting cut sites can be calculated . similarly , the fragmentation pattern from each hypothetical peptide can be predicted . thus , we can conceptually digest the proteins within the human proteome and fragment them . when a peptide has been “ sequenced ” it is understood that the peptide fragment has been purified by one of the methods above , i . e . time of flight ( tof ) or by chromatography , before fragmenting it with gas to produce the peptide fragments . the original peptide mass and fragmentation pattern obtained is then fit to those from the theoretical digestion and fragmentation of the genome . the peptide that best matches the theoretical peptides and fragments and is biologically possible , i . e . a potential human blood - borne protein , is thus identified . it is possible to identify plural targets in this fashion . following are exemplary , but non - limiting examples of preparatory protocols useful in the process of the instant invention . any of these protocols may be selected from a column flow - through stream , a column elution stream , or a column scrub stream . hi q is a strong anion exchanger made of methyl acrylate co - polymer with the functional group : — n + ( ch 3 ) 2 ; hi s is a strong cation exchanger made of methyl acrylate co - polymer with the functional group : — so 3 − ; deae is diethylaminoethyl which is a weak cation exchanger made of methyl acrylate co - polymer with the functional group — n + c 2 h 5 ) 2 ; ps is phenyl sepharose ; bs is bul sepharose . note that the supports , i . e . methyl acrylate and sepharose are different , but non - limiting examples , as the same functional group on different supports will function , albeit possibly with different effects . 2 ) equilibrate column in 5 bed volumes of 50 mm tricine ph 8 . 8 ( binding buffer ); 5 ) elute column in 120 μl of 0 . 4 m phosphate buffer ( pb ) ph 6 . 1 ; 6 ) elute column in 120 μl of 50 mm citrate buffer ph 4 . 2 ; 7 ) scrub column with 120 μl sequentially with each of 0 . 1 % triton , 1 . 0 % triton and 2 % sds in 62 . 5 mm tris ph 6 . 8 . 2 ) equilibrate column in 5 bed volumes of 1 . 7 m ( nh 4 ) 2 so 4 in 50 mm pb ph 7 . 0 ( binding buffer ); 3 ) disolve 35 μl of sera in 465 μl of binding buffer and apply ; 5 ) elute column in 120 μl of 0 . 4 m ( nh 4 ) 2 so 4 in 50 mm ph 7 . 0 ; 6 ) elute column in 120 μl of 50 mm pb ph 7 . 0 ; 7 ) scrub column with 120 μl sequentially with each of 0 . 1 % triton , 1 . 0 % triton and 2 % sds in 62 . 5 mm tris ph 6 . 8 . 2 ) equilibrate column in 5 bed volumes of 1 . 7 m ( nh 4 ) 2 so 4 in 50 mm pb ph 7 . 0 ( binding buffer ); 3 ) dissolve 35 μl of sera in 465 μl of binding buffer and apply ; 5 ) elute column in 120 μl of 0 . 2 n ( nh 4 ) 2 so 4 in 50 mm pb ph 7 . 0 ; 6 ) elute column in 120 μl of 50 mm pb ph 7 . 0 ; 7 ) scrub column with 120 μl sequentially with each of 0 . 1 % triton , 1 . 0 % triton and 2 % sds in 62 . 5 mm tris ph 6 . 8 . 2 ) add hiq resin to column and remove any air bubbles ; 6 ) collect all the flow - through fraction in eppendorf tubes until level is at resin ; 2 ) add his resin to column and remove any air bubbles ; 6 ) collect all flow through fractions in eppendorf tubes until level is at resin ; illustrative of the various buffering compositions useful in this technique are : sample / running buffers : including but not limited to bicine buffers of various molarities , ph &# 39 ; s , nacl content , bis - tris buffers of various molarities , ph &# 39 ; s , nacl content , diethanolamine of various molarities , ph &# 39 ; s , nacl content , diethylamine of various molarities , ph &# 39 ; s , nacl content , imidazole of various molarities , ph &# 39 ; s , nacl content , tricine of various molarities , ph &# 39 ; s , nacl content , triethanolamine of various molarities , ph &# 39 ; s , nacl content , tris of various molarities , ph &# 39 ; s , nacl content . elution buffer : acetic acid of various molarities , ph &# 39 ; s , nacl content , citric acid of various molarities , ph &# 39 ; s , nacl content , hepes of various molarities , ph &# 39 ; s , nacl content , mes of various molarities , ph &# 39 ; s , nacl content , mops of various molarities , ph &# 39 ; s , nacl content , pipes of various molarities , ph &# 39 ; s , nacl content , lactic acid of various molarities , ph &# 39 ; s , nacl content , phosphate of various molarities , ph &# 39 ; s , nacl content , tricine of various molarities , ph &# 39 ; s , nacl content . following tryptic digestion , additional processing may be carried out , for example : utilizing a type of micro - chromatographic column called a c18 - ziptip available from the millipore company , the following preparatory steps were conducted . illustrative of the various buffering compositions useful in the present invention are : sample buffers ( various low ph &# 39 ; s ): hydrochloric acid ( hcr ), formic acid , trifluoroacetic acid ( tfa ), equilibration buffers ( various low ph &# 39 ; s ): hcl , formic acid , tfa ; wash buffers ( various low ph &# 39 ; s ): hcr , formic acid , tfa ; elution solutions ( various low ph &# 39 ; s and % solvents ): hcl , formic acid , tfa ; solvents : ethanol , methanol , acetonitrile . spotting was then performed , for example upon a gold chip in the following manner : 1 . spot 2 ul of sample onto each spot 2 . let sample partially dry as a result of these procedures , the disease specific markers namely peroxisomal carnitine octanoyl transferase protein having a molecular weight of about 1208 . 6574 daltons and a sequence of ( r ) spnhivvlcr ( g ), betain / gaba transport protein having a molecular weight of about 1211 . 5591 daltons and a sequence of ( k ) qhpcldgsagr ( n ), and adrenergic , alpha - 2a , receptor having a molecular weight of about 1446 . 7831 daltons having a sequence of ( r ) taahpaqrrpwr ( a ) related to insulin resistance were found . fig1 and 3 are photographs of a gel which is indicative of the presence / absence of the marker in disease vs . control and , in cases where the marker is always present , the relative strength , e . g . the up or down regulation of the marker relative to categorization of disease state is deduced . a method for evidencing and categorizing at least one disease state is disclosed . the steps taken include obtaining a sample from a patient , preferably human , and conducting ms analysis on the sample . as a result , at least one biopolymer marker sequence or analyte thereof is isolated from the sample which undergoes evidencing and categorizing and is compared to the biopolymer marker sequence as disclosed in the present invention . the step of evidencing and categorizing is particularly directed to biopolymer markers or analytes thereof linked to at least one risk of disease development of the patient or related to the existence of a particular disease state . in addition , various kits are contemplated for use by the present invention . one such kit provides for determining the presence of the disease specific biopolymer marker . at least one biochemical material is incorporated which is capable of specifically binding with a biomolecule which includes at least the disease specific biopolymer marker or analyte thereof , and a means for determining binding between the biochemical material and the biomolecule . the biochemical material for any of the contemplated kits , by way of example an antibody or at least one monoclonal antibody specific therefore , or biomolecule may be immobilized on a solid support and include at least one labeled biochemical material which is preferably an antibody . the sample utilized for any of the kits may be a fractionated or unfractionated body fluid or a tissue sample . non - limiting examples of such fluids are blood , blood products , urine , saliva , cerebrospinal fluid , and lymph . further contemplated is a kit for diagnosing , determining risk - assessment , and identifying therapeutic avenues related to a disease state . this kit includes at least one biochemical material which is capable of specifically binding with a biomolecule which includes at least one biopolymer marker including the sequence of the particular disease specific biopolymer marker or an analyte thereof related to the disease state . also included is a means for determining binding between the biochemical material and the biomolecule , whereby at least one analysis to determine a presence of a marker , analyte thereof , or a biochemical material specific thereto , is carried out on a sample . as previously described , analysis may be carried out on a single sample or multiple samples . in accordance with various stated objectives of the invention , the skilled artisan , in possession of the specific disease specific marker as instantly disclosed , would readily carry out known techniques in order to raise purified biochemical materials , e . g . monoclonal and / or polyclonal antibodies , which are useful in the production of methods and devices useful as point - of - care rapid assay diagnostic or risk assessment devices as are known in the art . the specific disease markers which are analyzed according to the method of the invention are released into the circulation and may be present in the blood or in any blood product , for example plasma , serum , cytolyzed blood , e . g . by treatment with hypotonic buffer or detergents and dilutions and preparations thereof , and other body fluids , e . g . csf , saliva , urine , lymph , and the like . the presence of each marker is determined using antibodies specific for each of the markers and detecting specific binding of each antibody to its respective marker . any suitable direct or indirect assay method may be used to determine the level of each of the specific markers measured according to the invention . the assays may be competitive assays , sandwich assays , and the label may be selected from the group of well - known labels such as radioimmunoassay , fluorescent or chemiluminescence immunoassay , or immunopcr technology . extensive discussion of the known immunoassay techniques is not required here since these are known to those of skilled in the art . see takahashi et al . ( clin chem 1999 ; 45 ( 8 ): 1307 ) for a detailed example of an assay . a monoclonal antibody specific against the disease marker sequence isolated by the present invention may be produced , for example , by the polyethylene glycol ( peg ) mediated cell fusion method , in a manner well - known in the art . traditionally , monoclonal antibodies have been made according to fundamental principles laid down by kohler and milstein . mice are immunized with antigens , with or without , adjuvants . the splenocytes are harvested from the spleen for fusion with immortalized hybridoma partners . these are seeded into microtiter plates where they can secrete antibodies into the supernatant that is used for cell culture . to select from the hybridomas that have been plated for the ones that produce antibodies of interest , the hybridoma supernatants are usually tested for antibody binding to antigens in an elisa ( enzyme linked immunosorbent assay ) assay . the idea is that the wells that contain the hybridoma of interest will contain antibodies that will bind most avidly to the test antigen , usually the immunizing antigen . these wells are then subcloned in limiting dilution fashion to produce monoclonal hybridomas . the selection for the clones of interest is repeated using an elisa assay to test for antibody binding . therefore , the principle that has been propagated is that in the production of monoclonal antibodies the hybridomas that produce the most avidly binding antibodies are the ones that are selected from among all the hybridomas that were initially produced . that is to say , the preferred antibody is the one with highest affinity for the antigen of interest . there have been many modifications of this procedure such as using whole cells for immunization . in this method , instead of using purified antigens , entire cells are used for immunization . another modification is the use of cellular elisa for screening . in this method instead of using purified antigens as the target in the elisa , fixed cells are used . in addition to elisa tests , complement mediated cytotoxicity assays have also been used in the screening process . however , antibody - binding assays were used in conjunction with cytotoxicity tests . thus , despite many modifications , the process of producing monoclonal antibodies relies on antibody binding to the test antigen as an endpoint . polyclonal antibody production and purification utilizing one or more animal hosts in a manner well - known in the art can be performed by a skilled artisan . another objective of the present invention is to provide reagents for use in diagnostic assays for the detection of the particularly isolated disease specific marker sequences of the present invention . in one mode of this embodiment , the marker sequences of the present invention may be used as antigens in immunoassays for the detection of those individuals suffering from the disease known to be evidenced by said marker sequence . such assays may include but are not limited to : radioimmunoassay , enzyme - linked immunosorbent assay ( elisa ), “ sandwich ” assays , precipitin reactions , gel diffusion immunodiffusion assay , agglutination assay , fluorescent immunoassays , protein a or g immunoassays and immunoelectrophoresis assays . according to the present invention , monoclonal or polyclonal antibodies produced against the disease specific marker sequence of the instant invention are useful in an immunoassay on samples of blood or blood products such as serum , plasma or the like , cerebrospinal fluid or other body fluid , e . g . saliva , urine , lymph , and the like , to diagnose patients with the characteristic disease state linked to said marker sequence . the antibodies can be used in any type of immunoassay . this includes both the two - site sandwich assay and the single site immunoassay of the non - competitive type , as well as in traditional competitive binding assays . particularly preferred , for ease and simplicity of detection , and its quantitative nature , is the sandwich or double antibody assay of which a number of variations exist , all of which are contemplated by the present invention . for example , in a typical sandwich assay , unlabeled antibody is immobilized on a solid phase , e . g . microtiter plate , and the sample to be tested is added . after a certain period of incubation to allow formation of an antibody - antigen complex , a second - antibody , labeled with a reporter molecule capable of inducing a detectable signal , is added and incubation is continued to allow sufficient time for binding with the antigen at a different site , resulting with a formation of a complex of antibody - antigen - labeled antibody . the presence of the antigen is determined by observation of a signal which may be quantitated by comparison with control samples containing known amounts of antigen . antibodies may also be utilized against the disease specific markers , as haptens , to create an antibody response against the protein to which it binds , thereby identifying targets for treatment of the disease or a sub - class thereof . lastly , the markers and associated antibodies provide a tool for monitoring the progress of a patient during a therapeutic treatment , so as to determine the usefulness of a novel therapeutic agent . all patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . all patents and publications are herein incorporated by . reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . it is to be understood that while a certain form of the invention is illustrated , it is not to be limited to the specific form or arrangement herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and drawings / figures . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned , as well as those inherent therein . the oligonucleotides , peptides , polypeptides , biologically related compounds , methods , procedures and techniques described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims .	8
