text stringlengths 1.55k 332k | label int64 0 8 |
|---|---|
a cellulosic pulp ( 272 g , 100 g oven dried — o . d .) which had never been previously dried was prepared from hardwood ( a mixture of principally gum , oak and maple ) by a steam prehydrolyzed kraft cooking process and several bleach stages prior to cold caustic extraction ( cce ) in a 10 % naoh solution at 3 . 0 % consistency ( 100 g o . d . pulp in 3233 . 3 g of 10 % naoh solution ). the pulp was slurried for 10 minutes at a temperature of 24 - 25 ° c . before its recovery in a small - scale centrifuge for 10 minutes to remove filtrate and recover 348 . 5 g of alkaline pulp stock . this entire process was repeated two more times using 100 g o . d . of starting pulp to attain a total of 1021 . 6 g of stock . the stock was subdivided into four equal portions of about 66 g o . d . equivalent ( 255 . 4 g ) based on the starting combined pulp weight of 300 g . each batch was shredded in a waring blender for about 24 seconds total time ( 3 × 8 seconds ) prior to placement in 2 liter , heavy duty plastic containers which were then flushed with nitrogen for one minute . propylene oxide ( 6 . 6 g ) was placed into each of the four containers which were then sealed and placed in a heated roller cabinet for 1 . 25 hours at 50 ° c . based on the total o . d . weight of the starting pulp after extraction ( 66 g × 4 = 264 g total ), a total of 26 . 4 g of po was added ( 6 . 6 g × 4 ), or 10 % by o . d . pulp weight . after removal from the roller cabinet , each stock was quenched by addition of large quantities of water and allowed to cool before processing . the treated pulps were then processed at ambient temperatures by slurrying in water followed by recovery and numerous water washes in a buchner funnel . the pulps were then reslurried in water , and acidified to ph between 2 . 5 - 3 . 0 with dilute sulfuric acid , and stirred for at least five minutes before recovery in a buchner funnel and numerous water washes . all four similarly processed stocks from the plastic reaction vessels were combined and slurried together prior to recovery , sheeting , and drying to recover 306 . 3 g of stock at 89 % o . d ., or overall yield from starting pulp of 90 . 1 %. the pulp had a hydroxypropoxy content of 2 . 9 %. example 1 was repeated but 16 % naoh solution was used for cce rather than 10 % naoh . the po treatment level was again 10 %, being based on the o . d . pulp weight of the cold caustic extracted stock . overall pulp product yield from starting stock was about 90 . 7 %. the resulting pulp had a hydroxypropoxy content of 3 . 3 %. example 2 was repeated , except that 12 . 5 % po was added rather than 10 %. the overall pulp product yield was about 90 . 9 % from starting stock . the resulting pulp had a hydroxypropoxy content of 3 . 7 %. example 2 was repeated , except that 15 % po was added rather than 10 %. overall pulp product yield was about 91 . 0 %. the resulting pulp had a hydroxypropoxy content of 4 . 5 %. for comparative purposes , control pulp samples ( not reacted with po ) were prepared by processing the same starting pulp using 10 and 16 % naoh , respectively , for cce ( as in examples 1 & amp ; 2 ). the pulps were recovered immediately after the cold caustic extraction stage by slurrying the centrifuge pulp cake in water with recovery on a buchner funnel and rinsing to remove excess caustic . this was followed by reslurrying and acidification with dilute sulfuric acid to ph 2 . 5 - 3 . 0 , recovery in a buchner funnel , and numerous water rinses prior to sheeting and drying . the 10 % naoh control sample ( example 5 ) was recovered in about a 90 . 2 % yield from starting stock , while the 16 % naoh control sample ( example 6 ) was recovered in about a 88 . 6 % yield . for comparative purposes the pulps prepared in the above examples were evaluated in low catalyst ( 1 . 4 % h 2 so 4 activation ) acetylation tests . the results along with those obtained on standard hardwood acetate grade pulp ( sulfatate - h - j ), and a cotton linters pulp ( clp ; buckeye 2355 — acetate grade clp ) are shown below in table 1 . conditions were selected to require an esterification time in the 170 - 190 minute range . more highly reactive pulps require lower acetylation temperatures . however , none of the modified hardwood pulps required acetylation temperatures that were significantly different from that used to acetylate standard sulfatate - h - j pulp . the cotton linters pulp required a significantly higher temperature than the hardwood acetate standard and the modified hardwood pulps of the invention , illustrating the slower reactivity of cotton linters as compared to wood cellulose pulps . | 2 |
with reference to fig3 and 4 , processes in accordance with the present disclosure are shown . fig3 shows preferred fabric treatment agent application zone a , wherein ingredients can be added to web 5 ′ subsequent to the coating of ingredients 17 . zone a is located after cooling drums 24 and 26 before cutting station 28 . by applying perfumes and / or other fabric treatment agents at or near zone a , the high temperatures associated with the upstream coating operation are avoided . in addition , because web 5 ′ is rolled - up at trimming station 28 shortly after application zone a , the fabric treatment ingredients become trapped as web 5 ′ winds about itself . fig4 shows an alternate , preferred application zones b . in this embodiment , the fabric treatment agents are applied in prior to final folding and cutting of the substrate . several zones are shown because the preferred process performs several cutting and folding operations simultaneously . an advantage of waiting to apply certain fabric treatment agents just prior to cutting and folding is that roles 2 ′ can be generic across several brands . more specifically , for example , if the only difference between two or more brands of product is the type or quantity of perfume , rolled stock 2 ′ can be used for each brand as needed . turning to fig5 a preferred apparatus for applying fabric treatment agents to web 5 ′ is shown . spray assemblies 80 have controllers 81 and air flow modules 82 for controlling the flow and spray pattern of liquid spray 83 emitted from nozzles n . spray assemblies 80 can be pressure spray assemblies or , more preferably , ultrasonic sprayers as shown . preferred ultrasonic spray assemblies are available from sono - tek corporation , milton , n . y . the sono - tek sprayers use ultrasonic power to atomize liquids . the flow of liquid from nozzles n and the flow of air from modules 82 are regulated by controllers 81 . controllers 81 can be programmed to apply more or less liquid agent and can be coupled to web speed information so as to apply predetermined , uniform quantities of fabric treatment agent . while three spray assemblies or shown , one or more can be used , depending on the width of web 5 ′ and on the width of the spray . spray assemblies can be used in zones a or b of fig3 and 4 , respectively . with reference to fig6 and 7 , an alternate preferred apparatus for applying fabric treatment agents web 5 ′ is shown . in fig6 the perfume applicator generally includes tubular member 50 having a plurality of micro holes 52 . web 5 ′ is directed past the applicator by one or more guide rolls 54 . the number and configuration of guide rolls 54 is not critical and could even be eliminated . liquid fabric treatment agent is preferable pumped into applicator 50 by means of a metering pump 60 associated with tank 70 . as shown , the liquid passes through tube 58 , into one end of applicators 50 . most preferably , the liquid is pumped into applicators 50 through a manifold ( not shown ) that directs the liquid into each end of the applicators 50 . such a system can provide a more uniform pressure profile within applicator 50 . applicators 50 are preferably fabricated from a low friction material that can apply the fabric treatment agents to the web as it contacts tubular member / applicator 50 and passes over the micro holes . while two rows of micro holes are shown , various combinations of holes , slits or other orifice that allow the liquid to exit the applicator can be used . applicators 50 can be used in zones a or b of fig3 and 4 , respectively . fig8 shows several applicators similar to fig6 in use prior to the steps of cutting and folding . in a preferred process where one or more of the fabric treatment applicators are used to apply perfume , at least between about 50 % to about 75 % by weight of the total perfume in the final product is added after the high temperature coating operation . in a most preferred process about 95 % to about 100 % by weight of the total perfume in the final product is added after the high temperature coating operation . by applying certain fabric treatment agents at either or both zone a and zone b , the need for changing and cleaning ingredients 17 in coat pan 15 can be eliminated , allowing for manufacturing efficiencies . in practice it was unexpectedly found that the post - added perfume could absorb into the dryer sheet material that was processed as shown in fig1 . by absorbing , the sheet remained “ non - tacky ”, and processing , such as cutting and packaging , were not hindered . see example 2 , below . an 11 inch by 6 . 75 inch polyester substrate was first coated with 1 . 392 grams of anti - static / softening agent on a bench - top coater . subsequently , 0 . 058 grams of perfume ( 4 % by weight , excluding the weight of the substrate ) was sprayed onto the coated sheet . this sheet and a typical production sheet were analysed by a headspace gc . the production sheet was produced using the process shown in fig1 and 2 , i . e ., without de - coupling the perfume from the coating step . the perfume level in ingredients 17 dosed into coat pan 15 was also initially 4 % by weight . the analysis data is shown in the following table . the data indicates that the new process has improved the perfume retention . therefore , for example , if the final product sold to the consumer only needs 0 . 033 g of perfume to deliver the expected perfume benefit , the methods disclosed herein allow for the addition of only 0 . 0347 g of perfume per sheet to deliver the same / expected amount — more than 40 % reduction in perfume use . an 11 - inch wide dryer sheet roll was coated with anti - static / softening agent and perfume via the production process of fig1 . the role was mounted on a pilot scale coater . an applicator device as shown in fig6 was set to contact the web of dryer sheet between unwind and rewind rolls . the roll was unwound and rewound at the speed of 10 ft / min while a pump was pumping perfume with the flow rate of 1 . 03 g / min onto the coated web . the addition of perfume is equal to extra 4 % of perfume added to the sheet . the sheets with the extra 4 % perfume made by this method showed a minimal increase of tackiness . thus , the process was demonstrated . | 3 |
referring now to fig1 to 7 , a cable sleeve for the structured storage and handling of optical waveguides guided in optical waveguide cables designed in the form of a hood sleeve is shown . fig1 to 6 relate to a first exemplary embodiment of the invention ; fig7 shows a second exemplary embodiment of the cable sleeve according to the invention . the cable sleeve may be used with hood sleeves , and may also be used with any other types of sleeve , for example , without limitation , with so - called in - line sleeves . fig1 shows a cable sleeve 10 according to the invention according to a first exemplary embodiment of the invention in the assembled state ; an exploded view of the cable sleeve shown in fig1 can be seen in fig2 . the cable sleeve 10 of fig1 and 2 according to the invention is designed in the form of a hood sleeve and has a covering body 11 designed in the form of a covering hood , which according to fig2 defines an interior 12 of the cable sleeve 10 . a sealing body 14 can be inserted in an opening 13 of the covering body 11 , wherein on the one hand optical waveguide cables can be fed into the interior 12 of the cable sleeve 10 and on the other hand said optical waveguide cables can be fed out of the interior 12 via the sealing body 14 . the optical waveguide cables are fed into and out of the interior 12 of the cable sleeve 10 by means of openings 15 integrated in the sealing body 14 . the covering body 11 of the cable sleeve 10 according to the invention is shown by itself in fig4 and 5 . fig6 shows the sealing body 14 likewise by itself , namely in an exploded view . the sealing body 14 of the cable sleeve 10 according to the embodiment has two dimensionally stable end pieces 16 and 17 , between which is arranged a compressible gel element 18 . as can be seen from fig6 , the sealing body 14 is designed in two parts and is accordingly made up of two halves 19 and 20 . in the assembled state of the cable sleeve 10 , the separation plane of the sealing body 14 hereby runs in the longitudinal direction of the cable sleeve 10 or in the longitudinal direction of the covering body 11 . according to fig6 , the two halves 19 and 20 of the sealing body 14 have projections 21 and recesses 22 respectively , wherein , when the sealing body 14 is made up of the two halves 19 and 20 , the projections 21 of one half 19 or 20 respectively engage in a recess 22 of the corresponding other half 20 or 19 respectively . spring elements 23 are integrated into the covering body 11 or into the interior 12 thereof . in doing so , the spring elements 23 are accommodated in projections 24 formed on an inner side or inner surface of the covering body 11 . the projections 24 stand radially inwards around the inner surface of the covering body 11 and accordingly protrude into the interior 12 . in the assembled state of the cable sleeve 10 according to the invention , namely when the sealing body 14 is inserted in the opening 13 of the covering body 11 , a dimensionally stable end piece of the sealing body 14 , namely the inner end piece 17 , bears against the spring elements 23 and the projections 24 . the projections 24 form stops for the sealing body 14 and limit the insertion depth thereof into the covering body 11 . the spring elements 23 store the force applied when locking the cable sleeve 10 and hold the gel element 18 of the sealing body 14 under compression force . as a result of this , on the one hand , optical waveguide cables fed into or out of the cable sleeve 11 via the openings 15 of the sealing body 14 are sealed , and on the other the sealing body 14 is sealed with respect to the covering body 11 of the cable sleeve 10 according to the invention . according to fig2 , the fitted position of the sealing body 14 in the covering body 11 is defined by projections 25 , which are associated with the sealing body 14 and which can be inserted into slot - like recesses 26 of the covering body 11 . at the same time , a projection 25 of this kind is associated with each half 19 and 20 of the sealing body 14 , wherein each of the two projections 25 can be inserted into a slot - like recess 26 of the covering body 11 in each case . according to fig2 and 6 , the projections 25 are associated with the outer dimensionally stable end piece 16 of the sealing body 14 in the assembled position of the cable sleeve 10 . in the exemplary embodiment of fig1 to 4 , the cable sleeve 10 according to the invention has a locking body 27 designed in the form of a locking cap , which locks the cable sleeve 10 and fixes the sealing body 14 to the covering body 11 . in the exemplary embodiment shown , the locking body 27 , which is designed in the form of a locking cap , can be fixed by means of a bayonet - like locking mechanism 28 on the covering body 11 , wherein the bayonet - like locking mechanism 28 is formed from projections 29 , which are formed on an outer surface of the covering body 11 , together with slot - like recesses 30 in the vicinity of the locking body 27 . at the same time , the projections 29 of the covering body 11 can be inserted in the recesses 30 of the locking body 27 , wherein the locking body 27 can then be twisted with respect to the covering body 11 . after twisting the locking body 27 relative to the covering body 11 , the projections 29 engage in corresponding undercuts of the recesses 30 as shown in fig1 . the slot - like recesses 30 of the locking body 27 run in a sloping manner , namely in such a way that , when it is twisted , the locking body 27 executes a screw - like relative movement with respect to the covering body 11 and thereby presses the sealing body 14 against the projections 24 and the spring elements 23 . this provides the compression force required to deform the gel element 18 of the sealing body 14 . when the cable sleeve 10 is assembled or put together , the sealing body 14 is accordingly inserted into the opening 13 of the covering body 11 , wherein the projections 24 , which act as stops , limit the insertion depth of the sealing body 14 in the covering body 11 . when the sealing body 14 bears with the inner end piece 17 against the projections 24 in the uncompressed state , said sealing body then stands at least partially around the covering body 11 with the outer end piece 16 , or protrudes at least partially therefrom . the locking body 27 is screwed to the covering body 11 in the manner of a bayonet , wherein in this case the gel element 18 of the sealing body 14 is compressed due to the fact that the sealing body 14 bears with the inner end piece 17 against the projections 24 . at the same time , the spring elements 23 , which are accommodated in the projections 24 and which store the force applied to lock the cable sleeve 10 , are also compressed and hold the gel element 18 of the sealing body 14 under compression force . this enables a change in the behavior of the gel element 18 due to temperature to be balanced or compensated for and a good sealing action thereof to be guaranteed . according to fig1 and 2 , the locking body 27 , which is designed in the form of a locking cap , is designed to be open on its face side in such a way that the openings 15 of the sealing body 14 are not covered . the outer dimensionally stable end piece 16 of the sealing body 14 in the assembled state of the cable sleeve 10 thereby comes to bear against a circumferential edge 31 of the locking body 27 . the cable sleeve 10 of the exemplary embodiment of fig1 and 2 can be fixed to a mast or wall by means of a retaining bracket 32 shown in fig3 , wherein bar - like projections 33 of the retaining bracket 32 can be inserted in recesses 34 of the locking body 27 for this purpose . here , the recesses 34 are made in radial projections 25 on the outside of the locking body 27 . fig7 shows a second exemplary embodiment of a cable sleeve 35 according to the invention , which differs from the exemplary embodiment of fig1 to 6 only in the design of the locking body . to avoid unnecessary repetition , the same reference numbers are therefore used for the same assemblies , and reference is made to the comments relating to the example of fig1 to 6 . only the details in which the exemplary embodiment of fig7 differs from the exemplary embodiment of fig1 to 6 are discussed below . as already mentioned , the exemplary embodiment of fig7 differs from the exemplary embodiment of fig1 to 6 only in the design of the locking body , two locking bodies 36 , which are designed in the form of locking clips , being provided in the exemplary embodiment of fig7 . according to fig7 , hooks 37 of the locking clips 36 can be inserted in recesses 38 of the sealing body 14 , wherein , in the closed position of the locking clips 36 shown in fig7 , the hooks 37 press the sealing body 14 against the spring elements 23 and projections 24 integrated in the covering body 11 . according to fig7 , the hooks 37 engage in openings 38 , which are formed on the outer dimensionally stable end piece 16 of the sealing body 14 in the assembled state . accordingly , in the assembled state of the cable sleeve 35 , the sealing body 14 is fixed in the covering body 11 by means of the locking clips 36 , and furthermore the compression force , which is required to compress the gel element 18 of the sealing body 14 and which is stored by the spring elements 23 and exerted on the sealing body 14 , is provided by the locking clips 36 . | 6 |
it is to be understood that the following disclosure provides many different embodiments , or examples , for implementing different features of various embodiments . specific examples of components and arrangements are described below to simplify the present disclosure . these are , of course , merely examples and are not intended to be limiting . in addition , the present disclosure may repeat reference numerals and / or letters in the various examples . this repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and / or configurations discussed . as depicted in fig1 , rotor 101 for use in a permanent magnet motor may include rotor body 103 . rotor body 103 may be generally cylindrical in shape . in some embodiments , rotor body 103 may be coupled to output shaft 105 . as rotor 101 is rotated within the permanent magnet motor , output shaft 105 serves to transfer the rotational power generated by rotor 101 to other equipment ( not shown ). rotor 101 may , in some embodiments , include one or more permanent magnets 107 positioned about the exterior surface of rotor body 103 . in some embodiments , as depicted in fig1 , permanent magnets 107 may be annular in shape . the concave surface of each permanent magnet 107 may have generally the same diameter as the exterior surface of rotor body 103 . permanent magnets 107 may be configured such that the magnetic axis of each permanent magnet is substantially aligned to be normal to the surface of rotor body 103 . in some embodiments , the magnetic field of adjacent permanent magnets 107 are in opposition , so that the magnetic pole of permanent magnets 107 alternate between north and south . in some embodiments , permanent magnets 107 may be formed by sintering of permanent magnet material such as , for example and without limitation , a rare - earth magnet such as neodymium . in other embodiments , permanent magnets 107 may be formed by a rapid solidification process as understood in the art . as depicted in fig2 , permanent magnet 107 may be coupled to rotor body 103 . in some embodiments , permanent magnet 107 may have one or more holes 109 formed therein . hole 109 is aligned so that when permanent magnet 107 is placed on the outer surface of rotor body 103 , hole 109 extends in a direction normal to the surface of rotor body 103 . in some embodiments , hole 109 may include countersink 111 . rotor body 103 may include one or more mounting holes 113 positioned to align with holes 109 of permanent magnets 107 . in some embodiments , mounting holes 113 may be tapped to accept the thread of threaded fastener 115 . in some embodiments , threaded fastener 115 may be , for example and without limitation , a screw , bolt , or other threaded fastener . countersink 111 may allow threaded fastener 115 to , when installed , remain below the outer surface of permanent magnet 107 which may , for example , avoid interference between threaded fastener 115 and other parts of the permanent magnet motor . in some embodiments , a thread - locking compound may be applied to threaded fastener 115 to , for example , prevent threaded fastener 115 from unintentionally unthreading from rotor body 103 . in some embodiments , a potting material or adhesive may be applied between , for example , rotor body 103 and permanent magnet 107 . in the embodiment depicted in fig2 , threaded fastener 115 is a flathead screw with a matching tapered profile to that of countersink 111 . one having ordinary skill in the art with the benefit of this disclosure will understand that threaded fastener 115 may be replaced by a threaded connector having a different profile without deviating from the scope of this disclosure . likewise , countersink 111 may have a different profile such as , for example and without limitation , a counterbore without deviating from the scope of this disclosure . for the purposes of this disclosure , the term “ countersink ” is intended to include both countersinks and counterbores unless specifically differentiated . in some embodiments , elastomeric body 117 may be positioned between the head of threaded fastener 115 and permanent magnet 107 when permanent magnet 107 is installed to rotor body 103 . elastomeric body 117 may be formed of an elastomeric material , allowing elastomeric body 117 to be installed under elastic compression between threaded fastener 115 and permanent magnet 107 . because threaded fastener 115 may have a thermal expansion coefficient and / or thermal conductivity different from that of permanent magnet 107 , threaded fastener 115 may thermally expand and increase in length more rapidly than permanent magnet 107 as permanent magnet 107 , threaded fastener 115 , and rotor body 103 increase in temperature during normal use . in such a case , the compressive stress on elastomeric body 117 between threaded fastener 115 and permanent magnet 107 may decrease . elastomeric body 117 , being elastically deformed , increases in size as the stress thereon decreases , which may maintain the compressive force between threaded fastener 115 and permanent magnet 107 . elastomeric body 117 may thus , for example , prevent any loosening of the attachment between permanent magnet 107 and rotor body 103 . although depicted as a single o - ring , elastomeric body 117 may , in some embodiments , be , for example and without limitation , a single o - ring , multiple o - rings , an elastomeric washer , or a combination thereof . likewise , as threaded fastener 115 and permanent magnet 107 decrease in temperature during normal operation of the permanent magnet motor , for example when the permanent magnet motor is shut off , threaded fastener 115 may thermally contract more rapidly than permanent magnet 107 . in this case , the compressive stress on elastomeric body 117 between threaded fastener 115 and permanent magnet 107 may increase . elastomeric body 117 may elastically deform to , for example , prevent excess force from being exerted on permanent magnet 107 by threaded fastener 115 . elastomeric body 117 may thus , for example , prevent threaded fastener 115 from crushing permanent magnet 107 . in order to assemble rotor 101 , a rotor body 103 may be provided . one or more mounting holes 113 may be formed in the exterior surface of rotor body 103 . in some embodiments , mounting holes 113 may be tapped to receive a threaded fastener . one or more permanent magnets 107 , having at least one hole 109 formed therein , each hole 109 positioned to align with a corresponding mounting hole 113 , each hole 109 having countersink 111 , is then positioned onto the outer surface of rotor body 103 . elastomeric body 117 is then placed within countersink 111 . a threaded fastener , such as threaded fastener 115 , is then threaded into hole 109 and mounting hole 113 , such that the head of threaded fastener 115 mechanically couples permanent magnet 107 to rotor body 103 . although fig1 depicts a permanent magnet 107 being coupled to rotor body 103 by only one threaded fastener 115 , one having ordinary skill in the art with the benefit of this disclosure will understand that multiple screws 115 may be utilized for each permanent magnet 107 . additionally , although depicted as being used for an internal rotor permanent magnet motor , one having ordinary skill in the art with the benefit of this disclosure will understand that permanent magnets 107 may be installed to the interior surface of a tubular rotor of an external rotor permanent magnet motor without deviating from the scope of this disclosure . likewise , although described with permanent magnets 107 coupled to the rotor of a permanent magnet motor , permanent magnets 107 may be coupled to the stator of a permanent magnet motor in which the coils are positioned on the rotor without deviating from the scope of this disclosure . in some embodiments , rotor 201 may include rotor body 203 as depicted in fig3 . rotor body 203 may include one or more dovetail channels 205 adapted to interface with permanent magnets 207 . in such embodiments , permanent magnets 207 may include magnet dovetail 209 adapted to fit into dovetails 205 and thus retain permanent magnet 207 to rotor body 203 . in such an embodiment , permanent magnet 207 may be slid into dovetail channels 205 during assembly . in some embodiments , dovetail channels 205 may be formed by removing material from rotor body 203 . in some embodiments , dovetail channels 205 may be formed as a separate piece from rotor body 203 and affixed thereto by , for example and without limitation , threaded couplers . in some embodiments , dovetail channels 205 may be coupled to rotor body 203 by threaded couplers as described above . in some embodiments , rotor 301 may include rotor body 303 as depicted in fig4 a , 4 b . permanent magnets 305 may include one or more flanges 307 as depicted in fig4 a . flanges 307 may , for example and without limitation , be adapted to receive retaining ring 309 when installed as depicted in fig4 b . retaining ring 309 may be adapted to encircle rotor body 303 and flanges 307 of permanent magnets 305 in order to retain permanent magnets 305 to rotor body 303 . in some embodiments , retaining ring 309 may be a split ring , the ends of which being coupled to one or more of rotor body 303 or the other end of retaining ring 309 . the foregoing outlines features of several embodiments so that a person of ordinary skill in the art may better understand the aspects of the present disclosure . such features may be replaced by any one of numerous equivalent alternatives , only some of which are disclosed herein . one of ordinary skill in the art should appreciate that they may readily use the present disclosure as a basis for designing or modifying other processes and structures for carrying out the same purposes and / or achieving the same advantages of the embodiments introduced herein . one of ordinary skill in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure and that they may make various changes , substitutions , and alterations herein without departing from the spirit and scope of the present disclosure . | 8 |
fig1 shows a four resonator filter assembly constructed in accordance with the principles of present invention and designated generally by reference numeral 10 . each resonator 12 is constructed in accordance with the principles of invention and it should be understood that is not necessary that the structural features of each of the helical resonators be identical . a printed circuit board 11 forms a base upon which resonator structures 12 are mounted to extend vertically therefrom . the base supports a conductive surface forming a ground plane 13 which cooperates with overall shielding can 43 ( shown in fig3 ) to enclose the rf electromagnetic radiation emanating from the resonators 12 to confine the rf radiation within the cavity formed by shielding can 43 and ground plane 13 . extending from ground plane 13 are ground leads 14 electrically coupling the one end of the resonator to ground . each resonator 12 is formed on printed circuit board ( pcb ) substrate material 16 . in the preferred embodiment of the invention , each side of board 16 is provided with a plurality of elongate conductive traces 18 extending between rows of apertures 20 and 22 . the rows of apertures 20 and 22 are preferably constructed as holes drilled through the pcb substrate 16 . the elongate conductive traces 18 extend between the apertures such that a conductor extending from aperture &# 34 ; n &# 34 ; in row 20 extend to aperture &# 34 ; n &# 34 ; in row 22 . the reverse side of the printed circuit board 16 has elongate conductive traces that are inclined such that a trace extending from aperture &# 34 ; n &# 34 ; in row 20 extents to or interconnects with aperture &# 34 ; n + 1 &# 34 ; in row 22 . for rf filter assemblies , it is necessary for each of the resonators to couple to the adjacent resonator to pass the signal to be filtered from the input lead 28 to the signal output lead 30 . in the rf filter depicted in fig1 four resonator coils are provided . the signal from the input lead 28 is supplied to the first resonator coil by means of an input tap line 32 . input tap line 32 extends from the signal input lead to a predetermined location on the &# 34 ; helix &# 34 ; of the first resonator coil , the location is selected to provide an impedance match to the circuitry supplying the input signal . as previously noted , one end of the resonator coil is provided with a ground tap 14 which completes the signal supply circuit for the input signal arriving at the resonator on input tap line 32 . the presence of an input signal on input supply line 28 causes an electromagnetic ( em ) field to be produced in the interior volume of the resonator &# 34 ; helix &# 34 ; which extends to the space surrounding the resonator in accordance with well understood principles of em fields . the em coupling with the next adjacent resonator can be controlled by provision of a ferromagnetic element . each ferromagnetic element is preferably in the form of a wire to allow the specification of the em coupling behaviour by parameters such as wire material , wire gauge and wire length . while only one ferromagnetic element 34 is shown between each adjacent resonator coil , it will be understood that more than one ferromagnetic element 34 may be provided there between . for example , the pcb substrate 11 in fig1 has four mounting holes 36 shown between each resonator to allow up to four ferromagnetic elements to be positioned between adjacent resonators . as will be understood by those versed in the art , these ferromagnetic elements control the filter tuning and response . the interconnection between traces 18 through the printed circuit board is best explained with reference to the cross - section shown in fig2 . another factor which controls filter timing and response is the inductance of each of the helical resonators . the inductance of each resonator can be controlled by ( 2 ) the spacing of the traces 18 and 24 ( shown in fig2 ), and ( 3 ) the number of loops or turns of the traces on the printed circuit board forming the resonation 12 . referring to fig2 pcb substrate 16 forms a non - conducting structure onto which the elongate conductive traces 18 and through which communicating apertures in the form of drilled through holes are provided . by way of example , two apertures from row 20 are shown in fig2 namely , 20n and 20n + 1 . each of the apertures forming rows 20 and 22 are provided to enable an electrical conductor to extend from the front surface of the pcb substrate to the back surface . by way of example , one end of elongate trace 18 is interconnected with one end of reverse side elongate trace 24 by an aperture which is provided to facilitate plated - through conductor 26 to interconnect these traces to form a loop or winding . each adjacent loop is connected in similar fashion with plated through conductor at the other end of the elongate traces . in this fashion interconnected loops formed and interconnected as described provide an inductor which extends in a substantially &# 34 ; helical &# 34 ; manner to form an inductor or resonator . in an rf filter assembly , multiple resonators are spacedly mounted on pcb 11 to extend upwardly from the base pcb 11 to form a helical resonator filter assembly . fig3 shows a bottom perspective view of a portion of a printed circuit board 11 incorporating the helical filter construction of the present invention . the helical resonators are encased in an enclosure shielding can 43 which is a structure that is impervious or opaque to or substantially attenuates em fields . typically enclosure can 43 will be constructed of a metal conductor . the enclosure shielding can 43 is used to contain the rf radiation emanating from resonators 12 ( of fig1 ). to complete the rf enclosure structure , the pcb surface below the enclosure shielding can 43 is conventionally provided with a grounding plane 13 that is electrically connected to the enclosure shielding can 43 itself by means of several tabs 47 extending from and generally forming part of enclosure can 43 . such tabs are soldered to the pcb ground plane 13 to provide physical means to attach the enclosure shielding can 43 to the pcb board 11 as well as provide electrical connection to ground plane 13 . also shown in fig3 are resonator mounting slots 38 which are used to provide a physical mounting system for mounting resonators 12 on pcb board 11 . any one of several means can be used to mount the resonators on the pcb board 11 including gluing or providing a metal shoe on the lower portion of the resonator structure which can be soldered to the ground plane 13 of the pcb board 11 . by way of example , there are two configurations of mounting slots 38 shown , namely , a single slot arrangement and a slot pair arrangement . a bottom plan view of the enclosure shielding can 43 of the present invention is shown in fig3 b . in accordance with the invention , shielding can 43 is constructed to provide a single internal cavity 44 to enclose all of the resonators provided in the rf filter . fig3 a shows the construction of prior art rf shielding can enclosures at 41 . prior art shielding cans or enclosures provide common walls forming communicating apertures 46 for rf coupling of each resonator coil to the next . such internal common walls are not needed in the construction of the rf filter assemblies of the present invention thereby simplifying the construction of the shielding can enclosures to the structure shown in fig3 b . fig4 shows a plan view of a printed circuit board assembly incorporating two rf filters 43 and 48 to illustrate incorporation of the filter assemblies of the present invention into a printed circuit board assembly . while the invention has be disclosed with reference to the description and drawings hereof , it will be apparent to those skilled in the art that many modifications and substitutions may be made to the specific embodiments herein described without departing from the spirit and scope of the invention as defined in the claims appended hereto . | 7 |
the composition of the present invention is capable of removing a variety of films from substrates . the substrates can be any of the normal substrates encountered in industry , such as iron , example steel , such as cold rolled steel or stainless steel , or light metals , such as aluminum , titanium , and most alloys thereof . in general , the substrate that has the protective and / or decorative coating applied thereto which is to be removed is dipped into a vat containing the coating stripping composition of the present invention . this is normally performed at ambient temperature and pressure , although higher temperatures up to the boiling point of the composition could be employed . generally no agitation is employed , although it is to be appreciated that for increased efficiency , agitation may be deemed desirable when a particularly adhesive composition is to be removed from a substrate . in addition to the components which have been described above , other additional components are used in the coating composition to improve the overall efficiency . such components are a combination of wax and aromatic compounds which assist in the application of the composition to the substrate and thereby assist in the removal . the wax and aromatic compound also retard evaporation of the stripping composition . materials such as aromatic hydrocarbons , as xylene , toluene , and other alkylated aromatics may be employed . a paraffinic wax may likewise be used . the acetylenic alcohol that is employed in the present case is one that inhibits corrosion of the substrate to which the stripping composition is to be applied . suitable acetylenic alcohols are hexynol , ethyloctynol , ethynyl cyclohexynol , methylbutynol , methylpentynol and the like . the acid accelerator that is useful in the present application is a carboxylic acid that is liquid at ambient and containing from one to twelve carbon atoms . a preferred carboxylic acid is a halogenated carboxylic acid , such as the chlorinated material . suitable carboxylic acids are formic , aceitc , propionic , butyric and the like , while the halogenated acids are chloroacetic , trichloroacetic and the like . it is most preferred that a combination of the acids be employed , such as the combination of formic acid and trichloroactetic acid used in amounts of one part formic acid to one to ten parts trichloroacetic acid . emulsifiers of the organic sox type may be employed such as sulfurous , sulfonic and sulfuric acids and the like , as well as the alkali salts thereof , such as sodium , potassium and the like . the sox emulsifiers that are used are generally long chain substances containing upwards of twenty - two carbon atoms . suitable emulsifiers of the sox type are petroleum sulfonate , sulfates of alcohol , sulfates of ethoxylated alcohol , sulfates and sulfonates of ethoxylated alkyl phenols , sulfates of fatty esters , sulfates and sulfonates of oils and fatty acids , sulfonates of alkyl aryls , sulfonates of benzene , toluene and xylene , sulfonates of condensed napthalenes , sulfonates of dodecyl and tridecyl benzene , sulfonates of napthalene and alkyl napthalene and the like . the penetrating nitrogen containing amine oxide surfactant is one that is useful for improving the efficiency of the stripping composition . while one does not wish to be held to any theory , it is believed that the nitrogen containing amine oxide surfactant has a tendency to penetrate the film to be removed , thereby allowing for destruction and removal of the coating composition or film from the substrate . suitable nitrogen containing amine oxide surfactants are materials of the aromox type ( trademark of armour industrial chemical company ), including dimethyl cocoamine oxide , bis ( 2 - hydroxyethyl ) cocoamine oxide , dimethyl - hexadecylamine oxide , dimethyl ( hydrogenated tallow ) amine oxide and bis ( 2 - hydroxyethyl ) tallowamine oxide ; materials of the alkamox type ( trademark of alkaril chemicals ) including cocoamidopropyl dimethylamine oxide and lauryl dimethylamine oxide ; materials of the aminoxide ws 35 type ( trademark of goldschmidt products corp .) including fatty acid amido alkyldimethylamine oxide ; materials of the ammonyx type ( trademark of onyx chemical co .) including cetyl dimethylamine oxide , myristylcetyl dimethylamine oxide , myristyl dimethylamine oxide and stearyl dimethylamine oxide ; materials of the varox type ( trademark of sherex chemical co .) includying alkyl dialkoxy amine oxides and alkyl dialkoxyether amine oxides ; and the like . listed below is a recitation of the components of the compositions of the examples and a preferred range of the components of the composition of the present invention : ancor ow - 1 is a trademark of air products for a material containing major amounts of hexynol . armohib 31 is an acid inhibitor useful in metal cleaning and pickling which is an aliphatic amine ( trademark of armour industrial chemical company ). petronate l is a sodium petroleum sulfonate of the anionic type ( trademark of witco chemical company ). pyronate 40 is a petroleum sulfonate ( trademark of witco chemical company . tergitol 15 - s - 15 is a polyethylene glycol ether of linear alkyl alcohol of the non - ionic type being a paste ( trademark of union carbide ). surfonic lf - 7 is an alkyl polyoxyalkylene ether of a non - ionic type having an hlb rating of 12 ( hlb index meaning hydrophylic lipophylic balance ) ( trademark of jefferson chemical company inc .). plurafac d - 25 is modified oxyethylated straight chain alcohol of a non - ionic type with an hlb index of 11 ( trademark of basf wyandotte ). calsoft las - 99 is linear alkyl benzene sulfonic acid of the anionic type ( trademark of pilot chemical company ). aromox dcm - w is dimethyl cocoamine oxide of the cationic type being a liquid ( trademark of armak industrial chemical of armour industrial chemical corporation ). morco m - 70 which is sodium petroleum sulfonate of the anionic type ( trademark of marathon monco company ). tergitol tmn - 10 is a trimethyl nonyl polyethylene glycol ether of the non - ionic type , hlb index of 14 ( trademark of union carbide ). table______________________________________protective and / or decorativecoating stripping composition range [ percent prior by weight preferred artcomponents ( pbw )] range ( pbw ) ( pbw ) ______________________________________methylene chloride at least 51 70 to 80 83 . 0xylene 1 to 10 2 to 4 2 . 5wax 0 . 1 to 3 0 . 5 to 1 0 . 5calsoft las - 99 1 to 10 4 to 8aromox dmc - w 0 . 5 to 10 1 to 5deionized water 1 to 20 5 to 15ancor ow - 1 0 . 2 to 5 0 . 5 to 1 . 5petronate l 1 to 10 1 to 3 2 . 0pyronate 40 0 to 10 1 to 3formic acid 1 to 15 1 to 10 7 . 0trichloroacetic acid 1 to 20 5 to 15______________________________________ the composition as used by the consumer generally has a ph of about 1 . the composition can be prepared in a number of ways . generally , however , the first three components are mixed together and then the las - 99 is blended thereto . thereafter , the remaining components are added in the order they are listed in table i . having described the invention above , listed below are detailed aspects thereof wherein all parts are parts by weight and temperatures are in degrees fahrenheit unless otherwise indicated . in the following working examples , the compositions used were to remove a cured acrylic resin film . the resins used were duracron 200 ( trademark of ppg for acrylic resin ) for examples in table ii and dupont ap - 3 acrylic resin for examples in tables iii and iv . the resins were applied onto a test panel of steel having bonderite 1000 thereon ( trademark of oxy metal industries for an iron phosphate conversion coating ). the panels were dipped into the composition at ambient to determine the paint removal efficiency thereof . table ii______________________________________ priorexamples a b c d e f art______________________________________methylene 81 . 0 81 . 0 82 . 0 81 . 0 81 . 0 81 . 0 83 . 0chloridexylene 2 . 5 2 . 5 2 . 5 2 . 5 2 . 5 2 . 5 2 . 5wax 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5 0 . 5formic acid 7 . 0 7 . 0 7 . 0 7 . 0 7 . 0 7 . 0 7 . 0deionized 2 . 0 2 . 0 2 . 0 2 . 0 2 . 0 2 . 0 -- waterarmohib 31 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0 1 . 0petronate l 2 . 0tergitol 4 . 015 - s - 15surfonic 6 . 0lf - 7plurafac d - 25 6 . 0calsoft 5 . 0las - 99aromox 6 . 0dmc - wmorco m - 70 6 . 0tergitol 6 . 0tmn - 10percent of n . e . n . e . n . e . 100 % 100 % 100 % 10 % film stripped 20 20 20 13 . 75 28 17 . 5 10in time ( min .) min . min . min . min . min . min . min . ______________________________________ table iii______________________________________examples g h i______________________________________methylene chloride 81 . 0 75 . 5 77 . 0xylene 2 . 5 2 . 5 2 . 5wax 0 . 5 0 . 5 0 . 5calsoft las - 99 -- 4 . 0 4 . 0aromox dmc - w 6 . 0 2 . 0 2 . 0deionized water 2 . 0 2 . 0 1 . 5armohib 31 1 . 0 1 . 0 1 . 0petronate i 1 . 0 2 . 0 3 . 5pyonate 40 -- 1 . 5 -- formic acid 7 . 0 -- 4 . 0trichloroacetic acid -- 9 . 0 4 . 0percent of film 100 % 100 % 100 % stripped in time 13 . 75 10 . 75 7 ( min .) min . min . min . ______________________________________ table iv______________________________________examples j k l______________________________________metylene chloride 73 . 5 73 . 0 74 . 5xylene 4 . 0 4 . 0 2 . 5wax 1 . 0 1 . 0 0 . 5armohib 31 -- -- 1 . 0ancor ow - 1 -- 1 . 0 -- calsoft las - 99 5 . 0 7 . 0 4 . 0aromox dmc - w 2 . 0 2 . 0 2 . 0pyronate 40 1 . 5 -- 1 . 5deionized water 2 . 0 2 . 0 2 . 0formic acid 2 . 0 2 . 0 2 . 0trichloroacetic acid 8 . 0 8 . 0 8 . 0propargyl alcohol 1 . 0 -- -- petronate l -- -- 2 . 0percent of film 100 % 100 % 100 % stripped in time 61 / 2 41 / 2 9 . 6 ( min .) min . min . min . ______________________________________ n . e . represents &# 34 ; no effect &# 34 ;. the test results reflect time to remove the film of acrylic resin . it is perfectly clear that the compositions using the penetrating nitrogen containing amine oxide substance ( aromox type ) were clearly superior in their effeciency of removing the protective coating . note that the prior art was able to remove only 10 % of the acrylic film in a ten minute period of time . note also that improved efficiency was obtained when the combination of formic acid and trichloroacetic acid was used in conjunction with the nitrogen containing amphoteric surfactant . it should also be noted that improved stripping efficiency is obtained when the acetylenic alcohol corrosion inhibitor ( ancor ow - 1 ) is used . | 2 |
the presently disclosed subject matter will be described more fully hereinafter with reference to the accompanying drawings , in which some , but not all embodiments are shown . indeed , this invention may be embodied in many different forms and should not be construed as being limited to the specific embodiment set forth in fig1 through 4 . in the drawings like numbers refer to like elements throughout . referring now to fig1 through 4 , the principles of the present invention provide for a relatively lightweight , foldable and collapsible baby bouncer 10 that can be selectively expanded into an operating shape or collapsed into an elongated shape ( see fig1 for a view of the baby bouncer 10 expanded into am operating state and fig3 for a view of the baby bouncer 10 in a collapsed state that is useful for portability and storage . referring now specifically to fig1 and 2 , the baby bouncer 10 includes a seat 12 for retaining an infant within the baby bouncer 10 . the seat 12 includes two leg holes 14 in a seat pocket 16 . for infant protection the seat 12 also includes a high seat back 18 that extends up from the seat pocket 16 . the back 18 helps protect in infant within the baby bouncer from whiplash and other neck injuries . still referring to fig1 , the seat 12 also includes a plurality of accessory holes 20 for assisting attachment of additional features such as rattles , bells , toy bars , and visual stimulators such as lights and mirrors to soothe and / or stimulate the baby . the seat 10 further includes a plurality of seat attachments 22 ( shown generically as rings ) that assist attaching the seat 12 to the remainder of the baby bouncer 10 . the seat 12 is beneficially removable from the remainder of the baby bouncer 10 via the seat attachments 22 . in practice , the seat 12 is preferably mostly comprised of a soft , flexible , and washable material ( such as cotton ) that is suitable for long - term contact with an infant . this makes for easy cleanup , proper sanitation , infant comfort , and , as subsequently described , portability . however , the seat back 18 may be made somewhat more rigid to provide infant protection while also assisting maintaining the general form of the seat 12 . padding on the seat back 18 can be added to further protect an infant . it is extremely important that the seat 12 , the seat attachments 22 , and the leg holes 14 are configured so that a seated infant is protected from injury . for example , it should not be possible for the seat 12 to pinch or choke an infant or to allow an infant to fall from the seat . all materials used to make the seat must be safe for use by an infant , and thus a flame retardant material or coating may be used . the seat 12 can be color coded in accord with infant sex ( i . e . pink for girls , blue for boys ) or other attribute ( i . e ., national colors red , white , and blue ), or it can be printed with a design . referring now to fig1 , the seat 12 is retained by three support legs 26 that form a tripod . the top end 27 of each support leg 26 retains a spring 28 that connects to an associated seat attachment 22 . the spring 28 which provides a bias support for the seat 12 . for both aesthetics and safety reasons each spring 28 is beneficially enclosed within a fabric cover 30 . still referring to fig1 , at the bottom end 32 of each support leg 26 is a foot 32 which beneficially forms a suction cup to firmly retain the baby bouncer 10 on a hard flat surface . the combination of the tripod arrangement of the support legs 26 , each having a foot 32 provides stability for the baby bouncer 10 . also beneficially each foot is durable , provides a sufficiently large contract area to safely stabilize the baby bouncer 10 on other than hard flat surfaces and to reduce or eliminate sliding and tipping . each support leg 26 is comprised of a sturdy , yet flexible material that can withstand the stresses of holding an active infant . steel , aluminum , fiberglass , or various engineering plastics ( such as glass reinforced nylon ) are suitable materials . it cannot be too highly stressed that the support legs 26 , springs 28 , seat attachments 22 , and fabric cover 30 are configured to protect seated infants from harm . still referring to fig1 , when deployed the tripod form of the support legs 26 is retained by structural arms 34 that connect pairs of support legs 26 . the structural arms 34 , in combination with the configuration of the support legs 26 , springs 28 , and seat attachments 22 form a structurally sound support for the baby bouncer 10 . a feature of the baby bouncer 10 is that it is easily collapsible and foldable . this is achieved by making the structural arms 34 themselves collapsible . collapsible structural arms 34 can be implemented in numerous ways , such as by using telescoping arms with locking arm assemblies , ratcheting mechanisms , spring loaded snaps that fit into holes or detents in a rail , and a wide range of other mechanisms . however , probably the simplest method is illustrated in fig4 . referring now to fig4 , a beneficially way to form a collapsible structural arm 34 is to form each structural arm 34 from two parts , shown as arm segments 34 a and 34 b in fig4 , which readily connect together . in fig4 arm segment 34 a includes a coupling 36 at one end . the coupling 36 is beneficially configured such that an end of structural arm 34 b fits snugly and securely into the coupling 36 . this type of construction is often done in tents and other structures that break down into component parts . then , to assemble a structural arm 34 the two structural arm segments 34 a and 34 b are fit together . as shown in fig3 , the baby bouncer 10 is collapsible into an elongated form to assist portability . to achieve this , the structural arms 34 are collapsed , which allows the support legs 26 to move . the structural arms 34 and support legs 26 are then aligned in a parallel fashion , the seat 12 is compressed , and the baby bouncer 10 is fit into a sleeve 40 having a handle 42 . the sleeve 40 and handle 42 are preferably comprised of a waterproof fabric such as nylon . the handle 42 is preferably dimensioned to fit over a shoulder for easy carrying , while the sleeve 40 beneficially includes a drawstring 44 to close the sleeve 40 . while the foregoing describes a baby bouncer that is in accord with the principles of the present invention , it is to be understood that the figures and description are exemplary only . for example , it may be desirable to include any number of additional features such as rattles , bells , toy bars , and visual stimulators . obviously many modifications and variations are possible in light of the above teaching , and thus others who are skilled in the applicable arts will recognize numerous modifications and adaptations that remain within the principles of the present invention . therefore , the present invention is to be limited only by the appended claims . | 0 |
it should be understood that the relative terminology used herein , such as “ front ”, “ rear ”, “ left ”, “ top ”, “ bottom ”, “ vertical ”, and “ horizontal ” is solely for the purposes of clarity and designation and is not intended to limit the invention to embodiments having a particular position and / or orientation . accordingly , such relative terminology should not be construed to limit the scope of the present invention . in addition , it should be understood that the invention is not limited to embodiments having specific dimensions . thus , any dimensions provided herein are merely for an exemplary purpose and are not intended to limit the invention to embodiments having particular dimensions . turning to fig1 , a top perspective , unassembled view of an exemplary gift card packaging ( e . g ., a gift card box ) assembly 100 ( hereinafter “ assembly 100 ”) is provided . in particular , the exemplary assembly 100 generally includes a base 102 and a lid 104 configured and dimensioned to house a gift card 106 . as will be discussed in greater detail below , the base 102 and the lid 104 generally include inserts , e . g ., foam inserts , configured and dimensioned to cooperatively mate relative to each other . the inserts can be fabricated from , for example , a die cut eva foam card , and / or the like . as can be seen in fig1 , base 102 generally defines a bottom wall 112 , a front wall 114 , a rear wall 116 , a right wall 118 and a left wall 120 . the front wall 114 and the rear wall 116 can be substantially parallel . similarly , the right wall 118 and the left wall 120 can be substantially parallel . the base 102 further defines an inside surface 122 and an outside surface 124 . in some exemplary embodiments , the outer periphery of the base 102 can be configured as , for example , substantially rectangular , square , circular , oval , and / or the like . base 102 generally includes a base insert 108 , such as a first insert , configured and dimensioned to fit within the inner periphery of the base 102 . the base insert 108 generally defines a female alignment member 126 for forming an interference fit . a lid insert 130 , such as a second insert , can generally be located within an inner periphery of the lid 104 and defines a complementary male alignment member 132 for forming an interference fit . in some exemplary embodiments , inserts of the base 102 and the lid 104 may be fabricated without male and / or female alignment members . although illustrated as a half circle alignment member for forming an interference fit , in some exemplary embodiments , the alignment member can be configured as , for example a square , a rectangle , an oval , a triangle , and / or the like . in some exemplary embodiments , the base insert 108 can be secured to the base 102 by , for example , a friction fit , an adhesive , and / or the like . the base insert 108 can be configured and dimensioned to receive a gift card 106 within an inner periphery 110 of the base insert 108 . as would be understood by those of ordinary skill in the art , the inner periphery 110 can be dimensioned such that the gift card 106 is prevented from translation along a horizontal plane . in addition , the inner periphery 110 generally defines a ledge for maintaining the gift card 106 within the base 102 . in some exemplary embodiments , the gift card 106 can include , for example , an open loop card , card packaging , indicia 146 , and / or the like , such as a bar code that can be scanned at a point of sale . the base 102 generally includes a window 128 , such as an aperture , configured and dimensioned to permit visualization of indicia 146 on the gift card 106 . in particular , the configuration of the gift card 106 as it is positioned in the inner periphery 110 of the base insert 108 can be such that the desired indicia 146 of the gift card 106 is located over the window 128 . thus , when viewing the base 102 from the outside surface 124 , the indicia 146 of the gift card 106 can generally be visualized through the window 128 and is positioned for scanning ( and gift card 106 provisioning and / or activation ) at a point of sale without having to open the assembly 100 . with reference to fig2 , a bottom perspective , unassembled view of the exemplary assembly 100 is provided . the exemplary assembly 100 generally includes a base 104 , a lid 102 and a gift card 106 . as discussed above , the gift card 106 generally includes indicia 146 , such as instructions , a scannable bar code , a price , information , and / or the like , provided thereon . as can be seen in fig2 , the indicia 146 on the gift card 106 can be oriented such that it is visible through the window 128 of the base 102 . thus , for example , a user can scan the bar code on the gift card 106 through the window 128 without having to open the assembly 100 . the lid 104 generally includes a bottom wall 134 , a front wall 136 , a rear wall 138 , a right wall 140 and a left wall 142 . the front wall 136 and the rear wall 138 can be substantially parallel relative to each other . similarly , the right wall 140 and the left wall 142 can be substantially parallel relative to each other . the lid 104 generally includes an inside surface 144 and an outside surface 148 . in some exemplary embodiments , the lid 104 can include , for example , cutouts 150 , tabs , surface features , and / or the like , to aid the user in grasping and / or removing the lid 104 for opening and / or closing the assembly 100 . as discussed above , the lid 104 generally includes a lid insert 130 , such as a second insert , which defines a male alignment member 132 for forming an interference fit . in some exemplary embodiments , the lid insert 130 can be fixed to the lid 104 with , for example , adhesives , and / or the like . the lid insert 130 defines an outer periphery 152 which can be configured and dimensioned to cooperatively mate with the inner periphery 110 of the base insert 108 . the lid insert 130 and the base insert 108 can be fabricated from a single piece of material , such as foam , and / or the like . in particular , the lid insert 130 can be cut from the single piece of material such that the remaining material defines the base insert 108 . in some exemplary embodiments , the lid insert 130 and the base insert 108 can be fabricated from different pieces of material . as would be understood by those of ordinary skill in the art , once a gift card 106 has been inserted into the inner periphery 110 of the base insert 108 , the lid 104 may be placed and / or pressed onto the base 102 such that the base insert 108 and the lid insert 130 cooperatively mate . in particular , the lid insert 130 generally prevents the gift card 106 from lifting away from the bottom wall 112 of the base 102 . the male and female alignment members 132 and 126 can aid in maintaining the desired orientation of the lid 104 relative to the base 102 and form an interference fit . thus , if the male and female alignment members 132 and 126 have not been properly aligned relative to each other , the male alignment member 132 can generally prevent the lid 104 from closing and / or lowering onto the base 102 . once the lid 104 has been removed from the base 102 , the user may implement the female alignment member 126 as an opening / unobstructed area for gripping and / or removing the gift card 106 from the base 102 . fig3 shows a top view of the inside surface 144 of an exemplary lid 104 , including the lid insert 130 . the lid 104 and the lid insert 130 can be substantially symmetrical about a vertical axis a v . the lid 104 is also provided with a horizontal section line l h1 , which will be discussed with respect to fig6 . an exemplary width w l of the lid 104 can be approximately 114 mm and an exemplary length l l of the lid 104 can be approximately 151 . 5 mm . fig4 shows a top view of an outside surface 148 of an exemplary lid 104 . the outside surface 148 of the lid 104 can include , for example , graphics , logos , information , and / or the like , provided thereon . with reference to fig5 , a cross - sectional view of an exemplary lid 104 along the vertical axis a v is provided . as described above , the lid insert 130 can be secured to the bottom wall 134 of the lid 104 with , for example , adhesives , and / or the like . an exemplary height h l of the lid 104 can be approximately 15 mm . fig6 shows a cross - sectional view of an exemplary lid 104 along a horizontal section line l h1 . as can be seen from fig5 and 6 , the space between the outer periphery 152 of the lid insert 130 and the inner periphery of the lid 104 can generally be configured and dimensioned to receive the base insert 108 such that the lid insert 130 and the base insert 108 cooperatively mate relative to each other with , for example , a friction fit , and / or the like . turning now to fig7 , a top view of an inside surface 122 of an exemplary base 102 is provided , including a base insert 108 . the base 102 and the base insert 108 can be substantially symmetrical along the vertical axis a v . as described above , the base insert 108 can be secured to the bottom wall 112 and / or the inner periphery of the side walls of the base 102 with , for example , a friction fit , adhesives , and / or the like . the exemplary base 102 generally defines a width w b and a length l b . as would be understood by those of ordinary skill in the art , the width w b and length l b of the base 102 can generally be slightly smaller than the width w l and length l l of the lid 104 . for example , the width w b of the base 102 can be approximately 112 mm and the length l b of the base 102 can be approximately 149 . 5 mm . the slightly greater dimensions of the lid 104 generally allow a user to place the lid 104 over the base 102 to close the assembly 100 . in some exemplary embodiments , the difference in dimensions can further create a friction fit between the inner surfaces of the lid 104 and the outer surfaces of the base 102 to maintain the assembly 100 in a closed configuration . fig8 shows a top view of an outside surface 124 of an exemplary base 102 . the outside surface 124 of the base 102 can include , for example , graphics , logos , information , and / or the like , provided thereon . as discussed above , when a gift card 106 is positioned inside the base 102 , the indicia 146 on the gift card 106 can generally be visualized through the window 128 . thus , a user can , for example , scan a bar code on the gift card 106 , provision the gift card , activate the gift card , and / or the like , at a point of sale without having to open the assembly 100 . fig9 and 10 show cross - sectional views of an exemplary base 102 along the vertical axis a v and along a horizontal section line l h2 aligned with the horizontal section line l h1 , respectively . as can be seen from fig9 and 10 , the inner periphery 110 of the base insert 108 can generally be configured and dimensioned to receive a gift card 106 and / or a lid insert 130 such that the lid insert 130 and the base insert 108 cooperatively mate relative to each other with , for example , a friction fit , and / or the like . an exemplary height h b of the base 102 can be substantially similar to the height h l of the lid 104 . in some exemplary embodiments , the height h b of the base 102 can be slightly smaller or greater than the height h l of the lid 104 , for example , approximately 14 mm , 16 mm , and / or the like . turning now to fig1 , an exemplary base 102 with an exemplary gift card 106 is provided . in particular , fig1 shows a gift card 106 which has been inserted into the inner periphery 110 of the base insert 108 . the inner periphery 110 of the base insert 108 can be configured and dimensioned slightly greater than the gift card 106 . thus , the base insert 108 can receive the gift card 106 within the inner periphery 110 and the gift card 106 can be inserted and / or pushed to substantially mate against the bottom wall 112 of the base 102 . fig1 shows an exemplary lid 104 , including a lid insert 130 . in some exemplary embodiments , the lid 104 can include a hang tab 154 for hanging the assembly 100 on a display peg ( not shown ). the hang tab 154 generally includes a hole 156 for hanging the assembly 100 on the display peg . thus , the exemplary assembly 100 can be , for example , placed on a shelf , hung from a display peg , and / or the like . the hang tab 154 can be fabricated from , for example , plastic , cardboard , a durable material , and / or the like . in some exemplary embodiments , the hang tab 154 can be fabricated from a single piece of material and can be further folded to cooperatively mate against the inner portion of the front wall 136 and / or the bottom wall 134 of the lid 104 . the hang tab 154 can further be secured to the lid 104 with , for example , adhesives , and / or the like . with reference to fig1 , an exemplary decoration 160 is illustrated . the decoration 160 can be , for example , a bow , and / or the like , and generally includes a strip 162 and a bow 164 . the strip 162 generally forms an inner passage 166 configured and dimensioned to slidably receive an assembled assembly 100 . in some exemplary embodiments , the decoration 160 can be implemented to maintain the assembly 100 in an assembled manner such that the decoration 160 can prevent the opening of the lid 104 relative to the base 102 . the decoration 160 can be fabricated from , for example , cardboard , fabric , and / or the like . fig1 shows a top perspective , assembled view of an exemplary assembly 100 for a gift card 106 . in assembled form , as described above , the lid 104 and the base 102 have been cooperatively mated . in particular , the gift card 106 has been placed inside the base 102 , the lid 104 has been placed over the base 102 , the male and female alignment members 132 and 126 have been aligned , and the lid insert 130 and the base insert 108 have been cooperatively mated . in some exemplary embodiments , the assembly 100 may include a hang tag 154 which protrudes from within the lid 104 at the front wall 136 for hanging the assembly 100 on a display peg . a decoration 160 may be placed around the lid 104 and the base 102 to maintain the lid 104 and the base 102 in assembled form . in some exemplary embodiments , a second decoration 170 , for example , a bow , and / or the like , can be placed around the assembly 100 . the second decoration 170 can be fabricated from , for example , cardboard , fabric , and / or the like . the second decoration 170 generally includes a strip 172 and a bow 174 . when tied around and / or positioned over the assembly 100 , the decoration 170 generally forms an inner passage configured and dimensioned to receive the assembled assembly 100 . although illustrated with both decorations 160 and 170 , in some exemplary embodiments , the assembly 100 can include , for example , no decorations , one decoration , two decorations , and / or the like . fig1 shows a bottom perspective , assembled view of an exemplary assembly 100 for a gift card 106 . in assembled form , the lid insert 130 generally provides pressure against the gift card 106 located in the base 102 such that the gift card 106 is pressed against the bottom wall 112 of the base 102 . in general , the lid insert 130 and / or the base insert 108 further maintain the gift card 106 in a substantially static and / or fixed position such that the gift card 106 is generally inhibited from movement within the assembled lid 104 and base 102 . as described above , with the gift card 106 pressed against the bottom wall 112 of the base 102 , the window 128 of the base 102 permits visualization of indicia 146 located on the gift card 106 . a user can therefore visualize and implement , for example , scan , input , and / or the like , the information provided by the indicia 146 without removing the gift card 106 from the assembly 100 . for example , a bar code on the gift card 106 can be scanned at a point of sale without having to open the assembly 100 . in addition , the user can implement the indicia 146 on the gift card 106 for provisioning and / or activating the gift card 106 without having to open the assembly 100 . while exemplary embodiments have been described herein , it is expressly noted that these embodiments should not be construed as limiting , but rather that additions and modifications to what is expressly described herein also are included within the scope of the invention . moreover , it is to be understood that the features of the various embodiments described herein are not mutually exclusive and can exist in various combinations and permutations , even if such combinations or permutations are not made express herein , without departing from the spirit and scope of the invention . | 1 |
while the invention has been described in preferred embodiments , various changes can be made therein without departing from the spirit and scope of the invention , as described in the appended claims . a wcd may both transmit and receive information over a wide array of wireless communication networks , each with different advantages regarding speed , range , quality ( error correction ), security ( encoding ), etc . these characteristics will dictate the amount of information that may be transferred to a receiving device , and the duration of the information transfer . fig1 includes a diagram of a wcd and how it interacts with various types of wireless networks . in the example pictured in fig1 , user 110 possesses wcd 100 . this device may be anything from a basic cellular handset to a more complex device such as a wirelessly enabled palmtop or laptop computer . near field communications ( nfc ) 130 include various transponder - type interactions wherein normally only the scanning device requires its own power source . wcd 100 scans source 120 via short - range communications . a transponder in source 120 may use the energy and / or clock signal contained within the scanning signal , as in the case of rfid communication , to respond with data stored in the transponder . these types of technologies usually have an effective transmission range on the order of ten feet , and may be able to deliver stored data in amounts from 96 bits to over a megabit ( or 125 kbytes ) relatively quickly . these features make such technologies well suited for identification purposes , such as to receive an account number for a public transportation provider , a key code for an automatic electronic door lock , an account number for a credit or debit transaction , etc . the transmission range between two devices may be extended if both devices are capable of performing powered communications . short - range active communications 140 includes applications wherein the sending and receiving devices are both active . an exemplary situation would include user 110 coming within effective transmission range of a bluetooth ™, wlan , uwb , wusb , etc . access point . the amount of information to be conveyed is unlimited , except that it must all be transferred in the time when user 110 is within effective transmission range of the access point . this duration is extremely limited if the user is , for example , strolling through a shopping mall or walking down a street . due to the higher complexity of these wireless networks , additional time is also required to establish the initial connection to wcd 100 , which may be increased if there are many devices queued for service in the area proximate to the access point . the effective transmission range of these networks depends on the technology , and may be from 32 ft . to over 300 ft . long - range networks 150 are used to provide virtually uninterrupted communication coverage for wcd 100 . land - based radio stations or satellites are used to relay various communications transactions worldwide . while these systems are extremely functional , the use of these systems are often charged on a per - minute basis to user 110 , not including additional charges for data transfer ( e . g ., wireless internet access ). further , the regulations covering these systems cause additional overhead for both the users and providers , making the use of these systems more cumbersome . in view of the above , it becomes easy to understand the need for a variety of different communication resources combined into a single wcd . since these types of devices are being used as replacements for a variety of conventional communications means , including land - land telephones , low - functionality cellular handsets , laptops enabled with wireless communications , etc ., the devices must be able to easily adapt to a variety of different applications ( e . g ., voice communications , business programs , gps , internet communications , etc .) in a variety of different environments ( e . g . office , automobile , outdoors , arenas , shops , etc .) as previously described , the present invention may be implemented using a variety of wireless communication equipment . therefore , it is important to understand the communication tools available to user 110 before exploring the present invention . for example , in the case of a cellular telephone or other handheld wireless devices , the integrated data handling capabilities of the device play an important role in facilitating transactions between the transmitting and receiving devices . fig2 discloses an exemplary modular layout for a wireless communication device in accordance with at least one embodiment of the present invention . in fig2 , wcd 100 is broken down into modules representing the functional aspects of the device . these functions may be performed by the various combinations of software and / or hardware components discussed below . control module 210 regulates the operation of the device . inputs may be received from various other modules included within wcd 100 . for example , interference sensing module 220 may use various techniques known in the art to sense sources of environmental interference within the effective transmission range of the wireless communication device . control module 210 interprets these data inputs , and in response , may issue control commands to the other modules in wcd 100 . communications module 230 incorporates all of the communications aspects of wcd 100 . as shown in fig2 , communications module 230 may include , for example , long - range communications module 232 , short - range communications module 234 and machine - readable data module 236 ( e . g ., for nfc ). communications module 230 utilizes at least these sub - modules to receive a multitude of different types of communication from both local and long distance sources , and to transmit data to recipient devices within the transmission range of wcd 100 . communications module 230 may be triggered by control module 210 , or by control resources local to the module responding to sensed messages , environmental influences and / or other devices in proximity to wcd 100 . user interface module 240 includes visual , audible and tactile elements which allow the user 110 to receive data from , and enter data into , the device . the data entered by user 110 may be interpreted by control module 210 to affect the behavior of wcd 100 . user - inputted data may also be transmitted by communications module 230 to other devices within effective transmission range . other devices in transmission range may also send information to wcd 100 via communications module 230 , and control module 210 may cause this information to be transferred to user interface module 240 for presentment to the user . applications module 250 incorporates all other hardware and / or software applications on wcd 100 . these applications may include sensors , interfaces , utilities , interpreters , data applications , etc ., and may be invoked by control module 210 to read information provided by the various modules and in turn supply information to requesting modules in wcd 100 . fig3 discloses an exemplary structural layout of wcd 100 according to an embodiment of the present invention that may be used to implement the functionality of the modular system previously described in fig2 . processor 300 controls overall device operation . as shown in fig3 , processor 300 is coupled to communications sections 310 , 312 , 320 and 340 . processor 300 may be implemented with one or more microprocessors that are each capable of executing software instructions stored in memory 330 . memory 330 may include random access memory ( ram ), read only memory ( rom ), and / or flash memory , and stores information in the form of data and software components ( also referred to herein as modules ). the data stored by memory 330 may be associated with particular software components . in addition , this data may be associated with databases , such as a bookmark database or a business database for scheduling , email , etc . the software components stored by memory 330 include instructions that can be executed by processor 300 . various types of software components may be stored in memory 330 . for instance , memory 330 may store software components that control the operation of communication sections 310 , 312 , 320 and 340 . memory 330 may also store software components including a firewall , a service guide manager , a bookmark database , user interface manager , and any communications utilities modules required to support wcd 100 . long - range communications 310 performs functions related to the exchange of information over large geographic areas ( such as cellular networks ) via an antenna . these communication methods include technologies from the previously described 1 g to 3 g . in addition to basic voice communications ( e . g ., via gsm ), long - range communications 310 may operate to establish data communications sessions , such as general packet radio service ( gprs ) sessions and / or universal mobile telecommunications system ( umts ) sessions . also , long - range communications 310 may operate to transmit and receive messages , such as short messaging service ( sms ) messages and / or multimedia messaging service ( mms ) messages . as disclosed in fig3 , long - range communications 310 may be composed of one or more subsystems supporting various long - range communications mediums . these subsystems may , for example , be radio modems enabled for various types of long - range wireless communication . as a subset of long - range communications 310 , or alternatively operating as an independent module separately connected to processor 300 , broadcast receivers 312 allows wcd 100 to receive transmission messages via mediums such as analog radio , digital video broadcast for handheld devices ( dvb - h ), digital audio broadcasting ( dab ), etc . these transmissions may be encoded so that only certain designated receiving devices may access the transmission content , and may contain text , audio or video information . in at least one example , wcd 100 may receive these transmissions and use information contained within the transmission signal to determine if the device is permitted to view the received content . as in the case of long - range communications 310 , broadcast receivers 312 may be comprised of one or more radio modems utilized to receive a variety of broadcast information . short - range communications 320 is responsible for functions involving the exchange of information across short - range wireless networks . as described above and depicted in fig3 , examples of such short - range communications 320 are not limited to bluetooth ™, wlan , uwb , zigbee , uhf rfid , and wireless usb connections . accordingly , short - range communications 320 performs functions related to the establishment of short - range connections , as well as processing related to the transmission and reception of information via such connections . short - range communications 320 may be composed of one or more subsystems made up of , for example , various radio modems employed to communicate via the previously indicated assortment of short range wireless mediums . short - range input device 340 , also depicted in fig3 , may provide functionality related to the short - range scanning of machine - readable data ( e . g ., for nfc ). for example , processor 300 may control short - range input device 340 to generate rf signals for activating an rfid transponder , and may in turn control the reception of signals from an rfid transponder . other short - range scanning methods for reading machine - readable data that may be supported by the short - range input device 340 are not limited to ir communications , linear and 2 - d ( e . g ., qr ) bar code readers ( including processes related to interpreting upc labels ), and optical character recognition devices for reading magnetic , uv , conductive or other types of coded data that may be provided in a tag using suitable ink . in order for the short - range input device 340 to scan the aforementioned types of machine - readable data , the input device may include a multitude of optical detectors , magnetic detectors , ccds or other sensors known in the art for interpreting machine - readable information . as further shown in fig3 , user interface 350 is also coupled to processor 300 . user interface 350 facilitates the exchange of information with a user . fig3 shows that user interface 350 includes a user input 360 and a user output 370 . user input 360 may include one or more components that allow a user to input information . examples of such components include keypads , touch screens , and microphones . user output 370 allows a user to receive information from the device . thus , user output portion 370 may include various components , such as a display , light emitting diodes ( led ), tactile emitters and one or more audio speakers . exemplary displays include liquid crystal displays ( lcds ), and other video displays . wcd 100 may also include one or more transponders 380 . this is essentially a passive device that may be programmed by processor 300 with information to be delivered in response to a scan from an outside source . for example , an rfid scanner mounted in a entryway may continuously emit radio frequency waves . when a person with a device containing transponder 380 walks through the door , the transponder is energized and may respond with information identifying the device , the person , etc . hardware corresponding to communications sections 310 , 312 , 320 and 340 provide for the transmission and reception of signals . accordingly , these portions may include components ( e . g ., electronics ) that perform functions , such as modulation , demodulation , amplification , and filtering . these portions may be locally controlled , or controlled by processor 300 in accordance with software communications components stored in memory 330 . the elements shown in fig3 may be constituted and coupled according to various techniques in order to produce the functionality described in fig2 . one such technique involves coupling separate hardware components corresponding to processor 300 , communications sections 310 , 312 and 320 , memory 330 , short - range input device 340 , user interface 350 , transponder 380 , etc . through one or more bus interfaces . alternatively , any and / or all of the individual components may be replaced by an integrated circuit in the form of a programmable logic device , gate array , asic , multi - chip module , etc . programmed to replicate the functions of the stand - alone devices . in addition , each of these components is coupled to a power source , such as a removable and / or rechargeable battery ( not shown ). the user interface 350 may interact with a communications utilities software component , also contained in memory 330 , which provides for the establishment of service sessions using long - range communications 310 and / or short - range communications 320 . the communications utilities component may include various routines that allow the reception of services from remote devices according to mediums such as the wireless application protocol ( wap ), hypertext markup language ( html ) variants like compact html ( chtml ), etc . iii . exemplary operation of a wireless communication device including potential interference problems encountered . fig4 discloses a stack approach to understanding the operation of a wcd in accordance with at least one embodiment of the present invention . at the top level 400 , user 110 interacts with wcd 100 . the interaction involves user 110 entering information via user input 360 and receiving information from user output 370 in order to activate functionality in application level 410 . in the application level , programs related to specific functionality within the device interact with both the user and the system level . these programs include applications for visual information ( e . g ., web browser , dvb - h receiver , etc . ), audio information ( e . g ., cellular telephone , voice mail , conferencing software , dab or analog radio receiver , etc . ), recording information ( e . g ., digital photography software , word processing , scheduling , etc .) or other information processing . actions initiated at application level 410 may require information to be sent from or received into wcd 100 . in the example of fig4 , data is requested to be sent to a recipient device via bluetooth ™ communication . as a result , application level 410 may then call resources in the system level to initiate the required processing and routing of data . system level 420 processes data requests and routes the data for transmission . processing may include , for example , calculation , translation , conversion and / or packetizing the data . the information may then be routed to an appropriate communication resource in the service level . if the desired communication resource is active and available in the service level 430 , the packets may be routed to a radio modem for delivery via wireless transmission . there may be a plurality of modems operating using different wireless mediums . for example , in fig4 , modem 4 is activated and able to send packets using bluetooth ™ communication . however , a radio modem ( as a hardware resource ) need not be dedicated only to a specific wireless medium , and may be used for different types of communication depending on the requirements of the wireless medium and the hardware characteristics of the radio modem . fig5 discloses a situation wherein the above described exemplary operational process may cause more than one radio modem to become active . in this case , wcd 100 is both transmitting and receiving information via wireless communication over a multitude of mediums . wcd 100 may be interacting with various secondary devices such as those grouped at 500 . for example , these devices may include cellular handsets communicating via long - range wireless communication like gsm , wireless headsets communicating via bluetooth ™, internet access points communicating via wlan , etc . problems may occur when some or all of these communications are carried on simultaneously . as further shown in fig5 , multiple modems operating simultaneously may cause interference for each other . such a situation may be encountered when wcd 100 is communicating with more than one external device ( as previously described ). in an exemplary extreme case , devices with modems simultaneously communicating via bluetooth ™, wlan and wireless usb would encounter substantial overlap since all of these wireless mediums operate in the 2 . 4 ghz band . the interference , shown as an overlapping portion of the fields depicted in fig5 , would cause packets to be lost and the need for retransmission of these lost packets . retransmission requires that future time slots be used to retransmit lost information , and therefore , overall communications performance will at least be reduced , if the signal is not lost completely . the present invention , in at least one embodiment , seeks to manage such situations where communications are occurring simultaneously so that anticipated interference is minimized or totally avoided , and as a result , both speed and quality are maximized . in an attempt to better manage communications in wcd 100 , an additional controller dedicated to managing wireless communications may be introduced . wcd 100 , as pictured in fig6 a , includes a multiradio controller ( mrc ) 600 in accordance with at least one embodiment of the present invention . mrc 600 is coupled to the master control system of wcd 100 . this coupling enables mrc 600 to communicate with radio modems or other similar devices in communications modules 310 312 , 320 and 340 via the master operating system of wcd 100 . while this configuration may in some cases improve overall wireless communications efficiency for wcd 100 , problems may occur when wcd 100 becomes busy ( e . g ., when the control system of wcd 100 is employed in multitasking many different simultaneous operations , both communications and non - communications related ). fig6 b discloses in detail at least one embodiment of wcd 100 , which may include multiradio controller ( mrc ) 600 introduced in fig6 a in accordance with at least one embodiment of the present invention . mrc 600 includes common interface 620 by which information may be sent or received through master control system 640 . further , each radio modem 610 or similar communication device 630 , for example an rfid scanner for scanning machine - readable information , may also include some sort of common interface 620 for communicating with master control system 640 . as a result , all information , commands , etc . occurring between radio modems 610 , similar devices 630 and mrc 600 are conveyed by the communications resources of master control system 640 . the possible effect of sharing communications resources with all the other functional modules within wcd 100 will be discussed with respect to fig6 c . fig6 c discloses an operational diagram similar to fig4 including the effect of mrc 600 in accordance with at least one embodiment of the present invention . in this system mrc 600 may receive operational data from the master operating system of wcd 100 , concerning for example applications running in application level 410 , and status data from the various radio communication devices in service level 430 . mrc 600 may use this information to issue scheduling commands to the communication devices in service level 430 in an attempt to avoid communication problems . however , problems may occur when the operations of wcd 100 are fully employed . since the various applications in application level 410 , the operating system in system level 420 , the communications devices in service level 430 and mrc 600 must all share the same communications system , delays may occur when all aspects of wcd 100 are trying to communicate on the common interface system 620 . as a result , delay sensitive information regarding both communication resource status information and radio modem 610 control information may become delayed , nullifying any beneficial effect from mrc 600 . therefore , a system better able to handle the differentiation and routing of delay sensitive information is required if the beneficial effect of mrc 600 is to be realized . fig7 a introduces mrc 600 as part of a multiradio control system ( mcs ) 700 in wcd 100 in accordance with at least one embodiment of the present invention . mcs 700 directly links the communications resources of modules 310 , 312 , 320 and 340 to mrc 600 . mcs 700 may provide a dedicated low - traffic communication structure for carrying delay sensitive information both to and from mrc 600 . additional detail is shown in fig7 b . mcs 700 forms a direct link between mrc 600 and the communication resources of wcd 100 . this link may be established by a system of dedicated mcs interfaces 710 and 720 . for example , mcs interface 720 may be coupled to mrc 600 . mcs interfaces 710 may connect radio modems 610 and other similar communications devices 630 to mcs 700 in order to form an information conveyance for allowing delay sensitive information to travel to and from mrc 600 . in this way , the abilities of mrc 600 are no longer influenced by the processing load of master control system 640 . as a result , any information still communicated by master control system 640 to and from mrc 600 may be deemed delay tolerant , and therefore , the actual arrival time of this information does not substantially influence system performance . on the other hand , all delay sensitive information is directed to mcs 700 , and therefore is insulated from the loading of the master control system . the effect of mcs 700 is seen in fig7 c in accordance with at least one embodiment of the present invention . information may now be received in mrc 600 from at least two sources . system level 420 may continue to provide information to mrc 600 through master control system 640 . in addition , service level 430 may specifically provide delay sensitive information conveyed by mcs 700 . mrc 600 may distinguish between these two classes of information and act accordingly . delay tolerant information may include information that typically does not change when a radio modem is actively engaged in communication , such as radio mode information ( e . g ., gprs , bluetooth ™, wlan , etc . ), priority information that may be defined by user settings , the specific service the radio is driving ( qos , real time / non real time ), etc . since delay tolerant information changes infrequently , it may be delivered in due course by master control system 640 of wcd 100 . alternatively , delay sensitive ( or time sensitive ) information includes at least modem operational information that frequently changes during the course of a wireless connection , and therefore , requires immediate update . as a result , delay sensitive information may need to be delivered directly from the plurality of radio modems 610 through the mcs interfaces 710 and 720 to mrc 600 , and may include radio modem synchronization information . delay sensitive information may be provided in response to a request by mrc 600 , or may be delivered as a result of a change in radio modem settings during transmission , as will be discussed with respect to synchronization below . vi . a wireless communication device including a distributed multiradio control system . fig8 a discloses an alternative configuration in accordance with at least one embodiment of the present invention , wherein a distributed multiradio control system ( mcs ) 700 is introduced into wcd 100 . distributed mcs 700 may , in some cases , be deemed to provide an advantage over a centralized mrc 600 by distributing these control features into already necessary components within wcd 100 . as a result , a substantial amount of the communication management operations may be localized to the various communication resources , such as radio modems 610 , reducing the overall amount of control command traffic in wcd 100 . mcs 700 , in this example , may be implemented utilizing a variety of bus structures , including the i 2 c interface commonly found in portable electronic devices , as well as emerging standards such as slimbus that are now under development . i 2 c is a multi - master bus , wherein multiple devices can be connected to the same bus and each one can act as a master through initiating a data transfer . an i 2 c bus contains at least two communication lines , an information line and a clock line . when a device has information to transmit , it assumes a master role and transmits both its clock signal and information to a recipient device . slimbus , on the other hand , utilizes a separate , non - differential physical layer that runs at rates of 50 mbits / s or slower over just one lane . it is being developed by the mobile industry processor interface ( mipi ) alliance to replace today &# 39 ; s i 2 c and i 2 s interfaces while offering more features and requiring the same or less power than the two combined . mcs 700 directly links distributed control components 702 in modules 310 , 312 , 320 and 340 . another distributed control component 704 may reside in master control system 640 of wcd 100 . it is important to note that distributed control component 704 shown in processor 300 is not limited only to this embodiment , and may reside in any appropriate system module within wcd 100 . the addition of mcs 700 provides a dedicated low - traffic communication structure for carrying delay sensitive information both to and from the various distributed control components 702 . the exemplary embodiment disclosed in fig8 a is described with more detail in fig8 b . mcs 700 forms a direct link between distributed control components 702 within wcd 100 . distributed control components 702 in radio modems 610 may , for example , consist of mcs interface 710 , radio activity controller 720 and synchronizer 730 . radio activity controller 720 uses mcs interface 710 to communicate with distributed control components in other radio modems 610 . synchronizer 730 may be utilized to obtain timing information from radio modem 610 to satisfy synchronization requests from any of the distributed control components 702 . radio activity controller 702 may also obtain information from master control system 640 ( e . g ., from distributed control component 704 ) through common interface 620 . as a result , any information communicated by master control system 640 to radio activity controller 720 through common interface 620 may be deemed delay tolerant , and therefore , the actual arrival time of this information does not substantially influence communication system performance . on the other hand , all delay sensitive information may be conveyed by mcs 700 , and therefore is insulated from master control system overloading . as previously stated , a distributed control component 704 may exist within master control system 640 . some aspects of this component may reside in processor 300 as , for example , a running software routine that monitors and coordinates the behavior of radio activity controllers 720 . processor 300 is shown to contain priority controller 740 . priority controller 740 may be utilized to monitor active radio modems 610 in order to determine priority amongst these devices . priority may be determined by rules and / or conditions stored in priority controller 740 . modems that become active may request priority information from priority controller 740 . further , modems that go inactive may notify priority controller 740 so that the relative priority of the remaining active radio modems 610 may be adjusted accordingly . priority information is usually not considered delay sensitive because it is mainly updated when radio modems 610 activate / deactivate , and therefore , does not frequently change during the course of an active communication connection in radio modems 610 . as a result , this information may be conveyed to radio modems 610 using common interface system 620 in at least one embodiment of the present invention . at least one effect of a distributed control mcs 700 is seen in fig8 c . system level 420 may continue to provide delay tolerant information to distributed control components 702 through master control system 640 . in addition , distributed control components 702 in service level 430 , such as modem activity controllers 720 , may exchange delay sensitive information with each other via mcs 700 . each distributed control component 702 may distinguish between these two classes of information and act accordingly . delay tolerant information may include information that typically does not change when a radio modem is actively engaged in communication , such as radio mode information ( e . g ., gprs , bluetooth ™, wlan , etc . ), priority information that may be defined by user settings , the specific service the radio is driving ( qos , real time / non real time ), etc . since delay tolerant information changes infrequently , it may be delivered in due course by master control system 640 of wcd 100 . alternatively , delay sensitive ( or time sensitive ) information includes at least modem operational information that frequently changes during the course of a wireless connection , and therefore , requires immediate update . delay sensitive information needs to be delivered directly between distributed control components 702 , and may include radio modem synchronization and activity control information . delay sensitive information may be provided in response to a request , or may be delivered as a result of a change in radio modem , which will be discussed with respect to synchronization below . mcs interface 710 may be used to ( 1 ) exchange synchronization information , and ( 2 ) transmit identification or prioritization information between various radio activity controllers 720 . in addition , as previously stated , mcs interface 710 is used to communicate the radio parameters that are delay sensitive from a controlling point of view . mcs interface 710 can be shared between different radio modems ( multipoint ) but it cannot be shared with any other functionality that could limit the usage of mcs interface 710 from a latency point of view . the control signals sent on mcs 700 that may enable / disable a radio modem 610 should be built on a modem &# 39 ; s periodic events . each radio activity controller 720 may obtain this information about a radio modem &# 39 ; s periodic events from synchronizer 730 . this kind of event can be , for example , frame clock event in gsm ( 4 . 615 ms ), slot clock event in bt ( 625 us ) or targeted beacon transmission time in wlan ( 100 ms ) or any multiple of these . a radio modem 610 may send its synchronization indications when ( 1 ) any radio activity controller 720 requests it , ( 2 ) a radio modem internal time reference is changed ( e . g . due to handover or handoff ). the latency requirement for the synchronization signal is not critical as long as the delay is constant within a few microseconds . the fixed delays can be taken into account in the scheduling logic of radio activity controller 710 . the radio modem activity control is based on the knowledge of when the active radio modems 610 are about to transmit ( or receive ) in the specific connection mode in which the radios are currently operating . the connection mode of each radio modem 610 may be mapped to the time domain operation in their respective radio activity controller 720 . as an example , for a gsm speech connection , priority controller 740 may have knowledge about all traffic patterns of gsm . this information may be transferred to the appropriate radio activity controller 720 when radio modem 610 becomes active , which may then recognize that the speech connection in gsm includes one transmission slot of length 577 μs , followed by an empty slot after which is the reception slot of 577 μs , two empty slots , monitoring ( rx on ), two empty slots , and then it repeats . dual transfer mode means two transmission slots , empty slot , reception slot , empty slot , monitoring and two empty slots . when all traffic patterns that are known a priori by the radio activity controller 720 , it only needs to know when the transmission slot occurs in time to gain knowledge of when the gsm radio modem is active . this information may be obtained by synchronizer 730 . when the active radio modem 610 is about to transmit ( or receive ) it must check every time whether the modem activity control signal from its respective radio activity controller 720 permits the communication . radio activity controller 720 is always either allowing or disabling the transmission of one full radio transmission block ( e . g . gsm slot ). vii . a wireless communication device including an alternative example of a distributed multiradio control system . an alternative distributed control configuration in accordance with at least one embodiment of the present invention is disclosed in fig9 a - 9c . in fig9 a , distributed control components 702 continue to be linked by mcs 700 . however , now distributed control component 704 is also directly coupled to distributed control components 702 via an mcs interface . as a result , distributed control component 704 may also utilize and benefit from mcs 700 for transactions involving the various communications components of wcd 100 . referring now to fig9 b , the inclusion of distributed control component 704 onto mcs 700 is shown in more detail . distributed control component 704 includes at least priority controller 740 coupled to mcs interface 750 . mcs interface 750 allows priority controller 740 to send information to , and receive information from , radio activity controllers 720 via a low - traffic connection dedicated to the coordination of communication resources in wcd 100 . as previously stated , the information provided by priority controller 740 may not be deemed delay sensitive information , however , the provision of priority information to radio activity controllers 720 via mcs 700 may improve the overall communication efficiency of wcd 100 . performance may improve because quicker communications between distributed control components 702 and 704 may result in faster relative priority resolution in radio activity controllers 720 . further , the common interface system 620 of wcd 100 will be relieved of having to accommodate communication traffic from distributed control component 704 , reducing the overall communication load in master control system 640 . another benefit may be realized in communication control flexibility in wcd 100 . new features may be introduced into priority controller 740 without worrying about whether the messaging between control components will be delay tolerant or sensitive because an mcs interface 710 is already available at this location . fig9 c discloses the operational effect of the enhancements seen in the current alternative embodiment of the present invention on communications in wcd 100 . the addition of an alternative route for radio modem control information to flow between distributed control components 702 and 704 may both improve the communications management of radio activity controllers 720 and lessen the burden on master control system 640 . in this embodiment , all distributed control components of mcs 700 are linked by a dedicated control interface , which provides immunity to communication coordination control messaging in wcd 100 when the master control system 640 is experiencing elevated transactional demands . an example message packet 900 is disclosed in fig1 in accordance with at least one embodiment of the present invention . example message packet 900 includes activity pattern information that may be formulated by mrc 600 or radio activity controller 720 . the data payload of packet 900 may include , in at least one embodiment of the present invention , at least message id information , allowed / disallowed transmission ( tx ) period information , allowed / disallowed reception ( rx ) period information , tx / rx periodicity ( how often the tx / rx activities contained in the period information occur ), and validity information describing when the activity pattern becomes valid and whether the new activity pattern is replacing or added to the existing one . the data payload of packet 900 , as shown , may consist of multiple allowed / disallowed periods for transmission or reception ( e . g ., tx period 1 , 2 . . . ) each containing at least a period start time and a period end time during which radio modem 610 may either be permitted or prevented from executing a communication activity . while the distributed example of mcs 700 may allow radio modem control activity to be controlled real - time ( e . g ., more control messages with finer granularity ), the ability to include multiple allowed / disallowed periods into a single message packet 900 may support radio activity controllers 720 in scheduling radio modem behavior for longer periods of time , which may result in a reduction in message traffic . further , changes in radio modem 610 activity patterns may be amended using the validity information in each message packet 900 . the modem activity control signal ( e . g ., packet 900 ) may be formulated by mrc 600 or radio activity controller 720 and transmitted on mcs 700 . the signal includes activity periods for tx and rx separately , and the periodicity of the activity for the radio modem 610 . while the native radio modem clock is the controlling time domain ( never overwritten ), the time reference utilized in synchronizing the activity periods to current radio modem operation may be based one of at least two standards . in a first example , a transmission period may start after a pre - defined amount of synchronization events have occurred in radio modem 610 . alternatively , all timing for mrc 600 or between distributed control components 702 may be standardized around the system clock for wcd 100 . advantages and disadvantages exist for both solutions . using a defined number of modem synchronization events is beneficial because then all timing is closely aligned with the radio modem clock . however , this strategy may be more complicated to implement than basing timing on the system clock . on the other hand , while timing based on the system clock may be easier to implement as a standard , conversion to modem clock timing must necessarily be implemented whenever a new activity pattern is installed in radio modem 610 . the activity period may be indicated as start and stop times . if there is only one active connection , or if there is no need to schedule the active connections , the modem activity control signal may be set always on allowing the radio modems to operate without restriction . the radio modem 610 should check whether the transmission or reception is allowed before attempting actual communication . the activity end time can be used to check the synchronization . once the radio modem 610 has ended the transaction ( slot / packet / burst ), it can check whether the activity signal is still set ( it should be due to margins ). if this is not the case , the radio modem 610 can initiate a new synchronization with mrc 600 or with radio activity controller 720 through synchronizer 730 . the same happens if a radio modem time reference or connection mode changes . a problem may occur if radio activity controller 720 runs out of the modem synchronization and starts to apply modem transmission / reception restrictions at the wrong time . due to this , modem synchronization signals need to be updated periodically . the more active wireless connections , the more accuracy is required in synchronization information . as a part of information acquisition services , the mcs interface 710 needs to send information to mrc 600 ( or radio activity controllers 720 ) about periodic events of the radio modems 610 . using its mcs interface 710 , the radio modem 610 may indicate a time instance of a periodic event related to its operation . in practice these instances are times when radio modem 610 is active and may be preparing to communicate or communicating . events occurring prior to or during a transmission or reception mode may be used as a time reference ( e . g ., in case of gsm , the frame edge may be indicated in a modem that is not necessarily transmitting or receiving at that moment , but we know based on the frame clock that the modem is going to transmit [ x ] ms after the frame clock edge ). basic principle for such timing indications is that the event is periodic in nature . every incident needs not to be indicated , but the mrc 600 may calculate intermediate incidents itself . in order for that to be possible , the controller would also require other relevant information about the event , e . g . periodicity and duration . this information may be either embedded in the indication or the controller may get it by other means . most importantly , these timing indications need to be such that the controller can acquire a radio modem &# 39 ; s basic periodicity and timing . the timing of an event may either be in the indication itself , or it may be implicitly defined from the indication information by mrc 600 ( or radio activity controller 720 ). in general terms these timing indications need to be provided on periodic events like : schedule broadcasts from a base station ( typically tdma / mac frame boundaries ) and own periodic transmission or reception periods ( typically tx / rx slots ). those notifications need to be issued by the radio modem 610 : ( 1 ) on network entry ( i . e . modem acquires network synchrony ), ( 2 ) on periodic event timing change e . g . due to a handoff or handover and ( 3 ) as per the policy and configuration settings in the multiradio controller ( monolithic or distributed ). in at least one embodiment of the present invention , the various messages exchanged between the aforementioned communication components in wcd 100 may be used to dictate behavior on both a local ( radio modem level ) and global ( wcd level ) basis . mrc 600 or radio activity controller 720 may deliver a schedule to radio modem 610 with the intent of controlling that specific modem , however , radio modem 610 may not be compelled to conform to this schedule . the basic principle is that radio modem 610 is not only operating according to multiradio control information ( e . g ., operates only when mrc 600 allows ) but it is also performing internal scheduling and link adaptation while taking mrc scheduling information into account . in order to better understand communication in accordance with at least one embodiment of the present invention , exemplary mrc - radio interface primitives are now described . primitives carry parameters which are needed in multiradio scheduling . air_time_enable ( mrc to radio ): mrc 600 may use this command to give radio modem 610 permission to operate for a set time . a regular air - time can be enabled for the radio with an interval parameter . parameters : start_time , period , interval tx / rx / trx enabled . ( see , for example , the previously described communication packet disclosed in fig9 ) sync_ind ( radio to mrc ): radio modem 610 indicates time dependent issues ( e . g . start time of the activity ). this primitive may be sent to mrc 600 to indicate when an activity starts if the radio is enabled to use air - time , or when the activity would have started if the radio is currently disabled because of the air_time_enable primitive . mrc 600 uses this indication as a help when composing air_time_enable messages for radio modem 610 . information_req ( mrc to radio ): mrc 600 may use this command to request information that is specified in the parameters of the primitive from radio modem 610 . information_cnf ( radio to mrc ): radio modem 610 may inform mrc 600 that it has received the information_req message . using success and failure parameters , radio modem 610 can indicate whether it can provide the requested information to mrc 600 . information_ind ( radio to mrc ): radio modem 610 may provide requested information parameters to the mrc 600 . one request may result in multiple indications , for example , indications which are sent regularly . these indications may also be sent without a request from mrc 600 ( e . g ., if remote device wants to change some parameters in a link ). configuration_change_req ( mrc to radio ): mrc 600 may use this primitive to indicate to radio modem 610 that a parameter change is required . configuration_change_cnf ( radio to mrc ): radio modem 610 may then indicate to mrc 600 that the required configuration change has succeeded or failed . radio modem 610 may also use some other parameters in scheduling ( e . g ., allowed frequencies ), which may be included in a configuration_change_req message . allowed frequencies information would be important to radio modem 610 if it were implementing a frequency hopping spread spectrum strategy . if the controller does not allow radio modem 610 to utilize all the frequencies , the modem can take this into account in the scheduling . even if radio modem 610 is enabled to transmit according to an air_time_enable message , it may still not transmit if the frequency hopping algorithm lands on a previously disabled frequency at the time the transmission would have occurred . depending on timing requirements ( delay sensitive vs . delay tolerant ), the primitives can be either exchanged via mcs 700 , or they can be obtained via the protocol stack of wcd 100 . the aforementioned communication primitives may be used in tandem with various communication status indicators to form the interface between a radio modem 610 and the previously discussed radio control elements in mcs 700 . fig1 a discloses examples of communication status signals which communicate synchronization signals , status and permission to either mrc 600 or radio modem 610 in accordance with at least one embodiment of the present invention . tx_allow in wcd 100 is a status indicator which notifies radio modem 610 ( as shown by the arrow pointing to modem 610 in fig1 a ) when a modem may transmit . for example , when the tx_allow signal is set for a particular modem , the modem is permitted to transmit . this bit may be set by the mrc 610 or radio activity controller 720 . further , rx_allow provides the same functionality with respect to receiving information into radio modem 610 . if these bits are not set by mrc 610 , then the radio modem 610 may not transmit or receive , respectively . tx_active and rx_active are used to indicate to other communication components in wcd 100 when radio modem 610 is actively transmitting or receiving , respectively . these indicators may be read by mrc 600 or other radio modems 610 to determine when a modem is actively communicating . during these periods , mrc 600 may alter planned resource management in order to allow radio modem 610 to complete the current communication transaction . further , mrc 600 may use these signals to account for the current status of various radio modems 610 in order to plan future communication resource management . for example , based on tx_active and rx_active for all of the active radio modems 610 , mrc 600 may further employ priority rules to determine how to best manage the radio modem resources within wcd 100 so as to avoid possible wireless transmission collisions . sync is a signal for synchronizing to a traffic pattern for radio modem 610 . sync is the mandatory output signal that sends synchronization pulses that match the clock of radio modem 610 . this could mean , for example , a beacon signal for wlan , or slot border instants for bluetooth ™ or gsm . the sync signal pulse is therefore tied to the radio modem &# 39 ; s synchronization with its peer , access point or base station element . when the sync signal is active , radio modem 610 may broadcast a synchronization signal over mcs 700 to mrc 600 or other radio modems 610 . sync_valid is a qualifier for sync . in some cases , due for example to handover or handoff of radio modem 610 , which may occur when a radio modem 610 is switching from one network access point / base station to another network access point / base station within a communications network , the clock signal of radio modem 610 may change or become unstable . during these periods , it will be advantageous for radio modem 610 to prevent other devices from utilizing this inaccurate clock signal in an attempt to synchronize . the sync_valid signal may change ( e . g ., become unset or go low ) during a period when the clock signal should not be used for synchronization , and the detection of this state may further cause other communication components to enter a delay or hold mode before attempting to resynchronize . when radio modem 610 is no longer in flux ( e . g ., the clock signal has stabilized ) the sync_valid bit may be enabled so that mrc 600 and other communication components seeking to synchronize to radio modem 610 may resume the synchronization process . fig1 a further demonstrates various communication scenarios and the state of interface the status indicators as a result in each case . in the example 1 , wcd 100 is wirelessly transmitting information to secondary device 1100 . therefore , at least the tx_allow must be set by mrc 600 to permit the radio modem 610 to send information , and the tx_active will be set when the transmission commences . in this case , sync_valid may be set because the modem is in a stable state and any synchronization signal issued by the modem may be valid . in the second example , the converse is happening in that secondary device 1100 is now transmitting to wcd 100 . as a result , at least the rx_allow must be set , and the rx_active when radio modem 610 enters a receiving mode . example 3 shows a case where there is no active communication between the wcd 100 and secondary device 1100 . the sync_valid may still be set if the modem is in steady state . fig1 b explores synchronization scenarios in view of the previously described communication interface . in example 1 , a synchronization is occurring between wcd 100 and secondary device 1100 . in this case , the sync signal is active and sync_valid is enabled to allow other components , such as mrc 600 and other radio modems 610 , as well as external devices , such as secondary device 1100 , to synchronize . however , in example 2 there is an instability in the communication network of radio modem 610 . there may be a network handoff or handover occurring , or clock drifting may be occurring . due to the clock drifting ( e . g . in bluetooth ) secondary device 1100 may not capable of receiving the synch - burst from wcd 100 , which may cause an error situation where secondary device 1100 cannot identify from the expected master slot the required synch - field and cannot process the received packet . as a corrective procedure , the slave device , for example , may prolong its “ receiving window .” as a further indication to mrc 600 of the state of the secondary device , the sync_valid signal may be disabled , or unset , until the secondary device 1100 is again synchronized with wcd 100 . once the sync_valid indicates that the clocking of radio modem 610 is invalid , the sync signal may further be disabled or prevented from broadcasting as shown in example 3 . this action may be a secondary precaution to prevent other internal components and / or external devices from synchronizing until the clock signal stabilizes . further , other components ( such as mrc 600 and other radio modems 610 ) and secondary device 1100 may enter a delay or hold mode until the sync_valid signal is reset . this mode may maintain the device or components in a safe mode until a re - synchronization is allowed by radio modem 610 . fig1 discloses an exemplary process flowchart in accordance with at least one embodiment of the present invention . in step 1202 , mrc 600 monitors all of the active radio modems 610 . an internal component ( e . g . mrc 600 and / or other radio modem 610 ) or an external device ( e . g ., secondary device 1100 ) then requires synchronization to the clock of radio modem 610 in step 1206 . the sync signal may then be enabled ( if not already enabled ) in step 1206 , and a synchronization signal may then be broadcast by radio modem 610 . however , in step 1208 a determination is made as to whether the clock signal in radio modem 610 is unstable due to a change of state ( as previously described ). if the state is unstable , then in step 1210 the sync_valid is disabled ( unset ) and the mrc 600 and / or other radio modems 610 are prevented from synchronizing ( step 1212 ). this may further cause these components to enter a hold or safe state in step 1214 until the synch_valid is enabled . again , the status of radio modem 610 is checked in step 1216 . if the clock signal has not become stable , then the communication system in wcd 100 remains in a hold or safe state by returning to 1210 . once the state of radio modem 610 is stabilized , the sync_valid may be enabled in step 1218 , and the mrc 600 and / or other radio modems 610 ( as well as external devices ) may synchronize . once the requested synchronization is completed , the synch signal may be deactivated to stop the synchronization signal broadcast ( e . g ., to clear mcs 700 for other communication traffic ) in step 1222 . the present invention is an improvement over the state of the art . the multipoint control system of the present invention allows a device with a plurality of active radio modems to efficiently manage communications between these modems in order to avoid potential communication conflicts . this scheduling of wireless communication resources allows a wireless communication device to function in a fully enabled mode without experiencing communication quality degradation due to the constant retransmission of lost packets . further , accommodation for occasional radio modem instability allows for the prevention of bad synchronization and , as a result , the possible disruption of active wireless communication . accordingly , it will be apparent to persons skilled in the relevant art that various changes in forma and detail can be made therein without departing from the spirit and scope of the invention . this the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents . | 7 |
for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . fig1 illustrates the type of electric propulsion system considered herein , indicated generally at 10 . the power source of the system 10 is a diesel engine or turbine 12 , which serves as a prime mover for the 3 - phase synchronous machine ( sm ) 14 . the 3 - phase output of the machine 14 is rectified using an uncontrolled rectifier 16 . the rectifier 16 output voltage is denoted ν r . an lc circuit 18 serves as a filter , and the output of the filter 18 is denoted ν dcs . a voltage regulator / exciter 20 adjusts the field voltage of the synchronous machine 14 in such a way that the source bus voltage ν dcs is equal to the commanded bus voltage ν * dcs . the source bus is connected via a tie line 22 to the load bus , the voltage at which is denoted ν dci . the load bus consists of a capacitive filter 24 ( which can include both electrolytic and polypropylene capacitance ) as well as a 3 - phase fully controlled inverter 26 , which in turn supplies an induction motor 28 . the induction motor 28 drives the mechanical load 30 , which is rotating at a speed ω rm , im . based upon the mechanical rotor speed , and the desired electromagnetic torque t c , des ( which is determined by the controller governing the mechanical system ), the induction motor controls 32 specify the on / off status of each of the inverter 26 semiconductors in such a way that the desired torque is obtained as is known in the art . although the system 10 is quite robust with regard to overcurrents , and simple to design from the viewpoint that the controller governing the mechanical system is decoupled from the control of the electrical system ( since the torque can be controlled nearly instantaneously ), such systems are prone to be subject to a limit cycle behavior in the dc bus voltage known as negative impedance instability . in order to gain insight into the cause of negative impedance instability , it is appropriate to set forth a highly simplified model of the system 10 depicted in fig1 . this model focuses on the dc link dynamics and need only be valid in the tens to hundreds of hertz frequency band . an appropriate equivalent circuit of the synchronous machine / rectifier 14 / 16 and lc filter 18 is illustrated in fig2 . therein , the dynamics of both the prime mover 12 and voltage regulator 20 are neglected since these are subject to long time constants imposed by the prime mover 12 inertia and synchronous machine 14 field , respectively . the dc voltage behind the inductance and resistance synchronous machine model of fig2 has been shown in the prior art to have excellent bandwidth . in fig2 ## equ5 ## where ω r , sm is the electrical rotor speed of the synchronous machine 14 and λ &# 34 ; q and λ &# 34 ; d are the q - and d - axis subtransient flux linkages , α is the firing angle relative to the subtransient back emf , l c ( β ) and l t ( β ) are the commutating and transient commutating inductances defined by ## equ6 ## and ## equ7 ## where β is the firing angle relative to rotor position and l &# 34 ; 1 and l &# 34 ; d are the synchronous machine 14 q - and d - axis subtransient inductances , r s , sm is the synchronous machine 14 stator resistance , l f and r f are the inductance and resistance of the lc filter 18 inductor , and c f is the capacitance of the lc filter 18 capacitor . a highly simplified model of the capacitive filter 24 and inverter 26 is illustrated in fig3 . therein , all losses in the machine 28 and inverter 26 are neglected whereupon the drive is modeled as a dependent current source equal to the instantaneous power p divided by dc link voltage ν dci and where it is assumed that the instantaneous power is equal to the instantaneous power command p * defined as in ( 4 ), t * e is an instantaneous torque command , which is the input to the field oriented induction motor control 32 . typically , the instantaneous torque command t * e is set equal to the desired torque t e , des . however , the control algorithm described herein also comprehends an alternate relationship . upon neglecting the tie line 22 , which is generally short in an electrical sense for the frequency range of interest , the component models illustrated in fig2 . and fig3 . are combined as fig4 . therein ## equ8 ## in ( 5 - 8 ), α and β can be found by steady - state analysis of the load commutated converter rectifier system . however , the calculation can be made much simpler by noting that the rectifier 16 is uncontrolled and by neglecting subtransient saliency whereupon and the commutating and transient commutating inductances are no longer a function of β . furthermore , due to the action of the voltage regulator , the subtransient inductances will have a value such that so that no subtransient information is actually needed . it should be cautioned that this model is intended for explanation purposes and for guidance in designing control algorithms , not for high - fidelity simulation or for the testing of control algorithms . in order to utilize this equivalent circuit to predict negative impedance stability , note that linearizing the input current with respect to input voltage about an operating point , wherein ν dci is equal to ν * dcs , yields ## equ9 ## from which it is apparent that the small signal inverter 26 input impedance is ## equ10 ## as can be seen , in a small signal sense the inverter 26 appears as a negative resistance which , from an intuitive point of view , would seem to be destabilizing . in order to verify this conclusion , replacing the dependent source representing the inverter 26 with its small signal equivalent impedance yields the following small signal model of the equivalent circuit ## equ11 ## which has a characteristic equation of ## equ12 ## from ( 14 ) it follows that necessary conditions for stability are that ## equ13 ## and that ## equ14 ## equations ( 15 ) and ( 16 ) both limit the maximum power command , however ( 16 ) is normally the dominant constraint . in order to avoid negative impedance instability , one method is to simply increase c e until the system 10 is stable to the maximum possible power command however , this has the disadvantage in that for very large drive systems the physical size and weight of this capacitance becomes an issue , especially considering the fact that the applications are largely mobile in nature . in addition , large capacitor banks are also undesirable from a maintenance point of view since identifying a shorted capacitor in a large bank is time - intensive . this is significant since electrolytic capacitors have relatively low reliability . hereinbelow , a control is set forth which eliminates the need to increase the capacitance in order to satisfy ( 16 ). in addition to ensuring stability , the control of the present invention can be used to improve damping even if the system is already stable , and , in the case of small drives , may make it possible to entirely eliminate electrolytic capacitance from some systems , thereby eliminating one of the traditionally least reliable drive components . one embodiment of the present invention comprises a function which improves the damping of the dc link by eliminating the negative impedance effect over a prescribed bandwidth . this function is based upon the fact that torque control in a field - oriented drive is nearly instantaneous . as described hereinabove , typically the instantaneous torque command t * e is set equal to the desired torque t e , des as determined by the control function governing the mechanical system . however , the present invention determines the instantaneous torque command as ## equ15 ## where ν dci is the filtered dc inverter voltage , i . e ., ## equ16 ## and the parameters n and τ are considered to be constants herein but could also be made to be a function of operation point ( i . e ., any predetermined real number ). the advantage of this readily implemented though nonlinear control function is that it is extremely straightforward to implement yet highly effective in mitigating negative impedance instabilities . in order to illustrate the effect of the function on the system 10 note that using the control law ( 17 ), the input power into the inverter 26 is given by ## equ17 ## where from ( 19 ) the input current may be expressed ## equ18 ## linearizing ( 21 ) about the desired operating point ( ν dci = ν dci = ν * dcs ) yields ## equ19 ## if τ is large compared to the time scale of the dc link dynamics and n is selected to be unity , then the input impedance presented by the inverter 26 is infinite over the frequency range in which negative impedance instabilities occur , thus avoiding this type of instability . although the explanation in the previous paragraph illustrates the basic philosophy of the control , the possibilities of the control are much richer than is indicated therein . in particular , by suitable selection of τ and n a large variety of behaviors can be obtained . in order to see this , it is helpful to first set forth the nonlinear differential equation governing the dc link dynamics in the presence of the control of the present invention . in particular , ## equ20 ## linearization of ( 23 ) yields ## equ21 ## in order to illustrate the effects of varying n and τ , consider the case of a system in which ν * es = 400v , r e = 4 . 58 ω , l e = 13 . 9 mh , and c e = 51 . 4 μf . these parameters correspond to a test system which was used by the present inventors for laboratory experimentation . fig5 illustrates the root loci of the characteristic equation as τ is varied from 0 . 1 ms to 1 s for n = 1 , 3 , 5 , and 7 . ( it should be noted that n does not have to be an integer .) as can be seen , in each case the root locus contains an unstable complex pole ( denoted a and a *) for small values of τ which becomes stable as τ is increased . for all n shown in fig5 the real part of the eigenvalues becomes more negative as τ is increased . in addition , initially the complex part also decreases . in the case of n = 5 , eventually the complex pair becomes real ( point b ) and then one of these real roots meets the root corresponding to the filter at point c , at which point this pair of eigenvalues becomes complex . in the case of n = 7 , the two complex poles eventually become real at point d ; after which the pair moves away from each other on the real axis . fig6 illustrates the damping of the complex pole pair as n and τ are varied . note that for each value of n , there is a value of τ which maximizes the damping . it is also apparent that , generally speaking , as n is increased , the damping can be increased . since the control law is nonlinear , the eigenvalues will be a function of operating point , and so it is desirable to investigate the performance of the control as the operating point ( primarily through power command ) is varied . fig7 illustrates the root locus of the system as power command is varied with ( n = 1 , τ = ms ), ( n = 3 , τ = 2 . 4 ms ), ( n = 5 , τ = 2 . 7 ms ), and ( n = 7 , τ = 3 . 1 ms ). in each case , τ was selected so as to maximize the damping factor of the complex pole pair . as can be seen from fig7 at low power the complex eigenvalue of the system is at point ( a , a *) regardless of n . in the case of ( n = 1 ), the location of the roots is power level independent . however , in the case of n = 3 , the complex pair moves to ( b , b *). finally , in the case of n = 5 , and n = 7 , the complex eigenvalues become real at point c and d , respectively . this illustrates an important feature of the control law of the present invention , which is that although with the standard control ( n = 0 ), the system becomes less stable as the power level increases , with the control law of the present invention , the system actually becomes more stable as the power level increases , with the exception of ( n = 1 ), in which case the eigenvalues associated with the dc link become largely operating point invariant . before setting forth an example of the implementation of the controller of the present invention , it is appropriate to first consider a standard field oriented control such as the rotor flux indirect field oriented control illustrated in fig8 . ( note that the control of the present invention is , however , independent of whether or not the field - oriented control is direct or indirect .) therein , an instantaneous torque command t * e is the input to the controller . this torque command is equal to the torque desired by the controller governing the mechanical dynamics , t e , des . as can be seen , based on the torque command t * e and desired d - axis rotor flux level λ e * dr , the desired q - and d - axis stator currents , i e * qs and i e * ds , are determined . this calculation is a function of the induction motor magnetizing inductance l m , the induction motor rotor inductance ( rotor leakage plus magnetizing ) l &# 39 ; rr , the rotor resistance r &# 39 ; r , and the number of poles , n p , im . based on the q - and d - axis stator currents , the electrical radian slip frequency , ω s , im , is determined , which is then added to the electrical rotor speed ω r , im in order to determine the electrical speed of the synchronous reference frame ω e , im , which is integrated in order to determine the position of the synchronous reference frame θ e , im . in addition to the function illustrated in fig8 especially in large drives , the field - oriented control will often include an on - line parameter identification algorithm to compensate for variations of the rotor time constant once the q - and d - axis current commands and the position of the synchronous reference frame are established , these currents may be synthesized in a variety of ways . herein , the q - and d - axis current command was transformed back into an abc variable current command , which is an input to a hysteresis type current control . incorporating the link stabilizing control of the present invention into the field - oriented control 32 is quite straightforward . in particular , the only difference in the control is that the instantaneous torque command is generated using ( 16 ) rather than being set equal to the desired torque , as is illustrated in fig9 . in order to experimentally verify the above control scheme , a system such as the one depicted in fig1 was constructed at a low ( 3 . 7 kw ) power level . the prime mover 12 was a dynamometer in speed control mode . the parameters of the 3 . 7 kw synchronous machine 14 are listed in table 1 . therein , all rotor parameters have been referred to the stator by the appropriate turns ratio . a solid state voltage regulator / exciter 20 was used to control the dc link voltage ; a block diagram of this control appears in fig1 . the lc filter 18 , transmission line 22 , and inverter 26 capacitance parameters are listed in table 2 . those having ordinary skill in the art will note that the capacitor values are small for this power rating . this was desirable to mimic conditions which exist on much larger drives used for ship propulsion . finally , a 3 . 7 kw induction motor was used as a load 28 . induction motor 28 parameters are listed in table 3 . the indicated motor control 32 was implemented based on the indirect rotor flux strategy with a rotor flux linkage command of 0 . 45 vs , and the current command was synthesized using hysteresis current control with a hysteresis band of 0 . 95 a . the link stabilizing controller parameters were n = 1 , τ = 4 ms , ν dcmin = 200 v , and ν dcmax = 600 v . table 1______________________________________synchronous machine parameters______________________________________r . sub . s , sm = 382 mω l . sub . ls = 0 . 83 mh p = 4l . sub . mq = 13 . 5 mh l . sub . md = 39 . 7 mh n . sub . sfd = 0 . 0271r . sub . kq1 = 31 . 8 ω l . sub . lkq1 = 6 . 13 mh r . sub . fd = 122 mωr . sub . kq2 = 0 . 923 ω l . sub . lkq2 = 3 . 4 mh l . sub . lfd = 2 . 54 mhr . sub . kd1 = 40 . 47 ω l . sub . lkd1 = 4 . 73 mhr . sub . kd2 = 1 . 31 ω l . sub . lkd2 = 3 . 68 mh______________________________________ table 2______________________________________passive component parameters . ______________________________________l . sub . f = 9 . 17 mh r . sub . f = 3 . 01 ω c . sub . f = 10 . 1 μfl . sub . line = 28 . 8 μh r . sub . line = 273 mω c . sub . l = 41 . 3 μf______________________________________ table 3______________________________________induction motor parameters . ______________________________________r . sub . s = 400 mω l . sub . ls = 5 . 73 mh l . sub . m = 64 . 3 mhr . sub . r &# 39 ; = 227 mω l . sub . lr &# 39 ; = 4 . 94 mh n . sub . p = 4______________________________________ the performance of the nonlinear stabilizing control of the present invention was validated using both a detailed ( as opposed to average value / reduced order ) computer simulation and in hardware tests . for the purposes of computer simulation , the synchronous machine and induction motor models were those set forth in analysis of electric machinery by p . c . krause . in the case of the salient pole synchronous machine 14 , magnetic saturation was represented in the d - axis . the simulation included the switching of each power semiconductor device . semiconductor conduction losses were included though switching losses were neglected . fig1 illustrates the simulated performance of the system as the desired torque is changed from 2 to 19 nm over a period of 100 ms . variables depicted include the commanded a - phase current i * as , the actual a - phase current i as , the dc inverter voltage ν dci , and the electromagnetic torque t e . although the actual torque closely tracks the desired torque , it can be seen that as the torque ( and hence power command ) increases , the dc bus voltage becomes unstable , stressing both the semiconductors and the capacitors . in a typical system , such behavior could easily result in the semiconductor and / or capacitor failure . the experimental system was constructed so as to be able to survive the overvoltages . fig1 depicts the same study as measured in the laboratory . in fig1 , the instantaneous electromagnetic torque is not shown because suitable instrumentation was not available . as can be seen , there is a reasonable correspondence between fig1 and fig1 with the exception that the actual system appears to be less stable than is predicted by the simulation . this is because the power requirements of the actual drive system are greater than the simulated system because of switching losses . ( it should be noted that the magnitude of the voltage swing increases very rapidly with power level .) in addition , once a system becomes unstable , it tends to be very sensitive to parameter variations . fig1 depicts the performance of the same system with the nonlinear stabilizing control of the present invention as calculated using the computer simulation . as can be seen , according to the simulation , the torque still closely tracks the commanded torque . furthermore , in this case there is no evidence of instability . fig1 illustrates the system performance as measured in the laboratory . as predicted , the dc bus voltage is well behaved , and the dc link voltage is stable . one concern which may arise is a possible reduction in torque bandwidth since a drop in inverter 26 voltage will result in a transient dip in torque . the detailed computer simulation was used to investigate this effect since the primary variable of interest was the electromagnetic torque . fig1 depicts the predicted change of performance of the prior art field oriented control as the torque command is stepped from 2 to 19 nm . as can be seen , the electromagnetic torque reaches the commanded value in approximately 5 ms . the torque response is not instantaneous due to the fact that a step change in current cannot be achieved in practice and because the dip in link voltage causes a temporary loss of current tracking in the hysteresis current control . fig1 depicts the response with the nonlinear stabilizing control of the present invention . in this case , the electromagnetic torque reaches the commanded value in the order of 8 ms . although the link stabilized control of the present invention is somewhat slower than the standard field oriented control , this slight reduction in bandwidth is not a significant disadvantage in view of the improved dc bus voltage . this is particularly true , in fact most propulsion systems have mechanical inertia such that in either case the torque response may be considered to be instantaneous . in addition to the permanent magnet synchronous motor drive control application illustrated hereinabove , those having ordinary skill in the art will recognize that the control function of the present invention has wide applicability in any system consisting of a generation system , a distribution system , and one or more power electronic loads . for example , the system 10 of fig1 may be modified by coupling the tie line 22 to a dc / dc converter load such as that illustrated in fig1 . the dc / dc converter 50 of fig1 may be , for example , a buck / boost converter which is used to convert between a voltage of the tie line 22 ( for example 300 vdc ) to a voltage required by the load 52 ( for example 450 vdc ). feedback to the converter 50 is provided by voltage regulator 54 . dc - to - dc converters are primarily used to convert power between different dc voltage levels . the circuit diagram shown in fig1 shows the buck / boost converter 50 configuration considered herein . the operation of the buck / boost converter 50 is as follows . first , the lower semiconductor device q 2 is on , whereupon the current in the inductor 56 ramps up linearly in time . this stores energy in the inductor &# 39 ; s magnetic field . next , the lower switch q 2 is turned off and the upper switch q 1 turned on , so the current passing through the inductor 56 begins to feed the load 52 . since the current cannot change instantaneously , the same current that was going to ground now feeds the load 52 . this is possible by the collapse of the magnetic field in the inductor 56 , transmitting the stored energy to the load 52 . the process is then periodically repeated at a rate known as the switching frequency f sw . the average power transmitted to the load 52 is dependent upon the amount of time that the upper switch q 1 is on , t ud , versus the period of the switching cycle , t sw . the ratio of t ud to t sw is referred to as the duty cycle which is defined as ## equ22 ## it is assumed that either the upper or lower switch is always on and that both switches are never turned on at the same time , as this would produce a condition called shoot - through wherein the output bus is shorted to ground . in order to model this circuit , it is necessary to define the state variables of the buck / boost converter 50 as the inductor current , i in , and the capacitor voltage , ν out , which are governed by ## equ23 ## and ## equ24 ## the typical prior art converter 50 control scheme consists of two separate levels . the inner level consists of a hysteresis current controller that regulates the input current of the converter 50 to within plus or minus a given hysteresis level of the commanded input current . advantages of using hysteresis control are that current ripple is independent of operating conditions and the tight regulation of the input current provides for highly effective current limiting . the outer level of the prior art controller , which consists of the supervisory control illustrated in fig1 , is used to maintain output voltage regulation . this nonlinear pi controller consists of second order low pass filters used for eliminating aliasing in the measured inputs and for smoothing the controller outputs . the nonlinear block following the pi control converts the output current command to an input current command . system components are protected by limiting the range of the commanded input current following the controller . the conditional block is used to limit the valid operating range of the converter 50 based on the level of the distribution bus voltage , which also provides additional system protection . values of the limits , time constants , and controller gains are set forth in table iv . table iv______________________________________dc - to - dc converter controller parameters______________________________________k . sub . pc = 0 k . sub . ic = 3 . 1 τ . sub . in = 30 μsτ . sub . out = 5 μs i . sub . max = 15a i . sub . min = 0aν . sub . max = 400 v ν . sub . min = 200 v ν . sub . ref = 450 v______________________________________ the pi controller can be fairly effective in regulating the output voltage of the converter 50 and does not result in system instability for some values of system parameters ( particularly if large amounts of bus capacitance are present ). however , as is demonstrated hereinbelow , the system can still go unstable unless an appreciable amount of bus capacitance is present . in order to gain insight into the nature of this instability consider the simplified system representation depicted in fig2 . therein , the synchronous machine is modeled as a voltage behind inductance and resistance . the equivalent resistance , r eq , is given by ## equ25 ## where the term in brackets is the synchronous machine 14 commutating inductance , l &# 34 ; q and l &# 34 ; d are the synchronous machine 14 q - and d - axis subtransient inductances , β is the firing angle related to electrical rotor position , r s , sm is the synchronous machine 14 stator resistance , and ω r , sm is the synchronous machine 14 electric rotor speed the equivalent inductance is given by ## equ26 ## where the term in brackets is equal to the synchronous machine 14 transient commutating inductance . the source voltage , v dceq , may be expressed ## equ27 ## which is a function of the firing angle relative to the subtransient back flux linkage , α , and ## equ28 ## where λ &# 34 ; q and λ &# 34 ; d are the q - and d - axis subtransient flux linkages . the transmission line 22 is short and can be neglected . the equivalent capacitance , c eq , is made up of the sum of the filter 18 capacitance and the dc / dc converter 50 input capacitance . in deriving this model , the synchronous machine exciter 20 and prime move 12 dynamics are neglected since their dynamics are relatively slow . it is also assumed for this calculation that the buck / boost converter 50 compensates instantaneously to changes in the distribution bus voltage , v in , allowing it to be modeled as a single dependent current source . the dependent source is controlled by the assumed constant desired input power , p *, divided by the distribution bus voltage , assuming that the input power is equal to the commanded input power . the stability of this simplified system can be determined by calculating its pole locations . differential equations governing the system can be written as ## equ29 ## and ## equ30 ## linearizing ( 32 ) and ( 33 ) and expressing the result in state space form yields ## equ31 ## the characteristic equation corresponding to ( 34 ) is ## equ32 ## this system will be stable as long as the coefficients in ( 35 ) are positive . therefore , necessary and sufficient conditions for stability are that ## equ33 ## and ## equ34 ## it is convenient to state the stability criteria in terms of the small signal input impedance into the constant power load . this impedance is defined as the linearized transfer function between the constant power load input voltage and input current . in particular , for a constant power load ## equ35 ## note that in a small signal sense the constant power load appears as a negative resistance ( impedance ), which would suggest a destabilizing effect . in terms of the input impedance the stability criteria may be expressed ## equ36 ## and ## equ37 ## equations ( 39 ) and ( 40 ) immediately suggest two methods for manipulating system stability . first , stability can be ensured by increasing the capacitance to an appropriate level . however , such measures can be expensive in terms of capital , space , weight and reliability . the second is to manipulate the input impedance of the converter 50 . this can be accomplished by adding passive filters at the input to the converter 50 , although this can again be an expensive solution . a better solution is to use the nonlinear stabilizing control of the present invention to alter the input impedance characteristics of the converter , thereby ensuring stability of the system . in particular , the nonlinear stabilizing control depicted in fig2 is used to alter the buck / boost converter 50 input impedance so as to maintain system stability . assuming that the actual input current , i in , is equal to the commanded input current , i inc , the input impedance of the converter 50 is altered by modulating the commanded input current by the ratio of the input voltage , ν in , to the filtered input voltage , ν inf , raised to some power , ## equ38 ## this effectively controls how the input voltage effects the input current of the converter 50 by appropriately choosing the filter used in obtaining ν inf and the power to which the ratio of ν in to ν inf is raised . this has the advantage of being very simply implemented and requires no new measurements above those already made by the prior art converter 50 pi control . in addition , the measured variables are strictly local variables so that extensive cabling and possible additional hardware is not needed as would be the case for some other methods of modulating the absorbed input power of the converter 50 . however , before discussing the system stabilizing controller it is instructive to set forth a more general stability criteria for designing the controller . in explaining the physical cause of the negative impedance instability hereinabove , a very specific stability criteria was utilized . in order to perform a detailed controller design , a generalized criteria is necessary . in order to develop such general impedance based stability criteria , consider fig2 . therein the system is divided into a single ` source ` and a single ` load `, each of which may represent the parallel combination of a number of elements . for example , in the specific case of the system of interest the source will consist of the synchronous machine 14 , rectifier 16 , filter 18 , and turbine 12 while the load will consist of the dc / dc converter 50 . next , it is convenient to express the source and load impedance as ## equ39 ## and ## equ40 ## whereupon the transfer function between a change in load current and a disturbance in the difference between the thevenin equivalent voltages can be expressed as ## equ41 ## in order to ensure that the denominator has only stable poles , it is convenient to assume that the polynomials n l and d s minimum phase , whereupon ## equ42 ## since n s is assumed to be minimum phase , stability is guaranteed provided that the nyquist plot of z s / z l does not encircle the - 1 point . a simplified sufficient ( though not necessary ) criteria for stability is derived by constructing an artificial barrier in the complex plane as depicted in fig2 . clearly , the nyquist plot of z s / z l cannot encircle - 1 unless it crosses the barrier . this leads to an impedance based stability criteria in particular , stability is guaranteed if in order to use this stability criteria , a bode plot of the phase and magnitude of the source impedance are made . then as long as the magnitude of the load impedance is less than the source impedance at the point where the load phase is equal to or greater than the critical phase the system will be stable , provided of course that the polynomials n l and d s are minimum phase . the effect of the nonlinear stabilizing control on the load input impedance can now be explored . the commanded input current of the converter 50 can be written in terms of the desired input current as shown in fig2 or in terms of the desired input power as ## equ43 ## assuming that the desired power is constant , linearizing equation ( 47 ) yields ## equ44 ## from fig2 , the input admittance can then be determined about the operating point , assuming that the actual input current is always equal to the commanded input current , in particular ## equ46 ## inverting the admittance yields the input impedance : ## equ47 ## as can be seen , the nonlinear stabilizing control offers many possibilities for input impedance control by adjusting n and h ( s ). first , setting ` n ` equal zero yields ## equ48 ## whereupon it can be seen that the stabilizing control has no effect . if ` n ` is set equal to one it can be seen that with proper choice of h ( s ) the input impedance can be readily manipulated . ## equ49 ## setting ` n ` equal to two yields ## equ50 ## in this case , and for higher powers , it can be seen that ` n ` acts as a gain on the filter . although only integer values have been discussed herein , ` n ` is in the set of real numbers and does not have to be an integer . insight into how the stabilizing controller of the present invention affects the input impedance of the converter 50 has been given hereinabove , but this does not offer a way of choosing either parameter . as stated before , the exemplary controller used here sets n equal to one , leaving only the time constant in h ( s ) to be chosen , assuming a first order low pass filter with unity gain at dc . in order to facilitate a means of making this choice , a computer simulation was used to generate the pole locations from the average value model for values of τ s spanning the frequency range of 1500 to 50 rad / sec , in 50 radian steps . this was done with the bus filter capacitance effectively removed from the system . the most interesting poles were then plotted in the complex plane creating a root locus in terms of the filter time constant , as shown in fig2 . from the root locus , a value of τ s = 2 ms was chosen that offered significantly high damping but still maintained a fairly high cutoff frequency so that the system stability was guaranteed and performance degradation was minimized . this type of stabilizing control of the present invention offers many possibilities in the maintenance of system stability affected by constant power loads . here the gain term ` n ` was set equal to one , and the time constant of the filter was changed to guarantee stability in the case of lost bus capacitance . those having ordinary skill in the art will recognize that there are many other possibilities , such as maximizing the performance of the stabilizing controller of the present invention in terms of ` n ` or τ s or even changing the filter configuration to that of a higher order low pass or stop band filter depending on the particular component and system requirements . the complete diagram of the converter 50 control of the present invention , including both the pi control as well as the system stabilizing control is depicted in fig2 . in order to verify that the choice made of the filter time constant , τ s , actually forces the input impedance of the dc / dc converter 50 to fall within the stable region of the generalized criteria , the average value model was used to generate input impedance bode plots with and without the stabilizing control of the present invention . fig2 and 28 illustrate the effectiveness of the nonlinear control of the present invention in shaping the input impedance of the de / dc converter 50 . fig2 is of the converter 50 input impedance ( with the original prior art control ) plotted over top of the magnitude of the impedance looking back into the rest of the system and the critical phase derived from the phase of the impedance looking back into the rest of the system , from the input side of the converter 50 . it can be clearly seen that the system is stable since the magnitude of the converter input impedance is always less than the system output impedance . fig2 depicts the impedance criteria diagram with the loss in generation bus capacitance . here the converter 50 input impedance is larger in magnitude than the system output impedance for a small range of frequency . according to the stability criteria established in equations ( 45 ) through ( 47 ), the system is clearly unstable since the phase of the converter 50 input impedance is greater than the critical phase during a portion of the same range of frequency . the effect of the stabilizing controller of the present invention on the impedance criteria is illustrated in fig2 . the magnitude of the converter 50 input impedance still slightly crosses the magnitude of the system output impedance , though not for as large of a frequency range . the important detail is that the phase of the converter 50 input impedance no longer crosses the critical phase during the same range , thereby guaranteeing system stability . in order to verify that the stabilizing control with the choice of the filter time constant , τ s , actually stabilizes the system , average value and detailed simulations were performed followed by hardware validation . fig2 and 30 depict the source and load variables for the system 10 having the converter 50 load , in which the filter capacitance connected to the generation bus is stepped from 1315 . 5 uf to 1 . 4 uf . data is shown for the system both with and without the stabilizing control of the present invention . the effect of the system stabilizing controller is dramatically seen : the once unstable system is now stable . notice though in fig2 that the generation bus voltage does undergo increased variation ; however , this is due to increased rectifier harmonics since the source filter capacitance has been effectively removed the stabilizing controller of the present invention has the desired effect . a straightforward but nonlinear stabilizing control function has been set forth hereinabove which can be used to mitigate negative impedance instabilities in power electronic power systems , power electronic propulsion systems , etc . the effectiveness of the control has been demonstrated both through the use of computer simulation and in the laboratory . in addition to being applicable to induction motor based drives , the control algorithm could also be used with other types of machines in which rapid torque control is possible , most notably permanent magnet synchronous machines , used in submarines , ships , hybrid electric and electric vehicles ( both commercial and tactical ), aircraft , spacecraft , and in power electronics based autonomous generation systems ( such as for construction sites and third world use ), etc . other applications will be apparent to those having ordinary skill in the art . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected . | 8 |
sample preparation : sixty commercially pure titanium ( cp - ti , astm b - 265 ) discs ( 2 mm thickness and 12 . 7 mm diameter ) were polished with 320 , 400 , and 600 grit papers using a grinding machine ( buehler , phoenix beta ), ultrasonically cleaned in baths of doubly distilled ( ddw ), acetone , ddw , ethanol , and ddw ( 10 min in each bath ), and then air - dried . two step apatite coating : the discs were immersed in a calcifying solution prepared by mixing 200 mm caco 3 + 100 mm nah 2 po 4 . h 2 o and dissolving the mixed reagents with 2 . 9 % h 3 po 4 solution . the ph of the solution was 2 . 67 at room temperature . the discs were placed on the bottom of a sealed container and kept in oven at 75 ° c . for 24 h . 10 discs were placed in each container with 100 ml of calcifying solution . the discs were then removed from the solution , rinsed three times in distilled water , and air - dried . after removing the discs , the ph of the calcifying solution was 2 . 81 at room temperature . in the second step , to convert the ca — p phase ( monetite ) formed from the first step to apatite , the discs were immersed in the 0 . 2m naoh solution at 75 ° c . for 24 h . these parameters were chosen based on results of several pilot studies . the discs were then removed from the naoh solution , rinsed three times in ddw , and the air - dried . scanning electron microscopy ( sem ) and electron dispersive spectroscopy ( eds ): the shape , size , and coverage of ca — p crystals formed from acidic solution and then their transformation to apatite crystals were analyzed using sem ( jeol - 5400 ) operating at 20 kv . an evax microanalysis system ( eds ) coupled to sem was used to determine the chemical elements of the coating materials in each step of coating procedure . after removing the coating materials using tensile or scratch tester , eds analysis was also carried out on the titanium surface or on the residual coating on substrate . the specimens were coated with gold - palladium prior to sem observation and carbon for eds analysis . one way - anova and tukey statistical tests were used to compare the percentage and ratios of different chemical elements in different areas of the coating . x - ray diffraction ( xrd ): x - ray diffraction ( philips x &# 39 ; pert ) using grazing incident angle of 2 ° was performed to determine the structural and chemical modification on the ti surface after each step of the coating procedure . xrd was carried out using cuk α radiation operating at 45 kv and 40 ma . tensile adhesion test : the tensile adhesion between the coating and the ti substrate was measured using quad - romulus iii system ( quad group inc ., pull down breaking point ). the 3 . 5 mm diameter studs that were pre - coated with a thin layer of epoxy by manufacturer ( quad group inc ) were mounted perpendicularly on each of the coated surface of the 10 ti discs using spring mounting clips . the mounting clip allowed the stud to be perpendicular to the coating surface under a constant pressure during the curing procedure of epoxy . the discs were then placed in an oven and the epoxy was cured at 150 ° c . for 1 h . the loading rate of the tensile test was at 2 n / sec and the tensile strength was measured in mpa . the above method is well - validated in industrial quality control laboratories for measuring the adhesion strength of thin films and complies with mil . std 883 standard test methods . the pre - coated epoxy layer on the stud was thin preventing the penetration of resin to substrate and applies a homogenous resin thickness on the coating . after removing the apatite coating , the samples were analyzed under sem and eds to ensure that the epoxy did not penetrated to the ti substrate . astm c633 , the standard procedure for measuring the adhesion of ha - plasma - sprayed coating , could not be used in this study because the astm procedure can be only applied in coating thickness greater than 0 . 38 mm . scratching test : the scratch test is a common technique used to evaluate the adhesion of a thin coating on the substrate . the adhesion of the coatings obtained in our study was assessed using a csem revetest scratch tester fitted with a rockwell c 200 μm - radius diamond stylus . the point of adhesion failure of the coating from the substrate was detected by an increase in the acoustic signal from the sample . this load is called the critical load lc or failure load measured in n and corresponds to the bonding strength between the coating and substrate . the scratches were generated on the samples by constantly increasing the load at the rate of 100 n / min while the sample was displaced at the constant speed of 10 mm / min . the critical load of coating was measured 10 times . sem analysis showed a uniform coating covering on the entire ti surface after incubation in acidic calcifying solution ( fig1 b compared to 1 a ). the ca — p coating from acidic solution consisted of large and rectangular crystals ( fig2 a and 2b ). xrd identified these crystals as dicalcium phosphate anhydrous ( dcpa ) or monetite , cahpo 4 , the highest peak located at 2θ = 26 . 5 ° ( fig3 b ). a preferred orientation along the ( 111 ) lattice planes of the monetite structure was observed from the xrd pattern ( fig3 b ). the ratio of the intensity of ( 111 ) plane to that of ( 020 ) in the diffraction pattern of the coating was about 2 . 5 , compared to a ratio of 1 . 5 observed in the diffraction pattern of monetite powder ( jcpds # 71 - 1759 ). higher intensity ratio in the coating compared to that in powder diffraction pattern indicates preferred orientation along in the monetite coating ( 111 ). table 1 shows the levels ( percentage ) of different chemical elements identified in the monetite coating using eds . the ca / p atomic weight ratio from eds was 1 . 16 . sodium ( na ) was not detected in the monetite coating . in the second step , the discs coated with monetite obtained from the first step were immersed in naoh solution at 75 ° c . for 24 h . xrd analysis showed that monetite coating was transformed to apatite , with the highest peak ( 211 ) at 2θ = 31 . 8 ° ( fig3 d ). the xrd pattern of apatite coating ( fig3 c ) showed ( 002 )/( 300 ) lattice planes intensity ratio of 1 . 5 compared to a ratio of 0 . 67 for the apatite powder ( jcpds # 09 - 0432 ), indicating preferred orientation along the ( 002 ) planes of the apatite crystals in the coating . the apatite crystals were agglomerated following the outline of the initially formed large monetite crystals ( fig2 c and 2d ). sem of the cross section of the coating showed porosity and a thickness of approximately 30 μm ( fig2 e ). table 1 summarizes the atomic percentage of ca , p , and na obtained using eds analysis in different areas of the coating . the ca / p ratio of the apatite coating was higher than that of the monetite coating ( 1 . 79 vs . 1 . 16 ). a low percentage of na was detected in the apatite coating ( table 1 ), probably due to the partial incorporation of na + ions into apatite structure ( na - for - ca substitution ) during the transformation of the monetite to apatite in naoh solution . fig4 a shows the scratch test data plotted for four different measurements . scratches made on each coating were reproducible in the failure mode . the failure load ( critical load ) at which the coating starts to be removed and the ti surface to become visible was measured at the point of the first increase in acoustic signal from the ti surface ( arrows in fig4 a and fig4 b ). the average of failure load of the coating was 13 . 1 ± 1 . 3n . fig4 b and 4c show the scratch track on apatite coating . no fracture or chipping was observed at the border or inside the scratch track and the coating materials were squashed along of the track . just before the point of the removal of the coating from the substrate , small lateral tensile cracks were observed inside of the scratch track ( fig4 c ). the mean tensile strength in different areas of the coating was 5 . 2 ± 2 . 1 mpa . no trace of epoxy was detected on substrate after coating removal demonstrating the absence of penetration of the resin to the substrate . sem and eds analysis showed — evidence of the presence of — coating residues on the areas from which the coating was removed during the tensile and scratch tests ( fig5 a , 5b and table 1 ). even after the coating appeared visually to have been removed , eds demonstrated the presence of calcium and phosphorous elements on the ti surface . the numbers on fig5 a and 5b correspond to the areas on which the eds analysis was performed . after the tensile test , the ca / p ratio of the coating residues in different areas was significantly lower ( p & lt ; 0 . 05 ) than that of coating surface ( table 1 ). decreasing ca / p ratio was also observed in the coating towards the ti substrate in the scratch track of the scratching test ( table 1 ). considering a na - for - ca substitution in the apatite , ( ca + na )/ p ratio would give a better estimation of the calcium phosphate phase of the coating . although the percent of na increased in the coating residues , the ( ca + na )/ p ratio was still lower in the coating residues close to the substrate compared to that away from the substrate and closer to the surface ( table 1 ). eds analysis of the ti surface ( after removing the apatite coating ) demonstrated the presence of ca — p compounds as well as a higher percentage of na —. the higher percentage of na on titanium surface could be due to the formation of na titanate during the monetite - to - apatite transformation in naoh solution at 75 ° c . the foregoing results show that homogenous and adherent ca — p coating ( monetite ) formed on titanium discs during the immersion of the substrates in the acidic calcifying solution . the low ph of the calcifying solution has several effects on the coating procedure . the low ph of the solution permitted higher a concentration of the calcium and phosphate ions in the calcifying solution . in a neutral calcifying solution ( ph 7 ), the concentrations of calcium and phosphate ions are limited and at higher concentrations , ca — p crystals start to precipitate in the solution . using a calcifying solution containing a higher concentration of calcium and phosphate results in a better coverage of the deposited ca — p coating . an acidic solution also affects the topography and chemistry of the ti surface . several studies have reported the effects of various acids on topography and chemistry of titanium surface . [ kim w d . effects of acid treatments on in vitro bioactivity of titanium . m . s . thesis , new york university 2002 .] acid etching could improve bone / implant attachment by improving the mechanical interlock between the implant and the host bone . surface topography has also been shown to have an effect on osteoblasts cell morphology , proliferation , and differentiation . [ boyan b d , lohmann c h , dean d d , sylvia v l , cochran d l , schwartz z . mechanisms involved in osteoblast response to implant surface morphology . annu rev mater res 31 : 357 - 371 , 2001 ; poisoned l , reybier k , jaffrezic n , comte v , lagneau c , lissac m , martelet c . relationship between surface properties ( roughness , wettability ) of titanium and titanium alloys and cell behaviour . mat sci eng c - bio s 23 : 551 - 560 , 2003 ] acid etching creates pits and increases the surface roughness and surface area of implant . higher surface area could improve the adsorption of proteins and growth factors on materials that in turn may affect cells behavior . on the other hand , a rougher surface could provide a higher number of nucleation sites for the growing calcium phosphate crystals , thereby improving both coverage and adhesion of the coating due to the mechanical bonding between the coating crystals and the ti surface . both acid and alkali pre - treatment have been shown to increase the thickness of oxide layer on the ti or ti alloy surface . the titanium oxide plays a critical role on the absorption of organic layer ( e . g . proteins ) or mineral ( e . g . calcium phosphate ) on the ti surface . in the presence of water , the titanium oxide layer becomes hydroxylated and forms ti — oh groups . the ti — oh groups on titanium surface are amphoteric , exhibiting both acidic and basic properties . acidic hydroxide binds to two ti atoms and basic hydroxide binds to one ti atom . the following equations reactions show the acidic and basic reactions of ti — oh with water molecule : ti — oh ( acidic hydroxide )+ h 2 o [ ti — o ] − + h 3 o + ( acidic reaction ) ti — oh ( basic hydroxide )+ h 2 o [ ti — oh 2 ] + + oh − ( basic reaction ) acidic hydroxide gives proton and causes a negative charged surface ( acidic reaction ), while basic hydroxide accepts proton and makes a positive charged surface ( basic reaction ). in an acidic solution ( e . g ., calcifying solution ), the higher availability of protons promote more basic reactions occur causing a positively charged surface . on the other hand , in a basic solution , the proton detached from acidic hydroxide ( acidic reaction ) resulting in a negatively charged surface . in our method , immersion of titanium discs in acidic calcifying solution could have resulted in a positive surface charge on the substrate , attracting the phosphate ions and creating the nucleation sites for calcium phosphate ( monetite ) deposition . phosphoric acid used as of one of ingredient of calcifying solution provides phosphate groups ( h 2 po 4 − , hpo 4 2 − , and po 4 3 − ), that could be attracted to the positive charge of [ ti — oh 2 + ] and form — further nucleation sites for ca — p deposition . furthermore , acid treatment could also increase the thickness of tio 2 layer . higher roughness , thicker tio 2 layer , and positively charged surface could all contribute to a higher attachment of the monetite layer formed from acidic calcifying solution . it should be mentioned that the higher concentration of positive charge reduces the calcium concentration on titanium surface and also decreases the substitution of phosphate ions for the basic hydroxide group . as mentioned above , in acidic solution , the equilibrium of basic reaction is shifted to right side resulting in a lower number of basic hydroxide present on the ti surface . depending on the ph , temperature , and composition of the calcifying solution , different types of ca — p compounds can form or transform from one type to another type . for example , under acidic condition ( ph 2 to 5 ) and at low temperature ( 25 ° c . to 60 ° c .) dicalcium phosphate dihydrate ( dcpd ), cahpo 4 . 2h 2 o is the preferred ca — p phase . under the conditions of our method ( ph 2 , 75 ° c . ), monetite or dicalcium phosphate anhydrous ( dcpa ), cahpo 4 , was the stable ca — p phase . monetite converted to apatite crystal in a basic solution , as demonstrated in earlier studies . legeros r z . calcium phosphates in oral biology and medicine . volume 15 . san francisco : karger ; 1991 . 201 p . ; [ legeros r z . the unit - cell dimensions of human enamel apatite : effect of chloride incorporation . arch oral biol 20 : 63 - 71 , 1974 . ; legeros r z , legeros j p , trautz o r , shirra w p . conversion of monetite , cahpo4 to apatites : effect of carbonate on the crystallinity and the morphology of apatite crystallites . adv x - ray anal 14 : 57 - 66 , 1971 ]. the transformation of one type of calcium phosphate to another type is in fact a dissolution / re - precipitation process . [ legeros r z . calcium phosphates in oral biology and medicine . volume 15 . san francisco : karger ; 1991 . 201 p . ; the initial ca — p phase dissolves in acidic or basic solutions and the second phase re - precipitates from the supersaturated solution . the sem micrographs showed that the apatite crystals precipitated following the outline of the initially formed monetite crystals , in a similar manner as that observed for the transformation of octacalcium phosphate , ocp , to apatite . eds analysis showed the presence of na ions in the apatite coating but was not detected in the monetite coating indicating that na - for - ca substitution occurred in the apatite during the transformation of monetite to apatite in the naoh solution . the ca / p molar ratio of the apatite coating was calculated as 1 . 79 . however , when na - for - ca substitution in the apatite was considered , the ( ca + na )/ p molar ratio was calculated as 1 . 94 . the ca / p molar ratio of stoichiometric hydroxyapatite , ca 10 ( po 4 ) 6 ( oh ) 2 , is 1 . 67 , lower than that calculated for the apatite coating in this study . the higher value of the ca / p molar ratio obtained for the coating may be due to the partial substitution of carbonate for phosphate ( carbonate type b ). the ca / p molar ratio for the monetite coating was calculated as 1 . 16 , slightly higher than that of a stoichiometric monetite , cahpo 4 , with a ca / p molar ratio of 1 . 0 . eds analysis obtained from areas from which the apatite coating was removed or scratched off demonstrated the presence of a calcium phosphate phase but with at a lower ( ca + na )/ p or ca / p ratio compared to that of the intact coating surface ( table 1 ). lower ca / p ratio of the coating materials at the coating / ti interface could be due to positive surface charge ( formed because of acidic calcifying solution ), that attracts more phosphate ions and leads to a lower ca / p ratio . compared to the apatite coating surface , the percentage of na was higher on the ti surface or coating residues after removing or scratching off the apatite coating . the higher percentage of na on titanium surface or in the coating layer closer to substrate may be explained by the partial incorporation of na in the apatite structure ( na - for - ca substitution ) during the transformation of monetite to apatite in the naoh solution and by the formation of na titanate layer on titanium surface 29 during the monetite - to - apatite transformation . the higher percentage of na could be in fact due to the higher percentage of na on the titanium substrate and not in the remaining apatite coating . formation of na titanate at the substrate / coating interface could also cause an increase in the coating adhesion . the tensile strength of apatite coating prepared in the foregoing was about 5 . 2 mpa . tensile strength of plasma - sprayed coating has been reported to range from about 5 to 54 mpa . this wide range of tensile strength values reported for plasma - sprayed ha coating may be due to the penetration of the resin to the ti substrate used in the tensile test ( especially with thin or porous coatings ) leading to inaccurate measurements . another source of inaccuracy in measuring tensile strength of the plasma - sprayed ha coating could be the misaligning of the tensile force causing a partially shear force during the measurement of tensile strength . in our method , it was observed that the failure occurred within the coating itself rather than at the coating / titanium interface , indicating low cohesive strength of coating compared to its adhesive strength on titanium surface . even for the samples on which the coating was visually removed , eds revealed the presence of remaining ca — p crystals on titanium surface . the coating adhesion using csem scratch test was measured at about 13 . 1 ± 1 . 3n . this value was much higher than those reported for sputtering and laser deposition coatings which were 38 . 47 mn and 1 . 7 mn respectively , using 50 μm - radius stylus . [ inagaki m , yokogawa y , kameyama i . bond strength improvement of hydroxyapatite / titanium composite coating by partial nitriding during rf - thermal plasma spraying . surf coat tech 173 : 1 - 8 , 2003 . ozeki k , yuhta t , fukui y , aoki h , nishimura i . a functionally graded titanium / hydroxyapatite film obtained by sputtering . j mater sci - mat med 13 : 253 - 258 , 2002 .] whereas for ha coating prepared using electrochemical deposition , 20n was needed to scraped off the coating from the substrate . [ kuo m c , yen s k . the process of electrochemical deposited hydroxyapatite coatings on biomedical titanium at room temperature . mat sci eng c - bio s 20 : 153 - 160 , 2002 .] it should be noted that the results of scratch test varies as a function of the coating thickness , coating ductility and brittleness , shape and size of stylus , the rate of applying the load , and substrate hardness . in our study the coating was squashed and displaced to both sides of the scratch track , without any chipping , or fracturing . the acoustic signal started to increase ( the point of reading the critical load ) at the point when the coating started to be removed from the substrate and the ti surface became visible ( adhesive failure ). before the failure point of the coating , small lateral cracks were observed inside the track due to coating delamination . the absence of fracturing indicates that the coating materials were squashed without detaching from the substrate . fernandez - pardas et al [ femandez - pradas j m , cleries l , martinez e , sardin g , esteve j , morenza j l . influence of thickness on the properties of hydroxyapatite coatings deposited by krf laser ablation . biomaterials 22 : 2171 - 2175 , 2001 ]. reported that when the coating deform without fracturing , and did not detach from the substrate even when subjected to 18n load . squashing of coating materials without fracturing could be the reason for the big difference between the critical loads measured in our study compared to those reported for the other type of coating . for the coating prepared by pulsed laser deposition technique , arias et al . [ arias j l , mayor m b , pou j , leng y , leon b , perez - amor m . micro - and nano - testing of calcium phosphate coatings produced by pulsed laser deposition . biomaterials 24 : 3403 - 3408 , 2003 ] reported that although the first increase in acoustic signal was read at 3 . 5n ( due to the formation of fractures ), the coating was partially removed and the substrate became visible at 9 . 6n load . the adhesion of the coating obtained from our method was much higher than that of coating prepared in calcifying solution at 37 ° c . and ph 7 . 2 . as mentioned above positive surface charge of titanium and higher surface roughness ( both due to acidic ph of calcifying solution ) could increase the number of nucleation site for monetite deposition . phosphate groups ( h 2 po 4 − , hpo 4 2 − , and po 4 3 − ) provided by phosphoric acid and nah 2 po 4 . h 2 o could bond to [ ti — oh 2 ] + group , create nucleation sites and increase the attachment of the calcium phosphate coating . furthermore , formation of na titanate during the transformation of monetite to apatite in naoh solution , could also contribute to a higher coating / substrate adhesion . the foregoing demonstrates the value of chemical deposition from acidic calcifying solution as an alternative coating technique . the coatings prepared using the present method were porous and composed of crystalline phase of apatite . good coating adhesion was obtained compared to other low temperature coating methods . in our method , using dilute phosphoric acid in calcifying solution made a positive surface charge [ ti — oh 2 ]+ which bonds to the phosphate groups ( h 2 po 4 − , hpo 4 2 − , and po 4 3 − ) and provides more nucleation sites for calcium phosphate deposition . furthermore , acidic calcifying solution could also modify the ti surface topography and increase the mechanical interlock between the substrate and ca — p coating . formation of na titanate during the transformation of monetite crystals to apatite could also favor apatite deposition and adhesion . while the present invention has been set forth in terms of specific embodiments thereof , the instant disclosure is such that numerous variations upon the invention are now enabled to those skilled in the art , which variations yet reside within the scope of the present teaching . accordingly , the invention is to be basically construed and limited only by the scope and spirit of the claims now appended hereto . | 0 |
as shown best in fig3 the bit 2 of the present invention is made in two pieces , including an elongated shaft 4 and a cutting head 6 . the shaft 4 has hexagonal flats 5 on one end to permit it to be received in a drill chuck . at its other end 8 , the shaft 4 has a reduced diameter and includes male threads 9 in its outer surface . a shoulder 10 is formed where the diameter of the shaft 4 is reduced . the cutting head 6 has an axial opening 12 which defines female threads 14 on its inner surface . the threads 14 of the cutting head are received by the threads 9 of the shaft 4 to join the shaft and head together . the inside diameter of the opening 12 of the cutting head is less than the diameter of the shoulder 10 on the shaft , so the shoulder 10 serves as a stop for the head as it is threaded onto the shaft 4 . the bit 2 is provided with threads 9 , 14 which facilitate assembly of the head 6 onto the shaft 4 . also , as the bit 2 is being assembled , an adhesive is applied to the mating threaded surfaces 9 , 14 so that , when the adhesive sets , a solid bond is made between the two pieces . the adhesive that has been used for this purpose is loctite brand permanent grade adhesive . as was mentioned earlier , one of the advantages of making the bit 2 in two pieces is that the head 6 and shaft 4 can be made of different materials or can be subjected to different treatments before assembly so that each part has the ideal properties to perform its function . the shaft should be tough to resist fatigue which can lead to snapping , cracking or breaking as the shank is stressed while being urged or forced along the arcuate path during cutting . the cutting head should be hard and resist abrasion for good cutting and edge retention . if the bit 2 is made as a single piece , the material properties of the bit will be a compromise between these characteristics . for example , with the present invention , the shaft 4 is preferably made of carbon steel and is heat treated to improve toughness , while the head 6 is preferably made of tool steel . the result is that the rockwell hardness of the shank is about 48 - 50 on the c - scale , while the hardness of the head is about 58 - 60 . now , looking at the cutting head 6 in more detail , as shown in fig3 - 6 ), the cutting head 6 defines a central , forward projecting point 16 which is substantially flat and defines cutting edges 18 , 20 on both sides . the main body of the cutting head 6 defines two forward cutting edges 22 , 24 and two , and two rear cutting edges 27 , 29 which extend back toward the shank . the cutting edge 18 , 20 on the sides of the point 16 meet with their respective forward cutting edges 22 , 24 , which , in turn , meet with their respective side which meet with their respective rear cutting edges 27 , 29 so that a single continuous cutting edge is formed on each side of the cutting head 6 -- one cutting edge including the side 18 of the point 16 , the forward cutting edge 22 , and the side cutting edge 26 and the rear cutting edge 27 , and the cutting edge on the other side including the point edge 20 , forward edge 24 , and side edge 28 and rear edge 29 . the intersections 30 , 32 between the forward cutting edges 22 , 24 and their respective side cutting edges 26 , 28 are rounded . the side cutting edges 26 , 28 have their maximum diameter where they meet their respective rounded corners 30 , 32 . the junction between the side cutting edges 26 , 28 and their respective rear cutting edges 27 , 29 is also rounded , forming a continuous , smooth cutting edge from the point 16 to the shank . the side cutting edges 26 , 28 define a smooth , curved line , and the rounded shape of the back of the cutting head 6 enables it to continue to freely rotate during cutting as it follows the arcuate path of the hole without the back cutting edges binding on the sides of the hole . the rear cutting edges 27 , 29 also prevent the bit from binding when backing out of the hole , because they also cut a path . no portion of the cutting head has a greater diameter than the side cutting edges 26 , 28 at any point along the cutting head . fig1 and 2 indicate how the bit 2 is used . as shown in fig1 the bit initially drills straight into the face of the workpiece . then , once the cutting head 6 is in the workpiece , the person handling the drill begins to apply a side force to the bit in addition to the downward force to urge it along an arcuate path . this force causes bending stresses in the shaft 4 , which can be withstood by the bit of the present invention due to its two - piece construction which permits the shaft 4 to be made of a tougher material than the head 6 . the point 16 and its cutting edges 18 , 20 keep the bit centered . the forward cutting edges 22 , 24 cut material directly ahead of the bit , and the side cutting edges 26 , 28 cut the sides of the hole . the bit 2 follows an arcuate path as is shown in fig2 until it comes out at a side face of the workpiece ( not shown ). the result is an arcuate hole through which wires can be inserted without getting caught on the sides of the hole . it will be obvious to those skilled in the art that modifications may be made to the embodiment described above without departing from the scope of the present invention . | 8 |
the glove or glove liners of the present invention are made from a continuous filament synthetic yarn , preferably nylon , most preferably nylon 6 / 6 . as disclosed in rhash , u . s . pat . no . 4 , 196 , 574 , although synthetic yarns lack the aesthetic qualities existing in natural fibers , thermoplastic continuous filament polymeric yarn , such as nylon , polyester and the like , offer better processing and uniformity than natural fibers . additionally , polymeric yarns form less dust or lint than natural fiber yarns such as cotton . synthetic yarns of the present invention , such as nylon , are considered to be &# 34 ; lively &# 34 ; yarns , in that they have a tendency to contract and twist due to the &# 34 ; live &# 34 ; torque in the yarn . torque can be introduced into or increased in synthetic yarns by twisting or crimping the yarn into &# 34 ; z &# 34 ; twists or &# 34 ; s &# 34 ; twists . the yarn can also be bulked or texturized . texturized or bulked continuous filament synthetic yarn may be highly contractible and stretchable . suitable yarns include nylon 6 , nylon 6 / 6 , polyester , ( such as polybutylene terephthalate , and polyethylene terephthalate ), polypropylene , and cellulose acetate . the preferred synthetic yarn of the present invention is nylon 6 / 6 . nylon is a relatively strong synthetic yarn , with low friction and has the necessary ability to form and retain the crimps , twists , contractions and coils of the present invention . many thermoplastic polymers , such as synthetic yarns , also exhibit considerable plastic &# 34 ; memory &# 34 ;. that is , the yarns can be stretched out of shape , heated , re - stretched , reheated and still return to their original shape . as disclosed in brenner et al ., u . s . pat . no . 4 , 193 , 899 , this polymeric feature is based on chemically covalent crosslinking that provides permanent restoring forces . this is also disclosed in ueno , u . s . pat . no . 4 , 820 , 782 as &# 34 ; thermal recovery property &# 34 ;. this polymeric feature is an important feature of the present invention . these lively , stretchable yarns have been known and used for some time in making processed ( knitted or woven ) goods , but their use is not without shortcomings . as disclosed in kramers , u . s . pat . no . 4 , 554 , 121 , elastic yarns require special equipment for processing the yarn into goods and are frequently formed into a 2 ply yarn using one relatively inelastic yarn coupled with an elastic yarn . the present invention uses a 2 ply co - twisted yarn made of an &# 34 ; s &# 34 ; twist and a &# 34 ; z &# 34 ; twist of the same textured continuous filament material , such as nylon 6 / 6 . this unique two ply yarn has a 300 to 500 % elongation capacity . the gloves or glove liners of the present invention are preferably knitted using a special knitting machine with 13 gage needles providing 13 courses per inch . the machine is a 73 to 88 needle machine . gloves or liners made in this manner have a 300 to 500 % elongation capacity , an important feature of the present invention . the glove or glove liner of the present invention is made from a continuous filament crimped and textured stretchable yarn using various yarn sizes . for gloves to be used in photoprocessing labs for example the yarn size should be no more than four ply 70 deniers , preferably 30 to 50 , most preferably about 40 . a glove made using about 70 deniers will be less than 15 mils thick . this thin , low bulk feature of the glove provides an important feature of the present invention . this feature is particularly important for glove liners , especially liners to be used under surgical gloves , and other usage where tactile dexterity is essential . in another contexts , the major benefits of the present invention are still available employing yarns of up to as much as 300 denier , producing a much thicker knit fabric . such heavier knits may be desirable when exposure to cold weather or other low temperature uses are encountered . in addition to fingers and a hand portion , the glove includes a cuff , preferably an elongated cuff . by extending the cuff length the glove is held more securely to the wrist . the cuff can also be manufactured to include extra synthetic yarn such as spandex elastomeric yarn . the cuff provides extra hold and comfort . the knit is preferably terminated with one or more courses of a heat shrink yarn co - twisted with the nylon 6 / 6 yarn . the heat shrink yarn serves to seal the edge of the knit and to stabilize the structure . the glove or liner is preferably single knit , using up to four ply 70 denier yarn or less , on the knitting machine . the glove is typically knit to an oversize of about 81 / 2 to 9 inches , desirably at 10 stitches per inch or more , preferably 12 stitches per inch or more . we particularly prefer to employ 13 stitches per inch . such a fine knit is important to glove liners , to prevent direct contact between the skin of the wearer and a latex or other overglove . the fineness of the knit , in combination with the fineness of the yarns employed provide a thin knit which maximizes tactical sensation and dexterity for the wearer , while still affording good barrier separation of the skin from the overglove . the glove is then washed and / or scoured and shrunk to less than 7 inches . the glove can alternatively be dry cleaned and / or heat dried and shrunk at a range of 120 to 180 f ., preferably 150 f . next the glove is heat stretched to about 7 inches . the glove may be further treated to add or improve other characteristics such as absorbance and anti - static features of the glove or liner . this process relies on the plastic &# 34 ; memory &# 34 ; characteristic of the synthetic yarn to provide a tight fitting glove that can be stretched out to fit all sizes ( universal size ) and allows for an ambidextrous knit . the gloves of the present invention , when so formed , can be stretched up to 300 % without permanent deformation , allowing the glove to fit hands of all sizes and be reused . furthermore , the glove can be washed , autoclaved , dry cleaned and still retain its shape . as yet another feature , the glove freely stretches and contracts as the hand is moved inside the glove , making for a comfortable glove . these too are important features of the present invention . it is also important to the present invention and most uses for the gloves and glove liners disclosed herein that the finger cots and thumb cot of the gloves and liners are integrally knit , and the gloves do not comprise any separate or separable component parts stitched together , as is common to many gloves and glove liners . stitched gloves have limited stretch properties , and impose a requirement for gloves of a variety of sizes . to be ambidextrous , the thumb cot must be symmetrically formed and placed , as those of ordinary skill in the art will understand . the synthetic yarn used in making the glove or liner is a multifilament yarn of 1 to 3 denier per filament , which has been texturized . this characteristic provides a large surface area which can absorb up to 5 % by weight of the yarn moisture . furthermore , wetting agents can be added to the glove or liner which improve moisture absorption . anionic surfactants or ph balanced soaps can be used to coat the glove or glove liner . preferably the anionic surfactants such as those available from sandoz under the trademarks sandop ms - 40 or sandop dtc . the basic chemical structure of the compounds is : any ph balanced soap will also work . this particularly useful in medical applications . it is important to wash the glove for health reasons and equally useful to help improved moisture absorption for glove liner under fluid / air impermeable rubber or latex gloves . anti - static properties can be increased depending on the needs of the wearer , by either treating the glove or liner with anti - static compounds or preferably by adding conductive yarn to the glove while the glove is being knitted . examples of antistatic compounds that can be added to polymers or coated on polymers are disclosed in mccullough , jr . et al , u . s . pat . no . 4 , 869 , 951 ; wozniak u . s . pat . no . 4 , 906 , 681 ; and degaravilla , u . s . pat . no . 5 , 037 , 875 . static dissipative properties are preferably achieved by adding increasing percentages of conductive yarn into the synthetic yarn before knitting the glove . various types of conductive yarn can be used . in particular , yarns with internal conductivity can be used such as yarn containing conductive carbon fiber ; yarn containing metal fiber ; and yarn containing copper sulfate . in addition yarn containing fibers of conductive metal or fibers coated with conductive metal such as silver or aluminum can also be used . it is preferable to use silver coated multifilament nylon yarn which can be obtained from sauquoit industries , called x - static ® conductive yarn . it is also effective to use copper sulfate impregnated nylon yarn which can be obtained from nippon sanmo dyeing co . ltd ., called thunderon ssn . a yarn of conductive carbon encapsulated in nylon polyamide is available from dupont under the trademark nega - stat ® conductive yarn . stainless steel fibers suitable for use are available from the fluid dynamics division of memtec america corporation , deland , fla . by using these conductive yarns static electricity can be greatly reduced or eliminated . the conductive yarns may be employed alone or may be co - twisted with another , nonconductive yarn to produce a two - ply composite yarn . in such cases , properties intermediate to those of the component yarns is normally obtained . in particular , the conductive yarn may be a crimped and textured stretchable continuous filament nylon yarn of about 150 denier or less wherein the yarn contains at least one electrically conductive fiber which is a member selected from the group consisting of conductive carbon fiber , metal fiber , yarn coated with conductive metal , copper sulfate impregnated nylon , and blends thereof . multi - ply composite yarns are known to those of ordinary levels of skill in the art , and the technique for the formation thereof are not per se a part of the present invention . conductivity in the glove fibers can be very high and if a surface , material or body is charged with static electricity , it will have an electric field emanating from it . in most situations this electric field will be perpendicular to the glove surface . as the diameter of each conductive filament in the glove is very small , it forms a sharp point at the fiber edge compared to the other conductive surfaces near or surrounding it . these sharp fiber edges will provide a point where all the static charges concentrate and generate ions . the ions will start to ionize in the air by corona discharge and neutralize any static charge in the glove . this process will continue until the field has been reduced to the point where ionization stops and static electricity is practically eliminated or rendered harmless . in gloves or liners which rely on corona discharge to dissipate static electricity it is effective to use 8 to 30 percent copper sulfate impregnated nylon . in the present invention the glove can also be grounded by connecting a ground wire to the cuff . in situations where the glove is to be grounded , it is preferable to use about 5 to 12 % silver coated nylon in the glove and optionally 12 to 15 % silver coated nylon in the cuff . the cuff edge can also be oversewn with either silver coated nylon or copper sulfate impregnated nylon . the ground wire can be attached to work area . when a worker approaches the area , the ground wire is hooked to the cuff using a clip , such as an alligator clip . this avoids the limitations of permanent ground wires and the hazards of dangling ground wires connected to the gloves of workers as they move about . using these conductive yarns the surface resistivity of the glove or liner is less than 10 4 ohm - square , generally between 10 3 to 10 6 ohm - square and where a cuff is formed , the cuff has a resistivity of between 10 2 to 10 6 ohm - square , generally & lt ; 10 4 , preferably & lt ; 10 3 ohm - square . these gloves are lint and dust free , anti - static , thin and close fitting reduce perspiration and clamminess , and eliminate fingerprints and scratches . they are ambidextrous , a universal size , sensitive , flexible , dexterous and low bulk . these gloves can be reused , washed and worn in comfort for prolonged periods . the elastic cuff adds to the comfort of the glove and the absence of seams eliminates catches . the gloves or liners made according to the present invention provide a very important feature , especially in medical settings ; namely , they can be cold sterilized and / or autoclaved . this feature allows the glove to be used repeatedly with great savings and convenience . furthermore , the ability to cold sterilize and autoclave the gloves allows for their use in environments , such as surgical field , where dexterity , comfort , safety , and economy are crucial . autoclaving requires that the glove withstand temperatures of at least 100 ° c . for a time of at least 40 minutes or more or , in the alternative , a temperature of at least 140 ° c . for a time of at least 10 minutes or more . these are demanding conditions for textile fibers and yarns and for fabrics and knit articles formed of textile fibers . the gloves and glove liners of the present invention withstand such conditions without degradation or difficulty . glove liners made according to the present invention provide a barrier to latex , rubber or plastic contact which reduces allergic reactions and rashes as glove liners . the liners eliminate the need for powder or - powdered gloves . they facilitate the easy slip on and removal of all types of gloves . the liners keep the inside of over - gloves clean and eliminate odors . they can be sterilized in an autoclave or easily washed in soap and water . glove or liners made according to the present invention with static dissipative conductive yarn reduce or eliminate static build - up . the gloves or liners have a uniform resistivity throughout the entire glove , with an average surface resistivity of 2 × 10 3 ohm - square with a static decay of 5 kv to 0 v in less than 0 . 1 second . the gloves eliminate the need for wrist straps . the gloves can be grounded by clipping a ground strap to the wrist strap should the need arise . in biomedical and bioelectrical fields , even higher conductivity is desirable . gloves ( as well as socks , sleeves , arm bands , wraps , caps , and the like ) knit and formed in accordance with the present invention entirely of highly conductive forms of yarns mentioned above are suitable for such use . such structures , in addition to the properties already described , will have high levels of conductivity and close conformity to the shape and contact with the body , suited to use as electrodes for contact with the skin , and will readily transmit electrical signals to the body . while any conductive yarn may be employed , we particularly prefer to use the silver plated nylon fiber x - static ® conductive yarn available from sauquoit industries , inc ., of scranton , pa . x - static ® conductive yarn yarns are readily crimped or otherwise bulked , and have no impregnated or bonded materials which can slough off the surface of the fibers in use and are generally more durable than other forms of conductive yarn . we prefer , too , that the gloves , or other comparable structures , be formed entirely of the x - static ® conductive yarn yarn to maximize electrical conductity . a glove corresponding to fig1 was knit , of nylon 6 / 6 yarn four ply of 40 denier , on a thirteen gage knitting machine with 13 gage needles . the glove body ( 12 ), finger cot portions ( 14 ) and the thumb cot portion ( 16 ) were single ply knit . the cuff portion ( 18 ) of the glove was double knit in a ribbed pattern of the same yarn co - twisted with a strand of spandex elastomeric yarn . the knit was terminated with a double course of a shrink yarn co - twisted with the nylon 6 / 6 yarn ( not shown ). the glove was washed and hot air dried , whereupon it shrank to about one - half its original size as knit . the washed glove was then stretched , formed and heat set . a glove corresponding to fig1 was knit , of nylon 6 / 6 yarn of four ply 30 denier having an s - twist co - twisted with the same yarn having a z - twist , on a thirteen gage knitting machine with 13 gage needles . the glove body ( 12 ), finger cot portions ( 14 ) and the thumb cot portion ( 16 ) were single ply knit . the cuff portion ( 18 ) of the glove was double knit in a ribbed pattern of the same yarn co - twisted with a strand of spandex elastomeric yarn . the knit was terminated with a double course of a shrink yarn co - twisted with the nylon 6 / 6 yarn ( not shown ). the glove was washed and hot air dried , whereupon it shrank to about one - half its original size as knit . the washed glove was then stretched , formed and heat set . a glove corresponding to fig1 was knit , of nylon 6 / 6 yarn of two ply 40 denier co - twisted with two ply 40 denier x - static ® conductive yarn , on a thirteen gage knitting machine with 13 gage needles . the glove body ( 12 ), finger cot portions ( 14 ) and the thumb cot portion ( 16 ) were single ply knit . the cuff portion ( 18 ) of the glove was double knit in a ribbed pattern of the same yarn co - twisted with a strand of spandex elastomeric yarn . the knit was terminated with a double course of a shrink yarn co - twisted with the nylon 6 / 6 yarn ( not shown ). the glove was washed and hot air dried , whereupon it shrank to about one - half its original size as knit . the washed glove was then stretched , formed and heat set . the glove had a surface resistivity of 2 × 10 3 ohm - square with a static decay of 5 kv to 0 v in less than 0 . 1 second . a glove corresponding to fig1 was knit , of nylon 6 / 6 yarn of four ply 40 denier co - twisted with thunderon yarn of 30 denier , on a thirteen gage knitting machine with 13 gage needles . the glove body ( 12 ), finger cot portions ( 14 ) and the thumb cot portion ( 16 ) were single ply knit . the cuff portion ( 18 ) of the glove was double knit in a ribbed pattern of the same yarn co - twisted with a strand of spandex elastomeric yarn . the knit was terminated with a double course of a shrink yarn co - twisted with the nylon 6 / 6 yarn ( not shown ). the glove was washed and hot air dried , whereupon it shrank to about one - half its original size as knit . the washed glove was then stretched , formed and heat set . the glove had a surface resistivity of 4 . 5 × 10 2 ohm - square with a static decay of 5 kv to 0 v in less than 0 . 1 second . a glove corresponding to fig1 was knit with four ply 50 denier x - static ® conductive yarn on a thirteen gage knitting machine with 13 gage needles . the glove body ( 12 ), finger cot portions ( 14 ) and the thumb cot portion ( 16 ) were single ply knit . the cuff portion ( 18 ) of the glove was double knit in a ribbed pattern of the same yarn co - twisted with a strand of spandex ® elastomeric yarn . the knit was terminated with a double course of a shrink yarn co - twisted with the nylon 6 / 6 yarn ( not shown ). the glove was washed and hot air dried , whereupon it shrank to about one - half its original size as knit . the washed glove was then stretched , formed and heat set . the glove had a surface resistivity of 35 ohm - square . while the above description is limited to the particular uses of the inventive material , it should be apparent that other applications and combinations could be made without departing from the spirit of the invention . | 0 |
a description of example embodiments of the invention follows . the teachings of all patents , published applications and references cited herein are incorporated by reference in their entirety . embodiments of the present invention may be implemented in a broadband software - defined radio ( sdr ). the sdr may include a radio - frequency ( rf ) front - end portion and a transceiver portion . the rf front - end , in example embodiments described below , includes a receive low noise amplifier ( lna ), transmit power amplifier ( pa ), and an antenna matching network . the transceiver may be coupled to the rf front - end and performs up - conversion and filtering of transmit signals , as well as filtering and down - conversion of received signals . fig1 is a block diagram of a radio - frequency ( rf ) front - end 200 as known in the art . the front - end 200 includes a plurality of pas for transmitting signals to an antenna , and an lna for receiving signals from the antenna . a duplexer switching network connects the pas and lna to the antenna , enables switching among the pas , and isolated the pas from the lna . because no individual one of the pas is able to operate over a broad frequency range ( i . e ., broadband operation , such as a 700 mhz - 2 . 7 ghz range present in the long - term evolution ( lte ) standard ), several pas must be included , and a duplexing switch is required to select among the pas for a given bandwidth . the duplexer switching network causes 2 - 4 db of loss at both the transmit and receive chains . as a result of this loss , the lna receives a signal with substantially less ( e . g ., half ) power , and the transmit pa must apply substantially more power ( e . g ., double ) to the output signal toward the antenna . fig2 is a block diagram of an rf front - end 210 including an echo canceller and circulator . in contrast to the rf front - end 200 of fig1 , the front - end 210 includes a broadband echo - canceling filter , such as a continuous - time fir transversal filter . this filter could be tuned under software control to cancel transmit echoes . further , the duplexer switching network is replaced with a broadband circulator or balanced hybrid , providing greater tx / rx isolation on the order of 20 db or less . this replacement may be possible due to the use of a broadband pa in place of a plurality of narrow - band pas . an example broadband pa is described below with reference to fig4 . however , the front - end 210 is still susceptible to 3 db loss , through the circulator , at both the transmit and receive chains . fig3 is a block diagram of a software - defined radio ( sdr ) rf front - end 300 in one embodiment of the invention . the front - end 300 is coupled to a transceiver 310 and facilitates transmission and reception of signals to and from an antenna 390 . a pa 350 in the transmission path from the transceiver 310 amplifies transmit signals toward the antenna 390 , while a differential lna 320 amplifies received signals from the antenna 390 on the receive path toward the transceiver 310 . the rf front - end 300 overcomes problems exhibited by the front - ends 200 , 210 described above through a number of features . in particular , 1 ) the lna 320 may be configured to provide broadband operation and echo cancellation , 2 ) the pa 350 is configured to operate over a broad frequency range , and 3 ) an antenna - matching network 360 maximizes power transfer between the pa 350 and antenna 390 . as a result , a duplexer switching network or circulator / balanced hybrid may be omitted , and only a single pa is required . elimination of a circulator is also enabled by configuring a short transmission line between the transmit and receive chains , so as not to cause a reflection of the rf signal . each of the above features is described in further detail below . the lna 320 employs echo cancelation via a variable gain and group delay equalizer 321 ( or feedback circuit ), which cancels the transmit signal from the lna 320 output by feeding its equalized version to the negative terminal of the lna 320 . thus , the common mode rejection ratio ( cmrr ) of the differential lna 320 prevents the high transmit signal from reach the output of the lna 320 , while the receive signal , being differential , is amplified by the gain of the lna 320 . noise from the pa 350 is also cancelled in this process , and thus the effective noise figure ( nf ) of the receiver path is well - maintained . the gain and group delay of the equalizer 321 are control of the microprocessor 324 , and are adjusted until the power is minimized . to provide this adjustment , a detector 320 detects the lna 320 output and forwards it to the microprocessor 324 via an analog - to - digital converter ( adc ) 323 , with values adjusted until a minimum is achieved ( following toggling around the minimum ). the microprocessor 324 may also control the equalizer 321 based on a pre - amplified transmit signal from the transceiver 310 prior to amplification by the pa 350 , as provided by a detector 325 and adc 326 . as a result , transmit noise cancelation may also be achieved . the lna 320 may be configured having a distributed structure to enable the transmitted and power amplified signal at the receiver to become common - mode . for example , the lna 320 may be structured as a parallel cascade of n individual lnas of lower power (“ lnts ,” not shown ) to form a summing lna . the received signal from the antenna 390 may be divided into n voltage - scaled signals prior to input to the lna 320 , each scaled signal being fed to an lnt . the outputs of the lnts may then be summed to provide a single differential output signal to the detector 322 . each lnt may therefore provide a respective rail - to - rail common mode range . the lnts have a high common - mode rejection ratio ( cmrr ), low noise ( e . g ., less than 3 db ), and operate to cancel transmit leak as well as any noise put out by the pre - amplifier ( located at the transceiver 310 or in the transmit path prior to the pa 350 ). by summing the outputs of the lnts , the lna 320 provides an output having an amplified received signal with echo cancellation and minimal noise from the transmit path . fig4 is a block diagram of a power amplifier ( pa ) 100 , which may be implemented as the pa 350 in the rf front - end 300 of fig3 . medium power (˜ 1 w ) power amplifiers for handset applications have so far been dominated by gaas semiconductor technology , due to superior high frequency operation and power handling capability of gaas ( iii - v ) semiconductors . however , due to the nature of these devices and its fabrication technology , only n - type devices can be built . this limitation has meant that only simple single - ended amplifier structures can be built using this technology . in addition , amplifier structures built using gaas technology have input and output impedances that contain large reactive components , which require a matching circuit to present a real impedance ( e . g ., 50 ohm ) to the outside world . these matching circuits are typically narrow band structures , which are insufficient for broadband applications . cmos technology advancements at smaller semiconductor nodes have increased the maximum operating frequency of the devices to be useful as amplifiers at the rf / cellular frequency range , but this improvement has come at the limitation of maximum output voltage and power available per device . for example , to generate a 250 mw rf signal into a 50 ohm load requires devices capable of generating & gt ; 3 . 5v rms . this requirement is higher than what can be generated from submicron cmos processes . for example , a 65 nm gp node at tsmc ( a semiconductor foundry ) is capable of producing 65 nm 1 . 2v devices with very high frequency performance , but a limited output voltage . larger , 280 nm devices having higher voltage capability of 2 . 5v can also be built , but such devices suffer from degraded high frequency performance . while 3 . 3v devices can be employed , even though such devices are incapable of generating the output power required for the aforementioned application . therefore , although existing devices may be capable of broadband amplification , the power output of such devices may not be acceptable in handset rf front - end applications . previous applications have employed techniques such as a distributed active transformer ( dat ), which combines the output power of multiple devices to generate the required output power . such power amplifiers typically use “ voltage ” amplifiers as building blocks and used tranformers ( dat being one implementation ) to generate an output signal . the pa 100 of fig4 , in contrast , may be considered to operate as a “ current ” mode power amplifier . the pa 100 is configured to amplify an input signal 120 and generate the required amount of power into a load impedance , such as a 50 ohm antenna 110 . the amplifier 100 may include a pre - amplifier / driver 130 , one or more current mode power amplifier stages built from operational transconductance amplifiers ( otas ) 140 , one or more current mode baluns ( e . g ., “ guanella baluns ”) 150 , the outputs of which are summed at a node 160 , and an impedance transformer 170 that matches the pa 100 output impedance to that of the load z l of the antenna 110 . each of the power amplifier stages 141 , 142 , etc . may be a low voltage ( e . g ., 3 . 3v ) ota capable of outputting a fraction of the required output current ( i . e . a fraction of the total required power at a voltage of , say , v a ). a number of pa stages 141 , 142 may be included as needed to generate the required total power , each providing a balanced / differential current output . a balun stage 150 is used to convert the balanced current outputs to an unbalanced output current . each balun 151 , 152 , etc . may operate in current mode . the unbalanced currents 161 , 162 , etc . from the balun are summed together at a current summing node 160 . guanella baluns indicate wide frequency range of operation making them suitable for wideband applications such as this . although typical guanella baluns may have a 1 : 1 impedance ratio between balanced and unbalanced ends but can also be designed for other fixed ratios , say 1 : 4 , as shown in the figures ( above ). the differential output impedance of each pa section ( z a ) is thus transformed to a singled ended current output stage with an impedance ( z 180 ). as described earlier , all the current outputs which are similarly converted to singled ended output currents ( i 161 , i 162 etc ) are summed together at the summing node 160 . the effective impedance at the combined output z 190 is therefore a fraction of the individual impedances at each balun 150 output . current - mode baluns may also provide a measure of isolation between the summing node 160 and the outputs of the pa stage 140 , which is beneficial in isolating the pas 140 from the load and from one another . this output impedance z 180 of the current - mode pa may then be adjusted to the required antenna impedance ( 100 z l ) by an impedance transformer 170 ( the voltage at the antenna being v l ). the impedance transformer 170 can be wideband ( e . g ., covering a 2 - octave range of 700 mhz to 2800 mhz ) using transmission line structures . alternatively , wideband impedance - transforming structures based on a current - mode or guanella balun can also be substituted . the broadband pa 100 therefore covers a wide frequency band of operation ( e . g ., cellular bands between 700 mhz and 2700 mhz ), and overcomes the limited power / voltage output capability of submicron cmos processes by utilizing a current mode of operation . in a specific example , the output impedance of each pa stage z a & lt ; the antenna load impedance z l and v a & lt ; v l . fig5 a - b are block diagrams of antenna - matching networks in one embodiment of the invention . fig5 a shows a simplified block diagram of a an antenna - matching network 501 , while fig5 b is a circuit diagram of a specific implementation of the antenna - matching network 501 . one goal of an antenna matching network is to maximize transfer of power from the power amplifier to the antenna . referring to fig5 a , the antenna impedance z 0 varies in time and , therefore , the task of the antenna matching network 501 is to provide a dynamic impedance matching the power amplifier and antenna over time . typical matching circuits employ banks of reactive elements that are switched in or out by a switch , which is constructed from solid state or mems devices . such architectures have difficulties relating to narrow bandwidth , high insertion loss and high voltage . turning to fig5 b , the antenna - matching network 501 operates to : 1 ) cancel the reactive component of the antenna impedance , z l 590 , in real time and over broad bandwidth ; and 2 ) adjust the transmit power such that required power delivered to the real components of z l 590 is equal to the power that would have been delivered had re [ z l ] been equal to a pre - defined ideal value ( e . g ., 50ω ). the value of resistor r 1 may be chosen to be small when compared to re [ z l ]. the voltage vi is therefore a measure of the current from the power amplifier ( pa ) 550 . voltage v l ′= αv l is a measure of the voltage across the load z l . the phase of which is detected by the phase detector 563 . thus , control system 1 562 , via the dac 564 , tunes the reactive tank 560 until v i and v l are in phase ( i . e . there is reactive power ). at this point , the reactance of the load is cancelled by the reactance of the tank . as the power amplifier 550 is putting out real power , it is going into the re [ z l ] part of the load because the reactive tank 560 and the load &# 39 ; s reactance cannot consume real power . the output voltage of the detetctor 573 is proportional to the power into the power amplifier . control system 2 572 measures this power with the power into the load , which is obtained from v l ( voltage across the load ) and v i ( measure of the current into the load ). control system 2 572 , via the dac 574 , adjusts the broadband variable attenuator 570 until the power into the re [ z l ] is equal to the power that would have been delivered into a pre - defined ideal resistance ( normally 50ω ). the disclosed transmit and receive filtering and up and down conversion are implemented through the method defined within u . s . patent application ser . no . 13 / 175 , 260 , the entirety of which is incorporated herein by reference . this disclosure defines post - lna receive filtering and pre - pa transmit filtering using wisp technology , as well as methods for up - conversion and down - conversion . optionally , the wisp anti - aliasing filters defined can precede up - conversion and follow down - conversion . fig6 is a block diagram of a sdr front - end in which embodiments of the present invention may be incorporated . the front end may be implemented on a cmos and sige device for low transmit power levels . for high transmit power levels , some components may be located off - chip . embodiments of the sdr front end can be configured for use in a software defined radio , a spectrum analyzer , an early warning radar system , or in any other application where wideband filtering and signal processing is required . other embodiments can be used in handsets for cellular telephone use . operation of the front end is described below . in the transmit path , an anti - aliasing filter 1 receives an input signal from a digital - to - analog converter ( dac ) or i / q dacss ( not shown ). the output from the anti - aliasing filter drives an up - converter mixer 3 where the local oscillator frequency is provided by a frequency synthesizer 2 . a programmable band pass filter 4 rejects unwanted sideband and harmonic content from the output of the upconverter 3 . the passband characteristics of this filter can be changed under software control such that it offers low loss insertion loss to the transmit frequency , which is determined by the synthesizer 2 . the output of the bandpass filter 4 drives an amplifier driver 5 , which typically operates in the linear region and , therefore , does not contribute to the spectral regrowth or non - linearization of the amplifier driver . the output from the amplifer driver 5 drives the power amplifier 7 , which may be implemented as a component external to the front end . in the receive path , a low noise amplifier 13 is a wide band device that operates across the operating range of the sdr front end . a programmable bandpass filter 14 further reduces the bandwidth of the incoming signal to the channel bandwidth of the desired receive signal . a downconverter mixer 15 downconverts the incoming rf signal from the low noise amplifier 13 to base band . the local oscillator frequency is provided by the synthesizer 2 . the programmable anti - aliasing filter 16 is a low pass filter , the filter transfer characteristics of which can be changed under software control based on data rate and presence of interferer in the base band . the filter 16 is provided to maximize the sensitivity of the analog - to - digital converter . the architecture and operation of the components of the sdr front end of fig6 are described in further detail in pct application pct / us2011 / 024542 , the entirety of which is incorporated herein by reference . while this invention has been particularly shown and described with references to example embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention . | 7 |
with continuing attention to the drawing disclosing present blow dryer , the same includes a handgrip portion 1 which conventionally houses multiple electric switches ( not shown ) in circuit with a fan motor and with an electrical resistance heater of the blow dryer . air intakes 2 permit entry of room ( ambient ) air to a fan and motor assembly within a dryer housing at 3 . the foregoing generally describes conventional blow dryer structure as found in various makes of blow dryers . the present blow dryer includes a novel barrel portion 9 which enables the instantaneous discharge of heated or ambient temperature air . a partition 10 extends lengthwise of the dryer barrel which is laterally defined by side walls 13 and 14 . a top wall at 15 extends the length of the barrel while a bottom wall 16 is truncated at 16a to provide a vent area as later set forth . the foregoing wall structure of the barrel defines a hot air duct 11 and an ambient air duct 12 the latter herein termed a cold air duct . disposed within duct 11 are electrical resistance heater coils 17 suitably insulated from internal barrel surfaces by an insulative sleeve 18 of asbestos or the like . leads at 20 and 21 are in circuit with coils 17 and with a switch control located on the unseen side of handgrip 1 . coil retainer plates are indicated at 22 and 23 . baffle means are provided for directing the fan discharged airflow to provide a heated or cold ( ambient ) airflow discharge from the outer end of barrel 9 . a baffle at 24 is located in the upstream end of barrel 9 and in one position ( shown in full lines in fig3 ) closes cold air duct 12 so as to divert the fan output toward heated air duct 11 . said baffle is in hinged connection at 25 with the upstream end of partition 10 with baffle movement being in response to a link 26 pivotally attached at 27 to an ear 29 on said baffle . in a second or broken line position , baffle 24 partially obstructs fan discharge to divert same into cold air duct 12 . said second position also permits a continuous portion of the fan discharge to be bled off via a space 28 for passage through heated air duct 11 to cool heater coils 17 thereby preventing heat damage to barrel structure . as later explained , this cooling flow of air is directed in a non - linear fashion to avoid contact with the person &# 39 ; s hair . a second baffle at 30 is carried by a hinge 31 suitably affixed to partition 10 by means of hinge plates 31a and spacer 12 . baffle 30 is of a size to close the downstream end of heated air duct 11 to cause , when in the duct closing position , a downwardly diversion of air through a vent area 32 past a wall member of the barrel . a toggle at 33 is carried by baffle 30 and with same moves about hinge 31 and pivotally carries at one of its ends the remaining end of link 26 for synchronized baffle movement . a gusset at 34 reinforces the toggle attachment to hinge 31 . the remaining end of toggle 33 receives , in a pivoted manner at 35 , an actuating rod 36 of baffle control means which further includes a trigger 37 disposed in a bracket 38 for convenient finger manipulation . to bias trigger 37 and the baffles to the full line position shown , a spring component 40 acts on a stop 41 on rod 36 with the remaining spring end supported by a barrel projection 42 . with the baffles in the full line positions shown , the fan discharge is routed through hot air duct 11 to accomplish rapid drying of the hair . before drying is complete , the hair is styled whereafter any remaining drying is accomplished by air exhausted through the cold air duct 12 with the baffles 24 and 30 moved to their broken line positions . the fan discharge bled off for cooling heater coils 17 is discharged via vent area 32 away from the person &# 39 ; s head . while i have shown and described but one embodiment of the invention it will be apparent to those skilled in the art that the invention may be embodied still otherwise without departing from the spirit and scope of the invention . | 0 |
a sewing machine frame drive device according to the present invention will be described hereinbelow with reference to the accompanying drawings , giving a preferred embodiment , in which it is applied to a multi - head embroidery sewing machine . fig1 is a perspective view showing a multi - head embroidery sewing machine having four heads . a frame 4 is mounted horizontally above a sewing machine table 1 , and four sewing machine heads 2 in total are arranged on the front sure of the frame 4 . mounted on the underside of the sewing machine table 1 below the respective serving machine heads 2 are shuttle bases ( not shown ), which support shuttles . the top surfaces of the respective shuttle bases are covered by throat plates 3 mounted on the sewing machine table 1 . placed on the sewing machine table 1 is a rectangular - shaped embroidery frame 5 , and arranged on the underside of the sewing machine table 1 are two x - direction drive units 6 , 6 and two y - direction drive units 7 , 7 . the embroidery frame 5 is connected to the x - direction drive units 6 and the y - direction drive units 7 , respectively , through slits 8 a formed in covers 8 , which cover the upper surface of the sewing machine table 1 . the x - direction drive units 6 and the y - direction drive units 7 are mainly composed of a screw rod 11 ( commonly called ball screw ), which is rotatably supported in a frame member 10 having a c - shaped cross section , and a nut member 12 adapted to be threaded on the ball screw 11 to function as a moving body , as shown in fig3 and 4 . the ball screw 11 extends lengthwise in the frame member 10 and is supported by bearings 15 , 15 , respectively , fixed on both ends of the frame member 10 . as clearly shown in fig4 linear guides 16 , 16 are correspondingly fixed to both sides of the nut member 12 threaded on the ball screw 11 . the respective linear guides 16 , 16 are correspondingly fixed on and supported by linear rails 17 , which are mounted on inner sides of the frame member 10 to be in parallel to the ball screw 11 and function to stop rotation of the nut member 12 . a support stud 18 is provided vertically upwardly on the top surface of the nut member 12 , and a roller 20 is supported on an upper end of the support stud 18 to be rotatable on a horizontal plane . as shown in fig3 one ends of the ball screws 11 in the x - direction drive units 6 ( and the y - direction drive units 7 ) are extended from the bearings 15 , timing pulleys 21 are fitted on specific ends of the ball screws , and a timing belt 22 is extended between the timing pulleys 21 . connected to an end of one of the ball screws 11 via a coupling member ( not shown ) is an output shaft 25 of a motor 23 . accordingly , when the motor 23 is activated , the pair of ball screws 11 are rotated in the same direction through the timing belt 22 , and the two nut members 12 are correspondingly moved in the same direction . the rollers 20 provided on the respective support studs 18 of the x - direction drive units 6 and of the y - direction drive units 7 extend above the sewing machine table 1 through slits 8 a of the covers 8 on the sewing machine table 1 shown in fig2 and are substantially closely fitted in an engagement groove 5 a formed on the underside of the embroidery frame 5 placed on the sewing machine table ( see fig5 ). in this case , both the rollers 20 , 20 in the x - direction drive units 6 are correspondingly fitted in the engagement groove 5 a in a right hand piece 5 a of the embroidery frame 5 , and both the rollers 20 , 20 in the y - direction drive units 7 are correspondingly fitted in the engagement groove 5 a in a right hand piece 5 b of the embroidery frame 5 ( see fig2 ). thus the sewing machine frame drive device according to this embodiment is constructed in the above manner , and the motor 23 allotted to the x - direction drive units 6 and the motor 23 allotted to the y - direction drive units 7 are activated to drive the pair of drive units so that the embroidery frame 5 is controlled to be freely movable in the x - y coordinates . since no extending and contracting elements in a transmitting mechanism in the prior art are provided in the respective drive units 6 , 7 , transmission of driving forces by the motors 23 is extremely precisely performed . in the case where the number of sewing machine heads provided in the embroidery sewing machine is great , the embroidery frame 5 in the embodiment shown in fig2 is larger in the x direction . thus , in order to stably perform driving of the embroidery frame 5 in the y direction , there is involved a need for increasing the number of the y - direction drive units 7 . fig6 shows a modification of a manner of connecting the respective y - direction drive units 7 in such a case . in the case where four of the y - direction drive units 7 are connected as in the modification , two of the y - direction drive units 7 disposed on opposite sides are connected to each other by a timing belt 30 . further , a motor 33 disposed in a middle position is connected to two of the y - direction drive units 7 , respectively , disposed inward by timing belts 34 , 34 . thus two timing pulleys 36 , 37 are mounted on an output shaft 35 of the motor 33 , and timing pulleys 38 , 39 are mounted on shaft ends of the two y - direction drive units 7 disposed inward . the timing belts 34 , 34 are extended between the timing pulleys 36 , 38 and between the timing pulleys 37 , 39 . accordingly , all the y - direction drive units 7 are driven synchronously when the motor 33 is activated . fig7 and 8 show another way of connection in the case where a multiplicity of y - direction drive units 7 are provided , like the modification described above . more specifically , a drive shaft 40 is arranged in a position spaced a predetermined distance from and below timing pulleys 21 , which are mounted on shaft ends of ball screws 11 in the respective y - direction drive units 7 , and is made perpendicular to the ball screws 11 . the drive shaft 40 mounts thereon timing pulleys 41 disposed immediately below the respective timing pulleys 21 , and timing belts 43 are twisted 90 degrees and extended between the respective timing pulleys 41 and the timing pulleys 21 disposed thereabove . the drive shaft 40 is connected at its end to an output shaft 46 of a motor 45 through a connection member ( not shown ). fig9 and 10 show a preferred second embodiment of the invention . this embodiment is different from the first embodiment in that driving forces are transmitted indirectly to the embroidery frame 5 from the respective y - direction drive units 7 . in addition , the same elements as those in the first embodiment are designated by the same reference numerals , and an explanation thereof is omitted . a y - direction driven body 50 , which is longer than a rear side piece 5 b of the embroidery frame 5 , is arranged on the upper surface of the sewing machine table 1 to be rearwardly of and in parallel to the rear side piece 5 b . as shown in fig1 , spacers 51 in place of the rollers 20 in the first embodiment are fixed to nut members 12 on the y - direction drive units 7 , and the top surfaces of both spacers 51 project upward through the slits 8 a formed in the covers 8 , which cover the upper surface of the sewing machine table 1 . the y - direction driven body 50 is mounted on the top surfaces of these spacers 51 . the y - direction driven body 50 and the rear side piece 5 b of the embroidery frame 5 are connected to each other so that the rear side piece 5 b of the embroidery frame 5 is movable relative to the y - direction driven body 50 in the x direction . such a connection method can employ roller pairs , and various other known connection methods . in the second embodiment , transmission of driving forces to the embroidery frame 5 from the respective y - direction drive units 7 is performed via the y - direction driven body 50 . since driving forces in the y direction can be uniformly exerted on the embroidery frame 5 even in any position where the embroidery frame 5 is moved , there is produced an advantage that the embroidery frame 5 is moved without generation of distortion . in the second embodiment , the embroidery frame 5 is driven by the y - direction driven body 50 only in the y direction , but a similar construction may be employed in the x direction . more specifically , an x - direction driven body is connected directly to both x - direction drive units 6 , 6 so that driving forces in the x direction are transmitted to the embroidery frame 5 through the x - direction driven body . in this case , the embroidery frame 5 can be more precisely moved by arranging both x - direction drive units 6 , 6 between both y - direction drive units 7 , and positioning respective ends of the y - direction driven body 50 and the x - direction driven body so as not to have them overhanging outside the respective rows of the drive units . of course , the x - direction driven body may be provided for the x - direction drive units . ( 1 ) in the embodiments described above , a so - called “ material cloth fabrics frame ”, which directly holds material cloth fabrics and holds small - sized embroidery frames of various types corresponding to respective sewing machine heads , is illustrated as an embroidery frame , but the present invention is not limited thereto . it is understood that a frame body recited herein indicates a comprehensive concept including all frame members driven in a direction of x - y coordinates , for example , a base frame holding a bag frame , a cap frame or the like . ( 2 ) in the embodiments described above , a timing belt or belts for connection of a pair or pairs of drive units are referred to as an example , but the present invention is not limited thereto . for example , other connecting means such as wire connection , gear connection or the like may be employed . ( 3 ) in the embodiments described above , a pair or pairs of drive units are connected to each other and driven by a common motor , but individual motors may be provided for respective drive units to be subjected to synchronous control . ( 4 ) vertical load from the embroidery frame is not exerted on the nut members provided on the drive units in the embodiments described above . accordingly , it is unnecessary to use the guide member composed of the linear rail and the linear guide in the illustrated examples provided that measures is effectively employed for inhibiting rotation of the nut members . ( 5 ) the embodiments described above employ the constitution , in which the screw rod and the moving body threaded onto the screw rod are combined to drive both of the x - direction drive unit and the y - direction drive unit . the combination of the screw rod and the moving body may be used only for either of the drive units . as described above , the sewing machine frame drive device according to the present invention enables performing precise control of movements of the frame , so that an article being sewn can be conveyed in accordance with sewing data even when additional correction control is not implemented , and so a useful effect is obtained in achieving precise sewing . | 3 |