a vertical deflection winding 21 of a vertical deflection circuit 20 , illustrated in fig1 is coupled to ground through a dc blocking capacitor 22 and an ac feedback resistor 23 . vertical deflection winding 21 comprises an inductive portion 21a and a resistive portion 21b and is coupled to an output terminal 24 of a push - pull output amplifier stage 25 . deflection winding 21 is coupled to a retrace capacitor 32 at output terminal 24 . push - pull output stage 25 comprises two npn output transistors 26 and 27 arranged in a stacked or totem pole configuration . the output electrode of transistor 26 , the emitter electrode , is coupled through a diode 28 to deflection winding 21 at output terminal 24 , and the output electrode of transistor 27 , the collector electrode , is coupled through a bias impedance network 29 to deflection winding 21 at terminal 24 . bias impedance network 29 comprises a parallelly coupled resistor 30 and diode 31 . push - pull output stage 25 is provided with a single - ended supply voltage of + 30 volts , illustratively , coupled to the collector of transistor 26 . base current for transistor 26 is obtained from the + 30 volt supply through a diode 52 and a resistor 33 and also from a bootstrap capacitor 34 , one terminal of which capacitor being coupled to the emitter of transistor 26 , the other terminal being coupled to the base of transistor 26 through resistor 33 . a vertical drive signal v 40 is provided at an input terminal 40 of push - pull output stage 25 from a conventional vertical oscillator and driver circuit 39 that is synchronized by pulses 41 repeating at a vertical deflection rate , 1 / t v , obtained from a synchronizing circuit , not shown . to maintain a linear trace current in deflection winding 21 , an ac feedback voltage developed across resistor 23 is coupled to vertical oscillator and driver 39 . a dc feedback voltage is provided by also coupling the voltage across capacitor 22 to vertical oscillator and driver circuit 39 . the vertical drive signal v 40 at terminal 40 is directly coupled to the base of transistor 27 through a resistor 37 of voltage dividing resistors 37 and 38 . transistor 27 amplifies and inverts vertical drive signal v 40 at its collector electrode . the inverted drive signal is then coupled to the base of transistor 26 through series coupled diodes 35 and 36 . as illustrated in fig2 a , during the trace interval , times t 1 - t 3 , the vertical deflection current i 21 comprises a negative - going sawtooth trace current i 121 . output transistor 26 conducts vertical deflection trace current mainly during the first half of the trace interval between times t 1 - t 2 , whereas output transistor 27 conducts vertical deflection trace current mainly during the second half or latter portion of the trace interval between times t 2 - t 3 . some degree of overlap exists near the center of trace , at time t 2 , when both output transistors are conducting . the vertical drive voltage v 40 at input terminal 40 , illustrated in fig2 b , is a sawtooth voltage portion 40a of relatively shallow , positive slope during conduction of output transistor 26 . only a shallowly sloped waveform is required because transistor 27 amplifies the drive voltage before it is coupled to the base of transistor 26 . the drive voltage increases in magnitude and becomes the waveform 40b , increasingly steep towards the end of trace , when voltage v 40 must provide relatively large amounts of base current to output transistor 27 . during trace , deflection winding 21 exhibits mainly a resistive impedance , as illustrated in fig2 c , by the sloping portion 124 of output voltage v 24 developed at output terminal 24 . also during trace , bootstrap capacitor 34 charges through diode 52 to a voltage about equal to the difference between the + 30 volt supply voltage and the value of output voltage v 24 at the end of trace . transistor 26 is reverse biased within the second half of trace when the voltage drop developed across biasing impedance network 29 biases the base - emitter junction of transistor 26 out of conduction . at the beginning of vertical retrace , near time t 3 , drive voltage v 40 decreases to its minimum value v min and remains at substantially this voltage during the retrace interval t 3 - t 4 . transistor 27 is cut off . vertical deflection winding 21 and retrace capacitor 32 form a resonant retrace circuit 232 during a resonant retrace portion t 3 - t 4 of the retrace interval . a retrace pulse is developed across retrace capacitor 32 is illustrated in fig2 c by the pulse voltage 224a . the retrace current flowing in deflection winding 21 is a sharply rising resonant retrace current portion 132a . with the voltage at the cathode of diode 28 , at terminal 24 , sharply increased , diode 28 becomes reverse biased and disconnects the resonant retrace circuit 232 from output transistor 26 . diode 28 thus prevents resonant retrace current from flowing in a reverse conduction path through output transistor 26 . at time t 4 , the retrace pulse voltage 224a has decreased sufficiently to forward bias diode 28 and the collector - emitter junction of output transistor 26 . bootstrap capacitor 34 provides sufficient base current to transistor 26 to switch the transistor into saturated conduction . output terminal 24 is thus clamped to the + 30 volt supply , as illustrated in fig2 c , by the pedestal voltage 224b occurring between times t 4 - t 5 , the clamped retrace portion of the retrace interval . retrace current now flows to deflection winding 21 from the + 30 volt supply as illustrated in fig2 a by the less sharply positively sloping clamped retrace current i 132b between times t 4 - t 5 . the duration of the clamped retrace interval t 4 - t 5 , during which the pedestal retrace voltage 224b is developed , is a function of the retrace losses occurring during the resonant retrace interval portion . increased losses result in an increased clamped retrace interval during which the deflection winding energy previously dissipated is replenished . near time t 5 , the deflection current i 21 has increased to the required beginning of trace value . drive voltage v 40 turns on transistor 27 to begin the subsequent trace interval . to damp resonant oscillations of the deflection winding current that may begin after the end of the resonant retrace interval portion and which oscillations may undesirably extend into the next trace interval , a terminal of damping resistor 42 is coupled to deflection winding 21 at a terminal 41 , the junction of the deflection winding and capacitor 22 . another terminal of damping resistor 42 is coupled to the junction of the emitter electrode of output transistor 26 and the anode of diode 28 . thus , diode 28 functions additionally to disconnect damping resistor 42 from resonant retrace circuit 232 during the resonant retrace interval portion . had damping resistor 42 been coupled directly across deflection winding 21 , that is to say , had damping resistor 42 been coupled between terminals 24 and 41 , resonant retrace current would also flow through damping resistor 42 , undesirably dissipating energy during the resonant retrace interval portion . the damped retrace portion would undesirably increase in duration , because the energy replenishment period would be longer . by providing disconnect diode 28 in the manner afordescribed , both output transistor 26 and damping resistor 42 may be isolated from the resonant retrace circuit , significantly increasing the efficiency of vertical deflection circuit 20 .	7
it is a discovery of the present invention that approximately equimolar yields of amplicons of varying lengths can be easily produced by multiplex pcr it has been determined that varying the primer concentrations as a function of the lengths of amplicons yields approximately equimolar amounts of amplicons of varying lengths . the relationship between primer concentration and the length of amplicons is as follows : c a = the concentration of primers for an amplicon a ; c l = the concentration of primer for the longest amplicon ; l a = the length of amplicon a ; l l = the length of the longest amplicon ; and x is usually not zero and is often between one and three . this relationship can be placed in a computer readable medium or be used with a computer system if desired . fig2 illustrates the relationship for given values x and l l , using the amplicons from different exons of the human p53 gene as an example . using primer concentrations as set forth , for example in fig2 , one skilled in the art can determine the optimum set of primer concentrations to yield approximately equimolar yields of varying length amplicons in a multiplex or multiple pcr . preferably , primers having both comparable base composition and comparable melting temperatures are used . also preferably , mg + 2 concentration , annealing temperatures , and cycling times of the pcr are optimized prior to choosing the desired set of primer concentrations in accordance with the present invention . pcr techniques applicable to the present invention include inter alia those discussed in pcr primr : a l aboratory m anual , dieffenbac , c . w . and dveksler , g . s ., eds ., cold spring harbor laboratory press ( 1995 ). the present application further provides primer sequences , primer concentrations , and experimental conditions useful in the amplification of the coding region of the human p53 gene . particularly useful primers for amplification of exons of the p53 gene are set forth in table 1 . 20 primers in 1 mm tris - hcl , ph 7 . 4 , 0 . 1 mm edta , sequences : exon 2 : 5 ′- tcatgctgcatccccacttttcctcttg - 3 ′ 5 ′ tggcctgcccttccaatggatccactca - 3 ′ exon 3 : 5 ′- aattcatgggactgactttctgctcttgtc . 3 ′ 5 ′- tccaggtcccagcccaacccttgtcc - 3 ′ exon 4 : 5 ′- gtcctctgactgctcttttcacccatctac - 3 ′ 5 ′- gggatacggccaggcattgaagtctc - 3 ′ exon 5 : 5 ′- cttgtgccctgactttcaactctgtctc - 3 ′ 5 ′- tgggcaaccagccctgtcgtctctcca - 3 ′ exon 6 : 5 ′- ccaggcctctgattcctcactgattgctc - 3 ′ 5 ′- gccactgacaaccacccttaacccctc - 3 ′ exon 7 : 5 ′- gcctcatcttgggcctgtgttatctcc - 3 ′ 5 ′- ggccagtgtgcagggtggcaagtggctc - 3 ′ exon 8 : 5 ′- gtaggacctgatttccttactgccttgc - 3 ′ 5 ′- ataactgcacccttggtctcctccacc - 3 ′ exon 9 : 5 ′- cacttttatcacctttccttgcctctttcc - 3 ′ 5 ′- aactttccacttgataagaggtcccaagac - 3 ′ exon 10 : 5 ′- acttacttctccccctcctgtgttgctgc - 3 ′ 5 ′- atggaatcctatggctttccaacctaggaag - 3 ′ exon 11 : 5 ′- catctctcctccctgcttctgtctcctac - 3 ′ 5 ′- ctgacgcacacctattgcaagcaagqgttc - 3 ′ table 2 shows particularly useful concentrations of the primers set forth in table 1 for multiplex pcr amplification using the experimental conditions set forth in table 3 . using the methods and reagents provided herein , we achieved multiplex pcr amplification of coding regions shown of the human p53 gene in approximately equimolar amounts . that desirable result was achieved in a single - tube reaction . the achievement of such desirable results with the remarkable convenience of a single tube reaction further illustrates the contribution to the art made by the present invention . the methods and compositions of the present invention are useful in virtually any context in which equimolar yields of various pcr products are desired . such contexts include without limitation paternity testing , forensic analysis , genetic screening , polymorphism detection , and mutation analyses . the present invention can be used to amplify nucleic acids for all forms of sequence analysis known to those skilled in the art . sequence analysis techniques includes , for example , dideoxy - sequencing and sequence analysis using high - density nucleic acid arrays : the genechip ® probe arrays or vlsips ™ technology of affymetrix , inc . high density nucleic acid arrays are discussed for example in chee , m ., yang , r ., hubbell , e ., berno , a ., huang , x . c ., stern , d ., winkler , j ., lockhart , d . j ., morris , m . s ., & amp ; fodor , s . p ., science 5287 , 610 - 614 ( 1996 ), u . s . pat . no . 5 , 445 , 934 , and international publication no . wo 95 / 11995 corresponding to pct application no . pct / us94 / 12305 . the p53 gene and its protein product are discussed in molecular biology of the cell , 3rd edition , alberts , b ., bray , d ., lewis , j ., raff , m ., roberts , k ., and watson , j . d ., garland publishing ( 1994 ) at pages 889 and 1284 - 1289 . it is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of any appended claims . all publications , patents , and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes .	2
the present disclosure generally relates to a frame , a system and / or a method for deploying a compact skid . more specifically , the present disclosure relates to an apparatus , a system and a method for deploying a skid that transitions between a storage position and an operational position using an air bladder . the storage position may be compact while the operational position may be expanded . referring to the drawings wherein like numerals refer to like parts , fig1 and fig4 - 6 generally illustrate a skid 10 that may have a storage position and an operational position . fig1 and 4 illustrate an embodiment of the skid 10 in the operational position . fig5 illustrates an embodiment of the skid 10 in the storage position . the skid 10 may have an outer shell 12 , an inner shell 14 and an air bladder 16 . as illustrated in fig2 , the outer shell 12 may have a base 18 , a front end frame 20 and a back end frame 22 . together , the base 18 , the front end frame 20 and the back end frame 22 may define a volume with the outer shell 12 , an outer length 13 , an outer width 15 , an outer height 17 , an inner length 19 and an inner width 21 . a . the base 18 may have a front end 24 and a back end 26 . the base 18 may be formed by a first side rail 28 , a second side rail 30 , a front cross member 32 and a back cross member 34 . the first side rail 28 , the second side rail 30 , the front cross member 32 and the back cross member 34 may be orthogonally connected together . the first side rail 28 may be parallel to the second side rail 30 . additionally , the front cross member 32 may be parallel to the back cross member 34 . the front cross member 32 may be attached to the first side rail 28 and the second side rail 30 at the front end 24 of the base 18 . the back cross member 34 may attached to the first side rail 28 and the second side rail 30 at the back end 26 of the base 18 . in an embodiment , the base 18 may also have one or more support cross members connecting the first side rail 28 and the second side rail 20 between the back cross member 34 and the front cross member 32 . the front end frame 20 may have a top 38 and a bottom 40 . the front end frame 20 may be formed by a first corner post 42 , a second corner post 44 and a first top cross member 46 . the first corner post 42 and the second corner post 44 may be orthogonally connected to the first top cross member 46 at the top 38 of the front end frame 20 . the first corner post 42 may be parallel to the second corner post 44 . a plurality of front gussets 48 may reinforce the connection between the first corner post 42 with the first top cross member 46 . additionally , the plurality of front gussets 48 may reinforce the connection between the second corner post 44 with the first top cross member 46 . the back end frame 22 may have a top 50 and a bottom 52 . the back end frame 22 may be formed by a third corner post 54 , a fourth corner post 56 and a second top cross member 58 . the third corner post 54 and the fourth corner post 56 may be orthogonally connected to the second top cross member 58 at the top 50 of the back end frame 22 . the third corner post 54 may be parallel to the fourth corner post 56 . a plurality of back gussets 60 may reinforce the connection between the third corner post 54 with the second top cross member 58 . further , the plurality of back gussets 60 may reinforce the connection between the fourth corner post 56 with the second top cross member 58 . the front end frame 20 may be connected to the front end 24 of the base 18 . the front cross member 32 of the base 18 may be parallel to the first top cross member 46 of the front end frame 20 . the back end frame 22 may be connected to the back end 26 of the base 18 . the back cross member 34 of the base 18 may be parallel to the second top cross member 58 of the back end frame 22 . a plurality of support gussets 62 may reinforce the connection between the base 18 and the front end frame 20 . additionally , the plurality of support gussets 62 may reinforce the connection between the base 18 and the back end frame 22 . the outer shell 12 may have a plurality locking supports 64 . one of the plurality of locking supports may be attached to the first corner post 42 of the front end frame 20 and the first side rail 28 of the base 18 . one of the plurality of locking supports may be attached to the second corner post 44 of the front end frame 20 and the second side rail 30 of the base 18 . the plurality of locking supports 64 connected to the front end frame 20 may extend from the bottom 40 to the top 38 of the front end frame 20 . additionally , one of the plurality of locking supports 64 may be attached between the third corner post 54 of the back end frame 22 and the first side rail 28 of the base 18 . finally , one of the plurality of locking supports 64 may be attached between the fourth corner post 56 of the back end frame 22 and the second side rail 30 of the base 18 . each locking support 64 may have a plurality of primary pin holes 66 . the plurality of locking supports 64 connected to the back end frame 22 may extend from bottom 52 to the top 50 of the back end frame 22 . the plurality of primary pin holes 66 of each locking support 64 may be used to lock the skid 10 into either the storage position or the operational position . the outer length 13 , the outer width 15 and the outer height 17 of the outer shell 12 may conform to size requirements of the iso 6346 standard . for example , in an embodiment , the outer length 13 , outer width 15 and the outer height 17 of the outer shell 12 may conform the dimensions of a twenty foot intermodal shipping container . alternatively , the outer length 13 , outer width 15 and the outer height 17 of the outer shell 12 may conform to the dimensions of a forty foot intermodal shipping container . however , the outer length 13 , the outer width 15 , and / or the outer height 17 of the outer shell 12 are not limited to the dimensions of the twenty foot intermodal container or the dimensions of the forty foot intermodal container . fig3 illustrates an embodiment of the inner shell 14 of the skid 10 . the inner shell 14 may have a top frame 68 , a bottom frame 70 and a plurality of corner posts 72 . the plurality of corner posts 72 may connect the top frame 68 to the bottom frame 70 . the top frame 68 and the bottom frame 70 may be parallel . a plurality of gussets 74 may reinforce the connection between the plurality of corner posts 72 and the top frame 68 . similarly , the plurality of gussets 74 may reinforce the connection between the plurality of corner posts 72 and the bottom frame 70 . the top frame 68 , the bottom frame 70 and the plurality of corner posts 72 may define an inner volume , an outer length 71 , an outer width 73 and an outer height 75 . the top frame 68 may be formed by two end cross members 76 orthogonally connecting opposite ends of two parallel side rails 78 . a support cross member 80 may connect the parallel side rails 78 between the two end cross members 76 . each end of each of the two parallel side rails 78 may have a plurality of storage pin holes 102 . the storage pin holes 102 may be used to lock the skid 10 into the storage position . the bottom frame 70 may be formed by two end cross members 82 orthogonally connected to opposite ends of two parallel side rails 84 . a plurality of support cross members 86 may connect the two parallel side rails 84 between the two end cross members 82 . a floor panel 88 may be attached to the plurality of support cross members 86 . each end of each of the two parallel side rails 84 may have a plurality of operational pin holes 90 . the operational pin holes 90 may be used to lock the skid 10 into the operational position . the outer length 71 , the outer width 73 and the outer height 75 of the inner shell 14 may be configured so that the inner shell 14 fits within the inner volume of the outer shell 12 . the outer width 73 of the inner shell 14 may substantially equal the inner width 21 of the outer shell 12 . similarly , the outer length 71 of the inner shell 14 may substantially equal the inner length 19 of the outer shell 12 . equipment 92 may be situated on the floor panel 88 of the bottom frame 70 of the inner shell 14 . in one embodiment , the equipment 92 may be one or more shale shakers and / or one or more dryers . the equipment 92 may also include mud mixers , chemical storage and / or control systems . the air bladder 16 may be situated between the inner shell 14 and the outer shell 12 . in the storage position , the air bladder 16 may be located within a volume defined by the first side rail 28 , the second side rail 30 , the front cross member 32 and the back cross member 34 of the base 18 of the outer shell 12 and the floor panel 88 of the bottom frame 70 of the inner shell 14 . when the skid 10 is not in the storage position , the air bladder 16 may expand to fill at least a portion of the inner volume of the outer shell 12 . as shown in fig5 , in the storage position , the inner shell 14 may be located within the inner volume of the outer shell 12 . additionally , the equipment 92 may be contained within the volume of the inner shell 14 . in the storage position , the skid 10 may be loaded onto a flat bed truck , transported to the intended destination , and unloaded . the skid 10 may be shipped by truck , train , airplane , boat or any other means of transportation normally used to ship intermodal containers . additionally , the skid 10 may be stored on - site or off - site in the storage position . further , a cover may be placed over the inner shell 14 and the outer shell 12 above the base 18 to protect the skid while in the storage position . in an embodiment , when the skid 10 is in the storage position , a portion of the bottom frame 70 of the inner shell 14 may sit on top of a portion of the base 18 of the outer shell 12 . additionally , the top frame 68 of the inner shell 14 may be substantially flush with the top 38 of the front end frame 20 of the outer shell 12 and the top 50 of the back end frame 22 of the outer shell 12 . in the storage position , the storage pin holes 102 of the two parallel side rails 78 of the top frame 68 of the inner shell 14 may align with the primary pin holes 66 of the plurality of support members 64 of the outer shell 12 . a plurality of pins 96 may be inserted into the primary pin holes 66 of the plurality of support members 64 of the outer shell 12 and the storage pin holes 102 of the two parallel side rails 78 of the top frame 68 of the inner shell 14 to lock the skid 10 into the storage position . to transition the skid 10 from the storage position to the operation position , an air compressor 94 may be connected to the air bladder 16 . the air compressor 94 may inflate the air bladder 16 . the air compressor 94 may supply a relatively small amount of pressure . in an embodiment , the air compressor may supply seven to ten psi of pressure . the air bladder 16 may lift the inner shell 14 . as the air bladder 16 inflates , the plurality of locking members 64 may guide the inner shell 14 to ensure that the inner shell 14 stays within the inner length 19 and the inner width 21 of the outer shell 12 . the air bladder 16 may lift the inner shell 14 until the plurality of operational pin holes 90 on the two parallel side rails 84 of the bottom frame 70 of the inner shell 14 align with the plurality of primary pin holes 66 on the plurality of locking members 64 of the outer shell 12 . fig6 illustrates the air bladder 16 fully inflated . the plurality of pins 96 may be inserted into the primary pin holes 66 and the operation pin holes 90 to lock the skid 10 into the operational position . subsequently , as shown in fig1 and 4 , the air bladder 16 may be partially deflated . in an embodiment , the plurality of pins 96 may be manually installed . alternatively , the plurality of pins 96 may be spring loaded so that the plurality of pins 96 automatically insert into the primary pin holes 66 and the operation pin holes 90 when the primary pin holes 66 and the operation pin holes 90 are aligned . fig1 and 4 illustrate an embodiment of the skid 10 in the operational position with the air bladder 16 partially deflated . in the operational position , the bottom frame 70 of the inner shell 14 may be aligned with the first top cross member 46 of the front end frame 20 of the outer shell 12 and the second top cross member 58 of the back end frame 22 of the outer shell 12 . additionally , the equipment 92 may be expanded or connected to other systems so that a portion of the equipment 92 is no longer contained within the volume of the inner shell 14 . in an embodiment , the equipment 92 may be connected to conduit to deliver a slurry to the equipment 92 and to remove drilling fluid from the equipment 92 . a power connection may also be connected to the equipment 92 . additionally , safety equipment , such as walkways , guard rails and / or stairs , may be installed onto the skid 10 . other support equipment , such as a shaker pit to collect the solids separated by a shale shaker , may be installed next to the skid 10 . to transition the skid 10 from the operational position to the storage position , the air bladder 16 may be reinflated with the air compressor 94 until the air bladder 16 supports the inner shell 14 . the equipment 92 may be adjusted to fit completely within the volume of the inner shell 14 . the plurality of pins 96 may be removed from the primary pin holes 66 and the operational pin holes 90 . the air bladder 16 may be deflated until the inner shell 14 is within the volume of the outer shell 12 and the primary pin holes 66 and the storage pin holes 102 are aligned . the plurality of pins 96 may be inserted into the primary pin holes 66 and the storage pin holes 102 to lock the skid 10 into the storage position . while the present disclosure has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments may be devised which do not depart from the scope of the disclosure as described herein . accordingly , the scope of the present disclosure should be limited only by the attached claims .	5
reference numeral 10 points out a high voltage electrical connector for splicing cables 12 and 14 together . referring also to fig3 the connector 10 , disclosed in u . s . pat . no . 3 , 681 , 512 , consists of an outer shell 16 , an internal barrel 18 and a firing chamber 20 . the powder 22 , when ignited , drives pistons 24 which in turn drives a plurality of tapered jaws into a gripping engagement with the cables . the method of igniting powder 22 includes a firing assembly 25 consisting of a remote firing collar subassembly 26 ( fig2 ) and an ignitor subassembly 28 ( fig3 ). reference is now directed to fig4 which shows the assembly 25 and subassemblies 26 and 28 in cross - section . the three major components of the remote firing collar subassembly 26 include a cylindrical housing 30 , a contact member retainer bushing 32 and a contact member 34 . the contact member is threaded into the lower portion of the bushing which in turn depends from the housing . the unit comprising the bushing and contact member enjoys limited vertical movement as will be explained below . contact member 34 has an outer shell 36 of brass or other conductive material , an inner or center post 38 , also of a conductive material , an upper insulating sleeve 40 , a lower insulating sleeve 42 and a conductive retaining ring 44 . the outer shell 36 has a passage 46 therethrough with an enlarged section at the top . the upper insulating sleeve 40 has a thickened end portion 48 which fills this enlarged section and also extends upwardly above the top of the shell . the rest of the sleeve extends down into passage 46 . the lower insulating sleeve 42 has a thick end portion 50 which extends laterally beyond the perimeter of the outer shell at its lower end . the sleeve &# 39 ; s elongated portion extends up into passage 46 towards sleeve 40 . the retaining ring 44 is positioned around the shell right above the insulating sleeve &# 39 ; s outwardly projecting end portion 50 . the ring has several spring fingers 52 around its periphery protruding up and outwardly . the outer shell has an aperture 54 drilled into the top portion . this aperture receives the end of one wire 56 which is part of the electrical circuit . the center post 38 , which is positioned in passage 46 inside the insulating sleeves , has an annular rim 58 adjacent its lower end . the thick end portion 50 of the insulating sleeve electrically isolates the rim 58 from the end of the outer shell 36 and also from contact with the retaining ring . the top of the center post is flared as shown to fix the post in the passage . an aperture 60 in the top of the post receives an end of a second wire 62 which is also part of the electrical circuit . bushing 32 is cylindrical , with a cavity 64 occupying most ot its volume . the cavity , opening out on the base of the bushing has threads to which the contact member 34 is threaded after electrical wires 56 and 62 are inserted into their proper apertures . these wires having been previously fed through an opening in the housing and opening 66 in the top of the bushing . the top of the bushing has a laterally extending rim 68 with the bottom shoulder 70 beveled inwardly . bushing 32 is made from a nonconductive material . as fig4 shows , the bushing is slidingly positioned in the lower unit 72 of housing 30 . the passage 74 in the lower unit has a corresponding beveled shelf 76 onto which the bushing rests . the lower