referring to fig1 , endoscope 21 can include a first channel 1 which may extend , for example , through at least a portion of control head section 23 and elongate portion 25 , and to an outlet at distal end 34 . endoscope 21 can also include additional channels 2 - 6 which can be configured to convey water or a gas or to receive a surgical instrument therein such that the surgical instrument can be guided into the site through the endoscope . in at least one embodiment , flexible feed hose or light - conductor casing can further include leak test connector 7 in fluid communication with an internal volume 13 inside outer housing 11 of the endoscope 21 . leak test connector 7 can be configured to introduce a pressurized fluid and / or vacuum into the internal volume 13 of outer housing 11 in order to inspect the integrity of outer housing 11 for leaks . after an endoscope has been used , it can be reprocessed such that it can be used once again . in various circumstances , a reprocessing system can be utilized to decontaminate the endoscope and / or evaluate whether the endoscope has been properly decontaminated . in at least one circumstance , water , sterilant , and / or any other reprocessing fluid , can be flushed through one or more of the channels of the endoscope and over the exterior of the housing to remove debris , and / or any other foreign matter , which may have entered into the channels or adhered to the exterior of the endoscope . in various embodiments , referring to fig2 , reprocessing system 40 can include basin 14 which can be configured to receive at least a portion of an endoscope , for example endoscope 21 , therein and , tube 42 which can , in at least one embodiment , be configured to receive at least a portion of , or be in fluid communication with , elongate portion 25 of the endoscope 21 . in at least one embodiment , reprocessing system 40 can further include circulation pump 43 , which can be configured to circulate fluid from basin 14 , for example , through endoscope 21 and / or tube 42 , and into line 35 . in certain embodiments , pump 43 can also be configured to push the fluid through heater 45 and into line 46 such that the fluid can be circulated back into basin 14 , for example . in various embodiments , reprocessing system 40 can further include valve 51 which can be configured to divert at least a portion of the fluid flowing within line 35 through the channels of the endoscope 21 . more particularly , in at least one embodiment , reprocessing system 40 can include a number of flush lines 41 , which can be configured to receive fluid from line 35 , wherein each of the flush lines 41 can be placed in fluid communication with one of the channels of the endoscope 21 , i . e ., channels 1 - 6 , for example , such that fluid , air , gas , etc . can flow therethrough . each flush line 41 may be connected to an outlet of a channel pump 41 b . the pumps 41 b are preferably peristaltic pumps or the like that , for example , pump fluid , such as liquid and air , through the flush lines 41 and any internal channels of the endoscope 21 . the channel pumps 41 b either can draw liquid flowing within line 35 through valve 51 , or can draw decontaminated air from an air supply system 36 through a valve 52 . the air supply system 36 can include a pump 38 and a microbe removal air filter 37 that filters microbes from an incoming air stream . in various embodiments , each flush line 41 may be provided with a dedicated channel pump 41 b to ensure adequate fluid pressure and to facilitate the individual monitoring of the fluid pressure in each flush line 41 . in at least one such embodiment , a sensor , such as sensor 39 , for example , can be in fluid communication with each flush line 41 for sensing excessive pressure in the flush line 41 . to perform the channel leakage detection test of the present invention on , for example , channel 1 of the endoscope 21 , system 40 may be configured to monitor fluid communication between channel 1 , and the internal volume 13 of outer housing 11 . detection of fluid communication can be indicative of fluid leakage from channel 1 into the internal volume 13 of outer housing 11 , which can indicate that channel 1 may be compromised . to monitor fluid communication between channel 1 and internal volume 13 of outer housing 11 , in one embodiment , system 40 may be configured to pressurize channel 1 by flowing air or any suitable gas , and monitor a change in pressure in the internal volume 13 of outer housing 11 . in certain embodiments , referring to fig2 , to perform the channel leakage detection test on channel 1 , a flush line 41 may be coupled to channel 1 as described above . a microcontroller may cause valve 52 to open in order to allow for fluid communication between air pump 38 and the flush line 41 . the microcontroller may then cause air pump 38 to be activated . air may flow from air pump 38 through valve 52 . as described above , each flush line 41 may include a separate pump 41 b and a separate sensor 39 to accurately control and monitor pressure within each channel . in some embodiments , pump 41 b can be a peristaltic pump or the like that pumps fluid , such as liquid and air . in this event , the microcontroller may cause the pump 41 b associated with channel 1 to be activated in order to pressurize channel 1 to about 2 to 30 psig , and even as low as about 3 to 5 psig . as pressure is maintained in channel 1 , the microcontroller may obtain several readings from a pressure sensor which measures pressure in the internal volume 13 of outer housing 11 . an increase in pressure of the internal volume 13 of outer housing 11 , beyond a predetermined baseline value , such as an increase of about 0 . 05 to 0 . 5 psig , preferably about 0 . 1 to 0 . 3 , or about 0 . 2 psig or more within a period of 1 minute or longer if the channels are pressurized to lower pressures , may prompt the microcontroller to stop the test and report a failure in the integrity of channel 1 . if no change , or a change below the predetermined baseline value , is detected , the microcontroller may report a successful completion of the channel leak detection test by channel 1 . the channel leak detection test may be repeated for each of the channels of endoscope 21 . an increase in the pressure of internal volume 13 as a result of pressurizing channel 1 can indicate fluid communication between channel 1 and outer housing 11 , which can indicate a compromise in channel 1 . as outlined above , reprocessing system 40 may sequentially test each of the channels 1 - 6 of endoscope 21 and determine separately whether each of the channels 1 - 6 is compromised . in an alternative embodiment , reprocessing system 40 may test all or some of the channels 1 - 6 simultaneously . for example , all of the channels 1 - 6 of the endoscope 21 can be pressurized simultaneously and the internal volume 13 of outer housing 11 can be monitored for a change in pressure , as described above . if no change , or a change below the predetermined baseline value , is detected , reprocessing system 40 may report a successful completion of the channel leak detection test by channel 1 - 6 . if a change in pressure , beyond the predetermined baseline value , is detected , reprocessing system 40 may report that at least one of the channels 1 - 6 of endoscope 21 is compromised . in various embodiments , the channel leakage detection test , outlined above , can be performed before , during , and / or after reprocessing of endoscope 21 . performing the channel leakage detection test , for example , prior to the introduction of reprocessing fluids , such as decontamination liquids , into the channels 1 - 6 of endoscope 21 , may mitigate the possibility of contaminating the internal volume 13 of outer housing 11 with reprocessing fluids during the reprocessing procedure . referring to fig1 and 3 , the integrity of outer housing 11 is preferably tested according to the method described in u . s . pat . no . 6 , 986 , 736 before the channel leakage detection test of the present invention , wherein conduit 112 can be coupled to leak test connector 7 of outer housing 11 to allow fluid communication between air pump 110 and the internal volume 13 of outer housing 11 when valve 53 is in the open position . while air is a suitable pressurization medium , other gases could be used . to begin the test , valve 53 may be turned into an open position , and air pump 110 can be activated to pump air through conduit 112 and into outer housing 11 to pressurize the internal volume 13 of outer housing 11 , which may initially be at ambient pressure . upon reaching a desired pressure , for example about 2 to 5 psig , the valve 53 may be closed , and air pump 110 deactivated . a pressure sensor 116 may look for a change in pressure in the internal volume 13 of outer housing 11 , which could indicate a compromise in the integrity of outer housing 11 . in at least one embodiment , pressure sensor 116 may look for a decrease in pressure in internal volume 13 of outer housing 11 . a decrease in pressure , beyond a predetermined acceptable range , for example a decrease in pressure of about 0 . 05 to 0 . 5 , preferably about 0 . 1 to 0 . 3 psig within a period of 1 minute , may indicate the escape of air through outer housing 11 , which may indicate a compromise in the integrity of outer housing 11 . alternatively , instead of pressurizing the internal volume of the outer housing , a vacuum may be created in the internal volume , and the pressure sensor could look for an increase in pressure in the internal volume of the outer housing , which may indicate a compromise in the integrity of the outer housing . a control system which may have a microcontroller may be configured to be in communication with air pump 110 , valve 53 and pressure sensor 116 to manage the testing of outer housing 11 as outlined above . if outer housing 11 of endoscope 21 fails the test , the control system may report a test failure . alternatively , if outer housing 11 of endoscope 21 passes the test , the microcontroller may cause valve 54 to open in order to vent the conduit 112 and return outer housing 11 to ambient pressure prior to conducting the channel leakage detection test of the present invention . referring again to fig3 , system 40 may include a valve 54 , which may selectively vent the conduit 112 , and the housing 11 through an optional filter 118 when the testing procedure is complete . system 40 may also include an air buffer 120 to smooth out pulsation of pressure from the air pump 110 . a hepa or other microbe - removing filter 113 may remove microbes from the pressurizing air ; and an overpressure switch or relief valve 114 may prevent accidental over pressurization of outer housing 11 of endoscope 21 during testing . the embodiments described herein are therefore to be regarded as illustrative rather than restrictive . variations and changes may be made by others without departing from the spirit of the present invention . accordingly , it is expressly intended that all such equivalents , variations and changes which fall within the spirit and scope of the present invention as defined in the claims be embraced thereby . | 0 |
referring to the drawings , fig1 depicts a metal workpiece of cylindrical rod form being machined on a lathe apparatus 10 according to the present invention . specifically , said workpiece 12 is mounted in the jaws of a conventional rotating chuck member ( not shown ) to conduct a turning operation whereby metal is removed with the depicted tool post construction . tool holder means 14 employs a support tool holder bar 16 in which a metal cutting insert 18 is mounted and which has been further coupled to fluid delivery means 20 in order to supply a high pressure fluid jet stream ( not shown ) aimed directly at the site of chip formation as the metal cutting operation takes place . the internal passageway construction of the depicted tool holder means 14 enabling such result to be carried out is more fully explained in fig2 . said tool holder means 14 is mounted by conventional means on the customary feed carriage ( not shown ) for said lathe apparatus 10 with the feed direction also being indicated in the present drawing by an arrow . the fluid delivery means 20 includes jet orifice means 22 supplying conventional liquid coolant to support bar member 16 with a high pressure pump 24 . a nozzle 26 is physically secured to said support bar member for this purpose which is further operatively associated with commercially available pneumatic control valve means 28 to supply such liquid coolant at the higher delivery pressure conditions pointed out in the previously referenced technical publication . accordingly , jet nozzle diameters in the approximate range 0 . 134 - 0 . 030 millimeters prove satisfactory at coolant velocities in the approximate range 370 - 740 meters per second when employed with a cylindrical passageway diameter in the depicted tool holder and metal insert embodiment of approximately 1 . 27 millimeters . when operated in such manner with the specified jet orifice means delivering high pressure coolant at discharge pressures in the approximate range 70 - 280 mpa , the depicted tool holder means 14 is advanced continuously in the direction shown while discharging coolant in a predetermined direction relative to said feed direction . the tool holder means 14 being employed in the fig1 apparatus embodiment is further illustrated in the fig2 drawing . accordingly , the same numerals are retained in fig2 to identify common features in said tool holder means . as can be seen in the present drawing , said tool holder means includes support bar member 16 in which is physically secured a triangular shaped metal cutting insert 18 . depicted cutting insert 18 can further to be seen to have flat top and bottom surfaces 30 and 32 , respectively , which are joined together by a linear side cutting edge 34 . said cutting insert is further provided with a forward sloping internal passageway 36 from which the high velocity coolant stream is discharged at top surface 30 in a direction substantially perpendicular to side cutting edge 34 . to properly aim the emerging coolant stream directly at the metal chip being formed with cutting edge 34 , the insert is mounted in a hollow seating cavity 38 provided in the support bar member so as to have its cutting edge exposed . a metal shim 40 physically supports the cutting insert in said hollow cavity 38 with both shim and insert members further being secured in place thereat by conventional clamp means 42 . as can further be seen in the present drawing , the internal passageway 36 provided in metal cutting insert 18 communicates with still other internal passageways 44 and 46 included in the presently illustrated tool holder embodiment for delivery of coolant thereto . internal passageway 44 in the shim member 40 is connected at one end to the internal passageway of said cutting insert while being connected at the opposite end to a discharge opening 48 as provided in the internal passageway 46 also formed in support bar member 16 . jet nozzle 26 can be secured in place at the entrance opening 50 of internal passageway 46 without need for any added seal means customarily now being included with conventional jet assisted cooling operation . a further seating cavity 52 is provided in support bar member 16 to retain said jet nozzle in place with conventional clamp means ( not shown ) enabling the desired physical interconnection therebetween . from a further reference in the present drawing to the feed direction of the tool holder unit being depicted , it can be noted that the direction of the fluid jet stream emerging from the assembled unit will reside at an acute angle with respect to said feed direction . a uniquely improved cutting action takes place according to the present invention . such improvement is attributable to a far greater participation of the emerging coolant stream in the cutting action as a result of properly aiming the coolant with respect to the exact workpiece location where chips are being formed with the present apparatus . in doing so , the coolant is required to be ejected from the jet nozzle at discharge pressures in the approximate range 70 - 280 mpa and a coolant velocity rate in the approximate range 370 - 740 meters / sec . heretofore , such elevated operating conditions for the liquid coolant were not utilized to any significant degree since extreme difficulty was experienced in maintaining a reliable physical seal between the jet orifice means and the associated cutting insert . this problem is minimized in the present apparatus by having larger size openings in the associated cutting insert than employed in the jet nozzle directly connected thereto for delivery of the liquid coolant . as a result , liquid coolant being discharged at the present operating conditions from a previously indicated 0 . 134 - 0 . 030 millimeter jet nozzle diameter into cylindrical passageways of the associated cutting insert having diameters also previously indicated to be approximately 1 . 27 millimeters causes the emerging coolant to undergo a significant pressure to velocity conversion . the lowering of fluid pressure by such means in the present apparatus largely avoids the previously experienced seal failures . in fig3 there is depicted an alternative tool holder embodiment in accordance with the present invention . more particularly , tool holder means 60 includes support bar member 62 in which is physically secured a triangular shaped metal cutting insert 64 having a physical configuration substantially the same as that described in the preceding embodiment . said cutting insert 64 is again mounted in a seating cavity 66 provided in the support bar member which further retains a metal shim 68 physically supporting the cutting insert . the linear cutting edge 70 of said cutting insert is also again exposed with both cutting insert and shim members similarly being secured in the seating cavity of support bar member 62 with conventional clamp means 72 . likewise , the metal cutting insert 64 includes a forward sloping internal passageway 74 which is further connected to other internal passageways 76 and 78 provided in the depicted shim and support bar members , respectively , so that a fluid jet stream can be directed at top surface 80 of said cutting insert in the proper direction . an entrance opening 82 provided to internal passageway 78 also again physically interfaces with jet nozzle 84 which is secured in a second seating cavity 86 of the support bar member . as distinct from the preceding embodiment , however , it can be noted from a further reference to the present drawing that the travel direction of the fluid jet stream now being provided lies substantially parallel to the feed direction of the cutting insert . on the other hand , proper aiming of said fluid jet stream so as to intersect with the metal chip being formed during a machining operation is preserved by still having its direction reside substantially perpendicular to the insert cutting edge . it will be apparent from the foregoing description that a broadly useful and novel means has been provided to machine various solid materials with assistance of a high velocity fluid jet stream in a significantly improved manner . it is contemplated that modifications can be made in the specific apparatus means and method for obtaining said improvement than herein illustrated , however , without departing from the true spirit and scope of the present invention . for example , a similar modification to machining apparatus other than a turning lathe which incorporates the presently disclosed means is contemplated as well as making such modification to various other already known tool holders . likewise , it is contemplated that materials other than metals can be machined with the presently improved means such as poorly machinable and thermally sensitive materials like ceramics . consequently , it is intended to limit the present invention only by the scope of the following claims . | 8 |
turning now to fig1 the s - icd of the present invention is illustrated . the s - icd consists of an electrically active canister 11 and a subcutaneous electrode 13 attached to the canister . the canister has an electrically active surface 15 that is electrically insulated from the electrode connector block 17 and the canister housing 16 via insulating area 14 . the canister can be similar to numerous electrically active canisters commercially available in that the canister will contain a battery supply , capacitor and operational circuitry . alternatively , the canister can be thin and elongated to conform to the intercostal space . the circuitry will be able to monitor cardiac rhythms for tachycardia and fibrillation , and if detected , will initiate charging the capacitor and then delivering cardioversion / defibrillation energy through the active surface of the housing and to the subcutaneous electrode . examples of such circuitry are described in u . s . pat . nos . 4 , 693 , 253 and 5 , 105 , 810 , the entire disclosures of which are herein incorporated by reference . the canister circuitry can provide cardioversion / defibrillation energy in different types of waveforms . in one embodiment , a 100 uf biphasic waveform is used of approximately 10 - 20 ms total duration and with the initial phase containing approximately ⅔ of the energy , however , any type of waveform can be utilized such as monophasic , biphasic , multiphasic or alternative waveforms as is known in the art . in addition to providing cardioversion / defibrillation energy , the circuitry can also provide transthoracic cardiac pacing energy . the optional circuitry will be able to monitor the heart for bradycardia and / or tachycardia rhythms . once a bradycardia or tachycardia rhythm is detected , the circuitry can then deliver appropriate pacing energy at appropriate intervals through the active surface and the subcutaneous electrode . pacing stimuli can be biphasic in one embodiment and similar in pulse amplitude to that used for conventional transthoracic pacing . this same circuitry can also be used to deliver low amplitude shocks on the t - wave for induction of ventricular fibrillation for testing s - icd performance in treating v - fib as is described in u . s . pat . no . 5 , 129 , 392 , the entire disclosure of which is hereby incorporated by reference . also the circuitry can be provided with rapid induction of ventricular fibrillation or ventricular tachycardia using rapid ventricular pacing . another optional way for inducing ventricular fibrillation would be to provide a continuous low voltage , i . e ., about 3 volts , across the heart during the entire cardiac cycle . another optional aspect of the present invention is that the operational circuitry can detect the presence of atrial fibrillation as described in olson , w . et al . “ onset and stability for ventricular tachyarrhythmia detection in an implantable cardioverter and defibrillator ,” computers in cardiology ( 1986 ) pp . 167 - 170 . detection can be provided via r - r cycle length instability detection algorithms . once atrial fibrillation has been detected , the operational circuitry will then provide qrs synchronized atrial defibrillation / cardioversion using the same shock energy and waveshape characteristics used for ventricular defibrillation / cardioversion . the sensing circuitry will utilize the electronic signals generated from the heart and will primarily detect qrs waves . in one embodiment , the circuitry will be programmed to detect only ventricular tachycardias or fibrillations . the detection circuitry will utilize in its most direct form , a rate detection algorithm that triggers charging of the capacitor once the ventricular rate exceeds some predetermined level for a fixed period of time : for example , if the ventricular rate exceeds 240 bpm on average for more than 4 seconds . once the capacitor is charged , a confirmatory rhythm check would ensure that the rate persists for at least another 1 second before discharge . similarly , termination algorithms could be instituted that ensure that a rhythm less than 240 bpm persisting for at least 4 seconds before the capacitor charge is drained to an internal resistor . detection , confirmation and termination algorithms as are described above and in the art can be modulated to increase sensitivity and specificity by examining qrs beat - to - beat uniformity , qrs signal frequency content , r - r interval stability data , and signal amplitude characteristics all or part of which can be used to increase or decrease both sensitivity and specificity of s - icd arrhythmia detection function . in addition to use of the sense circuitry for detection of v - fib or v - tach by examining the qrs waves , the sense circuitry can check for the presence or the absence of respiration . the respiration rate can be detected by monitoring the impedance across the thorax using subthreshold currents delivered across the active can and the high voltage subcutaneous lead electrode and monitoring the frequency in undulation in the waveform that results from the undulations of transthoracic impedance during the respiratory cycle . if there is no undulation , then the patent is not respiring and this lack of respiration can be used to confirm the qrs findings of cardiac arrest . the same technique can be used to provide information about the respiratory rate or estimate cardiac output as described in u . s . pat . nos . 6 , 095 , 987 , 5 , 423 , 326 , 4 , 450 , 527 , the entire disclosures of which are incorporated herein by reference . the canister of the present invention can be made out of titanium alloy or other presently preferred electrically active canister designs . however , it is contemplated that a malleable canister that can conform to the curvature of the patient &# 39 ; s chest will be preferred . in this way the patient can have a comfortable canister that conforms to the shape of the patient &# 39 ; s rib cage . examples of conforming canisters are provided in u . s . pat . no . 5 , 645 , 586 , the entire disclosure of which is herein incorporated by reference . therefore , the canister can be made out of numerous materials such as medical grade plastics , metals , and alloys . in the preferred embodiment , the canister is smaller than 60 cc volume having a weight of less than 100 gms for long term wearability , especially in children . the canister and the lead of the s - icd can also use fractal or wrinkled surfaces to increase surface area to improve defibrillation capability . because of the primary prevention role of the therapy and the likely need to reach energies over 40 joules , a feature of one embodiment is that the charge time for the therapy , is intentionally left relatively long to allow capacitor charging within the limitations of device size . examples of small icd housings are disclosed in u . s . pat . nos . 5 , 597 , 956 and 5 , 405 , 363 , the entire disclosures of which are herein incorporated by reference . different subcutaneous electrodes 13 of the present invention are illustrated in fig1 - 3 . turning to fig1 the lead 21 for the subcutaneous electrode is preferably composed of silicone or polyurethane insulation . the electrode is connected to the canister at its proximal end via connection port 19 which is located on an electrically insulated area 17 of the canister . the electrode illustrated is a composite electrode with three different electrodes attached to the lead . in the embodiment illustrated , an optional anchor segment 52 is attached at the most distal end of the subcutaneous electrode for anchoring the electrode into soft tissue such that the electrode does not dislodge after implantation . the most distal electrode on the composite subcutaneous electrode is a coil electrode 27 that is used for delivering the high voltage cardioversion / defibrillation energy across the heart . the coil cardioversion / defibrillation electrode is about 5 - 10 cm in length . proximal to the coil electrode are two sense electrodes , a first sense electrode 25 is located proximally to the coil electrode and a second sense electrode 23 is located proximally to the first sense electrode . the sense electrodes are spaced far enough apart to be able to have good qrs detection . this spacing can range from 1 to 10 cm with 4 cm being presently preferred . the electrodes may or may not be circumferential with the preferred embodiment . having the electrodes non - circumferential and positioned outward , toward the skin surface , is a means to minimize muscle artifact and enhance qrs signal quality . the sensing electrodes are electrically isolated from the cardioversion / defibrillation electrode via insulating areas 29 . similar types of cardioversion / defibrillation electrodes are currently commercially available in a transvenous configuration . for example , u . s . pat . no . 5 , 534 , 022 , the entire disclosure of which is herein incorporated by reference , disclosures a composite electrode with a coil cardioversion / defibrillation electrode and sense electrodes . modifications to this arrangement is contemplated within the scope of the invention . one such modification is illustrated in fig2 where the two sensing electrodes 25 and 23 are non - circumferential sensing electrodes and one is located at the distal end , the other is located proximal thereto with the coil electrode located in between the two sensing electrodes . in this embodiment the sense electrodes are spaced about 6 to about 12 cm apart depending on the length of the coil electrode used . fig3 illustrates yet a further embodiment where the two sensing electrodes are located at the distal end to the composite electrode with the coil electrode located proximally thereto . other possibilities exist and are contemplated within the present invention . for example , having only one sensing electrode , either proximal or distal to the coil cardioversion / defibrillation electrode with the coil serving as both a sensing electrode and a cardioversion / defibrillation electrode . it is also contemplated within the scope of the invention that the sensing of qrs waves ( and transthoracic impedance ) can be carried out via sense electrodes on the canister housing or in combination with the cardioversion / defibrillation coil electrode and / or the subcutaneous lead sensing electrode ( s ). in this way , sensing could be performed via the one coil electrode located on the subcutaneous electrode and the active surface on the canister housing . another possibility would be to have only one sense electrode located on the subcutaneous electrode and the sensing would be performed by that one electrode and either the coil electrode on the subcutaneous electrode or by the active surface of the canister . the use of sensing electrodes on the canister would eliminate the need for sensing electrodes on the subcutaneous electrode . it is also contemplated that the subcutaneous electrode would be provided with at least one sense electrode , the canister with at least one sense electrode , and if multiple sense electrodes are used on either the subcutaneous electrode and / or the canister , that the best qrs wave detection combination will be identified when the s - icd is implanted and this combination can be selected , activating the best sensing arrangement from all the existing sensing possibilities . turning again to fig2 two sensing electrodes 26 and 28 are located on the electrically active surface 15 with electrical insulator rings 30 placed between the sense electrodes and the active surface . these canister sense electrodes could be switched off and electrically insulated during and shortly after defibrillation / cardioversion shock delivery . the canister sense electrodes may also be placed on the electrically inactive surface of the canister . in the embodiment of fig2 there are actually four sensing electrodes , two on the subcutaneous lead and two on the canister . in the preferred embodiment , the ability to change which electrodes are used for sensing would be a programmable feature of the s - icd to adapt to changes in the patient physiology and size ( in the case of children ) over time . the programming could be done via the use of physical switches on the canister , or as presently preferred , via the use of a programming wand or via a wireless connection to program the circuitry within the canister . the canister could be employed as either a cathode or an anode of the s - icd cardioversion / defibrillation system . if the canister is the cathode , then the subcutaneous coil electrode would be the anode . likewise , if the canister is the anode , then the subcutaneous electrode would be the cathode . the active canister housing will provide energy and voltage intermediate to that available with icds and most aeds . the typical maximum voltage necessary for icds using most biphasic waveforms is approximately 750 volts with an associated maximum energy of approximately 40 joules . the typical maximum voltage necessary for aeds is approximately 2000 - 5000 volts with an associated maximum energy of approximately 200 - 360 joules depending upon the model and waveform used . the s - icd and the us - icd of the present invention uses maximum voltages in the range of about 50 to about 3500 volts and is associated with energies of about 0 . 5 to about 350 joules . the capacitance of the devices can range from about 25 to about 200 micro farads . in another embodiment , the s - icd and us - icd devices provide energy with a pulse width of approximately one millisecond to approximately 40 milliseconds . the devices can provide pacing current of approximately one milliamp to approximately 250 milliamps . the sense circuitry contained within the canister is highly sensitive and specific for the presence or absence of life threatening ventricular arrhythmias . features of the detection algorithm are programmable and the algorithm is focused on the detection of v - fib and high rate v - tach (& gt ; 240 bpm ). although the s - icd of the present invention may rarely be used for an actual life - threatening event , the simplicity of design and implementation allows it to be employed in large populations of patients at modest risk with modest cost by non - cardiac electrophysiologists . consequently , the s - icd of the present invention focuses mostly on the detection and therapy of the most malignant rhythm disorders . as part of the detection algorithm &# 39 ; s applicability to children , the upper rate range is programmable upward for use in children , known to have rapid supraventricular tachycardias and more rapid ventricular fibrillation . energy levels also are programmable downward in order to allow treatment of neonates and infants . turning now to fig4 the optimal subcutaneous placement of the s - icd of the present invention is illustrated . as would be evidence to a person skilled in the art , the actual location of the s - icd is in a subcutaneous space that is developed during the implantation process . the heart is not exposed during this process and the heart is schematically illustrated in the figures only for help in understanding where the canister and coil electrode are three dimensionally located in the left mid - clavicular line approximately at the level of the inframammary crease at approximately the 5th rib . the lead 21 of the subcutaneous electrode traverses in a subcutaneous path around the thorax terminating with its distal electrode end at the posterior axillary line ideally just lateral to the left scapula . this way the canister and subcutaneous cardioversion / defibrillation electrode provide a reasonably good pathway for current delivery to the majority of the ventricular myocardium . [ 0050 ] fig5 illustrates a different placement of the present invention . the s - icd canister with the active housing is located in the left posterior axillary line approximately lateral to the tip of the inferior portion of the scapula . this location is especially useful in children . the lead 21 of the subcutaneous electrode traverses in a subcutaneous path around the thorax terminating with its distal electrode end at the anterior precordial region , ideally in the inframammary crease . fig6 illustrates the embodiment of fig1 subcutaneously implanted in the thorax with the proximal sense electrodes 23 and 25 located at approximately the left axillary line with the cardioversion / defibrillation electrode just lateral to the tip of the inferior portion of the scapula . [ 0051 ] fig7 schematically illustrates the method for implanting the s - icd of the present invention . an incision 31 is made in the left anterior axillary line approximately at the level of the cardiac apex . this incision location is distinct from that chosen for s - icd placement and is selected specifically to allow both canister location more medially in the left inframammary crease and lead positioning more posteriorly via the introducer set ( described below ) around to the left posterior axillary line lateral to the left scapula . that said , the incision can be anywhere on the thorax deemed reasonably by the implanting physician although in the preferred embodiment , the s - icd of the present invention will be applied in this region . a subcutaneous pathway 33 is then created medially to the inframmary crease for the canister and posteriorly to the left posterior axillary line lateral to the left scapula for the lead . the s - icd canister 11 is then placed subcutaneously at the location of the incision or medially at the subcutaneous region at the left inframmary crease . the subcutaneous electrode 13 is placed with a specially designed curved introducer set 40 ( see fig8 ). the introducer set comprises a curved trocar 42 and a stiff curved peel away sheath 44 . the peel away sheath is curved to allow for placement around the rib cage of the patient in the subcutaneous space created by the trocar . the sheath has to be stiff enough to allow for the placement of the electrodes without the sheath collapsing or bending . preferably the sheath is made out of a biocompatible plastic material and is perforated along its axial length to allow for it to split apart into two sections . the trocar has a proximal handle 41 and a curved shaft 43 . the distal end 45 of the trocar is tapered to allow for dissection of a subcutaneous path 33 in the patient . preferably , the trocar is cannulated having a central lumen 46 and terminating in an opening 48 at the distal end . local anesthetic such as lidocaine can be delivered , if necessary , through the lumen or through a curved and elongated needle designed to anesthetize the path to be used for trocar insertion should general anesthesia not be employed . the curved peel away sheath 44 has a proximal pull tab 49 for breaking the sheath into two halves along its axial shaft 47 . the sheath is placed over a guidewire inserted through the trocar after the subcutaneous path has been created . the subcutaneous pathway is then developed until it terminates subcutaneously at a location that , if a straight line were drawn from the canister location to the path termination point the line would intersect a substantial portion of the left ventricular mass of the patient . the guidewire is then removed leaving the peel away sheath . the subcutaneous lead system is then inserted through the sheath until it is in the proper location . once the subcutaneous lead system is in the proper location , the sheath is split in half using the pull tab 49 and removed . if more than one subcutaneous electrode is being used , a new curved peel away sheath can be used for each subcutaneous electrode . the s - icd will have prophylactic use in adults where chronic transvenous / epicardial icd lead systems pose excessive risk or have already resulted in difficulty , such as sepsis or lead fractures . it is also contemplated that a major use of the s - icd system of the present invention will be for prophylactic use in children who are at risk for having fatal arrhythmias , where chronic transvenous lead systems pose significant management problems . additionally , with the use of standard transvenous icds in children , problems develop during patient growth in that the lead system does not accommodate the growth . fig9 illustrates the placement of the s - icd subcutaneous lead system such that he problem that growth presents to the lead system is overcome . the distal end of the subcutaneous electrode is placed in the same location as described above providing a good location for the coil cardioversion / defibrillation electrode 27 and the sensing electrodes 23 and 25 . the insulated lead 21 , however is no longer placed in a taught configuration . instead , the lead is serpiginously placed with a specially designed introducer trocar and sheath such that it has numerous waves or bends . as the child grows , the waves or bends will straighten out lengthening the lead system while maintaining proper electrode placement . although it is expected that fibrous scarring especially around the defibrillation coil will help anchor it into position to maintain its posterior position during growth , a lead system with a distal tine or screw electrode anchoring system 52 can also be incorporated into the distal tip of the lead to facilitate lead stability ( see fig1 ). other anchoring systems can also be used such as hooks , sutures , or the like . [ 0054 ] fig1 and 11 illustrate another embodiment of the present s - icd invention . in this embodiment there are two subcutaneous electrodes 13 and 13 ′ of opposite polarity to the canister . the additional subcutaneous electrode 13 ′ is essentially identical to the previously described electrode . in this embodiment the cardioversion / defibrillation energy is delivered between the active surface of the canister and the two coil electrodes 27 and 27 ′. additionally , provided in the canister is means for selecting the optimum sensing arrangement between the four sense electrodes 23 , 23 ′, 25 , and 25 ′. the two electrodes are subcutaneously placed on the same side of the heart . as illustrated in fig6 one subcutaneous electrode 13 is placed inferiorly and the other electrode 13 ′ is placed superiorly . it is also contemplated with this dual subcutaneous electrode system that the canister and one subcutaneous electrode are the same polarity and the other subcutaneous electrode is the opposite polarity . turning now to fig1 and 13 , further embodiments are illustrated where the canister 11 of the s - icd of the present invention is shaped to be particularly useful in placing subcutaneously adjacent and parallel to a rib of a patient . the canister is long , thin , and curved to conform to the shape of the patient &# 39 ; s rib . in the embodiment illustrated in fig1 , the canister has a diameter ranging from about 0 . 5 cm to about 2 cm without 1 cm being presently preferred . alternatively , instead of having a circular cross sectional area , the canister could have a rectangular or square cross sectional area as illustrated in fig1 without falling outside of the scope of the present invention . the length of the canister can vary depending on the size of the patient &# 39 ; s thorax . in an embodiment , the canister is about 5 cm to about 40 cm long . the canister is curved to conform to the curvature of the ribs of the thorax . the radius of the curvature will vary depending on the size of the patient , with smaller radiuses for smaller patients and larger radiuses for larger patients . the radius of the curvature can range from about 5 cm to about 35 cm depending on the size of the patient . additionally , the radius of the curvature need not be uniform throughout the canister such that it can be shaped closer to the shape of the ribs . the canister has an active surface , 15 that is located on the interior ( concave ) portion of the curvature and an inactive surface 16 that is located on the exterior ( convex ) portion of the curvature . the leads of these embodiments , which are not illustrated except for the attachment port 19 and the proximal end of the lead 21 , can be any of the leads previously described above , with the lead illustrated in fig1 being presently preferred . the circuitry of this canister is similar to the circuitry described above . additionally , the canister can optionally have at least one sense electrode located on either the active surface of the inactive surface and the circuitry within the canister can be programmable as described above to allow for the selection of the best sense electrodes . it is presently preferred that the canister have two sense electrodes 26 and 28 located on the inactive surface of the canisters as illustrated , where the electrodes are spaced from about 1 to about 10 cm apart with a spacing of about 3 cm being presently preferred . however , the sense electrodes can be located on the active surface as described above . it is envisioned that the embodiment of fig1 will be subcutaneously implanted adjacent and parallel to the left anterior 5th rib , either between the 4th and 5th ribs or between the 5th and 6th ribs . however other locations can be used . another component of the s - icd of the present invention is a cutaneous test electrode system designed to simulate the subcutaneous high voltage shock electrode system as well as the qrs cardiac rhythm detection system . this test electrode system is comprised of a cutaneous patch electrode of similar surface area and impedance to that of the s - icd canister itself together with a cutaneous strip electrode comprising a defibrillation strip as well as two button electrodes for sensing of the qrs . several cutaneous strip electrodes are available to allow for testing various bipole spacings to optimize signal detection comparable to the implantable system . fig1 to 18 depict particular us - icd embodiments of the present invention . the various sensing , shocking and pacing circuitry , described in detail above with respect to the s - icd embodiments , may additionally be incorporated into the following us - icd embodiments . furthermore , particular aspects of any individual s - icd embodiment discussed above , may be incorporated , in whole or in part , into the us - icd embodiments depicted in the following figures . turning now to fig1 , the us - icd of the present invention is illustrated . the us - icd consists of a curved housing 1211 with a first and second end . the first end 1413 is thicker than the second end 1215 . this thicker area houses a battery supply , capacitor and operational circuitry for the us - icd . the circuitry will be able to monitor cardiac rhythms for tachycardia and fibrillation , and if detected , will initiate charging the capacitor and then delivering cardioversion / defibrillation energy through the two cardioversion / defibrillating electrodes 1417 and 1219 located on the outer surface of the two ends of the housing . the circuitry can provide cardioversion / defibrillation energy in different types of waveforms . in one embodiment , a 100 uf biphasic waveform is used of approximately 10 - 20 ms total duration and with the initial phase containing approximately ⅔ of the energy , however , any type of waveform can be utilized such as monophasic , biphasic , multiphasic or alternative waveforms as is known in the art . the housing of the present invention can be made out of titanium alloy or other presently preferred icd designs . it is contemplated that the housing is also made out of biocompatible plastic materials that electronically insulate the electrodes from each other . however , it is contemplated that a malleable canister that can conform to the curvature of the patient &# 39 ; s chest will be preferred . in this way the patient can have a comfortable canister that conforms to the unique shape of the patient &# 39 ; s rib cage . examples of conforming icd housings are provided in u . s . pat . no . 5 , 645 , 586 , the entire disclosure of which is herein incorporated by reference . in the preferred embodiment , the housing is curved in the shape of a 5 th rib of a person . because there are many different sizes of people , the housing will come in different incremental sizes to allow a good match between the size of the rib cage and the size of the us - icd . the length of the us - icd will range from about 15 to about 50 cm . because of the primary preventative role of the therapy and the need to reach energies over 40 joules , a feature of the preferred embodiment is that the charge time for the therapy , intentionally be relatively long to allow capacitor charging within the limitations of device size . the thick end of the housing is currently needed to allow for the placement of the battery supply , operational circuitry , and capacitors . it is contemplated that the thick end will be about 0 . 5 cm to about 2 cm wide with about 1 cm being presently preferred . as microtechnology advances , the thickness of the housing will become smaller . the two cardioversion / defibrillation electrodes on the housing are used for delivering the high voltage cardioversion / defibrillation energy across the heart . in the preferred embodiment , the cardioversion / defibrillation electrodes are coil electrodes , however , other cardioversion / defibrillation electrodes could be used such as having electrically isolated active surfaces or platinum alloy electrodes . the coil cardioversion / defibrillation electrodes are about 5 - 10 cm in length . located on the housing between the two cardioversion / defibrillation electrodes are two sense electrodes 1425 and 1427 . the sense electrodes are spaced far enough apart to be able to have good qrs detection . this spacing can range from 1 to 10 cm with 4 cm being presently preferred . the electrodes may or may not be circumferential with the preferred embodiment . having the electrodes non - circumferential and positioned outward , toward the skin surface , is a means to minimize muscle artifact and enhance qrs signal quality . the sensing electrodes are electrically isolated from the cardioversion / defibrillation electrode via insulating areas 1423 . analogous types of cardioversion / defibrillation electrodes are currently commercially available in a transvenous configuration . for example , u . s . pat . no . 5 , 534 , 022 , the entire disclosure of which is herein incorporated by reference , discloses a composite electrode with a coil cardioversion / defibrillation electrode and sense electrodes . modifications to this arrangement is contemplated within the scope of the invention . one such modification is to have the sense electrodes at the two ends of the housing and have the cardioversion / defibrillation electrodes located in between the sense electrodes . another modification is to have three or more sense electrodes spaced throughout the housing and allow for the selection of the two best sensing electrodes . if three or more sensing electrodes are used , then the ability to change which electrodes are used for sensing would be a programmable feature of the us - icd to adapt to changes in the patient physiology and size over time . the programming could be done via the use of physical switches on the canister , or as presently preferred , via the use of a programming wand or via a wireless connection to program the circuitry within the canister . turning now to fig1 , the optimal subcutaneous placement of the us - icd of the present invention is illustrated . as would be evident to a person skilled in the art , the actual location of the us - icd is in a subcutaneous space that is developed during the implantation process . the heart is not exposed during this process and the heart is schematically illustrated in the figures only for help in understanding where the device and its various electrodes are three dimensionally located in the thorax of the patient . the us - icd is located between the left mid - clavicular line approximately at the level of the inframammary crease at approximately the 5 th rib and the posterior axillary line , ideally just lateral to the left scapula . this way the us - icd provides a reasonably good pathway for current delivery to the majority of the ventricular myocardium . [ 0065 ] fig1 schematically illustrates the method for implanting the us - icd of the present invention . an incision 1631 is made in the left anterior axillary line approximately at the level of the cardiac apex . a subcutaneous pathway is then created that extends posteriorly to allow placement of the us - icd . the incision can be anywhere on the thorax deemed reasonable by the implanting physician although in the preferred embodiment , the us - icd of the present invention will be applied in this region . the subcutaneous pathway is created medially to the inframammary crease and extends posteriorly to the left posterior axillary line . the pathway is developed with a specially designed curved introducer 1742 ( see fig1 ). the trocar has a proximal handle 1641 and a curved shaft 1643 . the distal end 1745 of the trocar is tapered to allow for dissection of a subcutaneous path in the patient . preferably , the trocar is cannulated having a central lumen 1746 and terminating in an opening 1748 at the distal end . local anesthetic such as lidocaine can be delivered , if necessary , through the lumen or through a curved and elongated needle designed to anesthetize the path to be used for trocar insertion should general anesthesia not be employed . once the subcutaneous pathway is developed , the us - icd is implanted in the subcutaneous space , the skin incision is closed using standard techniques . as described previously , the us - icds of the present invention vary in length and curvature . the us - icds are provided in incremental sizes for subcutaneous implantation in different sized patients . turning now to fig1 , a different embodiment is schematically illustrated in exploded view which provides different sized us - icds that are easier to manufacture . the different sized us - icds will all have the same sized and shaped thick end 1413 . the thick end is hollow inside allowing for the insertion of a core operational member 1853 . the core member comprises a housing 1857 which contains the battery supply , capacitor and operational circuitry for the us - icd . the proximal end of the core member has a plurality of electronic plug connectors . plug connectors 1861 and 1863 are electronically connected to the sense electrodes via pressure fit connectors ( not illustrated ) inside the thick end which are standard in the art . plug connectors 1865 and 1867 are also electronically connected to the cardioverter / defibrillator electrodes via pressure fit connectors inside the thick end . the distal end of the core member comprises an end cap 1855 , and a ribbed fitting 1859 which creates a water - tight seal when the core member is inserted into opening 1851 of the thick end of the us - icd . the s - icd and us - icd , in alternative embodiments , have the ability to detect and treat atrial rhythm disorders , including atrial fibrillation . the s - icd and us - icd have two or more electrodes that provide a far - field view of cardiac electrical activity that includes the ability to record the p - wave of the electrocardiogram as well as the qrs . one can detect the onset and offset of atrial fibrillation by referencing to the p - wave recorded during normal sinus rhythm and monitoring for its change in rate , morphology , amplitude and frequency content . for example , a well - defined p - wave that abruptly disappeared and was replaced by a low - amplitude , variable morphology signal would be a strong indication of the absence of sinus rhythm and the onset of atrial fibrillation . in an alternative embodiment of a detection algorithm , the ventricular detection rate could be monitored for stability of the r - r coupling interval . in the examination of the r - r interval sequence , atrial fibrillation can be recognized by providing a near constant irregularly irregular coupling interval on a beat - by - beat basis . a r - r interval plot during af appears “ cloudlike ” in appearance when several hundred or thousands of r - r intervals are plotted over time when compared to sinus rhythm or other supraventricular arrhythmias . moreover , a distinguishing feature compared to other rhythms that are irregularly irregular , is that the qrs morphology is similar on a beat - by - beat basis despite the irregularity in the r - r coupling interval . this is a distinguishing feature of atrial fibrillation compared to ventricular fibrillation where the qrs morphology varies on a beat - by - beat basis . in yet another embodiment , atrial fibrillation may be detected by seeking to compare the timing and amplitude relationship of the detected p - wave of the electrocardiogram to the detected qrs ( r - wave ) of the electrocardiogram . normal sinus rhythm has a fixed relationship that can be placed into a template matching algorithm that can be used as a reference point should the relationship change . in other aspects of the atrial fibrillation detection process , one may include alternative electrodes that may be brought to bear in the s - icd or us - icd systems either by placing them in the detection algorithm circuitry through a programming maneuver or by manually adding such additional electrode systems to the s - icd or us - icd at the time of implant or at the time of follow - up evaluation . one may also use electrodes for the detection of atrial fibrillation that may or may not also be used for the detection of ventricular arrhythmias given the different anatomic locations of the atria and ventricles with respect to the s - icd or us - icd housing and surgical implant sites . once atrial fibrillation is detected , the arrhythmia can be treated by delivery of a synchronized shock using energy levels up to the maximum output of the device therapy for terminating atrial fibrillation or for other supraventricular arrhythmias . the s - icd or us - icd electrode system can be used to treat both atrial and ventricular arrhythmias not only with shock therapy but also with pacing therapy . in a further embodiment of the treatment of atrial fibrillation or other atrial arrhythmias , one may be able to use different electrode systems than what is used to treat ventricular arrhythmias . another embodiment , would be to allow for different types of therapies ( amplitude , waveform , capacitance , etc .) for atrial arrhythmias compared to ventricular arrhythmias . the core member of the different sized and shaped us - icd will all be the same size and shape . that way , during an implantation procedures , multiple sized us - icds can be available for implantation , each one without a core member . once the implantation procedure is being performed , then the correct sized us - icd can be selected and the core member can be inserted into the us - icd and then programmed as described above . another advantage of this configuration is when the battery within the core member needs replacing it can be done without removing the entire us - icd . post - shock bradycardia is a common after - effect of shocking the heart for cardioversion / defibrillation therapy . symptoms related to low blood pressure may result from post - shock bradycardia whenever the heart rate falls below approximately 30 to approximately 50 beats per minute . accordingly , it is often desirable to provide anti - bradycardia pacing to correct the symptoms resulting from bradycardia . to ensure adequate pacing capture of the heart through a subcutaneous only lead system , pacing therapy can be enhanced by using a monophasic waveform of the present invention for pacing . [ 0073 ] fig1 is a graph that shows an embodiment of the example of a monophasic waveform for use in anti - bradycardia pacing applications in subcutaneous implantable cardioverter - defibrillators (“ s - icd ”) in an embodiment of the present invention . as shown in fig1 , the monophasic waveform is plotted as a function of time versus instantaneous voltage . in an embodiment , the monophasic waveform 1902 comprises an initial positive voltage 1904 , a positive decay voltage 1906 and a final positive voltage 1908 . in an embodiment , the polarities of the monophasic waveform 1902 can be reversed such that the waveform 1902 is negative in polarity . as shown in fig1 , the monophasic waveform 1902 is initially at zero voltage . upon commencement of the anti - bradycardia pacing , a voltage of positive polarity is provided and the monophasic waveform 1902 rises to the initial positive voltage 1904 . next , the voltage of the monophasic waveform 1902 decays along the positive decay voltage 1906 until reaching a voltage level at the final positive voltage 1908 . at this point , the monophasic waveform 1902 is truncated . the total amount of time that the monophasic waveform 1902 comprises is known as the “ pulse width .” in an embodiment , the pulse width of the monophasic waveform can range from approximately 1 millisecond to approximately 40 milliseconds . the total amount of energy delivered is a function of the pulse width and the average ( absolute ) value of the voltage . the ratio of the final positive voltage 1908 to the initial positive voltage 1904 is known as the “ tilt ” of the waveform . an example of one embodiment of the monophasic waveform 1902 will now be described . in this embodiment , the amplitude of the initial positive voltage 1904 can range from approximately 0 . 1 to approximately 100 volts . in one example , the amplitude of the initial positive voltage 1904 is approximately 20 volts . in addition , in an example , the tilt of the positive decay voltage 1906 is approximately 50 %. typically , the tilt of the positive decay voltage 1906 can range from approximately 5 % to approximately 95 % although the waveform tilt can be considerably higher or lower , depending on variables such as capacitance , tissue resistance and type of electrode system used . in the example , the pulse width of the monophasic waveform 1902 can range from approximately 1 millisecond to approximately 40 milliseconds . in addition , the implantable cardioverter - defibrillator employs anti - bradycardia pacing at rates of approximately 20 to approximately 120 stimuli / minute for severe bradycardia episodes although programming of higher pacing rates up to 120 stimuli / minute is also possible . although it possible for the present invention to provide standard vvi pacing at predetermined or preprogrammed rates , one embodiment provides anti - bradycardia pacing only for bradycardia or post - shock bradycardia . to avoid frequent anti - bradycardia pacing at 50 stimuli / minute but to provide this rate in case of emergencies , a hysteresis detection trigger can be employed at lower rates , typically in the range of approximately 20 to approximately 40 stimuli / minute . for example , a default setting may be set at approximately 20 stimuli / minute ( i . e ., the equivalent of a 3 second pause ), and the invention providing vvi pacing at a rate of approximately 50 stimuli / minute only when such a pause occurs . in another embodiment , the invention can provide physiologic pacing in a vvir mode of operation in response to a certain activity , respiration , pressure or oxygenation sensor . the s - icd and us - icd devices and methods of the present invention may be embodied in other specific forms without departing from the teachings or essential characteristics of the invention . the described embodiments are therefore to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore to be embraced therein . | 0 |
in a typical can - annular combustor configuration in a gas turbine , an array of combustors surrounding the turbine rotor supply hot combustion gases to the turbine first stage via a corresponding array of transition ducts that extend between the combustors and the first stage inlets . with reference to fig1 , one such transition piece or duct 10 connects at a forward end to a combustor liner ( not shown ). the aft end 12 of the transition duct in the exemplary embodiment has an integral or attached aft end frame 14 surrounding the outlet 16 , thus facilitating attachment to the turbine first stage nozzle ( not shown ). fig2 illustrates another known transition piece aft end frame 18 formed with plural cooling holes 20 drilled or otherwise formed in the frame . the frame 18 is welded to the transition duct at 24 . seal cavities 26 , 28 are typically provided in the aft frame for receiving seals at the transition duct - turbine nozzle interface . referring now to fig3 - 5 , in one exemplary but nonlimiting embodiment of this invention , an inner surface 30 of the frame 32 is worked ( by milling , casting , laser etching , etc .) to create a plurality of axially - oriented , three - sided , open cooling channels 34 extending from the forward edge 36 of the frame to the rearward or aft edge or face 38 . the cooling channels 34 may be provided on one , all or any combination of the interior top , side and bottom surfaces ( generally referred to as the inner surface 30 ) of the aft frame , and the number of channels or grooves 34 in each of those surfaces may also vary as desired . the channels 34 may be of any suitable cross - sectional shape including rectangular as shown in fig4 - 5 , but also including semi - circular , oval , v - shaped etc . in addition , the cross - sectional areas of the various channels in any single frame may be substantially uniform or may vary in any fashion . in this first exemplary embodiment , the three - sided channels 34 are substantially closed by a metal wrapper or closure band 40 ( fig3 ) that forms the inner wall of the channels 34 thus forming closed - periphery passageways 42 . note that the closure band 40 is exposed to the flow of hot gases through the transition piece . the closure band 40 has an aft outwardly extending flange 44 ( the closure band 40 may therefore also be regarded as an “ l - bracket ”) that engages and is welded or otherwise fixed to the aft edge or face 38 of the frame . holes or apertures 48 are drilled or otherwise formed in the flange 44 to align with the channels 34 thus providing outlets 50 for the passageways 42 . the forward end 52 of the band 40 extends beyond ( i . e ., upstream of ) the forward edge 36 of the frame , and is welded to the transition piece 54 at 56 . the sloped edge 58 of the frame provides enlarged inlets 60 to the passageways 42 . in another exemplary but nonlimiting embodiment , the cooling channels may be formed by a series of raised ribs which are either integrally formed on , or fastened by any suitable means to the outer surface of the l - bracket such that the channels are closed by the smooth interior frame surface , forming the outer wall of the channels . this arrangement is shown in fig6 where the exterior surface 62 of the closure band 64 is provided with a plurality of substantially axially - extending ribs 66 , integrally or by attachment , thus forming a plurality of three - sided , open channels 68 . the fourth or open side of the channels is closed by the smooth interior surface of the aft frame , thus forming cooling passageways similar to passageways 42 in fig3 - 5 . as in the earlier - described embodiment , apertures or holes 70 are required to be formed in the vertical stem or flange 72 of the closure band to form the outlets of the passageways . as in the earlier described embodiment , any number of ribs 66 may be formed on any one or all of the top , bottom and side surfaces of the frame . one or more of the bounding walls of the cooling passageways themselves may also be formed or provided with any of several known heat transfer enhancement mechanisms , such as , for example , turbulators , fins , dimples , cross - hatch grooves , chevrons or any combination thereof ( see fig5 ). the arrangement and number of such enhancements may be varied as desired among the various channels . cooling air may be delivered to the passageways 42 in any number of ways . for example , the passageways may be exposed at their upstream ends ( i . e ., at their respective inlets ) to compressor discharge flow , or they may be fed directly from a separate inlet or manifold . the cooling flow may exit into the hot gas flow from any multiple of outlets in the closure band or l - bracket . note that the above - described aft end cooling arrangement can be used with or without conventional impingement cooling sleeves that are used to impingement cool areas of the duct upstream of the aft end . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims . | 5 |
fig1 depicts a needle assembly 10 comprising an infusion needle 11 with a preformed bend 16 for lateral infusion or aspiration of medicaments and other materials . as defined herein , the “ needle assembly 10 ” can comprise infusion needle 11 alone or infusion needle 11 in combination with other components . the “ infusion needle 11 ” as defined herein comprises one or more needle cannulae having a preformed bend 16 . the infusion needle 11 of fig1 is comprised of a superelastic alloy needle cannula 13 , preferably the alloy sold under the trademark nitinol , that is soldered or otherwise affixed to a well - known needle hub 14 using one of a selected number of well - known techniques , including that of hall described in u . s . pat . no . 5 , 354 , 623 whose disclosure is expressly incorporated herein by reference , and a flange 23 which has a first tapered or pointed end 24 whose shape is readily distinguishable from the second , squared end 42 . first end 24 corresponds to the direction of preformed bend 16 in needle cannula 13 of infusion needle 11 . bend 16 is formed in the nitinol needle cannula 13 by either the well - known process of deforming the cannula under extreme heat for a prescribed period of time , which produces a cannula entirely in the austenitic state , or by cold working the cannula , which involves applying a large amount of mechanical stress to deflect the 15 cannula well beyond the desired amount of permanent bend . cold working permanently locks a crystalline structure in the bending zone into at least a partial martensitic condition while the unstressed portions of the cannula remain in the austenitic state . cold worked ni — i alloys are discussed in “ linear superelasticity in cold - worked ni — ti ”, ( zadno and duerig ) pp . 414 to 419 , in engineering aspects of shape memory alloys , butterworth - heineman , boston , mass . ( duerig et al , editors ) which is incorporated herein by reference . in addition to nitinol , superelastic or pseudoelastic copper alloys , such as cu — al — ni , cu — al — zi , and cu — zi , are available as alternative needle cannula materials . flexible polymeric materials with sufficient rigidity for both deployment and shape memory to assume a desired curve may also be used in certain applications , either alone or in combination with reinforcing metal components such as a metal braid or tip . preformed bend 16 of infusion needle 11 forms a distal portion of needle cannula 13 , preferably close to about 25 % of the length of needle cannula 13 in the embodiment shown in fig1 . the large size of the infusion needle , preferably 10 to 18 gauge , makes this particular embodiment suitable for penetrating a vertebral body to perform a vertebroplasty or percutaneous corpectomy procedure . a more preferred range is 12 to 17 gauge , with the most preferred cannula size being 13 to 15 gauge . with regard to a vertebroplasty and corpectomy procedures , the larger gauge cannula has both the strength to penetrate dense bone material as well as a sufficient lumen diameter to aspirate material from the vertebral body and to infuse highly viscous bone cement , such as methyl methacrylate . the preferred preformed bend 16 of the infusion needle 11 has a constant radius . for the embodiment of fig1 , the preferred radius of distal bend 16 is approximately 3 . 0 cm for a 13 gauge needle , and approximately 2 . 5 cm for a 14 gauge needle . although the illustrative embodiment has a constant bend radius , an increasing or decreasing radius bend could be employed for certain clinical applications . furthermore , it is possible to introduce more than one bend into the superelastic cannula for applications requiring a special needle configuration . the primary purpose of using a nitinol or other superelastic alloy cannula is that the cannula can be constrained into one shape during passage to the treatment site , then deployed into the preformed configuration without experiencing any plastic deformation . fig2 depicts a pair of needles to be used coaxially in that manner , including the infusion needle 11 of fig1 and a coaxial outer cannula 12 for maintaining inner infusion needle 11 in a substantially straight configuration while being introduced to the treatment site . the embodiment depicted in fig2 is jamshidi - type needle ( manan inc ., northbrook , ill .) which is a two - part needle assembly 43 , and is most commonly used for accessing dense , hard tissue such as bone , fibrous material , etc . thus , it is well suited for penetrating the wall of a vertebral body wherein the infusion needle 11 can be deployed . the two - part needle assembly 43 includes a coaxial outer cannula 12 having a stainless steel cannula 19 with an inner passageway 21 that is sufficiently large to accommodate inner infusion needle 11 . for example , the standard 11 gauge jamshidi - type needle suitable for accessing a vertebral body would be used with thirteen ( 13 ) gauge inner curved needle . stainless steel cannula 19 is affixed proximally to a handle 26 and a connector hub 31 ( shown in fig3 ). the connector hub 31 receives the second part of the two - part needle assembly 43 , the coaxial outer cannula introducer 52 which preferably comprises a trocar 25 . the trocar hub 27 locks into handle 26 of coaxial outer cannula 12 . the beveled tip 30 of trocar 25 extends approximately 5 mm beyond the distal tip 22 of coaxial outer cannula 12 and assists in penetration . trocar 25 also serves to prevent the coaxial outer cannula 12 from coring a sample of bone or other material during access . after outer needle assembly 43 has been directed to the target site , trocar 25 is removed from coaxial outer cannula 12 and infusion needle 11 is inserted into passageway 21 of the coaxial outer cannula 12 , as shown in fig3 . to maintain openness of the infusion needle passageway 15 and to prevent tissue coring during deployment , an inner needle introducer stylet 46 can be introduced coaxially inside the infusion needle . inner needle introducer stylet 45 includes a handle 83 and a shaft 46 which is made of a flexible , high - tensile . polymeric material such as polyetherethylketone ( peek ) to allow stylet 45 to assume the contour of preformed bend 16 after deployment . inner infusion needle 11 straightens as it is loaded into coaxial outer cannula 12 . as the portion including preformed bend 16 of infusion needle 11 extends out from tip 22 of coaxial outer cannula 12 as depicted in fig3 , infusion needle 11 assumes the preformed shape due to the superelastic properties of needle cannula 13 . for infusion , inner needle introducer stylet 52 , which helps prevent coring of tissue into passageway 21 of coaxial outer cannula 12 , is removed . the tapered or “ arrow ” end 24 of flange 23 of proximal hub 14 corresponds with the deflection plane 29 of infusion needle 11 . by maneuvering flange 28 , the inner curved needle 13 can be rotated in either direction 28 to reorient the plane of deflection 29 and place the tip opening 17 at multiple locations within the area being treated . in fig3 , tip 17 is deflected at an angle 44 of approximately 60 ° to 70 ° from the device longitudinal axis 18 . this gives , for example , with a thirteen ( 13 ) gauge infusion needle 11 , a lateral reach , measured from tip 17 to longitudinal axis 18 , of nearly thirty ( 30 ) millimeters in any direction . while the degree of deflection required is determined by the application and desired lateral reach of the device , it is also limited by the size of the cannula if the permanent bend is cold worked into the material . cold working provides a stiffer bend which can be advantageous in certain applications such as vertebroplasty and biopsy of dense tissue ; it is more difficult to permanently deform a larger gauge nitinol cannula without application of extreme heat . for the embodiments contemplated , the angle of deflection 44 can encompass a range of 30 ° to 110 ° , with a preferred range of 40 to 90 ° for most applications . fig4 depicts a second version of the inner curved needle and sheathing outer needle adapted for use in the injection of medicaments , contrast media , or other non - viscous agents . the infusion needle 11 is comprised of a smaller gauge needle cannula 13 , preferably around twenty - five ( 25 ) gauge , mounted to a proximal hub 14 . the preformed bend 16 of individual needle cannula 13 has a slightly tighter radius than that illustrated in fig1 through 3 . still referring to fig4 , the coaxial outer cannula 12 includes a correspondingly sized needle cannula 19 , preferably around twenty - one ( 21 ) gauge , attached to a standard needle hub that is adapted to receive proximal hub 14 of infusion needle 11 . the embodiment of fig4 is used with a plurality of stylets that are inserted within both the inner and outer needles during their respective introduction into the body . the first is an outer cannula introducer stylet 52 that is inserted into the passageway 21 of coaxial outer cannula 12 . the coaxial outer cannula 12 and outer cannula introducer stylet 52 are inserted together into the patient . the stylet , which is preferably a stainless steel stylet wire 46 with an attached standard plastic needle hub 47 , prevents the coaxial outer cannula 12 from coring tissue into passageway 21 at distal tip 22 . once coaxial outer cannula 12 is in position , outer cannula introducer stylet 52 is withdrawn from coaxial outer cannula 12 and infusion needle 11 and second introducer stylet 45 are inserted together into outer needle passageway 21 . the inner needle introducer stylet 45 , which is longer than outer cannula introducer stylet 52 in order to fit the longer infusion needle 11 , serves a similar function to the outer cannula introducer stylet 52 by preventing coring of tissue when infusion needle 11 is deployed from coaxial outer cannula 12 . as illustrated in fig4 and 5 , proximal hub 14 of infusion needle 11 is adapted such that hub 53 of inner needle introducer stylet 45 locks together with proximal hub 14 to keep the two in alignment . this locking mechanism includes a molded protuberance 49 on hub 53 that fits within a recess 50 on proximal hub 14 . the purpose of maintaining alignment of hub 53 and proximal hub 14 is to match the beveled surface 51 at the tip of the inner needle introducer stylet 45 , shown in fig5 , with the beveled edge at the tip 17 of infusion needle 11 . fig6 through 8 depict the deployment of infusion needle 11 from within outer needle cannula 12 . fig6 shows infusion needle 11 during initial deployment from coaxial outer cannula 12 . the preformed bend 16 of the infusion needle 11 is constrained by the cannula 19 ; however , as illustrated in fig6 , preformed bend 16 may be of sufficient stiffness to slightly deform outer cannula 19 while infusion needle 11 is inside coaxial outer cannula 12 . despite this slight deformation , coaxial outer cannula 12 is still substantially straight . as depicted in fig7 , stress preformed bend 16 places on outer cannula 19 relaxes as infusion needle 11 is further deployed and the angle of deflection 44 ( measured from longitudinal axis 18 of coaxial outer cannula 12 to the opening at tip 17 of infusion needle 11 ) is increased . as infusion needle 11 is further deployed as depicted in fig8 , fully exposing preformed bend 16 to produce the largest angle of deflection 44 , the unstressed outer cannula returns to a straight configuration . the phenomenon depicted in fig6 through 8 is most noticeable when using smaller gauge cannulae , such as shown in fig4 and 5 . the larger gauge outer cannula of fig1 to 3 is more resistant to deformation than that of fig4 and 5 . naturally , the tendency of the stressed outer cannula to deform is also very much dependent on the stiffness and radius of the preformed bend 16 as well as the thickness of the cannula wall and material used . to eliminate this deformation during introduction of the device into the body , stylet 45 , as depicted in fig5 , can be used as a stiffener until removed immediately before the portion having preformed bend 16 is deployed . fig9 through 11 depict the use of the device illustrated in fig3 to perform a vertebroplasty procedure on a pathological vertebral body 33 using a transpedicular approach . as depicted in fig9 , coaxial outer cannula 12 with introducer trocar 25 is introduced through the wall 38 and into the marrow 37 of the vertebral body 33 . the transpedicular route of access places the needle between the mammillary process 34 and accessory process 35 of the vertebral arch 55 . the vertebral arch 55 is attached posteriorly to the vertebral body 33 and together they comprise the vertebra 54 and form the walls of the vertebral foremen 36 . once coaxial outer cannula 12 and inner introducer trocar 25 are within the internal region or marrow 37 of the vertebral body , trocar 25 is withdrawn from the coaxial outer cannula 12 and infusion needle 11 is inserted in its place . fig1 depicts infusion needle 11 infusing bone cement 41 , commonly methyl methacrylate , into vertebral body 33 to provide it with improved structural integrity . as depicted in fig1 , infusion needle 11 can be partially withdrawn or rotated to obtain more complete filling or to avoid the network of vertebral veins . even though the vertebral body may not need to be completely filled , the density of marrow 37 would still necessitate a second transpedicular stick in the absence of the instant apparatus infusing cement within multiple planes within vertebral body 33 . upon completion of the procedure , infusion needle 11 is withdrawn back into coaxial outer cannula 12 and both are removed from vertebral body 33 . the utility of the hollow , curved superelastic needles is certainly not limited to procedures involving the spine . such needles are useful at many sites within the body that might require straight access by a needle , followed by indirect or lateral infusion , aspiration , or sampling . for example , the inner needle could be adapted to take biopsy samples from dense tissue , such as a breast lesion , especially where indirect access is might be desirable . fig1 is an isometric view of hollow , curved superelastic needles in which needle assembly 10 comprises a multiple needle assembly 70 useful in infusion of ethanol or other medicaments into a tumor . in fig1 , needle assembly 10 comprises an infusion needle 11 , which includes a multiple needle assembly 70 comprising a plurality of needle cannulae 13 , each having a preformed bend 16 , a proximal assembly 58 for constraining the multiple needle assembly 70 , and a coaxial outer cannula 12 for introducing the multiple needle assembly 70 to its anatomical target . the multiple needle assembly 70 in fig1 includes a base cannula 56 affixed to a proximal hub 14 such as a standard female luer fitting . a plurality of needle cannulae 13 are manifolded into base cannula 56 , preferably evenly spaced in an umbrella configuration 75 , and affixed in place with a solder joint 57 . in the structure illustrated in fig1 , five needle cannulae 13 are used ; from two to as many as appropriate for the given cannula size can be used . as with the other versions , needle cannulae 13 are preferably made of nitinol that is either annealed or cold - worked to produce the preformed bend 16 . in the structure illustrated in fig1 , the coaxial outer cannula 12 has an outer diameter of approximately 0 . 072 inches and an inner diameter of around 0 . 06 inches , while the individual curved needle cannulae 13 have an outer diameter of 0 . 02 inches and an inner diameter of about 0 . 12 inches . as shown in fig1 , the tips 17 of the needle cannulae 13 may be beveled to better penetrate tissue . deployment of curved needle cannulae 13 of multiple needle assembly 70 is depicted in fig1 . needle cannulae 13 are restrained by coaxial outer cannula 12 until multiple needle assembly 70 is advanced , exposing the distal end portions of needle cannulae 13 at distal end 22 of coaxial outer cannula 12 , whereby they radiate outward to assume , when fully advanced , the umbrella configuration 75 shown in fig1 . fig1 depicts a side view of an outer needle assembly comprising a coaxial outer cannula 12 and outer cannula introducer stylet 52 used in placement of the multiple needle assembly 70 of fig1 through 14 . the outer cannula introducer stylet 52 is inserted into passageway 21 of coaxial outer cannula 12 with the male proximal hub 47 of the outer cannula introducer stylet 52 fitting into the female proximal hub 20 of coaxial outer cannula 12 when the outer cannula introducer stylet 52 is fully advanced . outer cannula introducer stylet 52 includes a sharp tip 63 , such as the diamond - shape tip depicted , for penetrating tissue . the outer cannula introducer stylet 52 and coaxial outer cannula 12 may be introduced percutaneously into the liver or kidney and placed at the desired treatment location . the outer cannula introducer stylet 52 is then removed . the proximal assembly 58 with the preloaded multiple needle assembly is then advanced into the coaxial outer cannula 12 which remains in the patient . in the version illustrated in fig1 through 15 , the coaxial outer cannula preferably has an outer diameter of about 0 . 095 inches and an inner diameter of about 0 . 076 inches , while the outer diameter of the inner stylet is preferably about 0 . 068 inches . fig1 a side view of the proximal assembly 58 shown of fig1 . the proximal assembly 58 includes a distal male adaptor 60 connected to an intermediate cannula 59 that is sufficiently large to accommodate multiple needle assembly 70 . at the proximal end of the intermediate cannula 59 is proximal assembly female adaptor 61 which is connected proximally to a proximal assembly hub 62 , such as a tuohy - borst adaptor . proximal assembly hub 62 is utilized by the physician during manipulation of the device . the multiple needle assembly 70 of fig1 is loaded into lumen 64 at the proximal end 65 of the proximal assembly hub 62 , with the needle cannulae 13 remaining within intermediate cannula 59 . distal end 66 of proximal assembly 58 with preloaded multiple needle assembly 70 is then inserted into proximal hub 20 of the coaxial outer cannula as depicted in fig1 . the multiple needle assembly 70 is then advanced from the proximal assembly 58 into the coaxial outer cannula 12 where it is deployed as depicted in fig1 to 14 . ethanol is infused into multiple needle assembly 70 via the proximal hub 14 of the infusion needle 11 . following treatment , the multiple needle assembly 70 is withdrawn into coaxial outer cannula 12 and the entire needle assembly 10 is removed from the patient . fig2 and 22 depict a variation of needle assembly 10 of fig1 in which infusion needle 11 and coaxial outer cannula 12 are connected to a coaxial handle 76 used to advance and deploy multiple needle assembly 70 releasably from constraint of coaxial outer cannula 12 . as shown , coaxial handle 76 comprises a stationary outer component 77 that fits over base cannula 56 of multiple needle assembly 70 and attaches to proximal hub 20 . a slidable inner component 78 further comprises a thumb piece 79 used by the physician to advance or retract the coaxial outer cannula 12 as the slidable inner component 78 retracts into stationary outer component 77 . in fig2 , the needle assembly is depicted in the introducer position with the thumb piece 79 advanced fully forward within a slot 80 in outer slidable component 77 . fig2 depicts the deployment state of needle assembly 10 in which thumb piece 79 has been moved to the most proximal position within slot 80 . in this position , coaxial outer cannula 12 is retracted to fully expose the plurality of needle cannulae 13 which can assume their unconstrained configuration with the preformed bends 16 . this type of handle can be used with both the multiple and single infusion needle where a introducer trocar or stylet is not required . other well - known types of coaxial handles 76 include , but are not limited to , screw - type , rachet - type , or trigger - activated handles which allow coaxial outer cannula 12 to be longitudinally displaced relative to infusion needle 11 . to reduce the need for a trocar or stylet for facilitating tissue penetration , distal tip 22 of coaxial outer cannula 12 can be shaped into a needle point such as depicted , or into a non - coring point to help maintain an open outer cannula passageway 21 . a syringe or other reservoir container can be attached to proximal hub 14 as an infusate source or for collection of aspirated material . in addition , a reservoir , such as a syringe , can be incorporated internally within coaxial handle 76 of needle assembly 10 or integrally attached thereto . another version of multiple needle assembly 70 is depicted in fig1 - 20 whereby there are one or more groupings of proximally - located needles 73 in addition to the distally - located needles 74 that are similar to those illustrated in of fig1 . by locating the additional needle cannulae 13 proximal to those at the distal end , wider dispersal and coverage is attained for infusion of medicaments . in the version illustrated in fig1 , there is an arrangement of four needle cannulae comprising the distally - located needles 74 , while at least one other group comprising proximally - located needles 73 located along the length of infusion needle 11 provides for simultaneous infusion in a more proximal location . the needle cannulae 13 of the proximally - located and distally - located needles 73 , 74 can vary in configuration , length , number , and how they are attached to a base cannula 56 such as that shown in fig1 . for example , individual needle cannulae 13 within an umbrella configuration 75 or between proximally - located and distally - located needles 73 , 74 can be longer , or have a different radius than others , to vary the distribution pattern of the infusate . as depicted in fig1 and 18 , each pair of oppositely - disposed needle cannulae 13 within a grouping of four proximally - located needles 73 are longitudinally offset with respect to the adjacent pair located ninety degrees ( 90 ° therefrom , as are the side apertures 67 from which they emerge . with regard to attachment , possibilities include , but are not limited to , having all needle cannulae 13 attaching to a single base cannula 56 ; dividing base cannula 56 such that a separate portion extends distally from the proximally - located needles 73 to join the distally - located needles 74 , or eliminating the base cannula 56 such that needle cannulae 13 of multiple needle assembly 70 are separate and run the length of infusion needle 11 . to constrain needle cannulae 13 for introduction along a single pathway into the body , a coaxial outer cannula 12 is used that has side apertures 67 in the cannula to permit the proximally - located needles 73 to deploy outward therethrough for lateral infusion . fig1 shows a sectioned view of the needle assembly of fig1 in which the needle cannulae 13 are constrained in the introduction position . an introducer cannula 68 is used to selectively expose side apertures 67 in versions where the arrangement of needles is such that individual needle cannulae 13 may prematurely exit a non - designated hole or row , preventing or delaying proper deployment of the multiple needle assembly 70 . by maintaining the introducer sheath over side apertures 67 until distally - located needles 73 are deployed , proper deployment of all needle cannulae 13 is easier . fig1 and 20 illustrate intraluminal guides 69 to help facilitate proper alignment of needle cannulae 13 with a designated side aperture 67 . in fig1 , a series of ridges 71 within passageway 21 of coaxial outer cannula 12 guide the needle cannulae 13 to align with a designated side aperture 67 . fig2 depicts an alternative intraluminal guide 69 in which the needle cannulae 13 travel longitudinally within grooves 72 formed in the inner wall of passageway 21 . | 0 |
referring to the drawings wherein like reference numerals designate like or corresponding parts throughout the several views , there is shown in fig1 a seafloor 10 to which a base 11 is suitably anchored . the base 11 houses a manifold or storage means for crude oil which is pumped thereto via pipelines 12 from satellite production facilities . a plurality of vertically aligned risers 15 interconnected by universal joints 16 are connected to the base by an articulated joint 17 . the uppermost universal joint 16 is connected to a buoy 18 which supports a column 19 and a housing structure 20 . as seen in fig2 the universal joint 16 has an upper yoke member 21 and a lower yoke member 22 . yoke member 21 has a pair of depending leg portions 24 - 25 supporting a laterally extending bearing member 26 therebetween . yoke member 22 has a pair of upwardly extending leg portions 27 - 28 supporting a laterally extending bearing member 29 . with bearing members 26 and 29 interconnected at their juncture , the respective yoke members 21 and 22 are permitted to pivot at right angles to each other on their respective bearing members about axes that are normal to each other . yoke member 22 has a hollow lower portion which is adapted to carry a plurality of conduits vertically therethrough . only four conduits 30 - 31 - 32 - 33 are shown in fig2 although many more conduits are contemplated . only four conduits are shown to provide a clearer understanding of the invention . conduit 31 is connected to a conduit 41 , which conduit 41 extends outwardly externally from the yoke 22 for connection to a swivel joint 42 . swivel joint 42 in turn is connected via a vertically extending conduit 43 - 44 to a slip joint 45 , which in turn is connected via suitable conduits to a swivel joint 46 , which swivel joint 46 is connected to a conduit 48 that extends through bearing member 29 into bearing member 26 for connection to a horizontally extending conduit 50 . slip joint 45 permits limited axial movement between adjacent conduits . conduit 50 is connected to a swivel joint 51 thence to conduit 52 and slip joint 53 . slip joint 53 permits a limited axial movement between conduit 52 and a conduit 54 . conduit 54 is connected to one end of a swivel joint 55 which in turn is connected to a conduit 56 , which conduit 56 extends into yoke member 21 for the conveyance of oil via a conduit 31 &# 39 ; to a subsequent conduit through the risers 15 for eventual connection to a storage facilities in the buoy 18 for discharge to a waiting tanker that is moored to support column 19 . in a similar manner conduits 30 - 32 - 33 in yoke 22 are connected by conduits , swivels and slip joints to respective conduits 30 &# 39 ;- 32 &# 39 ;- 33 &# 39 ; in yoke 21 for eventual connection through suitable conduits through the respective risers 15 to the storage facilities in the buoy 18 for subsequent or immediate unloading to a tanker that is moored to support column 19 . all of the slip joints such as joints 45 and 53 are similar in construction and only one such slip joint will be described . slip joint 53 ( fig3 ) has an inner tubular member 58 and an outer tubular member 59 . outer tubular member 59 has an annular or flanged end portion 60 with a plurality of circumferentially spaced bores 61 to provide means for connecting one end of such slip joint 53 to the adjacent conduit 54 . tubular member 59 has a plurality of stepped bores 63 and 64 extending inwardly from the flanged end portion 60 . the respective bores 63 and 64 are succeedingly of larger diameter as viewed from the flange portion 60 . the one end of inner tubular member 58 has an external diameter that permits a sliding fit with bore 64 . the other end of tubular member 58 has an annular or flanged end portion 70 with a plurality of circumferentially spaced bores 71 . such flanged end portion 70 is welded to the tubular member 58 after assembly with outer tubular member 59 . such flanged end portion 70 provides a means for securing the slip joint 53 to the adjacent conduit 52 . located intermediate the flanged end portion of inner tubular member 58 is an annular abutment 72 which acts as a piston with a sleeve 73 that has its one end secured to tubular member 59 . the outer end of sleeve 73 abuttingly engages a flanged sleeve 75 . flanged sleeve 75 , sleeve 73 and tubular member 59 have a plurality of aligned bores which receive threaded bolts 76 to provide an integral outer tubular housing within which inner tubular member 58 is adapted to reciprocate . the sleeve 73 , flanged sleeve 75 and outer tubular member 59 cooperate with the inner tubular member 58 to define a chamber 79 within which the abutment 72 is located . the piston or abutment 72 is adapted to engage the annular abutment or shoulder 74 on outer tubular member 59 or annular abutment or shoulder 62 on flanged sleeve 75 . the end face portion of outer tubular member 59 that abuttingly engages the one end of sleeve 73 has a plurality of ports 78 that vent that portion of chamber 79 that is located between piston 72 and the annular shoulder 74 to ambient or atmosphere through ports 78 while that portion of chamber 79 that is located between piston 72 and annular shoulder 62 is vented to the bore of inner tubular member 58 by means defined hereinafter . chamber 79 is thus defined as the annular space located between the sleeve 73 and the outer intermediate portion of inner tubular member 58 . the abutment or piston 72 operates within chamber 79 . the inner tubular member 58 has a plurality of circumferentially spaced bleeder ports 80 that equalizes the pressure in chamber 79 with the pressure inside the tubular member 58 when abutment 72 is in an upwardmost position as seen in fig3 exposing ports 80 to such chamber . the outermost circumferential edge of abutment 72 is grooved as at 82 . a ring 84 of elastomeric material suitable for service exposure to both lubricating oils and sea water is bonded or similarly suitably secured to the outer peripheral surface of groove 82 on abutment 72 . the term elastomer is defined as a substance that can be stretched at room temperature to at least twice its original length and , after having been stretched and the stress removed , returns with force to approximately its original length in a short time . ( see glossary of terms as prepared by astm committee d - 11 on rubber and rubber - like materials . published by the american society for testing materials ). the elastomeric or rubber materials that can be used include natural rubber , copolymers of butadiene and acrylonitrile , copolymers of butadiene and styrene , copolymers of butadiene and alkyl acrylates , butyl rubber , olefin rubbers such as ethylene - propylene and epdm rubber , flurocarbon rubbers , flurosilicone rubbers , silicone rubbers , chlorosulfonated polyethylene , polyacrylates , polybutadiene , polychloroprene and the like . preferred elastomeric materials include natural rubber , copolymers of butadiene / acrylonitrile and copolymers of butadiene and styrene which is often referred to as sbr . such elastomeric ring or seal 84 of abutment 72 is under compression when assemblied within sleeve 73 of outer tubular member 59 . prior to assembling the slip joint , such ring 84 expands radially in the normal uncompressed condition such that there is substantial clearance space to either side of ring 84 on abutment 72 . as seen in fig5 the annular elastomeric seal 84 in the normal condition prior to assembly also extends radially outwardly a distance slightly greater than the outer periphery of groove 82 such that in the compressed condition such seal 84 is effectively sealed in the groove 82 . an annular ring or seal 85 made of a material such as from polytetrafluoroethylene is suitably secured as by bonding to the inner peripheral surface of sleeve 73 of outer tubular housing . in the compressed state of elastomeric ring 84 , the outer surface thereof comes into frictional contact with the seal 85 and the edges of the groove 82 such that the groove provides support for the seal against pressure differentials . a second annular elastomeric ring 86 is mounted on the outer peripheral surface of inner tubular member 58 closely adjacent the flanged end of outer tubular member 59 in a suitable groove such that it operates in the same manner as ring 84 . the other end portion of inner tubular member 58 between flange 70 and ports 80 is suitably grooved to receive a third elastomeric ring 88 that operates in the same manner as ring 84 . the surface of inner bore 64 and inner bore surface of flanged sleeve 75 has an annular ring or seal 89 and 90 respectively of a material such as polytetrafluoroethylene secured thereto as by bonding . the one end portion of flanged sleeve 75 is recessed to receive a bearing 91 which has an inner surface that frictionally engages the outer surface of inner tubular member 58 . the outer tubular member 59 adjacent to sleeve 73 is recessed to receive a bearing 92 whose inner surface frictionally engages the outer surface of one end of inner tubular member 58 . in the operation of the slip joint 53 which permits relative axial movement between conduits 52 and 54 on off centerlines of adjacent risers 15 , it is assumed that abutment or piston 72 is in the position shown in fig3 wherein abutment 72 is in abutting engagement with an annular abutment 74 in the outer tubular member 59 . in this condition , chamber 79 is pressurized via ports 80 with the fluid that flows through the tubular members 58 and 59 . upon displacement of risers 15 in an upward direction due to external forces such as wave action , the risers 15 tend to move in an upward direction , which action is manifested in a movement of conduits 52 and 54 axially away from each other thereby moving abutment 72 downward as viewed in fig3 . the fluid in chamber 79 is moved inwardly into tubular member 58 via ports 80 while that portion of chamber 79 that is above the piston or abutment 72 as viewed in fig3 is pressurized via ports 78 from the external fluids surrounding the slip joint 53 to provide a pressure balanced slip joint . during this axial movement of the respective tubular members 58 and 59 the respective ring seals 84 , 86 and 88 absorb axial elastic deformation . upon any extended axial movement between tubular members 58 and 59 the ring seals 84 , 86 and 88 will move with inner tubular member 58 while their outer peripheral surfaces will slide on the respective surfaces of sleeve 73 , the inner surface of bore 89 and the inner surface of the bore of flanged sleeve 75 . the elastomeric or rubber seals 84 , 86 , and 88 absorb the axial thrust in the rubber until the thrust equals the frictional forces exerted by the polytetrafluoroethylene materials 89 , 85 and 90 . at this point , the rubber will slip on the surface of the polytetrafluoroethylene material . various modifications are contemplated and may obviously be resorted to by those skilled in the art without departing from the described invention , as hereinafter defined by the appended claims , as only a preferred embodiment thereof has been disclosed . | 8 |
at the outset , it should be noted that in the development of any such actual embodiment , numerous implementations — specific decisions must be made to achieve the developer &# 39 ; s specific goals , such as compliance with system related and business related constraints , which will vary from one implementation to another . moreover , it will be appreciated that such a development effort might be complex and time consuming but would nevertheless be a routine undertaking for those of ordinary skill in the art having the benefit of this disclosure . in addition , the composition used / disclosed herein can also comprise some components other than those cited . in the summary of the invention and this detailed description , each numerical value should be read once as modified by the term “ about ” ( unless already expressly so modified ), and then read again as not so modified unless otherwise indicated in context . also , in the summary of the invention and this detailed description , it should be understood that a concentration range listed or described as being useful , suitable , or the like , is intended that any and every concentration within the range , including the end points , is to be considered as having been stated . for example , “ a range of from 1 to 10 ” is to be read as indicating each and every possible number along the continuum between about 1 and about 10 . thus , even if specific data points within the range , or even no data points within the range , are explicitly identified or refer to only a few specific points , it is to be understood that inventors appreciate and understand that any and all data points within the range are to be considered to have been specified , and that inventors possessed knowledge of the entire range and all points within the range . this disclosure concerns compositions for cementing subterranean wells , comprising a settable material , water and at least one additive that swells in the event of structural failure of or damage to the set material ( i . e ., the cement sheath ). such behavior restores and maintains a physical and hydraulic barrier in the failure zone . as a result , zonal isolation in the subterranean well is preserved . such set cements are said to be “ self - healing ” or “ self - repairing .” in the following disclosure , both terms are used indifferently , and are to be understood as the capacity of a cement sheath to restore hydraulic isolation after suffering a matrix - permeability increase , structural defects such as cracks or fissures , or debonding from casing or formation surfaces ( i . e ., micro annuli ). examples of settable materials include ( but are not limited to ) portland cement , microcement , geopolymers , resins , mixtures of cement and geopolymer , plaster , lime - silica mixtures , resins , phosphomagnesium cements and chemically bonded phosphate ceramics ( cbpcs ). as stated earlier , improved self - healing set cements that operate in an environment containing high concentrations of gaseous hydrocarbons , methane in particular , would be beneficial to the industry . surprisingly , the inventors have discovered that self - healing properties may be achieved in this environment by incorporating asphaltite - mineral particles in the cement formulation . asphaltite minerals are hard , solid bitumens whose chief consituents , asphaltenes , have very large molecules . they are typically dark brown to black in color . common asphaltites include ( but are not limited to ) uintaite , unitahite ( both of which are usually sold as gilsonite ™ from american gilsonite company , bonanza , utah , usa . ), glance pitch and grahamite . of these , unitaite and unitahite are preferred . further embodiments relate to methods for maintaining zonal isolation in a subterranean well having a borehole that penetrates one or more hydrocarbon - containing formations . the method comprises pumping a cement slurry comprising asphaltite - mineral particles into the well , and allowing the cement slurry to form a cement sheath . those skilled in the art will recognize that a cement slurry is generally considered to be pumpable when its viscosity is less than or equal to 1000 mpa - s at a shear rate of 100 s − 1 throughout the temperature range the slurry will experience during placement in the well . the cement sheath may be located between the well casing and the borehole wall , or between the casing and another casing string . if microannuli , cracks or defects occur in the cement sheath , the casing - cement interface or the cement - borehole wall interface , the particles will be exposed to formation hydrocarbons , causing them to swell and enabling the cement sheath to have self - healing properties . further embodiments aim at uses of asphaltite - mineral particles to impart self - healing properties to a set cement sheath in a subterranean well that penetrates one or more hydrocarbon - containing formations . the particles swell when contacted by hydrocarbons from the formation , in particular gaseous hydrocarbons . the asphaltite - mineral particle concentration is preferably between about 10 % and 75 % by volume of solids in the cement slurry , also known as percentage by volume of blend ( bvob ). a more preferred particle concentration lies between about 20 % and 50 % bvob . the particle - size range is preferably between about 50 μm and 900 μm , and more preferably between about 90 μm and 800 μm . the particles may be added as spheres , ovoid particles , fibers , meshes or ribbons . one of the current challenges that the industry is facing is the presence in some wells of high concentration of gaseous hydrocarbons such as methane , propane and / or ethane . such gaseous hydrocarbons are much more volatile than those in liquid form , and have the tendency to penetrate the failures and / or microannuli that can be present in the cement sheath , thereby modifying the pressure and safety conditions of the well as the integrity is diminished . the inventors have determined that the compositions according to the present invention can solve this problem , even in the presence of very high concentrations of gaseous hydrocarbon . in a preferred embodiment , the gaseous - hydrocarbon concentration in the hydrocarbon fluid is greater than about 80 mol %, and more preferably above about 91 mol %. in addition , the hydrocarbon pressure to which the cement sheath is exposed is preferably above about 11 mpa , more preferably above about 13 mpa and most preferably above about 15 mpa . pressures as high as 200 mpa may even be envisaged , preferably 100 mpa . the asphaltite - mineral particles may be further encapsulated by a protective layer . the layer may rupture or degrade upon exposure to one or more triggers , including ( but not limited to ) contact with a hydrocarbon , propagation of a crack within the set - cement matrix , time and temperature . in addition to the asphaltite - mineral particles , the cement slurries may also comprise customary additives such as retarders , accelerators , extenders , fluid - loss - control additives , lost - circulation additives , gas - migration additives , gas - generating additives and antifoam agents . furthermore , the cement slurries may contain additives that enhance the flexibility and / or toughness of the set cement . such additives include ( but are not limited to ) flexible particles having a young &# 39 ; s modulus below about 5000 mpa and a poisson &# 39 ; s ratio above about 0 . 3 . preferably , such particles would have a young &# 39 ; s modulus below about 2000 mpa . examples include ( but are not limited to ) polypropylene , polyethylene , acrylonitrile butadiene , styrene butadiene and polyamide . such additives may also include fibers selected from the list comprising polyamide , polyethylene and polyvinyl alcohol . metallic microribbons may also be included . the asphaltite - mineral particles may also be used in engineered - particle - size cement formulations involving trimodal or quadrimodal blends of small , medium and coarse particles . such as formulations exemplified in u . s . pat . no . 5 , 518 , 996 and / or ca 2 , 117 , 276 incorporated herein by reference in their entirety . the cement compositions preferably have densities between about 1200 and 1600 kg / m 3 , and solid - volume fractions ( svf ) between about 45 - 58 %. if necessary , the slurry densities may be further decreased to about 1050 kg / m 3 by adding any known low - specific - gravity additives , preferably hollow ceramic or glass microspheres and mixtures thereof . the asphaltite - mineral particles may also be employed in cement compositions that comprise an external phase comprising water , a hydraulic cement and one or more particulate materials that swell upon contact with a water immiscible fluid such as a hydrocarbon . the internal phase of such systems is typically a water - immisicible fluid . the asphaltite - mineral particles may be further associated with one or more compounds from the list comprising an aqueous inverse emulsion of polymer comprising a betaine group , poly - 2 , 2 , 1 - bicyclo heptene ( polynorbornene ), alkylstyrene , crosslinked substituted vinyl acrylate copolymers , diatomaceous earth , natural rubber , vulcanized rubber , polyisoprene rubber , vinyl acetate rubber , polychloroprene rubber , acrylonitrile butadiene rubber , hydrogenated acrylonitrile butadiene rubber , ethylene propylene diene monomer , ethylene propylene monomer rubber , styrene - butadiene rubber , styrene / propylene / diene monomer , brominated poly ( isobutylene - co - 4 - methylstyrene ), butyl rubber , chlorosulphonated polyethylenes , polyacrylate rubber , polyurethane , silicone rubber , brominated butyl rubber , chlorinated butyl rubber , chlorinated polyethylene , epichlorohydrin ethylene oxide copolymer , ethylene acrylate rubber , ethylene propylene diene terpolymer rubber , sulphonated polyethylene , fluoro silicone rubbers , fluoroelastomers , substituted styrene acrylate copolymers , styrene - isoprene - styrene polymers , styrene - butadiene - styrene polymers and bivalent cationic compounds . the cement compositions may also comprise fibers or ribbons selected from the list comprising polyamide , polyethylene , polypropylene , polyvinyl alcohol and metallic compounds . other fibers known by those skilled in the art may be incorporated . those skilled in the art will appreciate that the disclosed method and use may not necessarily be applied throughout the entire length of the subterranean interval being cemented . in such cases , more than one cement - slurry composition is placed sequentially . the first slurry is called the “ lead ,” and the last slurry is called the “ tail .” under these circumstances , it is preferred that the inventive slurry be placed such that it resides in regions where hydrocarbons exist . those skilled in the art will also appreciate that the disclosed method and use would not only be useful for primary cementing , but also for remedial cementing operations such as squeeze cementing and plug cementing . such remedial operations may or may not involve pumping the cement slurry . instead , other placement means including ( but not limited to ) dump bailers may be employed . also , hydrocarbons might be injected into the borehole to contact the cement sheath thus triggering the swelling of the particles which will then repair any defect of said cement sheath . other and further objects , features and advantages of the present invention will be readily apparent to those skilled in the art upon a reading of the description of the examples which follows , taken in conjunction with the accompanying drawings . the asphaltite mineral employed in all of the examples was gilsonite ™ from american gilsonite company , bonanza , utah , usa . gilsonite ™ is unitaite with a specific gravity of 1 . 007 as measured by a pycnometer . the particle - size distribution was as follows : d [ 0 . 1 ]= 13 . 0 μm ; d [ 0 . 5 ]= 94 . 8 μm ; d [ 0 . 9 ]= 579 . 7 μm . the thermal properties of gilsonite ™ were investigated by thermogravimetric analysis ( tga ). the tga instrument was manufactured by ta instruments , new castle , del ., usa . a gilsonite ™ sample was placed in the instrument chamber , and the amount and rate of weight change was measured as a function of temperature . the instrument chamber was filled with a nitrogen atmosphere . the thermogram , shown in fig1 , shows that the sample gradually lost weight as the temperature rose to about 410 ° c . at about 464 ° c ., a large weight decrease occurred . the results indicated that , from a thermal - stability standpoint , gilsonite ™ would be suitable for use in most wellbore environments . the swelling behavior of two types of particles was tested inside a pressure cell equipped with a window that allows one to observe the behavior of materials within the cell . the cell supplier was temco inc ., houston , tex ., usa . a camera captures images from inside the pressure cell , and image - analysis software is employed to interpret the behavior of materials inside the cell . for particle - size measurements , the software examines the cross - sectional area of the particles in the cell . gilsonite ™ and petroleum coke particles were tested . during each test , a few particles were introduced into the cell , and the cell was sealed . the initial particle sizes were measured using the image - analysis software . a methane - gas line was then connected to the cell , and the methane pressure was raised to 21 mpa over a 3 - min period . the cell pressure was maintained for 2 hr , after which the particle sizes were measured again . as shown in fig2 , gilsonite ™ swelled in the presence of methane but the size of the petroleum - coke particles decreased . two cement formulations containing a swelling particle were evaluated for their self - healing properties at ambient temperature and pressure . the slurry compositions are presented in table 1 . the additive compositions were as follows : antifoam agent : polypropylene glycol ; dispersant : polynapthalene sulfonate ; antisettling agent : 90 % crystalline silica , 10 % polysaccharide biopolymer ; retarder : calcium lignosulfonate . the swelling - particle concentrations may be expressed as a percentage by volume of the cement blend ( bvob ). the petroleum - coke concentration was 50 % bvob , and the gilsonite ™ concentration was 42 % bvob . the solid - volume fractions of the slurries were adapted such that both slurries had the same density — 1608 kg / m 3 ( 13 . 4 lbm / gal ). each cement slurry was prepared according to the method described in iso publication 10426 - 2 , and samples were prepared in the manner required to perform a brazilian tensile - strength test . this test is also described in iso publication 10426 - 2 . the cement - core samples were 66 mm long and 22 mm in diameter . the samples were cured at room temperature and atmospheric pressure for periods given in table 2 . the samples were fractured by the brazilian method , then transferred to a steel tube and secured by a sealing cement . as shown in fig3 , the steel tube 101 is 180 mm long . there are two 90 - mm sections — one with an internal diameter of 31 . 5 mm in diameter , the other with an internal diameter of 29 . 5 mm . the fractured cement sample 102 is placed inside the tube and the sealing cement 103 is applied around the sample . midway along the cement sample , owing to the different tube diameters , there is an edge 104 to prevent the cement sample from sliding . the composition of the sealing cement was a 1 . 88 kg / m 3 portland cement slurry containing 2 . 7 ml / kg polynaphthalene sulfonate dispersant , 2 . 7 ml / kg polysiloxane antifoam agent , 178 ml / kg styrene butadiene latex and 2 . 1 % by weight of cement calcium chloride accelerator . nitrogen was injected into the tube at ambient temperature ( 20 °- 23 ° c .) and about 43 - bar ( 3 psi ) pressure . the baseline nitrogen flow rate was measured . butane was then injected through the fractured samples at ambient temperature and pressure for two hours . nitrogen was again introduced into the cell and the flow rate was measured . the flow - rate reduction was proportional to the fracture closure arising from particle swelling . the results , shown in fig4 , demonstrate that the gilsonite ™ particles swelled to a greater degree than the petroleum coke . | 2 |