unit has a wide circular base 78 and a smaller cylindrical upright member 80 . a groove 82 is positioned between the upright member and base . the cylindrical upper unit 84 of the housing is cup shaped with passage 86 therethrough . the passage consists of through portions , the first and largest opens out onto the base of the unit and it has threads to receive the lower unit as shown . the middle portion is smaller in diameter and provides a recess for coil spring 88 . the coil spring biases bushing 32 downwardly in its seat in the lower unit . the third and smallest portion opens out on top of the upper unit and provides an entrance for wires 56 and 62 . housing 30 is nonconductive . belt 89 provides the means for securing the subassembly 26 to connector 10 . an opening in the belt has a diameter groove 82 . in assembly the subassembly 26 , upper unit 84 is first slid onto wires 56 and 62 followed by coil spring 88 , bushing 32 , belt 89 and lower unit 72 . after the wires are fixed into apertures 54 and 60 the contact member 34 is threaded into the bushing cavity 64 . thereafter the lower unit is threaded into the upper unit with belt 89 positioned in between as shown in the drawings . ignitor subassembly 28 consists of an ignitor body member 90 , washer 92 , ignitor cap 94 , ignitor housing 96 , ignitor wire 98 , propellant 100 and end cap 102 , and clear plastic window 103 . the above elements with the exception of body member 90 and washer 92 constitutes shell member 104 . ignitor body member 90 , preferably made from cold drawn steel , has external threads 105 . the upper surface 106 is shallowly bisected to provide a slot 108 ( fig3 ). a passage 110 extends longitudinally through the member . the lower portion of the passage is enlarged to provide a cavity 112 and a downwardly facing shoulder 114 . washer 92 , is preferably made from polyethylene . the ignitor cap 94 is cylindrical with a laterally extending flange 118 on its top surface 120 . the edge of its lower surface is beveled to facilitate inserting it into the ignitor housing . this cap is preferably made from cold drawn steel . ignitor housing 96 is made from nylon and is simply a sleeve or tube . ignitor wire 98 is preferably a wire sold under the tradename ni - chrome by the driver - harris company of harrison , new jersey . propellant 100 is a powder sold under the tradename infallible by hercules powder company . end cap 102 is cup - shaped with a flange 122 on its lower edge and an aperture 124 extending through the cap &# 39 ; s flat bottom surface . the cap is preferably made from aluminum . clear plastic window 103 is made from polyethylene . the ignitor subassembly 28 may be assembled by first assembling the shell . to begin , the wire 98 is placed through the housing 96 so that the wire ends extend out either end of the sleeve . the plastic window 103 and end cap 102 are then placed , in that order , over one end of the housing with the wire coming up the inside of the end cap side walls and down the outside as shown in fig4 . the inside dimensions of the end cap permit the housing to fit inside tightly . the plastic window covers the aperture 124 and further provides a gasket between the housing end and cap 102 . after loading the housing with propellant 100 , wire 98 is positioned so that it preferably cuts diagonally through the propellant as shown . holding the loose end of the wire , ignitor cap 94 is pressed into the open end of the housing until its flange abuts the sleeve ; the loose end of the wire must extend outside of the cap 94 as shown . wire 98 is bent so that it lays across the top surface 120 of cap 94 . ideally the wire should be in the center of the top surface . with body member 90 held upsidedown , the washer 92 is dropped into the cavity 112 followed by the assembled shell member to complete the ignitor subassembly . the outer diameter of end cap side walls are dimensioned so that they , plus the interference by wire 98 , results in an extremely tight fit in the cavity . subsequent to the construction of connector 10 , ignitor subassembly 28 is threaded through outer shell 16 into chamber 20 by means of its threads 105 and mating threads in the connector . the slot 108 on the subassembly assists in this step . immediately prior to using connector 10 , remote firing collar subassembly 26 is strapped onto the connector with the lower end of contact member 34 inserted into passage 110 as shown in fig4 . the end tip 126 of center post 38 contacts wire 98 and ignitor cap 94 . the fingers 52 on retainer ring 44 centers the contact member 34 in the passage . the two wires 56 and 62 are then connected to a power source ( not shown ) and an electric current delivered to wire 98 . as it well known , the current heats wire 98 which ignites propellant 100 . it burns rapidly and melts window 103 so that the burning flame can reach and ignite powder 22 in firing chamber 20 . the current flows down center post from wire 62 , through wire 98 , into body member 90 , through retainer ring 44 , up outer shell 36 and out wire 56 . the foregoing detailed description has been given for clearness of understanding only , and no unnecessary limitations should be understood therefrom , as some modifications will be obvious to those skilled in the art .	5
with reference now to the figures , and in particular with reference to fig1 a network of data processing systems in which a preferred embodiment of the present invention may be implemented is depicted . the exemplary embodiment depicted includes a client 102 connected via communications link 104 to the internet 106 . communications link 104 may , for example , be in the form of access provided directly by an internet service provider ( isp ) or indirectly via a proxy within a firewall , as is known in the art . client 102 includes a java - enabled browser application , allowing client 102 to retrieve and display information formatted in accordance with the hypertext markup language ( html ) and to run java applets , or a java interpreter , allowing client 102 to execute java applications . also connected to internet 106 , via communications link 108 , is server 110 . server 110 may be a world wide web ( www , often simply referred to as &# 34 ; the web &# 34 ;) server capable of receiving and serving hypertext transmission protocol ( http ) requests . client 102 may thus retrieve html - formatted data from server 110 and display such information , executing java applications or applets , or applications written in other object - oriented languages , in connection with such retrieval and / or display . java applets thus executed may be object - oriented applications formulated utilizing processes facilitating automatic coding and automatic testing and optimization of data structures in accordance with the present invention . referring to fig2 a block diagram of a data processing system utilizing mechanisms for automatic code generation and testing in accordance with a preferred embodiment of the present invention is depicted . data processing system 200 may be client 102 or server 110 depicted in fig1 . data processing system 200 in the exemplary embodiment includes a processor 202 , which may be a powerpc ™ processor available for international business machines corporation of armonk , n . y . processor 202 is connected to a level two ( l2 ) cache 204 , which is utilized to stage data to and from processor 202 at reduced access latency . l2 cache 204 is connected in turn to an interconnect or system bus 206 , which is also connected , in the embodiment depicted , to system memory 208 and memory - mapped graphics adapter 210 . graphics adapter 210 provides a connection for a display device ( not shown ) on which the user interface of software executed within data processing system 200 is displayed . also connected to system bus 206 in the exemplary embodiment is input / output ( i / o ) bus bridge 212 , which provides an interface between system bus 206 and i / o bus 214 . a nonvolatile memory such as hard disk drive 216 may be connected to i / o bus 214 , as may keyboard / mouse adapter 218 , which provides connection to 1 / o bus 214 for keyboard 220 and pointing device 222 . pointing device 222 may be a mouse , trackball , or the like . also connected to i / o bus 214 may be network adapter 224 for connecting data processing system 200 to a local area network ( lan ), the internet , or both . those skilled in the art will appreciate that other devices may be incorporated into data processing system 200 , such as an optical disk drive or a modem . the operation of data processing systems of the type depicted in fig2 is well known in the art . program information comprising instructions and / or data is stored on nonvolatile memory 216 and may be selectively copied into system memory 208 once data processing system 200 is powered on . processor 202 executes the instructions within such program information and generates text or graphical information for presentation on display device connected via graphics adapter 210 , where the information may be viewed by a user . the user may selectively control operation of data processing system 200 through input entered on keyboard 220 or through pointing device 222 . in the present invention , the software implements the structures and methods described below for automatic generation and testing of java or javascript object code . with reference now to fig3 an implementation module diagram for a java / javascript application development environment utilizing automatic code generation and testing in accordance with a preferred embodiment of the present invention is depicted . data structures 302 contain data around which an application or applet may be structured , and may comprise financial information residing on a server , such as server 110 depicted in fig1 for a financial institution . data structure analysis module 304 may be utilized to analyze data structures 302 and generate a dictionary 306 of data elements or provide other information to other modules . dictionary 306 may be employed by an object generator 308 attempting to automatically generate objects forming a java or javascript application or applet . lookup engine 310 looks up a desired data element within dictionary 306 and returns a pointer 312 to the data element . this information may be used by object generator 308 as described below . it is important to note that , although depicted as a single diagram , those skilled in the art will recognize that the structure depicted may actually be implemented within different data processing systems . for example , data structures 302 , data analysis engine 304 , dictionary 306 , and lookup engine 310 may all reside on one data processing system , such as a server for a financial institution . the remainder of the modules depicted may reside on a client used to develop java or javascript applications or applets . pointer 312 may be employed by object generator 308 to create object constructors 314 and 316 , test data and real data versions , respectively . an object &# 34 ; constructor &# 34 ; is a piece of code that &# 34 ; constructs &# 34 ; or builds an object , retrieving all property values from wherever necessary and setting them as properties on the object . an input file 310 containing a designation of which properties are to be implemented as sub - objects rather than properties on an object may also be employed by object generator 308 , as may a rule base 320 containing rules for naming properties on an object . data structure analysis engine 304 may also be utilized by test generator 322 to create html page test cases 324 for the object implemented by object generator 308 , and to create test data structures 326 for test data versions of automatically generated object constructors 314 . a browser / java interpreter 328 may be utilized to load the html test cases 324 and instantiate objects from the automatically generated object constructors 314 or 315 . lookup engine 310 may also employ a correlation table 330 created by object generator 308 in instantiating objects from object constructors 314 or 316 . the operation of the components depicted in fig3 are described in greater detail below . referring to fig4 a - 4d , high level flowcharts for processes facilitating automatic coding in object - oriented application development in accordance with a preferred embodiment of the present invention are illustrated . these processes may be implemented within the modules depicted in fig3 partially within a server such as server 110 depicted in fig1 and partially within a client such as client 102 depicted in fig1 . fig4 a - 4b illustrate a dictionary process for accessing data in data structures in accordance with a preferred embodiment of the present invention . in accordance with the present invention , a dictionary of information related to offsets , links , etc . which define each element within every data structure is created and utilized to store and retrieve all data elements in the appropriate locations within the data structures with a minimum amount of coding . in the flowchart of fig4 a , a process for creating a dictionary is illustrated . the process illustrated may be utilized to create a dictionary for the first time , or to update an existing dictionary . the process begins at step 402 , which depicts starting analysis of the data structures utilized by an object - oriented application . the process then passes to step 404 , which illustrates the optional step of verifying existing dictionary entries , if any . such verification may be performed either by utilizing the dictionary entry to retrieve a corresponding data element , or by repeating the steps described below for the dictionary element . the process next passes to step 406 , which depicts analyzing the data structures ( new and / or preexisting ) to determine the offsets , links , and pointers required to get each element in every data structure . this analysis may be performed , for example , by reading and analyzing the c header files which define the data structures . from such header files , the path of offsets and pointers required to retrieve each element within a given data structure may be determined . the process then passes to step 408 , which illustrates updating the dictionary entries for data structure elements analyzed . when created , the dictionary serves as a roadmap to each data structure element for a particular application . the process then passes to step 410 , which depicts the process becoming idle until a subsequent dictionary creation or update is initiated . as an example of how this process may be employed , suppose a client - side java object needs access to a complex data structure written , for instance , in c prior to the existence of java . in c , data structures may contain fields and pointers to other data structures , which may in turn contain fields and pointers to other data structures , which may also contain fields and pointers to other data structures , etc . an example might be the user profile information for a bank customer . the top structure may have a few fields identifying the user , but may also contain a pointer to a structures containing all of the user demographic information . this demographic structure may also contain a pointer to an array of structures , one for each account which the user has at the bank . in each of these