before describing in detail embodiments that are in accordance with the present disclosure , it should be observed that the embodiments reside primarily in combinations of method steps and system components related to sharpening a digital image without amplifying a noise level in the digital image . in this document , relational terms such as first and second , and the like may be used solely to distinguish one module or action from another module or action without necessarily requiring or implying any actual such relationship or order between such modules or actions . the terms “ comprises ,” “ comprising ,” or any other variation thereof , are intended to cover a non - exclusive inclusion , such that a process , method , article , or apparatus that comprises a list of elements that does not include only those elements but may include other elements not expressly listed or inherent to such process , method , article , or apparatus . an element proceeded by “ comprises . . . a ” does not , without more constraints , preclude the existence of additional identical elements in the process , method , article , or apparatus that comprises the element . any embodiment described herein is not necessarily to be construed as preferred or advantageous over other embodiments . all of the embodiments described in this detailed description are illustrative , and provided to enable persons skilled in the art to make or use the disclosure and not to limit the scope of the disclosure , which is defined by the claims . the present disclosure provides a method and system for increasing the sharpness of digital images without or at least minimally amplifying a noise level in the digital images . specifically , a digital image is processed or sharpened by the system pixel by pixel , as will be explained in conjunction with fig2 , 3 , and 4 . referring to fig2 , a block diagram of an image processing system is shown , in accordance with an embodiment of the present disclosure . the image processing system comprises camera optics 100 , an image sensor 200 , an image buffer 300 , and an image processor 400 . the camera optics 100 and the image sensor 200 may enable the system to capture a digital image 500 ( as is shown in fig3 ). the digital image 500 may be stored in the image buffer 300 which is coupled to the image processor 400 . further , the digital image 500 may be read by the image processor 400 from the image buffer 300 for further processing and sharpening of the digital image 500 . in one embodiment , the system may be in the form of a digital camera , in which case it may include other components dictated by the function of the digital camera such camera optics 100 . referring to now fig3 , a more detailed block diagram of the image buffer 300 and the image processor 400 is shown , in accordance with an embodiment of the present disclosure . the image buffer 300 is a memory device which may be used by the image processor 400 for extracting digital image 500 for sharpening and processing . the image buffer 300 may store the digital image 500 as shown in the fig3 . the digital image 500 may comprise millions of pixels depending on the resolution of the image sensor 200 . for the sake of brevity of this description , a 3 × 3 pixel matrix 510 of the digital image 500 is used for explaining the various embodiments of the present invention . specifically , the 3 × 3 pixel matrix 510 has three columns and three rows having nine pixels in totality . the image processor 400 includes an edge detector 10 , a noise detector 20 , a scaling module 30 , an image sharpening module 40 , an image darkening module 50 , and an adder 60 . the image processor 400 may read the digital image 500 in the form of blocks of pixels in order to sharpen the digital image 500 . specifically , a block of pixels may be read by the edge detector 10 from the image buffer 300 . the edge detector 10 executes an edge detection algorithm to determine whether a pixel x m , n is at an edge . specifically , the edge detector 10 is capable of determining an edge parameter e of the pixel x m , n of the digital image 500 . the edge parameter e provides an indication of whether the pixel x m , n is at an edge in the image . further , the edge parameter e may determine whether the pixel x m , n is on a dark side of the edge or on a light side of the edge . in embodiment of the present disclosure , a sobel type edge detector may be used as the edge detection algorithm . however , it will be evident to a person skilled in the art that any other type of edge detector may be used without deviating from the scope of present disclosure . in the present embodiment , the blocks of pixels may also be read by the noise detector 20 from the image buffer 300 . the noise detector 20 is capable of determining a noise parameter σ which provides an indication of whether the pixel x m , n represents noise in the digital image 500 . specifically , the noise parameter σ may compare the pixel x m , n with a neighborhood r of pixels centered on the pixel x m , n . in one embodiment , a 3 × 3 neighborhood r of pixels centered at x m , n may be considered . the 3 × 3 neighborhood r of pixels defines an 8 - pixel neighborhood comprising the pixel set { x m − 1 , n − 1 , x m − 1 , n , x m − 1 , n + 1 , x m , n − 1 , x m , n + 1 , x m + 1 , n − 1 , x m + 1 , n , x m + 1 , n + 1 }. the pixels in the neighborhood r are examined to determine the maximum value and minimum pixel values in the neighborhood r as follows : in one embodiment , if the pixel x m , n is either larger than a m , n or lower than b m , n , then the pixel x m , n is considered to be a high level noise . further , when the difference between a m , n and b m , n is large or when pixel x m , n is close to either a m , n or b m , n pixel xm , n would be considered to be a medium level noise . in one embodiment of the present disclosure , the edge parameter e and the noise parameter σ may be fed to the scaling module 30 for calculation of a scaling factor α m , n . specifically , the edge detector 10 and the noise detector 20 are coupled to the scaling module 30 which is capable of determining the scaling factor α m , n based on a combination of the edge parameter e and the noise parameter σ . the scaling factor α m , n is used to sharpen the digital image 500 . in a one embodiment , the scaling module 30 controls the value of the scaling factor α m , n for every pixel location by combining the results of edge parameter e and noise parameter σ . an objective of the combining the results of edge parameter e and noise parameter σ for calculating the scaling factor α m , n is to avoid sharpening at either non - edge pixels or noise pixels . in one embodiment of the present disclosure , when the pixel x m , n is considered to be a high level noise , the scaling factor will be set to zero and there will be no sharpening . similarly , when the pixel x m , n is considered to be a medium level noise , the scaling factor will be reduced thereby reducing the sharpening level . in other words , the scaling factor α m , n may be discarded when the value of the pixel x m , n is outside a range defined by the neighborhood pixels . in one embodiment of the present disclosure , the scaling factor α m , n may be fed to the image sharpening module 40 which is coupled to the scaling module 30 . the image sharpening module 40 is capable of utilizing the scaling factor α m , n in as a parameter of an image sharpening algorithm for sharpening the pixel x m , n to get a sharpened pixel y m , n in an output image . in one embodiment , the image sharpening module 40 implements an unsharp masking algorithm of the form where the scaling factor α m , n varies from pixel to pixel , and y m , n is a pixel an output / sharpened image . in one embodiment , to perform edge controlled sharpening , the scaling factor α m , n is set to zero for the pixel locations where an edge is not detected . further , for edge pixel locations , scaling factor α m , n is set to a non - zero value to perform edge sharpening . in one embodiment of the present disclosure , the edge parameter e may be fed to the image darkening module 50 which is coupled to the edge detector 10 . the image darkening module 50 is capable of determining an offset parameter u m , n when the pixel x m , n is determined to be on the dark side of the edge . when the pixel x m , n is determined to be on the dark side of the edge , the image darkening module 50 darkens the pixel x m , n in order to sharpen the pixel x m , n using the offset parameter u m , n . in an embodiment of the present disclosure , an adder may generate an output image pixel t m , n based on a combination of the sharpened pixel y m , n and the offset parameter u m , n as shown in the following equation : referring now to fig4 , a flow chart representing a method for sharpening the digital image 500 is shown , in accordance with an embodiment of the present disclosure . the method starts at 402 where an image , such as the digital image 500 , is captured using the image processing system described . at 404 , a pixel x m , n of the digital image 500 is read by the edge detector 10 . further , at 406 , the edge parameter e of the pixel x m , n is determined using the edge detector 10 . at 408 , it is determined whether the pixel x m , n is at an edge of the digital image 500 . when the pixel x m , n is determined to be at the edge of the digital image 500 , then at 410 it is determined whether the pixel x m , n is on a dark side of the edge . if yes , then the noise parameter σ of the pixel x m , n is determined using the noise detector 20 at 412 . at 414 , the scaling factor α m , n is determined at a scaling module 30 based on a combination of the edge parameter e and the noise parameter σ . at 416 , the image darkening module 50 determines an offset parameter . at 418 , the image darkening module 50 darkens in order to sharpen the pixel x m , n using the offset parameter u m , n . at 420 , the adder generates an output image pixel t m , n based on a combination of the sharpened pixel y m , n and the offset parameter u m , n . it will be appreciated that embodiments of the disclosure described herein may comprise one or more conventional processors and unique stored program instructions that control the one or more processors to implement , in conjunction with certain non - processor circuits , some , most , or all functions of sharpening a digital image without amplifying a noise level in the digital image . alternatively , some or all functions of sharpening a digital image could be implemented by a state machine that has not stored program instructions , or in one or more application specific integrated circuits ( asics ), in which each function or some combinations of certain of the functions are implemented as custom logic . of course , a combination of the two approaches could be used . thus , methods and means for these functions have been described herein . further , it is expected that one of ordinary skill , notwithstanding possibly significant effort and many design choices motivated by , for example , available time , current technology , and economic considerations , when guided by the concepts and principles disclosed herein will be readily capable of generating such software instructions and programs and ics with minimal experimentation . as will be understood by those familiar with the art , the disclosure may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . likewise , the particular naming and division of the modules , agents , managers , functions , procedures , actions , methods , classes , objects , layers , features , attributes , methodologies and other aspects are not mandatory or significant , and the mechanisms that implement the disclosure or its features may have different names , divisions and / or formats . furthermore , as will be apparent to one of ordinary skill in the relevant art , the modules , agents , managers , functions , procedures , actions , methods , classes , objects , layers , features , attributes , methodologies and other aspects of the disclosure can be implemented as software , hardware , firmware or any combination of the three . of course , wherever a component of the present disclosure is implemented as software , the component can be implemented as a script , as a standalone program , as part of a larger program , as a plurality of separate scripts or programs , as a statically or dynamically linked library , as a kernel loadable module , as a device driver , and / or in every and any other way known now or in the future to those of skill in the art of computer programming . additionally , the present disclosure is in no way limited to implementation in any specific programming language , or for any specific operating system or environment . accordingly , the disclosure of the present disclosure is intended to be illustrative , but not limiting , of the scope of the disclosure , which is set forth in the following claims . | 6 |
in the description which follows like parts are marked throughout the specifications and drawings with the same referenced numerals . the drawings are not necessarily to scale and certain features of the invention may be exaggerated in scale or shown in schematic form in the interest of clarity and conciseness . it will be readily apparent to one skilled in the art that various substitutes and modifications may be made to the invention disclosed herein , without departing from the scope and spirit of the invention . fig1 , and 3 show the various parts of the cephalic expansion apparatus 9 including a flexible container 10 for holding sterile fluid and allowing a swollen brain to expand . the flexible container can be a variety of shapes and sizes to fit a head . in the preferred embodiment an elliptical shape is used . the upper side 11 of the unfilled flexible container is shown . the broken lines represent the shape of the flexible container when fluid filled and attached to a skull for treatment . the outer inferior surface 13 of the flexible container 10 is applied to a shaved , deoiled and adhesive prepared scalp 16 ( fig4 ). the inferior scalp contact section 17 of the flexible container 10 contains special scalp contact strips 18 . these contact strips 18 include a special biological adhesive . contact strips 18 are incised when the skin is incised . an irrigation tube 21 can be attached to a port 22 in the flexible container 10 . the port 22 has reinforcement 24 to help support the irrigation tube . although a single irrigation tube 21 and port 22 can be used the preferred embodiment includes a plurality of irrigation tubes 21 and ports 22 . in the preferred embodiment the ports 22 and irrigation tubes 21 are located along the bottom of the flexible container 10 . an expandable reinforceable flap 33 is located in a 360 ° direction directly adjacent to the scalp adhesive part 27 of the flexible container 10 . when the flexible container 10 is applied , fig5 to the scalp 16 , the water - tight locking means 30 is initially closed . the adhesive strips 18 are applied in situ , and the inferior expansion flap 33 is folded down . a nasal canual 36 , oral airway 39 and endotracheal tube 42 are also shown . a cephalo - cervical head rest 46 and collar support 43 are also shown . in fig6 the flexible container 10 is opened exposing the interior surface 45 of the inferior surface 13 which is adherent to the treated scalp 16 . in fig7 the special adhesive strip 18 and scalp 16 have been incised 48 . the scalp 16 with the scalp contact section 17 of the flexible container 10 adhering by a water - tight bond have been retracted laterally . hemostasis is accomplished by electrocautery . the frontal 51 , parietal 54 and occipital calvaria are examined and the coronal 57 and sagittal sutures 60 are identified in preparation for craniotomy . the scalp is retracted 48 and sutured to the flexible container 10 . fig8 shows the line 63 along which the craniotomy is performed . in fig9 the two free bone flaps 66 are carefully removed from the general dura 69 and dura over the superior sagittal sinus 72 . two bilateral parallel incisions 73 adjacent to the superior sagittal sinus 72 and two bilateral incisions 74 parallel to the coronal suture 57 are made and the dura 69 is opened and retracted laterally ( fig1 ). hemostasis is accomplished by bipolar electrocautery . generous amounts of 37 ° c . saline are used to irrigate the injured cortex 84 . swollen gyri 87 and sulci 90 are shown . after the dura 69 is sutured to the galea aponeurotica 93 , the flexible container 10 is closed by bringing the two flaps 75 medially ( e . g ., in the direction of the arrows shown in fig1 ). after observing for any bleeding the water - tight locking means 30 , in the form of a groove locking device such as may be found on a conventional plastic bag of the type used for storing food and sold under the brand name &# 34 ; zip - loc ®&# 34 ;, is engaged . support ring 103 can be placed in the support rod 100 ( see also fig1 a and 13b ) and secured to a stationary support . an irrigation port 22 is used to exchange sterile fluid . in the preferred embodiment a plurality of ports 22 are incorporated into the flexible container 10 . the irrigation ports 21 can be attached to devices which monitor and purify the fluid . in the preferred embodiment the fluid is saline , however , electrolytes and drugs can be added . the fluid can be processed by devices external to the cephalic expansion apparatus . for example the ph can be adjusted or the fluid can be cooled . another enhancement to the cephalic expansion apparatus 9 is shown in fig1 . here a plurality of cortical electrodes 107 are placed in reinforced rings 110 . the leads 119 from the surface electrode grid 116 can be connected to a pre - amp and amplifier for surface eeg and evoked potential recordings . in the preferred embodiment the cephalic expansion apparatus 9 holds approximately 7 - 9 liters of fluid . the fluid is preferably cooled , ph adjusted , filtered saline . fig1 shows a patient intubated in bed 124 with the cephalic expansion apparatus 9 attached . the patient &# 39 ; s head is supported by a support means indicated generally in fig1 and 13b at reference numeral 125 , and is elevated . in the treatment of severe head injury the head is elevated from about 30 ° to about 45 °. in the preferred embodiment the head is elevated at about 45 °. the cerebral expansion apparatus 9 is supported by support rod 100 , which in turn supports the semi - circular rods 103 . the surface electrodes 107 are made stationery by locking arms 128 . the surface electrode grid wires 131 are secured by multi - pin sockets 133 and are channeled to a data acquisition area . one skilled in the art will recognize that a number of patient monitoring , and treatment devices can be attached to the patient and the cephalic expansion apparatus . one embodiment of the cephalic expansion apparatus for the treatment of brain trauma comprises a flexible container for holding sterile fluid and allowing a swollen brain to expand . the flexible container can include a circumferential expansion flap for increasing the volume of flexible container . the external , inferior surface of the flexible container includes an adhesion means . the adhesion means , includes a biological adhesive for forming a water - tight bonding of the container to the skin . for example , alpha - cyanoacrylates can be used . a water - tight locking means is used for sealing the container . in the preferred embodiment the container is sterile when sealed . in the preferred embodiment a groove locking device is used . a support means for supporting the container and a port for access to the sealed container are also included . specific embodiments of the device in the preferred mode include a plurality of ports on the device for the irrigation of the chamber and for the insertion of monitor means for monitoring the brain . for example , cortical electrodes can be inserted into the device for monitoring brain surface electrical activity . the plurality of ports can have support rings attached to prevent inadvertent tube and probe movement and cortical injury . the ports are of a sufficient size to allow the attachment and insertion of tubes for the irrigation of the brain and to allow the attachment and insertion of monitor means . furthermore , the ports can be connected to devices for monitoring , as well as , for exchanging the fluid in the brain . one skilled in the art will recognize that a variety of devices can be used to reduce the temperature , to adjust the ph , to filter the fluid and to add substances such as electrolytes and drugs for the treatment of infections or other medical , physical and chemical problems of the patient . the cortical electrodes are moveable over the cortical surface and include surface attachments connected to a pre - amp . a locking means is used to prevent inadvertent electrode movement and cortical injury . the cephalic expansion apparatus can be used to treat head injury . this method of treatment includes the attachment of the cephalic expansion apparatus to the scalp . in the preferred embodiment the shaved head of the patient receives a ten minute surgical scrub to minimize infection . the head is then aseptically prepared with an antiseptic solution and 90 % alcohol . one skilled in the art will recognize that a variety of scrubbing and surgical preparation procedures are available . the preferred embodiment for scrubbing and sterilizing employees betadine and alcohol . the liquid alpha - cyanocrylate is spread on the alcohol prepared scalp in a thin layer . strips of plastic polymer sheeting , for example polyethylene , are applied along the sagittal suture from the nasion to the inion and from midway between the coronal and lambdoidal sutures to the level of both tragi . after these strips adhere , the cephalic expansion apparatus is attached to the strips and scalp . the bonding of the cephalic expansion apparatus to the strips and scalp with a topical biological adhesive forms a water - tight seal between scalp and the cephalic expansion apparatus . the external , inferior surface of the cephalic expansion apparatus is applied with sufficient force to spread the liquid in a thin layer between the scalp and the flexible container . usually about one drop of adhesive per square inch of skin is sufficient to cause adhesion in seconds . sixty percent of the final bond strength occurs within 10 minutes . a standard craniotomy is then performed . the bone flaps are removed and preserved for replacement after the treatment of the brain injury . in the preferred embodiment the bone flaps are kept sterile and frozen at about 4 . 5 ° c . the cephalic expansion apparatus is sealed by closing the water - tight locking means . the closed cephalic expansion apparatus is then filled with ph adjusted fluid . the fluid is cooled with a temperature regulating means . the lower temperature facilitates recovery . in the preferred embodiment the electrical , physical and chemical parameters of the brain and the surrounding fluid are monitored . additionally , the fluid can be modified , purified and recycled . when the patient has improved sufficiently such that the danger of brain swelling has subsided , usually in about 72 hours , the device is removed and the bone flaps are replaced . in addition to treating brain injury from trauma , one skilled in the art will readily recognize that other brain injuries and / or diseases which require continual and / or repeated access to the brain can be treated with the cephalic expansion apparatus . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned as well as those inherent therein . the methods , procedures , techniques , devices and apparatuses described herein are presently representative of the preferred embodiments and are intended to be exemplary and not intended as limitations on the scope . changes therein and other uses which are encompassed within the spirit of the invention or defined by the scope of the appended claims will occur to those skilled in the art . | 0 |
the present invention is directed to methods and systems for obtaining a quantitative measurement of moisture . one specific application for the invention includes the detection and measurement of perspiration . for purposes of illustration , the invention is described herein in the context of measuring perspiration , however , embodiments of the invention can be used to measure other sources of moisture . in accordance with some embodiments of the invention , the perspiration sensor includes a pair of ground shielded parallel electrodes sandwiching a moisture absorbent dielectric material ( e . g ., a microfiber cloth ) that forms a capacitor . the sensor allows perspiration to become absorbed by moisture absorbent dielectric material which changes the dielectric constant the dielectric material and is reflected in the measured capacitance of the electrode plates of the perspiration sensor . in accordance with some embodiments of the invention , the dielectric material can be electrically coupled ( e . g ., capacitively coupled ) to the skin of the user to provide for more stable signal measurement . in accordance with some embodiments of the invention , the absorbent dielectric material can be weakly ( e . g ., 10 pf or less ) but consistently ( e . g ., up to 10 % variation ) coupled through the skin to earth ground which is weakly coupled to signal ground of capacitance measuring circuit . the method includes providing a capacitor that includes an exposed dielectric material that can absorb moisture ( e . g ., perspiration ) produced by the skin . as perspiration is released from the skin and becomes absorbed by the absorbent dielectric material , the dielectric properties of the material between the electrode plates change resulting in a change in the capacitance of the perspiration sensor . an internal or external measurement component can be connected to the electrodes of the capacitor to measure the changes in capacitance of the perspiration sensor . the dielectric properties of perspiration closely resemble that of saline which in turn closely resemble that of water . the dielectric constant of water is about 80 times that of air . an air capacitor formed by two parallel plates will increase capacitance significantly when air is replaced with water , saline , or perspiration . the approximate capacitance c of the parallel plates can be determined by where a is the area of the electrode plate , d is the distance between the plates ; ε 0 is the dielectric constant of free space and ε r is the relative dielectric constant of the material between the plates . in accordance with the invention , the dielectric material can be selected to rapidly absorb the perspiration . in accordance with some embodiments of the invention , the dielectric material can have predefined wicking or absorbency properties that provide a desired level of perspiration absorption . in operation , the dielectric material is initially in a dry state and has dielectric properties similar to air and produces an initial capacitance level . as the dielectric material is exposed to moisture ( e . g ., perspiration ) the moisture rapidly replaces the air , changing the dielectric properties of the dielectric material and the measured capacitance level of the sensor . in accordance with some embodiments of the invention , the absorbent dielectric material can include a tufted microfiber cloth . this material has been found to have improved capillary suction and to diffuse perspiration faster and more uniformly than other materials as well as provides higher absorption densities . other absorbent materials , such as cellulose paper , foamy elastomers , cotton , wool , air , and moisture wicking materials , can be used . the absorbent dielectric material can be configured to have a large surface area to volume ratio of the material that results in capillary suction causing the air filled space to become filled with environmental moisture or perspiration . a capacitance measuring circuit can be provided onboard or in close proximity to the capacitor sensor to minimize noise and convert the capacitance to a digital signal for transmission to a connected device . fig1 a and 3b shows a moisture or perspiration sensor 100 according to various embodiments of the invention with the encapsulating polymer removed to provide a better view of the structure of the device . fig2 a and 2b show diagrammatic views of a perspiration sensor 200 according to embodiments of the invention encapsulated in an encapsulating material , such as polymer material ( e . g ., silicone , pdms , polyimide , tpe , pet , pvc , and mma ). the perspiration sensor 200 can include channels 210 that serve to guide moisture , such as perspiration , toward inlets in the perspiration sensor 200 . as shown in fig3 a and 3b , the perspiration sensor 100 can be constructed from two or more layers of insulating or dielectric material ( e . g ., a first layer 110 , a second layer 120 and the third layer 130 ). in accordance with some embodiments of the invention , each layer can include a non - conductive substrate ( e . g . fr4 epoxy fiberglass , pdms , or polyimide ) having a conductive layer ( e . g ., copper and / or tin ) on one or both surfaces of the substrate , such as a printed circuit board ( pcb ) or flexible pcb . in accordance with some embodiments of the invention , each layer can include a protective and / or insulating coating ( e . g ., solder mask coating ) covering a portion or all of each surface of each layer . each of the layers that make up the perspiration sensor 100 can be bonded together using well known adhesives ( e . g ., epoxy , polyimide , and / or silicone based adhesives ). the surfaces of at least some of the layers can include exposed pads enabling electronic components such as integrated circuits , discrete components ( e . g ., resistors , capacitors , diodes and other passive devices ) to soldered in place . the layers can also include vias or plated through holes that allow circuit traces to extend through the layer can make contact with circuit traces of the other layers . in accordance with some embodiments of the invention , some or all of the layers can include castellated vias on or extending from the external edges that provide for mechanical alignment and enable low temperature fabrication — the castellated vias are positioned away from central chamber and can be soldered without fear of melting or otherwise damaging the absorbent dielectric material . fig4 shows an exploded view of a perspiration sensor 100 according to some embodiments of the invention . in this embodiment , the perspiration sensor 100 includes a first or top layer 110 , a second or middle layer 120 and the third or bottom layer 130 . the first layer 110 includes a first electrode 112 on the underside of the first layer ( hidden from view in fig4 , but shown in fig5 ). the first layer 110 can also include circuit traces that enable a sensing integrated circuit 140 to soldered in place and electrically connected to the first electrode 112 and second electrode 134 and wires ( not shown ) that connect the perspiration sensor 100 to other devices . the third layer 130 includes one or more inlets 132 and the second electrode 134 . the third layer 130 can also include a skin electrode 136 ( hidden from view in fig4 , but shown in fig5 ) and an adhesive material covering the skin electrode 136 to adhere the perspiration sensor 100 to a surface such as a skin surface . the second layer 120 forms a ring 122 that at least partially surrounds or encloses the dielectric material 124 in the dielectric space defined by the central chamber 26 . when the three layers are bonded together , they form a central chamber 126 which encloses the dielectric material 124 ( e . g ., the moisture absorbent material ). in accordance with some embodiments of the invention , the thickness of each layer can be selected to minimize the overall thickness of the sensor to improve user comfort . thus , the first layer 110 and the third layer 130 can be thicker or thinner than the middle layer 120 . alternatively , each of the layers can have the same or different thicknesses . in accordance with some embodiments , the sensor detection area , defined by the inlets 132 can cover an area of 1 cubic centimeter and provide an average pore density of 50 pores ( e . g ., in the arm pit ). fig5 shows an exploded bottom view of the perspiration sensor 100 ( e . g ., showing the third layer 130 on top ). as shown in fig5 , the third layer 130 can include a skin electrode 136 on the outer surface thereof . the skin electrode 136 can be provided in the form of a ring , as shown , or as a set of interconnected contact points over the outer surface of the third layer 130 . in accordance with some embodiments , the skin electrode 136 can be electrically connected to the dielectric material 124 in the central chamber 126 of the perspiration sensor 100 by extending circuit traces around or vias through the third layer 130 to the middle layer 120 and in contact with the dielectric material 124 . in accordance with other embodiments , the skin electrode 136 can be electrically connected to the dielectric material 124 by circuit traces or wires that extend from the inner surface of the third layer 130 into the central chamber 126 . the skin electrode 136 can be covered with a solder mask or other insulating material ( e . g ., skin adhesive tape ). when the perspiration sensor 100 is adhered or placed in contact with the skin , the skin electrode 136 capacitively couples the dielectric material 124 to the skin . fig6 a shows an exploded cross - section view and fig6 b shows an assembled cross - section view of a perspiration sensor 100 according to some embodiments of the invention . in this embodiment , an adhesive layer 150 adheres the third layer 130 of the perspiration sensor 100 to the surface of the skin 160 enabling the device to measure perspiration . the perspiration sensor 100 includes a first layer 110 , second layer 120 and a third layer 130 . the first electrode 112 is formed on the inner surface of the first layer 110 and the second electrode 134 is formed on the inner surface of the third layer 130 . a mask 114 on the first layer and a mask 138 on third layer can be included to electrically insulate the first electrode 112 and the second electrode 134 from the dielectric material 124 while enabling the dielectric material 124 to be in intimate contact with the first electrode 112 and the second electrode 134 while preventing the moistened dielectric material from shorting the first electrode to the second electrode . the insulating masks 114 and 138 can be formed from any solder mask insulating material ( e . g ., a layer or film of epoxy or uv cured polymer or resin ). the second layer 120 is bonded between the first layer 110 and the third layer 130 supporting the first electrode 112 at predefined distance with respect to the second electrode 134 and forming the central chamber 126 that encloses the moisture absorbent dielectric material 124 . the third layer 130 includes one or more inlets 132 that allow the moisture ( e . g ., perspiration ) to enter the central chamber 126 and become absorbed by the moisture absorbent dielectric material 124 as well as to allow air initially contained within the moisture absorbent dielectric material 124 to escape . as shown in fig6 b , when the layers are bonded together , the moisture absorbent dielectric material 124 can become partially or fully extruded through the inlets 132 to facilitate moisture absorption . in accordance with some embodiments , an outlet can be provided through the middle layer 120 or the first layer 110 to enable air initially contained within the moisture absorbent dielectric material 124 to escape . the perspiration from skin 160 enters the inlets 132 and is absorbed by the moisture absorbent dielectric material 124 . as shown in fig6 a and 6b , the third layer 130 includes one or more vias or plated through holes that electrically connect the skin electrode 136 to the inner surface of the third layer 130 and after assembly , make electrical contact with an inner trace or electrode 122 on the middle layer 120 . the inner electrode 122 can extend into the central chamber 126 and make contact with the moisture absorbent dielectric material 124 . in some embodiments of the invention , all or a portion of the inner surface 128 of the middle layer 120 can include a conductive material ( e . g ., copper or tin ) that makes contact with the moisture absorbent dielectric material 124 . fig7 a shows a perspective view of a perspiration sensor 100 according to some embodiments of the invention and fig7 b shows a diagrammatic view of the middle layer 120 . in these embodiments , the first layer 110 , the middle layer 120 and the third layer 130 each include pads 122 , 236 and plated through holes or partial holes or vias 228 that enable circuit traces to extend between layers . solder can be applied to the plated through holes or vias 228 to create a physical connection between the layers and an electrical connection between the pads 122 , 236 on the outside surfaces of the sensor 100 and the dielectric space defined by the central chamber 126 . in some embodiments , the third layer 130 can include pads ( not shown ) that serve as the skin electrode 136 and can be electrically connected to circuit traces on the middle layer 120 and the first layer 110 soldering together the vias 228 . similar vias 226 can be provided on the inner surface of the middle layer 120 and connected by circuit traces 222 to one or more of the vias 228 to provide an electrical connection between the skin electrode 136 and the moisture absorbent dielectric material 124 . in accordance with some embodiments of the invention , the perspiration sensor 100 can also include one or more anchor rings 220 that project from the peripheral edge of the device as shown in fig7 a and 7b . the anchor rings 220 serve to provide features in the peripheral structure of the sensor device to aid in anchoring the device in the encapsulating material such as silicone , pdms , polyimide during assembly . fig7 c shows a partially cut away view of a perspiration sensor 100 according to some embodiments of the invention . in this embodiment , the vias 228 are shown along the outer surface of the sensor 100 and the anchor rings 220 are shown extending from the outer peripheral surface of the sensor 100 . in some embodiments , the encapsulating material 205 can at least partially extend into the openings of the anchor rings 220 . fig8 a and 8b show photos and diagrams of microfibers . microfiber based materials provide for improved absorption of moisture . in some embodiments , the microfibers can be split microfibers which have an x or asterisk shaped cross - section as shown in fig8 a . this structure results in the formation of microchannels in the fibers that help absorb moisture ( e . g ., by capillary action ) better than regular solid fibers . as shown in fig8 b , these microfibers can be loosely woven into a tufted cloth that provides good absorption of moisture . in accordance with some embodiments , the perspiration sensor can include a capacitive sensor signal measuring integrated circuit that accurately measures the capacitance or capacitive signal and converts it to a digital signal for transmission to a remote device . in accordance with some embodiments of the invention , the capacitive sensor signal measuring integrated circuit can include a zssc3123 integrated circuit ( zmdi , dresden , germany and milpitas , calif .). fig9 a shows a block diagram of the integrated circuit . fig9 b shows a diagram of a charge balancing circuit for converting the analog capacitance signal to a digital signal . the circuit includes a 1st order charge - balancing capacitance - to - digital converter . capacitor cb can be a fixed reference capacitor internal to the ic itself . the measurement determines the amount of time it takes each cycle to charge and discharge the reference capacitor . the capacitor ca is driven by a square wave voltage with excitation frequency in the 100 khz range to prevent aging effects that occur when driven by a dc signal . the output signal generated by this circuit is a ratio of sensor capacitance to reference capacitance . fig1 a shows a sensitivity graph for a capacitive perspiration sensor according to the invention . as shown in fig1 a , the sensitivity is higher ( e . g ., 2 . 5 pf / μl ) at lower moisture levels and decreases ( e . g ., to 1 . 2 pf / μl ) as the level of moisture increases . fig1 b shows a responsivity graph for a capacitive perspiration sensor according to the invention . the graph in fig1 b shows the response of the capacitive perspiration sensor according to the invention over time at 5 different moisture levels ( e . g ., 0 . 1 μl , 0 . 2 μl , 0 . 5 μl , 1 . 0 μl , and 2 . 0 μl ). fig1 c shows the effect of shielding ( e . g ., capacitive coupling the dielectric to the skin ) on a capacitive perspiration sensor according to the invention . as shown in fig1 c , an unshielded capacitive perspiration sensor exhibits signal spikes upon contact whereas the shielded capacitive perspiration sensor according to the invention does not . fig1 d shows a comparison of the range and sensitivity of shielded and unshielded capacitive perspiration sensors according to the invention . as shown in fig1 d , the shielded sensor has approximately the same range and sensitivity as an unshielded sensor . in accordance with some embodiments of the invention , the perspiration sensor can be part of system that quantitatively measures perspiration of a user in real time . the sensor can be connected to a data - logging hub ( e . g . biostamp tm by mc10 inc ., a smartphone or data recorder ). the perspiration sensor can measure a change in capacitance over time and calculate perspiration moisture volume using a predetermined calibrated curve . the data logging hub can include a computer processor and associated memory that can communicate with the perspiration sensor to receive sensor data . the data logging hub can include additional wired or wireless communication components to enable the sensor data to be stored in a remote database or processed by a remote data processing system . while some embodiments of the present invention are described in the context of a perspiration sensor , the invention can be used for measuring moisture in other applications . in some embodiments , the moisture sensor can be used to measure perspiration to test the efficacy of anti - perspirant products . in other applications , the moisture sensor can be installed in a helmet worn by an athlete , a soldier or a fighter pilot as well as other areas of the body to provide continuous physiological monitoring , for example , for health , wellness , hydration and / or stress monitoring . in accordance with some embodiments , the central chamber or an adjacent collection chamber can include analyte sensors and / or assays to detecting the presence and / or quantity of components of the absorbed perspiration . for example , a sodium sensor can be included for diagnosis of cystic fibrosis . other embodiments are within the scope and spirit of the invention . for example , due to the nature of hardware and software , functions described above can be implemented using software , hardware , firmware , hardwiring , or combinations of any of these . features implementing functions may also be physically located at various positions , including being distributed such that portions of functions are implemented at different physical locations . further , while the description above refers to the invention , the description may include more than one invention . | 0 |
a method of manufacturing a semiconductor device according to an embodiment of the invention will be described by taking as an example a semiconductor device having mixed logic circuits and drams . in each drawing of fig1 a to 1 l , the left area shows a cross sectional view of a dram area and the right area shows a cross sectional view of a logic circuit area . as shown in fig1 a , an element separation insulating film 2 of a shallow trench type is formed on the surface of a p - type silicon substrate 1 . a method of forming the element separation insulating film 2 will be briefly described . first , the surface of the silicon substrate 1 is thermally oxidized to form a silicon oxide film having a thickness of about 5 nm . on this silicon oxide film , a 100 nm thick silicon nitride film is formed by low pressure chemical vapor deposition ( lpcvd ). the silicon nitride film is removed which was formed in an area where the element separation insulating film 2 is to be formed . by using the remaining silicon nitride film as a mask , the surface layer of the silicon substrate 1 is etched to form a trench having a depth of about 400 nm . the side wall of the trench is thermally oxidized to form a silicon oxide film having a thickness of 10 nm . a 700 nm thick silicon oxide film is deposited on the substrate whole surface . this silicon oxide film is deposited by high density plasma cvd ( hdp - cvd ) using high density plasma of mixed gas of silane ( sih 4 ) at a flow rate of 150 sccm , oxygen ( o 2 ) at a flow rate of 300 sccm , and helium ( he ) at a flow rate of 325 sccm . the silicon oxide film is subjected to chemical mechanical polishing ( cmp ) to remove the silicon oxide film deposited in an area other than the trench . at this time , the silicon nitride film under the silicon oxide film functions as a stopper . then , the exposed silicon nitride film is removed to expose the surface of the silicon substrate 1 . the element separation films 2 define an active region 3 in the dram area and an active region 4 in the logic circuit area . an n - type well 6 is formed in the surface layer of the silicon substrate 1 in the dram area , and a p - type well 7 is formed in the region corresponding to the active region 3 . the p - type well 7 is located inside the n - type well 6 . an n - type well 5 is formed in the region corresponding to the active region 4 . although not shown in fig1 a , in a region corresponding to a region where an n - channel misfet ( metal / insulator / semiconductor type field effect transistor ) is to be formed , a p - type well is formed . by forming the n - type well 6 in the dram area , the operating potentials of a dram circuit can be set independently from that of a logic circuit . the processes of forming the structure shown in fig1 b will be described . the surfaces of the active regions 3 and 4 are thermally oxidized to form a silicon oxide film having a thickness of 2 . 5 nm . a 100 nm thick polysilicon film , a 100 nm thick tungsten silicide film and a 100 nm thick silicon nitride film are sequentially to deposited in this order over the whole surface of the silicon substrate , 1 . these three films are patterned to leave lamination structures 10 to 13 . the lamination structure is disposed in a partial area of the active region 4 , and the lamination structure 11 is disposed in a partial area of the active region 3 . the lamination structures 12 and 13 are disposed on both sides of the lamination structure 11 , with a space therebetween of , for example , 0 . 22 to 0 . 24 μm . the polysilicon film and tungsten silicide film in the lamination structure 10 constitute the gate electrode of misfet in the logic circuit area . the polysilicon film and tungsten silicide film in the lamination structure 11 constitute the gate electrode of misfet of a dram cell . by using the lamination structures 10 to 13 as a mask , arsenic ( as ) ions are implanted . in the logic circuit area , low concentration regions 15 of the ldd structure are formed on both sides of the lamination structure 10 . in the dram area , source / drain regions 16 are formed on both sides of the lamination structure 11 . in the logic circuit area where an n - channel misfet is to be formed , boron ( b ) ions are implanted . the low concentration region 15 is in contact with the lamination structure 10 as viewed along a direction normal to the substrate . the processes of forming the structure shown in fig1 c will be described . a 20 nm thick silicon nitride film 20 is formed over the whole surface of the silicon substrate 1 . on this silicon nitride film 20 , a 40 nm thick phosphosilicate glass ( psg ) film 21 is formed . this psg film 21 is formed by low pressure cvd using helium as a carrier gas , tetraethylorthosilicate ( teos ), ozone ( o 3 ) and trimethylphosphate ( po ( och 3 ) 3 ) as the source gas . this cvd is executed under the growth conditions of teos at a flow rate of 1000 mg / min , ozone at a flow rate of 5000 sccm , teop at a flow rate of 70 g / min , helium at a flow rate of 6000 sccm , a pressure of 60 kpa ( 450 torr ), and a growth temperature of 480 ° c . under these growth conditions , the phosphorous concentration in the psg film 21 is about 3 wt . %. a resist pattern 22 is formed covering the surface of the psg film 21 in the dram area . the processes of forming the structure shown in fig1 d will be described . by using as a mask the resist pattern 22 shown in fig1 c , the psg film 21 and silicon nitride film 20 in the logic circuit area are anisotropically etched . side spacer 25 is therefore left on the side wall of the lamination structure 20 , the side spacer 25 having a two - layer structure of a silicon nitride film 20 a and a psg film 21 a . after the anisotropic etching , the resist pattern 22 is removed . by using the lamination structure 10 and side wall spacer 25 as a mask , arsenic ions are implanted into the surface layer of the active region 4 . high concentration regions 26 of the source / drain regions are therefore formed . in the logic circuit area where an n - channel misfet is to be formed , boron ions are implanted . in order to activate implanted impurity ions , a heat treatment is performed at 1000 ° c . as shown in fig1 e , the psg film 21 a constituting the side wall spacer 25 and the psg film 21 left in the dram area are removed by hydrofluoric acid ( hf ). for example , etchant to be used is hydrofluoric acid solution of 0 . 25 vol . % containing hydrofluoric acid of 50 % density diluted with water . removing the psg film 21 is executed under the condition that the silicon oxide film formed through thermal oxidization is etched by 12 nm in thickness . under this condition , the psg film having a phosphorous density of 3 wt . % is etched by about 55 nm . the 40 nm thick psg film 21 can therefore be removed completely . in place of the 40 nm thick psg film 21 , an undoped silicon oxide film of 40 nm in thickness may be used which is formed by cvd using ozone ( o 3 ) and tetraethylorthosilicate ( teos ) as the source gas . this silicon oxide film is called an o 3 - teos film . the etching amount of the o 3 - teos film is 40 nm or less when it is etched under the condition that the silicon oxide film formed through thermal oxidization is etched by 12 nm in thickness . it is preferable to perform over - etching of 20 % when variations of film thicknesses and etching amounts are taken into consideration . namely , in order to completely remove the 40 nm thick o 3 - teos film , it is preferable to etch it under the condition that the silicon oxide film formed through thermal oxidization is etched by 14 . 4 nm in thickness . while the psg films 21 and 21 a are etched , the surface of the element separation insulating film 2 is exposed to the etchant . however , because the element separation insulating film 2 is an undoped silicon oxide film formed through pe - cvd using sih 4 and o 2 as the source gas , the etching speed is slower than that of the psg film . it is therefore possible to reduce the etching amount of the surface of the element separation insulating film 2 while the psg films 21 and 21 a are etched . the etching speed of the o 3 - teos film is also faster than that of the element separation insulating film 2 . as a result , the etching amount of the surface of the element separation insulating film 2 can be reduced also when the o 3 - teos film 25 is used in place of the psg film 21 . of the two films constituting the side wall spacer 25 , the silicon nitride film 20 a is left unetched . the silicon nitride film 20 a covers the side wall of the lamination structure 20 and the upper surface of the low concentration regions 15 , conformingly with the underlying layers . since the nitride film is formed as the highest layer of the lamination structure 10 , the upper surface of the lamination structure 10 is not etched while the psg films 21 and 21 a are etched . the highest layer of the lamination structure 10 may be made of undoped silicon oxide having an etching speed slower than psg . as shown in fig1 f , a cobalt silicide ( cosi ) film 30 is formed on the surfaces of the high concentration regions 26 of the source / drain regions . the cosi film 30 is formed by depositing a 10 nm thick cobalt film over the substrate whole surface and thereafter by executing a heat treatment . this heat treatment is executed for about 30 minutes in a nitrogen atmosphere at 500 ° c . as shown in fig1 g , a 25 nm thick silicon nitride film 33 is formed covering the substrate whole surface . this silicon nitride film 33 is formed by cvd using silane , ammonium and nitrogen . the growth temperature is set to 700 ° c . a borophosphosilicate glass ( bpsg ) film 35 having a thickness of 1100 nm is formed on the silicon nitride film 33 , and a reflow process is executed at 700 ° c . the bpsg film 35 is formed by using helium at a flow rate of 6000 sccm as a carrier gas , teos at a flow rate of 600 mg / min , trimethylphosphate at a flow rate of 130 mg / min , trimethylborate ( b ( och 3 ) 3 ) at a flow rate of 160 mg / min , ozone at a flow rate of 4000 sccm as the source gas , under the conditions of a growth pressure of 27 kpa ( 200 torr ) and a growth temperature of 480 ° c . the psg film 21 shown in fig1 d was removed before the bpsg film 35 is formed . the thickness of the psg film 21 is 40 nm , whereas that of the silicon nitride film 33 shown in fig1 g is 25 nm . as compared to the case wherein the psg film 21 is left , the spaces between the lamination structures 11 to 13 in the dram area can be made broader . it is therefore easy to fill the spaces with the bpsg film 35 . in the logic circuit area , as compared to the length of the low concentration region 15 , the side wall spacer 20 a covering the side wall of the lamination structure 10 is thin . the length of the low concentration region 15 is determined from the electric characteristics required for misfet , and a predetermined length is required . the side wall spacer 25 shown in fig1 d is therefore required to have a corresponding thickness . if the psg film 21 a constituting the side wall spacer 25 is left unetched , the lamination structure 10 and another nearby lamination structure are required to be spaced additionally by a thickness of the psg film 21 a , in order to facilitate to fill the bpsg film 35 in the space between the lamination structures . in this embodiment , since the psg film 21 a was removed , a space between the lamination structure and another adjacent lamination structure can be narrowed . as shown in fig1 h , contact holes 36 and 37 are formed through the bpsg film 35 in the areas corresponding to the source / drain regions 16 . at this time , the silicon nitride films 20 and 33 function as the etching stopper . although the silicon nitride films 20 and 33 at the shoulders of the lamination structures 11 to 13 are etched in some cases , the gate electrodes are not exposed in the contact holes because the 100 nm thick silicon nitride film is disposed as the highest layer of each lamination structure . in this manner , the contact holes 36 and 37 can be formed in a self - alignment manner . as shown in fig1 i , the silicon nitride films 20 and 33 exposed on the bottoms of the contact holes 36 and 37 are anisotropically etched and removed . the silicon nitride films 20 and 33 on the side walls of the contact holes 36 and 37 are left unetched . the contact holes 36 and 37 are filled with polysilicon plugs 40 and 41 doped with impurities and imparted with conductivity . the polysilicon plugs 40 and 41 are formed by depositing a polysilicon film over the substrate whole surface and then planarizing the polysilicon film on the flat surface by cmp . at this stage , the psg film 21 formed on the side wall of the lamination structures 11 to 13 shown in fig1 d was already removed . in place of the psg film 21 , the silicon nitride film 33 thinner than the psg film 21 was formed . as a result , the contact areas between the plugs 36 and 37 and the source / drain regions 16 can be broadened . in the logic circuit area , the side wall spacer 20 a covers the side wall of the lamination structure 10 and extends to cover the upper surface of the low concentration region of the source / drain regions . in contrast , the dram area , although the side wall spacer constituted to two layers , silicon nitride films 20 and 33 , covers the side wall of the lamination structures 11 to 13 , it does not cover the upper surfaces of the source / drain regions . as shown in fig1 j , a 100 nm thick silicon oxide film 45 is formed on the bpsg film 35 . this silicon oxide film 45 is formed by using a diode parallel plate plasma cvd system . an opening 46 is formed through the silicon oxide film 45 in an area corresponding to the polysilicon plug 40 . a bit line 47 is formed on the silicon oxide film 45 . the bit line 47 has a three - layer structure of a ti layer , a tin layer and a w layer sequentially stacked in this order . the bit line 47 fills the opening 46 and is electrically connected to the polysilicon plug 40 . another silicon oxide film 48 having a thickness of 500 nm is formed on the silicon oxide film 45 , covering the bit line 47 . the silicon oxide film 48 is formed by plasma cvd using high density plasma such as inductive coupled plasma . as shown in fig1 k , a contact hole is formed through the silicon oxide films 48 and 45 in an area corresponding to the polysilicon plug 41 . this contact hole is filled with a plug 50 made of amorphous silicon doped with impurities and imparted with conductivity . a capacitor 55 is formed on the silicon oxide film 48 in an area corresponding to the plug 50 . the capacitor 55 is constituted of a storage electrode 51 , a dielectric film 52 and a cell plate 53 . the storage electrode 51 is made of amorphous silicon imparted with conductivity and has a tubular shape with a closed bottom and an opened top . the storage electrode 51 is electrically connected at its bottom to the plug 50 . the dielectric film 52 is made of a silicon oxynitride film . the silicon oxynitride film is formed by thermally oxidizing a silicon nitride film . the cell plate 53 is made of amorphous silicon imparted with conductivity . such a capacitor can be formed by the method illustrated in fig7 of jp - a - 11 - 195618 . another silicon oxide film 58 having a thickness of 1 . 5 μm is formed on the silicon oxide film 48 , covering the capacitor 55 . the silicon oxide film 58 is formed by plasma cvd using high density plasma . as shown in fig1 l , a contact hole 60 is formed starting from the upper surface of the silicon oxide film 58 and reaching the upper surface of the cobalt silicide film 30 . the bottom of the contact hole 60 is located to ride over the boundary between the cobalt silicide film 30 and element separation insulating film 2 . while the contact hole 60 is formed , the silicon nitride film 33 covering the upper surface of the cobalt silicide film 30 functions as the etching stopper . the silicon nitride film 33 exposed on the bottom of the contact hole 60 is etched by hydrofluoric acid or the like . a barrier metal layer 61 is formed on the inner surface of the contact hole 60 and on the upper surface of the silicon oxide film 58 , the barrier metal layer 61 having a two - layer structure of a ti layer and a tin layer . a w layer 62 is formed on the barrier metal layer 61 , filling the contact hole 60 . the w layer 62 and barrier metal layer 61 are subjected to cmp to leave a conductive plug 63 in the contact hole 60 . a conduction wire 65 is formed on the silicon oxide film 58 , and a multi - layer wiring structure is formed over the substrate whole surface , covering the conduction wire 65 . in this embodiment , as described with fig1 e , the etching amount of the surface of the element isolation insulating film 2 can be reduced while the psg films 21 and 21 a shown in fig1 d are etched . if the upper surface of the element isolation insulating film 2 is etched , a large step is formed between the cobalt silicide film 30 and element isolation insulating film 2 shown in fig1 l . a large step is known to degrade the channel stopper function of the silicon nitride film 33 . the contact hole 60 may therefore reach the n - type well 5 to make the conductive plug 63 directly contact the n - type well 5 . since the etching amount of the upper surface of the element isolation insulating film 2 is reduced in the process shown in fig1 e , it is possible to prevent direct contact between the conductive plug 63 and n - type well 5 . in this embodiment , the outer layer of the side wall spacer 25 shown in fig1 d is made of the psg film 21 a having a phosphorous density of 3 wt . %. other materials having a faster etching speed than an undoped silicon oxide film may be used for the outer layer . for example , it may be made of borosilicate glass ( bsg ) or bpsg . if psg is used , it is preferable to set the phosphorous density to 3 wt . % or higher in order to have a sufficiently large etching speed difference between the psg film and undoped silicon oxide film . however , if the psg film is sufficiently thin and the etching time is short , the phosphorous density may be set to 3 wt . % or smaller . in this embodiment , as described with fig1 d , the length of the low concentration region 15 of misfet having the ldd structure is defined by the total thickness of the silicon nitride film 20 a and psg film 21 a . by adjusting the thickness of the psg film 21 a , the low concentration region 15 can be set to a desired length . in the dram area , as described with fig1 g , the psg film 21 is not left in the spaces between the lamination structures 11 to 13 . the integration degree of drams can therefore be improved without being restricted by the length of the low concentration region of misfet in the logic circuit area . the present invention has been described in connection with the preferred embodiments . the invention is not limited only to the above embodiments . it is apparent that various modifications , improvements , combinations , and the like can be made by those skilled in the art . | 7 |
in one embodiment , shown in fig1 , a male incontinence device 10 includes a body 11 and a first liquid - permeable liner 24 . the device 10 has a top 13 which , when worn , points generally toward the navel of the wearer , and a bottom 15 which , when worn , points generally toward the perineum of the wearer . the device 10 further has an external side 17 which , when worn , faces away from the wearer , and an interior side 19 which , when worn , faces the wearer and , particularly , the genitalia 38 of the wearer . see , fig5 . the body 11 forms a cavity 36 ( see , also , fig2 , 3 , 5 , and 7 ) adapted to hold human male genitalia 38 and includes a shell 14 and may further include a crest 26 at the top 13 and may further include a tongue 28 at the bottom 15 . note that the neither the crest 26 nor the tongue 28 are shown in fig5 and 7 . especially when the shell 14 is comprised of flexible , semi - rigid material as described below , the device 10 is easily moved to the side while being worn to facilitate normal male urination . the device 10 also includes at least one moisture barrier 12 , 16 adapted to prevent moisture , and specifically urine , from wetting the clothes of the wearer . as best seen in fig2 , 3 , and 7 , but also in fig5 , the first liquid - permeable liner 24 cooperates with the body 11 , and particularly the shell 14 to create a gap d g and a chamber 32 . this effect is aided by securing the first liquid - permeable liner 24 , having an area sufficient to prevent its total collapse into the body 11 . thus , the first liquid - permeable liner 24 is sufficiently suspended to create the gap d g and the chamber 32 and acts to hold the male genitalia 38 separated from discharged urine stored in one or more absorbent 18 , 20 . in this configuration , the first liquid - permeable liner 24 also provides needed support to the male genitalia 38 . the gap d g and the chamber 32 also create an opportunity for air to circulate about the genitals 38 for a further drying effect . while the first liquid - permeable liner 24 may be secured about the periphery 34 of the body 11 , the first liquid - permeable liner 24 may also be secured inboard of the periphery 34 . as shown in fig2 and 3 , the device 10 forms a length external angle α and , as shown in fig8 , a width internal angle θ . the length external angle α is that angle formed by the intersection of extending a tangent from the top 13 of the device 10 and from the bottom 15 of the device 10 . the width internal angle θ is that angle formed between an apex 40 of the external side 17 of the device 10 and edges 42 at the widest point w d of the device 10 . the length external angle α cooperates with the width external angle θ to accommodate human male genitalia 38 ( fig5 ) and to minimize the characteristic visible “ bulge ” indicative of men wearing an incontinence device . the length external angle α is between about 70 deg . and about 100 deg . the width internal angle θ is between about 85 deg . and about 105 deg . proportionally , the width internal angle θ is between about 85 percent and 150 percent of the length external angle α . as shown in fig2 and 3 , the crest 26 extends from the shell 14 and generally comprises soft , flexible material . the crest 26 forms a comfortable seal at the abdomen of the wearer and can provide additional absorbent protection . also shown in fig2 and 3 , the tongue 28 extends from the shell 14 and also generally comprises soft , flexible material . the tongue 28 forms a comfortable seal beneath the scrotum and in the perineum . additionally , the tongue 28 may provide further absorbent protection . the tongue 28 forms an angle β of between about 30 deg . and 50 deg . both the crest 26 and the tongue 28 provide a comfortable transition from the device 10 to the human body . in an embodiment , the periphery 34 of the device 10 comprises soft , flexible material for comfort and to help seal the device 10 against the body of the wearer . as shown in fig2 - 4 and in table 1 , below , the device 10 has an overall length l d , a width at the widest part w d , a depth at the apex 40 of d a , a tongue length l t , and a crest length l c . proportionally , the width w d is between about 50 percent and about 55 percent of the overall length l d . as will be appreciated by those skilled in the relevant art , the indicated sizes are exemplary only , and smaller , larger , and other intermediate sizes are possible without departing from the spirit of the invention . table 1 , below , lists representative dimensions for four different sized devices 10 . all dimensions are in centimeters ( cm ). thus , as table 1 above shows , the width at the widest point w d is between about 9 cm and 10 cm , the ratio of the width w d to overall length l d ( w d / l d ) is between about 45 percent and about 65 percent , the depth of the device at the apex 40 d a is between about 5 cm and about 6 cm , and the ratio of the depth of the device at the apex 40 d a to a long axis l d is between about 25 percent and about 40 percent . in one embodiment , the shell 14 is flexible and semi - rigid and may be molded from a sheet or batt of fibers by placing the fiber sheet of batt between dies and , with the application of heat and pressure , molded into the desired shape . the shell 14 may also be resilient and attempt to return to its original shape when distorting forces are removed . conventional examples include materials used to make particle masks so manufactured using natural fibers , such as wool and cotton , and synthetic materials , such as nylon , acrylonitrile , polyethylene , polyester , or polypropylene fibers . these fibers are often mixed with chemical resins , such as polyolefinic resins the nominal thickness of the shell 14 is about 2 mm . as will be appreciated by those skilled in the relevant art , various foams and other plastics may also be employed in making the shell 14 . the shell 14 is flexible with the pressures due to normal activities while being worn . at the same time , the shell 14 is resistant to flattening out against the genitalia 38 . the latter may be aided in part , for example , by molding into the shell 14 , elongated ridges to improve shape retention as may be seen in conventional dust masks . an exemplary shell 14 that has been used successfully uses the material of the 8000 series n95 particle mask from 3m , st . paul , minn . other , non - limiting , examples include those found in u . s . pat . nos . 4 , 384 , 577 to huber et al . and 3 , 220 , 409 to liloia et al . in a further embodiment , the shell 14 comprises rigid material , plastic , for example . in such an embodiment , the shell 14 can provide further strength to help keep the body 11 from collapsing around the genitalia 38 , in the case of penile , testicular , or scrotal surgery , for example . the first liquid - permeable liner 24 is in contact with the genitalia 38 and serves to allow discharged urine to pass through freely and to keep the genitalia separated from the discharged urine . preferably , the first liquid - permeable liner 24 is compliant , soft to the touch , and nonirritating . in addition , the first liquid - permeable liner 24 is non - absorbent and preferably formed from rapidly drying material which wicks away moisture quickly . typically , the liner 24 is a netting material , woven or non - woven , comprised of , for example , polyester , nylon , polypropylene , rayon , or cotton . other materials include apertured hydrophobic formed film . exemplary , but non - limiting , formed films include those described in u . s . pat . nos . 4 , 324 , 246 to mullane et al . and 4 , 342 , 314 to radel et al . other , non - limiting , liner materials include that described in u . s . pat . no . 5 , 705 , 249 to takai et al . a first absorbent 18 provides collection and storage of discharged urine and is formed of material adapted to absorb and retain human urine . successful materials include processed wood pulp and super - absorbent polymers found in conventional disposable diapers and feminine hygiene products , such as polyacrylate / polyacrylamide copolymers , ethylene maleic anhydride copolymer , cross - lined carboxy - methyl - cellulose , polyvinyl alcohol copolymers , cross - linked polyethylene oxide , and starch grafted copolymer of polyacrylonitrile . turning now to fig2 and 4 , a second absorbent 20 may be included to provide additional absorbent capacity . as shown in fig4 , the second absorbent may be limited to a central portion of the device 10 where the majority of the discharged urine would collect . accordingly , the second absorbent 20 may provide a higher absorbent density so that additional urine can be effectively absorbed and stored . exemplary absorbent materials that have been used successfully include those of always ® ultra thin ™ pads ( procter & amp ; gamble , cincinnati , ohio ). see , for example , u . s . pat . nos . 4 , 950 , 264 to osborn , iii ; 5 , 520 , 875 to wnuk et al . ; and 6 , 601 , 705 to molina et al . for other , non - limiting , absorbent materials , see , also , u . s . pat . nos . 5 , 075 , 344 to johnson ; 3 , 926 , 891 to gross et al . ; and 4 , 293 , 609 to erickson . in a further embodiment , a second liquid - permeable liner 22 may be provided adjacent the absorbent 18 , 20 . the second liquid - permeable liner 22 may comprise any suitable material for enclosing the absorbent 18 , 20 . exemplary materials include apertured hydrophobic formed films discussed above as well as woven and non - woven materials . turning again to fig2 , 3 , and 7 , in a further embodiment , a first moisture barrier 12 is provided on the external side 17 of the device 10 . a sheet of thin plastic of the type commonly found in conventional incontinence devices and feminine pads have been used successfully . in a further embodiment , shown in fig2 and 3 , a second moisture barrier 16 is provided adjacent to the absorbent 18 . as with the first moisture barrier 12 , the second moisture barrier 16 of the type of thin plastic sheet commonly used in conventional incontinence devices and feminine pads have been used successfully . turning now to fig3 , an embodiment of a male urinary incontinence device 10 is shown which includes a shell 14 , a moisture barrier 16 , an absorbent 18 , and a second liquid - permeable liner 22 . the embodiment shown in fig3 does not include a moisture barrier 12 on the external side of the device 10 and includes just one absorbent 18 . the first liquid - permeable liner 24 provides support for the genitalia 38 and helps separate the genitalia 38 from urine stored in the absorbent 18 . the shell 14 provides shape for the body 11 and helps to prevent the device 10 from collapsing around the genitalia 38 . finally , the moisture barrier 16 , placed between the absorbent 18 and the clothing of the wearer to help protect the clothing from becoming soiled . turning now to fig6 and 7 , an embodiment of a male urinary incontinence device 10 is shown which includes neither a crest 26 nor a tongue 28 . in a series of tests , a size small device 10 was used and held in a position similar to that which it would be in when worn and water streamed from a syringe - type delivery apparatus with a slit to mimic the action of urine being excreted from a male penis . in two tests , the absorbent from an always ® regular feminine hygiene pad absorbed 70 ml before reaching saturation . in one test , the absorbent from an always ® overnight feminine hygiene pad absorbed 120 ml before reaching saturation . while certain preferred embodiments of the present invention have been disclosed in detail , it is to be understood that various modifications may be adopted without departing from the spirit of the invention of scope of the following claims . | 0 |
the preferred embodiments of the present invention are explained below with reference to the drawings . however , the scope of the present invention is not limited by the following embodiment examples and extends to the inventions appearing in the claims and to items equivalent thereto . [ 0038 ] fig2 is a diagram of the configuration of the dma control system relating to the present embodiment . the microprocessor 10 includes a cpu core , not shown , a direct memory access controller ( dmac ) 16 , sdram interface 14 , and i / o interface 18 . the sdram interface 14 controls the sdram 24 which is an external synchronous memory . also , the i / o interface 18 controls the i / o memory 28 included in the control circuit , or the like , of an external device , not shown . the sdram 24 and i / o memory 28 are connected via an external universal bus 22 . the i / o sequencer 180 in the i / o interface 18 asserts the i / o read command ( or i / o read signal )/ iord to the i / o memory 28 and reads the stored data to the universal bus 22 ; and asserts the i / o write command ( i / o write signal ) / iowr to the i / o memory 28 and writes the data on the universal bus 22 . the i / o memory 28 receives the requested data from the external device and stores the data in the i / o memory , and asserts the ready signal ready 0 at the stage of output to the universal bus 22 . in response thereto , the i / o sequencer 180 negates the i / o read command / iord . furthermore , at the stage where requested data can be fetched from the universal bus 22 , the i / o memory 28 asserts the ready signal ready 0 and in response thereto , the i / o sequencer 180 negates the i / o write command / iowr . also , when the access cycle of the external device is fixed , the i / o sequencer 180 sets that access cycle in advance in the i / o register 182 . when accessing the i / o memory 28 , the i / o sequencer sets the set value s 2 of the register 182 to the i / o counter 184 using the signal s 1 and negates the i / o read command / iord or the i / o write command / iowr in response to the count end signal s 3 . however , in the case where the flyby transfer command flybyi is put out from the dmac 16 , if the i / o sequencer 180 receives the ready signal ready 0 from the i / o memory 28 without receiving the second ready signal ready 2 from the sdram interface 14 , the i / o sequencer 180 maintains the assertion state without negating the i / o read command / iord or the i / o write command / iowr until receiving the second ready signal ready 2 . when the second ready signal ready 2 has already been received , the i / o sequencer 180 negates the i / o read command / iord or the i / o write command / iowr as usual in response to the reception of the ready signal ready 0 or the count end signal s 3 . [ 0042 ] fig3 is a flowchart for the operations of the i / o sequencer . upon receiving the i / o access request from the dmac 16 ( s 20 ), the i / o sequencer 180 asserts the i / o read or i / o write command / iord , / iowr and waits for the end of the countdown , or waits to receive the ready signal ready 0 from the i / o memory 28 ( s 21 , s 22 ). once the waiting state has ended , in the case of a flyby transfer command ( s 23 ), if the i / o sequencer receives the second ready signal ready 2 indicating that sdram setup is complete ( s 24 ), the sequencer immediately negates the i / o read or i / o write command / iord , / iowr ( s 26 ). if the i / o sequencer has not received the second ready signal ready 2 , the i / o sequencer maintains the command assertion state until that signal is received ( s 25 ). in response to receiving the second ready signal , the i / o sequencer negates the i / o read or i / o write command / iord , / iowr ( s 26 ). when there is a request to access the sdram , the sequencer 140 in the sdram interface 14 supplies commands cmd , comprising a combination of / ras , / cas , / ce , and / we , to the sdram 24 and performs a read operation or write operation . in the case of sdram , the read operation and the write operation in an access operation are carried out with a combination of the following : “ active ” for activating a word line , “ read ” for reading data from a memory cell , “ write ” for writing data to a memory cell , and “ precharge ” for resetting a bit line . consequently , the commands cmd include an active command , read command , write command , precharge command , and so forth . the sdram sequencer 140 supplies those commands in order and carries out the read operation and write operation . also , the sequencer 140 supplies the clock enable cke , for enabling and disabling the supply of the clock clk into the sdram , to the sdram 24 . the sdram sequencer 140 controls the operation cycles of each command and supplies the abovementioned commands cmd in a predetermined order . for that reason , the number of operation cycles of each command is set in the register 142 and the operation cycle data s 12 corresponding to a command is loaded to a counter 144 in response to an instruction signal s 11 . when the counter 144 ends the countdown , the count end signal s 13 is supplied to the sequencer 140 . in the case of a read operation , the sdram 24 outputs the read data for a period of one clock cycle following cas latency once the read command has been supplied . cas latency is preset in the register 142 and the number of clock cycles from the read command until data output is fixed . however , when the clock enable cke is negated , the internal operation of the synchronous memory can be stopped for the negation period without the clock being supplied therein . consequently , the sdram sequencer 140 can extend the time of the read data output effective state by appropriately negating the clock enable cke . the sdram sequencer 140 therefore negates the clock enable cke from before one clock cycle when read data is output , and in response to the first ready signal ready 1 that is output when the i / o memory 28 completes input setup , asserts the clock enable cke . accordingly , during flyby transfer , the sdram sequencer 140 can output read data from the sdram 24 to the universal bus 22 at the timing corresponding to the i / o memory 28 operation speed . furthermore , in the write operation , the sdram 24 inputs the write data in the same clock cycle as the write command . consequently , at the time of flyby transfer , the sdram sequencer 140 issues the write command in response to the first ready signal ready 1 , and can thereby match the fetch timing of the write data with the operation of the i / o memory 28 . [ 0048 ] fig4 is a flowchart for the sdram sequencer . when sdram access is issued ( s 30 ), thesdramsequencerl 40 issues a precharge command pre and an active command actv depending on the state of the sdram 24 , and then issues the write command or read command . if the sdram 24 makes a page miss in the bank active state , it is necessary to perform reading or writing after the precharge pre and active actv . also , if the sdram 24 makes a page miss in the bank inactive state , it is necessary to perform reading or writing after the active actv . in the case where precharging is necessary ( s 32 ), the sdram sequencer 140 issues the precharge command pre and after waiting for the precharge clock cycle trp ( ras precharge ) ( s 34 ), issues the active command actv . also , the sdram sequencer 140 issues the active command actv in the case where active is necessary ( s 36 ) or after the precharge , and waits for the active clock cycle trcd ( s 38 ). each clock cycle wait operation is performed by loading the set values in the register 142 to the counter 144 and initiating countdown . in the case where the access request is a read operation , the sdram sequencer 140 issues the read command read . in response thereto , the sdram 24 outputs the read data after the cas latency cl clock cycle . however , in the case of flyby transfer ( s 44 ), the sdram sequencer 140 negates the clock enable cke from one clock before the cas latency cl clock cycle ends and waits until the i / o memory 28 setup ends ( s 46 , s 48 ). upon receiving the first ready signal ready 1 from the i / o sequencer 180 ( s 48 ), the sdram sequencer asserts the clock enable cke in response thereto ( s 50 ), renews clock supply , and causes output of the read data to the universal bus 22 ( s 52 ). in the case where the access request is a write operation , the sdram sequencer 140 issues a write command writ and causes the sdram 24 to fetch the write data in the universal bus 22 ( s 60 ). however , in the case of flyby transfer ( s 54 ), the sequencer waits until i / o memory 28 setup ends ( s 56 , s 58 ), and then issues the write command writ . next , the flyby transfer operation is explained for the cases where i / o memory is slower than sdram and where i / o memory is faster than sdram . flyby transfer includes transfer from sdram to i / o memory and from i / o memory to sdram . [ 0054 ] fig5 is a timing chart for a conventional operation for transfer from sdram to i / o memory . because flyby transfer could not be performed conventionally as discussed above , the dmac 16 initially causes the sdram interface 14 to perform sdram read , temporarily stores the read data in an internal buffer , and then causes the i / o interface 18 to perform i / o write . the sdram sequencer 140 issues a read command read , the sdram 24 fetches same at clock cycle c 2 and outputs read data d at clock cycle c 3 after cas latency cl = 1 . as a result , the read data is stored in an internal buffer . next , the i / o sequencer 180 asserts the i / o write signal / iowr from clock cycle c 4 and outputs a write command to the i / o memory 28 . in response thereto , the i / o memory 28 asserts the ready signal ready 0 at clock cycle c 6 , when the write setup is complete , whereupon i / o sequencer 180 detects this at clock cycle c 7 and negates the i / o write signal / iowr . in order to fetch data , the i / o memory 28 requires the write data d and address a during the i / o hold period of one clock cycle from the i / o write negation . [ 0055 ] fig6 is a timing chart of flyby transfer from sdram to i / o memory relating to the present embodiment . in this example , cas latency cl is 1 and the sdram can operate from the read command . initially , the dmac 16 issues the flyby signals flybyi , flybys to the i / o interface 18 and sdram interface 14 respectively . these flyby signals also include the direction of flyby transfer . in response thereto , the sdram sequencer 140 issues the read command read to the sdram 24 , and the i / o sequencer 180 asserts the i / o write signal / iowr to i / o memory at clock cycle c 1 . since the cas latency cl = 1 in the example in fig6 the sdram sequencer 140 negates the clock enable cke at clock cycle c 1 and exercises control so as to extend the read data output state . shortly afterwards , when the i / o memory 28 setup is complete at clock cycle c 3 and the i / o sequencer 180 asserts the first ready signal ready 1 , the sdram sequencer 140 asserts the clock enable cke in response thereto . as a result , the sdram 24 maintains read data output during the one clock cycle from the rising edge of clock cycle c 4 . consequently , the i / o hold period is established automatically and the i / o memory 28 can fetch the write data correctly . compared to fig5 flyby transfer in fig6 is completed in three clock cycles shorter than fig5 . moreover , by using the clock enable cke to extend the effective state of read data output for the sdram 24 , a data hold is effected for one clock cycle automatically when the clock enable cke is asserted in response to the negation of the i / o write signal / iowr . moreover , the i / o memory 28 having lower - speed operation requires the data hold period after the negation of the i / o write signal / iowr . in the case of i / o memory 28 having higher - speed operation , this data hold period is not necessary . consequently , the i / o interface 18 contains a register of whether data hold is necessary or not and notifies the sdram interface 14 via the dmac . [ 0060 ] fig7 is a timing chart of a conventional transfer operation from sdram to i / o memory in the case of slow sdram . the order of operations is the same as in the example in fig5 but in the example in fig7 the operation of the i / o memory is complete in two clock cycles while the cas latency cl of the sdram is long , 3 . otherwise , the operations are the same as in fig5 and a detailed explanation of the operations is omitted . [ 0061 ] fig8 is a timing chart of flyby transfer from sdram to i / o memory relating to the present embodiment . in this example , because the read operation of the sdram 24 is long , read data is output for a period of only two clock cycles without extending the read data output as in fig6 . initially , the sdram sequencer 140 issues a read command read at clock cycle c 1 in response to a flyby request and the i / o sequencer 180 asserts the i / o write signal / iowr . at clock cycle c 3 , when the write setup for the i / o memory 28 is complete , the i / o sequencer 180 asserts the first ready signal ready 1 . thereafter , at clock cycle c 4 corresponding to cas latency cl = 3 , the sdram sequencer 140 asserts the second ready signal ready 2 to indicate that the read data setup for the sdram 24 is complete , whereupon the i / o sequencer 180 negates the i / o write signal / iowr at clock cycle c 5 and causes the i / o memory 28 to write data during the i / o hold period . corresponding to cas latency cl = 3 , at clock cycle c 3 that is one clock before read data output the sdram sequencer 140 negates the clock enable cke , but because the first ready signal ready 1 is already asserted , the sequencer 140 asserts the clock enable cke at clock cycle c 4 and effectively outputs the read data d for a period of two clock cycles . in the example in fig6 the sdram sequencer 140 maintains the output of read data for a period of three clock cycles because the i / o memory setup is long , but in the example in fig8 this becomes a period of two clock cycles because the i / o memory setup is short . in the case of fig8 flyby transfer is complete in a smaller number of clock cycles than in the example in fig7 . [ 0065 ] fig9 is a timing chart of a conventional transfer operation from i / o memory to sdram . the dmac 16 sends an i / o read request to the i / o interface 18 , and the i / o sequencer 180 reads data from the i / o memory 28 and temporarily stores same in an internal buffer . next , dmac 16 sends an sdram write operation request to the sdram interface 14 and the sdram sequencer 140 issues an active command actv and write command writ to the sdram 24 and controls the writing of data . in the example in fig9 since the active operation requires two clock cycles , the write command writ is issued at c 7 , two clock cycles after the issuing of the active command actv . [ 0066 ] fig1 is a timing chart of flyby transfer from i / o memory to sdram relating to the present embodiment . the dmac 16 issues the flyby signals flybyi , flybys and sends a flyby transfer request to both interfaces 18 , 14 . at clock cycle c 1 , the i / o sequencer 180 asserts the i / o read signal / iord and requests a read operation of the i / o memory 28 . also , the sdram sequencer 140 starts the write operation transaction from the same cycle c 1 . in the example in fig1 , the active command actv is issued and then the write command writ is issued . when the read data output setup is complete , the i / o memory 28 asserts the ready signal ready 0 at clock cycle c 2 ( not shown ) and the i / o sequencer 180 asserts the first ready signal ready 1 at clock cycle c 3 . in response to this assertion , the sdram sequencer 140 issues the write command writ and the sdram 24 fetches the read data d on the universal bus and writes to a memory cell at clock cycle c 4 . in the case where the sdram 24 does not require the active operation actv , the sdram sequencer 140 can issue the write command writ without issuing the active command actv at clock cycle c 1 . even in that case , however , the first ready signal ready 1 , that indicates that i / o memory 28 setup is complete , is not asserted , and therefore the write command writ is not issued ; the issuing of the write command is waited until clock cycle c 3 . in this case also , the flyby transfer operation is completed in fewer clock cycles than in the example in fig9 . [ 0071 ] fig1 is a timing chart of a conventional transfer operation from i / o memory to sdram . with the same operations as in fig9 the sdram 24 writes data after reading same from the i / o memory 28 . in the example in fig1 , however , the io read operation of the i / o memory takes two clock cycles and is shorter compared with that of fig9 . [ 0072 ] fig1 is a timing chart of flyby transfer from i / o memory to sdram relating to the present embodiment . in this example , the read operation in i / o memory 28 is complete in one clock cycle and the first ready signal ready 1 is already asserted at clock cycle c 2 . consequently , the sdram sequencer 140 issues the active command actv and write command writ in order and asserts the second ready signal ready 2 at the same time as issuing the write command . as a result , data is written to the sdram 24 at clock cycle c 4 and the i / o sequencer 180 negates the i / o read signal / iord thereafter . since the operation of the sdram is slow in this example , the period during which the i / o memory 28 outputs read data is three clock cycles , longer than the two clock cycles in the case of fig1 . [ 0074 ] fig1 is a timing chart of burst transfer using flyby transfer from sdram to i / o memory relating to the present embodiment . this example is an operation with a burst length of 4 , in the case where the cas latency cl of the sdram 24 is short , 2 , and the i / o memory 28 is slow and requires an i / o hold period of one clock cycle after the negation of the i / o write command / iowr . also , the i / o sequencer 180 and sdram sequencer 140 indicate that setup is complete in each case by transmitting the first and second ready signals . moreover , burst transfer includes a flyby request signal , for example , and a request for burst transfer is sent to each interface from the dmac . in response to a flyby transfer request , not shown , the sdram sequencer 140 issues a read command read at clock cycle c 1 and the i / o sequencer 180 asserts the i / o write signal / iowr . since the cas latency is cl = 2 , the sdram sequencer 140 asserts the second ready signal ready 2 at clock cycle c 3 to indicate that the read data setup is prepared . also , the sdram sequencer 140 negates the clock enable cke at clock cycle c 2 , which is one clock cycle before data output , and waits to receive the first ready signal ready 1 . when the i / o memory write setup is prepared at clock cycle c 4 , the ready signal ready 0 is asserted and at the same time the i / o sequencer 180 asserts the first ready signal ready 1 . in response thereto , the sdram sequencer 140 asserts the clock enable cke and performs the next read data output control . also , the i / o sequencer 180 negates the i / o write signal / iowr at clock cycle c 5 . in burst mode also , the sdram sequencer must maintain read data output until the first ready signal ready 1 , which indicates that i / o memory setup is prepared , is asserted . consequently , the sdram sequencer 140 immediately negates the clock enable cke at clock cycle c 5 and waits for the first ready signal ready 1 . once the i / o hold period ends at clock cycle c 5 is complete , the i / o sequencer 180 asserts the i / o write signal / iowr at clock cycle c 6 in order to write the next data . because the sdram 24 already has the output setup prepared for burst mode for the second read data output , the second ready signal ready 2 remains asserted . once the setup for the i / o memory 28 is prepared , the i / o sequencer 180 asserts the first ready signal ready 1 at clock cycle c 7 . in response thereto , the sdram sequencer 140 also asserts the clock enable cke and carries out the next read data output control . the third and fourth data flyby transfers are the same as the abovementioned second data flyby transfer . in effect , at clock cycle c 3 , two clock cycles corresponding to cas latency cl = 2 after issuing the read command read , the sdram sequencer 140 asserts the second ready signal ready 2 and then maintains that asserted state . the sdram sequencer 140 negates the clock enable cke at each time to maintain read data output , and then waits for the first ready signal ready 1 from the i / o sequencer 180 to assert the clock enable cke , so that the sdram sequencer performs control of the next read data output . therefore , the sdram sequencer 140 can even handle flyby transfer in burst mode by using the clock enable cke . [ 0080 ] fig1 is a timing chart for burst transfer using flyby transfer from the i / o memory to sdram relating to the present embodiment . this example concerns the case of burst transfer of three data . in response to a request for flyby transfer , not shown , the sdram sequencer 140 issues the active command actv at clock cycle c 1 for a write operation , asserts the second ready signal ready 2 indicating the completion of write setup at clock cycle c 3 , and waits for the first ready signal ready 1 . however , in the example in fig1 , the read output setup of the i / o memory 28 is completed at the same time and the first ready signal ready 1 is asserted at clock cycle c 3 . in response thereto , the sdram sequencer 140 issues the write command writ . at the same time that the write command is issued , the read data on the universal bus are written to the sdram 24 at c 4 . consequently , in the case where the sdram 24 does not require the active operation , the second ready signal ready 2 is asserted sooner than in fig1 . however , in this case also , the issuing of the write command writ is not performed until the first ready signal ready 1 is asserted . when the write operation for the initial data is performed , the i / o sequencer 180 asserts the i / o read signal / iord once more , at clock cycle c 5 , to output the next data . at this time , because the sdram 24 is in a writable state , the second ready signal ready 2 remains asserted . once the setup for the next data output is prepared in the i / o memory 28 , the first ready signal ready 1 is asserted at clock cycle c 7 , the sdram sequencer 140 issues the write command writ , and causes a write operation to the sdram 24 . the operations for the next data are the same as the flyby transfer for the second data . in this way , with burst transfer in flyby transfer from i / o memory to sdram , subsequent writing of data can be performed promptly with the issuing of a write command once the initial write setup is prepared for the sdram 24 . consequently , the sdram sequencer 140 may simply continue to wait for the first ready signal ready 1 and then issue the write command writ . in effect , this is burst transfer , but the sdram sequencer 140 only repeats single write control , rather than burst write control , for the burst length . [ 0086 ] fig1 is a diagram of the configuration of a modified example of the dma control system relating to the present embodiment . the same reference numbers are used for portions that are the same as in fig2 . the configuration differs from fig2 as follows : the count value iocount of the i / o counter 184 in the i / o interface 18 is supplied to the sdram sequencer 140 side instead of receiving a first ready signal , the sdram sequencer 140 monitors the i / o count value iocount and detects whether i / o memory setup is prepared . likewise , instead of receiving the second ready signal ready 2 from the sdram sequencer 140 , the i / o sequencer 180 receives the count value sdcount until the read or write operation setup is prepared . the sdram sequencer 140 counts down the counter 144 to manage the number of clock cycles necessary for each type of operation of the sdram 24 . the sdram sequencer 140 converts from that count value s 13 to the number of clock cycles sdcount until the read or write setup is prepared and thus supplies sdcount to the i / o sequencer 180 . consequently , in the dma control system in fig1 , the completion of the sdram setup is determined according to the sdram count value sdcount in the course of the process s 24 in the flowchart of the i / o sequencer operations shown in fig3 . furthermore , the completion of the i / o memory setup is determined according to the i / o count value iocount in the course of the processes s 48 , s 58 in the flowchart of the sdram sequencer operations shown in fig4 . [ 0088 ] fig1 is a timing chart of the burst transfer operation with flyby transfer from sdram to i / o memory according to the system in the abovementioned modified example . in this example , cas latency cl is 3 and the i / o memory engages in high - speed operations that do not require the i / o hold . as shown , the i / o count value iocount and sdram count value sdcount are monitored instead of the first and second ready signals . as in fig1 , the output of the read data d in the sdram 24 is held by the negation of the clock enable cke ; the clock enable cke is asserted by predicting the cycle at which the write operation is completed in the i / o memory according to the change in the i / o count value so that the next read data is output . in response to a flyby transfer request , not shown , the sdram sequencer 140 issues the read command read at clock cycle c 1 and supplies to the i / o sequencer 180 , the number of clock cycles “ 3 ”, showing cycles until read data is output , as the sdram count value s 144 . when it is necessary for the , sdram 24 to execute from active operation , this sdram count value sdcount becomes a value that is equal to the cas latency added to the clock cycle for active operation . also , the i / o sequencer 180 supplies to the sdram sequencer 140 the number of clock cycles “ 1 ” showing cycles until the write operation setup is prepared , as the i / o count value iocount . because the i / o count value iocount becomes “ 0 ” at clock cycle c 2 , the sdram sequencer 140 detects that i / o memory setup is complete and does not negate the clock enable cke even if this is one clock cycle before the output of the read data d . then , the sequencer 140 negates the clock enable cke at clock cycle c 4 in order to hold the next read data output . the i / o sequencer 180 detects the completion of the writing of the effective read data when the sdram count value sdcount becomes “ 0 ”, temporarily negates the i / o write signal / iowr at clock cycle c 5 , and then asserts that signal once more at the next clock cycle c 6 . accordingly , the i / o memory starts write setup for the next flyby transfer . the i / o sequencer sets the i / o count value iocount to “ 1 ” with the assertion of the i / o write signal / iowr at clock cycle c 6 . the sdram sequencer sees this i / o count value and detects that the i / o memory setup for writing the second data is prepared after one clock cycle . the sequencer 140 asserts the clock enable cke in order to output the third read data . at the next clock cycle c 7 following the assertion of the clock enable cke , the clock enable cke is negated and the sdram is controlled so as to hold the third read data . subsequent to clock cycle c 5 , the sdram is set up for read data output and therefore that count value sdcount remains “ 0 ”. consequently , control of the second and subsequent read data by the sdram sequencer 140 is based on the i / o count value iocount and is controlled by the negation and assertion of the clock enable cke . [ 0093 ] fig1 is a timing chart of the burst transfer operation with flyby transfer from i / o memory to sdram according to the system in the abovementioned modified example . in this example , the sdram sequencer supplies a burst write instruction to the sdram , delays the time of the write operation by negating the clock enable cke , monitors the time at which the read data in i / o memory becomes effective according to the i / o count value iocount , asserts the clock enable cke and gives an instruction for the write operation . initially , when flyby transfer is ordered at clock cycle c 1 , the sdram sequencer 140 issues the active command actv and sets the sdram count value sdcount to “ 3 ”. meanwhile , the i / o sequencer 180 asserts the i / o read command / iord and sets the i / o count value iocount to “ 1 ”. in the initial data flyby transfer , the read data setup of i / o memory is prepared first . accordingly , the sdram sequencer can issue a write command at the shortest clock cycle c 4 and the data is written at clock cycle c 5 . at that time , the sdram sequencer 140 issues the write command writ , while negating the clock enable cke and controls the next data writing in a hold state . in response to the sdram count value sdcount becoming “ 0 ”, the i / o sequencer 180 negates the i / o read command / iord at clock cycle c 5 and asserts the command once more at the next cycle c 6 . at this assertion , the i / o count value iocount is set to “ 1 ”. in response thereto , the sdram sequencer 140 asserts the clock enable cke and controls the writing operation in clock cycle c 8 . the sdram sequencer 140 negates the asserted clock enable cke once more at the next cycle c 7 and controls the third data writing operation in a hold state . subsequently , the sdram 24 remains in a writable state and therefore the sdram sequencer 140 maintains the sdram count value sdcount at “ 0 ” and then asserts and negates the clock enable cke for a period of one clock cycle once the i / o count value iocount is set to “ 1 ”. the i / o count value iocount is set to “ 1 ” by the i / o sequencer 180 at the assertion of the i / o read command / iord to start the read data setup of the i / o memory . as above , the sdram sequencer and i / o sequencer provide each other with the number of clock cycles showing cycles until setup is complete as count values , and thereby allow the other to make predictions according to that count value and control the corresponding controlling device . in the case of the burst transfer discussed above , the sdram sequencer regulates the timing for writing a plurality of data by toggling the clock enable cke during burst write control and makes possible flyby transfer . as above , the present invention makes it possible to perform data transfer directly via a universal bus between synchronous memory and input / output memory . | 6 |
referring now to fig3 and 4 , respective top and side views of a first embodiment of the present invention show how the conventional thin mesa transistor structure of fig1 and 2 is modified such that the body / channel region 14 extends beyond its interfaces with each of the source and drain regions , as shown by body / channel extension regions or segments 31 , 32 . regions 31 , 32 have a prescribed length x and a width y within the dimensions of the gate layer 21 and serve to increase the effective channel length of body / channel region 14 to a value greater than the case where the body / channel region terminates ` flush ` with source and drain regions 16 , 18 ( as shown in fig1 ). the respective channel / body extensions 31 , 32 at both ends of the body / channel region beneath the polysilicon gate , by increasing the ` net edge length ` ( 2x + y ), will result in a significantly reduced off state leakage due to the attenuation of parasitic transistor short channel effects . fig5 and 6 diagrammatically show respective top and side view of a second embodiment of the invention , in which respective high impurity concentration ` tab ` regions 41 , 42 are introduced to overlap end portions 43 , 44 of ( p - type ) body / channel extension regions 31 , 32 so that the impurity concentration of these end portions of the extension regions is increased relative to the impurity concentration of that portion 17 of the body / channel region 14 disposed between the source and drain regions , thereby forming a pair of p + channel stops . this relatively high impurity concentration of the channel stop tab regions 41 , 42 insures that the parasitic sidewall threshold is higher than any possible negative threshold shift which might be induced by ionizing radiation . these more heavily doped ( p +) tab regions 41 , 42 of the extension regions 31 , 32 are spaced apart from the endwall edges of source and drain regions 16 , 18 by respective portions 51 , 52 of the extension regions 31 , 32 of the same doping concentration as the body / channel region 14 itself , so that the more heavily doped ( p +) channel stop tab regions 41 , 42 do not form ( very low breakdown voltage ) p +/ n + junctions with the source and drain regions 16 , 18 . the source and drain regions may be formed by an n + implant using an implant mask the geometry of which overlaps polysilicon gate layer 21 , as shown at 55 in fig6 . pursuant to a third embodiment of the invention , the channel stops of the extension regions are configured to provide additional functionality , specifically to provide body tie contact regions , so that the body / channel region may be terminated at a prescribed bias voltage ( e . g . vss , which will substantially reduce parasitic sidewall originating current leakage during the transistor &# 39 ; s off state ). for this purpose , as shown in the diagrammatic top and side views of fig7 and 8 , heavily doped ` bodytab ` portions 61 , 63 of p - type body / channel extension regions 31 , 32 protrude to the side of or transverse to the lengthwise direction of the body / channel region 14 and its polysilicon gate overlay 21 , so that the pair of heavily doped ( p +) bodytabs 61 , 63 project outwardly from beneath and to the side of the gate layer 21 , thereby forming a symmetrical , bidirectional transistor geometry and facilitating the electrical connection of a bias voltage rail to the body / channel region from either end of the device . as in the second embodiment heavily doped bodytab regions 61 , 63 are spaced apart from the end sidewalls of n + drain region 18 by extension portions 51 , 52 , so that the more heavily doped ( p +) channel stop tab regions 61 , 63 do not form ( low reverse breakdown voltage ) p +/ n + junctions with the drain region 18 . in accordance with a fourth embodiment of the invention , the problem of ionizing radiation - induced inversion of the sidewalls of the p - type body / channel region is addressed by means of an asymmetric sidewall channel stop structure formed in opposite end portions of one of the source and drain regions . specifically , as diagrammatically illustrated in the isometric sectional view of fig9 and the top view of fig1 , first and second end portions 71 , 72 of one of n + source and drain mesa regions are heavily overdoped with impurities of the same conductivity type as the body / channel region . in particular , these p + end portions 71 and 72 are located such that they are contiguous with the ( p ) body / channel mesa region 14 and extend to sidewall edges 75 , 76 of the source mesa region 16 , thereby forming a demiurgic channel stop structure having first and second mesa sidewall channel stops 81 , 82 immediately adjacent to ends 83 , 84 of the ( p ) body / channel region 14 and which extend throughout the thickness of the selected region ( source region 16 ). the p + implant photomask used to define the geometry of channel stop regions 81 , 82 is sized and located such that it partially overlaps ( e . g . terminates beneath a portion of polysilicon gate 21 , as shown in fig9 or it may terminate along the centerline 90 of polysilicon gate 21 , as shown in fig1 , and also extends beyond the side edge of the gate onto the source region , so as create a partially self - aligned p + channel stop structure that is contiguous with the p - type body / channel region . terminating the p + channel stop implant masking photoresist pattern over polysilicon gate layer 21 guarantees that the p + implant will not fall off the gate onto either the source or drain region side under statistically controlled misalignment conditions . channel stop regions 71 , 72 are doped with a p - type impurity during both a lightly doped p source / drain region implant and p + surface source / drain implant operations , such that the composite doping profile of these regions is sufficient to inhibit sidewall inversion well into the megarad total dose range . the magnitude of p + implant energy is predetermined to be sufficient to cause a pair of p source and drain regions of an associated complementary p - channel device to bottom out against insulator support layer 12 . as a consequence , the p + implant is similarly effective across the entire sidewall interface surface in the formation of the channel stops 81 , 82 . the shape and position of this heavy ( p +) overdoping ensures that the sidewalls 83 , 84 of the mesa adjacent to the location where gate electrode 21 exits the mesa are p - doped to the magnitude necessary to prevent sidewall inversion . the heavy overdoping also ensures that the parasitic sidewall threshold is higher in magnitude than any possible threshold shift that might occur as a result of the incidence of ionizing radiation . even in the case of a very thick dielectrically filled trench isolation structure where the potential charge generation volume is relatively large , the sidewall remains adequately enhancement mode . since p + channel stops 81 , 82 are disposed in the same n + source region 16 , they are physically and electronically separated from the n + drain region 18 on the opposite side of body / channel region 14 over which polysilicon gate 21 is formed . conductive material such as a layer of low resistance silicide 95 is formed atop each of gate layer and source and drain regions , as shown in fig9 . silicide layer 95 conductively bridges channel stop regions 81 , 82 and source region 16 , so that the body region 14 is inherently shunted to source region 16 . thus , p +/ n + junctions 91 , 92 formed between the high impurity concentration p + channel stops 81 , 82 and the n + material of source region 16 in which they are introduced are at the same potential , so that the reverse bias voltage characteristics of the diode are of no consequence . the amount of semiconductor real estate necessary to prevent sidewall inversion using the asymmetric channel stop configuration of fig9 and 10 is considerably reduced compared with other mos channel stop architectures , shown in fig1 - 16 , that have been conventionally used for this purpose . specifically , in the course of carrying out a full self - alignment with the polysilicon gate in a t - gate structure , such as shown in fig1 and an h - gate structure shown in fig1 and 13 , contacts must be added to the channel stop regions in order for the p + regions to provide body tie capability . on the other hand , as described above , the asymmetric channel stop configuration of the embodiment of fig9 and 10 is inherently shunted to source region 16 by means of low resistance silicide 95 . this bridging silicide layer 95 also eliminates the need for additional contacts and metalization , such as those shown in the structure of fig1 , which employs n + diffusions spaced inwardly away from the mesa edge . in fact , for small transistors , a single , minimum sized source contact to silicide layer 95 will serve to maintain the necessary bias on both sidewall channel stops 81 , 82 , while also providing bias to the body / channel region 14 and the source region 16 . it will also be appreciated that conventional configurations employing full or partial guardrings ( fig1 ) and circular gate structures ( fig1 ) require significantly larger chip area to implement than do the asymmetric device of fig9 and 10 , and make high density memories and other digital circuits more difficult to design and manufacture . indeed for guardring structures , at least one additional lithographic and ion implantation step is required prior to the deposition of the gate electrode . on the other hand , in asymmetric device of the present invention no additional fabrication operations , photomasking , or ion implantation steps are required . while we have shown and described several embodiments in accordance with the present invention , it is to be understood that the same is not limited thereto but is susceptible to numerous changes and modifications as known to a person skilled in the art , and we therefore do not wish to be limited to the details shown and described herein but intend to cover all such changes and modifications as are obvious to one of ordinary skill in the art . | 7 |
the accompanying drawings are included to provide a further understanding of the invention , and are incorporated in and constitute a part of this specification . the drawings illustrate embodiments of the invention and , together with the description , serve to explain the principles of the invention . fig5 is a schematic diagram illustrating a high - performance block - matching vlsi architecture according to an embodiment of the present invention . referring to fig5 , the present invention provides a high - performance block - matching vlsi architecture . the high - performance block - matching vlsi architecture includes a block - matching circuit architecture 70 . the block - matching circuit architecture 70 includes an external memory 71 , a data bus 73 , and a motion estimation processor 80 . the external memory 71 includes data of a plurality of reference frames and a plurality of current frames saved therein . the data bus 73 is connected with the external memory 71 and the motion estimation processor 80 . the motion estimation processor 80 includes an internal memory 82 , a memory processing block 84 , an address selection processing block 86 , a predicting search path processing block 88 , a bma processing block 90 , and a motion estimation result processing block 92 . the memory processing block 84 is adapted for controlling a data access operation between the internal memory 82 and the external memory 71 . the address selection processing block 86 is adapted for selecting a current block address in a current frame . the predicting search path processing block 88 is adapted for executing a prediction of a search path regarding the current block according to the current block address selected by the address selection processing block 86 , so as to predict the search path corresponding to the current block in the search window . the bma processing block 90 is adapted for loading corresponding data of the search window from the external memory 71 to the internal memory 82 , and finding out the best matched blocks by the bma , according to the search path predicted by the predicting search path processing block 88 . in such a way , the motion estimation of a single current block is completed , and motion vectors of the current block and the best matched block are obtained , and recorded by the motion estimation result processing block 92 . further , the memory processing block 84 loads a current block of another frame having the same current block address . the current block of the current frame is saved in the external memory 71 . the predicated search path is updated by the predicting search path processing block 88 , and the best matched block and the motion vector are found out by the bma processing block 90 . meanwhile , the motion estimation result processing block 92 records the motion vector , until motion estimations of all current blocks having the same current block address are completed . therefore , the data of the same search window can be shared by a plurality of current blocks , for improving the utilization efficiency of the data , and reducing the data bandwidth of the data bus 73 . then , the motion estimation result processing block 92 restarts the address selection processing block 86 to select another address , and updates the predicted search path by the memory processing block 84 and the predicting search path processing block 88 . the bma processing block 90 finds out the best matched block and the motion vector . meanwhile , the motion estimation result processing block 92 records the motion vector , until motion estimations of all current blocks having the same current block address are completed . therefore , the block - matching circuit architecture 70 of the present invention is adapted for carrying out the motion estimation of the h . 264 / avc video coding standard data . fig6 is a schematic diagram illustrating the block - matching of the high - performance block - matching vlsi architecture according to an embodiment of the present invention . referring to fig6 , a search window 50 of a reference frame 40 of a time t − 4t is a first current block 31 of a first current frame 21 provided for a time t − 3t , a second current block 32 of a second current frame 22 provided for a time t − 2t , a third current block 33 of a third current frame 23 provided for a time t − t , and a fourth current block 34 of a fourth current frame 24 provided for a time t , for carrying out the motion estimation to find out the best matched blocks . the first current block 31 , the second current block 32 , the third current block 33 , and the fourth current block 34 are positioned at a same spatial address of different current frames . as such , the first current block 31 , the second current block 32 , the third current block 33 , and the fourth current block 34 are highly time correlated in a time axis . comparing with the present invention , the conventional technology as shown in fig3 differs in that it requires to load four search windows and the data of a current block for carrying out the motion estimation . on the contrary , the present invention requires to load only one search window and data of four current blocks . since the data amount of a search window is much more than the data amount of a current block , the present invention is adapted for drastically reducing the data transmission bandwidth . for example , supposing that a data amount of a search window is 3 × 3 times of a current block , the data amount processed by the conventional technology is 37 times of the current block , i . e ., 9 × 4 + 1 = 37 , while the data amount processed by the present invention is 13 times of the current block , i . e ., 9 + 1 × 4 = 13 . as such , according to the present invention , the data transmission bandwidth can be reduced up to 13 / 37 ( about 35 %) of the conventional technology . therefore , about 65 % of the data transmission bandwidth can be saved . correspondingly , the power consumption of the battery can be decrease , and the battery can thus maintain the power supply for a longer time . it should be noted that , although four current blocks are exemplified for sharing the same search window in the current embodiment , the scope of the present invention is not restricted by quantity of the exemplified current blocks . in other words , the present invention can select n current blocks for sharing the same search window , in which n is a positive integer . fig7 is a flow chart illustrating the high - performance block - matching vlsi architecture according to an embodiment of the present invention . referring to fig7 , at step s 100 , the motion estimation is started , in which the search window and the current blocks are saved in the external memory 84 . at step s 110 , a current block address of a current frame is selected . then , at step s 120 , data of the current block of the current block address is loaded to the internal memory 74 . then , at step s 140 , a predicated search path is obtained . then , at step s 160 , data designated according to the predicated search path is loaded from the external memory 84 to the internal memory 74 . then at step s 180 , a bma matching operation is executed to find out a best matched block . then , at step s 200 , it is determined whether the bma matching operation has been executed to all of the current blocks having the same address . if no , then the flow goes to step s 220 , or otherwise if yes , then the flow goes to step s 240 . at step s 220 , another current bock having the same address is loaded , and the flow goes back to step s 140 , and the steps from s 160 to s 200 are repeated . at step s 240 , according to the bma matching operation result of the same address , the motion estimation of the current blocks at the same spatial address is completed . then , at step s 260 , it is determined whether bma matching operations of current blocks of all spatial addresses have been completed . if no , then the flow goes to step s 280 , or otherwise if yes , then the flow goes to step s 300 . at step s 280 , another address is selected , and the flow goes back to step s 120 , and the steps s 140 to s 260 are repeated . at step s 300 , the motion estimation result is obtained . then , at step s 320 , the motion estimation operation is completed . as such , prior to the bma matching operation , the present invention searches a more suitable predicated search path , i . e ., updates the predicated search path , when loading a next current block . fig8 is a flow chart illustrating a process of predicating the search path of the high - performance block - matching vlsi architecture according to an embodiment of the present invention . the flow chart of the process of predicating the search path of fig8 depicts the details of step s 140 of fig7 . referring to fig8 , first at step s 142 , motion vectors , adaptive search ranges and a search path of adjacent blocks of the current block are obtained according to the h . 264 / avc video coding standard . then , at step s 144 , a motion vector and an adaptive search range of the current block are predicted . then , at step s 146 , a search path of the current block is predicted , according to the predicted motion vector , the predicted adaptive search range , the current search pattern , and the search path of the adjacent blocks of the current block . fig9 is a flow chart illustrating a process of predicating the motion vectors of the high - performance block - matching vlsi architecture according to an embodiment of the present invention . fig9 is provided for further illustrating steps s 144 and s 146 of fig8 . referring to fig9 , a first adjacent block 30 a , a second adjacent block 30 b , a third adjacent block 30 c are adjacently positioned at a left side , an upper left side , and an upper side of a current block 30 . the first adjacent block 30 a , the second adjacent block 30 b , and the third adjacent block 30 c have motion vectors mv 1 , mv 2 , and mv 3 , respectively . according to an aspect of the current embodiment , a predicted motion vector mvp of the current block 30 can be determined by averaging the motion vectors mv 1 , mv 2 , and mv 3 . further , according to another aspect of the current embodiment , the predicted motion vector mvp of the current block 30 can be determined by executing an extrapolation calculation upon a motion vector plane constructed according to the motion vectors mv 1 , mv 2 , and mv 3 . it should be noted that the present invention the above mentioned aspects of the current embodiment are exemplified for illustration purpose without restricting the scope of the present invention . the predicted adaptive search range for example can be a maximum value of the adaptive search ranges of the adjacent blocks , or an average of the of the adaptive search ranges of the adjacent blocks . fig1 is another flow chart illustrating a high - performance block - matching vlsi architecture according to an embodiment of the present invention . fig1 is provided for further illustrating steps s 120 to s 240 of fig7 , facilitated with fig6 . referring to fig1 , at step s 500 , a search path of the reference frame at the time t − 4t is loaded . then , at step s 510 , the first current block of the first current frame at the time t − 3t is loaded . then , at step s 512 , the search path is updated , i . e ., at step s 140 of fig7 in which the search path is predicted . then , at step s 514 , a first best matched block is found out . then , at step s 520 , the second current block of the second current frame at the time t − 2t is loaded . then , at step s 522 , the search path is updated , i . e ., at step s 140 of fig7 in which the search path is predicted . then , at step s 524 , a second best matched block is found out . then , at step s 530 , the third current block of the third frame at the time t − t is loaded . then , at step s 532 , the search path is updated , i . e ., at step s 140 of fig7 in which the search path is predicted . then , at step s 534 , a third best matched block is found out . then , at step s 540 , the fourth current block of the fourth current frame is loaded . then , at step s 542 , the search path is updated , i . e ., at step s 140 of fig7 in which the search path is predicted . the , at step s 544 , a fourth best matched block is found out . then , at step s 550 , the first best matched block , the second best matched block , the third best matched block , and the fourth best matched block are combined . as such , according to the present invention , best matched blocks and motion vectors corresponding to four current blocks having the same address are searched , so as to improve the reusability of the data , and drastically reduce the power consumed upon the overall motion estimation operation , and improve the operation speed and the performance thereof . although the present invention has been described with reference to the preferred embodiments thereof , it is apparent to those skilled in the art that a variety of modifications and changes may be made without departing from the scope of the present invention which is intended to be defined by the appended claims . | 7 |
as follows is a description of embodiments of the present invention with reference to the drawings . in fig2 illustrating a first embodiment , air is drawn into an internal combustion engine 1 from an air cleaner 2 , by way of an intake duct 3 , a throttle valve 4 , and an intake manifold 5 . fuel injection valves 6 are provided for each cylinder in respective branch portions of the intake manifold 5 . the fuel injection valves 6 are solenoid type fuel injection valves 6 which open with power to a solenoid and close with power shut - off . the fuel injection valves 6 are intermittently driven open in response to a drive pulse signal of a predetermined pulse width provided by a control unit 12 ( to be described later ) so that fuel , pressurised by a fuel pump ( not shown ) and controlled to a predetermined pressure by means of a pressure regulator , is injected to the engine 1 . ignition plugs 7 are provided for each combustion chamber of the engine 1 for spark ignition of a mixture therein . for the various sensors for detecting engine operating conditions , there is provided in the intake duct 3 , an air flow meter 8 such as a hot wire type air flow meter , which detects an intake air quantity q of the engine 1 as a mass flow rate . the air flow meter 8 corresponds to the intake air mass flow rate detection device . moreover , an engine rotational speed sensor 9 is provided for detecting an engine rotational speed n . furthermore , a throttle valve sensor 10 is provided for detecting an opening α of the throttle valve 4 , by means of a potentiometer . in addition there is provided an intake air temperature sensor 11 for detecting the temperature of the intake air . the control unit 12 incorporates a microcomputer comprising a cpu , rom , ram , a / d converter , and input / output interface etc . the control unit 12 takes input signals from the various sensors and controls the pulse width of a drive pulse signal applied to the fuel injection valves 6 , as well as setting ignition timing adv in accordance with engine operating conditions such as engine load and engine rotational speed , and controlling ignition by the ignition plugs 7 . a solenoid type idle control valve 14 is provided in a bypass passage 13 arranged so as to bypass the throttle valve 4 . by controlling the opening of the idle control valve 14 , the rotational speed at the time of idling can be controlled . the control unit 12 as described later , learns and corrects changes in the intake air volumetric flow rate in the low opening region of the throttle valve 4 accompanying contamination thereof ( referred to hereunder as throttle valve contamination learning ), while carrying out estimation of atmospheric pressure in the high opening region of the throttle valve 4 . fig3 ( a ) and fig3 ( b ) show a flow chart for a routine for judging whether or not contamination is of a sufficient level to change the volumetric flow rate of the throttle valve . in fig3 ( a ) and fig3 ( b ), in step 1 ( with &# 34 ; step &# 34 ; denoted by s in the figures ) a throttle valve opening α is read from the throttle sensor 10 . in step 2 , it is judged if the throttle valve opening α is a high opening greater than or equal to a predetermined opening α h . when a low opening is judged , control returns to step 1 , while when a high opening is judged , control proceeds to step 3 where an opening iv of the idle control valve 14 ( a control value from the control unit 12 ), an intake air mass flow rate ( af / m ) q detected by the air flow meter 8 , and an intake temperature t q detected by the intake air temperature sensor 11 are read . in step 4 , an atmospheric pressure a is estimated / computed according to the following equation , based on the intake air mass flow rate ( af / m ) q , the intake air volumetric flow rate ( α - n ) q corresponding to the throttle valve opening α and the engine rotational speed n ( the function of estimating the intake air volumetric flow rate using α and n corresponds to the intake air volumetric flow rate estimation device ), and the intake temperature t q . in step 5 , a timer for measuring an elapsed time t from after carrying out estimation / computation of the atmospheric pressure , is started . in step 6 , it is judged if the throttle valve opening α has changed to a low opening less than or equal to a predetermined opening α l . when the throttle valve opening α has changed to the low opening , control proceeds to step 7 , where it is judged if the elapsed time t has reached a time t 0 of a duration such that atmospheric pressure could change due to ascent or descent . when this time is reached , control returns to step 1 to cancel the contamination learning and correction , while when not yet reached , control proceeds to step 8 . in step 8 , the throttle valve opening α , the idle control valve opening iv , the intake air mass flow rate ( af / m ) q and the intake air temperature t q are read . in step 9 , an atmospheric pressure b for low opening regions of the throttle valve opening α , is estimated using a similar computation method to that of step 4 . then in step 10 , the atmospheric pressure a computed in step 4 for the high opening region is compared with the atmospheric pressure b computed in step 9 for the low opening region , to judge if both are in agreement . when judged in step 10 that the atmospheric pressure a and the atmospheric pressure b are in agreement , it is judged that contamination has not occurred in the throttle valve 4 to a level sufficient to change the volumetric flow rate , and the routine is terminated . when the atmospheric pressure a and the atmospheric pressure b are not in agreement , it is judged that contamination has occurred in the throttle valve 4 to a level sufficient to change the volumetric flow rate , and control proceeds to step 11 where throttle valve contamination learning , to be described later , is carried out so as to correct the volumetric flow rate which has been changed due to contamination of the throttle valve . the functions of step 4 and step 9 correspond to the atmospheric pressure estimation device , while step 11 ( covered by the respective routines of fig4 ˜ fig6 to be described later ) corresponds to the learning device . fig4 is a flow chart showing a first mode for throttle valve contamination learning . in step 21 , an intake air volumetric flow rate ( α - n ) q for the low opening region of the throttle valve , is corrected so that the atmospheric pressure b computed for the low opening region is in agreement with the atmospheric pressure a computed for the high opening region . more specifically , since in the high opening region of the throttle valve , the change in the intake air volumetric flow rate due to contamination of the throttle valve is small enough to be disregarded , then the atmospheric pressure a estimated at the high opening region , based on this intake air volumetric flow rate is reliable . hence since an atmospheric pressure b &# 39 ; estimated based on a true intake air volumetric flow rate ( α - n ) q l which has been influenced by contamination of the throttle valve will be equal to the atmospheric pressure a , then this true intake air volumetric flow rate ( α - n ) q l can be obtained from the following equation . where subscript h indicates the value for the high opening region of the throttle valve , while subscript l indicates the value for the low opening region of the throttle valve . in step 22 , the relevant value in a throttle valve low opening α - n region in a map or table of ( α - n ) q , is rewritten with the true intake air volumetric flow rate ( α - n ) q l computed in step 21 . by carrying out such learning , then even under extended periods of driving with a low throttle valve opening , such as at the time of down slope travelling or gentle up slope travelling , atmospheric pressure estimation can be carried out using a true intake air volumetric flow rate for which the influence due to contamination has been learnt and corrected . therefore good speed change control performance of an automatic transmission can be ensured by switching the speed change pattern based on the estimated atmospheric pressure , and good engine control can be carried out by appropriately setting the correction amount of the fuel injection quantity during transition . in this learning mode , the intake air volumetric flow rate for the low opening region of the throttle valve is learnt and corrected . however it is possible to learn and correct the opening characteristics of the throttle valve . fig5 . shows a flow chart of a second learning mode wherein the relationship of the throttle valve opening to the output value of the throttle sensor , is learnt and corrected . in step 31 , the throttle opening corresponding to the output voltage from the throttle sensor 10 is increase or decrease corrected by a very small amount δα according to the size relationship between the atmospheric pressure a and the atmospheric pressure b . normally , due to contamination of the throttle valve 4 , the true intake air volumetric flow rate is smaller than the intake air volumetric flow rate corresponding to the throttle valve opening detected by the throttle sensor 10 . consequently , since prior to starting learning , an intake air volumetric flow rate larger than the true intake air volumetric flow rate is used in the computation of step 9 in fig3 the atmospheric pressure b exhibits a value which is larger than the atmospheric pressure a which is close to the true value . therefore , the value of the throttle valve opening α for the output value of the throttle sensor 10 is reducingly corrected by δα . control then returns to step 9 , and the atmospheric pressure b is again estimated using the throttle valve opening α corrected in step 31 . in step 10 the atmospheric pressure a and the atmospheric pressure b are re - compared , and if not in agreement , then the same operation is again repeated . when the atmospheric pressure a and the atmospheric pressure b are in agreement , the routine is terminated . at this time , with respect to the same intake air volumetric flow rate , the throttle valve opening α increases due to the contamination of the throttle valve compared to a situation for no contamination . accordingly , with respect to the output value of the throttle sensor 10 , the increased throttle valve opening α is learned and corrected so as to decrease to a throttle valve opening corresponding to conditions there were no contamination of the throttle valve . that is to say , by correcting the throttle valve opening α to a throttle valve opening corresponding to a situation for no throttle valve contamination , even though contamination exists , then atmospheric pressure estimation can be carried out even in the low opening region , using the learnt / corrected throttle valve opening . furthermore , in the case of speed change control of an automatic transmission , even if switching of the speed change pattern by estimating the atmospheric pressure is not carried out , if speed change control is carried out using the learnt / corrected throttle valve opening , then since the throttle valve opening is corrected to a value corresponding to the true intake air volumetric flow rate , setting is automatically carried out to a speed change pattern corresponding to atmospheric pressure . in this case , compared to the arrangement wherein the atmospheric pressure is estimated and the speed change pattern is switched , there is no need to switch the speed change pattern . moreover , since the throttle valve opening is corrected continuously corresponding to changes in atmospheric pressure , and setting is carried out to an appropriate speed change pattern , then this is also beneficial for accuracy . in addition , with an arrangement wherein the correction amount for the fuel injection quantity during transition operation is set for example by the change rate in the throttle valve opening , then setting of the correction amount for the fuel injection quantity corresponding to the intake air volumetric efficiency change corresponding to the change in the throttle valve opening α , can be carried out to high accuracy , so that engine operating performance can be improved . next is a description in accordance with the flow chart of fig6 of a third learning mode wherein a relationship of the throttle valve opening area to the throttle valve opening , is learnt and corrected . this routine obtains the throttle valve opening area from a detection value of the throttle valve opening , by retrieval from a table or from a computation formula and the like , and is effective for example when setting the correction amount for the fuel injection quantity during transition operation , from for example the change rate in the opening area . in step 41 , a throttle opening area a for the detected throttle valve opening α corresponding to the output voltage from the throttle sensor 10 , is increase or decrease corrected by a very small amount δa according to the size relationship between the atmospheric pressure a and the atmospheric pressure b . normally , as mentioned before , due to contamination of the throttle valve , the atmospheric pressure b exhibits a value which is larger than the atmospheric pressure a which is close to the true value . therefore the throttle opening area a is reducingly corrected by a very small amount δa so as to approach the atmospheric pressure a . control then returns to step 9 , and the atmospheric pressure b is again estimated using the throttle opening area corrected in step 41 . with this learning mode , instead of using ( α - n ) q in the atmospheric pressure estimation , the throttle valve opening α is converted to the throttle opening area a , and an intake air volumetric flow rate ( a - n ) q obtained based on the converted throttle opening area a and the engine rotational speed n is used . in step 10 , the atmospheric pressure a and the atmospheric pressure b are re - compared , and if not in agreement , then the same operation is again repeated . when the atmospheric pressure a and the atmospheric pressure b are in agreement , the routine is terminated . at this time , with respect to the same intake air volumetric flow rate , the throttle opening area a increases due to the contamination of the throttle valve compared to a situation for no throttle valve contamination . accordingly , with respect to the throttle valve opening α , the increased throttle valve opening area a is learned and corrected so as to decrease to a throttle valve opening area corresponding to conditions there were no contamination of the throttle valve . that is to say , the throttle valve opening area is corrected to a throttle valve opening area corresponding to a situation for no throttle valve contamination , even though contamination exists . since the throttle opening area a corresponding to the true intake air volumetric flow rate is obtained in this way , then at the time of transitional operation , the setting of the correction amount for the fuel injection quantity corresponding to the intake air volumetric efficiency change corresponding to the change in the throttle opening area a , can be carried out to high accuracy , so that engine operating performance can be improved . now with the present embodiment , the atmospheric pressure is estimated and contamination learning is carried out when the throttle valve has changed to a low opening prior to the lapse of a predetermined time after estimation / computation of the atmospheric pressure for the high opening region of the throttle valve . however , a gravity direction sensor and the like may be provided to detect the inclination of the vehicle , and thereby detect up slope or down slope travelling , and throttle valve contamination learning carried out when the throttle valve has changed to a low opening prior to detecting up slope or down slope travelling after computation for the high opening region . | 5 |
referring now to fig1 a digital system 10 , which may be a part of a computer ( personal computer ( pc )), digital camera and the like is shown in accordance with an embodiment of the present invention to include a host 12 , a controller device 14 and a nonvolatile memory unit 16 . the host 12 is shown to be coupled to read information from and write information to the memory unit 16 under the direction of the controller device 14 . the memory unit 16 , as depicted , is comprised of at least two nonvolatile memory devices in accordance with the present invention . each of the nonvolatile memory devices is an integrated circuit ( or semiconductor device , as commonly referred to by the industry ). the nonvolatile memory devices may be flash , eeprom ( electronically erasable programmable read only memory ) or other type of solid state memory . the host 12 is shown to communicate with the controller 14 through host bus 18 and the controller device 14 is shown coupled to the memory unit 16 through memory signals 20 . the controller device 14 is an integrated circuit ( or semiconductor ) shown to include a host interface circuit 22 , a microprocessor circuit 24 , a volatile storage unit 26 and a space manager / flash interface circuit 28 . the host interface circuit 22 is for coupling the host 12 through host bus 18 , which includes an address bus , a bi - directional data bus and control signals ( not shown separately ). depending on the architecture of the host being employed , the host address and data busses may be comprised of a single bus carrying both address and data information by multiplexing address and data signals onto the same bus . it should be noted that the term bus as used herein includes multiple electrical conductors or signal lines . the host bus 18 may be a pcmcia interface , an ata interface or other kinds of interfaces employed by the industry . the host interface circuit 22 is shown coupled to the host bus 18 and is further shown to be coupled through a microprocessor bus 30 to the microprocessor circuit 24 . microprocessor circuit 24 is further coupled to the space manager / flash interface circuit 28 through the microprocessor bus 30 , which facilitates communication of address and data information and control signals therebetween . the microprocessor circuit 24 is coupled to read and write information to the volatile storage unit 26 through a volatile storage bus 32 . in one embodiment of the present invention , the microprocessor circuit 24 is an intel 8051 processor and alternatively , the microprocessor unit 24 may be any general - purpose processor unit . the volatile storage unit 26 is generally a read - access memory ( ram ) for storing firmware code that is executed by the microprocessor circuit 24 . information between the host 12 and the controller 14 is transferred through the host bus 18 and information between the controller 14 and the memory unit 16 is coupled through the memory signals 20 . the memory unit 16 is comprised of two or more nonvolatile memory devices , such as 34 and 36 . the size of each of the nonvolatile memory devices 34 and 36 may vary depending on the application of the digital system 10 . nonetheless , this size is generally referred to by bytes where each byte is 8 bits . for example , in one application , the size of the nonvolatile memory unit 16 is 160 mb ( mega bytes ) together , or 80 mb each . the nonvolatile memory devices 34 and 36 are of the memory type that preserve their contents even during a power - down . typical examples of nonvolatile memory devices are flash or eeprom devices comprised of floating gate cells and manufactured by companies such as toshiba , hitachi and the like . while not shown in fig1 the space manager / flash interface circuit 28 includes a space manager control unit 38 , a flash interface circuit 40 and a space manager storage unit 42 . the space manager unit 38 , in one embodiment of the present invention , is comprised of a state machine for controlling the information that is stored in a look - up - table ( lut ) maintained within the space manager storage unit 42 . alternatively , the functions of the space manager control unit 38 may be performed by other types of hardware and / or software as understood by those of ordinary skill in the art . the space manager storage unit 42 is of a volatile type of memory , such as ram , for storing block addressing and status information within the lut . still not shown in fig1 the memory signals 20 include a flash address bus , a bi - directional flash data bus and flash control signals . some of these signals will be further described with respect to other figures included herein . in operation , the host 12 accesses the memory unit 16 from time to time and during performance of various operations such as reading and writing to the memory unit 16 . in doing so , the host 12 provides an address identifying a location for reading or writing of data . the host - provided address is coupled onto the host bus 18 for use by the controller 14 in accessing or reading information to and from the memory unit 16 . in one embodiment , the host - provided address is in the form of chs ( cylinder , head and sector ). this type of addressing is adopted from systems using hard disks where such an addressing scheme was used to identify a particular location on the disk . with the advent of nonvolatile memory for storage of information however , the chs address format need be converted to a value for identifying a location within the nonvolatile memory unit . thus , when a chs address is coupled onto the host bus 18 , the controller 14 converts the same to a logical block address ( lba ). the lba is then coupled through the microprocessor bus 30 for use by the space manager / flash interface unit 28 . alternatively , the host 12 provides an lba type of address to the controller 14 , in which case , while conversion is still performed , it is not a chs to lba conversion . the latter conversion merely displaces the lba , as is also performed when the former conversion , i . e . chs to lba is used . the reader will note that as previously discussed herein , a block is defined to include a predetermined number of sectors . the manipulation and conversion of the addressing information from chs to what ultimately becomes an address that is used to look up or store information in the memory unit 16 is important and will therefore be discussed in further detail . in the case where a chs address is provided by the host to the controller 14 , the latter converts the chs to an lba pursuant to the following equation : the asterisk (*) denotes a multiplication ( or shift to the left in binary ) operation , the slash (/) denotes a division ( or shift to the right in binary ) operation and the plus (+) obviously denotes an addition operation . the cluster size generally determines the requisite size of the memory unit 16 since the size of the space manager storage unit 42 is typically fixed . this will become apparent during a later discussion . the lba calculation according to the equation shown above may be performed by hardware or firmware . in the case where firmware is used to calculate the lba , the microprocessor 24 performs such function by execution of the firmware code stored in the volatile storage unit 26 . in the case where hardware is used to calculate the lba , a state machine block ( not shown in fig1 ) performs such a calculation . after calculation of the lba according to the equation hereinabove , the lba is translated to a vlba ( virtual logical block address ) value by masking certain least significant bits of the lba . for example , in the case where 16 sectors per block is employed , the vlba is calculated from the lba by a logical ` and ` of the lba with the hexadecimal value 0x3ffff0 . this essentially results in the lba being preserved except for the 4 least significant bits thereof . in the case where 32 sectors per block are employed , the vlba is calculated by a logic ` and ` of the lba value with the hexadecimal value of 0x3fffe0 , which is effectively masking off the 5 least significant bits of the lba and preserving the remaining bits , and so on . the translation of the lba to vlba is performed by the space manager / flash interface 28 . this translation may be performed by either hardware or software . the vlba is then coupled onto the microprocessor bus 30 from the microprocessor 24 to the space manager control unit 38 of the space manager / flash interface circuit 28 where it is used to address the lut of the space manager storage unit 42 . in fact , the vlba is used to address a particular location of the lut wherefrom a vpba ( virtual physical block address ) is retrieved . it should be noted that a particular lba value may be used to point to various pba values . for example , if the host wishes to write to a location that is identified by a particular lba value , the particular lba value is then used to look up a vpba value in the lut . this vpba value may be , for example , ` 20 ` but the next time the host wishes to write to the same lba - identified location , the vpba value retrieved from the lut may be ` 200 ` rather than ` 20 `. the way in which this is done is with the use of certain flag information that is also maintained within the lut . briefly , the first time after an erase operation that a particular lba location is being addressed by the host for writing thereto , the information is written and a flag field within the lut corresponding the particular lba is marked as ` used ` so that the next time the host wishes to write to that same location prior to an erase operation , a different location within the memory unit 16 is identified by a different pba for such writing . accordingly , there is no one - to - one correspondence between the lba and the pba . for a further explanation of flag fields and the lba and pba lut addressing , the reader is directed to a u . s . application filed on mar . 31 , 1997 , entitled &# 34 ; moving sectors within a block of information in a flash memory mass storage architecture &# 34 ;, the inventors of which are petro estakhri , berhanu iman and ali r . ganjuei and the disclosure of which is herein incorporated by reference as though set forth in full . in pc applications , a block of information is typically a sector as employed in conventional hard disk drives , with each sector typically having 512 bytes of data , although other - sized sectors may be similarly employed . microprocessor 24 executes instructions in the form of program code from the volatile memory unit 26 ( such as rom ( read - only memory ) or ram ( read - and - write memory )) located either within or outside of the microprocessor 24 . the microprocessor 24 further instructs the space manager control unit 38 to use the lba , originated by a chs value provided by the host , to find the next unused ( or free ) addressable storage block location available within the memory unit 16 . during a host write operation , this unused block location is stored in the lut and during a host read operation , this unused block location is read from the lut . the address value identifying the a location within the memory unit 16 , as stored within the lut , is referred to as a virtual physical block address ( vpba ). the space manager control unit 38 may employ any one of a variety of algorithms to find the next available ( or free ) block located within the flash memory devices . an example of a space manager is disclosed in an earlier - issued patent , u . s . pat . no . 5 , 485 , 595 , entitled &# 34 ; flash memory mass storage architecture incorporating wear level technique without using cam cells &# 34 ;, issued on jan . 16 , 1996 with the inventors being mahmud assar , petro estakhri , siamack nemazie and mahmood mozaffari , the disclosure of which is herein incorporated by reference as though set forth in full . the reader is particularly directed to fig1 - 13 and discussions regarding the same . in alternative embodiments , however , other space management methods and apparatus may likewise be employed by the present invention . the vlba value is ultimately used to look up a vpba value from the lut . the lut is comprised of rows and columns with each row being addressed by a vlba value . during a read operation , the vlba value is used to address a particular row of the lut for retrieving therefrom , the vpba , which includes certain flag information . during a write operation , the vlba is used to address a particular row of the lut for storing a vpba value including certain flag information . the vpba is ultimately translated to a physical block address ( pba ) for identifying a particular sector location within the memory unit 16 . the mapping of address information is perhaps best understood with the use of an example . table 1______________________________________160mb , 64 sectors / blocklba xxxx , xccc , bbbb , bbbb , bbcc , sssspba xxxx , xccc , ccbb , bbbb , bbxx , xxxxvpba xxxx , uodc , cccc , bbbb , bbbb , xxxxfor 64mbit flash 16 sector per blockc : chip , b : block , s : sector , u : used , o : old , d : defect______________________________________ table 1 , above , shows an example of such an address mapping where a nonvolatile memory unit size of 160 mb is used and further where a ` super ` block includes 64 sectors . a ` super ` block is a block comprising of a plurality of blocks with each block residing in a location within a flash device that is the same relative location as that of the remaining blocks in the remaining flash device . in other words , blocks of a super block are positioned in like - locations within each of the flash devices and each block of a super block is within one flash device thereby positioning the blocks of a super block in - parallel with respect to each other . an lba , derived , if need be , from a chs value sent by the host 12 is calculated in accordance with the equation above . the lba value is then coupled onto the microprocessor bus 30 by the microprocessor 24 for use by the space manager / flash interface 28 where it is translated to a vlba address . the lba value shown in table 1 includes 4 bits of sector information , 10 bits of block information and 5 bits of chip select information . four bits of sector indicates the use of 16 sectors per block since 2 to the power of 4 equals 16 . the vlba is derived by masking the sector bits ( the masked sector bits will be referred to as sector offset value ), which in this example include 4 bits . the block and chip select information remain the same . the chip select bits are used to select a particular one of the plurality of nonvolatile memory devices included within the memory unit 16 , such as one of the devices 34 or 36 . the block information identifies a particular block within the selected nonvolatile memory device . in table 1 , the vpba value is shown to include 4 least significant bits ( lsbs ) as ` don &# 39 ; t care ` bits , which indicates that those bits carry no meaningful information , followed by eight block information bits and five chip select bits and three flag bits . the three flag bits are shown as ` uod `, respectively . as indicated in the key portion of the table 1 , ` u ` indicates a ` used ` flag , ` o ` stands for ` old ` flag and ` d ` stands for ` defect ` flag . similarly , ` c ` s indicate bits that carry chip select information while ` b ` s indicate bits that carry block information and ` s ` s carry sector information . as earlier noted , the chip select information is used for addressing a particular nonvolatile memory device within the memory unit 16 while block information is used for identifying a particular block within the selected nonvolatile memory device and sector information is used for identifying a sector , although the latter is not used by the lut , as the sector bits are masked . in table 1 , the vpba is converted to a pba value by shifting the vpba value to the left so as to eliminate flag information and by appending the sector offset value . there are a number of ` 0 ` s appended , as lsbs , to the pba in order to account for expansion of the size of the memory unit 16 . the size of the lut or the size of the space manager storage unit 42 ( in fig1 ) is generally fixed . in one embodiment of the present invention , the lut has 5120 rows or entries with each row or entry being 24 bits wide . accordingly , since the lut size remains the same , the size of the cluster , or the number of sectors per block , dictates the size of the memory unit 16 being employed . the size of the memory unit 16 is often referred to as the memory capacity . in prior art systems , the size of each block ( in terms of number of sectors , or cluster size ) is a determination of the size of the requisite nonvolatile memory capacity . consider the information provided in the following table 2 for example : table 2______________________________________cluster size spm entry nonvolatile memory capacity______________________________________16 sectors 5120 40mb ( 5120 * 8kb ) 32 sectors 5120 80mb ( 5120 * 16kb ) 64 sectors 5120 160mb ( 5120 * 32kb ) ______________________________________ the cluster size , in table 2 , as discussed earlier , represents the number of sectors in a block . for example , in prior art systems , where a 40 mb nonvolatile memory capacity is being employed , each block includes 16 sectors . whereas , for a 80 mb capacity , 32 sectors per block ( or cluster size ) is employed . this is again , in part , due to the number of lut entries remaining the same , i . e . 5120 . additionally , blocks are numbered sequentially in the nonvolatile memory unit 16 and blocks are erased sequentially by selecting a particular nonvolatile memory devices among the devices within the memory unit 16 , issuing an erase command followed by the address of the block to be erased and subsequently verifying whether or not the erase operation was successful by reading the contents of the erased block and comparing it to an all ` 1 ` s value . as is understood by those skilled in the art , successful erasure of flash or nonvolatile memory cells entails programming the cells to a logic state of ` 1 `. once erased , a cell can be written to but only once before it must be erased in order to be capable of being re - written . it was the inventors &# 39 ; intention to be able to use a larger nonvolatile memory capacity while decreasing the time associated with erase operations . accordingly , the present invention introduces the use of ` super ` blocks for addressing of the nonvolatile memory unit 16 . in this respect , a ` super ` block is defined by a number of blocks that are in like locations of the different nonvolatile memory devices and residing in - parallel with respect to each other . according to the information provided in the following table 3 , below , table 3______________________________________cluster size spm entry nonvolatile memory capacity______________________________________4 * 16 sector 5120 160mb ( 64 - mbit flash devices ) 4 * 32 sectors 5120 320mb ( 128 / 256 - mbit flash devices ) ______________________________________ the spm entry or lut rows remain the same , i . e . 5120 but the intent is to have a 320 mbyte nonvolatile memory capacity size , i . e . this is the total size of the memory unit 16 . the memory unit 16 is then managed as 128 sectors / cluster . for example , according to the above , if a block is defined to include 16 sectors , a ` super ` block will include 8 * 16 or 128 sectors with each 16 - sector block being stored in one nonvolatile memory device and eight such nonvolatile memory devices being used in - parallel to define 8 blocks . this is perhaps best understood using an example to show the management of the memory unit 16 when using 32 sectors / block and a ` super ` block having 4 blocks , as shown in fig2 . but before this is done , it should be understood that in table 3 , in the cluster size column , the number of sectors defines an erasable block . for example , in the first row of that column , an erasable block consists of 16 sectors and in the second row of that column , an erasable block is shown to consist of 32 sectors and so on . furthermore , the nonvolatile memory capacity column reflects the total capacity of the memory unit 16 and the flash devices are the nonvolatile memory devices within the memory unit 16 . for example , in the first column of the table 3 , a total memory size of 160 mb is made up of twenty 8 mb - flash devices . referring now to fig2 a flash memory unit 200 is shown to include 4 flash memory devices , 202 - 208 . using the example of a 320 mb memory capacity and 32 sectors per block , a super block then includes 4 blocks . a super block is denoted in fig2 by the reference number 210 and as shown spreads over 4 flash memory devices . blocks are numbered horizontally through the flash memory devices 202 - 208 such that , for example , the blocks included within the first super block , i . e . blocks 0 - 3 , are each stored within the first block row of each of the flash memory devices 202 - 208 , respectively . similarly , blocks 4 - 7 , which belong to the second super block , are stored within the second block row of the flash devices 202 - 208 , respectively . each of the flash devices 202 - 208 is shown to include 1024 block rows . each block row is a storage space of 32 sectors * 512 bytes or 16 kb since each sector is 512 bytes . an entire super block is erased as a unit during an erase operation . for example , if the first super block is to be erased , the flash device 202 is first selected and an erase operation command is issued along with an address identifying the first block of the flash device 202 . next , the second flash device , or flash device 204 , is selected , followed by another erase operation command and an address identifying the first block of the flash device 204 ( this value will be the same as the value used in identifying the first block of the flash device 202 ). next , flash device 206 is selected and a read operation command is issued in the same manner as is done with respect to the flash device 208 . at the completion of these operations , a ` read status ` command is performed by issuing a read status command to check for the erase operation being completed without errors , i . e ., checking for the contents of the erased blocks of each of the flash devices 202 - 208 being at logic state ` 1 ` and if so , the erased blocks are used for further writing thereto . it should be noted that an erase operation is performed under the direction of the controller 14 ( in fig1 ). the signals used for coupling information between the controller 14 and the memory unit 16 , i . e . memory signals 18 , include various address , data and control signals for effectuating not only erase but also read and write operations ( the latter two operations having been initiated by the host 12 ). some of these signals included within the memory signals 18 will be referred to in the following discussion with respect to fig3 and shown therein . the sequence of activities during an erase operation is shown in a timing diagram in fig3 as an example , where two flash devices are employed . this may be the case where a block includes 64 sectors to form 160 mb nonvolatile memory capacity shown in table 3 above . in fig3 the signals , cle0 302 , cle1 304 , cle2 301 and cle3 303 , / we 306 , address 308 , read / busy * 310 are shown as being included in the memory signals 18 ( in fig1 ). this example assumes there are four flash devices in the memory unit 16 ( in fig1 ). the signals 302 , 304 , 301 and 303 are chip enable or chip select signals that select one of the four flash devices when active ( active in this example refers to a logical state of ` 1 `) . the / we 306 signal is a write enable signal that is activated whenever address or data is being written to one of the flash devices . activated of the 306 signal is a logic state of ` 0 `. the address signals 308 provide the command and address portions of an operation . the address being the address of a block within a flash device and the command being one of read , write or erase operations . in the sequence of events , a command is first provided by the controller 12 through the address signals 308 to the memory unit 16 , followed by the address of the block , in byte form , with the high byte being transmitted first followed by the low byte . the ready / busy * signal , 310 , indicates whether a corresponding flash device is ready or busy . at logic state ` 1 `, the ready / busy * signal indicates that the corresponding flash device is ready for being written thereto , read from or erased , whereas , a logic state of ` 0 ` indicates that the corresponding flash device is busy and operation thereupon is not allowed . in the example of fig3 since there are four flash devices , a first , second , third and fourth flash devices ( to which the signals 302 , 304 , 301 and 303 correspond , respectively ), a super block is comprised of four blocks so that an erase operation includes erasing four blocks that are located in the same position within the four flash devices . when an erase operation takes place in accordance with the present invention , the cle0 signal 302 is activated and an erase command is coupled onto the address signals 308 ( this is indicated by the value ` 60 ` in hexadecimal notation in fig3 ). when so doing , the / we signal 306 is asserted or activated . furthermore , with the assertion of the cle0 signal 302 , the first flash device is enabled . next , the cle1 signal 304 is activated in order to enable the second flash device and the address of the block being erased is coupled onto the address signals 308 , followed by causing the signal 310 to go to a logic state of ` 0 ` to indicate that the first flash device is now busy . next , another erase command is issued , again indicated by the value ` 60 ` coupled onto the address signals 308 , which is followed by the address of the block within the second flash device that is being erased . note that as previously indicated this address is the same as the address that followed the previous erase command ` 60 `. this is followed by the activation of the cle2 and cle3 signals , respectively in the same manner as is done with respect to the cle0 and cle1 signals and an erase command is issued in the same manner as well . thereafter , the ready / busy * signal 310 is asserted or activated to indicate that the second flash device is busy and then a read command , shown by the value ` 70 ` on the address signals 308 , is issued in order to verify that the erase operation was successful . note that in the present invention , a super block is being erased during an erase operation with a super block including a plurality blocks , as determined by the sector size of a block . it has been the inventors &# 39 ; experience that the time frame , indicated by reference number 314 in fig3 when the flash devices are busy being erased , is 2 . 3 milliseconds in accordance with the present invention when four flash devices are employed , whereas the same time frame is 8 milliseconds for prior art erase operations . this results in an overall system performance improvement of approximately 20 %. when using two flash chips , the inventors &# 39 ; experience has been that the time for performing an erase operation , measured as indicated by 314 but for two devices , is reduced from 4 to 2 . 3 milliseconds in accordance with the present invention . in fact , the more flash devices being employed , the more time is saved for performing an erase operation with the use of the structure and methods of the present invention . to give the reader some perspective regarding the relationship between the pba ( in table 1 for example ) and the signals shown in fig3 the chip select signals and other addressing information , such as block and sector address are derived from the pba . as noted with respect to table 1 earlier , ` c ` s indicate chip select and if only two flash devices are being employed , cle0 and cle1 signals are developed from the value of the ` c ` s . in this example , a two - bit ( or ` c ` s ) would be required and if these two bits are at logic state ` 0 `, then the cle0 signal is activated and if they are at logic state ` 1 `, then the cle1 signal is activated and if they are at logic state ` 2 `, the cle2 signal is activated and if they are at logic state ` 3 `, the cle3 signal is activated . similarly , the ` b ` s and ` s ` s form the address signals 308 . fig4 a and 4b illustrate a flow chart showing the steps performed by the controller 14 ( shown in fig1 ) when writing one sector of information to the memory unit 16 ( shown in fig1 ). these steps may be performed by hardware or software ( firmware ). in one embodiment of the present invention , these steps are performed by the microprocessor circuit 24 by executing the firmware code stored in the volatile storage unit 26 . in fig4 a , at step 400 , the host 12 ( in fig1 ) sends and the controller 14 receives a chs address where the host is interested in writing data within the memory unit 16 . the controller 14 checks the received chs address at 402 to determine whether or not the address is valid . upon power - on , the host will issue an identification command . this command will return memory card parameters ( maximum cylinder , head , sector and track information including maximum lba value ). if the received chs address is not a valid address , the controller 14 returns an error message back to the host . if on the other hand , the received address is valid , the process continues to step 406 . at step 406 , the controller 14 calculates a lba from the chs address that was sent by the host . this calculation is done in accordance with equation 1 as recited hereinabove . next , at step 408 , a particular location of buffer is preserved for storing the data that is to be later programmed into the memory unit 16 . this particular buffer area is not shown in fig1 although it is composed of ram . at step 410 , the lba is translated to vlba . this is done by logically ` anding ` the lba with a hexadecimal value ` 0x3ffff0h .` essentially by doing so all of the bits in the lba are preserved except for the four least significant bits . this is for the case where 16 sectors per block are employed . in the case where there are 32 sectors per block being used , the vlba is calculated by logically ` anding ` the lba by the hexadecimal value 0x3fffe0h . this preserves the lba except for the five least significant bits , and in the case where there are 64 sectors per block , the vlba is calculated by logically ` anding ` the lba by the hexadecimal value 0x3fffc0h where all of the lba bits are preserved except for the six least significant bits thereof . in cases where other sector sizes are being employed the calculation of vlba is performed in a similar fashion . at step 412 , in fig4 a , the data that is to be written to the memory unit 16 is written by the host to a buffer located within the controller . at 414 , the vlba is checked to determine whether the address that the host is currently interested in writing to has been previously written . if so , that is , if the address is one that has been previously written , then at step 416 the vpba is obtained from the lut using the vlba as explained hereinabove . the process then continues to step 420 where the block that was checked at 414 is marked as ` old ` and the process then continues to step 418 . the sector information is that portion of the lba that was earlier masked . in other words , the four least significant bits that were masked at step 410 are now appended to the vpba to obtain pba . referring back to 414 , if the lba is not one that was previously written , then at step 418 , which is where the process continues from step 420 as well as from 414 , a search is performed by the space manager to obtain a free block for writing thereto . at step 422 , the ` used ` flag is set to indicate that the block is now in use and contains data and then a write operation is performed to write the data into the appropriate vpba . at step 424 , the pba is converted to a fap ( flash address pointer ) value . the fap serves as a value that identifies the particular chip , the non - volatile device , within the memory unit 16 being written to and the particular sector therein that is being written thereto . for example , the fap value is broken down such that the four most significant bits of the pba value indicate the chip select . the next nine bits indicate the sector select value and the least four significant bits of the pba indicate the offset . in this example , the fap has a 17 bit value . at step 426 , data is written to the appropriate sector , as defined by the fap , of one of the non - volatile memory devices of the memory unit 16 , and at step 428 a check is performed for errors that is , the hardware or firmware will issue a command to read the flash status and if the flash reports that the write operation completed successfully , there is no error reported , otherwise , failure to successfully program the flash device is reported as an error . if the outcome of the error check at step 428 is such that an error is detected , the process continues to 430 where the block is considered defective and designated as no longer being used and another block is searched for writing thereto . if , on the other hand , the error check at step 428 is determined to yield a result where no errors are detected the process continues to step 432 where the remainder of the cluster or block is moved to the block where the host data was written , and at step 434 the old cluster or block is erased . in fig4 b , after the old cluster or block is erased again as shown at step 436 , the process continues to step 438 where the parallel erase chip counter is set . thereafter , at 440 , the pba value is converted to fap and at step 442 an erase flash command is issued by the controller 14 . at step 444 , the pba value is increased to indicate the next non - volatile memory device within the memory unit 16 and the erase counter which was set at step 438 is decremented by one at step 446 and checked as to whether it is equal to zero after it has been decremented . if at step 446 it is determined that the erase counter is not equal to zero the process goes back to step 440 and continues on through steps 440 through 446 until the erase counter is equal to zero . once the erase counter is equal to zero the process continues to 448 . the ready / busy * signal 310 is checked . if the signal indicates that the memory unit 16 is busy , in other words , if the ready / busy * signal 310 is zero , the process continues back to step 448 and loops onto itself until the signal 310 indicates ready , and then continues to step 450 . next the process continues to step 450 where the erase counter is set . thereafter , at step 452 the read status command is issued and the process continues to 454 where error is checked therefor . if no errors are reported the process continues to step 458 . if an error exists the test continues to 456 where an error message is returned . at step 458 , the erase counter that was set at step 450 is decremented and checked against zero . if the erase counter is equal to zero the process continues to 460 where essentially the erase operation is completed , and if the erase counter is not equal to zero after it has been decremented , the process continues to step 452 where steps 452 through 458 are repeated until the erase counter is set equal to zero . this completes the steps performed during a write operation of the sector in accordance with an embodiment of the present invention . fig5 shows an example of the contents of the lut as it relates to the memory unit 16 . in this example a 160 mb memory unit is employed and on the left hand side of fig5 there is shown a column that is the vlba whose values are used to look up information in the lut . in the lut , there is maintained the vpba information . each of the vlbas corresponds to a vpba . each of the vpba values corresponds to four blocks that make up a super block within the flash devices of the memory unit 16 which is shown on the right hand side of fig5 under the pba column . for example , a vlba value of zero corresponds to a vpba value of zero which then corresponds to four blocks that are blko . each block will be within one flash or non - volatile memory device . this is indicated by the arrows extending from vpba value zero which is the first entry in the lut to each of the flash devices 0 - 3 . as another example , a vlba value of 200 in hexadecimal notation corresponds to vpba value of 20 in hexadecimal notation which is then used to point to block one of each of the flash devices zero through three , or each of the four flash devices . each flash device has blocks therein . it should also be noted that while not shown in fig5 the fap value is calculated from the pba value and appended to the lba offset value . although the present invention has been described in terms of specific embodiments it is anticipated that alterations and modifications thereof will no doubt become apparent to those skilled in the art . it is therefore intended that the following claims be interpreted as covering all such alterations and modification as fall within the true spirit and scope of the invention . | 6 |
the following symbols are used in the figures to indicate general characteristics of the system : in fig8 ; 10 ; 10 , examples 1 and 2 ; 12 ; 12 , examples 1 ; 13 ; 13 , examples 1 - 7 ; 14 ; 14 , example 1 ; 18 ; 20 ; 22 ; 23 ; 25 ; 25 , example 1 , a long horizontal line symbolizes a template . coding region 1 symbolizes sequences that anneal to type 1 building blocks . building blocks are symbolized as shown in fig4 - 7 . x / y , s / t and p / q represent pairs of reactive groups ( where the reactive groups of one pair ( e . g . x and y ) are partly or fully orthogonal to the reactive groups of other pairs ( e . g . s / t , p / q )). r 1 , r 2 , . . . , r x symbolize functional groups . l 1 and l 1 , l 2 , l 3 , . . . represent cleavable linkers , where linkers of one group ( e . g ., l 1 - linkers ) are cleavable under conditions where linkers of other groups ( l 2 , l 3 . . . ) are not cleaved , or are cleaved less efficiently . the proximity effect that results from incorporating two building blocks on the same template , or alternatively , as a result of incorporating a building block on a template to which is attached a reactive group , may be enhanced by any of the methods described above or below that increases this effect . for example , in order to increase the efficiency and specificity of templated synthesis , the proximity effect may be increased by the introduction of zipper boxes in most of the general concepts described here . in all the examples , the templated molecule may be coupled to the template through the non - covalent interaction of a monomer building block with the template , or alternatively , through covalent or non - covalent coupling to the template , and may be located at either of the ends of the template , or anywhere on the template . the coupling reaction to the template may be performed before , during or after the synthesis of the templated molecule . for clarity , in some of the figures only the reaction step , not the cleavage step , has been included . the figures included have been drawn so as to highlight specific set - ups . obviously , any combination of the methods may be employed , in order to make linear , as well as non - linear molecules , to use reactive groups that lead to simultaneous cleavage , as well as reactive groups that do not lead to simultaneous cleavage , to use cleavable and non - cleavable linkers etc . the protocol for an embodiment of a multi - step templated synthesis is shown in fig1 and involves a number of steps that each result in the addition of one or more molecular moieties to a growing molecule that eventually becomes the templated molecule . each of these steps can be divided into substeps . initially , a number of templates ( also called a library of templates ) are provided . each of the templates comprises a plurality of unique codons and a reactive group . also , a plurality of different building blocks are provided , each of the building blocks comprises a functional entity separated from an anti - codon with a suitable linker . the anti - codon of a specific building block complements a unique codon of a template and is , therefore , capable under proper hybridisation conditions to anneal to the unique codon . the incorporation of building blocks is initiated by contacting the plurality of different templates with a subset of the entire amount of building blocks . the subset carries anti - codons which hybridise to unique codons of a distinct coding region . a connection between the reactive group of the template and the functional entity of the building blocks is obtained . in fig1 the reactive group of the template is part of a building block ( building block 1 ) and the said building block is hybridised to the template . in a preferred embodiment the building block 1 comprising the reactive group of the template and the second building block are contacted with the template simultaneously to allow for an efficient connection between the functional entities . the line between fe 1 and fe 2 symbolise a direct connection between the functional entities or an indirect connection via a bridging molecule entity . the molecule part formed by a connection of fe 1 to fe 2 is a nascent templated molecule , which may be added further functional entities resulting in a growing nascent templated molecule . the propagation part of the method starts with the incorporation of a further building block ( building block 3 ). the incorporation involves the hybridisation of a subset of the building blocks to the plurality of templates bearing the nascent templated molecule . the subset of building blocks is selected to have anti - codons which complement unique codons of the templates , said unique codons being in the vicinity of , preferably neighbouring to , unique codons hybridised to the building block ( s ) bearing the templated molecule . the functional entity of the further building block is able to form a chemical connection to the nascent templated molecule through the reaction of a reactive group attached to the functional entity . the linkage between one or more of the functional entities and the corresponding anti - codons may be cleaved if desired and the incorporation of a new building block may be performed . in the example illustrated in fig1 only three functional entities are connected in the templated molecule . however the propagation step may be conducted as many times as appropriate to obtain the desired templated compound . as a terminal phase the linkers connecting functional entities / templated molecule and anti - codons may be cleaved . the complex comprising the templated molecules ( specific compositions or sequences of molecular moieties , the identity of which is determined by the template ) attached to the templates that templated their synthesis , can now be taken through a screening process . this process leads to an enrichment of templated molecules complexes with appropriate characteristics . the isolated complexes may now be enriched by amplification of the templates , and a new round of templated synthesis and screening can be performed . eventually , the templated molecules may be identified by characterization of the corresponding templates . the stages of the process involving incorporation of building blocks may be mediated by chemicals , or enzymes such as polymerase or ligase . for example , the anti - codon part of the building blocks may be nucleotide - derivatives that are incorporated by a polymerase . incorporation may also be solely by hybridization of building blocks to the template . if the template is a dna molecule , the template may comprise primer binding sites at one or both ends ( allowing the amplification of the template by e . g . pcr ). the remaining portion of the templates may be of random or partly random sequence . the reaction stage of the method involves reactions between the incorporated building blocks , thereby forming chemical connections between the functional entities . the chemical connection can be a direct chemical bond or the connection can be established through a suitable bridging molecule . the optional cleavage step involves cleaving some , all but one , or all of the linkers that connect the functional entities and anti - codons . in fig1 the templated molecule is displayed by cleaving the linkers of the second and third functional entities , while maintaining the linker from the first building block . subsequent to the production of library according to the invention a selection is performed . the selection or screening involves enriching the population of template - templated molecule pairs for a desired property . for example , passing a library of templated molecule - template complexes over a solid phase to which a protein target has been immobilized , and washing unbound complexes off , will enrich for complexes that are able to bind to the protein . the selection may be performed more than once , for example with increasing stringency . between each selection it is in general preferable to perform an amplification . the amplification involves producing more of the template - templated molecule complexes , by amplification of the template or complementing template , and producing more of the template - templated molecule pairs , for further rounds of selection / screening , or for sequencing or other characterization . for example , if the template is a dna strand , the template may be amplified by pcr , where after the templated synthesis can be performed using the amplified dna , as described above . cloning and sequencing may also be useful techniques and involve the cloning of the isolated templates or complementing templates , followed by characterization . in some cases , it may be desirable to sequence the population of isolated templates or complementing templates , wherefore cloning of individual sequences is not required . in fig2 , in the upper part of the figure , the general structure of a template is shown . the templates comprise x coding regions . each coding region has a unique sub - structure which differentiates it from some or all of the other coding regions . shown below the general structure of a template are specific templates . a given specific template carries a specific set of x unique codons . a unique codon specifies ( by way of interaction with a specific anti - codon of a building block ) a specific functional entity . the unique codons 1 . 1 , 1 . 2 , 1 . 3 , . . . , 1 . m are all examples of coding region 1 sequences . the general design of the templates therefore enables the templated incorporation of building blocks , in the sense that a sub - set of building blocks can be added that will only be incorporated at the same position on the template ( i . e ., coding region 1 if the building blocks have anti - codons that are complementary to the unique codons of codon region 1 ). fig3 shows an example of a design of templates and anti - codons for oligonucleotide - based building blocks . section a discloses the general structure of a set of templates carrying 6 coding regions , each containing a partly random sequence ( x specifies either c or g ), and a constant sequence that is identical for all sequences in the group ( e . g ., all coding region 1 sequences carries a central atattt sequence ). by using c and g only ( or , alternatively , a and t only ), the building blocks that are complementary to coding regions 1 have very similar annealing temperatures wherefore misannealing is insignificant . the attachment point of the linker that connects the anti - codon and the functional entity is not specified in the figure . ideally , the linker is attached to the constant region of the anti - codon , in order to avoid bias in the annealing process . section b of fig3 shows examples of codon and anti - codon sequences . example codon 1 and codon 6 sequences are shown . the example codon 1 sequence represents one specific sequence out of 1024 different sequences that anneal specifically to the complementary anti - codon 1 sequences ; the example codon 6 sequence represents one specific sequence out of 128 different sequences that anneal to the complementary anti - codon 6 sequences . fig4 illustrates different general designs of building blocks . a building block comprises or essentially consists of a functional entity , connected through a ( cleavable ) linker to an anti - codon . panel a shows a building block with one reactive group ( x ), connecting the , functional group ( r x ) with the anti - codon . this type of building block may be used for the simultaneous reaction and cleavage protocol ( e . g . fig9 and 15 ). the functional entity in this example comprises one reactive group , and a functional group r x , also called a functionality . the reactive groups typically become part of the templated molecule . panel b shows a building block with two reactive groups ( x and y ), connecting the anti - codon and the functional group ( r x ). the functional entity in this example comprises two reactive groups that are both part of the moiety that links the anti - codon and functional group , r x . panel c shows a building block with a reactive group ( x ) connecting r x and the anti - codon , and a reactive group ( y ) attached to the r x group . this type of building block may be used in the simultaneous reaction and cleavage protocol ( e . g ., fig9 and 10 ). the functional entity comprises two reactive groups x and y , where x is part of the linker , and y is attached to the functional group r x . panel d shows a building block with one reactive group ( x ). the reactive group ( x ) does not link the functional group ( rx ) and the complementing element . a cleavable linker ( l ) is provided in order to release the functional entity from the anti - codon . this type of building block may be used in protocols that require cleavage of the linker after the reactive groups of the functional entities have reacted ( e . g ., fig1 ). panel e disclose a building block with four reactive groups and a functional group rx . the four reactive groups and the functional group rx may serve as a scaffold , onto which substituents ( encoded by building blocks bound to codons on the same template ) are coupled through reaction of reactive groups ( x ) of other building blocks with the reactive groups ( y ) ( e . g ., fig1 ). in this example , no cleavable linker is indicated . therefore , after the templating reactions the templated molecule is attached to the template through the linker of this building block . in fig5 three different building blocks are depicted . building block a comprises an anti - codon ( horizontal line ), which may be an oligonucleotide , to which a linker carrying the functional entity is attached to the central part . the portion of the linker marked “ a ” may represent a oligonucleotide sequence to which a single stranded nucleotide may be annealed in order to make the linker more rigid , or alternatively , “ a ” may represent a zipper box sequence of nucleotides or other type of zipper box moiety . the vertical line may represent a peg ( polyethylene glycol ) linker , oligonucleotide linker , or any other linker that provides the functional entity with the appropriate freedom interact productively with a functional entity of a building block annealed to the same template during the templating process . in building block , the linker is attached to the terminus of the anti - codon . the anti - codon and the linker may be one continuous strand of an oligonucleotide . the horizontal part here represents the anti - codon , and the vertical part represents the linker . the linker may contain a moiety “ a ” that functions as a zipper box ( see fig2 ), a rigid linker , or an annealing site for another entity that rigidifies the linker upon annealing . in building block c of fig5 the linker and anti - codon may be a continuous strand of an oligonucleotide . attached to the linker is a nucleophile “ nu ” which may react with a functional entity . this may be used as an anchorage point for the templated molecule . building block c may preferably be used as the starting or the terminal building block . when used in the initial stage of the production of the complex comprising the templated molecule , building block c may provide the template with a reactive group to which the functional entities may be attached in the growing templated molecule . in a further embodiment of the invention “ nu ” of building block c represents any reactive group able to participate in a reaction resulting in the formation of a connection to a functional entity of a building block . fig6 shows five different general methods for the preparation of building blocks . the general methods involves the coupling of the functional entities to oligonucleotide - based building blocks . reactions and reagents are shown that may be used for the coupling of functional entities to modified oligonucleotides ( modified with thiol , carboxylic acid , halide , or amine ), without significant reaction with the unmodified part of the oligonucleotide . as an alternative approach , the functional entity may be synthesized as phosphoramidite precursor , which can then be used for oligonucleotide synthesis by standard methods , resulting in an oligonucleotide - derivative carrying a functional entity . fig7 shows the design and synthesis of exemplary building blocks . panel a shows a general synthesis scheme for building blocks using dna oligonucleotide as codon , and coupling amines and carboxylic esters . the oligonucleotide is purchased with an amine coupled to e . g . the base at a terminal position of the oligo . by addition of edc ( 1 -( 3 - dimethylaminopropyl )- 3 - ethylcarbodiimide hydrochloride ) and nhs ( n - hydroxysuccinimide ), the oligonucleotide is coupled to the building block through an amide bond . panel b shows specific synthesis schemes for the generation of specific classes of building blocks . fig8 illustrates an embodiment for the templated synthesis of a polymer . x and y are reactive groups of the functional entity . x and y may be different kinds of reactive groups ( e . g ., amine and carboxylic acid ), of the same kind but different ( e . g ., different primary amines or a primary amine and a secondary amine ), or identical . reaction of x with y to form xy either happens spontaneously when the building block has been incorporated , or is induced by a change of conditions ( e . g . ph ), or by the addition of an inducing factor ( chemical or uv exposure , for example ) fig8 , ex . 1 . shows light - induced reaction between symmetric coumarin - derivatives . light - induced reaction of the coumarin units , followed by cleavage of the linker , result in a ring structure . examples of functional groups ( phosphate and carboxylic acid ) are shown . the building blocks are said to be symmetric because the two reactive groups , two coumarin units , are of the same reactivity ( in fact , in this example are identical ). fig9 shows an embodiment - for templated synthesis of a polymer . a population of templates , each carrying four codons are incubated with two sets of building blocks ( carrying anti - codons 1 and 2 , respectively ), at a temperature that ensures efficient and specific annealing of anti - codons type 1 to coding regions 1 , and efficient and specific annealing of anti - codons type 2 to coding regions 2 . after annealing , the excess building blocks may optionally be removed . if desired , reactive groups may be deprotected ( and thus activated for reaction ) at this step . then building block - template complexes are incubated under conditions that allow the reactive groups of the building blocks ( i . e ., reactive groups x and y ) to react . this leads to a transfer of the functional group r1 from building block 1 to building block 2 , and thus results in the formation of a dimeric polymer carrying two functional groups , r1 and r2 . the process is then repeated , i . e . a third monomer ( with anti - codon type 3 ) is added , and after annealing to coding region 3 , excess building block is removed , and the reaction between x and y now leads to the formation of a trimeric polymer , coupled to the building block annealed to coding region 3 . once more , the process is repeated with building blocks of type 4 , resulting in the formation of a tetrameric polymer . the reactive groups x and y used in this scheme thus have two functions : i ) reaction between x and y leads to coupling of the corresponding functionalities ( e . g ., r1 and r2 ), and simultaneously , ii ) the linker between r1 and the anti - codon is cleaved . examples of reactive groups x and y with such characteristics ( i . e ., the ability to simultaneously react and cleave ) are shown in fig2 . by appropriate choice of x and y , the nascent polymer is migrated down the template , from building block to building block , as it is being synthesized . for example , by choosing x = ester ( coor ), and y amine ( nh 2 ), the nucleophilic attack of the amine on the ester leads to transfer of the upstream functionality ( e . g ., r 1 ) to the downstream building block ( e . g ., carrying anti - codon type 2 ). this ensures the highest possible effect of proximity with this set - up ( i . e ., in each step , the reacting x and y are carried on neighbouring monomers ). if desired , the templated polymer may be coupled to the template through the non - covalent interaction of a building block with the template ( in the example given , through the interaction of building block 4 with the template ), or alternatively , through covalent coupling to a reactive group on the template , located at either of the ends of the template , or anywhere on the template sequence . in the latter case , the coupling reaction to the template may be performed before , during or after the synthesis of the polymer . fig1 shows the templated synthesis of a mixed polymer . the most noticeable difference , when compared to the embodiment shown in fig9 is that the reactive groups on the individual building blocks are different . the pairs of reactive groups ( x / y , s / t , and p / q ) are chosen so that the reaction of x and y , s and t , p and q , respectively , results in transfer of a functional group from one building block to another ( i . e ., the reaction both mediates the coupling of the two functional groups and the cleavage of the linker that initially connects one of the functional groups to the anti - codon ). example pairs of reactive groups that mediate this simultaneous reaction and cleavage are shown in fig2 . fig1 , example 1 shows two methods of obtaining different classes of compounds using simultaneous reaction and cleavage . in panel a , the formation of an alpha - peptide is disclosed and in panel c the synthesis of a polyamine is shown . in panel a , two building blocks are incorporated by hybridization to the template . one of the building blocks is an oligonucleotide to which has been appended a thioester . the other building block is an oligonucleotide to which has been appended an amino acid thioester . the amine of the latter building block attacks the carbonyl of the other building block . this results in formation of an amide bond , which extends the peptide one unit . when the next amino acid thioester building block is incorporated , this may attack the thioester carbonyl , resulting in cleavage of the dipeptide from the anti - codon , to form a tripeptide . this process is repeated until the desired peptide has been generated . importantly , as the reaction in each step is between the incoming subunit - precursor and the subunit of the nascent polymer that is closest to the linker that connects it to the anti - codon , the geometry of the nucleophilic attack remains unchanged . the reactivity of the amine with the ester may be tuned in several ways . parameters that will affect the reactivity include : ( i ) ph and temperature , ( ii ) nature of ester ( thio -, phosphor or hydroxy - ester ); ( iii ) the nature of the substituent on the sulfur ( see panel b below ). the general scheme presented here can be applied to most nucleophilic reactions , including formation of various types of peptides , amides , and amide - like polymers ( e . g ., mono -, di -, tri -, and tetra - substituted α -, β , γ -, and ω - peptides , polyesters , polycarbonate , polycarbarmate , polyurea ), using similar functional entities . panel b shows four different thioesters with different substituents on the sulphur and therefore different reactivity towards nucleophiles . panel c relates to the formation of a polyamine . using the same principle as in ( a ), a polyamine is formed . fig1 , example 2 shows simultaneous reaction and cleavage for two reactions . in reaction a a peptoid or an a - or p - peptide is formed , and in reaction b a hydrazino peptide is formed . in reaction a , two building blocks are initially incorporated , one of which carries both a nucleophile ( an amino group ) and an electrophile ( e . g . an ester ); the other building block only carries an electrophile ( e . g . a thioester ). as a result , the nucleophilic amine will attack the electrophile of the building block attached to the same template . as a result , a dimeric structure is formed , linked to building block that initially carried the amine . upon sequential addition of building blocks , the linear structure grows , and eventually the desired templated molecule ( a peptoid or an α - or β - peptide ) has been formed . the reaction b follows the same line as in a , except that hydrazine - peptide precursor building blocks are used , leading to the formation of hydrazino peptides . fig1 shows a general reaction scheme for templated synthesis of a polymer , using non - simultaneous reaction and cleavage . in this scheme , the reaction of the reactive groups ( e . g ., x and y ) does not in itself lead to cleavage , wherefore the functional entity is coupled to the anti - codon via a cleavable linker . therefore , each addition of a subunit to the growing polymer involves two steps . first , the reactive groups x and y react to form a bond xy . then , in a separate step , a cleavable linker l is cleaved , which releases one of the functional entities from the anti - codon . by alternating between two types of cleavable linkers ( cleavable under different conditions ) one may achieve migration of the nascent polymer down the template , like described in fig9 and 10 . this ensures the highest possible effect of proximity with this set - up ( i . e ., in each step , the reacting x and y are carried on neighbouring monomers ). in the example , some or all of the reactive pairs may be of the same kind ( e . g ., x / y = s / t = p / q ). example reactions that do not mediate simultaneous reaction and cleavage are shown in fig2 . any combination of cleavable and non - cleavable linkers may be used , dependent on the nature of the reactive groups in the functional entities ( e . g ., dependent on whether the reaction involves a release from the anti - codon ). fig1 relates to activation of reactive groups and release from anti - codon by ring - opening . reaction of the initiator with x in the ring structure opens the ring , resulting in activation of y . y can now react with x in a neighboring functional entity . as a result of ring - opening , the functional entities are released from the anti - codons . if the zipper - box principle is applied to this set - up ( where each additional building block added reacts with the nascent templated molecule attached to the initiator ), the initiator linker must carry half of the zipper ( e . g ., the “ sense strand ”), and all the building blocks must carry the other half of the zipper - box ( the “ anti - sense strand ”). fig1 , example 1 . ring - opening of n - thiocarboxyanhydrides , to form β - peptides . after incorporation of two building blocks , where one of the building blocks carry an initiator reactive group ( or incorporation of one building block next to a covalently attached initiator molecule ), the initiator is activated , for example by deprotection or by an increase in ph . the primary amine then attacks the carbonyl of the n - thiocarboxyanhydride ( nta ) unit . as a result , cso is released , and a primary amine is generated . when the next building block is incorporated , this amine will react with the nta , and eventually when all the building blocks have been incorporated and the nta units have reacted , a β - peptide will have formed . finally , the linkers that connect the β - peptide to the anti - codons are cleaved , resulting in a β - peptide attached to its template through one linker . a number of changes to this set - up can be envisaged . for example , instead of thiocarboxyanhydrides , one might use carboboxyanhydrides . the initiator might be protected with a base - or photolabile group . if a base - labile protection group is chosen , the stability of the carboxyanhydride must be considered . at higher ph it may be advantageous to use carboxyanhydrides rather than thiocarboxyanhydrides . other types of peptides and peptide - like polymers ( e . g ., mono -, di -, tri -, and tetra - substituted α -, β -, γ -, and ω - peptides , polyesters , polycarbonate , polycarbarmate , polyurea ) can be made , using a similar scheme . for example , a - peptides can be made by polymerization of 5 - membered carboxyanhydride rings . fig1 shows the principle of symmetric fill - in ( symmetric xx building blocks ). the fill - in reaction occurs between the reactive groups (“ x ” in the figure ) and bridging molecules “ y - y ” in figure ). for clarity , only the reaction ( not the cleavage ) is shown in the figure . x represents the reactive groups of the functional entity . in this case the two reactive groups are of the same kind . ( y - y ) is added to the mixture before , during or after incorporation of the building blocks . fig1 , ex . 1 shows imine formation by fill - in reaction . dialdehyde is added in excess to incorporated diamines . as a result , an imine is formed . in the example , the templated molecule carries the following functional groups : cyclopentadienyl and hydroxyl . fig1 , example 2 shows an example of amide formation using symmetric fill - in . after incorporation of two building blocks each carrying a di - amine , non - incorporated building blocks may be removed . then edc ( 1 - ethyl - 3 -( 3 - dimethylaminopropyl ) carbodiimide ), and dicarboxylic acid is added in excess to the primary amines of the building blocks . alternatively , a di -( n - hydroxy - succinimide ester ) may be added in excess . at a ph of 7 - 10 , this will lead to the formation of two amide bonds linking the functional entities . after reaction , excess reagents may be removed by dialysis , precipitation of the building blocks and template , gel filtration or by other means that separate the reagents from the building blocks . when the process of incorporation - and - reaction has been repeated a number of times , and the desired molecule has been templated , the linkers ( l ) may be cleaved , and , if functional groups have been masked by protection groups ( pg ), these functional groups can be deprotected to expose the functional groups . appropriate protecting groups would be for example boc -, fmoc , benzyloxycarbonyl ( z , cbz ), trifluoracetyl , phthaloyl , or other amino protecting groups described e . g . in ( t . w . green and peter g . m . wuts ( 1991 ), protective groups in organic synthesis ). an alternative route to amide - bonded functional entities would be to incorporate building blocks carrying di - carboxylic acids , and then add diamines , nhs and edc . alternatively , the building blocks could carry n - hydroxy - succinimidyl ( nhs ) esters , which would react with the added amines without the need to add edc and nhs . the functional entities of the incorporated building blocks react with phosgen or a phosgen - equivalent such as cdi to form a polyurea . formaldehyde may also be used . the linkers are cleaved and the protected hydroxyl is deprotected . appropriate leaving groups ( lv ) are chloride , imidazole , nitrotriazole , or other good leaving groups . fig1 , example 4 shows the formation of chiral and achiral templated molecules . in this example , the functional group rx is used as a cleavable linker , that generates the desired functional group upon activation . in both reaction a and reaction b , a urea - bond is formed . in reaction a , the functional group is attached to the backbone via a chiral carbon . the hydrogen on this carbon is drawn to emphasize this . before bond formation , there is free rotation about the bond connecting the chiral carbon and the functional group . when the reactive groups ( the amines ) react with the phosgen equivalent ( e . g ., a carbonyldiimidazole ) to form the templated molecule , the building blocks may be inserted in either of two orientations ( as indicated by the position of the hydrogen , left or right ). as a result , each encoded residue of the templated molecule will have two possible chiral forms . if the templated molecule was e . g . a pentameric polyurea ( formed from five functional entities ), this molecule would have 2 5 = 32 stereoisomers . in certain cases it may be advantageous to incorporate such additional structural diversity in the library ( for example when a low building block diversity is employed ). in other cases such additional diversity is not desirable , as the screening efficiency may become compromised , or it may become too difficult to determine the identity of a templated molecule that has been isolated in a screening process . in reaction b , the chiral carbon of reaction a has been replaced by a nitrogen . as a result , the resulting templated molecule is achiral , i . e . the template encodes one specific structure . fig1 , example 5 shows the formation of a phosphodiester bond by the principle of symmetric fill - in . the incorporated building blocks react with the activated fill - in molecule to form a phosphodiester bond . then the linkers are cleaved , releasing the templated molecule from its template . an example of an appropriate leaving group ( lv ) is imidazole . fig1 , example 6 shows phosphodiester formation with one reactive group in each building block . upon addition of a dihydroxylated compound such as 1 , 3 - dihydroxypyridine , a phosphodiester bond is formed . finally , the functional group rx is liberated from the anti - codon by cleavage of the protection groups / cleavable linker that connected it to the anti - codon . fig1 , example 7 shows the an example of a pericyclic fill - in reaction . first , two building blocks are incorporated . then 1 , 4 - benzoquinone is added in excess , resulting in the formation of a polycyclic compound . a third building block is added , reacted with the 1 , 4 - benzoquinone , and this process is repeated a number of times until the desired templated molecule has been generated . finally , all but one of the linkers that connect the templated molecule to the anti - codon , are cleaved . fig1 relates to asymmetric fill - in using xs building blocks . a fill - in reaction between reactive groups ( x and s ) and bridging molecules ( t - y ) is shown . for clarity , only the reaction ( not linker cleavage ) is shown . x and s represent the reactive groups of the functional entity . in this case the two reactive groups are not of the same kind . ( t - y ) is added to the mixture before , during or after incorporation of the building blocks . likewise , significant reaction between x and y , and between s and t may take place during or after incorporation of the building blocks . fig1 , example 1 shows an example of asymmetric fill - in by modified staudinger ligation and ketone - hydrazide reaction . the reactive groups x and s of the building blocks are azide and hydrazide . the added molecule that fills the gaps between the building blocks carry a ketone and a phosphine moiety . the reactions between a ketone and a hydrazide , and between an azide and a phosphine , are very chemoselective . therefore , most functional groups rx can be employed without the need for protection during the reactions . examples for the molecular moieties r , r1 , x and y may be found in ( mahal et al . ( 1997 ), science 276 , pp . 1125 - 1128 ; saxon et al . ( 2000 ), organic letters 2 , pp . 2141 - 2143 ). fig1 shows a general reaction scheme for templated synthesis of a non - linear molecule . a template carrying four codons is mixed with two building blocks . the functional entity of one building block comprises a reactive group x and a functional group r 1 . the other building block comprises three reactive groups y and a functional group r 2 . the building block bound to codon 2 is here called the scaffold , as the functional groups are transferred to this building block during the templating process . after incubation at a temperature that ensures efficient and specific annealing of the two building blocks to their respective codon , and optionally , excess building block has been removed , x is brought to react with one of the reactive groups y , for example by changing the conditions , by deprotecting x or y , or by simply exploiting the pronounced proximity of x and y groups when the building blocks are bound to the template . in this scheme , x and y have been chosen so as to allow simultaneous reaction and cleavage . thus , as a result of the reaction between x and y , the substituent group ( functional group ) r 1 is transferred to the scaffold . example reactive groups x and y that mediate simultaneous reaction and cleavage are given in fig2 . any pair of reactive groups x and y that mediates simultaneous reaction and cleavage can be used in this scheme , i . e ., different x / y pairs may be used at each substituent position . annealing and reacting of two more building blocks lead to the formation of a scaffolded molecule carrying three substituents ( r 1 , r 3 and r 4 ). the identity of the substituents is determined by the codons of the template to which the scaffolded molecule is attached . fig1 shows templated synthesis of a non - linear molecule , employing reactive groups of different kinds , and non - simultaneous reaction and cleavage . the reactive groups x , s , p and y , t , q may be of different kinds , and the bonds formed ( xy , st , and pq ) therefore may be of different kinds . after reaction and then cleavage of the linker l ( that attaches the functional entity of the first building block to the anti - codon ), the substituent ( functional group ) r1 is transferred to the second building block ( the scaffold ). thus , relative to the synthesis scheme of fig1 , here an additional step of linker cleavage is required . after repeating the processes of annealing , reacting and cleavage a number of times , a scaffolded molecule has been formed carrying encoded substituents . the identity of the substituents is determined by the codons of the template to which the scaffolded molecule is attached . the position of the substituents are determined by the identity of the reactive groups y , t and q of the scaffold , and therefore indirectly determined by the identity of the codon to which the scaffold building block anneals . therefore , in this set - up , the identity and position of the substituents , as well as the identity of the scaffold , is determined by the sequence of the template . the reactive pairs may also be of the same kind ( e . g ., x / y = s / t = p / q ). fig1 discloses the principle of templated synthesis of a non - linear molecule , by exploiting the increased proximity effect that arises from a “ migrating ” scaffold . in this set - up , the templated molecule migrates down the template as it is being synthesized . this is made possible by the use two different linkers l x and l y , cleavable under different conditions . as a result , a high proximity is maintained throughout the templating process , as the building blocks that react in each reaction step are bound to adjacent coding regions on the template . fig1 shows the templated synthesis of various non - linear molecules . ( a ) three building blocks are added and reacted one at a time . each building block comprises an activated ester ( reactive group , ( x )) where the ester moiety carries a functional group rx . upon reaction between the esters and the amines on the scaffold ( scaffold is covalently attached to the template ), amide bonds are formed , and the rx groups are now coupled to the scaffold via amide bonds . this is thus an example of simultaneous reaction ( amide formation ) and cleavage ( release of the rx moiety from the anti - codon ), see e . g . fig1 . ( b ) analogously to ( a ), three amines react with three esters to form three amide bonds , thereby coupling the functional groups rx to the scaffold moiety . however , as opposed to ( a ), the scaffold is here encoded by the template , and therefore the scaffold is here part of the functional entity of a building block . ( c ) three building blocks are used . the nucleophilic amine ( covalently attached to the template ) attacks the ester carbonyl of the building block bound to coding region 3 ; the amine of the third monomer attacks the thioester of the next incorporated building block , and after incorporation of the third building block , the horner - wittig emmans reagent of the building block reacts with the aldehyde of the third monomer under alkaline conditions . this forms the templated molecule . the double bond may be post - templating modified by hydrogenation to form a saturated bond , or alternatively , submitted to a michael addition . ( d ) the thiol of the scaffold reacts with the pyridine - disulfide of the incorporated building block . the amine of the scaffold reacts with the ester of the second incorporated building block . the double nitrile - activated alpha - position is acylated by the thioester of the next building block in the presence of base . finally , the aryliodide undergoes suzuki coupling with the arylboronate of monomer 4 to yield the biaryl moiety . ( e ) the incorporated building block acylates one of the primary amines . the aryliodide undergoes a suzuki coupling by reaction with the next building block , and the benzylic amine is acylated by last incorporated building block . ( f ) acylation of the hydrazine followed by cyclization leads to formation of a hydroxypyrazole . after incorporation of the second building block , the arylbromide undergoes suzuki coupling with the aryl boronate . finally , the aldehyde reacts with the horner - wittig - emmons reagent of the building block that is next incorporated , to yield an alpha , beta - unsaturated amide , which may be further modified or functionalized by either reduction with h 2 / pd — c or michael addition with nucleophiles . alternatively , a fourth building block might be used to template the coupling of a nucleophilic substituent at the double bond position . fig1 shows a general procedure of templated synthesis , wherein the reaction step may be performed under conditions where specific annealing of building blocks to the template is inefficient . it may be desirable to perform the reaction step ( or one of the other steps ) under conditions where annealing of building blocks is in - efficient . to solve this potential problem , one may covalently link the incorporated building blocks , either chemically or by using a ligase ( when the anti - codon comprises an oligonucleotide ) or a polymerase ( when the anti - codon is e . g . a nucleotide ). in this set - up , the template is designed to fold back on itself . in step 1 , the two incorporated building blocks are incorporated and may be ligated together , and be linked to the template , during or after their incorporation . if desired , the conditions may now be changed to increase the efficiency of the reaction step that follows . then , in step 2 , the reactive groups x and y are brought to react . because the building blocks are covalently attached to each other ( and to the template ), the reaction can be performed under conditions where annealing of the building blocks to the template is inefficient . reaction conditions that may not be compatible with efficient annealing and double helix structure include organic solvents , low salt and high temperature , all of which may be used with the set - up described in this figure . after step 2 ( reaction ), the conditions are changed again , in order to allow efficient incorporation and covalent linkage of the next building block ( step 3 ). this cycling between conditions that allow incorporation and ligation , and that allow reaction , is continued until the desired number of building blocks have been incorporated and reacted . finally , some of the linkers are cleaved to give the templated molecule . as described above , the covalent coupling of the building blocks to each other allows the reaction between their reactive groups to be performed under more diverse conditions than would otherwise be possible . in addition , covalent coupling between building blocks makes it possible to use anti - codons comprising shorter recognition sequences . when the anti - codon comprises an oligonucleotide , it is generally preffered to use an oligonucleotide of at least fifteen nucleotides during incorporation , in order to obtain high efficiency of incorporation . however , if a ligase or chemical is used to covalently couple the building blocks , a shorter oligonucleotide ( 4 - 8 nucleotides ) may be used . this will bring the reactive groups x and y into closer proximity , and increase the local concentration of rective groups dramatically : if the distance between the reactive groups is decreased from 16 nucleotides to 4 nucleotides , this will increase the local concentration 4 3 = 64 . everything else being equal , this will increase the rate of the reaction by 64 - fold . in order to change between conditions that allow incorporation and covalent coupling between building blocks , and conditions that allow the reaction to occur efficiently , the templates may be attached to a solid phase material ( e . g ., streptavidin beads if the templates are biotinylated ), or the templates ( with the building blocks associated to them ) may be precipitated and resuspended in appropriate buffer during the steps of incorporation and reaction . fig2 shows various reaction types allowing simultaneous reaction and activation . different classes of reactions are shown which mediate translocation of a functional group from one monomer building block to another , or to an anchorage point . the reactions have been grouped into three different classes : nucleophilic substitutions , addition - elimination reactions , and transition metal catalyzed reactions these reactions are compatible with simultaneous reaction and activation . ( a ) reaction of nucleophiles with carbonyls . as a result of the nucleophilic substitution , the functional group r is translocated to the monomer building block initially carrying the nucleophile . ( b ) nucleophilic attack by the amine on the thioester leads to formation of an amide bond , in effect translocating the functional group r of the thioester to the other monomer building block . ( c ) reaction between hydrazine and β - ketoester leads to formation of pyrazolone , in effect translocating the r and r ′ functional groups to the other monomer building block . ( d ) reaction of hydroxylamine with β - ketoester leads to formation of the isoxazolone , thereby translocating the r and r ′ groups to the other monomer building block . ( e ) reaction of thiourea with β - ketoester leads to formation of the pyrimidine , thereby translocating the r and r ′ groups to the other monomer building block . ( f ) reaction of urea with malonate leads to formation of pyrimidine , thereby translocating the r group to the other monomer building block . ( g ) depending on whether z ═ o or z ═ nh , a heck reaction followed by a nucleophilic substitution leads to formation of coumarin or quinolinon , thereby translocating the r and r ′ groups to the other monomer building block . ( h ) reaction of hydrazine and phthalimides leads to formation of phthalhydrazide , thereby translocating the r and r ′ groups to the other monomer building block . ( i ) reaction of amino acid esters leads to formation of diketopiperazine , thereby translocating the r group to the other monomer building block . ( j ) reaction of urea with α - substituted esters leads to formation of hydantoin , and translocation of the r and r ′ groups to the other monomer building block . ( k ) alkylation may be achieved by reaction of various nucleophiles with sulfonates . this translocates the functional groups r and r ′ to the other monomer building block . ( l ) reaction of a di - activated alkene containing an electron withdrawing and a leaving group , whereby the alkene is translocated to the nucleophile . ( m ) reaction of disulfide with mercaptane leads to formation of a disulfide , thereby translocating the r ′ group to the other monomer building block . ( n ) reaction of amino acid esters and amino ketones leads to formation of benzodiazepinone , thereby translocating the r group to the other monomer building block . ( o ) reaction of phosphonates with aldehydes or ketones leads to formation of substituted alkenes , thereby translocating the r ″ group to the other monomer building block . ( p ) reaction of boronates with aryls or heteroaryls results in transfer of an aryl group to the other monomer building block ( to form a biaryl ). ( q ) reaction of arylsulfonates with boronates leads to transfer of the aryl group . ( r ) reaction of boronates with vinyls ( or alkynes ) results in transfer of an aryl group to the other monomer building block to form a vinylarene ( or alkynylarene ). ( s ) reaction between aliphatic boronates and arylhalides , whereby the alkyl group is translocated to yield an alkylarene . ( t ) transition metal catalysed alpha - alkylation through reaction between an enolether and an arylhallide , thereby translocating the aliphatic part . ( u ) condensations between e . g . enamines or enolethers with aldehydes leading to formation of alpha - hydroxy carbonyls or alpha , beta - unsaturated carbonyls . the reaction translocates the nucleophilic part . ( v ) alkylation of alkylhalides by e . g . enamines or enolethers . the reaction translocates the nucleophilic part . ( w ) [ 2 + 4 ] cycloadditions , translocating the diene - part . ( x ) [ 2 + 4 ] cycloadditions , translocating the ene - part . ( y ) [ 3 + 2 ] cycloadditions between azides and alkenes , leading to triazoles by translocation of the ene - part . ( z ) [ 3 + 2 ] cycloadditions between nitriloxides and alkenes , leading to isoxazoles by translocation of the ene - part . fig2 shows pairs of reactive groups ( x ) and ( y ), and the resulting bond ( xy ). a collection of reactive groups that may be used for templated synthesis as described herein are shown , along with the bonds formed upon their reaction . after reaction , cleavage may be required ( e . g ., see fig8 ). fig2 shows a method of increasing the proximity effect of the template : the zipper - box . panel a discloses linkers carrying oligonucleotide zipper boxes ( a ) and ( b ) that are complementary . by operating at a temperature that allows transient interaction of ( a ) and ( b ), the reactive groups x and y are brought into close proximity during multiple annealing and strand - melting events , which has the effect of keeping x and y in close proximity in a larger fraction of the time than otherwise achievable . alternatively , one may cycle the temperature between a low temperature ( where the zipper boxes pairwise interact stably ), and a higher temperature ( where the zipper boxes are apart , but where the anti - codon remains stably attached to the codon of the template ). by cycling between the high and low temperature several times , a given reactive group x is exposed to several reactive groups y , and eventually will react to form an xy bond . as a final alternative , the temperature may be kept appropriately low that the two strands of the zipper - box ( a and b ) are stably associated . independent on which of these protocols is followed , the building blocks must be added to the reaction mix at an appropriately high temperature where the interaction between the codon and anti - codon is specific . once the building blocks have been specifically associated with the template , the temperature can be lowered , and the alternative protocols described above followed , in order to achieve a high reaction efficiency . when the anti - codon is an oligonucleotide ( e . g ., dna , rna ) or oligonucleotide analog ( e . g ., pna , lna ), it may be practical to use a continuous nucleotide strand , comprising both the anti - codon , linker and zipper - box ( see ( b ) below ). panel b shows sequences of two dna oligo - based building blocks . the anti - codon (“ annealing region ”), linker and zipper - box are indicated . thus , in this example , one linear dna molecule constitutes the anti - codon , the linker that connects the functional entity and the anti - codon , and the zipper - box . the reactive groups x ( a carboxylic acid ) and z ( an amine ) are coupled to the 3 ′- end of dna oligo 1 and the 5 ′- end of dna oligo 2 , respectively . a template sequence to which oligo 1 and oligo 2 would anneal might contain the following sequence : 5 ′- ccgatgcaatccagaggtcggctggatgctcgacaggtc . fig2 shows three methods of how the proximity effect can be increased : ( a ) helix stacking . two building blocks with oligonucleotide - based anti - codons anneal to their respective codons ( in the figure , the left building block is a “ scaffold ” that carries four reactive groups , and the right building block carries a functional entity with e . g . one reactive group , i . e ., the latter building block may carry the substituent that will become attached to the scaffold . double helices tend to stack , especially if the sequence of the opposing ends of the helices has been designed so as to optimize this interaction ( for example by the presence of the sequence ggg at the ends of the duplex structures ). this stacking tendency will bring the two building blocks into closer proximity , in turn increasing reaction efficiency between the functional entities . if the “ substituent - building blocks ” have anti - codons with lower melting temperatures than that of the “ scaffold - building block ”, the substituent building block may be removed after its reaction with the scaffold building block , before the next building block is incorporated . in this way , the template region between two reacting building blocks may be kept single stranded , allowing this region to loop out and let the two duplex structures stack during the reaction between the two building blocks . ( b ) ligation of building blocks . the anti - codons of two building blocks may be chemically or enzymatically ligated together . coupling of two anti - codons will increase the annealing efficiency . therefore , smaller anti - codons can be used if ligated together with the previously incorporated building block . as an example , first add a building block ( or just an 20 - nucleotide dna oligo ) with a melting temperature of e . g . 60 ° c . then add another building block ( e . g ., with a 8 - nucleotide dna anti - codon ) with a low melting temperature and therefore only capable of transiently interacting with the template at the ambient temperature . if a dna ligase is employed , or if the anti - codon can be ligated to the anti - codon of the first building block chemically , then the second building block will become firmly attached to the template , despite its short length of just 8 nucleotides . thus , ligation allows the use of shorter anti - codons , which in turn brings the reactive groups into closer proximity . ( c ) rigid linkers . by using linkers comprising one or more flexible regions (“ hinges ”) and one or more rigid regions , the probability of two functional entities getting into reactive contact may be increased . a . symbol used for building block with a rigid part and two flexible hinges . b . a building block with the characteristics described in ( a ). the building block contains a continuous oligonucleotide - strand , constituting both the anti - codon ( horizontal line ), and linker ( vertical line ) connecting the functional entity ( fe ) with the anti - codon . annealing of a complementary sequence to the central part of the linker leads to formation of a rigid double helix ; at either end of the linker a single - stranded region remains , which constitutes the two flexible hinges . fig2 discloses various cleavable linkers . a number of cleavable linkers are shown , as well as the agents that cleave them and the products of the cleavage - reaction . in addition , catalysts including enzymes and ribozymes , may also be used to cleave the linker . exemplary enzymes are proteases ( e . g . chymotrypsin ), nucleases , esterases and other hydrolases . fig2 shows two different ways of templated synthesis by generating a new reactive group . in cases where the reaction of x and y leads to formation of a new reactive group z , this may be exploited to increase the diversity of the templated molecule , by incorporating building blocks carrying reactive groups q that react with z . using this approach , the templated molecules may be very compact structures , and thus , this approach describes a method to make highly substituted ( functionalized and diverse ) libraries of molecules of relatively low molecular weight . ( a ) first , a building block carrying a reactive group x and a building block carrying a reactive group y is incorporated , whereafter x and y react , leading to the formation of the z bond . then a building block carrying a reactive group q is added , whereafter z reacts with q , to form the zq bond . in this example , both the reaction of x with y , and of z with q , are reactions that involve simultaneous reaction and cleavage . ( b ) first , a building block carrying a reactive group x and a building block carrying a reactive group y is incorporated , whereafter x and y react , leading to the formation of the z bond . then a building block carrying a reactive group q is added , whereafter z reacts with q , to form the zq bond . in this example , the reaction of z with q does not involve simultaneous cleavage , wherefore an additional step of linker cleavage is introduced . fig2 , example 1 , shows a templated synthesis by generating a new reactive group . the reaction of the functional entities of the first three building blocks leads to formation of two double bonds , which may react with two hydroxylamines carried in by the building blocks added in the latter steps , and leads to formation of an ester , which may react with the hydroxylamine , encoded by a building block . finally , the linkers are cleaved , generating the templated molecule . fig2 shows different methods of performing post - templating modifications on templated molecule . after the templating process has been performed , the templated molecules may be modified to introduce new characteristics . this list describes some of these post - templating modificiations . fig2 illustrates one preferred method for selection of template - displaying molecules . fig2 shows the proposed complexes that may form when a reaction step is performed using set - ups that allow for stacking of dna duplexes . fig2 shows a autoradiography of a polyacrylamide gel analysis of the reaction between building blocks . fig3 shows the feuston 3 functional entity as well as the feuston 5 ligand . fig3 shows an elisa analysis of the product of the two - step encoding process . in the following examples , building blocks are used which contain a zipper box adjacent to the functional entity . the zipper box sequences are underlined below . the following buffers and protocols are used in the same three examples . mix 5 pmol oligonucleotide , 2 μl 10 × phosphorylation buffer ( promega cat # 4103 ), 1 μl t4 polynucleotide kinase ( promega cat # 4103 ), 1 μl γ - 32 p atp , add h 2 o to 20 μl . incubate at 37 ° c . 10 - 30 minutes . the samples are mixed with formamide dye 1 : 1 ( 98 % formamide , 10 mm edta , ph 8 , 0 . 025 % xylene cyanol , 0 . 025 % bromphenol blue ), incubated at 80 ° c . for 2 minutes , and run on a denaturing 10 % polyacrylamide gel . develop gel using autoradiography ( kodak , biomax film ). the effect of alternating temperature on reaction efficiency in the zipper box system ah 316 : 5 ′- 6 gtaac agacctgtcgagcatccagct ah 331 : 5 ′- cgacctctggattgcatcggt gttac x ah140 : 5 ′- agctggatgctcgacaggtcaggtcgatccgcgttaccagtcttgc - ctgaacgtagtcgtccgatgcaatccagaggtcg mix 10 μl buffer a , 1 pmol ah 331 ( 32 p - labelled ), 10 pmol ah 316 , 5 pmol ah 140 , and add h 2 0 to 50 μl . anneal from 80 ° c . to 30 ° c . (− 1 ° c ./ 30 sek ). then dilute 100 times in buffer b + 50 mm dmt - mm . ( prepared according to kunishima et al . tetrahedron ( 2001 ), 57 , 1551 ) dissolved in ddh 2 o . incubate at one of 8 different temperature profiles o / n ( 6 different constant temperatures ( 15 ° c . ; 17 . 8 ° c . ; 22 . 7 ° c . ; 28 . 3 ° c . ; 31 . 0 ° c . ; or 35 . 0 ° c . ; or alternating between 10 ° c . for 5 sec . and 35 ° c . for 1 sec . ); or alternating between 20 ° c . for 5 sec . and 45 ° c . for 1 sec ). analyze by 10 % urea polyacrylamide gel electrophoresis . the polyacrylamide gel analysis showed that a more efficient reaction results from alternating the temperature between 10 ° c . and 35 ° c ., rather than performing the reaction at a constant temperature of 15 ° c ., 17 . 8 ° c ., 22 . 7 ° c ., 28 . 3 ° c ., 31 . 0 ° c ., or 35 . 0 ° c . ah36 : 5 ′- cgacctctggattgcatcggtcatggctgactgtccgtcgaatgtg - tcca gttac x ah38 : 5 ′- agctggatgctcgacaggtcccgatgcaatccagaggtcg ah51 : 5 ′- z gtaac acctgtgtaagctgcctgtcagtcggtactgacctgtcga - gcatccagct ah137 : 5 ′- acgactacgttcaggcaaga ah138 : 5 ′- tcttgcctgaacgtagtcgtaggtcgatccgcgttaccagagctg - gatgctcgacaggtcccgatgcaatccagaggtcg ah139 : 5 ′- cgacctctggattgcatcgg ah143 : 5 ′- ctggtaacgcggatcgaccttcatttttttttttttttttttttgg - ctgactgtccgtcgaatgtgtcca gttac x ah 202 : 5 ′- tctggattgcatcgg gttac x ah 270 : 5 ′- 6 gtaac gacctgtcgagcatccagct ah 286 : 5 ′- agctggatgctcgacaggtcaagtaacaggtcgatccgcgttatat - cgtttacggcattacccgtatagccgctagatgcccaaccatgacggccc atagcttgcggcttgc ah 320 : 5 ′- agctggatgctcgacaggtcaggtcgatccgcgttaccaggcccat - agcttgcggcttgctgcagtcgatggaccatgcctcttgcctgaacgta - gtcgtccgatgcaatccagaggtcg ah 321 : 5 ′- caagaggcat ah 322 : 5 ′- tcaggcaagaggcatggtcc ah 342 : 5 ′- tacttgacctgtcgagcatc gttac x ah 343 : 5 ′- 6 gtaac cagctgcaagccgcaagctatgggc oligo 1 oligo 3 experiment ( 32 p - labelled ) oligo 2 template oligo 4 oligo 5 buffer a h 2 o to 1 5 pmol 10 pmol 10 pmol 2 μl 10 μl ah 36 ah 51 ah 38 2 5 pmol 10 pmol 10 pmol 10 pmol 10 pmol 2 μl 10 μl ah 143 ah 51 ah 138 ah 139 ah 137 3 1 pmol 10 pmol 5 pmol 10 μl 50 μl ah 202 ah 270 ah 320 4 1 pmol 10 pmol 5 pmol 10 μl 50 μl ah 36 ah 51 ah 320 5 1 pmol 10 pmol 5 pmol 50 pmol 10 μl 50 μl ah 202 ah 270 ah 320 ah 321 6 1 pmol 10 pmol 5 pmol 50 pmol 10 μl 50 μl ah 36 ah 51 ah 320 ah 321 7 1 pmol 10 pmol 5 pmol 50 pmol 10 μl 50 μl ah 202 ah 270 ah 320 ah 322 8 1 pmol 10 pmol 5 pmol 50 pmol 10 μl 50 μl ah 36 ah 51 ah 320 ah 322 9 0 . 2 pmol 2 pmol 1 pmol 2 μl 10 μl ah 342 ah 343 ah 286 10 0 . 2 pmol 2 pmol 1 pmol 4 pmol 2 μl 10 μl ah 342 ah 343 ah 286 ah 356 11 0 . 2 pmol 2 pmol 1 pmol 4 pmol 4 pmol 2 μl 10 μl ah 342 ah 343 ah 286 ah 357 ah 358 anneal from 80 ° c . to 30 ° c . (− 1 ° c ./ min ). add 0 . 5 m dmt - mm . ( prepared according to kunishima et al . tetrahedron ( 2001 ), 57 , 1551 ) dissolved in h 2 o . to a final concentration of 50 mm . incubate at 10 ° c . for 5 sec . and then 25 ° c . for 1 sec . repeat o / n . in order to test the effect of stacking of dna duplexes on reaction efficiency , we designed a number of different set - ups of templates and building blocks ( see fig2 ). the following conclusions were reached : fig2 , 1 and fig2 , lane 1 : reference reaction between two building blocks annealed to adjacent sites on the template . as expected an efficient reaction is observed . in this set - up , the two building blocks anneal to the template and thereby form dna duplexes that can stack onto each other . fig2 , 2 and fig2 , lane 2 : in this set - up , the two building blocks anneal to adjacent sites on the template . however , the two dna - duplexes stack onto each other , basically forming one long dna duplex . this rigid duplex does not allow the two building blocks to bend around the flexible hinge that might otherwise be present at the connection point between the two duplexes ( i . e . the position of the nick in the dna ). consequently , no significant reaction between the two building blocks is observed . fig2 , 3 and fig2 , lane 3 ; and fig2 , 4 and fig2 , lane 4 : despite the fact that the two building blocks anneal to sites separated by 80 nucleotides , the reaction is still very efficient . we speculate that this is because of stacking , i . e . the intervening 80 nucleotides are looped out as a consequence of this , and therefore , the two functional entities are brought into close proximity . in the experiment of fig2 , lane 3 the linker that connects the functional entity to the complementing element is short ( 5 nucleotides ); in fig2 , lane 4 it is long ( 35 nucleotides ). however , both linker lengths result in an efficient reaction . fig2 , 5 and fig2 , lane 5 ; and fig2 , 6 and fig2 , lane 6 : the annealing sites and separation between them are identical to those of the experiment described above ( fig2 , 3 and 4 ; fig2 , lanes 3 and 4 ). in addition , a short oligo ( 10 nucleotides ) has been annealed to the central region of the template . this result in a drastic decrease in reaction efficiency for the building blocks with the short linkers ( lane 5 ); the reaction efficiency of the building blocks with the long linkers is only slightly affected if at all by the annealing of the short oligo . as indicated by the suggested structure of the complexes ( fig2 , 5 and 6 ), we believe this is because of stacking of the 3 dna duplexes to generate an “ extended ” duplex : the short linkers cannot reach across the extended duplex ; the long linkers can reach across the extended duplex structure and the reaction efficiency is not significantly affected . fig2 , 7 and fig2 , lane 7 ; and fig2 , 8 and fig2 , lane 8 : as immediately above , except that a 20 nucleotide long oligo is annealed to the central region of the template . in this case none of the linkers ( short or long ) can reach across the extended duplexes , and as a result no or little reaction is observed . fig2 , 9 and fig2 , lane 9 ; fig2 , 10 and fig2 , lane 10 ; and fig2 , 11 and fig2 , lane 11 : in these experiments the building blocks are oriented the “ other way ”, i . e . the linker connecting the complementing element and the functional entity is near the ends of the template . additionally , the complementing element of the left building block contains a 5 - nucleotide sequence that is complementary to other right end of the template . as a result , the building block should be capable of circularizing the template , as depicted in fig2 , 9 - 11 . these circular structures should also be stabilized by an extended duplex structure across the ends of the template . in the experiments of lanes 10 and 11 , a short oligo ( 10 nucleotides ) or two longer oligos ( each 20 nucleotides ) are annealed to the central region . this has no effect on the reaction efficiency , in correlation with the proposal that the building blocks stack onto each other through a circularization of the template , thereby bringing the functional entities into close proximity . ah136 : 5 ′- agctggatgctcgacaggtctcttgcctgaacgtagtcgtccgatg - caatccagaggtcg ah 174 : 5 ′- tacgttcaggcaagagt6cca gttac 7 ah 190 : 5 ′- z gtaac acctgptgacctgtggagcatc dry 10 nmol dna oligo ( ah174 ) and then resuspended in 50 μl 100 mm dtt ( 1 , 4 - dithio - l - threitol d - 9760 sigma ) in 50 mm phosphate buffer ph = 8 . incubate at 37 ° c . for 1 hour . purification on microspin g - 25 ( amersham biosciences , 27 - 5325 - 01 ). add 50 μl 200 mm nhm ( n - hydroxymaleimide fluka 55510 ) and incubate at 25 ° c . for 2 hours . loading of building blocks ( 4 - pentenoic - acid , β - ala - boc or ch 3 cooh ) on the nhm - dna - oligo : mix 50 μl 100 mm edc and 50 p 100 mm building block . incubate at 25 ° c . for 30 minutes . then mix 500 pmol nhm - dna - oligo ( ah174 - nhm ) and 10 μl of the edc / building block mix from above . add 100 mm mes ph = 6 to 20 μl . incubate at 25 ° c . for 5 minutes . purification on micro bio - spin chromatography columns p6 ( bio - rad 732 - 6221 ) equilibrated in 100 mm mes ph = 6 . mix 350 pmol ah136 , 300 pmol ah190 and 500 pmol building block loaded ah 174 . add buffer a to 50 μl . incubate at 10 ° c . for 5 sec . and then 25 ° c . for 1 sec . repeat o / n . purification on micro bio - spin chromatography columns p6 equilibrated in h 2 o . the transfers were analyzed by ms , see table below . transfer efficiencies of 20 - 34 % were observed . transfer efficiency 4 - pentenoic - acid β - ala - boc ch 3 cooh 33 - 34 % 20 - 23 % 29 - 33 % in this example three functional entities are transferred to an amino modified scaffold oligo by a three step reaction , and analyzed by a denaturing acrylamide gel using radio labelling . loading of functional entities on modified oligonucleotides to create building blocks . 5 nmoles of three carboxylic acid modified building block oligos [ ah 155 ; 5 ′ ctg gta acg cgg atc gac ctg tta ct - cooh 3 ′; ah 272 5 ′ acg act acg ttc agg caa gag tta ct - cooh 3 ′ and ah 202 5 ′- tct gga ttg cat cgg ctg tta ct - cooh 3 ′] ( all oligonucleotides described ordered from dna technology , aarhus , denmark ) one from each of the three positions corresponding to the template were loaded with β - alanine methyl ester coupled to allylglycine n - boc followed by boc deprotection ( β - alaome ag ). the loading was done by incubating each of the oligos with 10 mm β - alaome ag , 75 mm dmt - mm in 150 mm hepes - oh buffer , ph 7 , 5 to a final volume of 50 μl at 25 ° c . shaking overnight . then adding 5 μl 1 m nh 4 - acetate , incubated at 25 ° c . for 10 min , then spin column purified with ddh 2 o equilibrated columns ( micro bio - spin chromatography columns p - 6 , bio - rad ). the deprotection of the methyl group protected acid was done by adding 0 . 5 μl 2m naoh to the oligos and incubating for 10 min at 80 ° c . lastly the oligos were spin column purified and loadings confirmed by mass spectrophotometry . in order to be able to analyze the functional entity transfers using acrylamide gel analysis , the scaffold oligo [ mdl251 5 ′ amino - c6 dt - acc tgt cga gca tcc agc t 3 ′] was radioactively labelled in the 3 ′ end . 50 pmol of the oligo was labelled with 10 μl ddatp αp32 ( amersham biosciences ) by adding 4 μl 10 × ne buffer 4 , 4 μl 10 × cocl2 and 35 units of terminal deoxynucleotide transferase ( new england biolabs ) and water to a final volume of 40 μl . mixture incubated at 37 ° c . for 1 hour . labeled oligo purified using ddh2o equilibrated spin column . 12 . 5 pmol of the labeled scaffold oligo , 125 pmol loaded building block oligo ah 202 , corresponding to position three on the template and 62 . 5 pmol template [ ah 154 5 ′ agc tgg atg ctc gac agg tca agt aac agg tcg atc cgc gtt acc agt ctt gcc tga acg tag tcg tcc gat gca atc cag agg tcg 3 ′] was incubated in a final volume of 45 μl containing 20 mm hepes - oh ph 7 . 5 , 200 mm nacl buffer . the oligos were annealed by heating to 80 ° c . and slowely going down to 20 ° c . ( 1 °/ min ) using a thermocycler ( eppendorf , mastergradient ) following the annealing 5 μl 0 . 5m dmt - mm was added . sample crosslinked , see fig3 overnight cycling at 10 ° c . 10 sec / 35 ° c . 1 sec . the sample was spin column purified and the crosslinked product cleaved to give first transfer of β - ala to scaffold oligo amine by adding 10 μl 25 mm 12 dissolved in 1 : 1 tetrahydrofuran : h2o and incubated at 37 ° c . for 1 . 5 hours . followed by addition of 1 . 5 μl m β - mercapotethanol and then purified with two equilibrated spin columns . the sample was completely dried down and oligos redissolved in 30 μl ddh20 . transfer 2 , oligo ah 272 and transfer 3 , ah 202 were done in the exact same way as just described including the annealing , crosslinking and cleavage . for each remaining round adding same amount of building block oligo , 125 pmol . samples for analysis were taking out along the way , before and after crosslinking for the three transfers , which were analyzed on a 10 % acrylamide denaturing gel , see fig3 . as can be seen , crosslinking efficiency ( step 1 ) was approximately 50 % ( fig3 , lane 1 ). this was followed by an almost 100 % efficient cleavage ( lane 2 ), which results in the transfer of the β - ala moiety onto the scaffold . this is followed by the crosslinking / cleavage of step 2 and 3 ( lanes 3 + 4 , 5 + 6 ) to generate the final product on the scaffold oligo . the product thus contains the three transferred β - ala moieties . in this example two entities are transferred to a scaffold oligo by a two - step reaction to produce a ligand , feuston 5 ( see fig3 ) that binds to the αvβ3 integrin receptor . the product of the two - step process was analyzed by elisa . loading of functional entities on modified oligonucleotides to create building blocks . two building block oligos were used , ah 155 ( see above ) loaded with feuston 3 allylglycine . feuston 3 is a derivative of the feuston 5 ligand see fig3 ( f3omeag ) and ah 272 ( see above ) loaded with glycine allylglycine ( glyo - meag ) according to the above protocol ( example xa ) for loadings of allylglycine functional entities to carboxylic acid modified oligos . 10 nmoles of each was loaded in two reactions each . to create the feuston 5 ligand aspartate is also needed . therefore aspartate which was loaded as a pentenoyl ( amine ) and methyl ( carboxylic acid ) protected functional entity see fig3 , to an amino modified scaffold oligo [ ah 270 ; 5 ′ amino - gta acg acc tgt cga gca tcc agc t 3 ′]. the loading was done by mixing 25 μl 150 mm edc ( n -( 3 - dimethylaminopropyl )- n ′- ethylcarbodiimide hydrochloride , fluka ), 25 μl nhs ( n - hydroxysuccinimide , sigma ) and 5 μl 100 mm of the pentenoyl protected aspartate functional entity , all reagents were dissolved in n , n - dimethylformamide , dmf . incubated at 25 ° c . for 40 min . to this mixture 5 nmol of the scaffold oligo , ah 270 resuspended in 30 μl 150 mm hepes - oh ph 7 . 5 was added and this incubated shaking over night at 25 ° c . the amine pentenoyl protection group was deprotected by adding 20 μl 25 mm 12 dissolved in 1 : 1 tetrahydrofuran : water and incubated at 37 ° c . for 2 hours . followed by spin column purification , and loading confirmed by mass spectrum analysis . the transfers were done in the same manner as described above , but using larger amounts of oligo to ensure there being enough ligand created to give a sufficient signal in the elisa . for the first round the following amounts were used : 850 pmol loaded scaffold oligo ; ah 270 , 7500 pmol loaded building block oligo , ah 272 and 3250 pmol template oligo ah 140 [ 5 ′ agc tgg atg ctc gac agg tca ggt cga tcc gcg tta cca gtc ttg cct gaa cgt agt cgt ccg atg caa tcc aga ggt cg 3 ′]. the second round , adding 7500 pmol loaded building block oligo ah 155 for a transfer . the created feuston 5 ligand on the scaffold oligo still had a methyl group protected acid on the aspartate , which was deprotected just as described before . by adding 0 . 5 μl 2 m naoh to the oligos and incubating at 80 ° c . for 10 min . the sample this time though was ph calibrated with 0 . 5 μl 2 m hcl and was now ready for the elisa analysis . maxisorb plates ( nunc immunomodule u8 maxisorp . biotecline ) were coated with αvβ3 integrin receptor 0 . 1 μg / well in pbs over night at 4 ° c . the wells were blocked with 300 μl blocking buffer containing pbs , 0 . 05 % tween 20 ( sigma ), 1 % bsa ( sigma ), 0 . 1 mg / ml herring sperm dna ( sigma ), for 3 hours at room temperature . wells were washed 5 * 300 μl using wash buffer containing pbs , 0 . 05 % tween 20 , 1 % bsa . the sample prepared above containing the displayed feuston 5 ligand on a scaffold oligo was added to a well , control for the experiment being a 20 mer oligo loaded with the rgd peptide , a well known and well described ligand for this integrin receptor ( loaded according to above described method for the pentenoyl and methyl protected aspartate functional entity ). the incubation with these ligands was done in ligand binding buffer containing pbs , 1 mm mncl2 , 1 mg / ml bsa at room temperature for one hour . washed in washing buffer 5 * 300 μl . incubated with 100 μl horseradish peroxidase - streptavidine ( endogen ) diluted 1 : 10000 times in wash buffer , incubated for one hour at room temperature . washed again in 5 * 300 μl wash buffer . 100 μl 3 , 3 ′, 5 , 5 ′- tetrametylbenzidine hydrogenperoxidase ( tmb substrate , kem - en - tec ) added and incubated at room temperature until color development . 100 μl 0 . 2 m sulphuric acid added , color measured at 450 nm , see fig3 . as can be seen the feuston 5 ligand generated by the two - step encoding procedure is active and binds the integrin receptor with relatively high efficiency . | 2 |