structures , if the account type is &# 34 ; savings ,&# 34 ; then there may be a pointer to a savings - account specific structure . similarly , if the account type is &# 34 ; checking ,&# 34 ; then there may be a pointer to a checking - account specific structure . off of one of these specific structures may be an array containing the passwords for all cosigners required for any transaction on the account . a java applet programmer may desire only to retrieve the first cosigner &# 39 ; s password from the third checking account for a specific user . while it would not be particularly difficult to manual implement code for retrieving this field , this field may be one of thousands in the overall data definition . handcrafting a single piece of code is not especially troublesome , but handcrafting thousands of pieces of code may become extremely burdensome . additionally , as new releases of the target data structure are created , architects of the data definition may decide to add or remove intermediate structures in the profile . every handcrafted line of code may have to change in that situation . for internet - based transactions , the problem is further complicated by the need , in order to access the data using standard handcrafted code , to transmit the entire data structure over the internet to the client java object to access the desired fields . availability of bandwidth may thus significantly impede the application . in the present invention , the complete data definition ( structures , fields , etc .) is assumed to be defined in c header files . this is a reasonable and generally accurate assumption given that header files are required for normal handcrafting of code . the header files may be analyzed to determine the &# 34 ; path &# 34 ; to any field in the entire data definition . the path to every field in the entire data definition may therefore be enumerated in a dictionary , and assigned a unique numeric identifier . for example , the cosigner password field described above may be designated element # 3005 . the dictionary contains information for element # 3005 such as : at that offset is an array ( of accounts , in this case ). index to the nth element of the array based on caller input . the lookup engine then will copy the field to the response buffer and return it to the user . if the data structure changes from release to release , adding or removing intermediate structures , the dictionary would change to contain different paths to the same structures . however , the caller still need only request element # 3005 using index 3 ( for the third account ). the new dictionary contains the proper path . therefore , even if the data structure changes , the call for a predetermined element need not change . additionally , because the lookup engine may be implemented on the server with only a request and a single element data response flows across the internet instead of the entire data structure , significant performance improvements may be attained . the flowchart of fig4 b illustrates a process for utilizing the data structure dictionary described above . by having an array or &# 34 ; roadmap &# 34 ; of each element in the data structures for an application , a generic routine may be written which interprets the dictionary and returns a pointer to the desired instance of a particular data structure element . such a generic engine may store and retrieve all of the data elements in the appropriate location within the data structures with a minimum amount of coding . generally , with less code to write and / or maintain , fewer errors will occur . the generic routine begins at step 412 , which depicts receiving a lookup request for a particular data element instance within a data structure . the process next passes to step 414 , which illustrates looking up the requested data item instance within the dictionary , and then to step 416 , which depicts returning a pointer to the desired instance of the data structure element . the process then passes to step 418 , which illustrates the process becoming idle until another lookup request is received . the dictionary process illustrated in fig4 a and 4b is particularly useful in , for example , financial transactions over the web to a particular financial institution . a financial application may consist of over 100 data transactions , each having associated request and response data structures which may include over 100 fields each typically embedded in complex data structures . by having an array of the &# 34 ; roadmaps &# 34 ; for each element in the request / response data structures , the generic engine can store and retrieve all of the required data elements in the appropriate data structure locations with minimal coding . the dictionary process described above may be extended for automatic generation of object constructor code . fig4 c illustrates a process for automatic code / web page generation in accordance with a preferred embodiment of the present invention . in cases where objects reflect an external data source such as a database , the data structures may be analyzed and , from an understanding of a rule base for naming properties on an object , identify the property name assigned on the object for data fields in the database data structures . based on this information , object constructor codes may be generated . each time the database structure changes , the same technique may be employed to automatically generate updated object constructors . the process begins at step 420 , which depicts initiation of the code generation process . the process then passes to step 422 , which illustrates analyzing the data structures containing data fields from which data is sourced to a subject object . the process next passes to step 422 , which illustrates analyzing data structures sourcing data to an object of interest , and then to step 424 , which depicts consulting a rule base for naming properties on an object . the process then passes to step 426 , which illustrates identifying the property names which are or will be assigned on the object for data fields from which data is sourced to the object of interest . the process passes next to step 428 , which depicts generating the object constructor needed , and then to step 430 , which illustrates the process becoming idle until the object constructor for another object requires generation . continuing with the specific example described above , assuming a transaction may be sent to the bank &# 39 ; s server which will return the user profile structure described above , a java object may be instantiated containing , as properties , all of the user profile data returned on the transaction in that profile structure . while handcrafting a single java object for such purposes may be routine , typically a number of objects , each having a multitude of properties , may be required . handcrafting code for instantiating each object will thus quickly become very time - consuming . furthermore , the data definition architects , in addition to possibly restructuring the data structures , will typically add new fields over time . thus , a new release may include within the user profile an e - mail address and cellular phone number for the user . code must therefore be manually added to retrieve those new fields and store them on the object . the applet which uses the object may need to be changed to do something with a new property , such as an e - mail address , and a developer may choose not to utilize this property . however , many businesses provide user profile information to other businesses , and thus still have to make it available on the object . since data definitions may be parsed from c header files as described above , all of the fields ( properties ) defined for a user profile are known . along with automatically creating the dictionary for accessing the data , java constructors may be generated . the generation program &# 34 ; writes &# 34 ; the code which would ordinarily have to be handcrafted . since the file is generated , it may be discarded and regenerated when a new release of the data structures is implemented . if new fields are added in the new release , the auto - generation program picks them up when run . therefore , essentially no coding is required to maintain the object constructors . the process described above may be further extended to include automatic generation of sub - objects for particular properties on an object . fig4 d illustrates a simple technique for specifying object containment hierarchies in accordance with a preferred embodiment of the present invention , which may be employed in the automatic creation of sub - objects . in cases where properties appear on the sub - object and the sub - object is attached as one property on a main object , some mechanism must be provided to permit automatic creation of the sub - object . since object constructors are determined by analyzing the database structure , the mechanism may be provided by simply specifying as an input for a utility generating object constructors a list of which groups of properties are to be come sub - objects , perhaps with a class name for each sub - object . one method of doing this is to create a separate input file listing the parent structure name for the group of attributes as found in the database structure . in this manner , nothing gets hardcoded and the list input file may be edited to add or remove properties grouped in a sub - object . updated object constructors may then be generated . the process begins at step 432 , which depicts initiation of automatic code generation . the process next passes to step 434 , which illustrates analyzing the data structures , and then to step 436 , which illustrates consulting a rule base for naming properties on an object . the process then passes to step 438 , which depicts identifying property names for both properties on the main object and properties on the sub - object . the process passes next to step 440 , which illustrates reading in an input file specifying which groups of properties found in the database structure are to become sub - objects and listing a parent structure name for the group of attributes . the process then passes to step 442 , which depicts identifying such sub - objects , and next to step 444 , which illustrates generating object constructors for both main objects and sub - objects . the process then passes to step 446 , which depicts the process becoming idle until code generation is again initiated . the mechanism for automatically generating sub - objects described above facilitates automatic code generation in circumstances where multiple properties are attached on a sub - object and the sub - object is attached on the main object as a single property . an example is a date parameter , which typically requires two properties : one for the data value and one for the data format . a sub - object may be created for both properties and attached on a main object . within the list file described above , the two properties would be specified as grouped together and a parent structure name specified for the grouped properties . support for automatic generation of such sub - objects may be easily controlled by editing a list file . returning again to the specific example described above , although all properties may be ascertained from the analysis which created the dictionary , some &# 34 ; sets &# 34 ; of properties should be grouped into a subobject for manageability . an example in the context of a bank user profile is currency . in a typical , low - level data definition , four fields are utilized for one logical &# 34 ; currency &# 34 ; element : value ; data precision indicator ; debit / credit indicator ; and iso currency code ( e . g ., us $, francs , pounds , yen , etc .). there are generally some specific actions which are desirable requiring these four fields , such as implementing a method to format the fields into normal readable format ( e . g ., -$ 200 . 00 ). in the case of an account , there are two balances : ledger balance and available balance . a java applet programmer would usually wish to treat the ledger balance as a &# 34 ; single entity ,&# 34 ; which is normally accomplished by creating a &# 34 ; sub - object &# 34 ; ( called a currency object ) which contains the four properties and several methods , such as one for formatting . again , as the data definition evolves and changes , the groups of properties which should rationally be implemented as sub - objects also evolves . even if the data definition hasn &# 39 ; t changed , a java programmer may decide that a specific group of properties should become a sub - object . the auto - generation program earlier described may therefore consult an input file containing a list of c structure names ( as defined in the c header files ) which should be created as sub - objects . if the requirements of data definitions change , the input file contents may be changed and the auto - generation program run again to easily create the new sub - objects desired . generation is not the only aspect of object - oriented application development which may be time - consuming , rigorous , and burdensome ; objects which have been implemented must also be tested prior to release . with reference now to fig5 a - 5d , high level flowcharts for processes facilitating automatic testing in object - oriented application development in accordance with a preferred embodiment of the present invention are depicted . those processes increase the automation of web page testing , helping to shorten product development cycles in applications requiring large and / or complex data structures subject to repeated changes . these processes may be also implemented within the modules depicted in fig3 operating in conjunction with the modules implementing automatic code generation , and may also be implemented partially within a server such as server 110 depicted in fig1 and partially within a client such as client 102 depicted in fig1 . fig5 a depicts a process for automated generation of html test pages for server - side objects in accordance with a preferred embodiment of the present invention . as described above , in cases where objects reflect an external data structure such as a database , the data structures may be analyzed and , from an understood rule base , property names for data fields in the database structure may be identified . based on this information , an html page may be generated for each object , where the html page ( 1 ) creates an instance of the object using an automatically generated constructor and ( 2 ) writes every property name and its associated data value for the object . the html page may be utilized as a test case and updated html page test cases may be generated each time the database structure changes . the process begins at step 502 , which depicts beginning test case generation for an object . the process then passes to step 504 , which illustrates generating an html page test case for the object of interest , where the test page is configured to instantiate the object and write all properties and associated data values for the object . the process next passes to step 506 , which illustrates instantiating the object , preferably utilizing the automatically generated object constructor , and then to step 508 , which depicts writing all properties and their associated data values for the object to a display . the steps of 506 and 508 may be performed by loading the html page test case in a browser for viewing , with the page visually checked for indications of errors . the process then passes to step 510 , which illustrates the process becoming idle . since the information to create the dictionary and the information to create the object constructors is available , test pages may also be generated . objects and their properties are simply internal data processing system representations of data . in testing the automatically generated objects , the ability to &# 34 ; dump &# 34 ; the contents of the object ( i . e . the property names and their values ) into some humanly readable form is required . thus , in the process of auto - generating the dictionary and constructors , an html page for each object which will display the contents in formatted html may also be auto - generated . while this could be done by hand , as in previous descriptions the maintenance of such pages may become time - consuming as the contents of the object change due to changes in the data structure ( and potentially changes in sub - object implementation as well ). in the present invention , test pages may be kept current simply by re - running the auto - generation program . as described earlier , appropriate test data must be generated for each property on an object to perform unit test and some functional verification testing . fig5 b depicts a process for test data generation for objects in accordance with a preferred embodiment of the present invention . in cases where the objects reflect an external data store structure such as a database , the data structures can be analyzed to generated data structures for populating each property on the data object . this data may be stored in a manner allowing it to be accessible to the object constructor within test environments . each time the source data structure changes , updated values for the test data structure values may be generated . the process begins at step 512 , which depicts initiating test data generation . the process next passes to step 514 , which illustrates analyzing the data structures sourcing data to the object of interest , and then to step 516 , which depicts generating a test data structure populating each property on the source data structure object . the process than passes to step 518 , which illustrates storing the test data structure in a location and manner such that it is accessible to the object constructor of the object of interest within test environments . the process then passes to step 520 , which depicts the process becoming idle . to instantiate an object using the object constructor as part of loading an html page test case as described above , required arguments for the object constructor must be accessible to verify that the object constructor operated properly . fig5 c depicts a process for echoing constructor arguments as properties on objects in accordance with a preferred embodiment of the present invention . as part of automatically generating an object constructor as described earlier , a special &# 34 ; echo &# 34 ; or &# 34 ; loopback &# 34 ; property may be created for each constructor argument and the value of the argument stored on this property . subsequently , in generating an html page test case as described , the loopback argument properties may also be displayed , allowing simple visual verification that the correct arguments were passed on the object constructor . this permits automatic display of the constructor arguments on test pages in lieu of manual debug . the process begins at step 522 , which depicts generation of an object constructor . the process passes next to step 524 , which illustrates creating a special property for each constructor argument , and then to step 526 , which depicts storing the value of the constructor argument in the special property . the process then passes to step 528 , which depicts displaying the special property in an html page test case , thereby displaying the value of the argument passed on the constructor call to verify that the correct argument value was passed . the process then passes to step 530 , which illustrates the process becoming idle until generation of another object constructor . those skilled in the art will understand that the process depicted may actually be implemented as portions of separate processes , such as the above - described processed for automatic generation of an object constructor and for automatically generating and displaying an html page test case for the object instantiated by the object constructor . as mentioned above , a &# 34 ; short path &# 34 ; which accesses test data without requiring additional components provides a great advantage in situations where use of test data is acceptable . unfortunately , automatically generated object constructors of the type described above typically dictate the source of the data . editing the constructors to access test may become extremely cumbersome where there are many objects , and there exists the possibility of test data version of an application getting out of sync with the real data version . in such circumstances , code that worked fine when debugged on the test data version may not work properly when moved to the real data version . fig5 d depicts a process for toggling between test data and real data in accordance with a preferred embodiment of the present invention . since the object constructors are generated automatically , two versions of each constructor may be created , one accessing test data and the other accessing real data . two separate executables of the application may be built from these different constructor versions , with a developer toggling from real data to test data by pointing to a different load module . since the two constructor versions are created at the same time from essentially the same generation code , the risk of problems existing in one version but not the other is minimal . thus , productive code development and debug may progress with test data without risking problems arising upon migration to the real data . the mechanism described removes dependencies on other components during code development and avoids barriers to returning to test data once the real data path is complete and functioning . the process begins at step 532 , which depicts the object constructor being generated . the process passes next to step 534 , which illustrates creating test data and real data versions of the object constructor , and then to step 536 , which depicts selecting a version of the object constructor by selecting a loading module . the process then passes to step 538 , which illustrates the process becoming idle until the need for toggling between real data and test data versions is again required . referring now to fig6 a high level flowchart for a process of flattening complex data structures in objects in accordance with a preferred embodiment of the present invention is illustrated . the problem of flattening complex data structures despite the use of non - unique names is solved in the present invention by creating &# 34 ; fully - qualified &# 34 ; names for each element . the fully - qualified names contain the names of all nodes within the nesting path in order to understand the true field being addressed . for example , the two amount fields ( amttg ) previously described may be named &# 34 ; balanceinquiry -- ledgerbalance -- amount &# 34 ; and &# 34 ; balanceinquiry -- availablebalance -- amount .&# 34 ; since such fully - qualified names may quickly become overly cumbersome , aliases are created for the fully - qualified names , where the aliases are associated within a correlation file created to map the fully - qualified names to the aliases . the process begins at step 602 , which depicts initiating flattening of nested data structures . the process next passes to step 604 , which illustrates analyzing a data structure for nesting , and then to step 606 , which depicts a determination of whether a nested structure is found . if not , the process proceeds to step 614 , described below . if so , however , the process proceeds to step 608 , which illustrates creating a fully - qualified name for a nested data structure , and then to step 610 , which depicts creating an alias for the fully - qualified name . the process next passes to step 612 , which illustrates mapping the alias to the fully - qualified name in a correlation table . the process then pauses to step 614 , which depicts a determination of whether all data structures have been analyzed . if not , the process returns to step 604 , which illustrates analyzing another data structure for nesting . if so , however , the process proceeds to step 616 , which illustrates the process becoming idle . returning yet again to the bank user profile example , the requirement of going through structures including pointers to structures nesting to pointer to other structures , etc . the full syntax to retrieve the desired field ( password for first cosigner on user &# 39 ; s third checking account ) may be : this not only is cumbersome , but also reveals more about the internal composition of the data structure than a business may wish to disclose . plus , as the architecture changes and another structure gets added in the chain , the name would have to change . since the field desired is known , the data may be flattened and an alias added , such that the field would be accessed by an external programmer by the name : as in the other cases described above , using an auto - generation program and alias mapping structure ( correlation file ), rerunning the auto - generation program updates the alias mappings and an updated object constructor will be created to access . the java programmer , however , is not impacted since the same flattened alias names still access the correct data . the shorter alias names also make programming easier and the resulting code more readable . it is important to note that while the present invention has been described in the context of a fully functional data processing system and / or network , those skilled in the art will appreciate that the mechanism of the present invention is capable of being distributed in the form of a computer readable medium of instructions in a variety of forms , and that the present invention applies equally regardless of the particular type of signal bearing media used to actually carry out the distribution . examples of computer readable media include : nonvolatile , hard - coded type media such as read only memories ( roms ) or erasable , electrically programmable read only memories ( eeproms ), recordable type media such as floppy disks , hard disk drives and cd - roms , and transmission type media such as digital and analog communication links . while the invention has been particularly shown and described with reference to a preferred embodiment , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention .	8
as described above , the present invention allows one to monitor changing data over time intervals , and to determine , from the change of the data during the interval , the present state of the data relative to normative value , and how the data are likely to change in the future or , more specifically , whether or not current patterns in the data can be expected to continue . the types of data for which the invention will operate are those types where a datum is pushed about in various directions by forces governed by a relationship based on the inverse power of the number of degrees of freedom , much like the motion of a small particle suspended in a thin layer liquid , being pushed about by invisible collisions with molecules of the liquid which , as a two - dimensional system , is governed by an inverse - square law ( a three - dimensional system would be governed by an inverse - cube law ). thus , a stock price , whose measurements over time represent a two - dimensional system , does not change purely randomly , as has been believed , but moves based on “ collisions ” with orders from buyers and sellers who are buying and selling predominantly haphazardly . the invention will now be explained with reference to fig1 - 9 . fig1 shows the movement of a particle 10 in a petri dish 11 filled with a thin layer of liquid 12 . in a first time interval δt , the particle moves throughout the area of the circle 13 of radius r . the area of the circle 14 of radius 2r is four times the area of circle 13 . therefore , the time necessary for the particle 10 to move throughout the area of circle 14 is four times δt , or 4δt . this longer time interval includes the initial time interval δt ( insofar as circle 13 is wholly within circle 14 ), and thus concludes 3δt after the end of the initial time interval δt . fig2 is a graph of stock price changes over time . instead of circles of radii r and 2r , what is important is the range of price changes , between a minimum price during an interval and the maximum price during that interval . for a first interval of duration δt beginning at time t 0 and a second interval of duration 4δt beginning at time t 0 , one would expect the range 20 between minimum and maximum prices during the longer interval to be twice the range 21 between minimum and maximum prices during the shorter interval , if the changes produced by buying and selling occurred in a purely brownian motion fashion . fig3 is similar to fig2 , but range 30 is more than twice range 21 . this is a situation where an outside force is tugging against the movement of price and distorting it from expanding at a uniform rate as depicted by the brownian motion circle , and represents a price trend . in this particular case , the trend is upward , which can be seen from the magnitudes of the changes . fig4 is similar to fig2 and 3 , but range 40 is less than twice range 21 . this is a situation where an outside force is constraining the movement of price and distorting it from expanding at a uniform rate as depicted by the brownian motion circle , and represents a price congestion condition . note that while the time intervals in fig2 - 4 are shown as being related by a multiple of 4 , with an expected price range multiple of 2 , the multiple of the time intervals can have any value , with the expected price range multiple being the square root of the multiple of the time intervals . moreover , if the price changes are being compared to a generated brownian motion standard , then any time interval can be used . the graphs of fig2 - 4 can be represented as orbital models as discussed above . the condition of fig2 , in which the range of prices during the longer time interval is exactly twice the range during the shorter interval normally can be expected to exist for only very short times , as conditions move between the other states shown in fig3 and 4 . however , if the condition of fig2 were to persist , it would signify that price changes were purely brownian , with no congealed group of buyers or sellers acting to distort the inverse - square law effect . the abstract orbital representation of such a price - expansion condition would be a circle of arbitary radius ( not shown ), representing an orbit around a single source of inverse - square law force , with no disturbing force . the more common price - expansion situations , illustrated in fig3 and 4 , can be analogized to non - circular elliptical planetary orbits as discussed above , with the core inverse - square law brownian motion “ force ” located at one focus of the ellipse in the role of the star , and the net effect of the distorting “ force ” resulting from the congealed group of buyers or sellers located at the second focus of the ellipse . the values calculated according to the present invention represent velocity along the elliptical orbit . such a non - circular elliptical orbit 50 is shown in fig5 , with the brownian “ star ” 51 at one focus , and the net effect of the distorting forces acting at a second focus 55 . just as in planetary mechanics , the orbiting body will sweep equal areas between itself and the “ star ” in equal times . therefore , when the orbiting body is close to “ star ” 51 , the orbital velocity will be high , and when it is far from “ star ” 51 the orbital velocity will be low . the high - velocity portion 52 of orbit 50 represents conditions where the range of prices during the longer interval exceeds the range during the shorter interval by more than would be expected based on a “ square root of time ” relationship , while the low - velocity portion 53 of orbit 50 represents conditions where the range of prices during the longer interval exceeds the range during the shorter interval by less than would be expected based on a “ square root of time ” relationship . the line 54 represents the points where the “ square root of time ” relationship is met exactly as one moves from region 52 to region 53 or vice - versa . to a gross approximation , if only one point were to be measured — i . e ., only one comparison between a shorter interval and a longer interval was made , region 52 could be considered a price trend region , while region 53 could be considered a price congestion region . however , few useful predictions could be made based on one point . somewhat better predictions could be made based on two points . if two consecutive points are taken ( i . e ., two comparisons between respective long and short intervals ), one can place current conditions in a particular quadrant of orbit 50 . thus , if two points are measured , both exceed the “ square root of time ” expectation , and the second is higher than the first , then the measured phenomenon — whether a stock market or some other phenomenon including a natural phenomenon — is in quadrant i ( assuming a clockwise orbit ), meaning that it is in a trend condition and the trend is accelerating . if two points are measured , both exceed the “ square root of time ” expectation , and the second is lower than the first , then the measured phenomenon is in quadrant ii ( assuming a clockwise orbit ), meaning that it is in a trend condition but the trend is decelerating . if two points are measured , both are less than the “ square root of time ” expectation , and the second is lower than the first , then the measured phenomenon is in quadrant iii ( assuming a clockwise orbit ), meaning that it is in a congestion condition and decelerating into deeper congestion . if two points are measured , both are less than the “ square root of time ” expectation , and the second is higher than the first , then the measured phenomenon is in quadrant iv ( assuming a clockwise orbit ), meaning that it is in a congestion condition but is accelerating out of congestion toward a trend . finally , one could be in a situation spanning two quadrants . if two points are measured , the first exceeds the “ square root of time ” expectation , and the second is less than the “ square root of time ” expectation , then the measured phenomenon has just crossed from a trend condition into a congestion condition . similarly , if two points are measured , the first is less than the “ square root of time ” expectation , and the second is exceeds the “ square root of time ” expectation , then the measured phenomenon has just crossed from a congestion condition into a trend condition . the predictions that can be made using two points are qualitative — e . g ., “ we are moving out of congestion toward a trend .” this is nevertheless useful . for example , if the measured phenomenon is stock price , and the determination is in quadrant iv , it may be a preferable time to buy ( or sell ), because while the price is about to break out into a trend , it is still congested and therefore there may be willing sellers ( or buyers ) who do not yet realize that the price will soon turn around . one can determine the direction of the predicted trend based on the direction of movement of the actual price data at the time of transition from quadrant iii to quadrant iv . that is the point where the congestion begins to decelerate . if at that point prices are moving up , the only way for the congestion to be decelerating is for the speed of price increase to slow until prices start to fall , meaning the coming trend will be a downward trend . if instead at that point prices are moving down , the only way for the congestion to be decelerating is for the speed of price decrease to slow until prices start to rise , meaning the coming trend will be an upward trend . while qualitative predictions can be made , no quantitative prediction can be made , using two points , of how long it will take , for example , to break out of congestion . such a prediction , however , may be made using three points , equally spaced in time . actually , each point represents two time periods — a shorter interval and longer interval , as discussed above , but the emphasis here is that the time between the second and third measurement points should be the same as the time between the first and second measurement points . because equal areas along ellipse 50 must be spanned in equal times , the area spanned between the second and third points must equal the area spanned between the first and second points . moreover , one can then extrapolate and predict where one will be after one or more additional equal time intervals , by determining how far along the ellipse the measurement point must move during each time interval to sweep out the same area as was swept out between the first and second points and between the second and third points . similarly , if one knows the time interval required to sweep a specific area , one can extrapolate and predict how long it will take to reach a specific point on the ellipse based on the total area to be swept to reach that point . for any three orbital velocity points calculated according to the invention and evenly spaced in time , there will be only one elliptical eccentricity to which such orbital velocities can be fit so as to sweep equal areas in equal time . that ellipse can be found using tables of elliptical motion such as are commonly used by astronomers , and which may be found , e . g ., in bauschinger , j ., et al ., tafeln zur theoretischen astronomie , 2d ed . ( leipzig , 1934 ). in the discussion so far , one set of measurements has been discussed , based on a particular duration — e . g ., one - minute / four - minute measurements , or one - hour / four - hour measurements , or one - day / four - day measurements , etc . however , additional information could be gleaned by taking multiple sets of measurements . thus , one could , at every minute , take a one - minute / four - minute measurement , and a one - hour / four - hour measurement , and a one - day / four - day measurement , etc ., thereby looking at long - and short - term patterns . exemplary computer hardware apparatus 610 with which the present invention may be implemented is shown in fig6 . in fig6 , which shows a first preferred embodiment of apparatus according to the invention , system 610 includes a computer 611 comprising a central processing unit (“ cpu ”) 620 , a working memory 622 which may be , e . g ., ram ( random - access memory ) or “ core ” memory , mass storage memory 624 ( such as one or more disk drives or cd - rom drives ), one or more cathode - ray tube (“ crt ”) display terminals 626 , one or more keyboards 628 , one or more input lines 630 , and one or more output lines 640 , all of which are interconnected by a conventional bidirectional system bus 650 . input hardware 636 , coupled to computer 611 by input lines 630 , may be implemented in a variety of ways . modem or modems 632 , which also may be routers or other computer - to - computer communications devices , connected by a telephone line or dedicated data line ( such as a t1 or t3 line ) 634 can be used to allow the system to obtain real - time ( or near - real - time ) data , such a stock price data , from a source such as a direct feed from one of the recognized stock exchanges , or a feed from a business data service . modems / routers 632 also may be used to allow access through the internet or other public access network . alternatively or additionally , the input hardware 630 may comprise cd - rom drives or disk drives 624 , particularly for input of historical data ( in case a user wants to plot data over long periods such as years . in conjunction with display terminal 626 , keyboard 628 may also be used as an input device , particularly to select the time periods to be plotted . output hardware 646 , coupled to computer 611 by output lines 640 , may similarly be implemented by conventional devices . by way of example , output hardware 646 may include crt display terminal 626 for displaying the values of the ratios for the selected periods , or the graphical representation of those values on an ellipse if desired . output hardware 646 might also include a printer or other printing device 642 , so that hard copy output may be produced , or a disk drive 624 , to store system output for later use . finally , output hardware 646 includes the necessary hardware to make the output data available to subscribers over modems or routers 632 . as stated above , implementation of the present invention may be computationally intensive . for example , in a preferred embodiment , every minute the system must calculate the ratio of the range over the previous four minutes to the range over first of those four minutes , for every index and individual stock or other instrument being tracked . this is in addition to similar calculations done hourly for the preceding four hour period , daily for the preceding four day period , etc . this can be achieved in a preferred embodiment by having subscribers allow their computers 660 to be used , while they are connected to the system , to perform some of the calculations during processor idle time . this could be required by the subscription agreement , or it could be optional , with a discount offered to those who allow their computers to be used . such a distributed computing system can be implemented using the frontier ™ distributed computing platform available from parabon computation , inc ., of fairfax , va ., with subscriber computers 660 running the pioneer ™ 90 client software , also from parabon computation , inc . the pioneer ™ software functions as , or in place of , a “ screen saver ” program , processing data during periods when the system would otherwise be idle , and returning the results to the frontier ™ platform via the internet or other data network to which computers 660 are attached . in operation , cpu 620 coordinates the use of the various input and output devices 636 , 646 , coordinates data accesses from mass storage 624 and accesses to and from working memory 622 , and determines the sequence of data processing steps . cpu 620 preferably also directs the parcelling out of data to subscribers &# 39 ; computers 660 for processing , and the collection and aggregation of processed data returned by subscriber computers 660 . whether performed solely on computer 611 ( or on a plurality of computers co - located with computer 611 ), or whether performed on a distributed basis such as on subscriber computers 660 as just described , each computer would , for a given measurement point , examine all recorded values between four ( for example ) time units prior to the measurement point and three time units prior to the measurement point of the price or index to be measured , and compute the difference between the maximum and minimum values during that interval . the computer would then multiply that result by two to obtain the expected range between the longer time interval between four time units prior to the measurement point and the measurement point . the computer would then examine all recorded values of the price or index to be measured during that longer interval , and again compute the difference between the maximum and minimum values during that interval to obtain the actual range . the actual range would then be compared to the expected range as described above . alternatively , computer 611 or each individual subscriber computer ( not shown ) could be equipped with a brownian motion standard chip as described above , which would allow a direct comparison , for any time interval , between the actual and expect range of change of the price or index to be measured . for example , the random number generator provided in the intel ® 810 chipset , from intel corporation , of santa clara , calif ., generates a non - deterministic “ random ” stream of numbers from thermal noise from a resistor . this stream of numbers , based on thermal noise , is in fact a brownian motion standard . the results of the data comparisons according to the invention may be displayed to users or subscribers in a number of ways . for example , as shown in fig7 , and particularly if the brownian motion standard is used , the results may be displayed by graphing the expected gaussian bell curve 70 representing a normal distribution , and then superimposing a curve 71 representing actual conditions . these curves would be for a specified time interval , such as the four - minute interval if one - minute / four - minute measurements are used , or the four - hour interval if one - hour / four - hour measurements are used . the curves would show the relative number of occurrences ( each representing one transaction ) of normalized price changes about a mean value , which can be expected to be zero . thus , preferably , the peaks of curves 70 and 71 would represent the normalized number of occurrences , or expected occurrences , of price changes of zero magnitude , and the abscissa preferably would be labelled with the number of standard deviations above or below zero . the ordinate preferably would be labelled in percentages , with 100 % representing the peak of gaussian curve 70 . if the graph in fig7 represents data captured during a sufficiently long interval — e . g ., four hours , the number of data points ( transactions ) should be sufficient to generate curve 71 with confidence . however , if there are too few data points ( e . g ., the interval is short , such as four minutes , and there are too few transactions ), then well - known conventional “ bootstrapping ” techniques can be used generate a curve 71 from the available data . in such a case , there would be some uncertainty in the curve . this could be displayed to the user by , e . g ., displaying a band ( not shown ) of a different color about curve 71 , with the width of the band representing the margin of error of curve 71 . alternatively , as shown in fig8 , the ellipse 50 described above can be displayed , with a highlighted point 80 representing the present , and points 81 representing past measurements . in addition , the eccentricity of the ellipse would reveal the relative size of the congealed group of buyers / sellers (“ dissenters ”) as compared to the brownian core of market participants (“ majority ”). for example , if the ellipse is close to circular , then the number of dissenters is small and any apparent trends may be statistically insignificant , while if the ellipse is highly elongated , the number of dissenters is very large and it may be too late to join the trend ( most of the gains may have already occurred ). additional information ( not shown ) could be indicated on the display of fig8 . for example , indicia identifying halves of ellipse 50 representing congestion and trend situations , or even quadrants , as described above , representing accelerating trend , decelerating tend , decelerating ( deepening ) congestion , and accelerating ( lessening ) congestion , could be displayed to assist users in interpreting the display . as in the case of the display of fig7 , the display of fig8 , the data used to create ellipse 50 may be insufficient to give full confidence in the result . for example , if each point 81 is based on data taken during a short time period , then the location of each point may have a sufficient margin of error to introduce some uncertainty into the fit of points 81 onto an ellipse . in such a case , any uncertainty in the elliptical path could be represented by a band of a different color as described in connection with fig7 . finally , in a particularly preferred display shown in fig9 , a simple line graph 90 showing the value of the measured price or index ( e . g ., the dow jones industrial average (“ djia ”)) as a function of time can be provided . superimposed on this line graph 90 , perhaps in a different color , can be a pair of bars 91 representing the expected range of the depicted price or index over various measured time intervals . thus , if the graph is a daily graph of the djia , the measured time intervals might be overlapping four - day intervals , each beginning one day apart . the effect would be a band 92 representing the expected range of the djia superimposed on the graph 90 of the djia itself . note that in fig9 , the bars 91 forming band 92 are shown only for the first few time intervals on the graph to avoid cluttering the graph . as long as the djia value remains inside band 92 , things are as expected . however , if the value moves outside band , it may signal a trend which is upward if the value is above the band or downward if the value is below the band . although not shown , a display integrating two or more of the displays of fig7 , 8 and 9 could be provided . thus it is seen that a model of market activity that explains the non - normal distribution of such activity , and a technique for market prediction based on that model , has been provided . one skilled in the art will appreciate that the present invention can be practiced by other than the described embodiments , which are presented for purposes of illustration and not of limitation , and the present invention is limited only by the claims which follow .	6
fig1 shows a medium 1 , fig1 a being a plane view , fig1 b showing a small part in a sectional view taken on line b - b , and fig1 b showing a portion 2 of the medium 1 in a larger scale . the medium 1 is a disc having tracks forming each a 360 ° turn of a spiral line 3 . each track comprises a groove 4 and a land 5 . for the purpose of recording data , the medium 1 has a recording layer 6 , which is deposited on a transparent substrate 7 and which is covered by a protective coating 8 . the data are recorded on the grooves 4 . the tracks are scanned by a laser beam that enters the medium 1 through the substrate 7 . the tracks have a continuous sinusoidal deviation from their average centreline . this sinusoidal deviation is referred to as wobble . in some standards the wobble is modulated to carry information . for instance in dvd + r the wobble is phase - modulated . the medium is a phase change medium which means that the recording layer 6 is made of a material capable of changing locally between an amorphous state and a crystalline state . data are written by locally heating the medium to a temperature at which it changes from the crystalline state to the amorphous state , thus creating amorphous marks with a different reflectance than the surrounding crystalline area . conversely , data are erased by locally heating the medium to a temperature at which it changes from the amorphous state back to the crystalline state . the material of the recording layer 6 is characterized by a maximum crystalline velocity above which change from said amorphous state to said crystalline state cannot be achieved . fig2 shows an example of a device 10 according to the invention for driving the medium 1 . the device 10 comprises inter alias an optical unit 20 , a bus 22 , a microprocessor assembly 24 , a user interface 26 a source encoder / decoder 28 , a channel decoder 30 , a channel encoder 32 , a servo block 34 , a motor control unit 35 and a wobble processing block 36 . the source encoder / decoder 28 is coupled to a host system 37 ( by way of example the host system 37 can be a pc , an audio player , a video layer . . . ). the microprocessor assembly 24 , the user interface 26 , the source encoder / decoder 28 , the channel decoder 30 , the channel encoder 32 , the servo block 34 , the motor control unit 35 and the wobble processing block 36 are connected to the bus 22 . the user interface 26 is designed so as to allow a user to select an operating mode amongst a plurality of operating modes including : a writing mode in which data provided by the host system 37 are written on the medium - 1 by locally changing the material of the recording layer from the crystalline state to the amorphous state , and an erasing mode in which data written on the medium 1 are erased by locally changing the material of the recording layer from the amorphous state back to the crystalline state . advantageously a reading mode is also available in which data written on the medium 1 are read and delivered to the host system 37 . the optical unit 20 comprises a radiation source 38 , for instance a semiconductor laser , generating a laser beam 41 that is directed onto a track of the medium 1 by means of an optical system comprising , inter alias , a focussing objective 42 . the radiation source 38 is controlled by a radiation source control unit 40 . the radiation source control unit 40 is connected to the bus 22 and controls the power of the laser beam 41 depending on the selected operating mode . typically , the radiation source control unit 40 drives the radiation source 38 so that the produced laser beam 41 has : by way of example , the reading power is set to 0 . 7 mw ± 0 . 1 mw , the writing power is set between 35 mw for a writing linear velocity equal to 16 × ( the writing power depends on the writing linear velocity ), and the erasing power is comprised between 5 mw and 10 mw . the laser beam 41 produces a small spot 43 on the medium 1 . for the spot 43 to scan the tracks , the medium is rotated about a shaft 44 by a motor 45 . the motor 45 is controlled by the motor control unit 35 . the motor control circuit 35 adapts the linear velocity of the motor depending on the selected operating mode . conventionally , the linear velocity used in the reading mode is referred to as reference speed and is noted x . by way of example in the dvd + r standard the reading speed is x = 3 . 49 m · s − 1 . according to the invention : the linear velocity used when the writing mode is selected is high ( it can be up to 16 ×); the linear velocity used when the erasing mode is selected is low ; it is lower than the maximum crystalline velocity which depends on the material used for the recording layer 6 ; typically it is comprised between 1 × and 2 . 4 ×. the laser beam 41 is reflected by the medium 1 . the projected and reflected beams are separated one from the other by a beam splitter 46 ( for example a partially transparent mirror ). the reflected radiation beam 47 is passed on to a photo detector 50 . the photo detector 50 has a radiation sensitive surface divided into a plurality of quadrants so as to generate a plurality of photocurrents . in fig2 , a four - quadrants photo detector is represented by way of example . this is not restrictive . the four quadrants of the photo detector 50 carry reference number q a , q b , q c and q d respectively . they generate four photocurrents a , b , c , and d . the four photocurrents a , b , c and d are forwarded to a pre - processing block 60 responsible for generating : several difference signals that are input to the servo block 34 , a wobble signal that is input to the wobble processing block 36 , and a data signal that is input to the channel decoder 30 . the servo block 34 is responsible for controlling the optical unit 20 ( including positioning the optical unit 20 , focussing the laser beam 41 , tracking the spiral line 3 ). the wobble processing block 36 is responsible for processing the wobble signal so as to recover the information carried by the wobble signal . the channel decoder 30 is responsible for recovering the source - encoded data from the data signal read by the optical unit 20 . the source - encoded data are forwarded to the source encoder / decoder 28 in order to be decoded . eventually , the decoded data are delivered to the host system 37 . the host system 37 can also provide data intended to be written on the medium 1 . these data are encoded by the source encoder / decoder 28 . the source - encoded data are then processed by the channel encoder 32 . the channel - encoded data are applied to the radiation source control unit 40 . as explained by reference to fig1 , the wobble signal is modulated so as to carry information ( usually physical format information ). in the dvd + r standard this information is called address - in - pregroove ( or adip ). the adip notably comprises data about the reading and writing power and the reading and writing linear velocity . currently , there is capacity for transmitting additional pieces of information compared to the adip defined in the standard . in a preferred embodiment of the invention , the erasing power and the erasing linear velocity are transmitted as a part of the adip . this is advantageous because the adip information is included in the medium itself during the manufacturing stage . it doesn &# 39 ; t have to be written on disc in a latter stage and it can neither be removed nor modified . alternatively , the erasing power and the erasing linear velocity can be written in the information zone of the medium ( that is in the recordable area of the medium ) or it can be stored in the device 10 . in order to allow for partial recording of the medium and subsequent appending of data to a partly recorded medium , the concept of multi - sessions has been introduced in many standards . for instance , a medium compliant with the dvd + r standard may contain a single session or a plurality of sessions . a table referred to as table of content is stored at the beginning of the information zone and contains the necessary information about recording on the disc ( in particular , the location of the sessions ). in an advantageous embodiment the user interface 26 is designed so as to allow selection by the user of an area to be erased on the medium . for instance , the area to the erased may be a session , a plurality of sessions , or the whole information zone . when the user selects one or more session ( s ), the microprocessor of the microprocessor assembly 24 recovers in the table of content the locations of the selected session ( s ) and drives the servo block 34 accordingly . as a result , the position of the laser beam 41 is controlled so as to scan only the locations of the selected session ( s ). after one or more sessions have been erased , the table of content must be updated so as to remove reference to the erased session ( s ). in another embodiment , when the whole medium is to be erased ( either because this is the option selected by the user , or because there is no other erasing option available ), the microprocessor of the microprocessor assembly 24 checks in the table of content the locations of the areas of the medium that are recorded . this information is used to skip during the erasing process the parts of the medium that are not recorded ( the servo block 34 is instructed accordingly by the microprocessor ). this embodiment is advantageous because it leads to a reduction in the amount of time required for the full erasing process ( as erasing is done at low speed it is a rather long process ; typically it may take 1 to 2 hours ). the block diagram of fig3 is a schematic representation of a preferred embodiment of a method according to the invention for driving the medium 1 . in box 100 the medium 1 is introduced in the device 10 ; then , in box 101 the required information is recovered from the medium 1 , notably the adip information including the erasing power and the erasing linear velocity be used with the medium 1 ; then , in box 102 , the user is prompted to select an operating mode amongst a plurality of operating modes including a writing mode w , an erasing mode e and optionally a reading mode r ; then , in box 103 , depending on the selected operating mode , enquiries are made in the table of content to determine the location ( s ) to be scanned ; then , in box 104 , the power p and the linear velocity s are set depending on the selected operating mode ; then , in box 105 , the medium is scanned at the appropriate locations with a laser beam having the appropriate power while the medium is rotated at the appropriate linear velocity so as to read or write or erase the medium ; then , in box 106 , when applicable , the table of content is updated . with respect to the described phase change storage medium , driving device and driving method , modifications or improvements may be proposed without departing from the scope of the invention . the invention is thus not limited to the examples provided , in particular it is not limited to the dvd + r standard . in the embodiment described with reference to fig2 , the wobble is a modulated signal used to carry location information but not for tracking . this is not restrictive . the wobble signal can also be used for tracking as an alternative to the known “ one - spot push - pull ” or “ 3 - spots push - pull ” methods . the invention is applicable independently on the type of wobble signal ( pure periodic or modulated wobble signal ) and independently on the way the wobble signal is used ( used for tracking and / or carrying information ). when the wobble is not modulated , then the information regarding the power and linear velocity to be used have to be located in the information zone of the medium . the embodiment of fig2 uses a four - quadrant photo - detector . this is not restrictive . for instance a two - segments photo - detector having a dividing line running parallel to the direction of the tracks to be scanned can be used instead of a four - quadrant photo - detector . the use of the word “ comprise ” does not exclude the presence of other elements or steps than those listed in the claims or in the description .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.