an automatic tank gauging system and a volumetric leak detection system ( tank tightness test ) are illustrated in fig6 as they would be used in an underground 8 storage tank 10 in accordance with the preferred embodiment of the present invention . the atg has three main components : the probe assembly , shown as 12 , a transducer controller 14 , and a system controller 16 . the transducer controller 14 , which is mounted toward the top of the assembly 12 within an explosion - proof housing , controls the acoustic transducers 22 , 23 and the temperature sensor 19 . the system controller 16 is mounted to an above - ground support and is in electrical communication with the transducer controller 14 through a cable 17 . the cable 17 carries power and command data from the system controller 16 to the transducer controller 14 , and acoustic and temperature data from the transducer controller 14 back to the system controller 16 . the cable is shown as fixed underground , but need not be . a cable is not necessary . the system controller and transducer controller can communicate telemetrically , with the transducer controller having a self - contained power supply . the transducer controller 14 contains the pulse waveform shaping , transmitting and receiving , and digital preprocessing electronics for the atg system . the system controller 16 contains the remainder of the hardware and software necessary to control the desired operationsl modes from the transducer controller 14 , acquire the acoustic and temperature date , process the data in terms of product level , water level and leak rate , and display the results . the system controller 16 can also be equipped to control other sensor systems , such as those that provide overfill protection and alert , pipeline leak detection , detection of leaks in the annular space of a double - wall tank , detection of petroleum floating on the groundwater outside the tank , and detection of vapors in the soil and backfill outside the tank . the probe assembly 12 is further comprised of a 2 . 0 - in .- diameter tube 18 with ferromagnetic properties , preferably made of stainless steel , that is inserted into a riser 20 typically having a 2 - to4 - in . diameter , an acoustic transducer 22 mounted toward the bottom of the tank and facing upward , another acoustic transducer 23 mounted toward the bottom of the tank , two fixed fiducial references 24 and 26 positioned at defined intervals with respect to the transducer 22 , a temperature sensor 19 mounted mid - way between the transducer 22 and the lower fiducial 24 , and a quasi - static fiducial reference device 28 , which provides a fixed reference point when attached to the wall of the tube and which adjusts its position with respect to the transducer 22 when the fluid level in the tank rises or falls by a predetermined increment . the quasi - static reference device 28 is further described below the particular reference to fig7 . the term quasi static indicates that the device 28 operates both as a float , which changes its position within the tube 18 when the height of the product 30 changes by a predetermined amount , and as a fixed reference point with respect to the surface 32 of the product . fig7 further illustrates the probe assembly 12 , shown with the midddle section cut away so as to better illustrate the relationship between the transducer 22 , the fixed references 24 and 26 , and the quasi - static reference device 28 . the tube 18 is substantiallly the same as the one illustrated in fig6 with the exception of the inlet / outlet valves 34 and 35 , which allows fluid from the tank to flow into the tube 18 . one advantage of the present invention is that the entire reference system ( the transducer 22 and references 24 , 26 , 46 , and 48 ) is contained within the tube 18 , rather than extending from the outside of the tube as is common in the prior art . the fact that this reference system is self - contained makes the atg easier to handle when it is being inserted in or removed from the tank 10 ; it makes the device less likely to be damaged ; and it provides a more controllable environment . the transducer 22 is in electrical communication with the transducer controller 154 ( fig6 ) by means of a conductor ( not shown ) traversing the length of the tube 18 . as noted above , communication may also be telemetric . the transducer 22 receives command data from the transducer controller 14 and transmits a series of accurately timed acoustic pulses up the probe , through the produce , and to the various fiducials . fiducials 24 and 26 ( fig7 ) comprise the bottom circumference of two concentric thin - walled nylon tubes separated in the vertical by a known distance ; the nylon sleeve 31 with fiducials 24 and 26 fits into the ferromagnetic tube that holds the probe assembly . fiducial 24 , f 0 , is preferably positioned at a height , h 1 , about 18 in . above the bottom of an 8 - ft - diameter tank , while fiducial 26 , f 2 , is preferably positioned at a height , h 2 , about 30 in . above the bottom of the tank . the positioning of these fiducials , which varies depending on the diameter of the tank , will be further explained below . in operation , acoustic pulses transmitted by the transducer 22 are reflected from the fiducial references 24 and 26 and the surface 32 of the product in the tank . the quasi - static reference device shown in fig7 is comprised of a cylindrical float 36 , a magnetized pinwheel 38 , and a support 42 that links the wheel to the other components of the device . the purpose of the cylindrical float is to provide bouyancy for the reference device . the purpose of the magnetized pinwheel is to provide a means of incrementally changing the vertical position of the reference device as the product level rises or drops by a predetermined distance . fig7 also shows the nominal level of the produce 32 when the device is attached to the wall , and the level to which the produce must rise 162 or fall 164 to cause the device to pull away from the wall and reattach itself as a higher or lower level . in general , this rise or drop is between 0 . 25 and 0 . 5 in . the cylindrical float is made of a very lightweight foam whose specific gravity is small compared to that of the produce in the tank . gasoline , diesel , and kerosene produces have a specific gravity between 1 . 7 and 0 . 9 , whereas water has a specific gravity of 1 . 0 . the specific gravity of the foam is approximately 0 . 1 , but the specific gravity can be more or less depending on the weight of the other components of the reference device 28 . the upper fiducial 46 is designed to remain in a fixes position relative to the transducer over the duration of a leak detection test . if the reference device 28 moves during a test , the accompanying 0 . 25 to 0 . 5 in . drop or rise in product level will be large enough to be easily distinguished from naturally occuring level changes ; if this happens , the test will nullified and will have to be restarted . the specific gravity and volume of the cylindrical float is especially designed in relation to the other components of the reference device 28 so that the fiducial 46 can maintain one of two positions with respect to the surface 32 of the product . it is designed to keep the upper fiducial 46 of the reference device 28 as close to the surface as possible and still permit measurements of changes in produce height that are independent from those of upper fiducial 46 . it is designed to rise or fall in steps of 0 . 25 to 0 . 5 in . after the level of the product has changed by a corresponding amount . although such changes are generally considered small in an absolute sense , they are large in comparison to the changes that can be expected to occur during a leak detection test , when non - leak - related changes are present in addition to leak - related ones . in the preferred embodiment , the minimum distance between the product surface 32 and the upper fiducial 46 is approximately 1 . 75 in ., which is controlled by the width of the acoustic pulse and the method of acquiring the data . during a test , the reference device 28 and the upper fiducial 46 ( which is physically located about 2 in . or less below the surface ) are fixed with respect to the transducer . the fiducial 46 and 48 on the bottom of the reference device are used to measure changes in sound speed and temperature in the layer of product between the transducer and the liquid surface . the product level can rise or fall only a certain amount ( i . e ., a defined minimum and maximum distance in terms of height ) before the reference device detaches itself from the wall , moves up or down one increment , and reattches itself ast a new level . the incremental distance that the reference device 28 is designed to move is such that upper fiducial 46 will always be close enough to the surface so that any error in estimating the average changes in sound speed will be small enough not to impact the leak detection pereformance of the atg . the wheel 38 rotates about an axle 44 extending through the wheel 38 and held in place by the support 42 . the wheel 38 has a diameter somewhat smaller than the internal diameter of the tube 18 and is about 1 / 8 to 1 / 4 in . thick at its circumference . the circumference is not smooth but is comprised of a number of segments , or facets , of equal length . these facets , made of permanent magnetic material are laid end to end around the periphery of the wheel . as shown in fig7 if the internal diameter of the tube is 11 / 2 in , and the circumferential diameter of the wheel is 11 / 4 in ., the wheel could be configured so as to have 12 facets , the strength of the magnetized segments of material , the strength of the guide magnet 40 , is one is used , ( see alternative embodiments of the reference device below ) and the amount of change in product level , the reference device 28 can be designed to move in certain incremental amounts in accordance with the incremental changes in the level of the product . when the product level drops 164 or rises 162 , the gravitational or buoyant forces exerted on the reference device 28 exhibit a corresponding change , thereby creating a moment centered about the point of contact the tube 18 and the attched facet 74 in the direction of the product - level change . hence , a sufficient decrease in product level would create a corespondingly sufficient moment force at this point of attachment ; the moment force would overcome the strength of the magnetized segment , causing the wheel 38 to rotate and travel down the side of the tube 18 . the same physical principle applies in the inverse to increase in the product level . the optimum minimum and maximum distances that the reference will remain fixed to the wall of the vertical mount before dropping or rising can be determined from the analysis of a free - body force and moment diagram . overall , these distances depend on the bouyancy exerted by the liquid on the reference device ( upward force ), the weight of the reference device ( downward force ), and the frictional forces produced by the magnetized facets . the reference device will fall ( or rise ) when the net vertical forces are sufficient to create a moment about the center axle of the pinwheel 474 that overcomes the facet &# 39 ; s magnetic attraction to the wall and causes the wheel to rotate about the lower ( or upper ) edge 70 , 72 of the magnetic facet attached to the tube . the overall center of gravity of the reference device is designed to be as low as possible to ensure that the device will rise and fall along a line that is perpendicular to the surface ; this guarantees that the acoustic return from the fiducials 46 and 48 will be strong . two alternative embodiments of the pinwheel are shown in fig8 and 9 . in both embodiments , discrete magnets are used at each fulcrum point , but the number of fulcrum points is the same as the number of facets in the preferred embodiment . the three embodiments in fig7 , and 9 are thus functionally similar . an analysis of the static forces and moments on the alternative embodiments of the pinwheel shows the important tradeoffs in the design of the reference device 28 . the number of magnetic facets can be calculated from a free - body analysis and depends on the strength of the magnetic material , the coefficient of friction between the magnet and ( 1 ) the wall , and ( 2 ) the angle between axle and the lower edge of the magnet facet attached to the wall . this analysis assumes that the pin and the axle are frictionless . the results of the analysis show that the device will function properly in both the upward and downward direction if the following relationships are satisfied : ## equ1 ## where θ = the arc angle between the upper 73 and lower 71 magnetic contact points f mi = the magnetic force at the lower contact point 71 f m2 = the magnetic force at the upper contact point 73 α = the coefficient of friction between the magnet and the wall at a lower contact point 71 β = the coefficient of friction between the magnet and the wall at a upper contact point 73 if magnets of the same strength , size and material are used all around the pinwheel , then α = β and f m1 = f m2 and the reference device will function in both directions if the following relationship is satisfied : ## equ2 ## a pinwheel with n magnets satisfies the condition imposed by the friction conditions in eq . ( 3 ). the number n of equally spaced magnets around the circumference is θ = 2π / n . for a large number of magnets ## equ3 ## if n = 12 , for example ( α = β ) must be less than or equal to 0 . 25 for f m1 = f m2 . the analysis shows that a minimum number of facets is required for the reference device to move in incremental steps rather than slide continuously in tandem with the surface changes . if the number of facets is too small , the frictional force at the fulcrum point 70 in fig7 during a rotation of the pinsheel may be too small to prevent the system from sliding without completing a one - facet rotation . if the number fo facets is too large , the dynamic force produced when the reference device is dropping ( and not accounted for in the static analysis presented below ) may result in a rotation of the pinwheel greater than one facet . this would not interfere with the primary function of the reference device if , when the device came to its new position and reattached itself to the wall of the tube , it did so squarely on the next facet and not in an intermediate position centered on the edge between two facets . if the latter occurred , the reference device would not remain in a fixed position on the wall but would rotate into a position of equilibrium with the changing product level . with common magnetic materials and a magnetized stainless steel tube that is 1 . 5 in . in diameter , a pinwheel with 10 to 14 facets functions is preferred . as shown in fig7 the reference device will drop or rise when the liquid surface is at at fixed point 162 or 164 on the cylindrical float 36 . the size of the increment is then equal to length of a facet . the diameter of the wheel is based on the location of the axle 44 and the strength , density , and frictional properties of the magnetic material used for the facets . the axle 44 , or center of rotation of the pinwheel , lies approximately on a vertical line through the center of gravity and center of bouyancy of the reference device so that the device will rise and fall vertically rather than bob on angle . in this way , the faces of the fiducials 46 and 48 will remain approximately perpendicular to the acoustic beam being transmitted up the tupe , thus ensuring strong and detachable acoustic reflections . two alternative embodiments of the quasi - static reference device shown in fig7 are shown in fig1 and 11 . the reference device in fig1 and 11 is identical to the one in fig7 except that guide magnet 40 has been raised above the product level 162 . the purpose of the guide magnet 40 ; is to help keep the reference device vertically aligned . the actual location of this guide magnet 40 on the reference device can vary provided that it is not positioned where it will produce a detectable acoustic echo . the position of the guide magnet 40 shown in fig7 is above the fiducial 46 but close enough to it that the system cannot complete the processing of the echo from the fiducial 46 in time to also detect and process the echo from the guide magnet ; in other words , the system has enough to detect and process the echo from the fiducial 46 but not enough time to let the echo from the guide magnet 40 interfere . the guide magnetic 40 can also be positioned along the side of the cylindrical float at the very top , so that it is never submerged . when the guide magnet is positioned above the highest level that the liquid can rise , no echo is produced by the guide magnet . fig1 and illustrate other locations for the guide magnet . in fig1 and 11 , the guide magnet 40 is fixed to the float and the pin wheel support , respectively , and aboove the highest level that the product may rise again , this means that it will not be ; submerged and there is no possibility of an unwanted acoustic echo . the guide magnet 40 in fig7 , or 11 is shown in detail in fig1 . it consists of magnetized solid cylinder 350 that is sallowed to move freely in a holder 41 . this guide magnet is used primarily to help maintain vertical alignment when the reference device changes position . fig1 shows side and front views . the guide magnet has a relatively thin horizontal dimension , so that it will adhere to the wall of the prove , which has a relatively small radius ( a radius of 0 . 5 in . or larger ). a thin , cylindrical magnet with the smallest coefficient of friction possible is the preferred embodiment because it will allow the reference device to roll vertically along the wall and slide horizontally to maintain vertical alignment with the surfce . because the cylindrical magnet rolls on the tube wall , it can only transmit forces perpendicular , or normal , to the wall . therefore , it produces no substantial vertical firctional forces that would effect the rotation of the pinwheel about the corners of the facets . an alterntive embodiment is shown in side , front , and top views in fig1 , where the cylindrical magent is replaced by a thin , small , rectangualr guide magnet 360 . the rectangular embodiment will produce both fricitonal forces and forces normal to the tube wall , and its strength has to be carefully calculated to ensure proper functioning of the pinwheel . another embodiment is shown in side and front views in fig1 , where a small , ferromagnetic ball bearing 340 replaces the cylindrical magnet 350 of fig1 . the ferromagnetic ball bearing is magnetized by a magnet 342 placed in a nonmagnetic holder 41 . the ball bearing is thus attracted to the metal wall of the tube and can roll either horizontally or vertically without transmitting any fricitnal forces . regardless of the type , the guide magnet should be strong enough that the reference device does not separate from the wall of the tube during vertical travel . if this happens , the reference system could tilt and become wedged between the walls of the tube . if three or more equally spaced roller magnets are used along the circumference of the cylindrical float , vertical alignment can also be maintained and the possibility of the float getting stuck can be eliminated . an alternative embodiment of the quasi - static reference device shown in fig1 can be seen in fig1 , where the guide magnet 40 of fig1 has been replaced by a second mangetized wheel 60 . the second wheel 60 has a smooth magnetized circumference so that it can roll up and down the sides of the vertical mount 18 about its axle 62 . the distance between the axle 62 and the sleeve 61 should be smaller than the smallest leve change to be measured , so that the float 36 can not bob up and down during a measurement . although this alternative is quite similar to the embodiment illustrated in fig1 , it is not as desirable because its center of gravity is not as low , and therefore , it tends to not remain aligned as well . the reference device will work the same way whether it is the pinwheel and guide that are magnetized and roll along a ferromagnetic surface , or whether , conversely , the pinwheel and guide are the ferromagnetic components and it is the surface that is magnetized ( or has a magnet affixed to its length ). some sliding of the reference device may occur when the liquid sufrace is immediately below or above the level at which the pinwheel will rotate . at this level , random fluctuations may initiate and then terminate a rotation at the fulcrum points 70 and 72 on the pinwheel device in fig7 . the amount of slippage , which might be on the order of several thousandths of an inch , will depend on the frictional force established at the fulcrum . with a high frictinal force , sliding can be minimized . therefore , materials with a high coefficient of friction are used . a leak detection test should not be initiated when the product level is too close to this critical rotation level . this can be assessed by measuring the distance between the surfce and the upper fiducial . unless this distnce is greater than some specified number , a leak detection test should not be initiated . this distance will differ for different types of liquid , but should be set so that a test can be started if the liquid level is within 80 % of a facet - rotation threshold . proper functioning of the reference device requires that the axle have low friction and that the total distance between the pin 44 and the sleeve 43 in fig7 be smaller than the smallest changes that have to be measured . in the present system , the total vertical movement has to be less than 1 distance - resolution cell . maintaining proper vertical alignment before , during , and after the reference device rises or falls rquires that its center of gravity be below its center of bouyance . the larger the separation , the truer the alignment . the reference device is used for measuring the height of the product surfce in the tank and for testing a tank for leaks . both the quasi - static and the fixed fiducials are required for the product - level measurements , but only the upper fiducial on the quasi - static reference is actually required for a leak detection test . the reference device remain permanently affixed to the wall during the entire leak detection test , which may take 1 to 8 h to complete , but it is not required to remain fixed during product - level measurements , which typical take less than a minute . a two - fiducial reference device that is allowed to float vertically in the tube and is not attached to the wall can also be used for the product - level measurement . returning to fig7 and additional fiducial 48 , spaced some distance from the first fiducial 46 by a rod 50 , is required in order to develop an estimate of the speed of sound near the surface of the product . fiducial 46 , f 4 , is preferably positioned at a height , h 4 , that is at a distance , δh 4 - s , 1 to 2 in . from the surface 32 of the product . fiducial 48 , f 3 , is preferably positioned at a height , h 3 , which is at a distance , δh 3 - 4 , 2 to 12 in . from fiducial 46 . the product level itself is at the height , h s , above the transducer , and the transducer is located at a height , h o , above the bottom of the tank . with the acoustic echoes reflected from the surface of the product and from the various fiducials , it is possible to compensate for changes in the product level , h s , that are not caused by actual increases or decreases due to a leak , for example , those due to the thermal expansion or contraction of the prodcut over time . unlike the prior art , the present invention does not require a series of evenly spaced fiducials in order to ensure a fixed fiducial is located near the product surface . fig1 through 20 are alternative embodiments of the acoustic transducer and fixed fiducial systems . fig1 is identical to fig7 except that the fiducials 24 are affixed to the vertical mount , are thin bars positioned such that long axes are perpendicuar to the acoustic transducer 22 . four of many acceptable cross - sectional shapes 54 , 64 , 94 , and 104 for the fiducials 24 and 26 are shown in fig1 . the triangular bar 54 has the preferred cross - section , because ( 1 ) the bottom edge of the bar is flat and perpendicular to the transducer so that the acoustic energy reflected from the fiducial is mazimized , and ( 2 ) the top edges of the bar are not perpendicular to the transducer and surface and will thus minimize the acoustic energy received from fudicials and surfaces located above it . fig . 17 is identical to fig7 except that a fiducial 25 , which is permanently affixed to the vertical mount , has been added between the downward - aimed transducer 23 and the bottom of the vertical mount 27 . either a cylindrical or a bar - type fiducial ( i . e ., one with a traingular , half - cylindrical or square cross - section ) can be used for 25 . if fiducial 25 is a bar type , a triangular cross - seciton 56 is the preferred configuration . fiducail 25 is used to estimate the speed of sound through the product between the downward - aimed transducer and the water / product interface . the cylindrical fiducials 24 and 26 shown in fig1 can be replaced by the bar - type fiducials 54 , 64 , 94 , or 104 shown in fig1 . the configuration of the transducer 22 and the fiducials 24 , 25 , and 26 shown in fig1 through 20 correspond to fig7 , and 17 , respectively , except that the downward - aimed transducer 23 used to measure the water level in the tank is replaced by an upward - aimed transducer 33 located on the bottom of the probe &# 39 ; s vertical mount . since the bottom of the vertical mount 27 rests on the bottom of the tank , once the water level is greater than the thickness of the acoustic transducer , in fig1 through 20 the water / product interface will be between upward - aimed transducer 33 and a fiducial 29 or 25 located below the upward - aimed transducer 22 , which is used to measure product level and do a leak detection test . fig2 and 22 show alternative embodiments of the cylindrical float 36 and the fiducials on the quasi - static reference device 28 shown infig7 . the float 36 and fiducials shown in fig2 are identical to those in fig7 except that an additional fiducial 47 has been added below fiducial 48 . fig2 is anarray of many fiducials hanging on a guide cable 80 below the float 36 and the fiducial affixed to the float 46 . only four conical fiducials 82 , 84 , 86 , and 88 are shown in fig2 . the bottoms of all of the conical fiducials are perpendicular to the direction of the acoustic pulse , and the cross - sectinal area of each successive conical fiducial gets progessively larger from bottom to top ; however , this change in corss - secitonal area is not required if proper gain control is used to collect the data . there is no limit to the number of fiducials that can be attached to the guide cable 80 . more accurate estimates of the height of the product surface can be achieved with the additional fiducials in the configurations shown in fig2 and 22 , because the speed of sound between the highest permanently affixed fiducial 26 and the surface can be estimated more accurately with more fiducials . if the length of the array in fig2 extends from the surface to the bottom of the tank and if the number of fiducials on the array is sufficient , permanently affixed fiducials like 24 and 26 are not needed to measure the height of the surface or to perform a leak detection test . if only surface height measurements are required , then it is not necessary for the float to be rigidly attached to the wall with a magnet , and the floating fiducials in figs . 21 and 22 can be used as shown . an estimate of the sound speed between the transducer and the liquid surface is necessary for determining the level of the product in the tank . this estimate is made from measurements made by two or more of the four fiducials 24 , 26 , 48 , and 46 found on the probe ( fig7 ). two different analysis algorithms are used to estimate the speed of sound between the transducer and the surface . one algorithm uses the fiducials 46 and 48 on the reference device 28 and two fixed fiducials 24 and 26 , and the other uses only the fixed fiducials 24 and 26 . a third algorithm , which can be used regardless of the location of the transducer , is then used to compute the product level with either of these sound speed measurements . this algorithm gives accurate estimates of the liquid height , even if the transducer is covered with water . if the transducer is submerged in the water , and only one fiducial is used to estimate the sound speed , estimates of the height of the product surface can be highly erroneous . this is because the average speed of sosund through water ( e . g . 14798 m / s at 25 ° c .) may be verry different from the average speed through the liquid in the tank ( e . g ., gasoline , which has a sound speed of 1147 m / s at 25 ° c . ); thus the average speed of sound between the transducer and the fiducials may be significantly different from the average between the fiducial and the surface . product level is computed from estimates of the speed of sound between the upper fixed fiducial 26 and the surface . two estimates are made , one using the two fiducials 24 and 26 fixed to the tube , and another using the two fiducials fixed to the reference device . the estimates from each pair of fiducials are averages . more specifically , the sound - speed estimate between the surface and the upper fixed fiducial , u 2 - s , is calculated in inches per second from the equation u 1 - 2 = the speed of sound in inches / second between fiducials 24 and 26 permanently affixed to the vertical mount u 3 - 4 = the speed of sound in inches / second between fiducials 46 and 48 affixed to the quasi - static reference device δh 1 - 2 = known distance in inches between fiducials 24 and 26 permanently affixed to the vertical mounts t 2 - 1 = the difference in the round - trip travel times in seconds between the transducer and fiducial 26 and the transducer and fiducial 24 δh 3 - 4 = known distances in inches between fiducials 46 and 48 afficed to the quasi - static reference t 3 - 4 = the difference in the round - trip tavel times in seconds between the transducer and the fiducial 46 and the transducer and fiducial 48 . the height of the surface above the transducer in inches , h s , is then calculated from u &# 39 ; d 2 - s = average speed of sound used to estimate the speed of sound between fiducial 26 and the surface in inches / second t 2 - s = round - trip travel time in seconds between the fiducial 26 and the surface the accuract of this method depends on the vertical profile of the temperature betgween the first fixed fiducial 24 and the surface ( which may include strong temperature gradients immediately below the surface ), the distance between the two fixed fiducials and the two fiducials on the reference device , the accuracy of the measurement of the distance between the pairs of references , and the accuracy of the acoustic system in measuring time . this method was evaluated under a wide range of temperature conditions with a prototype of the invention in an 8 - ft - dimameter , 8 , 000 - gal underground storage tank filled to 77 in . with gasoline . rsults show that this method has a precision and accuracy surpassing 1 / 8 in . an estimate of the speed of sound between the upper fixed fiducial and the surface can also be made using only the two fixed fiducials 24 and 26 . if the distance between the fiducials and the transducer is great , an estimate of sound speed made with two fiducials produces a more accurate estimate of height than one made with a single fiducial . this is because strong gradients in temperature tend to cause overestimation when the average sound speed is measured with a single fiducial . these strong gradients , which are found near the bottom of the tank , do not affect the estimate of sound speed made with the two fixed fiducials , because they occur only in the region below the fiducials . more specifically , the sound speed estimate between the surface and the upper fixed fiducial , u 2 - 5 , in inches per second is calculated from the height of the product is then determined from eq . ( 6 ). fig1 illustrates a variety of temperature profiles that may be encountered in the product in an underground storage tank . fig2 ( a ) is a sound - speed profile measured in a gasoline tank filled to 78 . 7 in . the sound - speed profile is estimated directly from the temperature profile in fig2 ( b ) by means of the following empricially derived relationship for gasoline : the sound speed at the location of the two fixed fiducials 24 and 26 and the two quasi - static fiducials 46 and 48 is shown in fig2 ( a ). the actual sound speed between the second fixed fiducial 26 and the surface ( as well as the sound speeds between any two points on the profile ) was estimate by integration of the sound - speed profile . the true average sound speed ( true u 2 - s ) between the second fixed fiducial and the surface is shown as the solid box in fig2 ( a ). the open box is the sound speed between fiducials 24 and 26 that is calculated using eq . ( 7 ) and the open circle is the sound speed estimated from fiducials 24 , 26 , 46 and 48 with eq . ( 5 ). the true sound speed between the transducer and the surface is denoted by the plus sign . in this temperature profile , the error in measuring the surface height from eqs . ( 6 ) and ( 7 ) is 0 . 03 in . as shown in fig7 the level of the water 33 in the tank is measured by the downward - pointed transducer 23 , which emits an acoustic pulse that is reflected from the water / product interface . the speed of sound through the product between the transducer and the water / product interface , which is required to convert the round - trip travel time to distance , is measured by the upward - pointing transducer 22 , which emits an acoustic pulse that is reflected from the lower fiducial 24 ( which is a known distance from transducer 22 ). the speed of sound estimated with this lower fiducial is sufficient to meet the 1 / 8 - in . accuracy requirement providing that the fiducial 24 is located within approximately 6 to 12 in . of the upward - pointing transducer . alternatively , as shown in fig1 , a fixed fiducial 25 can be located between the downward - pointing transducer and the maximum water level . in both configurations , the water can be measured at any level from the bottom of the tank up to approximately 4 in . the level of the water above the bottom of the tank , h w , in inches is calculated from the following algorithm : h b = the distance between the bottom of the tank and acoustic transducer 23 in inches t w - p = the round - trip travel time between the transducer 23 and the water / product interface in seconds . u 1 = the speed of sound through the product between the transducer and the water / product interface ( 1 ) estimated from a temperature measurement of the product , ( 2 ) measured between the transducer 22 and the nearest fiducial 24 affixed to the vertical mount , or ( 3 ) between the transducer 23 and the nearest fiducial 25 affixed to the vertical mount alternatively , the lower transducer can be mounted below the water / product interface and pointed upward ( 33 in fig1 through 20 ). with this approach , the water level cannot be measured when it is below the transducer , i . e ., near or at the bottom of the tank . the minimum depth that can be measured is controlled by the thickness of the transducer and the interference of the acoustic reflection from the water / product interface with the transmitted pulse . an alternative algorithm can be used to measure water level without the acoustic reflection from the water / product interface . this approach can be used when the water / product interface cannot be detected , or as a stand - alone measurement . it requires that the acoustic reflection from the bottom of the probe 27 , which is located at a known distance from the transducer , be measured . the approach can be implemented with the downward - pointed transducer shown in fig7 and 17 , or with the upward - pointed transducer shown in fig1 through 20 , which is submerged in water , by means of the following algorithm , which is used to calculate the height of the water above the bottome of the probe , h w - pb : h pb = the distance between the bottom of the tank and acoustic transducer 23 in inches t pb = the round - trip travel time between the transducer and the reference bottom of the probe in seconds the height of the water above the bottom of the tank can be calculated by adding the distance between the bottom of the probe , which reflects the acoustic pulses , and the bottom of the tank to h w - pb calculated by eq . ( 10 ). the accuracy of this indirect water - level measurement concept depends primarily on the accuracy of the estimate of the sound speed in both the product and the water . the estimate of the speed of sound through the product is made from the fixed fiducial 24 in fig7 , 18 and 19 or fiducial 25 in fig1 and 20 , and the estimate of the speed of sound through water is made from the well - known relationship between sound speed and temperature , available from published sources . this relationship is used in combination with an estimate of the temperature made by a sensor 19 in fig7 . the speed of sound through water , u w , in m / s is estimated from the temperature sensor 19 located near the bottom of the probe assembly is used to estimate t in eq . ( 11 ). the product in a tank ( as well as the tank itself ) is continually expanding or contracting in response to temperature . this causes changes in the product level that are not due to leaks . to find small leaks , therefore , the product - level changes due to thermal expansion and contraction must be compensated for . during a leak detection test , the upper fiducial 46 on the reference device 28 and either the lower or upper fixed fiducial ( 24 or 26 ) usually located in the bottom third of the tank are ued to calculate a temperature - compensated level change ( volume change ) with sufficient accuracy to meet or exceed the epa standards for an atg or tank tightness test . an array of fiducials can be used to calculate an average product temperature that is weighted according to the cross - sectional area of the tank ( i . e ., a volumetrically weighted average ). although one can meet the epa regulation with only one fiducial , additional accuracy can be obtained by using more . the largest errors encountered by acoustic measurement systems such as the present invention are due to improper weighting of the large temperature changes that occur near the bottom and top of the tank , and erroneous estimates of the sound speed between the surface and the fiducial closest to the surface . the present invention addresses both problems . it is not necessary to known the height of the reference device above the transducer in order to perform a leak detection test . however , the position of the fiducial on this device must remain at a fixed height as close to the surface as possible during the test . the primary function of the reference device in a leak detection test is to provide this fixed location for the fiducial . the round - trip travel time is calculated from the acoustic echoes reflected from the surface , one of the fixed fiducials ( e . g ., 26 ), and a fiducial on the reference device ( the one closest to the surface 46 ). the temperature - compensated level changes measured in inches , δh s , are calculated from ## equ4 ## where u = spedd of sound in meters / second between the transducer and the surface which can be estimated ( 1 ) between fiducials 46 and 48 , ( 2 ) between fiducials 24 and 26 , ( 3 ) between the transducer and fiducial 24 , or ( 4 ) between the transducer and fiducial 26 , or with an average or weighted average of any combination of these , δt s = change in the round - trip travel time over the measurement period in seconds between the transducer and the surface δt r = change in the round - trip travel time over the measurement period in seconds between the transducer and a fiducial such as 46 , which is rigidly fixed to the vertical mount v = volume of the product in the tank in inches 3 at the height of the surface of the product in the tank h = height of the liquid surface in the tank above the acoustic transducer in inches a = cross - sectional area of the surface in inches 2 of the product in the tank at the height of the surface of the product above the bottom of the tank c e = coefficient of thermal expansion of the liquid in the tank t s = round - trip travel time between the transducer and the surface in seconds δt = change in the average weighted temperature between the transducer and the fiducial 46 that is located closest to the surface and affixed to the vertical mount during the measurement and ## equ5 ## ps where w 1 = volume of the product in the tanke below fiducial 24 or fiducial 26 divided by the total volume of the product in the tank w 2 = the volume of the product between fiducial 24 or fiducial 26 and the surface divided by the total volume of the product in the tank = 1 - w 1 δt 1 v 2 = change in the round - trip travel time between the transducer and either fiducial 24 or 26 in seconds δ 4 - 1 v 2 = change in the round - trip travel time between fiducial 46 on the quasi - static reference device and either fiducial 24 or fiducial 26 t . sub . ( 1 v 2 ) = round - trip travel time between the transducer and either fiducial 24 or 26 u . sub . ( 1 v 2 )= sound speed between the transducer and either fiducial 24 or 26 u 2 = sound speed between the transducer and fiducial 26 ## equ6 ## an estimate of the average temperature change is made from ## equ7 ## where t r is the round trip travel time between the transducer and fiducial 46 on the quasi - static reference device . the first term in the square brackets in eq . ( 12 ), δt s , is a measurement of the product - level changes . the second term , δt r , is used to correct the level changes for errors in sound speed , and the third term , involving δt , is the one that compensates for the thermal expansion and contraction of the product produced by temperature changes in the product . if a fixed fiducial is not located within 2 to 3 in . of the surface , the sound - speed correction for level changes in the second term can be significantly in error relative to the leak detection performance standards specified by the epa . due to the heat transfer between the liquid and the vapor found immediately above the surface , temperature and sound speed can change significantly in the upper 12 in . of the product . the reference device 28 minimizes this error because it always positions a fiducial within 2 to 3 in . ( or less ) of the surface . temperature compensation is accomplished in the third term . in the present embodiment , the temperature is weighted only by two fiducials . in large tanks , or others in which more accurate compensation is required , additional weighting may be necessary . this is accomplished by means of one or more additional fixed fiducials or the fiducials in fig2 or 22 , which are separated by a known distance . with the present invention , the bottom two fixed fiducials 24 and 26 can be used in conjunction with the fiducial 46 for temperature compensation as described by ## equ8 ## where u 1 - 2 = the sound speed estimated between fiducials 24 and 26 u 2 - 5 = the sound speed estimate between fiducial 26 and the surface using eq . ( 5 ) w 1 - 2 and w 2 - s = the volume of product between fiducial 24 and 26 and fiducial 26 and the surface , respectively , divided by total volume of product in the tank . an alternative yet similar equation that can be used to estimate the temperature - compensated level changes is ## equ9 ## the only difference between eqs . ( 12 ) and ( 16 ) is the term that is used to correct the level changes for sound speed . once the speed of sound through the layer of product between the transducer and the upper fiducial 46 on the reference device has been estimate , the quantity ( c 1 ) in eq . ( 16 ) is a constant used to extrapolate the estimate to the layer of product between this fiducial 46 and the surface . another method of estimating the δh s is to use the sound speed measured with the two fiducials on the reference device to estimate the sound speed between fiducial 48 and the surface , as given by ## equ10 ## where u 3 - 4 = speed of sound between fiducials 46 and 48 . fig2 through 26 illustrated three alternative embodiments of the quasi - static reference device that do not rely on a magnetized wheel but nevertheless operate on the same basic principles . all three are variations on the &# 34 ; woodpecker &# 34 ; embodiment of the reference device , as opposed to the &# 34 ; pinwheel &# 34 ; embodiment previously discussed . fig2 shows a reference device 128 having a vertical cylindrical float 136 , a fiducial 146 ( corresponding to fiducial 46 in fig7 ), and a fiducial 148 ( corresponding to fiducial 48 ) spaced some distance from fiducial 146 by a rod 150 . as the liquid level goes up ( or down ), the reference device detaches itself from the wall and reattaches itself at a higher ( or lower ) location . thus , with the nominal product level 160 , the following sequence occurs : the device attaches itself to the wall ; there is an interval during which the product level goes down ; the device then pulls away from the wall ; the cycle is repeated with each incremental change in product level . the device is designed so that the difference in product level at the beginning ( 160 ) and end ( 162 or 164 ) of this interval , shown in fig2 , is generally between 0 . 25 and 0 . 5 in . the fiducial 148 and the rod 150 are not essential . toward the top of the reference device 128 are two fulcrums 170 and 172 and a permanent magnet 174 . the upper and lower fulcrums on this embodiment and on the ones shown in fig2 and 26 are made of a material that has a high coefficient of friction with the steel tube . as with the pinwheel device , when a drop in the product level occurs that is sufficient to create a moment about the fulcrum 170 that breaks the bond between the magnet 174 and the wall 18 , the woodpecker device rotates about the fulcrum 170 , drops to the new level , and reattaches itself to the wall by the pull of the magnet 174 . conversely , the device moves up the tube if the liquid level rises . the woodpecker device , like the pinwheel , stays rigidly affixed to the wall during a leak detection test , because the product - level changes that occur during a test are not large enough to cause the device to move . the weight of the various components of the reference device 128 are such that the center of gravity of the reference device is below its center of bouyancy regardless of the level of the product in the tank . this keeps the reference vertiacally aligned with the surface and the transducer , even when the reference is released from the wall , drops or rises , and then reattaches itself to the wall . otherwise , the reference would have a tendency to float horizontally on its side instead of vertically . the rod 150 can be a j hollow plastic rod , with can be filled with a heavy material such as steel or lead shot 152 , so that it will have the force and moment balances required for proper functioning of the reference device 1285 . adding weight at the bottom of the rod 150 ensures that the center of gravity of the reference device is as low as possible . an analysis of the static forces and moments acting on this reference device shows the important design features that must be specified for the reference device to drop or rise at predetermined incremental steps . it was assumed that the net vertical force obtained from the sum of the gravity and bouyancy forces always act at a fixed distance δ x from the fulcrum , even though this distance will increase slightly when the reference device begins to rotate about the fulcrum ; this distance would not change if the float and fiducials were suspended from a pin and axle as done with the pinwheel . the analysis shows that the following two conditions must be satisfied in order for the reference device to function properly with regard to downward movement : where α is the coefficient of friction between the fulcum and the wall , δ y is the vertical distance between the fulcrum and the magnet , and δ x is the horizontal distance between ( 1 ) the contact point of the vertical wall 18 , fulcrums 172 and 170 , and the magnet 174 , and ( 2 ) the location of the center of gravity of the net sum of the gravitational and bouyancy forces on the reference device , f net , and where f m is the force holding the magnet to the wall of tghe tube . eq . ( 18 ) shows that the minimum distances between ( 1 ) the fulcrum and the magnet and ( 2 ) the wall and the center of gravity of the net force on the reference device depend on the coefficient of friction between the wall and the fulcrum . eq . ( 19 ) shows the relationship between the strength of the magnet and the net force on the reference device , so that when the device breaks away from the wall it will rotate about the fulcrum rather than slide down the side of the tube . if α = 0 . 1 and δ x = 0 . 75 in ., then δ y ≦ 0 . 075 in ., which means the fulcrum is very close to the magnet . if these conditions are satisfied , the reference device will not slide down the wall but will drop incrementally . because of the frictional force generated between the fulcrum and the wall , the reference device will remain attached to the wall unit the magnet is completely detached from the wall . proving that eqs . ( 18 ) and ( 19 ) are satisfied , the higher the coefficient of friction between trhe fulcrum 170 or 172 is , the better the performance of the reference device . the higher friction tends to keep the reference device attached to the wall , even when the balance of forces , which create the moment about the fulcrum , are just at the instant of producing the rotation . this higher friction offsets the fact that the magnet , if it has any surface area , does not detach itself from the wall all at one time . the rotation begins as soon as any part of the magnet pulls away from the wall . the alternative embodiments of the woodpecker reference are shown in fig2 and 26 without detailed explanation , because they are substantially similar to the one shown in fig2 and described above . fig2 - f show seven embodiments of the magnet and fulcrum stepup . however , any combination of fulcrum and magnet shapes can be made to operate functionally as described above . in fig2 a the magnet is rectangular in shape , with the vertical dimension 300 being much smaller than the horizontal dimension 314 , and the fulcrums are triangular , with only the tip of the triangle 310 touching the wall . the smaller the vertical dimension of the rectangle , the easier the system is to design . this is the preferred embodiment , because the reference tends to stay better aligned vertically as it moves up and down . this embodiment works best with a vertical support 12 that presents either a flat or a nearly flat wall ( one with a very large radius ). in a tube of small diameter , such as the 1 . 5 - in .- diameter tube 12 used in the preferred embodiment , only the ends of the magnet and fulcrums actually touch the wall of the tube . in another embodiment , shown in fig2 b , the triangular fulcrum has been replaced with a rectangular one whose vertical dimension , like that of the magnet , is smaller than its horizontal dimension . this configuration functions in the same way as the one in fig2 a , because once the reference device begins to rotate about the fulcrum , the rotation occurs at the edge of the rectangle . this alternative is used if better contact is needed between the wall and the fulcrum than is provided by the triangular embodiment . in fig2 c , the fulcrums and the magnet all have a triangular shape . in fig2 d and e , the wide rectangular magnet in fig2 a has been replaced by one whose vertical dimension is greater than its horizontal dimension . the embodiments in fig2 f and g can be used when the tube 12 has a small radius . in fig2 f and g , the magnet is rectangular in shape and the fulcrums are either rectangular or triangular in shape , with the horizontal dimension of both the magnet and fulcrums that is smaller than or approximately equal to the vertical dimension . the reference device will function properly regardless of the shape of the shape of the magnets and fulcrums , so long as the constraints given by eqs . ( 18 ) and ( 19 ) are satisfied . fig2 through 30 show some additional alternative embodiments of the fulcrum and magnet configuration . they are similar to the embodiments shown in fig2 through 26 . the fulcrums used in all of the embodiments of the reference device can also be replaced by magnets of similar shape . this alternative is used if the vertical support 12 is not perpendicular to the surface of the product . an analysis similar to the one performed for the nonmagnetic fulcrum shows the conditions that must be satisfied for this reference device to function in the same way as the one with a nonmagnetic fulcrum . the two are very similar , as can be seen by comparing eqs . ( 18 ) and ( 19 ) with those below . the two criteria that must be satisfied for the reference with magnetic fulcrums to function properly with regard to downward movement are : where f f is the magnetic force holding the fulcrum to the wall , and if f f = f m , eq . ( 21 ) shows that α ≧ 0 . 5 [[ δ y / δ x ]]. if the strength of the magnet at the fulcrum 170 or 172 in fig2 through 26 is only 10 % of the strength of the magnet at 174 , eq . ( 20 ) shows that α ≧ 0 . 909 [[ δ y / δ x ]], or nearly the same as the relationship for a nonmagnetic fulcrum . the reference device 28 does not have to be in a tube 12 such as the one described in the preferred embodiment ( fig7 ). it can be placed directly in the tank as long as there is a guide , such as a flat plate ( fig3 ) or channel ( fig3 and 32 ), along which it can move . such a guide might even be placed within a tube 12 . the guide 312 shown in fig3 is simply a long , thin , flat rectangular staff that can be inserted into a tube . fig3 is a channel with sides 320 that are designed to keep the reference from wandering off a flat or curved surface . fig3 illustrates a channel with a holder 330 that serves as a track for the reference device . all embodiments of the woodpecker device are attached to a wall or tube mount by a permanent magnet . the wall or tube mount must be co nstructed of a metal with ferromagnetic properties so that the magnet 174 that will be attacted to it . as was the case with the pinwheel , the woodpecker device will work the same way regardless of which components are magnetized : the magnets can be replaced with ferromagnetic material if the metal tube or vertical mount is a magnet or is magnetized . two additonal embodiments of the quasi - static reference device 28 , using a variation of the woodpecker devices shown in fig2 through 26 , are shown in fig3 and 35 . these embodiments are obtained by attaching the magnet and fulcrum setup to the float and fiducial subsystem with a pin and axle by a rigid bar . the rotation of the bar is limited to a small angle , usually less than 30 °, so that the magnet will reattach itself to the mount after the device has fallen or risen . the bar is physicall limited from rotating beyond a certain angle . these embodiments drop and rise similarly to the woodpecker device except the float and fiducials , which are hanging from the pin and axle , remain vertical during a drop or rise of the device because the float and fiducials are free to rotate at the pin an axle . the static analysis done for the woodpecker device also describes this embodiment . another general embodiment of the quasi - static reference device is one in which the permanent magnet is replaced by an electromagnet that is operated either by a battery ( with a timer on the reference device itself ) or by a power supply ( at the atg controller or system controller ) connected to the cylindrical float by wires or by remote transmitters and receivers . in the latter configuration , the reference device would be instructed by the controller to attach or detach itself from the wall wheneer the surface of the product level changed by a specified amount . there could be several modes of operation . one would be to keep a current running through the electromagnet so that the reference device remained attached to the metal wall . when the level changed by a certain amount , the current would be turned off so that the reference device could rise or fall , and then , at the appropriate moment , turned on so that it would reattach itself to the wall . in the second mode of operation , the permanently magnetized wall would be the polar opposite of the permanent magnet . an electomagnet would then be used in conjunction with either the wall or the permanenet magnet ; the electromagnet would change the polarity of the permanent magnet so that the wall and the permanent magnet would repel one another and allow the reference device to rise or fall when so instructed by the controller . the third mode of operation is similar to the second . in this mode , the reference device would have a permanent magnet , and the tube would not have to magnetized . a configuration would consist of a torroidal electromagnet that is placed outside the tube , floats with the product , and can be activated to produce a magnetic field with a polarity opposite to that of a power supply located at the atg or system controller . it would be operated identically to the second mode . in the latter two modes of operation , the electromagnet is operated only when the reference device must be detached from the wall ( i . e ., when the product level changes ). the power requirement is less for the latter two modes than it is for the first . if a battery is used to power the electromagnet in the first mode , a timer must be used as a means ofdetermining when the float should attach and / or detach itself from the wall . since the reference device has to be rigidly affixed to the wall only during a leak detection test , the timer can be used to set the precise hour to start and end a test . although the present invention has been described in terms of specific embodiments , it is anticipated that alterations and modifications will become apparent to those skilled in the art . it is therefore intended that the followign claims be interpreted as covering all such alterations and modifications as fall within the true spirit and scope of the invention . | 8 |
the features and the advantages of the present invention will be more readily understood upon a thoughtful deliberation of the following detailed description of a preferred embodiment of the present invention with reference to the accompanying drawings . fig1 - 3 depict preferred embodiments of an automatic wood planer of the present invention . the embodiments are provided only for explanatory purposes with respect to the patent claims . the automatic wood planer a comprises a main body 10 , including a supporting portion 11 and feed table 12 . the feed table 12 is provided with an input end 121 and an output end 122 . there are two front columns 20 , arranged separately at both sides of input end 121 of the feed table 12 of the main body 10 . the bottom of two front columns 20 is screwed with the feed table 12 for a swinging state , and the top of two front columns 20 is connected via a cross bracket 21 . a lifting seat 30 transversely bridges between two front columns 20 in a sliding state . a brake unit 40 controls the sliding state of the lifting seat 30 . two rotary supports 50 are obliquely assembled between the lifting seat 30 and the output end 122 of the feed table 12 . the rotary support 50 is available with pin joint end 51 , which could be screwed at both sides of the output end 122 of the feed table 12 , or screwed on the protruding framework of the feed table 12 . the other end of the rotary support 50 is a swinging end 52 connected at both sides of the lifting seat 30 . the rotary support 50 is also of a prefabricated structure . a cutter shaft 60 is assembled at a central section between pin joint end 51 and swinging end 52 of two rotary supports 50 , so that the bottom of the cutter shaft 60 is placed opposite to the feed table 12 . a brake unit 70 of the cutter shaft 60 is used to drive the cutter shaft 60 for rotation . a feed unit 80 includes at least a front roller 81 and a rear roller 82 , which are separately assembled at the bottom of the rotary support 50 . the rollers 81 , 82 are transversely positioned at intervals with the cutter shaft 60 . the brake unit 40 comprises a screw 41 and a rotary table 42 fixed onto top of the screw 41 . then , the cross bracket 21 at the tops of two front columns 20 is provided with a screw hole 22 ( shown in fig3 ) for the screw 41 . the bottom of the screw 41 is rotatably connected to the lifting seat 30 , so the rotary table 42 could be operated to drive the forward and reverse rotation of the screw 41 , thus enabling the sliding of the lifting seat 30 . the cutter shaft &# 39 ; s brake unit 70 comprises a motor 71 , drive unit 72 ( belt and belt wheel , or chain and chain wheel ) and a gearbox 73 . the motor 71 is assembled at the top of two rotary supports 50 adjacent to the pin joint end 51 . the drive unit 72 is placed laterally onto the rotary support 50 , and then connected with the motor 71 , cutter shaft 60 and front and rear rollers 81 , 82 , so the motor 71 simultaneously drives the cutter shaft 60 and front / rear rollers 81 , 82 . the feedstock could be shifted with forward drive of the front and rear rollers 81 , 82 . moreover , said feed unit 80 comprises a conveyor belt 83 , which is assembled onto the feed table 12 for recycling operations . the conveyor belt 83 could also be driven by the cutter shaft &# 39 ; s brake unit 70 . additionally , the feed unit 80 drives the feedstock forward via the conveyor belt 83 . in such a case , the front and rear rollers 81 , 82 just press the feedstock without being driven by the cutter shaft &# 39 ; s brake unit 70 . ( note : this view shows that the front and rear rollers 81 , 82 and conveyor belt 83 are driven by the cutter shaft &# 39 ; s brake unit 70 simultaneously ). a swinging rack 91 and traction frame 92 are arranged between the swinging end 52 of two rotary supports 50 and the feed table 12 . the swinging rack 91 is provided with front and rear extensions 911 , 912 , which are available with stoppers 913 , 914 . both ends of the traction frame 92 are separately connected to the front extension 911 of the swinging rack 91 and the feed table 12 , so that the front and rear rollers 81 , 82 are separately adapted with the rotary support 50 and swinging rack 91 via front and rear cantilever 811 , 821 . the front and rear cantilevers 811 , 821 are separately supported on the stopper 913 , 914 of the front and rear extension 911 , 912 of the swinging rack 91 . furthermore , an elastic member 93 ( a spring ) is arranged between the front and rear extensions 911 , 912 and front and rear cantilevers 811 , 821 . a plurality of reinforced rods 53 is arranged between two rotary supports 50 . referring to fig6 and 7 , the reinforced rod 53 comprises the first and second rods 531 , 532 , where stud 533 and screw hole 534 are arranged at the coupling end of the first and second rods 531 , 532 . the stud 533 is provided with nut 535 , while the stud 536 is placed externally onto the first and second rods 531 , 532 , and located via the nut onto two rotary supports 50 ; the reinforced rod 53 is used to make up the spacing error between two rotary supports 50 since the coupling portion allows for slight adjustment of the length , helping to realize optimum connection and reinforcement . referring to fig4 and 5 , when it is intended to adjust the height of said cutter shaft 60 , the rotary table 42 of the brake unit 40 rotates forward or backward . the rotation of the rotary table 42 will drive the screw 41 to pass through the screw hole 22 of the cross bracket 21 , so the motion of screw 41 will lead to a vertical shift , and then will drive the lifting seat 30 to slide along two front columns 20 ( shown by arrow l 1 ). with the slide of the lifting seat 30 , the swinging end 52 of two rotary supports 50 will be driven for vertical swinging . the cutter shaft 60 between pin joint end 51 and swinging end 52 of two rotary supports 50 flexibly lifts for adjusting the planing depth . moreover , when the lifting seat 30 is activated to drive the rotary support 50 for oblique swinging , the swinging end 52 will generate lateral displacement . correspondingly , a swinging structure may be designed between the bottom of two front columns 20 and the feed table 12 , allowing for smooth motion of the lifting seat 30 . on the other hand , the traction frame 92 and swinging rack 91 are arranged to make the front and rear rollers 81 , 82 press horizontally against the feedstock during oblique swinging of two rotary supports 50 . referring to fig5 , when the swinging end 52 of the rotary support 50 is driven by the lifting seat 30 to shift upward , both ends of the traction frame 92 are separately connected to the front extension 911 of the swinging rack 91 and the feed table 12 . the front and rear rollers 81 , 82 press horizontally against the feedstock without being affected by the oblique swinging of the rotary support 50 ( since the front and rear cantilevers 811 , 821 of front and rear rollers 81 , 82 are supported by the front and rear extensions 911 , 912 of the swinging rack 91 , and the front and rear extensions 911 , 912 are connected to the front and rear cantilevers 811 , 821 via an elastic member 93 ). referring to fig3 and 4 , feedstock b is fed from the input end 121 of the feed table 12 , then guided and rolled through the conveyor belt 83 and front roller 81 of the feed unit 80 , enabling the smooth planning of the cutter shaft 60 . then , the feedstock b will be rolled by the rear roller 82 and output via the conveyor belt 83 outside of the feed table 12 . | 1 |
the following description and examples illustrate a preferred embodiment of the present invention in detail . those of skill in the art will recognize that there are numerous variations and modifications of this invention that are encompassed by its scope . accordingly , the description of a preferred embodiment should not be deemed to limit the scope of the present invention . referring to the drawings , fig1 depicts a removal system of a preferred embodiment . fig1 shows the filter module 5 in its normal operating condition . the module 5 comprises an elongate generally rectangular feed tank 6 having ports 7 and 8 for introducing and removing feed from the tank 6 . it is generally preferred that the feed tank have a rectangular configuration , however , other configurations can also be employed , depending upon the number and arrangement of membrane modules within the feed tank . for example , the feed tank can be square , cylindrical , triangular , or employ any other configuration , as desired . it is generally preferred to employ a single port for introducing feed into the tank , and a single port for removing feed from the tank . however , in certain embodiments it can be desirable to employ two or more inlet ports , or two or more outlet ports . the inlet port or ports are preferably situated at or above the top portion of the tank , and the outlet port or ports are preferably situated at or above the bottom portion of the tank . the ports can be situated on a side wall of the tank , or at some other location , e . g ., a bottom wall . the tank 6 has a removable end wall 9 and is supported by side members 10 with feet 11 . while it is generally preferred to employ side members for support , in certain embodiments it can be desirable to omit such members . in such embodiments , the tank rests on the floor . alternatively , feet only secured to the bottom of the tank can be employed , without the side members . side members alone , e . g ., for reinforcement of the tank structure , can be employed . in one embodiment , one or more support structures , with or without feet , can be placed beneath the tank such that the bottom of the tank does not rest directly on the floor . the side members and feet can be of any suitable configuration . for example , the support members can comprise tubes , bars having a circular , rectangular , square , or other cross section , i - shaped beams , l - shaped beams , or any other desired configuration . feet comprising a flat sheet of metal are generally preferred , preferably a square sheet , however other configurations can be employed , e . g ., circular sheet , and any suitable thickness can be employed . preferably the side members and feet are constructed of a metal , e . g ., steel , aluminum , or alloy , however , any suitable material can be employed , for example , a composite material , e . g ., reinforced concrete , or a polymeric or other material , e . g ., carbon fibers , and the like . as shown in fig3 the filter module 5 contains a plurality of membrane modules 12 supported in a membrane rack 13 formed from the filtrate manifold 14 and associated components . vertically extending support members 15 and 16 are fixed at one end to either end of the filtrate manifold 14 and have a wheeled trolley arrangement 17 at their distal ends . while it is generally preferred to employ a wheeled trolley arrangement at the distal end , any other suitable arrangement can also be employed , such as a member that slides over a track , or a member supported by ball bearings . the tank 6 is open at its top and along the length of each side 18 has opposed inwardly extending lip members 19 and 20 . the inner edges 21 and 22 of the respective lip members 19 and 20 are provided with respective rack rear support tracks 23 and 24 extending along the length of the lips 19 and 20 . the outer edges 25 and 26 of the respective lip members 19 and 20 are provided with respective cantilever rack support tracks 27 and 28 extending generally parallel to the rack rear support tracks 23 and 24 . in this embodiment the tracks are formed from upwardly extending v - shaped angle members but it will be appreciated that any form of suitable track can be used . while it is generally preferred to have the support tracks positioned on the sides of the tank , other configurations can also be employed . for example , it may be preferred to support the removal system on a frame positioned over the tank , or suspended from the ceiling , such that the system is not supported by the tank . a frame system can also be employed to support the filter modules above a tank of any configuration , without the need to rely on the tank walls for support . the cantilever rack support 30 comprises a generally elongate rectangular structure of similar dimension to the cross section of the tank 6 having a pair of elongate side members 31 and 32 joined at each end by end members 33 ( not depicted ) and 34 . the members 31 to 34 are typically formed of angle or channel elements . while it is generally preferred that the rack support is of similar dimension to the cross section of the tank , other shapes can be employed . for example , if a tank contains a series of banks of filter modules , it can be preferred to employ multiple cantilever rack supports arranged parallel to each other over the tank . a suitable frame or one or more support members can be employed to support the parallel rack system , or the racks can be secured to each other , the outer racks along the tank walls providing support for the racks over the center of the tank . the upper edge of each side member 31 and 32 is provided with respective rack front support tracks 35 and 36 extending longitudinally along the length of each respective side support member . a series of rollers or wheels 37 are provided at spaced locations along the length of the side members 31 and 32 having rotation axes normal to the side members and attached thereto . in this embodiment the wheels 37 are v - grooved to engage with the inverted v - shaped tracks 27 , 28 , 35 and 36 . while v - grooved tracks are generally preferred , any suitable configuration can be employed . a pair of angled brace members 38 ( one not shown ) extend downwardly from a cross member 39 located midway along the length of the rack support 30 to a vertical downwardly extending support strut 40 located at the rear of the rack support 30 . a hooked handle 41 is provided at end 34 of the rack support 30 , to facilitate removal . any suitable configuration for the handle can be employed , or the handle can be dispensed with altogether . when the filtration module 5 is in normal operation , the cantilever rack support 30 is in its normal retracted position over the tank 6 as shown in fig1 . when maintenance to the membrane module rack 13 is required , the tank 6 is drained and the removable end wall 9 is removed and set aside . the end wall can be fitted to the tank in any suitable fashion . a gasket seal can be employed , and the wall secured to the tank with clamps , bolts , or any other suitable fasteners . in an alternative embodiment , the wall is secured to the tank with hinges and a latch , such that the wall can be swung open . the plant operator then extends the cantilever rack support 30 away from the tank 6 by pulling on the handle 41 attached to the assembly as shown in fig2 . the cantilever rack support 30 travels along the top of the tank 6 on its v - groove wheels 37 , guided by the tracks 27 and 28 on the outer edge of the tank 6 . once in its fully extended position the cantilever rack support 30 is locked in place by pins 43 passing through the support strut 40 and stiffener elements 44 extending down the sides of the tank 6 . as shown in fig4 and 5 , the membrane module rack 13 is then unseated from the socket connection 45 located at the rear of the tank 6 . this is done by unlatching the rack lever 46 from the bottom air manifold 47 as best shown in fig4 , 4 a and 4 b of the drawings . two pivot points on the rack lever 46 allow for the membrane module rack 13 to be pried out of the socket connection 45 . the top pivot point is comprised of a removable bolt 48 that creates an axis for the rack lever 46 when assembled to the brackets located on the tank 6 . the second pivot point is permanently located on the end of the filtrate manifold of the membrane module rack 13 . as shown in fig5 and 5a , when the lever 46 is pulled out away from the tank 6 , the top remains stationery , transferring the force to the second pivot point , resulting in the removal of the membrane module rack from the filtrate connection at the rear of the tank 6 . to fully remove the membrane module rack 13 from the tank 6 , the bolt 45 at the top pivot point is removed , the bottom of the lever 46 is then latched again to the air manifold 47 , and the lever 46 now acts as a handle . as shown in fig3 , the membrane module rack 13 is then pulled out the length of the cantilever rack support 30 , with the wheels 17 guided by the tracks 23 , 24 , 35 and 36 . the membrane module rack 13 , in the extended position , hangs by the front rack support 49 from the cantilever rack support 30 and the rear rack support 50 from the front of the tank 6 . an advantage of the system described above is that it is supported on the top of the side walls of the tank containing the modules . such an arrangement offers advantages in terms of space utilization and compact design . in an alternative embodiment , the membrane module rack is supported on a frame equipped with wheels at its base , the wheels resting on the floor , or in a track on the floor . to remove the membrane modules from the tank , a wall is opened , and the frame is rolled forward . such a system can offer advantages in terms of retrofitting existing tanks , or accommodating non - standard tank configurations . the cantilever system described above is advantageously employed in any membrane filtration system employing modules or cassettes suspended in a tank . such systems can be employed for water treatment ( e . g ., aerobic , anaerobic , or non - aerobic systems ), or for filtration of any suitable liquid substrate . the system is particularly preferred for use in conjunction with membrane bioreactor systems . membrane bioreactor systems combine biological treatment , involving bacteria , with membrane separation to treat wastewater . treated water is separated from the purifying bacteria , referred to as activated sludge , by a process of membrane filtration . membrane bioreactors preferably employ submerged hollow fiber membrane modules incorporated in a distributed flow reactor . membrane processes can be used as an effective tertiary treatment of sewage and provide quality effluent . submerged membrane processes where the membrane modules are immersed in a large feed tank and filtrate is collected through suction applied to the filtrate side of the membrane , and wherein the membrane bioreactor combines biological and physical processes in one stage , are compact , efficient , economic , and versatile . the cantilever system described herein can be modified or adapted to accommodate various membrane module or cartridge systems as are commercially available , such as those commercially available from usfilter memcor research pty . ltd . membrane modules and cartridges , and related systems , devices , and methods , are described , for example , in u . s . pat . no . 5 , 639 , 373 , u . s . pat . no . 5 , 783 , 083 , u . s . pat . no . 5 , 910 , 250 , u . s . pat . no . 5 , 944 , 997 , u . s . pat . no . 6 , 042 , 677 , u . s . re37 , 549 , u . s . pat . no . 6 , 193 , 890 , u . s . pat . no . 6 , 294 , 039 , u . s . pat . no . 6 , 620 , 319 , u . s . pat . no . 6 , 685 , 832 , u . s . pat . no . 6 , 682 , 652 , u . s . pat . no . 6 , 319 , 411 , u . s . pat . no . 6 , 375 , 848 , u . s . pat . no . 6 , 245 , 239 , u . s . pat . no . 6 , 325 , 928 , u . s . pat . no . 6 , 550 , 747 , u . s . pat . no . 6 , 656 , 356 , u . s . pat . no . 6 , 708 , 957 , u . s . pat . no . 6 , 706 , 189 , u . s . publ . no . 2004 - 0035780 - a1 , u . s . publ . no . 2003 - 0164332 - a1 , u . s . publ . no . 2002 - 0130080 - a1 , u . s . publ . no . 2002 - 0179517 - a1 , u . s . publ . no . 2004 - 0007527 a1 , u . s . pat . no . 5 , 918 , 264 , u . s . pat . no . 6 , 159 , 373 , u . s . pat . no . 6 , 077 , 435 , u . s . pat . no . 6 , 156 , 200 , u . s . pat . no . 6 , 254 , 773 , u . s . pat . no . 6 , 202 , 475 , u . s . design patent 478913 , u . s . design patent 462699 , and u . s . pat . no . 6 , 524 , 481 , the contents of which are hereby incorporated by reference in their entirety . the membrane bioreactor systems preferably employed in the preferred embodiments utilize an effective and efficient membrane cleaning method . commonly used physical cleaning methods include backwash ( backpulse , backflush ) using a liquid permeate or a gas , membrane surface scrubbing , and scouring using a gas in the form of bubbles in a liquid . examples of the second type of method are described in u . s . pat . no . 5 , 192 , 456 to ishida et al ., u . s . pat . no . 5 , 248 , 424 to cote et al ., u . s . pat . no . 5 , 639 , 373 to henshaw et al ., u . s . pat . no . 5 , 783 , 083 to henshaw et al ., and u . s . pat . no . 6 , 555 , 005 to zha et al . in the examples referred to above , a gas is injected , usually by a pressurized blower , into a liquid system where a membrane module is submerged to form gas bubbles . the bubbles so formed then travel upwards to scrub the membrane surface to remove the fouling substances formed on the membrane surface . the shear force produced largely relies on the initial gas bubble velocity , bubble size , and the resultant forces applied to the bubbles . the fluid transfer in this approach is limited to the effectiveness of the gas lifting mechanism . to enhance the scrubbing effect , more gas has to be supplied . however , this method has several disadvantages : it consumes large amounts of energy , it can form mist or froth flow reducing effective membrane filtration area , and can be destructive to membranes . moreover , in an environment of high concentration of solids , the gas distribution system can gradually become blocked by dehydrated solids or simply be blocked when the gas flow accidentally ceases . for most tubular membrane modules , the membranes are flexible in the middle ( longitudinal directions ) of the modules but tend to be tighter and less flexible towards to both potted heads . when such modules are used in an environment containing high concentrations of suspended solids , solids are easily trapped within the membrane bundle , especially in the proximity of two potted heads . the methods to reduce the accumulation of solids include the improvement of module configurations and flow distribution when gas scrubbing is used to clean the membranes . in the design of a membrane module , the packing density of the tubular membranes in a module is one factor that is considered . the packing density of the fiber membranes in a membrane module as used herein is defined as the cross - sectional potted area taken up by the fiber membranes divided by the total potted area and is normally expressed as a percentage . from the economical viewpoint it is desirable that the packing density be as high as possible to reduce the cost of making membrane modules . in practice , solid packing is reduced in a less densely packed membrane module . however , if the packing density is too low , the rubbing effect between membranes could also be lessened , resulting in less efficient scrubbing / scouring of the membrane surfaces . it is thus desirable to provide a membrane configuration that assists removal of accumulated solids while maximizing packing density of the membranes . the membranes can be in contact with each other ( e . g ., at high packing densities ), or can be closely or distantly spaced apart ( e . g ., at low packing densities ), for example , a spacing between fiber walls of from about 0 . 1 mm or less to about 10 mm or more is typically employed . in some embodiments , a method of scrubbing a membrane surface using a liquid medium with gas bubbles entrained therein , including the steps of entraining the gas bubbles — into the liquid medium by flow of the liquid medium past a source of the gas , and flowing the gas bubbles and liquid medium along the membrane surface to dislodge fouling materials therefrom , can be employed in membrane bioreactors . preferably , the gas bubbles are entrained into the liquid stream by means of a venturi device or other type of junction . for further preference , the gas bubbles are entrained or injected into the liquid stream by means of devices which forcibly mix gas into a liquid flow to produce a mixture of liquid and bubbles , such devices including a jet , nozzle , ejector , eductor , injector or the like . optionally , an additional source of bubbles can be provided in the liquid medium by means of a blower or like device . the gas used can include , for example , air , nitrogen , oxygen , gaseous chlorine , or ozone . air is the most economical for the purposes of scrubbing and / or aeration . gaseous chlorine can be used for scrubbing , disinfection , and enhancing the cleaning efficiency by chemical reaction at the membrane surface . the use of ozone , besides the similar effects mentioned for gaseous chlorine , has additional features , such as oxidizing disinfectant by - product ( dbp ) precursors and converting non - biodegradable natural organic matter ( nom ) to biodegradable dissolved organic carbon . the membrane modules employed in the membrane bioreactor preferably comprise a plurality of porous membranes arranged in close proximity to one another , optionally mounted to prevent excessive movement therebetween , and include a source of gas bubbles for providing , from within the module gas bubbles entrained in a liquid flow such that , in use , the liquid and bubbles entrained therein move past the surfaces of the membranes to dislodge fouling materials therefrom , the gas bubbles being entrained in the liquid by flowing the liquid past a source of gas to draw the gas into the liquid flow . preferably , the liquid and bubbles are mixed and then flowed past membranes to dislodge the fouling materials . the fibers of the membrane bioreactor can be cleaned by providing , from within the array of fibers , by means other than gas passing through the pores of the membranes , uniformly distributed gas - bubbles entrained in a liquid flow , the gas bubbles being entrained in the liquid flow by flowing the liquid past a source of gas so as to cause the gas to be drawn and / or mixed into the liquid , the distribution being such that the bubbles pass substantially uniformly between each membrane in the array to , in combination with the liquid flow , scour the surface of the membranes and remove accumulated solids from within the membrane module . preferably , the bubbles are injected and mixed into the liquid flow . preferably , the membranes of the membrane bioreactor comprise porous hollow fibers , the fibers being fixed at each end in a header , the lower header having one or more holes formed therein through which gas liquid flow is introduced . the holes can be circular , elliptical or in the form of a slot . the fibers are normally sealed at the lower end and open at their upper end to allow removal of filtrate , however , in some arrangements , the fibers can be open at both ends to allow removal of filtrate from one or both ends . the fibers are preferably arranged in cylindrical arrays or bundles , however other configurations can also be employed , e . g ., square , hexagonal , triangular , irregular , and the like . it will be appreciated that the cleaning process described is equally applicable to other forms of membrane such flat or plate membranes that can also be employed in membrane bioreactors . the membrane modules employed in the membrane bioreactor preferably comprise a plurality of porous hollow fiber membranes , the fiber membranes being arranged in close proximity to one another and mounted to prevent excessive movement therebetween , the fiber membranes being fixed at each end in a header , one header having one or more of holes formed therein through which gas / liquid flow is introduced , and partition means extending at least part way between the headers to partition the membrane fibers into groups . preferably , the partition or partitions are formed by a spacing between respective fiber groups , however porous ( e . g ., a screen , clip , or ring ) or solid partitions can also be employed . the partitions can be parallel to each other or , in the case of cylindrical arrays of fiber membranes , the partitions can extend radially from the center of the array or be positioned concentrically within the cylindrical array . in an alternative form , the fiber bundle can be provided with a central longitudinal passage extending the length of the bundle between the headers . the membrane modules employed in a membrane bioreactor preferably include a plurality of porous hollow membrane fibers extending longitudinally between and mounted at each end to a respective potting head , the membrane fibers being arranged in close proximity to one another and mounted to prevent excessive movement therebetween , the fibers being partitioned into a number of bundles at least at or adjacent to their respective potting head so as to form a space therebetween , one of the potting heads having an array of aeration openings formed therein for providing gas bubbles within the module such that , in use , the bubbles move past the surfaces of the membrane fibers to dislodge fouling materials therefrom . the fiber bundle can be protected and fiber movement can be limited by a module support screen which has both vertical and horizontal elements appropriately spaced to provide unrestricted fluid and gas flow through the fibers and to restrict the amplitude of fiber motion reducing energy concentration at the potted ends of the fibers . alternatively , clips or rings can also be employed to bind the fiber bundle . preferably , the aeration openings are positioned to coincide with the spaces formed between the partitioned bundles . preferably , the openings comprise one or more holes or slots , which can be arranged in various configurations , e . g ., a row of holes . preferably , the fiber bundles are located in the potting head between the slots or rows of holes . in certain embodiments , it can be preferred to situate the holes or slots within the fiber bundles , or both within and adjacent to the fiber bundles . preferably , the gas bubbles are entrained or mixed with a liquid flow before being fed through the holes or slots , though it will be appreciated that gas only can be used in some configurations . the liquid used can be the feed to the membrane module . the fibers and / or fiber bundles can cross over one another between the potting heads though it is desirable that they do not . typically , the fibers within the module have a packing density ( as defined above ) of from about 5 % or less to about 75 % or more , preferably from about 6 , 7 , 8 , 9 , or 10 % to about 60 , 65 , or 70 %, and more preferably from about 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , or 20 % to about 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , or 55 %. preferably , the holes have a diameter of from about 0 . 5 mm or less to about 50 mm or more , more preferably from about 0 . 6 , 0 . 7 , 0 . 8 , 0 . 9 , 1 . 0 , 1 . 1 , 1 . 2 , 1 . 3 , 1 . 4 , or 1 . 5 to about 25 , 30 , 35 , 40 , or 45 mm , and most preferably from about 1 . 75 , 2 . 0 , 2 . 5 , 3 . 0 , 3 . 5 , 4 . 0 , 4 . 5 , or 5 . 0 mm to about 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , or 24 mm . in the case of a slot or row of holes , the open area is chosen to be equivalent to that of the above holes . typically , the fiber inner is from about 0 . 05 mm or less to about 10 mm or more , preferably from about 0 . 10 , 0 . 15 , or 0 . 20 mm to about 3 , 4 , 5 , 6 , 7 , 8 , or 9 mm , and preferably from about 0 . 25 , 0 . 50 , 0 . 75 , or 1 . 0 mm to about 1 . 25 , 1 . 50 , 1 . 75 , 2 . 00 , or 2 . 50 mm . the fibers wall thickness can depend on materials used and strength required versus filtration efficiency . typically , wall thickness is from about 0 . 01 mm or less to about 3 mm or more , preferably from about 0 . 02 , 0 . 03 , 0 . 04 , 0 . 05 , 0 . 06 , 0 . 07 , 0 . 08 , or 0 . 09 mm to about 1 . 1 , 1 . 2 , 1 . 3 , 1 . 4 , 1 . 5 , 1 . 6 , 1 . 7 , 1 . 8 , 1 . 9 , 2 . 0 , 2 . 1 , 2 . 2 , 2 . 3 , 2 . 4 , 2 . 5 , 2 . 6 , 2 . 7 , 2 . 8 , or 2 . 9 mm , and most preferably from about 0 . 1 , 0 . 2 , 0 . 3 , 0 . 4 , or 0 . 5 mm to about 0 . 6 , 0 . 7 , 0 . 8 , 0 . 9 , or 1 mm . the membrane bioreactor can include a tank having a line , a pipe , a pump , and or other apparatus for the introduction of feed thereto , an activated sludge within the tank , a membrane module positioned within the tank so as to be immersed in the sludge , and apparatus for withdrawing filtrate from at least one end of the fiber membranes . the membrane bioreactor is preferably operated by introducing feed to the tank , applying a vacuum to the fibers to withdraw filtrate therefrom while intermittently , cyclically , or continuously supplying gas bubbles through the aeration openings to within the module such that , in use , the bubbles move past the surfaces of the membrane fibers to dislodge fouling materials therefrom . preferably , the gas bubbles are entrained or mixed with a liquid flow when fed through the holes or slots . if desired , a further source of aeration can be provided within the tank to assist microorganism activity . preferably , the membrane module is suspended vertically within the tank and the further source of aeration can be provided beneath the suspended module . alternatively , the module can be suspended horizontally , or in any other desired position . preferably , the further source of aeration comprises a group of air permeable tubes or other such aeration source . the membrane module can be operated with or without backwash , depending on the flux . a high mixed liquor of suspended solids ( about 5 , 000 ppm or less to about 20 , 000 ppm or more ) in the bioreactor has been shown to significantly reduce residence time and improve filtrate quality . the combined use of aeration for both degradation of organic substances and membrane cleaning has been shown to enable constant filtrate flow without significant increases in transmembrane pressure while establishing , high concentration of mixed - liquor suspended solids ( mlss ). the use of partitioned fiber bundles enables higher packing densities to be achieved without significantly compromising the gas scouring process . this provides for - higher filtration efficiencies to be gained . in a particularly preferred embodiment , a module as described in u . s . pat . no . 6 , 555 , 005 is employed in the membrane bioreactor . referring to fig6 , the membrane module 55 typically comprises fiber , tubular , or flat sheet form membranes 56 potted at two ends 57 and 58 and optionally encased in a support structure , in this case a screen 59 . either one or both ends of the membranes can be used for the permeate collection . the bottom of the membrane module has a number of through apertures 60 in the pot 61 to distribute a mixture of gas and liquid feed past the membrane surfaces . a venturi device 62 or the like is connected to the base of the module . the venturi device 62 intakes gas through inlet 63 , mixes or entrains the gas with liquid flowing through feed inlet 64 , forms gas bubbles and diffuses the liquid / gas mix into the module apertures 60 . after passing through the distribution apertures 60 , the entrained gas bubbles scrub membrane surfaces while travelling upwards along with the liquid flow . either the liquid feed or the gas can be a continuous or intermittent injection depending on the system requirements . with a venturi device it is possible to create gas bubbles and aerate the system without a blower . the venturi device 62 can be a venturi tube , jet , nozzle , ejector , eductor , injector , or the like . referring to fig7 , an enlarged view of jet or nozzle type device 65 is shown . in this embodiment , liquid is forced through a jet 66 having a surrounding air passage 67 to produce a gas entrained liquid flow 68 . such a device allows the independent control of gas and liquid medium — by adjusting respective supply valves . the liquid commonly used to entrain the gas is the feed water , wastewater , or mixed liquor to be filtered . pumping such an operating liquid through a venturi or the like creates a vacuum to suck the gas into the liquid , or reduces the gas discharge pressure when a blower is used . by providing the gas in a flow of the liquid , the possibility of blockage of the distribution apertures 60 is substantially reduced . by using a venturi device or the like it is possible to generate gas bubbles to scrub membrane surfaces without the need for a pressurized gas supply such as a blower . when a motive fluid passes through a venturi it generates a vacuum to draw the gas into the liquid flow and generate gas bubbles therein . even if a blower is still required , the use of the above process reduces the discharge pressure of the blower and therefore lowers the cost of operation . the liquid and gas phases are well mixed in the venturi and then diffuse into the membrane module to scrub the membranes . where a jet type device is used to forcibly mix the gas into the liquid medium , an additional advantage is provided in that a higher velocity of bubble stream is produced . in treatment of wastewater , such thorough mixing provides excellent oxygen transfer when the gas used is air or oxygen . if the gas is directly injected into a pipe filled with a liquid , it is impossible that the gas will form a stagnant gas layer on the pipe wall and therefore gas and liquid will bypass into different parts of a module , resulting in poor cleaning efficiency . the flow of gas bubbles is enhanced by the liquid flow along the membrane resulting in a large scrubbing shear force being generated . this method of delivery of gas / liquid provides a positive fluid transfer and aeration with the ability to independently adjust flow rates of gas and liquid . the injection of a mixture of two - phase fluid ( gas / liquid ) into the holes of the air distribution device can eliminate the formation of dehydrated solids and therefore prevent the gradual blockage of the holes by such dehydrated solids . the injection arrangement further provides an efficient cleaning mechanism for introducing cleaning chemicals effectively into the depths of the module while providing scouring energy to enhance chemical cleaning . this arrangement , in combination with the high packing density obtainable with the module configuration described , enables the fibers to be effectively cleaned with a minimal amount of chemicals . the module configuration described allows a higher fiber packing density in a module without significantly increasing solid packing . this adds an additional flexibility that the membrane modules can be either integrated into the aerobic basin or arranged in a separate tank . in the latter arrangement , the advantage is a significant saving on chemical usage due to the small chemical holding in the tank and in labor costs because the chemical cleaning process can be automated . the reduction in chemicals used is also important because the chemicals , which can be fed back to the bio process , are still aggressive oxidizers and therefore can have a deleterious effect on bio process . accordingly , any reduction in the chemical load present in the bio - process provides significant advantages . the positive injection of a mixture of gas and liquid feed to each membrane module provides a uniform distribution of process fluid around membranes and therefore minimizes the feed concentration polarization during filtration . the concentration polarization is greater in a large - scale system and for the process feed containing large amounts of suspended solids . the prior art systems have poor uniformity because the process fluid often enters one end of the tank and concentrates as it moves across the modules . the result is that some modules must deal with much higher concentrations than others , resulting in inefficient operation . the filtration efficiency is enhanced due to a reduced filtration resistance . the feed side resistance is decreased due to a reduced transverse flow passage to the membrane surfaces and the turbulence generated by the gas bubbles and the two - phase flow . such a cleaning method can be used to the treatment of drinking water , wastewater , and the related processes by membranes . the filtration process can be driven by suction or pressurization . referring to fig8 a , 8 b , 9 a , and 9 b , embodiments of various partitioning arrangements are shown . again these embodiments are illustrated with respect to cylindrical tubular or fiber membrane bundles 70 , however , it will be appreciated that other configurations can be employed . fig8 a and 8 b show a bundle of tubular membranes 70 partitioned vertically into several thin slices 71 by a number of parallel partition spaces 72 . this partitioning of the bundle enables accumulated solids to be removed more easily without significant loss of packing density . such partitioning can be achieved during the potting process to form complete partitions or partial partitions . another method of forming a partitioned module is to pot several small tubular membrane bundles 73 into each module as shown in fig9 a and 9 b . another configuration of membrane module is illustrated in fig1 a and 10 b . the central membrane - free zone forms a passage 74 to allow for more air and liquid injection . the gas bubbles and liquid then travel along the tubular membranes 70 and pass out through arrays of fibers at the top potted head 58 , scouring and removing solids from membrane walls . a single gas or a mixture of gas / liquid can be injected into the module . fig1 a and 11 b illustrate yet a further embodiment similar to fig7 but with single central hole 75 in the lower pot 57 for admission of the cleaning liquid / gas mixture to the fiber membranes 70 . in this embodiment , the fibers are spread adjacent the hole 30 and converge in discrete bundles 73 toward the top pot 58 . the large central hole 75 has been found to provide greater liquid flow around the fibers and thus improved cleaning efficiency . fig1 and 13 show further embodiments of the invention having a similar membrane configuration to that of fig1 a and 11 b and jet mixing system similar to that of the embodiment of fig7 . the use of a single central hole 75 allows filtrate to be drawn off from the fibers 70 at both ends as shown in fig1 . referring to fig1 and 15 of the drawings , the module 76 comprises a plurality of hollow fiber membrane bundles 77 mounted in and extending between an upper 58 and lower potting head 57 . the potting heads 58 and 57 are mounted in respective potting sleeves 78 and 79 for attachment to appropriate manifolding ( not shown ). the fiber bundles 77 are surrounded by a screen 80 to prevent excessive movement between the fibers . as shown in fig1 , the lower potting head 57 is provided with a number of parallel arranged slot type aeration holes 81 . the fiber membranes 82 are potted in bundles 77 to form a partitioned arrangement having spaces 83 extending transverse of the fiber bundles . the aeration holes 81 are positioned to generally coincide with the partition spaces , though there is generally a number of aeration holes associated with each space . the lower potting sleeve 79 forms a cavity 84 below the lower pot 57 . a gas or a mixture of liquid and gas is injected into this cavity 84 , by a jet assembly 85 ( described earlier ) before passing through the holes 81 into the membrane array . in use , the use of partitioning enables a high energy flow of scouring gas and liquid mixture , particularly near the pot ends of the fiber bundles , which assist with removal of buildup of accumulated solids around the membrane fibers . air is preferably introduced into the module continuously to provide oxygen for microorganism activities and to continuously scour the membranes . alternatively , in some embodiments , pure oxygen or other gas mixtures can be used instead of air . the clean filtrate is drawn out of the membranes by a suction pump attached to the membrane lumens that pass through the upper pot , or the filtrate can be drawn out of the membranes from the lower pot by gravity or suction pump . preferably , the membrane module is operated under low transmembrane pressure ( tmp ) conditions due to the high concentration of suspended solids ( mlss ) present in the reactor . higher transmembrane pressure can advantageously be employed for reduced concentrations of suspended solids . the membrane bioreactor is preferably combined with an anaerobic process that assists with further removal of nutrients from the feed sewage . it has been found that the module system of preferred embodiments is more tolerant of high mlss than many other systems and the efficient air scrub and back wash ( when used ) assists efficient operation and performance of the bioreactor module . any suitable membrane bioreactor can be employed in the water treatment systems of the preferred embodiments . a particularly preferred membrane bioreactor system is designed to draw filtrate from a reservoir of liquid substrate by the use of vertically oriented microporous hollow fibers immersed within the substrate , as illustrated in fig1 . fig1 depicts a side view of a so - called “ cloverleaf ” filtration unit comprising four sub - modules . a plurality of such filtration units in a linear “ rack ” is immersed in a substrate reservoir . the illustrated membrane bioreactor filtration unit includes a filtrate sub - manifold ( not shown ) and an air / liquid substrate sub - manifold , which receive the upper and lower ends , respectively , of the four sub - modules . each sub - manifold includes four circular fittings or receiving areas , each of which receives an end of one of the sub - modules . each sub - module is structurally defined by a top cylindrical pot ( not shown ), a bottom cylindrical pot , and a cage ( not shown ) connected therebetween to secure the fibers . the pots secure the ends of the hollow fibers and are formed of a resinous or polymeric material . the ends of the cage are fixed to the outer surfaces of the pots . each pot and associated end of the cage are together received within one of the four circular fittings of each sub - manifold . the sub - manifolds and pots of the sub - modules are coupled together in a fluid - tight relationship with the aid of circular clips and o - ring seals . the cage provides structural connection between the pots of each sub - module . each sub - module includes fibers arranged vertically between its top and bottom pot . the fibers have a length somewhat longer than the distance between the pots , such that the fibers can move laterally . the cage closely surrounds the fibers of the sub - module so that , in operation , the outer fibers touch the cage , and lateral movement of the fibers is restricted by the cage . the lumens of the lower ends of the fibers are sealed within the bottom pot , while the upper ends of the fibers are not sealed . in other words , the lumens of the fibers are open to the inside of the filtrate sub - manifold above the upper face of the top pot . the bottom pot includes a plurality of slots extending from its lower face to its upper face , so that the mixture of air bubbles and liquid substrate in the air / liquid substrate sub - manifold can flow upward through the bottom pot to be discharged between the lower ends of the fibers . the filtrate sub - manifold is connected to a vertically oriented filtrate withdrawal tube that in turn connects to a filtrate manifold ( not shown ) that receives filtrate from all of the filtration units ( such as the illustrated cloverleaf unit ) of a rack . the filtrate withdrawal tube is in fluid communication with the upper faces of the top pots of the sub - modules , so that filtrate can be removed through the withdrawal tube . in addition , the system includes an air line that provides air to the air / liquid substrate sub - module skirt , as depicted in fig1 . in operation , the cages of the sub - modules admit the liquid substrate into the region of the hollow fibers , between the top and bottom pots . a pump ( not shown ) is utilized to apply suction to the filtrate manifold and , thus , the filtrate withdrawal tubes and fiber lumens of the sub - modules . this creates a pressure differential across the walls of the fibers , causing filtrate to pass from the substrate into the lumens of the fibers . the filtrate flows upward through the fiber lumens into the filtrate sub - manifold , through the filtrate withdrawal tube , and upward into the filtrate manifold to be collected outside of the reservoir . during filtration , particulate matter accumulates on the outer surfaces of the fibers . as increasing amounts of particulate matter stick to the fibers , it is necessary to increase the pressure differential across the fiber walls to generate sufficient filtrate flow . to maintain cleanliness of the outer surfaces of the fibers , air and liquid substrate are mixed in the skirt of the air / liquid substrate sub - module and the mixture is then distributed into the fiber bundles through the slots of the bottom pots and is discharged as a bubble - containing mixture from the upper faces of the bottom pots . continuous , intermittent , or cyclic aeration can be conducted . it is particularly preferred to conduct cyclic aeration , wherein the air on and air off times are of equal length , and the total cycle time . ( time of one air on and one air off period ), is from about 1 second or less to about 15 minutes or more , preferably from about 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , or 14 second to about 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , or 14 minutes , and more preferably from about 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , 60 , 65 , 70 , 75 , 80 , 85 , 90 , 95 , 100 , 105 , 110 , 115 , or 120 seconds to about 130 , 140 , 150 , 160 , 170 , 180 , 190 , 200 , 210 , 220 , 230 , 240 , 250 , 260 , 270 , 280 , 290 , or 300 seconds . the rising bubbles scour ( i . e ., clean particulate matter from ) the fiber surfaces . aeration wherein the air is provided in uniform bubble sizes can be provided , or a combination of different bubble sizes can be employed , for example , coarse bubbles or fine bubbles , simultaneously or alternately . regular or irregular cycles ( in which the air on and air off times vary ) can be employed , as can sinusoidal , triangular , or other types of cycles , wherein the rate of air is not varied in a discontinuous fashion , but rather in a gradual fashion , at a preferred rate or varying rate . different cycle parameters can be combined and varied , as suitable . in a particularly preferred embodiment , fine bubbles are continuously provided to the membrane bioreactor for aeration , while coarse bubbles are provided cyclically for scouring . bubbles are typically from about 0 . 1 or less to about 50 mm or more in diameter . bubbles from about 0 . 1 to about 3 . 0 mm in diameter , preferably from about 0 . 2 , 0 . 3 , 0 . 4 , 0 . 5 , 0 . 6 , 0 . 7 , 0 . 9 , 0 . 9 , or 1 . 0 mm to about 1 . 25 , 1 . 50 , 1 . 75 , 2 . 00 , 2 . 25 , 2 . 50 or 2 . 75 mm in diameter are particularly effective in providing oxygen to the bioreactor . bubbles of from about 20 to about 50 mm in diameter , preferably from about 25 , 30 , or 35 to about 40 or 45 mm in diameter , are particularly effective in scouring the membranes . bubbles of from about 3 to about 20 mm in diameter , preferably from about 4 , 5 , 6 , 7 , 8 , 9 , or 10 mm to about 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , or 19 mm in diameter , are generally preferred as providing both acceptable oxygenation and scouring . the cantilever system of preferred embodiments can be applied to a variety of submerged membrane filtration systems and provides a number of advantages over the prior art including a simple one person operation , a compact facility not requiring significant headroom above the tank or costly equipment such as hoists or the like . all numbers expressing quantities of ingredients , reaction conditions , and so forth used in the specification and claims are to be understood as being modified in all instances by the term “ about .” accordingly , unless indicated to the contrary , the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention . at the very least , and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims , each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches . the term “ comprising ” as used herein is synonymous with “ including ,” “ containing ,” or “ characterized by ,” and is inclusive or open - ended and does not exclude additional , unrecited elements or method steps . the above description discloses several methods and materials of the present invention . this invention is susceptible to modifications in the methods and materials , as well as alterations in the fabrication methods and equipment . such modifications will become apparent to those skilled in the art from a consideration of this disclosure or practice of the invention disclosed herein . consequently , it is not intended that this invention be limited to the specific embodiments disclosed herein , but that it cover all modifications and alternatives coming within the true scope and spirit of the invention as embodied in the attached claims . | 1 |
referring firstly to fig1 shown therein is a greatly simplified perspective view of a fuel container 1 of plastic material , which has a peripherally extending welded seam generally indicated at 2 . the fuel container 1 shown can typically be the fuel tank of a motor vehicle . the illustrated fuel container 1 is preferably in the form of a hollow molding produced by extrusion blow molding , with a multi - layer container wall as indicated at 3 in fig2 which in known manner involves a six - layer structure including an inwardly disposed barrier layer 4 to afford permeability resistance for hydrocarbons . it should be mentioned at this juncture that the invention expressly also concerns fuel containers which were welded together from two half - shell portions in the second heat . whether the plastic components to be welded together are of a single - layer or multi - layer structure is of significance in regard to the invention only insofar as the problem of the welded seams as potential diffusion weak points in the fuel container is important , in particular in the case of fuel containers with walls of a multi - layer structure . these problems will be discussed hereinafter with reference to fig2 and 3 , with fig2 showing part of a container wall 3 with a welded seam 2 formed by the procedure in the state of the art . fig3 shows a portion on an enlarged scale from the container wall 3 in fig2 showing the typical structure of a multi - layer container wall 3 of a plastic container produced by extrusion blow molding . the wall comprises an outer layer 5 and an inner layer 6 , each comprising polyethylene . the outer layer is possibly of a dark color . the outer layer 5 is of a layer thickness of between about 10 and 15 % of the overall thickness of the container wall and the inner layer is of a thickness of about 20 %, as the load - bearing layer . reference 7 denotes a layer of regenerated or recycled material , for example processed waste material or scrap , generally comprising a mixture of all materials forming the container wall 3 . the barrier layer 4 is embedded between the layer 7 and the inner layer 6 , with the interposition of bonding layers . it will be appreciated that , upon production of a fuel container 1 of such a configuration by extrusion blow molding the operation of squeezing off the tubular preform will give rise to a welded seam 2 of greater or lesser size and which under some circumstances may extend completely around the fuel container , as is shown in fig2 . as can readily be seen from fig2 it will be appreciated that the inner layers 6 of the container wall 3 in that case bear against each other . in the region of the location where the tubular preform is squeezed off , all the layers blend together , but over wide parts of the welded connection formed in that way only the inner layers 6 of adjacent wall regions are in contact against each other , even if in that region they are of a reduced residual thickness . those residual - thickness layers have a lower level of barrier effect in relation to hydrocarbons so that consequently a small proportion of hydrocarbons can still diffuse through the welded seam 2 . reference is now made to fig4 showing an embodiment of a welded seam of a fuel container 1 in accordance with the present invention . the welded seam 2 is of such a configuration that it is penetrated in its longitudinal extent by a duct 10 which is adapted to be filled with and emptied of air . hydrocarbons which diffuse from the interior of the fuel container 1 through the inner layers 6 which are welded together and between the barrier layers 4 pass into the duct 10 by virtue of the lower partial pressure therein . it will be noted that the wall structure of the fuel container is shown in simplified views in the relevant figures illustrating the various embodiments of the invention , and that wall structure should approximately correspond to that illustrated in fig3 . looking now at fig5 the view therein diagrammatically shows that the duct 10 is provided at each of two end positions with an air - filling or intake connection 11 and an air - discharge or venting connection 12 . by virtue of a drop in concentration in the duct 10 to a filter element ( not shown ), fuel vapors will be positively caused to flow through the duct 10 and issue therefrom into the filter element . it will be noted that the duct 10 can also be specifically and targetedly flushed with air or ventilated , for example either by applying a reduced pressure to the duct at an appropriate location or by applying an increased pressure thereto . the flushing air does not necessarily have to be fed to a filter element but rather it can also be fed to the combustion air for the associated engine . the connections 11 and 12 which are provided for ventilation purposes on the duct 10 can also be formed in the procedure for producing the fuel container 1 . reference is now made to fig6 diagrammatically showing manufacture of a fuel container 1 in accordance with the present invention by extrusion blow molding . in fig6 references 13 a and 13 b show first and second mold portions of a blow molding mold in a closed condition , while reference 14 denotes cutting edges which sever the material , projecting out of the mold , of the preform which is already expanded under the effect of an increased pressure therein , thereby to form the welded seam 2 . as can be seen from fig6 the squeeze edges of the mold portions 13 a , 13 b are each provided with a respective semicircular groove 15 which extends around the mold . the grooves 15 form a duct - shaped opening or recess when the mold portions 13 a , 13 b are in the closed condition as shown . in order to ensure that the duct 10 remains free and open and the walls of the container are not welded together in that region , a plurality of blowing needles 16 which are arranged at spacings in succession may possibly be provided in the longitudinal direction of the welded seam 2 , for example at least at the beginning and at the end of the duct 10 . the blowing needles 16 extend into the opening or recess defined by the grooves 15 and serve to introduce blowing air thereinto in order to cause the duct 10 to be inflated into the appropriate shape against the wall surfaces of the grooves 15 . looking now at fig7 diagrammatically shown therein is a connection on a fuel container 1 comprising two prefabricated half - shell portions 17 each of a multi - layer wall structure . the regions which are to be welded together are each in the form of peripherally extending flange - like collars 18 . a duct 10 of the kind described hereinbefore is also formed by channels 19 which are provided in the respective collars 18 , after the two half - shell portions 17 are welded together . fig8 through 11 show various alternative configurations of container walls 3 when first and second half - shell portions 17 are welded together to form a fuel container 1 . in the alternative configuration of the wall container 3 in the region of the welded seam 2 , as shown in fig8 the inside wall of the first half - shell portion 17 , being the upper half - shell portion in fig8 is welded to the outside wall of the second half - shell portion 17 , thereby forming the duct 10 therebetween . in this configuration of the connection between the half - shell portions 17 , pressure can be applied to the welded seam 2 at the inside of the container when making the connection , such pressure being produced for example by means of a gaseous medium . in the case of the connection shown in fig9 the container walls 3 are welded together in the manner of an end butting relationship , forming respective steps or shoulders as indicated at 20 . for the purposes of centering the half - shell portions 17 with respect to each other and in order to keep the duct 10 open , spacers in the form of respective knobs 21 are provided at the inside and outside on the wall regions of the half - shell portions 17 , which form the duct 10 . the knobs 21 are arranged in respective rows which extend in the longitudinal direction of the welded seam 2 , and thus into the plane of the drawing . in the case of the connection between the half - shell portions 17 as shown in fig1 and 11 , one half - shell portion 17 is of a configuration such as to conically enlarge in a direction towards its opening , in other words , the upper half - shell portion 17 in fig1 expands conically outwardly in a downward direction , whereas the other half - shell portion , being the lower half - shell portion 17 in fig1 , is of a conically inwardly tapering configuration in complementary relationship therewith , thereby affording an angular position for the welded seam or seams 2 , which is such that it can compensate for inaccuracies in respect of shape and in which a pressure is applied to the welded seam 2 when the half - shell portions 17 are fitted together . it will be appreciated that while the foregoing text at the appropriate locations refers in each case only to a welded seam , that is also intended to denote first and second welded seams which are at a spacing from each other , being separated by the duct 10 . finally , referring to fig1 and 13 , shown therein is the welding of a multi - layer cover 22 with at least one barrier layer 4 embedded therein , to the container wall 3 , in the region of an opening 23 therein . provided in the cover 22 on the inward face thereof , that is to say on the face thereof which is towards the container wall 3 , extending peripherally therearound at the edge portion thereof , is a channel 19 which is of semicircular cross - section and which forms a duct which is also semicircular in cross - section . a corresponding channel is not provided in the container wall 3 as that is not absolutely necessary and would only represent unnecessary weakening of the container wall 3 in that region . it will be appreciated that in a corresponding manner the duct may also be of the configuration shown in the embodiments of fig7 through 11 . fig1 shows an alternative form of this structure where a cover 22 is welded to the fuel container in the region of an opening 23 , at a location where the container wall 3 forms a cover flange or neck structure 24 . fig1 also shows an air intake connection 11 communicating with the duct 10 and an air - discharge or venting connection 12 . it will be appreciated that the connections 11 and 12 may also be provided in the embodiment illustrated in fig1 but are not shown therein . it will be appreciated that the above - described embodiments of the invention have been set forth solely by way of example and illustration of the principles of the present invention and that various other modifications and alterations may be made therein without thereby departing from the spirit and scope of the invention . for example the shell portions 17 may be obtained by cutting open a blow - molded container or tank . | 1 |
in some embodiments , an uninterruptible power supply ( ups ) receives commands from a computer system . the ups can parse and filter the commands for example , a user and / or developer can designate subsets of commands as unrestricted commands and restricted commands . the unrestricted commands can be allowed and executed as received . the restricted commands can be disallowed and discarded . in some embodiments , the ups can be delivered pre - configured to classify all commands as restricted commands in some embodiments , the restricted commands are executed if the restricted commands are properly authenticated . in some embodiments , a subset of commands can be designated to never be allowed when received from a computer system . in various embodiments , the filtering of commands is activated and deactivated based on a configuration setting . for example , the user can set a switch to a first position to activate the filtering of commands various embodiments are described in greater detail below with reference to the figures . examples of the methods and apparatuses discussed herein are not limited in application to the details of construction and the arrangement of components set forth in the following description or illustrated in the accompanying drawings . the methods and apparatuses are capable of implementation in other examples and of being practiced or of being carried out in various ways . examples of specific implementations are provided herein for illustrative purposes only and are not intended to be limiting . in particular , acts , elements and features discussed in connection with any one or more examples are not intended to be excluded from a similar role in any other examples . also , the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . any references to examples or elements or acts of the apparatus and methods herein referred to in the singular may also embrace examples including a plurality of these elements , and any references in plural to any example or element or act herein may also embrace examples including only a single element . references in the singular or plural form are not intended to limit the presently disclosed systems or methods , their components , acts , or elements . the use herein of “ including ,” “ comprising ,” “ having ,” “ containing ,” “ involving ,” and variations thereof is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . references to “ or ” may be construed as inclusive so that any terms described using “ or ” may indicate any of a single , more than one , and all of the described terms . any references to front and back , left and right , top and bottom , upper and lower , and vertical and horizontal are intended for convenience of description , not to limit the present apparatus and methods or their components to any one positional or spatial orientation . fig1 is a block diagram of an example network system of some embodiments . in particular , the system 100 includes one or more systems connected by one or more networks . in the example shown , a system 102 is coupled to a proxy system 101 over a network 103 . according to some embodiments , the proxy system 101 has a capability for communicating to the system 102 using a communication protocol . communication with the system 102 may be useful , for example , for monitoring or managing a system 104 by the system 102 . in an alternative configuration ( not shown ), the system 102 may be coupled directly to another system ( e . g ., system 104 ) or via a network ( e . g ., network 105 ). for example , in some embodiments , the system 102 is a computer and the system 104 is a ups . further , according to some embodiments , the proxy system 101 translates requests from one or more systems ( e . g ., system 102 ) to requests that may be processed by the system 104 . these requests may be , for example , messages generated by an application program executing on system 102 . one example application program that may generate such requests is a management program that is provided for managing one or more systems ( e . g ., system 104 ). these requests may include control data used to control and configure system 104 , requests for performance and / or status information from system 104 , among others . to this end , proxy 101 may be capable of translating received management requests to messages that are capable of being processed by system 104 . although proxy 101 may be capable of communicating management data , it should be appreciated that proxy 101 may be capable of translating any type of request having any type of data . in some embodiments , the proxy system 101 is coupled to more than one system . in one example , the proxy system 101 is coupled to two or more networks ( e . g ., network 103 and network 105 ). to this end , proxy 101 may have more than one network interface . proxy 101 may also be capable of communicating using one or more communication protocols . proxy 101 may also be incorporated in the system 104 . in some embodiments , the system 100 may exist as part of a remote computing infrastructure , such as a cloud computing infrastructure . for example , the system 102 may be located remote from the system 104 , but may still monitor and control the system 104 remotely . as discussed in greater detail below , the system 102 and the system 104 may be implemented as entities in an internet - of - things ( iot ) environment . system 100 is merely an illustrative embodiment of a communication system in accordance with one embodiment . any of numerous other implementations of the system ( e . g ., variations of 100 having more or less systems ) are possible and are intended to fall within the scope of embodiments . various embodiments may be implemented on one or more computer systems . these computer systems may be , for example , general - purpose computers such as those based on intel pentium - type processor , motorola powerpc , sun ultrasparc , hewlett - packard pa - risc processors , or any other type of processor . in one specific embodiment , various aspects of a communication protocol are provided that may be used by computer systems such as micro - controllers or micro - processors . such controllers may be embedded in one or more systems , such as , for example , an uninterruptible power supply ( ups ) or one of its components . in some embodiments , system 104 is a ups . fig2 shows an on - line ups 104 used to provide regulated , uninterrupted power in accordance with one example in accordance with the present invention . the ups 104 includes an input circuit breaker / filter 212 , a rectifier 214 , a control switch 215 , a controller 216 , a battery 218 , an inverter 220 , an isolation transformer 222 , a dc / dc converter 228 , a user interface ( ui ) 230 , data storage 232 and external system interface 234 . the ups also includes an input 224 for coupling to an ac power source , and an outlet 226 for coupling to a load . the ups 104 operates as follows . the circuit breaker / filter 212 receives input ac power from the ac power source through the input 224 , filters the input ac power and provides filtered ac power to the rectifier 214 . the rectifier 214 rectifies the input voltage . the dc / dc converter 228 regulates dc power from the battery 218 . the control switch 215 receives the rectified power and also receives the dc power from the dc / dc converter 228 . the controller 216 determines whether the power available from the rectifier 214 is within predetermined tolerances , and if so , controls the control switch 215 to provide the power from the rectifier 214 to the inverter 220 . if the power from the rectifier 214 is not within the predetermined tolerances , which may occur because of “ brown out ” or “ black out ” conditions , or due to power surges , then the controller 216 controls the control switch 215 to provide the dc power from the dc / dc converter 228 to the inverter 220 . the inverter 220 of the ups 104 receives dc power and converts the dc power to ac power and regulates the ac power to predetermined specifications . the inverter 220 provides the regulated ac power to the isolation transformer 222 . the isolation transformer 222 is used to increase or decrease the voltage of the ac power from the inverter 220 and to provide isolation between a load and the ups 104 . the isolation transformer 222 is an optional device , the use of which is dependent on ups output power specifications . depending on the capacity of the battery 218 and the power requirements of the load , the ups 104 can provide power to the load during brief power source dropouts or for extended power outages . specific examples in accordance with the present invention include several variations of the ups 104 . for instance , in one example , the ups 104 is configured to accept and distribute polyphase power , such as three phase power . in some examples , the outlet 226 includes a plurality of physical outlet groups , each of which includes a plurality of physical outlets . in other examples , the ups 104 is configured to monitor and record , in data storage 232 , the amount of power supplied via these outlet groups and outlets . in other examples , the ups 104 is a standby ups . in other examples , the ups 104 is a line interactive ups . returning to the example of fig2 , the controller 216 monitors and controls operation of the ups 104 . using data stored in associated memory , the controller 216 also performs one or more instructions that may result in manipulated data . in some examples , the controller 216 may include one or more processors or other types of controllers . in one example , the controller 216 is a commercially available , general purpose processor . in another example , the controller 216 performs a portion of the functions disclosed herein on a general purpose processor and performs another portion using an application - specific integrated circuit ( asic ) tailored to perform particular operations . as illustrated by these examples , examples in accordance with the present invention may perform the operations described herein using many specific combinations of hardware and software and the invention is not limited to any particular combination of hardware and software components . the data storage 232 stores computer readable information required for the operation of the ups 104 . this information may include , among other information , data subject to manipulation by the controller 216 and instructions that are executable by the controller 216 to manipulate data . thus , in some embodiments , the data storage 232 can receive and store or retrieve and provide this computer readable information . the data storage 232 may include relatively high performance , volatile , random access memory such as a dynamic random access memory ( dram ) or static memory ( sram ) or may include a nonvolatile storage medium such as read - only memory ( rom ), magnetic disk , flash memory , cd , dvd or one or more electrical switches , such as a dip switch . in one example , the data storage 232 includes both volatile and non - volatile storage . various examples in accordance with the present invention can organize the data storage 232 into particularized and , in some cases , unique structures to perform the aspects and functions disclosed herein . in addition , these data structures may be specifically configured to conserve storage space or increase data exchange performance . in one example , the data storage 232 includes data structures that house system information regarding the ups 104 and devices coupled to it . examples of system information are discussed below and include , among other information , configuration management information and performance information . the devices that may be coupled to the ups 104 include any electronic device that requires power to function , such as , among others , computers , printers , routers , switches , automatic transfer switches and air conditioning units . some devices may also include communication components , such as ethernet or usb interfaces , that can be coupled to the ups 104 via external system interface 234 to allow for enhanced communication between the device and the ups 104 . configuration management information may be any information that can be used to indentify attributes of the ups 104 or other devices . examples of configuration management information specific to a device include , among other information , manufacturer , model , serial number and version . in addition , configuration management information may also include manufacturer , model , serial number and version information for components included in the device , such as software installed on the device or identifiable hardware elements within the device . performance information may be any information that characterizes the operation of the ups 104 or other devices . examples of performance information include , among other information , device uptime information , operational logs and power consumption information . power consumption information may include listed , i e nameplate , values and actual measured values for power consumption of the device . the external system interface 234 exchanges data with one or more external devices . these external devices may include any device configured to communicate using standards and protocols supported by the ups 104 . examples of specific standards and protocols that the external system interface 234 may support include parallel , serial , and usb interfaces . other examples of these supported protocols and standards include networking technologies such as udp , tcp / ip and ethernet technologies . in at least some examples , the external system interface 234 includes a network management card ( nmc ) and a usb interface . in these examples , the external system interface 234 can receive or transmit data using either or both of these conduits . the user interface 230 includes a display screen and a set of keys through which a user of the ups 104 can monitor , control and configure operation of the ups 104 . in some embodiments , the user interface 230 includes a power button , a replace battery indicator , a warning indicator , an on - battery power indicator , an on - line power indicator , an interface display , a scroll up button , a scroll down button , an enter button , and an escape button . referring to fig3 , a general - purpose computer system according to some embodiments is configured to perform any of the functions described herein including , but not limited to , communicating between computer systems and / or relaying data to other systems ( e . g ., system 306 ). the system may perform other functions , and the embodiments are not limited to having any particular function or set of functions . various entities such as , for example , systems 102 , 104 and proxy 101 may be general - purpose computer systems that implement various communication functions according to various embodiments . for example , various embodiments may be implemented as specialized software executing in a general - purpose computer system 102 such as that shown in fig3 . the computer system 102 may include a processor 301 connected to one or more memory devices 302 , such as a disk drive , memory , or other device for storing data . memory 302 is typically used for storing programs and data during operation of the computer system 102 . components of the computer system 102 may be coupled by an interconnection mechanism ( e . g ., network 304 ), which may include one or more busses ( e . g ., between components that are integrated within a same machine ) and / or a network ( e . g ., between components that reside on separate machines ). the interconnection mechanism 304 enables communications ( e . g ., data , instructions ) to be exchanged between system components of system 102 . system 102 also includes one or more i / o devices 303 ( e . g ., ports , devices , systems , etc .) for inputting and outputting data . in addition , system 102 may contain one or more interfaces 305 that connect computer system 102 to a communication network 307 . according to some embodiments , interface 305 may be a serial - type interface that is used to communicate to an attached device . the interface 305 may be capable of communicating using various embodiments . such an interface 305 may use one or more serial - type transport layer protocols including , but not limited to , ttl serial , rs - 232 , rs - 422 , rs - 485 , i2c , can , usb , or any other transport layer capable of moving packets between systems . in some embodiments , the interface 305 may be an ethernet interface . in some embodiments , the interface 305 may be a wireless interface . fig4 shows a block diagram 400 including the ups 104 . in some embodiments , the computer system 102 communicates with the ups 104 to monitor and manage the ups 104 . as discussed above , the computer system 102 can be connected directly to the ups 104 , via a network , and / or via other intervening systems . the computer system 102 may be configured to monitor and control the ups 104 , such as in an iot environment , transmit commands to be executed by the ups 104 , and receive messages and data from the ups 104 . the messages can include acknowledgment messages from the ups 104 , for example , when the ups 104 successfully receives or executes a command transmitted by the computer system 102 . the data can include ups environment data , for example , information used by the computer system 102 to monitor the ups 104 and how the ups 104 is operating . for example , the ups environment data can include information such as remaining battery capacity , input power source , power quality , power output , temperature , and other information that can be provided by a ups to a user . in some embodiments , the ups 104 includes a communication stack 402 . the communication stack 402 can include various ports , hardware , software , and protocols that allow the ups 104 to communicate with external systems . the communication stack 402 can include the external system interface 234 described above with reference to fig2 . for example , the communication stack can include a serial port , a usb port , an ethernet port , a wireless connection , and / or other appropriate ports , along with corresponding software and protocols to communicate with the computer system 102 . in some embodiments , the communication stack receives the command and relays the command to a command processor 404 . the command processor 404 can include a general - purpose processor , as described above . the ups 104 also includes a local interface 406 . the local interface 406 can include the user interface 230 described above with reference to fig2 . the ups 104 can receive information via the local interface 406 to determine whether or not to filter commands the local interface 406 can be used to modify a configuration setting to determine whether the ups 104 filters commands . for example , the local interface may include a switch 408 and the configuration setting can be modified by the switch 408 . the user can turn on filtering by setting the switch 408 to a first position ( e . g ., an on position ). the switch 408 can be a hardware switch ( e . g ., a dip switch ) or a software switch . in some embodiments , the local interface 406 consists solely of the switch 408 . in some embodiments , the local interface 406 is not coupled to any networks ( e . g ., remote communication networks ) and external systems . the switch 408 can be configured to be accessible only via the local interface 406 , such that malicious users , software , viruses , or commands cannot modify or access the switch setting remotely . in this respect , the switch 408 is an “ out of band ” switch that can only be manipulated by a user that is physically present where the switch 408 is implemented . in some embodiments , the switch 408 is a key switch such that even with physical access to the ups 104 , a fitting key is needed to change the setting of the switch 408 . other appropriate access control methods can be used to prevent unauthorized changing of the configuration setting , such as usernames and username - password combinations . in some embodiments , the ups 104 also includes a received command configuration 410 , which the ups 104 can use to determine whether a received command is authorized . the received command configuration 410 is a configuration that can be determined by the user or a developer . in some embodiments , the received command configuration 410 includes a subset of commands that are authorized . for example , in some embodiments , the ups 104 can disallow a shutdown command and allow all other commands in some embodiments , the ups 104 can disallow a subset of commands deemed mission critical by a user and allow all other commands in some embodiments , the received command configuration 410 authorizes no commands in some embodiments , the received command configuration 410 authorizes all commands . commands include ups - specific commands , such as self - testing , testing a battery , routing power from different power sources , shutting off power to a load , changing configuration settings ( e . g ., acceptable power quality settings ). commands also include requests for information , such as environment data . the received command configuration 410 allows commands that are properly encrypted or authenticated . for example , the received command configuration 410 can authorize commands received with an authentication code and / or encrypted using an authentication code . the authentication code can be a password determined by the user and / or a code found on the ups 104 , such that users with physical access to the ups 104 can obtain the code . in some embodiments , the authentication code can be requested by the ups 104 upon receiving a command in a subset of commands requiring proper authentication . in some embodiments , the ups 104 can provide a time window in which the user can provide the authentication code . in some embodiments , the ups 104 can disallow the command for a time period upon one or more failed attempts to provide the authentication code . the time period can be constant or varying with multiple failures and / or require a local reset . the received command configuration 410 can allow commands based on the interface through which the command was received . for example , the received command configuration 410 can allow commands received via the local interface 406 and the usb and serial ports and not allow commands received through ethernet . the received command configuration 410 can use a combination of these configurations . for example , the received command configuration 410 can allow a first subset of commands and allow a second subset of commands only if the command is properly authenticated and disallow a third subset of commands in various embodiments , other appropriate combinations and / or configurations can be determined by the user . in some embodiments , the ups 104 can provide a plurality of predetermined configurations with varying levels of security for the user to select as the received command configuration 410 . for example , the switch 408 can have multiple settings , which correspond to each of the predetermined configurations of varying levels of security . alternatively or additionally , each of the switch settings can correspond to customized configurations . in some embodiments , the number of settings of the switch is configurable by the user . in some embodiments , the ups 104 includes a transmitted command configuration 412 , which the ups 104 can use to determine whether responses generated by the ups 104 are authorized to be transmitted . transmissions can include responses , such as acknowledgement of commands and confirming execution of commands transmissions can also include reports , such as load information and time of day . transmissions can be restricted to prevent private information from being reported and / or intercepted by malicious users . the transmitted command configuration 412 can operate with the ups 104 in a similar manner as the received command configuration 410 . in some embodiments , the transmitted command configuration 412 allows all transmissions , including responses and reports . in some embodiments , the transmitted command configuration 412 allows a subset of transmissions and disallows a second subset of transmissions . in some embodiments , the transmitted command configuration 412 can request an authentication code to allow all or a subset of transmissions . in some embodiments , the transmitted command configuration 412 can allow transmissions to a subset of interfaces and disallow transmissions to a second subset of interfaces . in some embodiments , combinations of these configurations are used . fig5 shows an example process 500 , which can be executed , for example , on the ups 104 . the ups 104 receives a command from the computer system 102 at act 502 . the command can be received by the communication stack 402 of the ups 104 . the communication stack 402 can route the command to the command processor 404 , where the command is interpreted at act 504 . a configuration setting can determine whether commands are filtered . when the configuration setting is set to not filtering ( e . g ., the switch 408 is set to an off position or a second position ), the command processor 404 allows all commands when the command interpreter allows all commands , the command processor 404 can route the commands directly to appropriate modules for execution by the ups 104 . when the configuration setting is set for filtering commands , the command is filtered at act 506 . in these embodiments , the command is parsed and a subset of commands is executed by the ups 104 at act 512 . for example , a subset of commands can be predetermined to be unrestricted and always allowable . unrestricted commands can include commands determined not to affect critical operations of the ups 104 . in some embodiments , unrestricted commands include commands such as requesting data , blinking light emitting diode ( led ) indicators on the ups 104 . in other embodiments , the subset of unrestricted commands includes no commands . the commands that are considered unrestricted can be determined by a developer . in some embodiments , the ups 104 can provide a plurality of predetermined subsets with varying levels of security for the user to select as the subset of commands that are unrestricted , restricted ( subject to authentication ), and restricted ( not subject to authentication ). the predetermined subsets can be selected by setting a switch with multiple positions , each position corresponding to one of the plurality of predetermined subsets of commands if the command is filtered at act 506 and determined to be in a subset of restricted commands , at act 508 the ups 104 determines whether the command is authorized based on the received command configuration 410 . the filtering of commands and the authorizing of commands can be combined . for example , commands that are unrestricted can be considered a subset of commands that are always authorized by the ups 104 . if the ups 104 disallows a command , the command is discarded at act 510 . the command can be discarded by ignoring the command in some embodiments , the ups 104 can record discarded commands , for example , to a file . the ups 104 can provide the file of recorded discarded commands to a user upon user request and / or at periodic intervals . in some embodiments , the ups 104 includes an attack detection algorithm . the attack detection algorithm can include viewing the recorded discarded commands for an indication that the ups 104 is being attacked by a malicious entity . the indication can include a pattern of received commands , a number of received commands , a frequency of received commands , failed authentication attempts , and / or other signs that the ups 104 is under attack . for example , the pattern of received commands can include one or more of predetermined sequences of commands , a regularity in periodicity of received commands , sources of commands , and / or other appropriate patterns . in some embodiments , the attack detection algorithm notifies the user of a suspected attack when an attack is detected . in some embodiments , the attack detection algorithm changes the received command configuration 410 if an attack is detected . the attack detection algorithm can change the received command configuration 410 to allow no commands when the ups 104 is determined to be under attack . alternatively or additionally , the attack detection algorithm can change the received command configuration 410 to configurations of varying levels of security depending on the perceived threat and / or the current configuration setting . in some embodiments , the attack detection algorithm can restore the received command configuration 410 to an original setting based on determining that the attack has ended . in some embodiments , the attack detection algorithm can restore the received command configuration 410 to an original setting after a predetermined time period . in some embodiments , a local reset can be required . the local reset can include an entering of a password and / or authentication code at the local interface 406 . the local reset can include a resetting of the switch or configuration setting , and / or other appropriate access control methods . if the ups 104 allows a command , the command is executed at act 512 . the process 500 is particularly advantageous to an end user where the user is able to access and modify the received command configuration 410 , because the end user is able to control which commands are restricted . in some examples , however , a user may be unable to access the received command configuration 410 , such as where the ups 104 is implemented in an internet - of - things ( iot ) environment . an iot environment includes a plurality of inter - networked devices which can communicate with each other directly or indirectly through a network to optimize the behavior of the iot devices . in some embodiments , it may be advantageous to implement at least one of the iot devices as a constrained device . a constrained device is a simple , low - complexity device connected to a higher - complexity device within the iot environment . the higher - complexity device controls the constrained device and executes computationally - burdensome tasks on behalf of the constrained device , which provides several advantages such as those described in co - pending u . s . patent application ser . no . 15 / 622 , 478 , which is herein incorporated by reference in its entirety . unconstrained devices , such as those that perform a substantial portion of high - and low - complexity tasks locally , also benefit from implementation in iot environments . although iot environments provide many advantages , an end user utilizing the iot device may be required to sacrifice some control over the iot device to other devices in the iot environment . for example , the end user may not be able to control the received command configuration 410 because it is under the control of a higher - complexity device controlling the iot device . the end user often does not have access to the higher - complexity device , which may be located remote from the iot device . in many cases , the end user may not even know who owns and / or controls the higher - complexity device . another issue is that , where the iot device is a constrained device , the constrained device may be designed with such minimal sophistication that it does not include a user interface through which an end user can modify high - level settings on the constrained device . each of the foregoing scenarios is problematic to some end users because they do not have full control over the operation of the iot device , whether the device is constrained or unconstrained . similar problems also arise when the device is not an iot device but is instead , for example , a device connected to a local area network ( lan ). accordingly , it would be advantageous to provide a device with a local configuration setting pre - configured to disallow all received commands when the configuration setting is activated , without requiring modification of the received command configuration 410 . in this capacity , the end user has greater control over the commands being executed by the device . the end user can allow or disallow all commands without being concerned with which commands are restricted or unrestricted , because all commands are automatically classified as restricted . the configuration setting can be designed for easy actuation by a user , without requiring interaction with a sophisticated user interface . for example , where the device is implemented as a ups , such as the ups 104 described above with respect to fig2 , the ups could include a simple switch corresponding to the configuration setting . in a first switch position , the ups allows all commands received from external devices . in a second switch position , the ups disallows all commands the ups can be delivered to the end user pre - configured to allow all or none of the commands depending on the state of the switch , and does not require manipulation of a command configuration such as the received command configuration 410 to decide which commands are allowed and which are disallowed . fig7 illustrates a process 700 which can be executed , for example , on the ups 104 . the ups 104 receives a command from the computer system 102 at act 702 . the command can be received by the communication stack 402 of the ups 104 . the communication stack 402 can route the command to the command processor 404 , where the command is interpreted at act 704 . a configuration setting can determine whether commands are filtered at act 706 . when the configuration setting is set to not filtering ( e . g ., when the switch 408 is set to an off position or a second position ), the command processor 404 allows all commands from a remote device to be received and executed . when the command processor 404 allows all commands ( 706 no ), the command processor 404 can route the commands directly to appropriate modules for execution by the ups 104 , and the commands are executed at act 710 . when the configuration setting is set to filtering ( e . g ., when the switch 408 is set to an on position or a first position ), the command processor 404 disallows all commands when the command processor 404 disallows all commands ( 706 yes ), the command processor 404 can discard all commands without executing them at act 708 . the command can be discarded by ignoring the command in some embodiments , the ups 104 can record discarded commands , for example , to a file . the ups 104 can provide the file of recorded discarded commands to a user upon user request and / or at periodic intervals . in any of the foregoing examples , the ups 104 can generate responses to commands and other data reports , such as environment data . fig6 shows an example process 600 , which can be executed , for example , on the ups 104 . at act 602 , the ups 104 can generate a report . the report can include environment information , such as information about loads and power provided by the ups 104 . at act 604 , the report is filtered . the ups 104 can determine whether the response is authorized based on the transmitted command configuration 412 . in some embodiments , the transmitted command configuration 412 can change corresponding to the security level of the received command configuration 410 , for example , if an attack is detected . if the transmission is allowed , at act 606 , the response is relayed to the communication stack 402 of the ups 104 , which transmits the response to the computer system 102 . if the transmission is disallowed , at act 608 , the transmission is discarded . discarded transmissions can be ignored or recorded , such as in a memory or to a file on a physical memory store . the discarded transmissions can also be used by the attack detection algorithm to determine indications of attacks by malicious entities . while the system has been described with reference to users and developers , the actions described to be performed by users can be taken by developers and vice versa . in some embodiments , users and developers can refer to the same entities . system 102 includes a storage mechanism as a part of memory 302 or other storage that includes computer readable and writeable nonvolatile recording media in which signals are stored that define a program to be executed by the processor or information stored on or in the medium to be processed by the program . the medium may , for example , be a disk , flash memory , eeprom , ram , or the like . in operation , the processor causes data to be read from the nonvolatile recording medium into another memory that allows for faster access to the information by the processor than does the medium . this memory is typically a volatile , random access memory such as a dynamic random access memory ( dram ) or static memory ( sram ). this memory may be located in a storage system , or in memory system 302 . the processor 301 generally manipulates the data within the memory and then copies the data to the medium after processing is completed . a variety of mechanisms are known for managing data movement between the medium and the memory elements , and embodiments are not limited thereto . it should be appreciated that embodiments are not limited to a particular memory system or storage system . the computer system may include specially - programmed , special - purpose hardware , for example , an application - specific integrated circuit ( asic ). embodiments may be implemented in software , hardware or firmware , or any combination thereof . further , such methods , acts , systems , system elements and components thereof may be implemented as part of the computer system described above or as an independent component . although computer system 102 is shown by way of example as one type of computer system upon which various embodiments may be practiced , it should be appreciated that aspects are not limited to being implemented on the computer system as shown in fig3 . various aspects may be practiced on one or more computers having a different architecture or components that that shown in fig3 . system 102 may be a general - purpose computer system that is programmable using a high - level computer programming language . system 102 may be also implemented using specially programmed , special purpose hardware . in the computer system 102 , processor 301 is typically a commercially available processor such as the well - known pentium class processor available from the intel corporation . many other processors are available . such a processor usually executes an operating system which may be , for example , the windows nt , windows 2000 ( windows me ) or windows xp operating systems available from the microsoft corporation , mac os system x available from apple computer , the solaris operating system available from sun microsystems , linux , or unix available from various sources . many other operating systems may be used . the processor and operating system together define a computer platform for which application programs in high - level programming languages are written . it should be understood that embodiments are not limited to a particular computer system platform , processor , operating system , or network . also , it should be apparent to those skilled in the art that embodiments are not limited to a specific programming language or computer system . further , it should be appreciated that other appropriate programming languages and other appropriate computer systems could also be used . it should be appreciated that embodiments are not limited to executing on any particular system or group of systems . also , it should be appreciated that embodiments are not limited to any particular distributed architecture , network , or communication protocol . various embodiments may be programmed using an object - oriented programming language , such as smalltalk , java , c ++, ada , or c # ( c - sharp ). other object - oriented programming languages may also be used . alternatively , functional , scripting , and / or logical programming languages may be used . various aspects may be implemented as programmed or non - programmed elements , or any combination thereof . according to some embodiments , upss communicate to a management entity using a directly - connected link ( e . g ., a serial communication cable or a usb cable ) or are provided what is referred herein as a network management card ( nmc ), interface card , or other devices that communicate to the device using the native language of the device , and this device translates data to one or more other systems or devices using network protocols such as http ( e . g ., over one or more networks ). ethernet and / or other local area networks can be interfaced directly to the ups or indirectly through a proxy such as the nmc or other devices . products such as upss and other devices can communicate to other devices over an ethernet - based network through either of two methods . first , an interface card ( e . g ., an nmc ), communicates to the ups or other device in the native language of the ups or other device , translates this data to client - friendly terminology and vocabulary , and communicates over the ethernet - based network to one or more other devices ( e . g ., a client ) using one of many protocols such as http , telnet , snmp and others . a client interpreting the translated data can be a human using a network browser or an application programmed to implement processes in response to the ups or other devices &# 39 ; state of condition . the interface card may also be integrated with the ups controller . another way by which a connection is formed includes a software application installed in a computer that connects to the ups or other device through a serial connection , translates the ups or other device data to client - friendly terms and makes that data available to other devices through an ethernet - based network connection . having thus described several aspects of at least one embodiment of this invention , it is to be appreciated that various alterations , modifications and improvements will readily occur to those skilled in the art . such alterations , modifications , and improvements are intended to be part of this disclosure , and are intended to be within the spirit and scope of the invention . accordingly , the foregoing description is by way of example only . | 6 |
referring now in detail to the single figure of the drawing , there is seen a high temperature fuel cell installation 2 that includes a high temperature fuel cell block 4 which is divided into an anode part 6 with non - illustrated anode gas spaces and a cathode part 8 with non - illustrated cathode gas spaces . the high temperature fuel cell block 4 is preferably composed of a multitude of non - illustrated high temperature fuel cells having a planar structure . an invertor 10 , which is connected to the high temperature fuel cell block 4 , converts direct current produced by the high temperature fuel cell block 4 into alternating current for an electrical network 18 . the anode part 6 is associated with an anode path 12 for supplying it with a working medium , for example hydrogen ( h 2 ) or a mixture of combustion gas and reaction vapor . the anode path 12 includes a feed path 14 and a discharge path 16 . the working medium is referred to as &# 34 ; working medium for the anode part 6 &# 34 ; before feeding it into the anode part 6 , and it is referred to as &# 34 ; anode waste gas of the anode part 6 &# 34 ; after it has left the anode part 6 . a gas splitter 20 , a mixing chamber 22 and a heat exchanger 24 are successively disposed , in that order in the flow direction , in the feed path 14 of the anode part 6 of the high temperature fuel cell block 4 . a gas motor 26 is connected to the discharge path 16 of the anode part 6 of the high temperature fuel cell block 4 . the term &# 34 ; gas motor &# 34 ; in this context is intended to mean a device for converting chemical energy contained in the working medium ( anode waste gas ) into mechanical energy . a generator 50 , which is coupled to the gas motor 26 , converts the mechanical energy produced in the gas motor 26 into alternating current . the alternating current is delivered over a line 52 to an electrical network 54 . the waste gas or off - gas is discharged from the gas motor 26 by a discharge line 17 leading from the high temperature fuel cell installation 2 . a heat exchanger 36 , a steam generator 38 and a further heat exchanger 40 are successively disposed , in that order in the flow direction , in the discharge line 17 . two water precipitators 30 , 32 and a mixing chamber 34 are successively disposed , in that order in the flow direction , in the discharge path 16 of the anode part 6 . the working medium for the anode part 6 of the high temperature fuel cell block 4 is fed into the anode part 6 through the feed path 14 . this being the case , the working medium firstly flows through the gas splitter 20 , in which a fraction of the working medium is diverted from the feed path 14 through a line 44 . that fraction of the working medium is fed directly into the mixing chamber 34 disposed upstream of the gas motor 26 in the discharge path 16 of the anode part 6 . operation of the gas motor 26 is therefore guaranteed even if not enough working medium is present in the anode waste gas or off - gas of the anode part 6 of the high temperature fuel cell block 4 . the working medium for the anode part 6 is heated by the anode waste gas in the heat exchanger 24 . after an electrochemical reaction has taken place in the high temperature fuel cell block 4 , the anode waste gas is discharged from the high temperature fuel cell block 4 through the discharge path 16 . a large portion of process water produced during the reaction in the high temperature fuel cell block 4 is removed in the water precipitators 30 and 32 together with a fraction of the heat content of the anode waste gas . after the process water has been removed from the anode waste gas , the cooled anode waste gas passes as working medium through the mixing chamber 34 into the gas motor 26 . the working medium , i . e . the anode waste gas , is burnt to produce mechanical energy in the gas motor 26 . the process water which is removed from the anode waste gas by the water precipitators 30 , 32 is evaporated in the steam generator 38 . for this purpose , the process water from the water precipitators 30 , 32 is fed to the steam generator 38 through lines 60a and 60b , in which a feed water tank 62 and a pump 64 are disposed . in this case the feed water tank 62 is used as a reservoir for the process water . the latter is fed through line 60b to the steam generator 38 by the pump 64 in the required quantity . water vapor produced in the steam generator 38 is fed through a line 68 to the mixing chamber 22 which is disposed in the feed path 14 of the anode part 6 . the water vapor is therefore mixed with the working medium for the anode part 6 in order to heat this medium . the heat obtained in the water precipitator 30 and in the further heat exchanger 40 can be fed through line 120a , 120b , 120c , and 120d carrying a heat - exchange medium into a local hot water network 122 which is not illustrated in detail . the cathode part 8 of the high temperature fuel cell block 4 is associated with a cathode path 80 which includes a feed path 82 and a discharge path 84 . a compressor 86 , a gas splitter 88 , a mixing chamber 90 , a heat exchanger 92 and an electrical heating device 94 are successively disposed , in that order in the flow direction , in the feed path 82 of the cathode part 8 . the working medium for the cathode part 8 is fed to the cathode part 8 through the feed path 82 . this being the case , the working medium , for example air or air enriched with oxygen ( o 2 ), is fed into the gas splitter 88 by the compressor 86 . at least a fraction of the working medium for the cathode part 8 is diverted in the gas splitter 88 from the feed path 82 of the cathode part 8 and fed through a line 100a leading through the heat exchanger 36 . that fraction is then fed through the line 100b back through the mixing chamber 90 to the feed path 82 . the heat exchanger 36 is connected downstream of the gas motor 26 in the discharge line 17 for the waste gas from the gas motor 26 . therefore , the working medium for the cathode part 8 which is diverted from the feed path 82 is heated by the waste gas from the gas motor 26 . the waste heat of the waste gas from the gas motor 26 is therefore advantageously used to heat the working medium for the cathode part 8 . the undiverted fraction of the working medium passes directly through the line 82 into the mixing chamber 90 , where it is recombined with the diverted fraction . the working medium for the cathode part 8 is then heated in the heat exchanger 92 and in the electrical heating device 94 . the working medium for the cathode part 8 is heated in the heat exchanger 92 by the cathode waste gas or off - gas , and it is electrically heated in the electrical heating device 94 for starting up the high temperature fuel cell block 4 . in this case , the electrical heating device 94 is supplied with current from the generator 50 associated with the gas motor 26 . the electrical heating device 94 in this case is supplied with current through a line 102 from the line 52 . the cathode waste gas is firstly fed through the discharge path 84 of the cathode part 8 leading through the heat exchanger 92 , where it heats the working medium for the cathode part 8 . it is then fed to a local heat - using system 110 which is not illustrated in detail . therefore , on one hand the gas motor 26 is operated by using the anode waste gas from the high temperature fuel cell block 4 and on the other hand the gas motor 26 is used for starting up the high temperature fuel cell block 4 . the process water obtained during the electrochemical reaction in the high temperature fuel cell block 4 is fed in the form of water vapor to the working medium for the anode part 6 in order to heat it . furthermore , the current produced by the gas motor 26 and the generator 50 is used to operate the electrical heating device 94 for heating the working medium for the cathode part 8 of the high temperature fuel cell block 4 . in addition , the heat of the waste gas from the gas motor 26 preheats the working medium for the cathode part 8 of the high temperature fuel cell block 4 . it is therefore possible for the start - up process of the high temperature fuel cell installation 2 to be carried out by merely using components which are provided in the high temperature fuel cell installation 2 . | 7 |
fig1 shows several components of a motor vehicle in which the inventive method is used several times . the inventive method is carried out by an electronic control device ( 1 ), which includes a microprocessor containing the inventive method as a part of a control program . the vehicle of fig1 is equipped with wheels ( 10 , 20 , 30 , 40 , 50 , 60 ). the wheels ( 10 , 20 ) serve to steer the vehicle and are not driven . these wheels are normally located on the front axle of a vehicle . the wheels ( 30 , 40 , 50 , 60 ) are drive wheels , and are driven indirectly by the engine ( 2 ). these wheels are installed in pairs on two drive axles , usually the rear axles of the vehicle . the vehicle shown in fig1 is thus a three - axle vehicle with two drive axles , e . g ., a truck . each of the drive wheels ( 30 , 40 , 50 , 60 ) is rigidly connected to a drive axle ( 32 , 42 , 52 , 62 ), and with part of a braking system ( 33 , 43 , 53 , 63 ). each drive wheel ( 30 , 40 , 50 , 60 ) is furthermore assigned an additional part ( 34 , 44 , 54 , 64 ) of the braking system , which is designed to interact with that part of the braking system which is rigidly connected to the drive wheel , and which is able to exert a braking force on the respective drive wheel when actuated by an actuating signal ( b3 , b4 , b5 , b6 ). a braking pressure can be used as the actuating signal ( b3 , b4 , b5 , b6 ). it is also possible to use an electric signal . to determine the speeds of the wheels ( 10 , 20 , 30 , 40 , 50 , 60 ), each wheel is associated with a speed sensor ( 11 , 21 , 31 , 41 , 51 , 61 ). the speed sensors can be designed , e . g ., in the form of an electromagnetically acting impulse speed transmitter , which interacts with a toothed wheel installed rigidly on the respective wheel for the production of impulses . the speed sensors transmit speed signals ( d1 , d2 , d3 , d4 , d5 , d6 ) to the control device ( 1 ). hereinafter , it is assumed that the speed signals ( d1 , d2 , d3 , d4 , d5 , d6 ) are already available in corrected condition , due to possible differences in the sizes of the drive wheels , e . g ., due to tire tolerances . a suitable method for this is known , e . g ., from de 41 14 047 a1 , which is incorporated herein by reference . the driving force of the engine ( 2 ) is transmitted in the form of a rotational movement , via the axles ( 6 , 7 , 8 ), the power divider ( 4 ), and the equalizing gears ( 3 , 5 ), to the driven axles ( 32 , 42 , 52 , 62 ). the gears ( 3 , 4 , 5 ) serve to uncouple the rotational movement of the axles ( 32 , 42 , 52 , 62 ) when the vehicle takes a curve , in order to avoid jamming and possible damage to the axles ( 32 , 42 , 52 , 62 ) resulting therefrom . the same effect of these gears also occurs in the case of differences in size of the drive wheels due to tolerances . the power divider ( 4 ) and the equalizing gears ( 3 , 5 ) are constructed in the form of differential drives . they are equipped to lock their respective output shafts via a locking device ( 3 &# 39 ;, 4 &# 39 ;, 5 &# 39 ;). a typical locking device is constructed in the form of a claw coupling for rigid connection of the drive axles . the input shaft of an equalizing gear is not influenced by this locking device . the locking , or actuation , of the claw coupling is triggered by a control signal ( s3 , s4 , s5 ), associated with its corresponding differential drive , from control device ( 1 ). the actuating signal for locking may be in the form of a pressure signal or an electric signal . the output shaft ( 6 ) of the engine ( 2 ) is connected to the input shaft of the power divider ( 4 ). axles ( 7 , 8 ) also serve as output shafts , which can be connected rigidly to each other as a result of control signal ( s4 ) actuating the locking device ( 4 &# 39 ;). the equalizing gear ( 3 ) utilizes the output shaft ( 7 ) of the power divider ( 4 ) as its input shaft . axles ( 32 , 42 ) serve as output shafts which can be connected rigidly to each other , as a result of the control signal ( s3 ) actuating the locking device ( 3 &# 39 ;). the output shaft ( 8 ) of the power divider ( 4 ) is utilized to drive the input shaft of the equalizing gear ( 5 ). axles ( 52 , 62 ), which can be connected rigidly to each other by actuating the locking device ( 5 &# 39 ;) by means of control signal ( s5 ), are the output shafts of the equalizing gear ( 5 ). the control device ( 1 ) receives the speed signals ( d1 , d2 , d3 , d4 , d5 , d6 ) and analyzes them in accordance with the inventive process . as a result of this analysis , the control device ( 1 ) transmits the actuating signals ( b3 , b4 , b5 , b6 ) to the braking system of the drive wheels as needed . the control device ( 1 ) also transmits the control signals ( s3 , s4 , s5 ) to the locking devices ( 3 &# 39 ;, 4 &# 39 ;, 5 &# 39 ;) of the differential gears ( 3 , 4 , 5 ). the present invention can be used in a number of applications . generally speaking , the speeds of two rotating parts , to which a common locking device and individually actuated braking devices are assigned , are herein determined and monitored continuously . when a large difference occurs between the speeds , the speed difference is reduced by actuating at least one of the braking devices . when a predetermined tendency to adapt level is recognized , the rotating parts are synchronized by actuating the locking device . in a first application of the inventive process , the speed signals ( d3 , d4 ) are considered . it is assumed that the speed signal ( d3 ) has the greater value . from these signals ( d3 , d4 ), a differential signal ( δd ) is calculated by subtraction : the differential signal ( δd ) is monitored until it reaches or exceeds a predetermined limit value ( δdmax ). to avoid erroneous actuation of the inventive process when the vehicle is traveling on tight curves , an auxiliary magnitude may be determined by using the speed signals ( d1 , d2 ). this auxiliary magnitude is then evaluated to ascertain whether it exceeds a predetermined auxiliary limit value . the generation of the actuating signals ( b3 , b4 ), or of the control signal ( s3 ), is enabled only if the above - mentioned auxiliary limit value has been exceeded . one method for determining the auxiliary magnitude utilizes the difference between the larger of the two speed signals of the driven wheels ( in this example , d3 ), and the larger of the two speed signals ( d1 , d2 ) of the non - driven wheels . the auxiliary magnitude then represents a slip signal . upon reaching the speed difference limit value ( δdmax ), and , if applicable , when the predetermined auxiliary limit value has been exceeded , the control device ( 1 ) transmits actuating signals ( b3 , b4 ) to the active parts ( 34 , 44 ) of the braking system . this causes the differing speeds to adapt to each other . that is , wheel ( 30 ), with the higher speed ( d3 ), is braked by means of the actuating signal ( b3 ). if , contrary to the above assumption , the speed signal ( d3 ) does not have the larger value , the subtraction according to formula [ 1 ] would be carried out in the opposite sense ( δd = d4 - d3 ), so that the differential signal ( δd ) would again have a positive sign . in this case , the wheel ( 40 ) would be braked by means of the actuating signal ( b4 ). the actuation of the braking system can also be carried out within the framework of a so - called &# 34 ; differential braking regulation &# 34 ;, which is part of a system for drive slip regulation of a motor vehicle . in this situation , it is possible to brake not only the wheel which rotates more rapidly , but , when a drive slip is recognized on both sides by means of a comparison with the speed signals ( 11 , 21 ) of the non - driven wheels ( 10 , 20 ), both drive wheels ( 30 , 40 ) can be subjected to a braking force . also , in the case of a differential braking regulation , the actuation of the braking system can be started before the recognition of the limit value ( δdmax ), e . g ., on the basis of a rapid rate of change of one of the speed signals ( d3 , d4 ), or of the speed difference ( δd ). upon reaching the limit value ( δdmax ), an adaptation value ( a ) is determined continuously by control device ( 1 ), based on the differential signal ( δd ). this adaptation value ( a ) represents a measure of the adaptation or approach tendency of the speed signals ( d3 , d4 ). the adaptation value ( a ) is preferably established on the basis of the following formula : the adaptation value ( a ) is continuously monitored to determine if it has reached a predetermined limit value ( amin ). when this limit value ( amin ) is reached , the control device ( 1 ) transmits a corresponding control signal ( s3 ) to lock the equalizing gear ( 3 ), so that the axles ( 32 , 42 ), and thereby also the wheels ( 30 , 40 ), are rigidly connected to each other , and thus generate the same speed signals ( d3 , d4 ). in this manner , the process for the synchronization of the parts ( 30 , 32 , 33 , 40 , 42 , 43 ) with the speed signals ( d3 , d4 ) is completed . in similar fashion , as in the case of wheels ( 30 , 40 ) and their appertaining parts ( 31 , 32 , 33 , 34 , 41 , 42 , 43 , 44 ), the inventive method can also be used in a second application for wheels ( 50 , 60 ), and the parts ( 51 , 52 , 53 , 54 , 61 , 62 , 63 , 64 ) connected thereto . the signals ( d5 , d6 ) are then used as the speed signals , and the signals ( s5 , b5 , b6 ) are used as control signals and actuating signals , respectively . in a third application of the inventive process , the axles ( 7 , 8 ) are considered as rotating parts to be synchronized . this synchronization takes place via the locking device ( 4 &# 39 ;) installed in the gear ( 4 ), which is actuated from the control device ( 1 ) by means of the control signal ( s4 ). the braking devices ( 33 , 34 , 43 , 44 , 53 , 54 , 63 , 64 ) associated with the different wheels ( 30 , 40 , 50 , 60 , respectively ) are actuated in pairs , or by axle , in this application . in this case , in order to decrease the speed of the axle ( 7 ), the control device ( 1 ) utilizes the actuating signals ( b3 , b4 ). to decrease the speed of the axle ( 8 ), the actuating signals ( b5 , b6 ) are used in an analogous fashion . the speeds of the axles ( 7 , 8 ) are not detected directly by speed sensors associated with these parts . instead , these axle speeds are calculated by the control device ( 1 ), based on the speed signals ( d3 , d4 , d5 , d6 ). the speed of the axle ( 7 ) is derived as an arithmetic mean value from the speed signals ( d3 , d4 ). the speed of the axle ( 8 ) is calculated in analogous fashion as the arithmetic mean value of the speed signals ( d5 , d6 ). the inventive method in this third application is then carried out in the manner previously described for the first application . in different applications , different limit values ( δdmax , amin ), and different computing constants ( k1 , k2 ), can be used for the respective adaptation values . suitable values for these parameters are : ## equ1 ## in short , a method and apparatus are disclosed for the synchronization of two or more rotating parts , in particular for a motor vehicle . moreover , the disclosed method and apparatus can be applied safely in widely varying speed differential situations between the rotating parts . the above described embodiments of the invention are intended to be illustrative only . numerous alternative embodiments may be devised by those skilled in the art without departing from the spirit and scope of the following claims . | 1 |
referring first to fig1 there is shown an elevation view of the invention in partial cross section and breakaway . the invention is supported by a framework 100 , preferably so as to place the components of the invention at an elevated position relative to the ground level . a number of hydraulic cylinders are affixed to framework 100 and aligned along a common axis . a first pre - compaction cylinder 80 is approximately centrally positioned along framework 100 and is horizontally aligned . cylinder 810 has a cylinder rod 17 projecting from its right end and a cylinder rod 19 projecting from its left end . cylinder rod 17 is connected to a pre - compaction piston 43 via a coupling link 15 . piston 43 is reciprocably movable within a cylinder 37 over the full range of movement of cylinder rod 17 . likewise , rod 19 is connected to a pre - compaction piston 23 via a coupling 21 , and piston 23 is reciprocable within a cylinder 53 over the full range of reciprocable movement of rod 19 . cylinders 37 and 53 are otherwise known as compaction chambers 37 and 53 , for they form the volume for compacting material to be hereinafter described . a die cylinder 200 is affixed to framework 100 in alignment with compaction chamber 53 . die cylinder 200 is a hydraulic cylinder having a cylinder rod 201 projecting therefrom and connected to a die piston 229 via a coupling 235 . die piston 229 is reciprocably movable within compaction chamber 53 over the full range of reciprocable motion of cylinder rod 201 . a second die cylinder 14 is affixed to the right side of framework 100 in alignment with compaction chamber 37 . cylinder 14 has a cylinder rod 33 projecting therefrom , and cylinder rod 33 is connected to a die piston 29 via a coupling 35 . the construction of these components is best seen in fig1 a which represents a partial exploded view of the same components . die piston 29 has a pair of piston rings 31 circumferentially attached thereto to provide a tight seal against the inner wall of compaction chamber 37 . a similar construction is found on die piston 229 . the inwardly facing surfaces of the respective die pistons are typically formed with a raised pattern or design so that the raised pattern or design may be embossed into the compressed material pellet which is formed by operation of the invention . a feed auger 11 is mounted to framework 100 and has a lower open end which opens into the interior of compaction chamber 53 . an auger screw 54 is axially aligned within the feed auger 11 tube , and screw 54 is 10 turned by operation of a hydraulic motor 56 . a feed hopper 59 opens into the screw passageway so that material dumped into the feed hopper 59 is moved downwardly through feed auger 11 and into the compaction chamber 53 . similarly , a hopper 49 is affixed to framework 100 and opens into feed auger 41 . feed auger 41 has an internal screw 44 which is driven by hydraulic drive motor 46 , and feed auger 41 opens into compaction chamber 37 . a pneumatic cylinder 64 is affixed to framework 100 and includes a reciprocable plunger 66 which is capable of being pneumatically inserted into compaction chamber 53 . a pellet ejection slot 25 also opens into compaction chamber 53 generally in alignment with the path of travel of plunger 66 . the purpose of plunger 66 and pneumatic cylinder 64 is to cause the ejection of a compressed pellet after the pistons in the invention have suitably compressed the material into a pellet . similarly , a pneumatic cylinder 74 is fixed to framework 100 and is positioned orthogonally relative to compaction chamber 37 . cylinder 74 has a reciprocable plunger 76 which may be moved into the compaction chamber 37 to eject a pellet downwardly through pellet ejection slot 75 . fig2 shows a view of a modified form of the invention with the framework deleted for clarity . in this view a modified form of hopper 58 is used to feed into the end of a feed auger 51 , and a similar hopper 48 is used to feed into the end of a feed auger 47 . feed auger 51 opens into compaction chamber 53 , and feed auger 47 opens into compaction chamber 37 . the hydraulic controls which operate the cylinders of the present invention are shown with reference to fig3 a and fig3 b . these hydraulic controls largely consist of solenoid - operated hydraulic valves which regulate the flow of pressurized hydraulic fluid from a set of pressurized lines , identified as &# 34 ; p &# 34 ; lines , to a set of return lines , identified as &# 34 ; t &# 34 ; lines . such pressurized lines are typically and commonly found in industrial plants where the invention may be utilized . the valves are operated in a particular sequence by a control mechanism ( not shown ) which is well within the scope of the prior art . one example of a control mechanism which could be used for this purpose is a suitably programmed microprocessor of the type generally known in the prior art . the sequence of operation described hereinafter is typical of the sequential control cycle which such a prior art microprocessor is capable of performing . the valves 16 , 18 , 20 and 22 are pilot - operated check valves which permit the flow of fluid in only a single direction unless the pilot input lines are activated . in each case , the pilot input line is shown as a dotted line . whenever pressurized fluid is provided to a pilot input line , the valve connected to that line becomes open for flow in either direction through the valve ; whenever pressurized fluid is not supplied to the pilot line , the valve operates as a one - way check valve thereby permitting fluid flow in only one direction . pre - compaction cylinder 80 has pilot - operated check valves 18 and 20 connected to both hydraulic inputs wherein the respective pilot lines are coupled to the opposite input . in this case , whenever pressurized fluid is applied to either input line it causes the pilot valve associated with the other line to open thereby permitting bi - directional fluid flow through the other line . a solenoid valve 32 is actuated to direct the flow of pressurized hydraulic fluid to hydraulic motor 56 , thereby causing auger screw 54 to begin turning in auger 11 , and feeding waste material collected in hopper 58 ( 59 ) into compaction chamber 53 . this continues for a predetermined time , and valve 32 is deactuated ( moved to center position ). next , solenoid valve 28 is actuated in the direction shown by arrow 28b , causing pressurized hydraulic fluid to flow into the right side of pre - compaction cylinder 80 and forcing piston 81 to move leftwardly . as piston 81 moves leftwardly , cylinder rod 19 forces pre - compaction piston 23 into compaction chamber 53 , thereby compressing the waste material previously augered into chamber 53 . this compression continues until a preselected pressure point is reached , which may be preset into a pressure relief valve ( not shown ) placed in the hydraulic line connected to cylinder 80 . a pneumatic valve ( not shown ) is actuated to activate cylinder 74 , thereby inserting plunger 76 into compaction chamber 37 to kick out the material previously compacted in this compaction chamber ; cylinder 74 is momentarily actuated and then returned to its deactivated position after the previously compressed pellet in compaction chamber 37 has been ejected from pellet ejection slot 75 . solenoid valve 26 is next actuated in the direction shown by arrow 26a , thereby causing pressurized hydraulic fluid to flow through pilot check valve 22 and into the left side of die cylinder 200 , and relieving pressurized hydraulic fluid from the right side of die cylinder 200 . die cylinder piston 202 moves rightwardly , causing cylinder rod 201 to move die piston 229 further into compaction chamber 53 and further compressing the material in compaction chamber 53 . at the same time , solenoid valve 24 is actuated in the direction shown by arrow 24a to cause pilot check valve 22 to open ( solenoid valve 30 is actuated in the direction shown by arrow 30b , thereby causing pressurized hydraulic fluid to flow into the right side of die cylinder 14 and forcing die cylinder piston 13 leftwardly and extending die piston 29 partially into compaction chamber 37 , placing it in the load position for the next cycle ). next , solenoid valve 26 is returned to its center position , thereby relieving hydraulic fluid pressure and hydraulic shock , from both sides of piston 202 ( pilot valve 22 being opened ), and the continuing force of piston 81 causes the compressed pellet to slide into position over pellet ejection slot 25 , which is the fully extended position of cylinder rod 19 ( it should be noted that a position sensor could be installed on cylinder 200 to monitor the position of die piston 229 , and this would provide a means for determining the thickness of the compressed pellet at this time ). solenoid valve 34 is next actuated , causing activation of hydraulic motor 46 , which feeds material from hopper 48 ( 49 ) into compaction chamber 37 for a predetermined time . after solenoid valve 34 has been deactuated ( moved to center position ), solenoid valve 28 is actuated in the direction shown by arrow 28a , thereby causing the flow of pressurized hydraulic fluid into the left side of pre - compaction cylinder 80 . this causes piston 81 to move rightwardly and compresses the material in compaction chamber 37 to a predetermined pressure , as described earlier . pneumatic cylinder 64 is actuated , causing plunger 66 to enter compaction chamber 53 and eject the compressed pellet from compaction chamber 53 . solenoid valve 30 is actuated in the direction shown by arrow 30b , thereby causing pressurized hydraulic fluid to flow into the right side of die cylinder 14 , and causing piston 13 to move leftwardly to further compress the material in compaction chamber 37 . solenoid valve 30 is then returned to its center position , thereby relieving pressure from both sides of piston 13 ( solenoid valve 24 is also actuated in the direction shown by arrow 24b to open pilot check valve 16 , to provide the pressure relief from both sides of the piston 13 ). the continuing force of piston 81 causes the compressed pellet in compaction chamber 37 to move rightwardly into position over ejection slot 75 ( again , a position sensor could be mounted to cylinder 14 to monitor the position of die piston 29 to provide a measure of the thickness of the compressed pellet ). the foregoing sequence is repeated as needed , to alternately provide compressed pellets from ejection slots 25 and 75 . during the compression steps , any fluid accumulation in the residue material is squeezed out through ejection slots 25 and 75 , and a suitable collection reservoir can be provided beneath these slots to collect the fluid . although the invention has been described with reference to the preferred embodiment thereof , it is apparent that persons skilled in the art may make modifications and changes within the essential spirit and scope of the invention . | 1 |
the present invention is directed to a torque transfer mechanism that can be adaptively controlled for modulating the torque transferred between a first rotary member and a second rotary member . the torque transfer mechanism finds particular application in power transfer systems of the type used in motor vehicle drivelines and which include , for example , transfer cases , power take - off units , limited slip drive axles and torque vectoring drive modules . thus , while the present invention is hereinafter described in association with a particular arrangement for a specific driveline application , it will be understood that the arrangement shown and described is merely intended to illustrate an embodiment of the present invention . with particular reference to fig1 , a schematic layout of a vehicle drivetrain 10 is shown to include a powertrain 12 , a first or primary driveline 14 driven by powertrain 12 , and a second or secondary driveline 16 . powertrain 12 includes an engine 18 and a multi - speed transaxle 20 arranged to normally provide motive power ( i . e ., drive torque ) to a pair of first wheels 22 associated with primary driveline 14 . primary driveline 14 further includes a pair of axle shafts 24 connecting wheels 22 to a front differential unit 25 associated with transaxle 20 . secondary driveline 16 includes a power take - off unit ( ptu ) 26 driven by the output of transaxle 20 , a propshaft 28 driven by ptu 26 , a pair of axle shafts 30 connected to a pair of second wheels 32 , a rear differential unit 34 driving axle shafts 30 , and a power transfer device 36 that is operable to selectively transfer drive torque from propshaft 28 to rear differential unit 34 . power transfer device 36 is shown integrated into a drive axle assembly and includes a torque transfer mechanism 38 . torque transfer mechanism 38 functions to selectively transfer drive torque from propshaft 28 to differential unit 34 . more specifically , torque transfer mechanism 38 includes an input shaft 42 driven by propshaft 28 and a pinion shaft 44 that drives differential unit 34 . vehicle drivetrain 10 further includes a control system for regulating actuation of torque transfer mechanism 38 . the control system includes a clutch actuator 50 , vehicle sensors 52 , a mode select mechanism 54 and an electronic control unit ( ecu ) 56 . vehicle sensors 52 are provided to detect specific dynamic and operational characteristics of drivetrain 10 while mode select mechanism 54 enables the vehicle operator to select one of a plurality of available drive modes . the drive modes may include a two - wheel drive mode , a locked (“ part - time ”) four - wheel drive mode , and an adaptive (“ on - demand ”) four - wheel drive mode . in this regard , torque transfer mechanism 38 can be selectively engaged for transferring drive torque from input shaft 42 to pinion shaft 44 to establish both of the part - time and on - demand four - wheel drive modes . ecu 56 controls actuation of clutch actuator 50 which , in turn , controls the drive torque transferred through torque transfer mechanism 38 . referring now to fig2 and 3 , a cross - section of torque transfer mechanism 38 is shown . torque transfer mechanism 38 generally includes a friction clutch assembly 60 having a multi - plate clutch pack 62 . clutch actuator 50 is operable to generate and apply a clutch engagement force on clutch pack 62 so as to regulate engagement and thus , the amount of drive torque transfer through clutch pack 62 . friction clutch assembly 60 also includes a clutch hub 64 and a drum 66 . hub 64 is adapted to be coupled for rotation with input shaft 42 while drum 66 is adapted to be coupled for rotation with pinion shaft 44 . as seen , a set of first or inner clutch plates 68 associated with clutch pack 62 are fixed for rotation with hub 64 . likewise , a set of second clutch plates 70 are interleaved with first clutch plates 68 and are fixed for rotation with drum 66 . the degree of engagement of clutch pack 62 , and therefore the amount of drive torque transferred therethrough , is largely based on the frictional interaction of clutch plates 68 and 70 . more specifically , with friction clutch assembly 60 in a disengaged state , interleaved clutch plates 68 and 70 slip relative to one another and little or no torque is transferred through clutch pack 62 . however , when friction clutch assembly 60 is in a fully engaged state , there is no relative slip between clutch plates 68 and 70 and 100 % of the drive torque is transferred from input shaft 42 to pinion shaft 44 . in a partially engaged state , the degree of relative slip between interleaved clutch plates 68 and 70 varies and a corresponding amount of drive torque is transferred through clutch pack 62 . in general , clutch actuator 50 includes an operator mechanism 72 and a power - operated drive mechanism 73 . operator mechanism 72 is shown to include a first actuator plate 74 , a second actuator plate 76 , a stop plate 78 , an apply plate 80 , a ballramp unit 82 , and a piston assembly 84 . first and second actuator plates 74 and 76 are rotatably supported on hub 64 by a bearing assembly 86 and include corresponding arm segments 74 a and 76 a , respectively , that extend tangentially . more specifically , arms 74 a and 76 a include respective edges 87 and 89 that are generally parallel to the axis a . first and second actuator plates 74 and 76 also include first and second ballramp groove sets 90 and 92 , respectively . balls 94 are disposed between first and second actuator plates 74 and 76 and ride within ballramp groove sets 90 and 92 . as best seen from fig3 , each set has three equally spaced grooves aligned circumferentially relative to the “ a ” axis . thus , ballramp unit 82 is shown to be integrated into actuator plates 74 and 76 so as to provide a compact arrangement . stop plate 78 is supported on hub 64 and is inhibited from axial movement by a lock ring 96 . more specifically , stop plate 78 is disposed between lock ring 96 and first actuator plate 74 and is separated from first actuator plate 74 by a thrust bearing assembly 98 . apply plate 80 is disposed between clutch pack 62 and second actuator plate 76 and is separated from second actuator plate 76 by another thrust bearing assembly 100 . apply plate 80 is adapted to move axially to regulate engagement of clutch pack 62 , as is explained in further detail below . piston assembly 84 is actuated by drive mechanism 73 to control relative rotation between first and second actuator plates 74 and 76 . more specifically , piston assembly 84 includes a first piston 104 and a second piston 106 that are disposed for sliding movement within a pressure chamber 108 formed in a cylinder housing 110 . as seen , first and second pistons 104 and 106 have first and second rollers 112 and 114 , respectively , attached thereto . first and second rollers 112 and 114 engage corresponding first and second cam surfaces 116 and 118 formed on first and second arms 74 a and 76 a , respectively . first and second rollers 112 and 114 are induced to ride against first and second cam surfaces 116 and 118 in response to movement of pistons 104 and 106 caused by actuation of drive mechanism 73 . specifically , rolling movement of first and second rollers 112 and 114 against first and second cam surfaces 116 and 118 results in relative rotation between first and second actuator plates 74 and 76 . pistons 104 and 106 are shown in fig3 in a first or “ retracted ” position within pressure chamber 108 such that first and second actuator plates 74 and 76 are located in a corresponding first angular position relative to each other . a return spring 120 is provided for normally biasing first and second actuator plates 74 and 76 toward this first angular position . with the actuator plates located in their first angular position , ballramp unit 82 functions to axially locate second actuator plate 76 in a corresponding first or “ released ” position whereat apply plate 80 is released from engagement with clutch pack 62 . in this position , a minimum clutch engagement force is applied to clutch pack 62 such that little or no drive torque is transmitted from input shaft 42 to pinion shaft 44 . as will be detailed , drive mechanism 73 is operable to cause pistons 104 and 106 to move toward a second or “ expanded ” position within pressure chamber 108 such that actuator plates 74 and 76 are caused by engagement with rollers 112 and 114 to circumferentially index to a second angular position . such rotary indexing of actuator plates 74 and 76 causes ballramp unit 82 to axially displace second actuator plate 76 from its released position toward a second or “ locked ” position whereat apply plate 80 is fully engaged with clutch pack 62 . with second actuator plate 76 in its locked position , a maximum clutch engagement force is applied to clutch pack 62 such that pinion shaft 44 is , in effect , coupled for common rotation with input shaft 42 . drive mechanism 73 is shown in fig3 to include a piston housing 122 , a ballscrew and piston assembly 124 , a gearset 126 , and an electric motor 128 . electric motor 128 rotatably drives gearset 126 which , in turn , rotatably drives a leadscrew 130 associated with piston assembly 124 . such rotation of leadscrew 130 results in axial movement of a nut 131 mounted thereon which , in turn , causes corresponding axial movement of a piston plunger 132 within a fluid control chamber 134 formed in housing 122 . control chamber 134 is in fluid communication with pressure chamber 108 via a closed hydraulic control system . specifically , as piston plunger 132 translates along an axis “ b ”, it regulates the volume of fluid in control chamber 134 . as the volume of control chamber 134 decreases , fluid is supplied through a conduit 136 to pressure chamber 108 in piston assembly 84 , thereby causing pistons 104 and 106 to move in concert toward their expanded position . in contrast , as the volume of control chamber 134 increases , the fluid flows back through conduit 136 from piston chamber 108 to relieve the pressure exerted by first and second rollers 112 and 114 against first and second cam surfaces 116 and 118 . accordingly , rotation of leadscrew 130 in a first rotary direction results in axial movement of piston plunger 132 in a first direction ( right in fig3 ), thereby causing pistons 104 and 106 to be forcibly moved toward their expanded position for angularly indexing first and second actuator plates 74 and 76 toward their second angular position in opposition to the biasing force exerted thereon by return spring 120 . in contrast , rotation of leadscrew 130 in a second rotary direction results in axial movement of piston plunger 132 in a second direction ( left in fig3 ), thereby permitting the biasing force of return spring 120 to forcibly rotate actuator plates 74 and 76 toward their first angular position which causes pistons 104 and 106 to move back toward their retracted position . a pressure sensor 140 is responsive to the pressure within conduit 136 and generates a signal that is sent to ecu 56 . preferably , ecu 56 is functional to correlate line pressure readings from pressure sensor 140 to the torque output of friction clutch assembly 60 . in its neutral state ( see fig3 ), clutch actuator 50 imparts no clutch engagement force on clutch pack 62 such that first and second clutch plates 68 and 70 are permitted to slip relative to one another . as first and second actuator plates 74 and 76 are caused to rotate relative to one another , balls 94 ride within ballramp grooves 90 and 92 to axially move second actuator plate 76 . since stop plate 78 inhibits axial movement of first actuator plate 74 , as balls 94 ride up ballramp grooves 90 and 92 , second actuator plate 76 is separated from first actuator plate 74 and moves linearly to impart the clutch engagement force on apply plate 80 through thrust bearing assembly 100 . apply plate 80 , in turn , imparts this linear clutch engagement force on clutch pack 62 , thereby regulating engagement of clutch pack 62 . it is contemplated that alternative drive mechanisms can be used in place of the closed - circuit hydraulic system disclosed . for example , a motor - driven dual leadscrew system could be implemented to drive first and second pistons 104 and 106 of operator mechanism 72 in concert between their retracted and expanded positions . likewise , it is to be understood that the particular drivetrain application shown is merely exemplary of but one application to which the clutch actuator of the present invention is well suited . a preferred embodiment has been disclosed to provide those skilled in the art an understanding of the best mode currently contemplated for the operation and construction of the present invention . the invention being thus described , it will be obvious that various modifications can be made without departing from the true spirit and scope of the invention , and all such modifications as would be considered by those skilled in the art are intended to be included within the scope of the following claims . | 5 |
while this invention is susceptible of embodiment in many different forms , there are shown in the drawings , and will be described herein in detail , specific embodiments thereof with the understanding that the present disclosure is to be considered as an exemplification of the principles of the invention and is not intended to limit the invention to the specific embodiments illustrated . fig1 illustrates a rake 10 having in a rectangular collecting frame 14 connected to an elongated handle 18 . the handle extends rearward from the frame toward a user . an angular brace 20 is connected between the frame 14 and handle 18 . a tension wire 26 forms a triangle between three fixed fastening locations 30 , 32 , 34 located on the handle 18 and frame 14 respectively . the tension wire 26 structurally stabilizes the frame with respect to the handle , and prevents bending or breaking of the frame 14 subject to vegetation resistance as the frame 14 is pulled through and out of the water by the handle . the locations can be fasteners that are fastened into the frame and handle , wherein the wire is tightly wound a few turns around the fastener . the frame 14 includes a top member 40 , and a parallel bottom member 42 connected together by opposite side members 44 , 46 . the members 40 , 42 , 44 , 46 are preferably hollow tubes and can be connected together by 90 ° hollow tube joints 52 . the handle 18 can be attached to the member 40 using a clamp or a tee joint such as a tubular tee member 56 . in the case of using a tee member , the member 40 is cut and fit into the tee member such that the handle , tee member and upper member 40 are open to each other on the inside . the brace 20 can be attached to the frame member 42 using a clamp joint or a tubular tee member 56 . in the case of using a tee member , the lower frame member 42 is cut and fit into the tee member such that the brace 20 , the tee member 56 and the lower frame member 42 are open to each other on the inside . the handle 18 is preferably a hollow tube and is closed at a distal end to the frame 14 by a cap 60 . a faster such as an eye - bolt 62 is fixed to an end of the cap 60 and is used for attaching a rope 64 to the handle 18 . the rope 64 is sufficiently long for the user to cast the rake out into the pond at a distance from the user . the user can then draw back the rake toward the user handle side first , by reeling in the rope , to rake through the pond . fig1 and 2 show that the upper frame member 40 mounts downwardly angled prongs or rods 70 . the prongs are spaced apart along the frame member 40 . the rods 70 extend perpendicularly from the frame member , in parallel , in a direction generally toward the distal end of the handle . the lower frame member 42 mounts upwardly angled prongs or rods 72 that are spaced apart along the frame member 42 . the rods 72 extend perpendicularly from the frame member 42 , in parallel , in a direction generally toward the distal end of the handle . the rods 70 , 72 can be tubular . the rod 70 in fig2 is shown in section to show the attachment method for the rods 70 , 72 . each of the rods 70 , 72 is mounted to the frame by a screw 70 a with a head diameter similar to the diameter of the rods 70 , 72 . the screw 70 a freely extends through the rod and is threaded through the wall of the tubular frame member adjacent to the rod and is threaded into but does not penetrate the opposite side of the tubular frame member . other ways of fastening the rods 70 , 72 to the frame are encompassed by the invention . a net 80 closes a rectangular open side of the frame 14 defined between the members 40 , 42 , 44 , 46 , opposite the handle 18 . the net has openings sufficiently large to allow water and small objects to past therethrough as the rake is pulled through the water , but small enough to capture the desired vegetation and debris to be removed from the water . the net openings are square with sides parallel to the respective frame sides and can have a width dimension of ¾ to 1 ″. alternatively , a lacing or webbing can be provided by lacing or criss - crossing rope or the like between the rods 70 , 72 . fig3 illustrates the connection area of the brace 20 in the handle 18 . the brace 20 terminates in a valve 90 having an open / close mechanism 94 , and an oblique angle fitting such as a 22 . 5 ° fitting or a 45 ° fitting 98 connected to the valve 90 . the fitting has an open end 100 covered by a fine screen 100 a to prevent debris from entering the open end 100 . the fitting 98 is tightly clamped by a pipe clamp 102 or the like . the pipe clamp 102 includes a fastener 104 that penetrates through holes through the handle 18 and is tightened by a nut 106 to fasten the pipe clamp 102 and brace 20 tightly to the handle 18 . preferably , the handle 18 , the frame 14 and the brace 20 are all in flow communication via the hollow insides of the tube members . the elbow joints 52 and the tee joints 56 are also in flow communication with the members attached thereto . the valve 90 allows for the entry of a desired amount of water into the rake 10 . by opening the valve while the valve and fitting are submerged , water can pass into the rake through the valve . this can be used to set a desired buoyancy for a desired skimming depth of the frame in the water as a rake 10 is pulled through the water . fig2 and 4 illustrate some advantageous dimensions . the overall length l of the frame 14 can be 52 , 46 or 40 inches , but the invention encompasses other sizes as well . the handle can be 5 feet , 6 inches . the overall width w of the frame 14 can be 8 inches . the spacing of the upper prongs 70 along the member 40 can be 3 inches . the spacing of the lower prongs 72 along the member 42 can be 3 inches . the upper prongs are preferably in line with the lower prongs along the length of the frame . the number of upper prongs can be 16 . the number of lower prongs can be 16 . the prongs preferably have a length l 3 of about 2 inches and a diameter of about ¼ inch . with the handle 18 held horizontal and the frame 14 oriented vertically , the angle β of the prongs 70 , 72 to horizontal is preferably about 35 degrees . advantageously , the members 20 , 40 , 42 , 44 , 46 , and 52 are tubular plastic pipe elements having a nominal diameter of ¾ inches . advantageously , the member 18 can be tubular plastic pipe element having a nominal diameter of 1 inch . the upper member 56 can be a tubular plastic pipe element having nominal diameters of 1 inch × ¾ inch × ¾ inch . the lower member 56 can be a ¾ ″ by ¾ ″ by ¾ ″ tee . from the foregoing , it will be observed that numerous variations and modifications may be effected without departing from the spirit and scope of the invention . it is to be understood that no limitation with respect to the specific apparatus illustrated herein is intended or should be inferred . | 0 |
[ 0011 ] fig1 shows a computer network 100 in which several computers 102 , 104 , 106 are connected to a repeater or switch 108 . the repeater 108 includes multiple ports , at least one of which receives data packets from the computers 102 , 104 , 106 , and at least one of which distributes the data packets throughout the network 100 . the repeater 108 also includes , or is linked to , a visual display 110 , such as an led array , that provides a visual indication of various status conditions monitored by the repeater 108 . in general , the visual display 110 responds to status information collected by the repeater 108 from the data packets . the repeater 108 usually collects information about one or more particular status conditions for each of the ports through which data packets travel . for example , a particular repeater might monitor six status conditions for each of six repeater ports , thus producing 36 separate status conditions . in most cases , each of these status conditions has a corresponding led in the indicator array . examples of the types of status conditions monitored for individual ports include the standard link , partition , isolate , port enabled , and collision conditions . in some cases , the repeater also monitors status conditions that do not apply to particular ports , but rather apply to the repeater as a whole . examples of conditions monitored for the repeater as a whole include the rps fault , global security , global fault , and global collision conditions . [ 0012 ] fig2 and 3 show a simple led array 200 and repeater structure 300 , respectively , that allow the repeater to drive n leds with fewer than n control lines 205 , 210 . this led array 200 and repeater structure 300 are much simpler , much easier to implement , and , for relatively small led arrays , less costly than previous solutions . the depicted led array 200 , which in many cases is a portion of a larger led array , includes three leds 202 , 204 , 206 connected between a power supply ( e . g ., + 3 . 3 volts ) and ground . three optional resistors 208 , 210 , 212 are included in the array 200 to limit the amount of current drawn through the leds . the resistance values of the resistors 208 , 210 , 212 depend upon several application - specific factors , including the power supply voltage and the desired maximum current draw . resistance values on the order of 270 ω are typical when the depicted led array 200 is used in a 5 . 0 volt system , and resistance values on the order of 120 ω are typical when the array is used in a 3 . 3 volt system . the power supply voltage and the number of leds in the array 200 also vary among applications , but in general these features are selected to ensure that the voltage drop across each led is not large enough to cause the led to conduct . in this example , each of the three leds 202 , 204 , 206 has a cut - in voltage of approximately 1 . 5 volts , so a power supply of 3 . 3 volts will not cause any of the diodes to conduct absent input from the control lines 205 , 210 . larger arrays are constructed by replicating the structure of fig2 . for example , the led array 200 is replicated five times to create a 6 × 3 array . only 12 control lines are needed to drive the 18 leds in the 6 × 3 array . the control lines 205 , 210 from the repeater chip 300 connect between adjacent leds in the led array 200 . for example , one of the control lines 205 connects between the first led 202 and the second led 204 ; the other control line 210 connects between the second led 204 and the third led 206 . if the led array includes the optional resistors 208 , 210 , 212 , each of the control lines connects to the cathode of one of the leds 202 , 204 , 206 and to one of the resistors 208 , 210 , 212 . the repeater chip 300 includes a conventional repeater logic circuit 302 coupled to a logic block 304 that controls the operation of the led array 200 . the array control logic 304 in turn is coupled to a pair of “ tristatable ” sink / source buffers 306 , 308 , each of which drives one of the control lines 205 , 210 . these “ tristatable ” sink / source buffers 306 , 308 are configured to provide three alternative types of output : ( 1 ) a logic high value ( e . g ., + 3 . 3 volts ); ( 2 ) a logic low value ( e . g ., 0 . 0 volts ); and ( 3 ) a high impedance output . in general , each sink / source buffer sources current to the led array when providing a logic high output , sinks current when providing a logic low output , and neither sinks nor sources current when providing a high impedance output . the array control logic 304 and the sink / source buffers 306 , 308 operate as shown in the table of fig4 . none of the leds illuminate when both of the sink / source buffers 306 , 308 provide high impedance outputs . when only the first led 202 is to illuminate , the first buffer 306 places a low logic output on the first control line 205 and the second buffer 308 places a high impedance output on the second control line 210 [ output state ( 0 , z )]. this forces a voltage of approximately 3 . 3 volts across the first led 202 , which causes the first led 202 to conduct . the current in the first led 202 flows from the power supply to the first sink / source buffer 306 . the high impedance output provided by the second buffer 308 insures that the second and third leds 204 , 206 do not conduct and therefore do no illuminate . when only the second led 204 is to illuminate , the first buffer 306 outputs a high logic value and the second buffer 308 outputs a low logic value [ output state ( 1 , 0 )]. this forces a voltage of approximately 3 . 3 volts across the second led 204 and voltages of approximately 0 . 0 volts across the first and third leds 202 , 206 . in this state , the first buffer 306 sources current to the second led 204 , and the second buffer 308 sinks this current . the first and third leds 202 , 206 do not conduct . when only the third led 206 is to illuminate , the first buffer 306 provides a high impedance output and the second buffer 308 provides a high logic output [ output state ( z , 1 )]. this forces a voltage of approximately 3 . 3 volts across the third led 206 and a voltage of approximately 0 . 0 volts across the first and second leds 202 , 204 . in this state , the second buffer 308 sources current through the third led 206 to ground . the first and second leds 202 , 204 do not conduct . the repeater usually cycles through the various states , starting with the state in which only the first led 202 illuminates , then shifting to the states in which only the second led 204 and only the third led 206 illuminate . in general , the repeater chip 300 drives the control lines 205 , 210 at a relatively fast rate and drives the leds with high bursts of intensity , so that an illuminated led appears to illuminate continuously to the human eye . in some embodiments , the repeater chip 300 drives two leds at a time by cycling through states that otherwise would be unused . for example , the output state ( z , 0 ) forces voltages of approximately 1 . 65 volts across the first and second leds 202 , 204 , causing them to conduct . the third led 208 does not conduct in this state . likewise , the output states ( 0 , 1 ) and ( 1 , z ) cause the first and third leds 202 , 206 and the second and third leds 204 , 206 to illuminate , respectively . in most cases , these states are used only to convey special information , such as at reset to show that the leds and control circuitry are functioning properly . a number of embodiments of the present invention have been described . nevertheless , it will be understood that various modifications are possible without departing from the spirit and scope of the invention . for example , in some cases the led array 200 includes more than three leds driven by more than two lines from the repeater chip . the led array may even include as few as two leds driven by one line from the repeater chip if a sufficiently low supply voltage ( e . g ., approximately 2 . 8 volts or less ) is present . also , while the invention has been described in terms of a 3 . 3 volt power supply , some implementations use power sources greater than 3 . 3 volts . other implementations use more than one power source , such as a high voltage source of 1 . 5 volts and a low voltage source of − 1 . 5 volts . some implementations use negative logic components that operate between ground and a negative voltage source , such as a − 3 . 3 volt source . accordingly , other embodiments are within the scope of the following claims . | 8 |
the catalyst composite described herein is created by heating a catalyst comprising at least one noble metal and at least one metal oxide to a temperature between about 600 ° c . to about 800 ° c . in an environment of a noble gas . this treatment modifies the catalyst such that , when it is cooled to room temperature , it is capable of catalyzing the decomposition nox species to nitrogen and oxygen at sub - ambient temperatures and above without the need for a reducing species to be present . the noble gas is selected from the group consisting of helium , neon , krypton , xenon and radon . in one method , the noble gas is helium . the catalyst is heated to a temperature that is sufficient to reduce the concentration of water absorbed / adsorbed to the catalytic active surface . hence , the concentration of surface hydroxyl moieties that contribute to the non - specific adsorption of emission effluent species that mitigate the catalytic efficiency is lowered . in one embodiment , this temperature is from about 700 ° to about 750 ° c ., although it is anticipated that significantly lower temperature thermal treatments would achieve comparable results for many catalytic formulations and embodiments described herein . in one embodiment , the catalyst composition for the decomposition of nitrogen oxides according to the present invention consists of at least one noble metal dispersed on at least one metal oxide possessing more than one oxidation state . noble metals include platinum , palladium , gold , silver , ruthenium , and rhodium and can comprise about 1 to 50 percent of the catalyst by weight with the balance ( about 50 - 99 percent ) being the metal oxide ( s ). in one preferred embodiment , the noble metal is platinum . the metal oxides upon which the noble metal can be dispersed include tin oxide , manganese oxide and copper oxide . in one preferred embodiment , the metal oxide is tin oxide . in at least one embodiment , promoter metal oxides ( e . g ., fe 2 o 3 , nio , co 2 o 3 and / or wo 3 ) can be included to improve catalytic performance . the catalyst can exist as a powder , or it can be prepared as a coating on supports , such as metallic , ceramic , composite or other material with a hydroxylated surface , in geometries or forms that include granules , pellets , honeycomb monoliths , or fabrics . a catalyst employed in the present inventive process can be prepared as follows : the preparation of similar powder catalysts or catalysts coated on silica gel , silica beads , or pellets has been presented in our earlier u . s . patents : “ process for making a noble metal on tin oxide catalyst ,” u . s . pat . no . 4 , 855 , 274 , “ catalyst for carbon monoxide oxidation ,” u . s . pat . no . 4 , 912 , 082 , and “ catalyst for carbon monoxide oxidation ,” u . s . pat . no . 4 , 991 , 181 . preparation of platinum - tin oxide - based catalyst coatings for pellets , beads , granules , fabrics , and especially ceramic honeycomb monoliths can be accomplished by successive layering of the desired components , for example a tin oxide and platinum catalyst can be prepared as follows : ( 1 ) a clean , dry substrate is deaerated in a solution containing tin ( ii ) 2 - ethylhexanoate ( sneh , hereafter ). the substrate is removed from the solution , and excess solution is removed from the substrate . residual solution components are evaporated leaving sneh layer on the substrate , which is thermally decomposed in air to tin oxide at 300 ° c . several layers are applied in the same manner to achieve the desired loading of tin oxide ; ( 2 ) platinum is added to the coated substrate as above using an aqueous solution of tetraamine platinum ( ii ) dihydroxide or other platinum salt , with chloride - free salts being preferred , and then thermally decomposing the salt . instead of thermal decomposition , however , a reductive decomposition can be used to decompose the salt . for example , the catalyst - coated substrate is heated in an atmosphere containing a reducing gas such as carbon monoxide or hydrogen to induce reduction of the platinum salt to platinum . the instant process operates merely by passing a gaseous mixture containing nitrogen oxides over the catalyst using any of a number of methods well known in the art , and monitoring the gas composition both upstream and downstream of the catalyst . there are numerous pertinent applications for this invention in addition to catalytic converters for internal combustion / automotive applications . these applications include , but are not limited to , air purification for heating , ventilation and air conditioning ( hvac ) systems , and gas phase sensing technologies . it should be understood that the foregoing description and examples are only illustrative of the invention . various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to embrace all such alternatives , modifications and variances that fall within the scope of the appended claims . | 1 |
the present invention may be more readily described with reference to fig1 - 7 . fig1 illustrates a schematic diagram of a conventional general - purpose digital computing environment that can be used to implement various aspects of the present invention . in fig1 , a computer 100 includes a processing unit 110 , a system memory 120 , and a system bus 130 that couples various system components including the system memory to the processing unit 110 . the system bus 130 may be any of several types of bus structures including a memory bus or memory controller , a peripheral bus , and a local bus using any of a variety of bus architectures . the system memory 120 includes read only memory ( rom ) 140 and random access memory ( ram ) 150 . a basic input / output system 160 ( bios ), containing the basic routines that help to transfer information between elements within the computer 100 , such as during start - up , is stored in the rom 140 . the computer 100 also includes a hard disk drive 170 for reading from and writing to a hard disk ( not shown ), a magnetic disk drive 180 for reading from or writing to a removable magnetic disk 190 , and an optical disk drive 191 for reading from or writing to a removable optical disk 192 such as a cd rom or other optical media . the hard disk drive 170 , magnetic disk drive 180 , and optical disk drive 191 are connected to the system bus 130 by a hard disk drive interface 192 , a magnetic disk drive interface 193 , and an optical disk drive interface 194 , respectively . the drives and their associated computer - readable media provide nonvolatile storage of computer readable instructions , data structures , program modules and other data for the personal computer 100 . it will be appreciated by those skilled in the art that other types of computer readable media that can store data that is accessible by a computer , such as magnetic cassettes , flash memory cards , digital video disks , bernoulli cartridges , random access memories ( rams ), read only memories ( roms ), and the like , may also be used in the example operating environment . a number of program modules can be stored on the hard disk drive 170 , magnetic disk 190 , optical disk 192 , rom 140 or ram 150 , including an operating system 195 , one or more application programs 196 , other program modules 197 , and program data 198 . a user can enter commands and information into the computer 100 through input devices such as a keyboard 101 and pointing device 102 . other input devices ( not shown ) may include a microphone , joystick , game pad , satellite dish , scanner or the like . these and other input devices are often connected to the processing unit 110 through a serial port interface 106 that is coupled to the system bus , but may be connected by other interfaces , such as a parallel port , game port or a universal serial bus ( usb ). further still , these devices may be coupled directly to the system bus 130 via an appropriate interface ( not shown ). a monitor 107 or other type of display device is also connected to the system bus 130 via an interface , such as a video adapter 108 . in addition to the monitor , personal computers typically include other peripheral output devices ( not shown )., such as speakers and printers . in a preferred embodiment , a pen digitizer 165 and accompanying pen or stylus 166 are provided in order to digitally capture freehand input . although a direct connection between the pen digitizer 165 and the processing unit 110 is shown , in practice , the pen digitizer 165 may be coupled to the processing unit 110 via a serial port , parallel port or other interface and the system bus 130 as known in the art . furthermore , although the digitizer 165 is shown apart from the monitor 107 , it is preferred that the usable input area of the digitizer 165 be co - extensive with the display area of the monitor 107 . further still , the digitizer 165 may be integrated in the monitor 107 , or may exist as a separate device overlaying or otherwise appended to the monitor 107 . the computer 100 can operate in a networked environment using logical connections to one or more remote computers , such as a remote computer 109 . the remote computer 109 can be a server , a router , a network pc , a peer device or other common network node , and typically includes many or all of the elements described above relative to the computer 100 , although only a memory storage device 111 has been illustrated in fig1 . the logical connections depicted in fig1 include a local area network ( lan ) 112 and a wide area network ( wan ) 113 . such networking environments are commonplace in offices , enterprise - wide computer networks , intranets and the internet . when used in a lan networking environment , the computer 100 is connected to the local network 112 through a network interface or adapter 114 . when used in a wan networking environment , the personal computer 100 typically includes a modem 115 or other means for establishing a communications over the wide area network 113 , such as the internet . the modem 115 , which may be internal or external , is connected to the system bus 130 via the serial port interface 106 . in a networked environment , program modules depicted relative to the personal computer 100 , or portions thereof , may be stored in the remote memory storage device . it will be appreciated that the network connections shown are exemplary and other techniques for establishing a communications link between the computers can be used . the existence of any of various well - known protocols such as tcp / ip , ethernet , ftp , http and the like is presumed , and the system can be operated in a client - server configuration to permit a user to retrieve web pages from a web - based server . any of various conventional web browsers can be used to display and manipulate data on web pages . fig2 illustrates a tablet pc 201 that can be used in accordance with various aspects of the present invention . any or all of the features , subsystems , and functions in the system of fig1 can be included in the computer of fig2 . tablet pc 201 includes a large display surface 202 , e . g ., a digitizing flat panel display , preferably , a liquid crystal display ( lcd ) screen , on which a plurality of windows 203 is displayed . using stylus 204 , a user can select , highlight , and write on the digitizing display area . examples of suitable digitizing display panels include electromagnetic pen digitizers , such as the mutoh or wacom pen digitizers . other types of pen digitizers , e . g ., optical digitizers , may also be used . tablet pc 201 interprets marks made using stylus 204 in order to manipulate data , enter text , and execute conventional computer application tasks such as spreadsheets , word processing programs , and the like . a stylus could be equipped with buttons or other features to augment its selection capabilities . in one embodiment , a stylus could be implemented as a “ pencil ” or “ pen ”, in which one end constitutes a writing portion and the other end constitutes an “ eraser ” end , and which , when moved across the display , indicates portions of the display are to be erased . other types of input devices , such as a mouse , trackball , or the like could be used . additionally , a user &# 39 ; s own finger could be used for selecting or indicating portions of the displayed image on a touch - sensitive or proximity - sensitive display . consequently , the term “ user input device ”, as used herein , is intended to have a broad definition and encompasses many variations on well - known input devices . region 205 shows a feed back region or contact region permitting the user to determine where the stylus as contacted the digitizer . in another embodiment , the region 205 provides visual feedback when the hold status of the present invention has been reached . fig3 - 7 show various flowcharts for determining what a user wants to do based on a user &# 39 ; s interaction with the digitizer . as will be discussed below , the user contacts the digitizer where the user wants to begin writing , tapping , annotating , dragging , etc . in the case where the digitizer is superimposed over a display , the user &# 39 ; s contact with the digitizer is directed at operating at ( or near ) the contact point between the user &# 39 ; s stylus and the currently displayed information at or near the contact point . in step 301 , the system senses a contact or other indication of an action . in one embodiment the contact may be the stylus contacting the surface of the digitizer . in another embodiment , the action may be bringing the tip of the stylus near the digitizer &# 39 ; s surface . further , if the stylus includes another signaling method ( for example , a radio transmitter transmitting a signal to the digitizer signaling a user &# 39 ; s input ), the digitizer ( or related input mechanism or mechanisms ) interpret the received signal as a user &# 39 ; s input . other methods of starting an operation or writing or contact with a digitizer are known in the art . for purposes of illustration and description , the system and method reference physical contact with the digitizer . all other ways of providing signals to a processor are considered within the scope of the invention and are not mentioned here for simplicity . in step 302 , the system determines the contact position and what lies beneath the contact position ( for example , an object , a drawing , blank space , ink , and the like ). in step 303 , the system determines if the stylus has moved beyond a first threshold ( time , distance , rate , or acceleration , and the like ). in one embodiment , the threshold is set to the minimum resolvable movement . in another embodiment , the threshold is set higher to account for shaky hands , vibrations of the digitizer or tablet pc ( for example , if trying to use the system while driving in a car over a bumpy road ). it is noted that objects may have all the same threshold . alternatively , objects may have different thresholds . this may be dependent on the object , the size of the object , the state of the system , the state of the object , and the like . if the first threshold has been exceeded , then the system proceeds to step 304 where the user &# 39 ; s input is classified as a stroke and the system steps to point a 305 . if the first threshold has not been exceeded , the system determines if the stylus was still in contact with the digitizer when a time threshold had expired in step 306 . if no ( meaning that the stylus was not still in contact with the digitizer surface ), the system classifies the input as a tap in step 307 and proceeds to point b 308 . if the stylus was still in contact with the surface after the time threshold in step 306 , the system determines if a second move threshold was exceeded in step 309 . the first and second move thresholds may be identical or different . for example , both may be 0 . 25 mm . or , the first may be 0 . 5 mm or one mm and the second be 0 . 3 mm . further , the first may be 1 . 2 mm or more and the second may be 0 . 5 mm or more . in short , any values may be used as long as they are not obtrusive to the user . the second threshold may be determined only after the time threshold of step 306 has expired . in this example , the second threshold may be higher than the first threshold ( or it may be the same or smaller ). if the second move threshold was not exceeded , then the system classifies the input as a hold in step 310 and proceeds to point c 311 . if the second move threshold was exceeded , then the system classifies the input as a ‘ hold and drag ’ in step 312 and moves to point d 313 . fig4 shows point a as starting point 401 . here , the system classified the input as a stroke and begins stroke processing in step 402 . in step 403 , the system determines if the stroke started on a draggable object . if yes , the system determines in step 404 whether drag threshold was exceeded ( for example , 0 . 25 inches , 0 . 25 inches per second and the like ). if so , the system classifies the stroke as a drag in step 405 and performs a function that is dependent on the object . for example , the drag may extend a selection as described in greater detail in “ selection handles in editing electronic documents ,” filed concurrently with the present application ( attorney docket 03797 . 00069 ), and expressly incorporated by reference . also , the drag may operate a bungee tool as described in ser . no . ( atty docket 3797 . 00070 ), entitled “ insertion point bungee space tool ”, and filed concurrently with the present application , and expressly incorporated herein . if , in step 404 , the drag threshold has not been exceeded , the system maintains the current state ( with the object being selected or not ) in step 407 . if the stroke was not over a draggable object in step 403 , the system determines if the area under the contact point is inkable in step 408 . for example , inkable may mean an area capable of receiving ink ( including drawings , annotations , or writing ) as detailed in serial no . 60 / 212 , 825 , filed jun . 21 , 2000 , and expressly incorporated herein by reference for essential subject matter . by contrast , a control button ( for copy , save , open , etc .) may not be inkable . if inkable in step 408 , the system permits inking ( drawing , writing , annotating and other related functions ) in step 409 . if not inkable , the system maintains the current state ( objects selected or not ) in step 407 . in fig5 a , the system starts at point b 501 and operates on the input as a tap 502 . the system determines whether the tap was on an area or object that is inkable in step 503 . if yes , the system determines whether any ink was recently added or “ wet ” ( for example , less than 0 . 5 or 1 second old ) in step 504 . if so , the system considers the tap as a dot to be added to the ink in step 505 ( and adds the dot ). if no wet ink exists , then the system determines if the tap was over a selectable object in step 506 it is noted that steps 503 and 504 may be combined . if the tap was over a selectable object , then the system determines if the object was already selected in step 507 . if it was not , then the system selects the tapped object in step 508 . if a previous object had been selected , the system cancels the previous or old selection in step 509 . if the object was previously selected as determined by step 507 , the system performs an action relevant to the object in step 510 . this action may include editing the object , performing a predefined operation ( for example , enlarge , shrink and the like ). from step 506 , if the tap was not on a selectable object , then the system proceeds to point bb 512 . fig5 b shows additional processing to fig5 a . as point bb 512 , the system determines if the tap was in a space between text ( referred to herein as an inline space ) in step 513 . if yes , the system places an insertion point at the tap point in step 514 . as shown in a broken lined box , the system may also cancel any old or previous selections in step 515 . if no , then the system determines if the tap point has ink nearby in step 518 . if the system determines that the tap was nearby ink , then the system adds a dot to the ink in step 516 . if there was an old selection , then the system cancels the old selection in step 517 ( as shown by a broken line box ). if not nearby ink in step 518 , the system determines if the tap is on an active object in step 519 . if the tap was not on an active object , the system places an insertion point at the tap point or performs some other definable action in step 520 . again , if there was an old selection , then the system cancels the old selection in step 521 ( as shown by a broken line box ). if the tap was on an active object as determined by step 519 , the system performs an action in step 522 . the action may be definable by the user or relate to any function desirable . in one embodiment , the action may be to perform a function to operate a selection handle or bungee space tool as described in “ selection handles in editing electronic documents ,” filed concurrently with the present application ( attorney docket 03797 . 00069 ), and expressly incorporated by reference . also , the drag may operate a bungee tool as described in ser . no . ( atty docket 3797 . 00070 ), entitled “ insertion point bungee space tool ”, and filed concurrently with the present application , and expressly incorporated herein . other operations are known in the art and incorporated herein . fig6 relates to holding a stylus beyond a time threshold . starting from point c 601 , the system classifies the user input as a hold operation in step 602 . next , the system simulates a right mouse button click or other definable event in step 603 . the functions associated with step 603 are described in greater detail in u . s . application ser . no . ( atty docket 3797 . 00072 ), entitled “ simulating gestures of a mouse using a stylus and providing feedback thereto ”, filed nov . 10 , 2000 , whose contents are expressly incorporated herein by reference . fig7 relates to holding a stylus beyond a time threshold and moving the stylus . starting from point d 701 , the system classifies the user input as a hold and drag operation in step 702 . next , in step 703 the system drags the selected object as directed by the user . there are a number of alternatives associated with dragging . if the hold and drag relates to an inline space , the system may use this hold and drag function to select text . similarly , one may use this function to select a drawing encountered by the dragged stylus . further , one may select both text and drawings in this manner . also , the cursor &# 39 ; s point may become a selection tool that leaves a trail behind it . in this regard , the user may loop a number of objects , drawing or text in this regard . the looping of the objects may result in the selecting of the objects . an alternate embodiment of the present invention relates to modifying ink drawings or annotations . for example , if one added an annotation ( from step 409 ) to text , one may manipulate the text ( for example , by inserting new text ) and have the annotation track the manipulation of the text . so , if one circled text then added text to the circled text , the annotation would expand to include the added text as well . this is described in relation to in u . s . pat . ser . no . 60 / 212 , 825 , filed jun . 21 , 2000 , entitled “ methods for classifying , anchoring , and transforming ink annotations ” and incorporated by reference . while exemplary systems and methods embodying the present invention are shown by way of example , it will be understood , of course , that the invention is not limited to these embodiments . modifications may be made by those skilled in the art , particularly in light of the foregoing teachings . for example , each of the elements of the aforementioned embodiments may be utilized alone or in combination with elements of the other embodiments . | 6 |
fig1 diagrammatically shows a first embodiment of a microcircuit 1 according to the invention . the microcircuit 1 is formed in a plate from a suitable material such as for example pdms ( polydimethylsiloxane ) through the use of a common technique of flexible lithography , as is known in the aforementioned prior art . one or several microchannels 2 can be formed at the surface of the plate , whereon is glued a glass microscope slide , for example . as can be seen in fig1 , the microchannel 2 has a rectangular section , of which the width l is defined by its horizontal transversal dimension , i . e . in the plane of the microcircuit 1 , and of which the height h is defined by its dimension in the vertical direction , i . e . according to a direction perpendicular to the plane of the microcircuit 1 . of course , the preceding terms are used only through reference to the drawings , and remain valid regardless of the orientation of the microcircuit . a groove 3 with rectangular or square section is arranged in one of the two horizontal walls 4 that delimit the microchannel 2 . according to an alternative embodiment of the invention , a second groove can be arranged in the opposite horizontal wall , across from the first 4 . the groove 3 as such forms a trough of greater section than the rest of the microchannel 2 . a first fluid , called carrier fluid , circulates in the microchannel 2 , in the direction indicated by the arrow f , by drawing with it drops 5 of a second fluid , of a different nature than the first fluid . in what follows , the second fluid can be in the form of drops or bubbles , without modification of the operation of the invention . the drops 5 flowing into the narrow area of the microchannel are crushed . when they encounter a trough 3 , they take therein a less crushed form , for example a spherical or quasi - spherical shape , requiring less surface energy than the crushed form . note that the drops can remain crushed while still being guided by the trough . the determining criterion is that the surface energy of the drop in the trough be smaller than that outside of the trough , the sphere corresponding to the minimum of this energy . the drops 5 that encounter the trough 3 then circulate along the latter , being carried away therefrom by the carrier fluid . the drops can be larger or smaller than the trough 3 . fig2 shows an alternative embodiment of the invention wherein the groove defining the trough 3 has a concave or rounded shape . another alternative embodiment is represented in fig3 , wherein one of the horizontal walls 4 is provided with two parallel ribs 6 , spaced from one another , directed towards the interior of the microchannel 2 and delimiting between them a trough 3 . in this way , the drops 5 crushed between the top of the ribs 6 and the opposite wall 8 , are directed either towards the trough 3 , or in the other areas of the microchannel 2 located on either side of the ribs 6 . in these areas , the drops 5 can return to a spherical or quasi - spherical shape and therefore a lower surface energy . in this way , the ribs form barriers making it possible to separate certain drops from others . fig4 shows , in a top view , the form of a trough 3 . in this example , the trough 3 comprises at least one portion 9 extending according to the axis a of the microchannel and therefore according to the axis of flow f of the carrier fluid , at least one portion 10 extending obliquely in relation to the aforementioned axis a , and / or at least one portion 11 of sinusoidal shape . in each of the aforementioned portions , the trajectory of the drops 5 circulating along the trough 3 has a component according to the direction of flow of the carrier fluid , in such a way that the drops 5 are always drawn by the carrier fluid , from upstream to downstream of the trough 3 and of the microchannel 2 . in the case of an oblique portion 10 or of a sinusoidal portion 11 in particular , the travel time of the drops 5 in the microchannel 2 is greater . in this way , the contents of the drops 5 can be observed using a microscope for a longer period , without having tom modify the observation area over time . fig5 shows a network of troughs comprising a central trough 12 extending in the direction of the microchannel 2 , on either side of which extend several auxiliary troughs 13 . each auxiliary trough 13 extends from the central trough 12 and exits again in the latter , in the manner of diversion troughs . in the case on fig5 , the drops 5 contain for example water and the carrier fluid is paraffin , the width of the microchannel 2 is 3 mm , that of the troughs 12 , 13 is 70 μm , the heights of the microchannel and of the troughs are respectively 50 μm and 35 μm , and the drops 5 flow from left to right in the direction of the arrow f . fig6 shows a microchannel 2 wherein circulates a first fluid forming a carrier fluid for drops of a first and of a second types . the drops of the first type 14 have a larger size than the drops of the second type 15 . the microchannel 2 is provided with a trough 3 extending obliquely from upstream to downstream in relation to the direction of circulation of the carrier fluid , shown by the arrow f . the height and / or the width of the trough 3 are adjusted in such a way that the largest drops 14 are carried away with the carrier fluid in the direction of the arrow f and that the smallest drops 15 are drawn into the trough 3 , then progress along the latter , from upstream to downstream , being drawn therefrom by the carrier fluid . the downstream end 16 of the trough 3 is provided with a reduction in its height or in its width in such a way that the viscous force exerted by the carrier fluid is greater than that required to crush the drops 15 , so that the carrier fluid draws them again into the microchannel 2 . the drops 14 and 15 circulate as such , downstream of the trough 3 , respectively according to two axes b and c parallel to the flow of the carrier fluid and separated from one another . such a microchannel as such makes it possible to sort two types of drops of a different nature . fig7 shows a microchannel 2 similar to that in fig6 , wherein the drops of the first type 14 are relatively very viscous and the drops of the second type 15 are relatively hardly viscous . the height and / or the width of the trough 3 are adjusted in such a way that the most viscous drops 14 are carried away with the carrier fluid and that only the viscous drops 15 are drawn into the trough , then progress along the latter , from upstream to downstream , by being drawn by the carrier fluid and exit from the trough 3 at the downstream end of the latter . recall that the more viscous the drop is , the stronger the effort exerted by the carrier fluid on the drop is , this effort allowing for the extraction of the drop outside of the trough . such a microchannel 2 can also be used to sort drops having different surface tensions . fig8 shows a microchannel of the type of those of fig6 and 7 , wherein the trough successively has , from upstream to downstream , areas of decreasing height and / or width 17 to 20 . each area is sized in such a way as to be able to discriminate a particular type of drop . in the case shown in fig8 , the carrier fluid draws four types of drops of different sizes or viscosities across from the first area 17 , i . e . the widest and / or the deepest area . the drops of the first type 21 , i . e . the largest or the most viscous are drawn through this area 17 by the carrier fluid , the trajectory of these drops 21 hardly being influenced by the presence of the trough 3 . the drops of the second , of the third and of the fourth types 22 , 23 , 24 , smaller or less viscous than the first ones 21 , are drawn by the first area 17 of the trough 3 and follow the latter from upstream to downstream being carried away therefore by the carrier fluid , until arriving at the second area 18 , with a lower width and / or height . the second area 18 is sized in such a way that the drops of the second type 22 cannot penetrate therein . these drops 22 are therefore extracted from the trough 3 and then circulate in the microchannel 2 , according to an axis parallel to the flow of the carrier fluid and separated from their original axis of circulation . in the same manner as previously , the other areas 19 and 20 of the trough 3 are sized in such a way that the drops of the third type 23 circulate successively in the first , second and third areas 17 , 18 , 19 before escaping outside of the trough 3 , and that the drops of the fourth type 24 circulate in each of the areas 17 to 20 of the trough 3 before escaping at the downstream end 16 of the trough 3 . in this way , the drops of each type 21 to 24 circulate , downstream of the trough 3 , respectively according to axes of circulation that are parallel and separated from one another . such a microchannel therefore makes it possible to sort four types of drops of a different nature . of course , the number of different areas of the trough can be adjusted according to need . it is also possible to separate several types of drops by arranging different troughs 3 of different dimensions and / or inclinations in the microchannel in relation to the direction of flow f of the carrier fluid , as is shown in fig9 . in this figure , the microchannel 2 is formed with four successive troughs 3 , of which the inclinations in relation to the flow of the first fluid are increasingly lower . the first trough 3 a , the most inclined , separates the smallest drops 24 , the second channel 3 b separates the drops that are a little larger 23 , the third channel 3 c separates the drops that are even larger 22 , and the fourth channel 3 d separates the largest drops 21 . the microchannel 2 can also be provided with a trough 3 , extending for example according to the axis of circulation of the carrier fluid , and provided with a reduction in its width 25 and / or in its height . this reduction can have the form of a step or of a discontinuous step , or a progressive shape such as that which can be seen in fig1 . in this way , a drop 5 flowing in the trough being carried away therefrom by the carrier fluid will be slowed when passing through the contraction 25 . in the case where the speed of the carrier fluid is zero , the geometry of the troughs can be used as an engine to convey the drops . in this way , the invention makes it possible to displace the drops in a two - dimensional field , even in the absence of a flow of a carrier fluid . the invention can even be used so as to displace drops against the current in relation to the flow of the carrier fluid . inversely , as shown in fig1 , the trough 3 can be provided with an enlarging area 26 in steps or progressive , in such a way that the drop 5 circulating in the trough 3 is accelerated when passing through this area . the slowing of the drops 5 can also be obtained ( fig1 ) by arranging on either side of the trough 3 wherein they circulate , secondary troughs 27 having for function to locally increase the section of the microchannel 2 . this has for effect to locally decrease the speed of circulation of the carrier fluid , and , consequently , the speed de circulation of the drops 5 . of course , the number , the shape and the position of the secondary troughs 27 can be modified according to need , with the important point being the local increase in the section of the microchannel . the reverse effect can be obtained by replacing the troughs 27 with ribs forming a local reduction of the section of the microchannel 2 . fig1 shows a microchannel 2 comprising an area for trapping 28 drops , formed by a pocket or a cavity 29 made in the wall of the microchannel 2 . in this embodiment , the microchannel is not provided with a trough , the drops conveyed by the flow of the carrier fluid f being trapped in the area or areas for trapping if the latter are located on the trajectory of the drops . the area for trapping can be smaller or larger than the drops or the bubbles to be trapped , according to applications and of the nature of the drops or of the bubbles . fig1 shows a trough 3 provided with an area for trapping 28 drops , formed by a pocket or cavity formed on a side of the trough 3 , in a wall 4 of the microchannel 2 . the pocket 29 is connected to the trough 3 by a mouth 30 and is able to trap a predefined number of drops . in the case of fig1 , this area only makes it possible to contain a single drop 5 . the section of the mouth 30 can be adapted according to the applications . in the case where the mouth 30 has a larger section than that of the trough 3 , the drop or drops 5 can be automatically drawn into the areas for trapping 28 . in the case where the mouth 30 has a smaller section or substantially equal to that of the trough 3 , it may be required to force the drops 5 to enter into the area for trapping 28 . this can be carried out by any suitable means , in particular using the method described in wo 2006 / 018490 and wo 2007 / 138178 and which uses a laser beam directed on the interface between a drop and the carrier fluid or between two drops , in order to influence the movement of the drops . the drops 5 can be withdrawn from the areas for trapping 28 by increasing the flow of the carrier fluid , or by forcing the drops 5 to exit using the aforementioned method . fig1 shows a trough 3 on either side of which are formed several areas for trapping 28 , 29 , separated from one another and arranged in a staggered manner . each area for trapping 28 , 29 can be sized to trap a predefined number of drops 5 , one drop for the case of areas 28 and two drops for the case of the area 31 , and / or to trap drops of a particular nature . the microchannel 2 can also be provided with a network of troughs formed of a main trough 3 , through which the drops arrive , from which extend one or several diverted troughs 31 wherein are arranged obstacles 32 making it possible to retain , at least temporarily , the drops 5 in the corresponding diverted trough 31 , as can be seen in fig1 . the latter then form areas for trapping . the diverted troughs 31 may or may not extend downstream of the obstacle 32 . according to another alternative embodiment of the invention , which can be seen in fig1 , the annex troughs 31 can be provided with wetting areas 33 . a wetting area is formed by an area of which the wetting properties of the wall 4 have been modified . this can be carried out for example using a drop of water which is stopped or slowed in an area rendered hydrophilic . the modification of the wetting properties can also be obtaining using chemical methods , such as silanisation or plasma etching , or by using physical methods , for example by introducing hydrophilic lugs onto which the drop will catch ( fakir effect ). the area for trapping can also comprise elements intended to react with the contents of the drops , in such a way as to form microreactors or so as to detect the presence of chemical and / or biochemical molecules in the drop or drops concerned . by way of example , a dna sequence can be detected if the complementary sequence is placed locally on the wall of the corresponding area for trapping . several drops can also be brought into the vicinity or in contact with one another as is shown in fig1 . for this , the microchannel comprises for example two parallel troughs 34 , 35 , each intended for the circulation of a particular type of drops 36 , 37 , from which extend diverted troughs 31 of which the downstream ends form areas for trapping 28 . the areas for trapping 28 are arranged in the vicinity or adjacently in relation to one another in such a way that a drop of a first type 36 is in the vicinity or in contact with a drop of a second type 37 . it is then possible to merge the two drops 36 , 37 and to have their contents react , or to compare their content . fig1 shows a microchannel 2 having a trough 3 provided with several successive areas for trapping 28 , arranged in series . when a drop 5 is trapped in each of the areas for trapping 28 and an additional drop arrives via the trough 3 , the latter dislodges the drop from the upstream trap which , itself , dislodges the drop from the trap located directly downstream of the previous one . this results , via the cascade effect , in the movement of all of the drops 5 , from one area for trapping 28 to another . the areas for trapping 28 form a buffer area t defined by an enlargement of the microchannel and wherein the drops 5 spend a determined duration required for example to incubate a chemical or biochemical reaction and / or to allow for their observation . the area for trapping 28 can also be with a matrix layout as shown in fig2 , by the intermediary of a main trough 3 and of parallel diverted troughs 31 , each connected to a determined number of areas for trapping 28 . fig2 shows a microchannel 2 comprising means of supplying 38 parallel streams of drops of a different nature 21 to 24 , parallel means of introducing 39 drops of a different nature into the microchannel 2 , and troughs 3 formed in the microchannel 2 using means for introducing 39 to guide the drops 21 to 24 exiting from each means for introducing until a predetermined area of the microchannel 2 . parallel streams of different drops are thus formed in the microchannel . the microchannels presented hereinabove for the treatment of drops in a carrier fluid can also be used for the treatment of bubbles . the invention makes it possible in particular to incorporate the preparation of samples into a microfluidic chip and to bring the samples towards the points of observation in a simple and robust manner . a microfluidic circuit according to the invention can be applied in the field of biotechnology or “ chimietech ”, but also in the field of fluid display and of observing reactions in microdrops . such a microfluidic circuit could have the form that has today become standard , such as “ micro - arrays ” or biochips , for example protein or dna chips , or cell culture chips . these biochips are comprised of a matrix of areas where the surface is functionalized with biomolecules , the size and the distance between these areas being of approximately the same size as the microfluidic drops and the troughs . the invention makes it possible to bring particular drops , of which the contents are known , towards the functionalized sites and to bring them into contact with the surface in order to produce the hybridization which will allow for the biological measurement . in this way , the invention makes it possible to interface the technology of biochips with the advantages of the manipulation of fluids in microfluidics . as indicated previously , the trajectory of the drops can be modified actively , using a laser , in order to bring the drops into a trap or into a determined area of a microchannel . in the case of a microchannel comprising several troughs , such a method can also be used to direct a drop from one trough to another , for example to select from among different trajectories that the drop could follow . for this , when the fluids have a normal thermocapillary flow , the wavelength of the laser should be selected so that it is absorbed by the carrier fluid . the carrier fluid can , if required , contain a colorant ( black ink for example ) absorbing the wavelength of the laser . in this case , the local heating of the carrier fluid using the laser , in a trough or in the vicinity of the latter , attracts the drop into this trough . heating can also be carried out at the interface between the drop and the carrier fluid in order to attract the drop into a determined trough . when the fluids have an abnormal thermocapillary flow , the laser can be positioned in order to block the progress of a drop and divert it into another trough . heating can also be applied locally or globally using electric heating elements . furthermore , in the case where the fluids used do not absorb the laser , such an absorption can be carried out either directly by the material comprising the microchannel , or by depositing in the microchannel or in the trough a layer or a particle of a material that absorbs laser radiation . dielectrophoretic forces can also be used in order to influence the trajectory of the drops , or to trap drops . | 1 |
the invention will now be described in detail with reference to the drawings showing preferred embodiments thereof . referring first to fig1 there is shown the whole arrangement of a dma data transfer system incorporating a data transfer apparatus according to an embodiment of the invention . in the figure , a data transfer apparatus 1 is connected to a cpu 3 and an external module 4 through a data bus 2 , to an external module 6 through a data bus 5 , and to an external module 8 through a data bus 7 . the data transfer apparatus 1 is connected to the cpu 3 through control information lines 9 and 10 as well as through the data bus 2 such that a dma transfer starting command is supplied from the cpu 3 to the data transfer apparatus 1 through the control information line 9 , and information indicative of completion of a dma transfer and a state of allotment of dma channels of the data transfer apparatus 1 is supplied from the apparatus 1 to the cpu 3 through the control line 10 . when a command for starting a dma block transfer ( hereinafter sometimes abbreviated to &# 34 ; dma transfer &# 34 ;) is given by the cpu 3 through the control information line 9 , the data transfer apparatus 1 selects two buses out of the data buses 2 , 5 and 7 , designated by dma control parameters delivered from the cpu 3 through the data bus 2 , to carry out dma block transfer between two external modules connected to the selected data buses via the data transfer apparatus 1 . fig2 shows the arrangement of essential parts of the data transfer apparatus 1 . the data transfer apparatus 1 is comprised of a dma channel information memory 11 , a backup channel information memory 12 , and a dma transfer - executing section 13 . the dma channel information memory 11 stores dma channel information including dma transfer commands and dma control parameters given by the cpu 3 . the dma control parameters include a source address sa , a destination address da , and a number n of data items to be transferred , which are initial information concerning a dma channel chn to be started for dma transfer . the backup channel information memory 12 stores backup information including dma control parameters which have been used for a dma transfer through a dma channel chn by the dma transfer - executing section 13 , when the dma block transfer through the dma channel chn is interrupted . these parameters include a source address sa and a destination address da which have been used for the dma transfer through the dma channel chn to be interrupted , and a number n of data items to be transferred , i . e ., the residual amount of data , which are assumed when the transfer is interrupted . the dma transfer - executing section 13 carries out dma transfer , based on dma channel information given from the dma channel information memory 11 through a dma channel information line 14 , or based on backup channel information given from the backup channel information memory 12 through a backup channel information line 16 , and at the same time saves the dma channel information stored in the dma channel to be interrupted at the time of the interruption into a corresponding backup channel within the backup channel information memory 12 through a backup channel information line 15 . according to the present embodiment , three dma channels ch0 to ch2 are provided for the dma channel information memory 11 , which have imparted thereto respective different priorities set in a relationship of ch2 & gt ; ch1 & gt ; ch0 according to the degree of urgency of data transfer to be carried out . further , backup channels bupch1 and bupch0 are provided for the backup channel information memory 12 , which correspond , respectively , to the channels ch1 and ch0 exclusive of the channel ch2 having the highest priority . the dma channels and backup channels are set in a relationship of priority of ch2 & gt ; bupch1 & gt ; ch1 & gt ; bupch0 & gt ; ch0 . fig3 shows a program for carrying out dma block transfer , which is executed in response to a command for dma transfer issued from the cpu 3 . for example , when a command for dma transfer through a certain dma channel chn is issued from the cpu 3 , which instructs to carry out a dma block transfer of data from the external module 6 to the external module 8 , the dma transfer - executing section 13 first sets dma control parameters stored in the dma channel chn , i . e ., sets the source address sa to an address value for the external module 6 , the destination address da to an address value for the external module 8 , and the number n of data items to be transferred by the dma transfer - executing section 13 to a value corresponding to the number of data items to be transferred , at a step s1 . then , the section 13 selects the data buses 5 and 6 corresponding to the set addresses sa and da , and data are dma - transferred from the external module 6 to the external module 8 through the selected buses 5 and 6 , at a step s2 . then , the source address sa and the destination address da 8 are incremented , and the number n of data items to be transferred is decremented , at a step s3 . then , the dma transfer - executing section 13 determines at a step s4 whether or not the number n of data items to be transferred is equal to 0 . if the number n of data items to be transferred is equal to 0 , the dma block transfer is terminated . on the other hand , if the number n of data items to be transferred is not equal to 0 , in order to continue the dma block transfer , the program returns to the step s2 , wherein data are further transferred from the external module 6 to the external module 8 . thereafter , the above processing is repeatedly carried out until the number n of data items to be transferred by the dma transfer - executing section 13 becomes 0 . when a command for dma transfer through a dma channel chn + 1 higher in priority than the dma channel chn is issued during the dma transfer through the dma channel chn , as shown in fig4 the source address sa , the destination address da , and the number n of data items to be transferred , which assume respective values stored in the dma channel chn at this time point , are transferred to the backup channel information memory 12 and saved into a backup channel bupchn corresponding to the dma channel chn , at a step s11 . then , a dma transfer through the channel chn + 1 is carried out according to the routine of fig3 described above . when the dma block transfer is restarted based on the dma control parameters saved in the backup channel bupchn , i . e ., the backup information , the information saved in the backup channel bupchn is set to the dma transfer - executing section 13 to restart the dma transfer thereof . fig5 shows an example of the relationship in timing between issuance of commands chngo for data transfer through dma channels and states of the dma channels and backup channels assumed when a dma transfer through the dma channel ch1 higher in priority than the dma channel ch0 is commanded during dma transfer through the dma channel ch0 . more specifically , when a command ch1go for dma transfer through the dma channel ch1 higher in priority is issued during dma transfer through the dma channel ch0 , channel information of the dma channel ch0 lower in priority is saved into the backup channel bupch0 to interrupt the dma transfer through the dma channel ch0 , whereby a dma transfer through the dma channel ch1 is preferentially carried out . when the dma transfer through the dma channel ch1 is completed , the information saved in the backup channel bupch0 is set to the dma transfer - executing section 13 , to thereby restart the interrupted dma transfer through the backup channel bupch0 . fig6 shows another example of the relationship in timing between issuance of commands chngo for data transfer through dma channels and states of the dma channels and backup channels assumed when a dma transfer through the dma channel ch1 higher in priority than the dma channel ch0 is commanded and then a dma transfer through the dma channel ch2 even higher in priority than the dma channel ch1 is commanded during the dma transfer through the dma channel ch0 . more specifically , when a command ch1go for dma transfer through the dma channel ch1 is issued during dma transfer through the dma channel ch0 lower in priority than the dma channel ch1 , channel information of the channel ch0 is saved into the backup channel bupch0 to interrupt the dma transfer through the dma channel ch0 , whereby a dma transfer through the channel ch1 is preferentially carried out . however , when a command ch2go for dma transfer through the dma channel ch2 even higher in priority is issued , channel information of the dma channel ch1 lower in priority than the dma channel ch2 is saved into the backup channel bupch1 to interrupt the dma transfer through the dma channel ch1 . after completion of the dma transfer through the dma channel ch2 , the later interrupted transfer , i . e ., the dma transfer through the dma channel ch1 is restarted through the backup channel bupch1 higher in priority than the backup channel bupch0 , and then , after completion of the dma transfer through the backup channel bupch1 , the first interrupted transfer , i . e ., the dma transfer through the dma channel ch0 , is restarted through the backup channel bupch0 . thus , all the transfers commanded are completed . fig7 shows another example of the relationship in timing between issuance of commands chngo for data transfer through dma channels and states of the dma channels and backup channels assumed when dma transfers through the dma channel ch2 higher in priority than the dma channel ch0 are consecutively commanded during dma transfer through the dma channel ch0 . more specifically , if a command ch2go for dma transfer through the dma channel ch2 is issued during dma transfer through the dma channel ch0 , channel information of the dma channel ch0 is saved into the backup channel bupch0 , to thereby interrupt the transfer through the dma channel ch0 . after completion of the data transfer through the dma channel ch2 , the interrupted data transfer through the dma channel ch0 is restarted through the backup channel bupch0 . then , if another command ch2go for dma transfer through the dma channel ch2 is issued again during the transfer through the backup channel bupch0 , channel information set in the dma transfer - executing section 13 at this time point is saved into the backup channel bupch0 to interrupt the transfer through the backup channel bupch0 , whereby dma transfer through the dma channel ch2 is preferentially carried out . thereafter , the above processing is repeatedly carried out . fig8 shows a further example of the relationship in timing between issuance of commands chngo for data transfer through dma channels and states of the dma channels and backup channels assumed when dma transfers through the dma channels ch0 and ch1 are commanded during interruption of dma transfers through the same dma channels ch0 and ch1 , which interruption has been caused by preferential execution of a dma transfer through the dma channel ch2 having the highest priority . more specifically , when a command ch1go for dma transfer through the dma channel ch1 higher in priority than the dma channel ch0 is issued during dma transfer through the dma channel ch0 , channel information stored in the dma channel ch0 is saved into the backup channel bupch0 to interrupt the transfer through the dma channel ch0 , whereby a dma transfer through the dma channel ch1 is preferentially carried out . then , if a command ch2go for dma transfer through the dma channel ch2 even higher in priority than the dma channel ch1 is issued during the dma transfer through the dma channel ch1 , channel information of the dma channel ch1 lower in priority than the dma channel ch2 is saved into the backup channel bupch1 as well , to interrupt the transfer through the dma channel ch1 , whereby a dma transfer through the dma channel ch2 is carried out . on this occasion , even if a new command ch1go for dma transfer through the dma channel ch1 is issued , a transfer through the dma channel ch1 lower in priority than the backup channel bupch1 is kept waiting . therefore , after completion of the transfer through the dma channel ch2 , the transfer through the dma channel ch1 is first restarted through the backup channel bupch1 , and then the transfer through the channel ch1 which has been kept waiting is carried out . similarly , when the transfer through the dma channel ch1 is completed , the first interrupted transfer is restarted through the backup channel bupch0 , and then a transfer through the dma channel ch0 which has been kept waiting is carried out . according to the present embodiment , as described above , the dma channels ch0 to ch2 are set in the relationship of priority of ch2 & gt ; ch1 & gt ; ch0 , and when a command for dma transfer through a dma channel chn + 1 higher in priority than a dma channel chn is issued during a dma transfer through the dma channel chn , the dma transfer through the dma channel chn is interrupted , whereby a dma transfer through the dma channel chn + 1 higher in priority is preferentially carried out . as a result , dma transfer of data with a high degree of urgency is promptly carried out without waiting . further , according to the present embodiment , a higher priority than that of a dma channel chn is imparted to a corresponding backup channel bupchn into which dma channel information of the dma channel chn is saved , and when a dma transfer through a dma channel having a higher priority than that of the backup channel bupchn is completed , dma transfers through the backup channel bupchn and the dma channel chn are successively restarted according to the priorities imparted thereto . as a result , even if a further command for dma transfer through the dma channel chn which is kept waiting for dma transfer is generated , restarting of the dma transfer through the dma channel chn which has been interrupted by execution of a dma transfer through a higher priority dma channel is started with transfer of a data block which was about to be transferred at the last time of interruption of the dma transfer through the dma channel chn , which makes it possible to achieve efficient and prompt interruption and restarting of the dma block transfer . fig9 shows the arrangement of essential parts of the data transfer apparatus 1 according to a second embodiment of the invention . according to the present embodiment , there are provided four dma channels ch0 to ch3 which are set in a relationship of priority of ch3 & gt ; ch2 & gt ; ch1 & gt ; ch0 according to the degree of urgency of the data transfer , and the four dma channels are divided into two groups , i . e ., a group of channels ch0 and ch1 , and a group of channels ch2 and ch3 . backup channels bupch0 and bupch1 are provided , which correspond , respectively , to the two groups . the dma channels and back up channels are set in a relationship of priority of bupch1 & gt ; ch3 & gt ; ch2 & gt ; bupch0 & gt ; ch1 & gt ; ch0 . as is shown in fig1 , when a dma transfer through the dma channel ch1 higher in priority than the dma channel ch0 is commanded during a dma transfer through the dma channel ch0 , channel information of the dma channel ch0 is saved into the corresponding backup channel bupch0 to interrupt the dma transfer through the dma channel ch0 , whereby the dma transfer through the dma channel ch1 higher in priority is carried out . during the dma transfer through the dma channel ch1 , if a command for dma transfer is issued for the dma channel ch2 having an even higher priority , channel information of the channel ch1 cannot be saved into the backup channel bupch0 since the channel information of the dma channel ch0 has already been saved into the backup channel bupch0 , and therefore the transfer through the dma channel ch1 is continued . consequently , the dma transfer through the dma channel ch2 with the highest priority is suspended for a short time period until the transfer through the dma channel ch1 is completed . except for this , the dma transfer according to the present embodiment is carried out in a manner identical with that carried out in the first embodiment described hereinbefore . in this embodiment , when a further command for dma transfer through one channel is issued during a dma transfer through the same channel , the new dma transfer is kept waiting . according to the present embodiment , as described above , the dma channels are divided into groups and the dma channels of the same group share the same backup channel . as a result , the manufacturing cost can be curtailed . fig1 shows the arrangement of essential parts of the data transfer apparatus 1 according to a third embodiment of the invention . according to the present embodiment , five dma channels ch0 to ch4 are provided , which are set in a relationship of priority of ch4 & gt ; ch3 & gt ; ch2 & gt ; ch1 & gt ; ch0 according to the degree of urgency of the data transfer , and the channels ch0 to ch3 exclusive of the channel ch4 having the highest priority are divided into groups , i . e ., a group of channels ch0 and ch1 , and a group of channels ch2 and ch3 . further , backup channels bupch0 and bupch1 are provided , which correspond , respectively , to the group of the channels ch0 and ch1 and the group of the channels ch2 and ch3 . the dma channels and the backup channels are set in a relationship of priority of ch4 & gt ; bupch1 & gt ; ch3 & gt ; ch2 & gt ; bupch0 & gt ; ch1 & gt ; ch0 . as is shown in fig1 , according to the present embodiment as well , when contention occurs between two or more of the dma channels , the channels assume states similar to the channels in the second embodiment . a backup channel need not be provided for the dma channel ch4 having the highest priority . | 6 |
referring to the figure , the present invention is shown as applied to a typical fluid catalytic cracking process . various items such as pumps , compressors , steam lines , instrumentation and other process equipment has been omitted to simplify the drawing . reaction or cracking zone 10 is shown containing a fluidized catalyst bed 12 having a level at 14 in which a hydrocarbon feedstock is introduced into the fluidized bed through line 16 for catalytic cracking . the hydrocarbon feedstock may comprise naphthas , light gas oils , heavy gas oils , residual fractions , reduced crude oils , cycle oils derived from any of these , as well as suitable fractions derived from shale oil kerogen , tar sands , bitumen processing , synthetic oils , coal hydrogenation , and the like . such feedstocks may be employed singly , separately in parallel reaction zones , or in any desired combination . typically , these feedstocks will contain metal contaminants such as nickel , vanadium and / or iron . heavy feedstocks typically contain relatively high concentrations of vanadium and / or nickel . hydrocarbon gas and vapors passing through fluidized bed 12 maintain the bed in a dense turbulent fluidized condition . in reaction zone 10 , the cracking catalyst becomes spent during contact with the hydrocarbon feedstock due to the deposition of coke thereon . thus , the terms &# 34 ; spent &# 34 ; or &# 34 ; coke - contaminated &# 34 ; catalyst as used herein generally refer to catalyst which has passed through a reaction zone and which contains a sufficient quantity of coke thereon to cause activity less , thereby requiring regeneration . generally , the coke content of spent catalyst can vary anywhere from about 0 . 5 to about 5 wt .% or more . typically , spent catalyst coke contents vary from about 0 . 5 to about 1 . 5 wt .%. prior to actual regeneration , the spent catalyst is usually passed from reaction zone 10 into a stripping zone 18 and contacted therein with a stripping gas , which is introduced into the lower portion of zone 18 via line 20 . the stripping gas , which is usually introduced at a pressure of from about 10 to about 50 psig , serves to remove most of the volatile hydrocarbons from the spent catalyst . a preferred stripping gas is steam , although nitrogen , other inert gases or flue gas may be employed . normally , the stripping zone is maintained at essentially the same temperature as the reaction zone , i . e . from about 450 ° c . to about 600 ° c . stripped spent catalyst from which most of the volatile hydrocarbons have been removed , is then passed from the bottom of stripping zone 18 , through u - bend 22 and into a connecting vertical riser 24 which extends into the lower portion of regeneration zone 26 . air is added to riser 24 via line 28 in an amount sufficient to reduce the density of the catalyst flowing therein , thus causing the catalyst to flow upward into regeneration zone 26 by simple hydraulic balance . in the particular configuration shown , the regeneration zone is a separate vessel ( arranged at approximately the same level as reaction zone 10 ) containing a dense phase catalyst bed 30 having a level indicated at 32 , which is undergoing regeneration to burn - off coke deposits formed in the reaction zone during the cracking reaction , above which is a dilute catalyst phase 34 . an oxygen - containing regeneration gas enters the lower portion of regeneration zone 26 via line 36 and passes up through a grid 38 and the dense phase catalyst bed 30 , maintaining said bed in a turbulent fluidized condition similar to that present in reaction zone 10 . oxygen - containing regeneration gases which may be employed in the process of the present invention are those gases which contain molecular oxygen in admixture with a substantial portion of an inert diluent gas . air is a particularly suitable regeneration gas . an additional gas which may be employed is air enriched with oxygen . additionally , if desired , steam may be added to the dense phase bed along with the regeneration gas or separately therefrom to provide additional inert diluents and / or fluidization gas . typically , the specific vapor velocity of the regeneration gas will be in the range of from about 0 . 8 to about 6 . 0 feet / sec ., preferably from about 1 . 5 to about 4 feet / sec . regenerated catalyst from the dense phase catalyst bed 30 in the regeneration zone 26 flows downward through standpipe 42 and passes through u - bend 44 , and line 80 into reduction zone 70 maintained at a temperature above 500 ° c . preferably above about 600 ° c . having a reducing agent such as hydrogen or carbon monoxide , entering through line 72 to maintain a reducing environment in the reduction zone to passivate the contaminants as described in more detail hereinafter . the regenerated and passivated catalyst then passes from reduction zone 70 through line 82 and u - bend 84 into the reaction zone 10 by way of transfer line 46 which joins u - bend 84 near the level of the oil injection line 16 . by regenerated catalyst is meant catalyst leaving the regeneration zone which has contacted an oxygen - containing gas causing at least a portion , preferably a substantial portion , of the coke present on the catalyst to be removed . more specifically , the carbon content of the regenerated catalyst can vary anywhere from about 0 . 01 to about 0 . 2 wt .%, but preferably is from about 0 . 01 to about 0 . 1 wt .%. predetermined quantities of selected metals or conventional passivation promoters may be added to the hydrocarbon feedstock through line 16 , if desired , as described more fully hereinafter . the hydrocarbon feedstock for the cracking process , containing minor amounts of iron , nickel and / or vanadium contaminants is injected into line 46 through line 16 to form an oil and catalyst mixture which is passed into fluid bed 12 within reaction zone 10 . the metal contaminants and the passivation promoter , if any , become deposited on the cracking catalyst . product vapors containing entrained catalyst particles pass overhead from fluid bed 12 into a gas - solid separation means 48 wherein the entrained catalyst particles are separated therefrom and returned through diplegs 50 leading back into fluid bed 12 . the product vapors are then conveyed through line 52 into the product recovery system ( not shown ). in regeneration zone 26 , flue gases formed during regeneration of the spent catalyst pass from the dense phase catalyst bed 30 into the dilute catalyst phase 34 along with entrained catalyst particles . the catalyst particles are separated from the flue gas by a suitable gas - solid separation means 54 and returned to the dense phase catalyst bed 30 via diplegs 26 . the substantially catalyst - free flue gas then passes into a plenum chamber 58 prior to discharge from the regeneration zone 26 through line 60 . where the regeneration zone is operated for substantially complete combustion of the coke , the flue gas typically will contain less than about 0 . 2 , preferably less than 0 . 1 and more preferably less than 0 . 05 volume % carbon monoxide . the oxygen content usually will vary from about 0 . 4 to about 7 vol .%, preferably from about 0 . 8 to about 5 vol .%, more preferably from about 1 to about 3 vol .%, most preferably from about 1 . 0 to about 2 vol .%. reduction zone 70 may be any vessel providing suitable contacting of the catalyst with a reducing environment at elevated temperatures . the shape of reduction zone 70 is not critical . in the embodiment shown , reduction zone 70 comprises a treater vessel having a shape generally similar to that of regeneration zone 26 , with the reducing environment maintained , and catalyst fluidized by , reducing agent entering through line 72 and exiting through line 78 . the volume of dense phase 74 having a level at 76 is dependent on the required residence time . the residence time of the catalyst in reduction zone 70 is not critical as long as it is sufficient to effect the passivation . the residence time will range from about 30 sec . to about 30 min ., typically from about 2 to 5 minutes . the pressure in this zone is not critical and generally will be a function of the location of reduction zone 70 in the system and the pressure in the adjacent regeneration and reaction zones . in the embodiment shown , the pressure in zone 70 will be maintained in the range of about 5 to 50 psia , although the reduction zone preferably should be designed to withstand pressures of 100 psia . the temperature in reduction zone 70 should be above about 500 ° c . preferably above 600 ° c ., but below the temperature at which the catalyst sinters or degrades . a preferred temperature range is about 600 °- 850 ° c ., with the more preferred temperature range being 650 °- 750 ° c . the reduction zone 70 can be located either before or after regeneration zone 26 , with the preferred location being after the regeneration zone , so that the heat imparted to the catalyst by the regeneration obviates or minimizes the need for additional catalyst heating . the reducing agent utilized in the reduction zone 70 is not critical , although hydrogen and carbon monoxide are the preferred reducing agents . other reducing agents including light hydrocarbons , such as c 3 - hydrocarbons , may also be satisfactory . reduction zone 70 can be constructed of any chemically resistant material sufficiently able to withstand the relatively high temperatures involved and the high attrition conditions which are inherent in systems wherein fluidized catalyst is transported . specifically , metals are contemplated which may or may not be lined . more specifically , ceramic liners are contemplated within any and all portions of the reduction zone together with alloy use and structural designs in order to withstand the maximum contemplated operating temperatures . the reducing agent utilized in all but one of the following tests was high purity grade hydrogen , comprising 99 . 9 % hydrogen . in the remaining test , shown in table viii a reducing agent comprising 99 . 3 % co was utilized . it is expected that commercial grade hydrogen , commercial grade co , and process gas streams containing h 2 and / or co can be utilized . examples include cat cracker tail gas , catalytic reformer off - gas , spent hydrogen streams from catalytic hydroprocessing , synthesis gas and flue gases . the rate of consumption of the reducing agent in reducing zone 70 will , of course , be dependent on the amount of oxidizable material entering the reducing zone . in a typical fluidized catalytic cracking unit it is anticipated that about 10 to 100 scf of hydrogen or about 10 to 100 scf of co gas would be required for each ton of catalyst passed through reduction zone 70 . if the reducing agent entering through line 72 is circulated through reduction zone 70 and thence into other units , a gas - solids separation means may be required for use in connection with the reduction zone . if the reducing agent exiting from zone 70 is circulated back into the reduction zone , a gas - solids separation means may not be necessary . preferred separation means for zones 10 , 26 and 70 will be cyclone separators , multiclones or the like whose design and construction are well known in the art . in the case of cyclone separators , a single cyclone may be used , but preferably , more than one cyclone will be used in parallel or in series flow to effect the desired degree of separation . the construction of regeneration zone 26 can be made with any material sufficiently able to withstand the relatively high temperatures involved when afterburning is encountered within the vessel and the high attrition conditions which are inherent in systems wherein fluidized catalyst is regenerated and transported . specifically , metals are contemplated which may or may not be lined . more specifically , ceramic liners are contemplated within any and all portions of the regeneration zone together with alloy use and structural designs in order to withstand temperatures of about 760 ° c . and , for reasonably short periods of time , temperatures which may be as high as 1000 ° c . the pressure in the regeneration zone is usually maintained in a range from about atmospheric to about 50 psig ., preferably from about 10 to 50 psig . it is preferred , however , to design the regeneration zone to withstand pressures of up to about 100 psig . operation of the regeneration zone at increased pressure has the effect of promoting the conversion of carbon monoxide to carbon dioxide and reducing the temperature level within the dense bed phase at which the substantially complete combustion of carbon monoxide can be accomplished . the higher pressure also lowers the equilibrium level of carbon on regenerated catalyst at a given regeneration temperature . the residence time of the spent catalyst in the regeneration zone is not critical so long as the carbon on the catalyst is reduced to an acceptable level . in general , it can vary from about 1 to about 30 minutes . the contact time or residence time of the flue gas in the dilute catalyst phase establishes the extent to which the combustion reaction can reach equilibrium . the residence time of the flue gas may vary from about 10 to about 60 seconds in the regeneration zone and from about 2 to about 15 seconds in the dense bed phase . preferably , the residence time of the flue gas varies from about 15 to about 20 seconds in the dense bed . the present invention may be applied beneficially to any type of fluid cat cracking unit without limitation as to the spatial arrangement of the reaction , stripping , and regeneration zones , with only the addition of reduction zone 70 and related elements . in general , any commercial catalytic cracking catalyst designed for high thermal stability could be suitably employed in the present invention . such catalysts include those containing silica and / or alumina . catalysts containing combustion promoters such as platinum can be used . other refractory metal oxides such as magnesia or zirconia may be employed and are limited only by their ability to be effectively regenerated under the selected conditions . with particular regard to catalytic cracking , preferred catalysts include the combinations of silica and alumina , containing 10 to 50 wt .% alumina , and particularly their admixtures with molecular sieves or crystalline aluminosilicates . suitable molecular sieves include both naturally occurring and synthetic aluminosilicate materials , such as faujasite , chabazite , x - type and y - type aluminosilicate materials and ultra stable , large pore crystalline aluminosilicate materials . when admixed with , for example , silica - alumina to provide a petroleum cracking catalyst , the molecular sieve content of the fresh finished catalyst particles is suitably within the range from 5 - 35 wt .%, preferably 8 - 20 wt .%. an equilibrium molecular sieve cracking catalyst may contain as little as about 1 wt .% crystalline material . admixtures of clay - extended aluminas may also be employed . such catalysts may be prepared in any suitable method such as by impregnation , milling , co - gelling , and the like , subject only to the provision that the finished catalyst be in a physical form capable of fluidization . in the following tests a commercially available silica - alumina zeolite catalyst sold under the tradename cbz - 1 , manufactured by davison division , w . r . grace & amp ; company was used after steaming to simulate the approximate equilibrium activity of the catalyst . as shown by the data in tables i - ix the incorporation of a reduction zone 70 is not effective for passivating a metal contaminated catalyst unless : a . a temperature in excess of about 500 ° c . is used ; and b . at least two metals selected from the group consisting of nickel , iron and vanadium are utilized . unless otherwise noted the following test conditions were used . the cbz - 1 catalyst utilized was first steamed at 760 ° c . for 16 hours after which the catalyst was contaminated with the indicated metals by laboratory impregnation followed by calcining in air at about 540 ° c . for four hours . the catalyst was then subjected to the indicated number of redox cycles . each cycle consisted of a five - minute residence in a hydrogen atmosphere , a five - minute nitrogen flush and then a five - minute residence in an air atmosphere at the indicated temperatures . following the redox cycles the catalyst was utilized in a microcatalytic cracking ( mcc ) unit . the mcc unit comprises a captive fluidized bed of catalyst kept at a cracking zone temperature of 500 ° c . tests were run by passing a vacuum gas oil having a minimum boiling point of about 340 ° c . and a maximum boiling point of about 565 ° c . through the reactor for two minutes and analyzing for hydrogen and coke production . in table i data is presented illustrating that the incorporation of a reduction step followed by an oxidation step ( redox ) significantly decreased the hydrogen and coke makes . table 1______________________________________ treatment yieldswt . % metal on catalyst prior wt . % on feedni v fe to cracking h . sub . 2 coke______________________________________0 . 16 0 . 18 calcined 0 . 86 7 . 820 . 16 0 . 18 redox 650 ° c . 0 . 62 6 . 040 . 12 0 . 12 calcined 0 . 53 5 . 490 . 12 0 . 12 redox 650 ° c . 0 . 34 4 . 150 . 15 0 . 19 0 . 35 calcined 1 . 16 10 . 610 . 15 0 . 19 0 . 35 redox 650 ° c . 0 . 79 7 . 48______________________________________ table ii illustrates that hydrogen and coke make reductions similar to that shown in table i also were obtained on a metals contaminated catalyst wherein the metals had been deposited by the processing of heavy metal feeds rather than by laboratory impregnation . table ii______________________________________ yieldswt . % metal on catalyst wt . % on feedni v fe treatment h . sub . 2 coke______________________________________0 . 28 0 . 31 0 . 57 510 ° c . cracking 1 . 13 9 . 11 620 ° c . regen . ( many cycles ) 0 . 28 0 . 31 0 . 57 redox 650 ° 0 . 75 5 . 41 4 cycles0 . 26 0 . 29 0 . 36 510 ° c . cracking 0 . 73 6 . 05 707 ° c . regen . ( many cycles ) 0 . 26 0 . 29 0 . 36 redox 650 ° c . 0 . 53 3 . 94 4 cycles______________________________________ table iii illustrates that the degree of passivation is a function of the reduction zone temperature . it can be seen that the adverse catalytic effects of the metal contaminants are only slightly reduced over that of untreacted catalyst , where the temperature in reduction zone 70 is only 500 ° c . as the reduction zone temperature is increased , it can be seen that the degree of passivation increases . table iii______________________________________ yieldswt . % redox wt . % on feedmetal on catalyst treatment temp . ° c . h . sub . 2 coke______________________________________0 . 28ni , 0 . 31v , 0 . 57 fe no redox treatment 1 . 13 9 . 11 500 1 . 10 8 . 55 600 0 . 99 7 . 94 625 0 . 98 7 . 33 650 0 . 75 5 . 41 700 0 . 59 4 . 80 750 0 . 50 4 . 11______________________________________ based on this data , it is believed that the reduction step decreases the hydrogen and coke makes and that the reduction must be performed at a temperature in excess of 500 ° c . table iv , illustrates that where only one of the metal contaminants is present , the redox step at 650 ° c . is not effective in reducing the hydrogen and coke makes . table iv______________________________________ yields , treatment prior wt . % on feedwt . % metal on catalyst to cracking h . sub . 2 coke______________________________________0 . 21 ni calcined 0 . 80 8 . 100 . 21 ni redox 650 ° c . 0 . 72 7 . 96 4 cycles0 . 29 v calcined 0 . 38 3 . 880 . 29 v redox 650 ° c . 0 . 36 4 . 20 4 cycles______________________________________ thus , to passivate the metal contaminants on a catalyst , where at least a major portion of the total of the metal contaminants comprises nickel , vanadium or iron , it may be necessary to add predetermined quantities of either of the other two contaminants . typically , crude oil will not contain relatively high concentrations of iron . vanadium and nickel , however , typically are found in many crudes , with the relative amounts varying with the type of crude . for example , certain venezuelan crudes have relatively high vanadium and relatively low nickel concentrations , while the converse is true for certain domestic crudes . in addition , certain hydrotreated residual oils and hydrotreated gas oils may have a relatively high nickel and relatively low vanadium concentrations , since hydrotreating removes vanadium more effectively than nickel . a catalyst could have substantial iron depositions where the iron oxide scale on process equipment upstream of the catalyst breaks off and is transported through the system by the feedstock . the relative catalytic activity of the individual metal contaminants nickel , vanadium and iron for the formation of hydrogen and coke are approximately 10 : 2 . 5 : 1 . based on this , iron preferably should be added to passivate catalyst contaminated only with nickel , or vanadium . table v illustrates the passivation that is achieved by adding quantities of iron to catalyst comprising only vanadium or only nickel . table v______________________________________ treatment yield , prior to wt . % on feedwt . % metal on catalyst cracking h . sub . 2 coke______________________________________0 . 17 ni calcined 0 . 76 7 . 300 . 17 ni , 0 . 23 fe redox 650 ° c ., 0 . 51 5 . 27 4 cycles0 . 29 v calcined 0 . 38 3 . 880 . 29 v , 0 . 13 fe redox 650 ° 0 . 30 3 . 72 4 cycles______________________________________ table vi illustrates the passivation achieved by adding varying weights of vanadium to catalyst comprising only the nickel contaminant . attention is directed to the fact that the addition of 0 . 02 wt .% vanadium followed by redox partially passivated the catalyst . combination of the nickel contaminated catalyst with 0 . 12 wt .% vanadium followed by rediox further passivated the catalyst . however , combination of the nickel contaminated catalyst with 0 . 50 wt .% vanadium resulted in an increase in undesired catalytic activity over that of the catalyst containing only 0 . 12 wt .% nickel . thus , there appears to be a level of addition of the second metal component , above which the effectiveness of the passivation decreases . the exact amount of nickel , vanadium or iron which should be added to a metal - contaminated catalyst has not been determined . table vi______________________________________ treatment yields , wt . % metal on catalyst prior to wt . % on feedni v cracking h . sub . 2 coke______________________________________0 . 12 calcined 0 . 60 5 . 650 . 12 redox 650 ° c . 0 . 44 4 . 780 . 12 0 . 02 redox 650 ° c . 0 . 39 4 . 530 . 12 0 . 12 redox 650 ° c . 0 . 34 4 . 150 . 12 0 . 50 calcined 1 . 17 11 . 080 . 12 0 . 50 redox 650 ° c . 0 . 72 6 . 86______________________________________ table vii illustrates passivation of a catalyst impregnated with equal weight percentages of nickel and vanadium . it should be noted that the redox at 650 ° c . resulted in a significant decreased in hydrogen and coke makes , but that , here also , the further addition of iron actually increased the undesired catalytic activity of the metal contaminants slightly . table vii______________________________________ treatment yields , wt . % metal on catalyst prior to wt . % on feedni v fe cracking h . sub . 2 coke______________________________________0 . 12 0 . 12 calcined 0 . 53 5 . 490 . 12 0 . 12 redox 650 ° c . 0 . 34 4 . 15 4 cycles0 . 12 0 . 12 0 . 26 redox 650 ° c . 0 . 37 4 . 50 4 cycles______________________________________ table viii illustrates that metals - contaminated catalyst also can be passivated by the use of carbon monoxide rather than hydrogen as the reducing agent . in one run cp grade co containing 99 . 3 % co by volume was utilized in the previously described passivation process while reagent grade hydrogen was used in the comparative run . it can be seen that both reducing agents passivated the catalyst to about the same extent . table viii______________________________________ treatment yields , wt . % metal on catalyst prior to wt . % on feedni v fe cracking h . sub . 2 coke______________________________________0 . 28 0 . 31 0 . 57 calcined 1 . 13 9 . 11 redox 650 ° c . 0 . 75 5 . 41 4 cycles , h . sub . 2 redox 650 ° c . 0 . 73 5 . 83 4 cycles , c0______________________________________ as shown by the data of table ix , the addition of iron or antimony followed by high temperature redox , reduced the rate of hydrogen and coke formation . the addition of both iron and antimony followed by high temperature redox leads to a still further decrease in hydrogen and coke makes . table ix______________________________________ treatment yields , prior to wt . % on feedwt . % metal on catalyst cracking h . sub . 2 coke______________________________________0 . 17 ni calcined 0 . 76 7 . 300 . 17 ni , 0 . 23 fe redox 650 ° c . 0 . 51 5 . 27 4 cycles0 . 27 ni calcined 0 . 83 8 . 400 . 27 ni , 0 . 52 sb redox 650 ° c . 0 . 59 6 . 03 4 cycles0 . 27 ni , 0 . 52 sb , 0 . 34 fe redox 650 ° c . 0 . 54 5 . 31 4 cycles______________________________________ in addition to antimony , it is belived that other known passivation agents such as tin , bismuth and manganese in place of the antimony also would decrease the hydrogen and coke makes . it has been found that one passage through the reaction and regeneration zones reduces the effectiveness of the reduction zone passivation . thus , at least a portion of the catalyst preferably is passed through reduction zone 70 on every catalyst regeneration cycle . the quantity of metal contaminant , or passivation promoter , if any , that should be added to the system may be determined preferably by monitoring the hydrogen and coke makes in the reaction zone or by analyzing the metal contaminant concentration either in the hydrocarbon feed or on the catalyst . where additional iron , vanadium or nickel is to be added to the system to reduce the hydrogen and coke makes , it is believed that the additional quantities of these metals should be added to the feed , rather than impregnated onto the catalyst prior to use . impregnation of an excess of these metals onto the catalyst prior to use in the cracking operation may lead to higher initial hydrogen and coke makes . moreover , where passivation promoters having relatively high vapor pressures , such as antimony , are used , some of the passivation promoter may be lost to the atmosphere if it is impregnated onto the catalyst . it has been found that the passivation efficiency of antimony is higher when the antimony is incorporated into the hydrocabon feedstock than when it is impregnated onto the catalyst . although the subject process has been described with reference to a specific embodiment , it will be understood that it is capable of further modification . any variations , uses or adaptations of the invention following , in general , the principles of the invention are intended to be covered , including such departures from the present disclosure as come within known or customary practice in the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth , and as fall within the scope of the invention . | 1 |
this invention proposes the design of a central tower receiver using molten salts with a defined configuration , which facilitates its functioning and control during the operation of the thermoelectric solar plant . the main advantage of the design which is the object of this invention is that its implementation allows the useful life of the receiver to be increased and a decrease in the differences in temperature between the feed entrance and exit in the pipes which the receiver is composed of . as a consequence , there would be a reduction in the thermal tensions experienced by the material which can result in structural damage , such as fractures and cracks , mainly in the welded areas . to achieve this , a system is proposed involving recirculation of a percentage of the exit flow of the receiver ( mixture of hot molten salts ) upon their entrance . this flow percentage must result in the lowest possible load loss , generating at the same time admissible thermal losses for a fixed level of receiver efficiency . the receiver proposed in this invention , in order to reduce thermal losses , will be of a cavity type . cavity type receivers are defined as those which are installed at the top of a tower inside a gap or cavity , in order to minimize thermal losses due to radiation or convection . the configuration is in a semi cylindrical shape composed of panels , the receiver area is determined according to the thermal power of the design . the panels are formed of a combination of vertical pipes . the semi cylindrical shape of the receiver allows the maximization of the capture of solar radiation by the heliostat field . the cold molten salt ( heat transfer fluid ), originating from the storage tank , is not directly introduced into the receiver , as occurs in state - of - the - art systems , but supplies a mixture deposit which collects cold salt as well as a part of the hot recirculating salt mixing them together in the deposit , so that afterwards said mixture , of cold and hot molten salts , is introduced in the upper part of the vertical pipes which the receiver consists of . on the lower part , the hot salt is collected . part of the exit flow of this hot salt ( this proportion is defined for reasons of recirculation ) is recirculated in the mixture deposit and the rest is carried to the hot salt storage tank . the heating of the salt mixture is produced as the fluid advances through the interior of the combination of vertical pipes in the panels , absorbing the incident solar radiation on the surface . the configuration of the panels which the receiver consists of is in parallel . the distribution of the entrance fluid ( mixture of cold and hot molten salts ) within the panels is carried out using control valves on the upper part . the distribution of the flow of fluid is based on the incident solar radiation power in the panels ( distribution of non uniform incident flow over time ). as a result , in the panels which receive greater incident radiant power , a greater flow of refrigeration will circulate , in this way ensuring that the gradients in the pipe walls of the receivers are at a minimum during their operation . the recirculation of a part of the exit flow of the receiver ( hot molten salt ) at its entrance allows , as previously mentioned , reductions in the temperature variations between the entrance and the exit of the vertical pipes of the panels of which the receiver consists of and , as a consequence , reductions in the thermal dilations of the materials from which the pipes are manufactured . however , as the recirculation percentage increases , not only is there an increase in the difference in temperatures between the entrance and the exit of the vertical tubes that the receiver is composed of , but the load losses in the system increase , so that greater impulsion power of the working fluid is required . furthermore , the temperature of the metal in the surface of the receiver is greater , resulting in greater thermal losses , mainly due to radiation . as a result , a suitable selection with regards to optimal recirculation for established design power will lead to optimal functioning of the receiver . the proposed configuration of the molten salt receiver ( system with recirculation ) minimizes the technological risks which are present in other receivers , in those which the thermal cycles which the material must bear are stronger and , as a result , have a greater impact on the material . this device must offer solutions to some of the problems detected that exist in molten salt receiver technology and provide advantages in its use , such as the reduction in the risk of damage to the structure and the material of the receiver ; and increase the efficiency of the thermodynamic cycle with respect to that currently obtained with saturated and / or overheated steam receivers , thanks to which greater working temperatures are reached . to complete the description that is being made and with the object of assisting in a better understanding of the characteristics of the invention , accompanying said description is a set of drawings wherein , by way of illustration and not restrictively , the following has been represented : fig1 . configuration of a molten salt receiver formed by a panel with a recirculation system . fig2 . configuration of a molten salt receiver formed by four panels with a recirculation system . fig3 . geometry of a molten salt receiver formed by four panels . a list is provided below with the references used in the figures : ( 3 ) entrance flow to the hot salt storage tank ( 5 ) entrance flow of cold salt to the mixer ( 11 ) panel 2 e ( east ) of the receiver ( 12 ) panel 1 e ( east ) of the receiver ( 13 ) panel 1 w ( west ) of the receiver ( 14 ) panel 2 w ( west ) of the receiver ( 15 ) control valve for the flow distribution of panel 2 e ( 16 ) control valve for the flow distribution of panel 1 e ( 17 ) control valve for the flow distribution of panel 1 w ( 18 ) control valve for the flow distribution of panel 2 w to achieve a better understanding of the invention , there is a description below of the system and operation of a central tower receiver system using molten salts . as observed in fig1 , the molten salt receiver ( 10 ) is formed by a panel composed of vertical pipes . the cold molten salt ( 5 ), originating from the tank in which it is stored ( 8 ), is carried to supply a mixture deposit ( 6 ) where , by way of a supply line , hot 10 molten salts ( 4 ) also arrive , so that the exit flow from the mixer ( 6 ) enters the upper part of the vertical pipes of which the receiver is composed ( 10 ). on the lower part of said pipes , the hot salt is collected ( 2 ). part of the exit flow ( 2 ) ( the quantity being defined for reasons of recirculation which are established ) recirculates ( 4 ) to the mixture deposit ( 6 ) and the rest ( 3 ) is carried to the hot salt storage tank ( 9 ). the heating of the mixture of cold and hot salts ( 1 ) entering the receiver ( 10 ) is produced as the fluid advances through the interior of the combination of vertical pipes in the panels , absorbing the incident solar radiation on the surface . shown in the configuration of the four panel receiver ( fig2 ) is the circulation circuit of the working fluid in parallel through the panels and the flow of recirculation ( 4 ) from the exit ( 2 ) to the entrance ( 1 ) of the receiver . each panel ( 11 , 12 , 13 and 14 ) is composed of a combination of vertical pipes . the circulation of the fluid inside the receiver is identical to that described for fig1 . as observed in fig3 , the molten salt receiver is formed by four panels ( 11 , 12 , 13 and 14 ) with a semi cylindrical disposition . this configuration manages to collect all the solar energy reflected by the heliostat field which is directed at the focus point ( 19 ). the heat transfer fluid used in a preferred embodiment is a mixture of molten nitrate salts ; a preferred composition would be formed by 60 % of nano 3 and 40 % of kno 3 . | 8 |
lymphocyte homing involves the physiological process of lymphocytes seeking out and localizing to specific tissues and micro - environments in an animal ( 39 ). generally , cell adhesion and binding to cell - surface receptors control how lymphocytes home to specific tissues or recirculate through blood or lymph . certain lymphocyte homing receptors , including cd62l , cd49d / β7 integrin , cd11a / cd18 , and their ligands ( glycam - 1 , madcam - 1 , icam - 1 , etc .) are expressed on the cell surface of high endothelial venules ( hev ), the small blood vessels of the lymph nodes . cd62l ( l - selectin ) ( 30 ) and cd49d / β7 integrin ( α 4 β 7 integrin ) ( 31 ) bind glycam - 1 ( 32 ) and madcam - 1 ( 33 ), respectively , and both are expressed on cell surface of hev in lymph nodes and peyer &# 39 ; s patches ( lymphoid tissues of the intestine ). the presence of these and other receptors and ligands on cells of an animal and on the lymphocytes forms the basis of the lymphocyte homing process . conducting the initial targeting of naive lymphocytes as well as the continuous distribution of other lymphocytes , the lymphocyte homing process plays a key role in immune system development and surveillance . physiological evidence indicates that most subsets of mature lymphocytes are in continuous recirculating motion through blood or lymph vessels and the tissues of an animal . in addition , some lymphocyte subsets show a strong tissue specificity . for example , memory and effector lymphocytes , in particular , home in on inflamed skin or intestinal lamina . clearly , the ability to affect lymphocyte homing can be directly tied to methods for suppressing the immune system . for example , a composition . that causes lymphocytes to home in the intestinal lamina will result in fewer lymphocytes available to react at another tissue within an animal . since it is the lymphocytes and immune cells that control the immune response , dictating lymphocyte activity effects the scope and strength of their response . furthermore , since directing lymphocytes to specific regions or tissues does not present detrimental physiological consequences , no toxic side effects to the immune cells would result by affecting lymphocyte homing , creating a safer immunosuppression therapy . while some research discusses methods for manipulating lymphocyte homing , for example with the use of cell surface receptors and genetic modification , chemical compounds that interact with the lymphocyte homing process have not been widely used or discussed . the identification of the important characteristics of the alh - immunosuppressive compositions and their uses , as described in this invention , opens a new avenue into immunosuppression treatments and therapies . furthermore , one skilled in the art will appreciate that the invention can be used in methods and assays to identify the molecular interactions of the intestinal immune system , the migration of the involved cells ( 43 ), and the importance of these processes to normal and disease states . in many cases , these compositions can be administered orally . the examples below detail the use of fty720 by oral administration . one skilled in the art is familiar with numerous methods and tests for determining the effectiveness of a selected route of administration . furthermore , pharmaceutically or physiologically acceptable carriers or excipients for use with the 2 - aminopropane - 1 , 3 - diol compounds or benzene compounds noted herein are known in the art or can be readily found by methods and tests known in the art . and , pharmaceutically and physiologically acceptable salts of these compounds can also be determined and used by one skilled in the art . in the examples that follow , fty720 , a 2 - aminopropane - 1 , 3 - diol compound , dose - dependently prevented acute rejection in allograft models . the combination treatment of fty720 with csa or trl showed a synergistic effect on prevention of acute rejections but did not enhance toxic side effects of the drugs csa or trl . unlike csa or trl , fty720 does not inhibit the expression of il - 2 mrna or the production of il - 2 in alloantigen stimulated t cells . fty720 remarkably decreased the number of circulating lymphocytes , especially t cells , in peripheral blood of rats , dogs and monkeys . furthermore , fty720 caused an atrophy in the t cell region of spleen in vivo . in addition , lymphocyte homing to lymph nodes and peyer &# 39 ; s patches was accelerated by fty720 . the fty720 activity sequesters immunologically competent t cells to high endothelial venules ( hev ) in lymph nodes and peyer &# 39 ; s patches . thus , fty720 possesses a unique mechanism of action , distinct from other immunosuppressants such as csa or trl . based on these results , administration of alh - immunosuppressive compositions prevents acute rejection without producing the side effects of individual drugs known in human organ transplantations . a number of other immunosuppressant compounds can also be combined with the 2 - aminopropane - 1 , 3 - diol compounds or benzene compounds to enhance immunosuppressive effects of the alh - immunosuppressive composition , including , but not limited to : steroid ( s ) ( prednisolone , methylprednisolone , dexamethasone , hydrocortisone and the like ) ( 13 - 14 ); nonsteroidal anti - inflammatory agent ( s ); azathioprine ( 13 ); mizoribine ( 14 ); brequinar sodium ; deoxyspergualin ; mycophenolate 2 - morphorinoethyl ; mycophenolate derivatives ; cyclosporin ; cyclosporin derivatives ; rapamycin ; tacrolimus monohydrate ; leflunomide ; okt - 3 ( 48 ); or various other immunosuppressive antibodies and compounds discussed herein or known in the art . methods such as those described in these examples , and examples 5 - 9 in particular , can be incorporated into assays for detecting the presence or absence of alh - immunosuppressive compounds . in this way , methods to screen numerous samples believed to contain alh - immunosuppressive activity can identify chemical or biological compounds with detectable levels of alh - immunosuppressive activity . for example , a sample can be administered to an animal , at various selected doses , and the animal &# 39 ; s lymphoid tissues and blood assayed for the number or amount of lymphocytes present . the use of prelabeled lymphocytes can also be incorporated into these methods . the sample believed to contain alh - immunosuppressive activity is first administered and then the prelabeled lymphocytes are transfused . certain patterns of prelabeled lymphocyte populations in lymphoid tissues , other tissues , or blood will indicate accelerated lymphocyte homing activity . fig1 represents typical results that may be obtained . in the example of fig1 , the use of male lymphocytes transfused into female recipients constitutes the use of prelabeled lymphocytes . the male , prelabeled lymphocytes are detectably different from the recipient animal &# 39 ; s lymphocytes , in this case , the label being at the genetic level . accordingly , prelabeled lymphocytes , as used in this invention , are not limited to a specific chemical or other label bound , associated with , or otherwise operably attached to a lymphocyte . [ 0075 ] fig1 indicates accelerated lymphocyte homing to peripheral lymph nodes , peyer &# 39 ; s patch , and mesenteric lymph nodes , evidenced by the increased numbers of cells present following administration of fty720 . spleen , however , shows a reduction in the number of pre - labeled lymphocytes when treated with fty720 . thus , fty720 possesses alh - immunosuppressive activity . in addition , the alh - immunosuppressive compositions may also be used in methods to reduce spleen lymphocyte levels . the description and examples below specifically employ the fty720 compound and combinations with csa and trl in the alh - immunosuppressive compositions . the inclusion of these examples should not be taken to limit the scope of the invention . many other compounds can be substituted for those exemplified , as discussed throughout this disclosure . one skilled in the art will appreciate that modifications to the compounds selected for use , the combinations of compounds used , and the dosages used , for example , can be made to arrive at physiologically acceptable alternatives within the scope of this invention . effect of fty720 on rat skin allograft survival in major histocompatibility complex ( mhc )- incompatible system a rat skin allograft survival assay employing mhc - incompatible rat strains as donor and acceptor has been described ( reference 21 , specifically incorporated herein by reference ). two mhc - incompatible rat strains were selected , wkah donor ( rt1 k ) and f344 recipients ( rt1 iv1 ). full - thickness skin grafts ( 2 . 0 × 2 . 0 cm square ) were transplanted to the lateral thorax of recipients and wrapped with sterile , bactericidal gauze . the chest was then wrapped with an elastic bandage . five days after transplantation , the wraps were removed and the grafts inspected daily for rejection . rejection was defined as more than 90 % necrosis of graft epithelium . all skin grafts in control ( vehicle - treated ) groups were rejected in 6 to 7 days after the transplantation . fty720 significantly prolonged graft survival at an oral dose of 0 . 1 mg / kg or more in a dose - dependent manner ( fig1 ). administration with fty720 at an oral dose of 10 mg / kg for 14 days resulted in a prolongation of graft survival with median survival time ( mst ) of 27 . 0 days without renal toxicity or other toxic signs . as shown in fig1 both csa and trl were also effective at oral doses of 3 mg / kg or more and 0 . 3 mg / kg or more , respectively , in this model . fourteen days repeated administration of csa at 100 mg / kg or trl at 10 mg / kg resulted in prolonging graft survival with mst of 26 . 0 days or 22 . 5 days , respectively . however , one of eight recipients died within the course of administration of csa at 100 mg / kg . these findings indicate that fty720 prolongs the skin allograft survival across a mhc barrier and is more potent than either csa or trl . in clinical organ transplantations , combination therapies of csa with prednisolone or other immunosuppressants are widely used to reduce the side effects of the individual drugs ( 13 - 14 ). to demonstrate that the use of fty720 in combinations with csa produces advantageously synergistic effects , experimental allograft models were used . one examined fty720 combined with csa at a dose of 3 or 10 mg / kg in the mhc - incompatible rat skin allograft model . comparing the effects of the therapy with either of fty720 or csa alone ( fig1 ), the combined administration of fty720 with csa at 3 mg / kg or 10 mg / kg brought a significant prolongation of skin allograft survival ( fig2 ). in combination with csa at 10 mg / kg , fty720 even at a dose of 0 . 1 mg / kg remarkably prolonged the allograft survival , with an mst of more than 70 days in five out of eight recipient rats ( fig2 ). the values of combination index , which were calculated by the method of kahan et al . ( 22 ), were less than 0 . 1 by combined administration of fty720 with csa , indicating a synergistic effect . the results of these initial combination therapy experiments show that fty720 acts synergistically with csa . a similar synergistic effect was obtained in combination therapies of fty720 and trl in this model ( fig2 ). in mhc - compatible rat strains of lew donor and f344 recipient ( 21 ), fty720 at 0 . 03 mg / kg or more also prolonged the survival of skin allograft significantly and showed a synergistic effect on prolonging allograft survival in combination with csa at 3 mg / kg ( data not shown ). effects of fty720 on heterotopic cardiac allograft survival in mhc - incompatible rat strain system the effect of fty720 on heterotopic cardiac allograft survival was compared with those of csa and trl by using wkah donor ( rti k ) and aci recipient ( rt1 av1 ) rats . this procedure is detailed in reference 23 , specifically incorporated herein by reference . hearts from donors were implanted in the cervical portion of recipients by the technique of miller et al . ( 40 ). the pulmonary artery of the donor heart was anastomosed to the right external jugular vein of the recipient in an end - to - side manner . the donor &# 39 ; s brachiocephalic artery was anastomosed to the left common carotid artery of the recipient in an end - to - end manner . the day of grafting was day o and cardiac arrest was defined as the last day of graft survival . a graft heart surviving over 100 days was considered an indefinite or long - term survivor . the results are illustrated in fig3 . all cardiac allografts in control ( vehicle - treated ) group were rejected within 14 days ( mst : 12 . 0 days ) after the transplantation . treatment with fty720 at an oral dose of 0 . 1 mg / kg or more significantly prolonged the cardiac allograft survival . the mst of fty720 administration with 0 . 1 , 0 . 3 , 1 , 3 and 10 mg / kg for 14 days were 20 . 0 , 21 . 0 , 25 . 5 , 29 . 5 and 58 . 5 days , respectively ( fig3 ). fty720 at 10 mg / kg induced a long - term or indefinite graft survival of more than 100 days in three out of eight recipient rats . csa ( at doses of 10 mg / kg or more ) and trl ( at doses of 1 mg / kg or more ) significantly prolonged the cardiac allograft survival compared to control . however , these drugs hardly induced long - term graft survival even at the highest dose tested ( fig3 ). these results show that fty720 is more potent than csa or trl in rat cardiac allograft and that this compound has the capability to induce indefinite graft acceptance in vascularized organ transplantations . the effect of fty720 in combination with csa was examined in this cardiac allograft model , using wkah donors and aci recipients . fty720 at an oral dose of 0 . 1 mg / kg or more significantly prolonged the allograft survival in combination with csa at 3 mg / kg as compared with the treatment of either fty720 or csa alone ( fig4 ). fty720 , when concomitantly administered with csa , produced indefinite graft survival in more than 50 % of recipients . fty720 at an oral dose of 1 mg / kg combined with trl at a dose of 1 mg / kg also showed a synergistic effect on graft survival in this model ( fig4 ). from these results , treatments of fty720 concomitantly administered with csa or trl synergistically prolongs the graft survival and induces indefinite allograft acceptance more frequently than fty720 alone . effect of fty720 on canine renal allograft survival in combination with csa in a canine renal allograft model , either azathioprine or mizoribine in combination with csa was reported to show a significant prolongation of the graft survival as compared with each drug alone ( 27 - 28 ). the effect of fty720 in combination with csa on renal allograft survival was investigated by using mongrel donors and beagle recipients in dogs ( 24 - 26 , specifically incorporated herein by reference ). kidneys from mongrel donor dogs were transplanted into beagle dogs in the right iliac fossa , and the recipient dogs were then nephrectomized bilaterally . levels of serum creatine and blood urea nitrogen were measured to monitor survival . graft rejection was defined as the day when either serum creatine levels increased to more than 10 . 0 mg / dl or blood urea nitrogen levels elevated to more than 200 mg / dl . as shown in fig5 in control ( vehicle - treated ) group , levels of serum creatinine irreversibly elevated within 10 days , and all animals died within 17 days due to renal dysfunction by acute rejection . the levels of serum creatinine also elevated within 14 days in 5 mg / kg fty720 or 10 mg / kg csa - treated group . in combinations of fty720 and csa , the serum creatinine levels in four out of five recipients were completely maintained at normal levels for at least 30 days after the transplantation ( fig5 ). the survival curves are illustrated in fig6 . mst in the control allograft group was 9 . 0 days . treatment of fty720 at 5 mg / kg or csa at 10 mg / kg resulted in slightly prolonging , not significantly , graft survival ( mst : fty720 - treated group : 12 . 0 days , csa - treated group : 11 . 0 days ). however , combination treatments of fty720 at 5 mg / kg with csa at 10 mg / kg resulted in significantly prolonging graft survival with mst of 74 . 0 days . fty720 at lower doses ( 0 . 1 to 3 mg / kg ) also prolonged renal allograft survival significantly in combination with csa at 10 mg / kg ( fig7 ), and there was no severe toxic signs in the kidney and liver functions . with the combination treatment of fty720 with csa , the blood concentration of creatine was unchanged . these results suggests that fty720 acts synergistically with csa . effect of fty720 on graft versus host reaction ( gvhr ) in rats spleen cells ( 2 . 5 × 10 6 cells ) from lew rats were injected subcutaneously into the footpad of ( lew × bn ) f1 ( rt1 i / n ) rats , inducing enlargement of draining and the weight of popliteal lymph node ( 29 ). weight increased to the maximum after 7 days . fty720 and csa , administered orally , significantly inhibited the enlargement in popliteal lymph node at doses of 0 . 1 mg / kg or more and of 3 mg / kg or more , respectively , in a dose - dependent manner ( fig8 ). thus , the immunosuppressive activity of fty720 was 30 - fold more potent than that of csa in local gvhr in rats . to examine the effect of fty720 in preventing the lethal gvhr , splenic lymphocytes from lew donor rats ( 1 × 10 8 spleen cells ) were injected intravenously into cyclophosphamide - pretreated ( lew × bn ) f 1 recipients . cyclophosphamide ( shionogi co . ltd ; osaka , japan ) was given at a 200 mg / kg dose . the results are shown in fig9 . in control ( vehicle - treated ) group , all rats developed severe gvhr - associated symptoms , including redness of skin and hair loss , within 15 days after the injection of lew spleen cells and died with mst of 22 . 0 days . csa at a dose of 10 mg / kg for 30 days significantly prolonged the survival of the recipient rats . however , cessation of csa administration caused the severe symptoms of gvhr and , subsequently , all of recipients died within 42 days ( mst : 40 . 0 days ). oral administration of fty720 at a dose of 0 . 1 mg / kg for 30 days prevented the development of gvhr - associated symptoms and prolonged the host survival significantly ( mst : 50 . 0 days ). treatment with fty720 at a dose of 0 . 3 mg / kg induced survival of more than 60 days in four out of five rats without the gvhr - associated symptoms . fty720 induced long - lasting unresponsiveness by treatment with low doses ( 0 . 1 to 0 . 3 mg / kg ) in the lethal gvhr model , indicating complete prevention of gvhr . effect of fty720 on il - 2 mrna expression in alloantigen - stimulated splenic t cells in rats csa and trl were reported to inhibit il - 2 production and il - 2 mrna expression in antigen or mitogen - stimulated helper t cells ( 9 , 11 ). the effect of fty720 on alloantigen - induced il - 2 mrna expression was examined as compared to those of csa and trl in allogeneic mixed lymphocyte cultures using splenic t cells of f344 rats as responder cells and mitomycin c - pretreated wkah rat spleen cells as stimulator cells ( 21 ). each of the compounds fty720 , csa , and trl were added to cultures ( f344 rat spleen cells at 5 × 10 6 cells / ml in rpmi 1640 medium containing and 10 % fetal calf serum ) to the indicated concentration . the housekeeping gene hprt was used as an internal control in order to compare levels of il - 2 mrna levels relative to the hprt mrna levels , as detailed below . allogeneic mixed lymphocyte culture was carried out by using nylon - nonadherent spleen cells of f344 rat ( rt1 1v1 ) as responder cells and the spleen cells of wkah rat ( rt1 k ) pretreated with 40 μg / ml of mitomycin c for 30 min as stimulator cells . in the presence of various concentrations of fty720 , csa , and fk506 , the responder cells ( 5 × 10 5 cells / well ) were cultured with an equal number of stimulator cells in 2 ml of rpmi 1640 medium containing 10 % fetal calf serum at 37 ° c . in 5 % co 2 . after culturing for 48 hours , the cells were recovered by centrifugation . the expression of il - 2 mrna in the cells was determined by a polymerase chain reaction ( pcr ) method . total rna was reverse transcribed in 60 ml of buffer solution containing 10 mmol / l tris - hcl ( ph 8 . 3 ), 50 mm kcl , 5 mm mgcl 2 , 1 mm each dntp ( datp , dgtp , dttp and dctp ), 60 u rnase inhibitor ( takara ltd . tokyo , japan ), 15 u avian myelobalastosis virus reverse transcriptase ( takara ltd .) and 150 pmol random 9 - mers at 30 ° c . for 10 min and 42 ° c . for 30 min . primer sequences for il - 2 and hypoxanthine - guanine phosphoribosyltransferase ( hprt ) were taken from the previous report ( 44 ). the length in base pairs of the pcr products of il - 2 and hprt are 351 and 608 bp respectively . a cdna equivalent of 100 ng total rna was amplified in a 25 ml volume containing 10 mm tris - hcl ( ph 8 . 3 ), 50 mm kcl , 2 mm mgcl 2 , 200 mm each dntp ( datp , dgtp , dttp and dctp ), 200 nm appropriate primer pair and 0 . 625 u taq dna polymerase ( takara ltd .). after an initial denaturation step , the cdna mixture was subjected to 30 ( il - 2 ), or 24 ( hprt ), amplification cycles , each cycle consisting of denaturation at 94 ° c . for 15 sec , annealing at 72 ° c . ( il - 2 ) or 65 ° c . ( hprt ) for 15 sec , and extension at 72 ° c . for 15 sec with an automatic thermocycler ( gene amp pcr system 9600 ®, perkin elmer cetus ). an aliquot ( 10 μl ) of the pcr product was electrophoresed on 2 % agarose gel , and amplified dna - fragments were stained with sybr green i ( molecular probes ). fluorescence intensity of the specific bands was visualized by fluorescence image analyzer ( fluor imager 575 ®, molecular dynamics ). csa at 10 nm or more and trl at 1 nm or more inhibited the il - 2 mrna expression down to levels approaching the unstimulated , control level . on the other hand , fty720 did not inhibit the il - 2 mrna expression even at the concentration of 1000 nm . ( fig1 ). in the same concentration range , fty720 did not inhibit the production of il - 2 by alloantigen - or concanavalin a - stimulated lymphocytes in rats ( 21 ). these results show that fty720 suppresses the immune response to alloantigen by a mechanism other than inhibiting il - 2 production from helper t cells . fty720 , in combination with csa or trl , shows a synergistic effect on allograft survival because of its distinct mechanism of action from csa or trl . numerous other methods for detecting the effect of alh - immunosuppressive compositions , or the presence of alh - immunosuppressive activity in a sample , exist . for example , measuring the expression of cytokines , such as il - 2 , using the polymerase chain reaction or rt - pcr to detect mrna levels is a straightforward and powerful method ( 41 - 42 ). the lymphocyte contents of peripheral blood and spleen in fty720 - treated intact or allografted rats were analyzed by two color flow cytometry using anti - rat cd3 and anti - rat cd45ra or a / b monoclonal antibodies ( 21 ). lymphocytes were stained with fitc - conjugated anti - cd3 ( clone : 1f4 , caltag laboratories , south san fransisco , calif .) ( 45 ) and phycoerythrin - conjugated anti - cd45ra or a / b ( clone : ox - 33 , pharmingen , la jolla , calif .) ( 46 ) monoclonal antibodies . the t cell and b cell contents were determined by two - color flow cytometry analysis using a flow cytometer ( epics - xl ; coulter co .). the numbers of cd3 - positive t cells and cd45ra or a / b - positive b cells in peripheral blood were dramatically decreased within 6 hours after the oral administration with fty720 at doses of 0 . 1 to 10 mg / kg ( fig1 ). in dogs and monkeys , as well as rats , oral administration with fty720 also decreases the number of circulating lymphocytes in peripheral blood . the reduction of the number of t cells was especially remarkable . withdrawal of fty720 treatment recovered the number of lymphocytes in peripheral blood to the normal level within 2 weeks . fig1 shows the cell numbers in various lymphoid tissues in rats orally administered fty720 at 1 mg / kg . fty720 also induced a decrease in the number of t cells and b cells in spleen , thoracic duct , as well as peripheral blood . on the contrary , the numbers of t cells and b cells in mesenteric and peripheral lymph nodes were significantly increased by administration with fty720 . fty720 did not effect the number of bone marrow cells , thymocytes , and polymorphonuclear cells ( data not shown ). the decrease in circulating lymphocytes by fty720 is due to the acceleration of lymphocyte homing to mesenteric and peripheral lymph nodes and peyer &# 39 ; s patches ( fig1 ). for this experiment , after 2 . 5 h of administering fty720 at 0 . 1 mg / kg or 1 mg / kg orally to female f344 rats , lymphocytes from male f344 rat were transfused intravenously into the rats . thirty minutes after the transfusion , the peripheral blood , spleen , mesenteric lymph nodes , axillary lymph nodes , peyer &# 39 ; s patches , liver , and lung were removed . pcr amplification of sry - 1 gene , which is y - chromosome specific , detected male lymphocytes in the tissue samples . the pcr primer sequences for sry amplification were taken from a previous report ( 47 ). after an initial denaturation step , the cdna mixture was subjected to 32 amplification cycles , each cycle consisting of denaturation at 94 ° c . for 1 min , annealing at 65 ° c . for 30 sec , and extension at 72 ° c . for 1 min , using an automatic thermocycler ( perkin elmer cetus , gene amp pcr system 9600 ). an aliquot ( 10 μl ) of the pcr products was electrophoresed on 2 . 5 % agarose gel and the amplified dna - fragments stained with sybr green i ( molecular probes ). the fluorescence intensity of the specific bands was visualized and measured by a fluorescence image analyzer ( fluor imager 575 , molecular dynamics ). the number of male cells in 10 6 female cells , calculated with a standard curve made from a control amplification of sry from a standard dna extracted from 10 6 female - lymphocytes , is indicated for each tissue noted in fig1 . the result show that fty720 exerts immunosuppressive activity by sequestering immunologically competent lymphocytes to lymph nodes and peyer &# 39 ; s patches . also , fty720 affects the adhesion of lymphocytes to hev . the adhesion of rat lymphocytes to rat high endothelial venule ( hev ) cells in vitro rat or mouse hev cells , such as ax cells , were plated into 96 well flat - bottomed microtest plates at a concentration of 1 × 10 4 cells / well , in 100 μl of rpmi 1640 medium containing 20 % fetal calf serum . the cells were cultured for 48 hours to confluency , at 37 ° c . in an atmosphere of 5 % co 2 and 95 % air . the lymphocytes prepared from mesenteric lymph nodes and axillary lymph nodes in 7 - week old f344 rats or c57bl / 6 mice were pre - labeled with calcein - am at 1 μmol / l on ice for 30 min . after the labeling with calcein - am , the lymphocytes were washed three times with ice - cold rpmi 1640 medium . thereafter , the lymphocytes at 10 6 cells / well were added to the 96 well microtest plates containing hev - monolayer in the presence or absence of fty720 at 1 to 1000 nmol / l . then , the mixture of the calcein pre - labeled lymphocytes and hev monolayer were cultured for 120 min at 37 ° c . in 5 % co 2 and 95 % air . after incubation , the plates were turned upside down and kept for 30 min to remove hev - nonadherent cells . calcein pre - labeled lymphocytes adhered to hev monolayer were lysed by adding distilled water containing 1 % nonidet p - 40 and the developed fluorescence was measured at 485 / 530 nm with fluorescence microplate reader ( cytofluor 2350 ). as shown in table 1 , fty720 at 1 nmol / l or more enhanced the adhesion of calcein - prelabeled lymphocytes to hev in vitro . each treatment dose of the alh - immunosuppressive composition resulted in increased lymphocytes adhering to hev cells . as shown in table 2 , the adhesion of rat lymphocytes to hev cells was increased by pretreatment of only hev cells for 3 hours with fty720 at 1 to 100 nmol / l . by contrast , rat lymphocytes pretreated with fty720 at 100 nmol / l for 3 hours did not show the acceleration of adhesion to hev cells . these results suggest that fty720 acts on hev cells in lymph nodes and peyer &# 39 ; s patches but not lymphocytes , unlike well - known immunosuppressants . effect of fty720 on the numbers of lymphocytes in peripheral blood , spleen , mesenteric lymph nodes , and peyer &# 39 ; s patches in vivo fty720 at 0 . 1 and 1 mg / kg were administered orally to 6 week - old male f344 rats . at 3 , 12 , 24 hours after administration , peripheral blood , spleen , mesenteric lymph nodes , and peyer &# 39 ; s patches were removed and the lymphocyte numbers of these tissues were measured by using a flow cytometer , as known in the art ( epics xl ). table 3 shows typical results at 24 hours after the administration . as shown in table 3 , lymphocyte numbers in peripheral blood and spleen decreased after administration of fty720 , in a dose - dependent manner . on the contrary , lymphocyte numbers in mesenteric lymph nodes and peyer &# 39 ; s patches increased significantly after the in vivo treatment with fty720 . these results show that the decrease in the number of lymphocytes in peripheral blood and spleen by fty720 is due to accelerated lymphocyte homing or migration to mesenteric lymph nodes , peripheral lymph nodes , or peyer &# 39 ; s patches . effect of fty720 on lymphocyte homing of calcein - prelabeled lymphocytes in various lymphoid tissues the lymphocytes prepared from mesenteric lymph nodes and axillary lymph nodes in 5 to 6 - week old f344 rats were pre - labeled with calcein - am ( molecular probes ) at 1 μmol / l on ice for 30 min . after the labeling with calcein - am , the lymphocytes were washed three times with ice - cold saline . thereafter , the calcein - prelabeled lymphocytes at 5 × 10 7 cells were transfused through the tail vein to sex and age - matched f344 rats . fty720 at 0 . 1 or 1 mg / kg was orally administered 2 . 5 hours before the transfusion . after 30 min . of the transfusion , mesenteric lymph nodes , axillary lymph nodes , peyer &# 39 ; s patches , and spleen were removed and the numbers of calcein prelabeled lymphocytes in these tissues were measured using flow cytometer ( epics - xl ). to examine the influence of antibodies against lymphocyte homing receptors , the calcein - prelabeled lymphocytes were treated with 60 μg / ml of either mouse anti - rat cd49d mab ( clone ta - 2 ) ( 49 ), hamster anti - rat cd62l mab ( clone hrl3 ) ( 50 ), mouse anti - rat cd11a mab ( clone wt . 1 ) ( 51 ), or control ig at 4 ° c . for 30 min . anti - rat lymphocyte - homing receptor mabs and control ig were purchased from seikagaku - kougyou ltd . or pharmingen , respectively . the results are shown in tables 4 to 7 . fty720 at an oral dose of 1 mg / kg induced lymphocyte homing of calcein - prelabeled lymphocytes to mesenteric lymph nodes and peyer &# 39 ; s patches . the treatment of anti - cd62l ( l - selectin ), anti - cd49d ( α4 - integrin ), or anti - cd11a ( αl - integrin ) antibody significantly inhibited the lymphocyte homing induced by fty720 . furthermore , fty720 - induced lymphocyte homing was almost completely inhibited by treatment with anti - cd62l antibody , anti - cd49d antibody , and anti - cd11a antibody concomitantly . these results indicate that fty720 enhances the lymphocyte homing of peripheral circulating lymphocytes to lymph nodes and peyer &# 39 ; s patches and that fty720 - induced lymphocyte homing is involved in the adhesion of lymphocyte homing receptors , including cd62l , cd49d / beta - 7 , and cd11a / cd18 ( lfa - 1 ), to their ligands ( glycam - 1 , madcam - 1 , icam - 1 , etc .) expressed on the cell surface of hev . [ 0106 ] table 5 fty720 - induced lymphocyte homing and effect of anti - cd49d antibody on fty720 - induced lymphocyte homing . lymphocyte homing ( number of calcein - prelabeled lymphocytes ) mean ± se , n = 4 mesenteric lymph nodes fty720 1 mg / kg + control igg 88350 ± 13029 fty720 1 mg / kg + anti - cd49d 34588 ± 3701 * antibody peyer &# 39 ; s patches fty720 1 mg / kg + control igg 26562 ± 4474 fty720 1 mg / kg + anti - cd49d 5894 ± 471 * antibody [ 0107 ] table 6 fty720 - induced lymphocyte homing and effect of anti - cd11a antibody on fty720 - induced lymphocyte homing . lymphocyte homing ( number of calcein - prelabeled lymphocytes ) mean ± se , n = 4 mesenteric lymph nodes fty720 1 mg / kg + control igg 86021 ± 12961 fty720 1 mg / kg + anti - cd11a 47116 ± 3608 * antibody peyer &# 39 ; s patches fty720 1 mg / kg + control igg 15534 ± 5371 fty720 1 mg / kg + anti - cd11a 5894 ± 1707 * antibody [ 0108 ] table 7 fty720 - induced lymphocyte homing and effect of anti - lymphocyte antibodies on fty720 - induced lymphocyte homing . lymphocyte homing mean ± se , n = 4 ( number of calcein - prelabeled lymphocytes ) mesenteric lymph nodes fty720 1 mg / kg + control igg 62644 ± 3175 fty720 1 mg / kg + anti - cd62l antibody + 2019 ± 236 ** anti - cd49d antibody + anti - cd11a antibody peyer &# 39 ; s patches fty720 1 mg / kg + control igg 32822 ± 4191 fty720 1 mg / kg + anti - cd62l antibody + 2181 ± 181 ** anti - cd49d antibody + anti - cd11a antibody ( number of calcein - prelabeled lymphocytes / 10000 cells ) mesenteric lymph nodes fty720 1 mg / kg + control igg 167 . 7 ± 12 . 5 fty720 1 mg / kg + anti - cd62l antibody + 15 . 5 ± 4 . 6 ** anti - cd49d antibody peyer &# 39 ; s patches fty720 1 mg / kg + control igg 115 . 3 ± 1 . 0 fty720 1 mg / kg + anti - cd62l antibody + 58 . 6 ± 4 . 7 ** anti - cd49d antibody one skilled in the art will appreciate that various methods and assays designed to identify the presence or absence of lymphocyte homing molecules , receptors , or ligands can also be modified by using the alh - immunosuppressive compositions of this invention . furthermore , various treatments to manipulate lymphocyte trafficking and to change or effect lymphocyte levels in tissues of an animal can be made from the description - herein . as this example shows , these methods and assays may comprise particular antibodies or binding agents that bind to lymphocyte homing receptors , ligands , or other molecules associated with the lymphocyte homing process . alternatively , they may involve molecules that interfere with the lymphocyte homing process . although the invention has been described and illustrated in detail , one skilled in the art clearly understands that the details are illustrative and exemplary . the details and description should not to be taken as a limitation of the scope of the invention . the spirit and scope of the invention should be limited only by the terms of the appended claims . furthermore , the description herein enables one skilled in the art to make and use the invention as claimed . the disclosure above refers to these references by number . each of the references is specifically incorporated herein by reference . in addition , one skilled in the art can rely on the contents of these references to make and use embodiments of this invention . 1 . cresswell p , ann . r . immunol . ( 1994 ) 12 : 259 . 2 . jackson m r , et al ., ann . r . cell biol . ( 1993 ) 9 : 207 . 3 . howard j c , curr . opin . immunol . ( 1995 ) 7 : 69 . 4 . kahan , b d , n . eng . j . med . ( 1989 ) 321 : 1725 . 5 . fung , j . et al ., transplant . proc . ( 1991 ) 23 : 2977 . 6 . borel , j . f ., feurer , c ., gubler , h . u ., and stahelin , h . the biological effects of cyclosporin a : a new antilymphocytic agent . agents and actions , 6 , 468 - 475 , 1976 . 7 . borel , j . f ., pharmacology of cyclosporine ( sandimmune ) iv . pharmacological properties in vivo . pharmacological rev ., 41 , 259 - 371 , 1989 . 8 . kino , t ., hatanaka , h ., hashimoto , m ., nishiyama , m ., goto , t ., okuhara , m . kohsaka , m ., aoki , h ., and imanaka , h . fk - 506 , a novel immunosuppressant isolated from a streptomyces i . fermentation , isolation , and physico - chemical and biological characteristics . j . antibiotics , 40 , 1249 - 1255 , 1987 . 9 . kino , t ., hatanaka , h ., miyata , s ., inamura , n ., nishiyama , m ., yajima , t ., goto , t ., okuhara , m ., kohsaka , m ., aoki , h ., and ochiai , t . fk - 506 , a novel immunosuppressant isolated from a streptomyces ii . immunosuppressive effect of fk - 506 in vitro . j . antibiotics , 40 , 1256 - 1265 , 1987 . 10 . inamura , n . nakahara , k ., kino , t ., goto , t ., aoki , h ., yamaguchi , i ., kohsaka , m ., and ochiai , t . prolongation of skin allograft survival in rats by a novel immunosuppressive agent , fk - 506 . transplantation , 45 , 206 - 209 , 1988 . 11 . liu , j ., farmer , jr ., j . d ., lane , w . s ., friedman , j ., weissman , i ., and schreiber , s . l . calcineurin is a common target of cyclophilin - cyclosporin a and fkbp - fk506 complexes . cell , 66 , 807 - 815 , 1991 . 12 . europian fk506 multicentre liver study group . randomised trial comparing tacrolimus ( fk506 ) and cyclosporin in prevention of liver allograft rejection . lancet . 344 , 423 - 428 , 1994 . 13 . slapak . m ., geoghegan , t ., digard , n ., ahmed , k ., sharman , v . l . and crockett , r . the use of low - dose cyclosporine in combination with azathioprine and steroids in renal transplantaion . transplant proc . 17 , 1222 - 1226 , 1985 . 14 . kokado , y ., ishibashi , m ., jiang , h ., takahara , s . and sonoda , t . low - dose ciclosporin mizoribine and prednisolone in renal transplantation : a new triple - drug therapy . clin . transplant , 4 , 191 - 197 , 1990 . 15 . fujita , t ., inoue , k ., yamamoto , s ., ikumoto , t ., sasaki , s ., toyama , r ., chiba , k ., hoshino , y ., and okumoto , t . fungal metabolites . part ii . a potent immunosuppressive activity found in isaria sinclairii metabolite . j . antibiotics , 47 , 208 - 215 , 1994 . 16 . sasaki , s ., hashimoto , r ., kiuchi , m ., inoue , k ., ikumoto , t ., hirose , r ., chiba , k ., hoshino , y ., okumoto , t ., and fujita , t . fungal metabolites . part 14 . novel potent immunosuppressants , mycestericins , produced by myceria sterilia . j . antibiotics , 47 , 420 - 433 , 1994 . 17 . fujita , t ., inoue , k ., yamamoto , s ., ikumoto , t ., sasaki , s ., toyama , r ., yoneta , m ., chiba , k ., hoshino , y ., and okumoto , t . fungal metabolites . part 12 . potent immunosuppressant , 14 - deoxomyriosin , ( 2s , 3r , 4r )-( e )- 2 - amino - 3 , 4 - dihydroxy - 2 - hydroxymethyleicos - 6 - enoic acid and structure - activity relationships of myriocin derivatives . j . antibiotics , 47 , 216 - 224 , 1994 . 18 . fujita , t ., yoneta , m ., hirose , r ., sasaki , s ., inoue , k ., kiuchi , m ., hirase , s ., adachi , k ., arita , m ., and k . chiba . simple compounds , 2 - alkyl - 2amino - 1 , 3 - propanediols have potent immunosuppressive activity . biomed . chem . lett ., 5 , 847 - 852 , 1995 . 19 . fujita , t ., hirose , r ., yoneta , m ., sasaki , s ., inoue , k ., kiuchi , m , hirase , s ., chiba , k ., sakamoto , h ., and arita , m . potent immunosuppressants , 2 - alkyl - 2 - aminopropane - 1 , 3 - diols . j . med . chem ., 39 , 4451 - 4459 , 1996 . 20 . adachi , k ., kohara , t ., nakao , n ., arita , m ., chiba , k ., mishina , t ., sasaki , s ., and fujita , t . design , synthesis , and structure activity relationships of 2 - substituted - 2 - amino - 1 , 3 - propanediols : discovery of a novel immunosuppressant , fty720 . biomed . chem . lett ., 5 , 853 - 856 , 1995 . 21 . chiba , k ., hoshino , y ., suzuki , c ., masubuchi , y ., yanagawa , y ., ohtsuki , m ., sasaki , s ., and fujita , t . fty720 , a novel immunosuppressant possessing unique mechanisms . i . prolongation of skin allograft survival and synergistic effect in combination with cyclosporine in rat . transplant . proc ., 28 ; 1056 - 1059 , 1996 . 22 . kahan , b . d ., tejpal , n ., stubbers , s . g ., tu , y ., wang , m ., stepkowski , s . and chou , t . c . the synergistic interactions in vitro and in vivo of brequinar sodium with cyclosporine or rapamycin alone and in triple combination . transplantation , 55 , 894 - 900 , 1993 . 23 . hoshino , y ., suzuki , c ., masubuchi , m ., amano , y ., and chiba , k . fty720 , a novel immunosuppressant possessing unique mechanisms . 11 . long - term graft survival induction in rat heterotopic cardiac allograft and synergistic effect in combination with cyclosporine a . transplant . proc ., 28 , 1060 - 1061 , 1996 . 24 . kawaguchi , t ., hoshino , y ., rahman , f ., amano , y ., higashi , h ., kataoka , h ., ohtsuki , m ., teshima , k ., chiba , k ., kakefuda , t ., and suzuki , s . fty720 , a novel immunosuppressant possessing unique mechanisms . 111 . synergistic prolongation of canine renal allograft survival in combination with cyclosporine a . transplant . proc ., 28 , 1062 - 1063 , 1996 . 25 . suzuki , s ., enosawa , s ., kakefuda , t ., shinomiya , t ., amari , m ., naoe , s ., hoshino , y ., and chiba . k . a novel immunosuppressant , fty720 , having an unique mechanism of action induces long - term graft acceptance in rat and dog allotransplantation . transplantation , 61 , 200 - 205 , 1996 . 26 . suzuki , s ., enosawa , s ., kakefuda , t ., amamiya , h ., hoshino , y ., and chiba , k . long - term graft acceptance in allografted rats and dogs by treatment with a novel immunosuppressant , fty720 . transplant proc ., 28 , 1375 - 1376 , 1996 . 27 . davies , hff . s ., collier , d . st . j ., thiru , s ., decurtins , m . and caine , r . y . long - term survival of kidney allografts in dogs after withdrawal of immunosuppression with ciclosporin and azathioprine . eur . surg . res ., 21 , 65 - 75 , 1989 . 28 . amemiya , h ., suzuki , s ., niiya , s ., watanabe , h ., and kotake , t ., synergistic effect of cyclosporine and mizoribine on survival of dog renal allografts . transplantation , 46 , 768 - 771 , 1988 . 29 . masubuchi , y ., kawaguchi , t ., ohtsuki , m ., suzuki , c ., amano , y ., hoshino , y ., and chiba , k . fty720 , a novel immunosuppressant possessing unique mechanisms . iv . prevention of graft versus host reactions in rats . transplant . proc ., 28 , 1064 - 1065 , 1996 . 30 . arbones , m . l ., ord , d . c ., ley , k ., ratech , h ., curry , c . m ., otten , g ., capon , d . j ., and tedder , t . f . lymphocyte homing and leukocyte rolling and migration are impaired in l - slectin - deficient mice . immunity , 1 , 247 - 260 , 1994 . 31 . hamann , a ., andrew , d . p ., westrich , d . j . holzmann , b ., and butcher , e . c . role of c4 - integrins in lymphocyte homing to mucosal tissue in vivo . j . immunol ., 152 , 3282 - 3293 , 1994 . 32 . imai y ., lasky , l . a . and rosen , s . d . sulphation requirement for glycam - 1 , an endothelial ligand for l - selectin . nature , 361 , 555 - 557 , 1993 . 33 . berlin , c ., berg , e . l ., briskin , m . j ., andrew , d . p ., kilshaw , p . j ., holzmann , b ., weissman , i . l ., hamann , a ., and butcher , e . c . α 4 β 7 integrin mediates lymphocyte binding to the mucosal vascular addressin madcam - 1 . cell , 74 , 185 - 195 , 1993 . 35 . schwartz , r s et al ., nature ( 1959 ) 183 : 1682 . 36 . turka , l a et al ., j . clin . invest . ( 1991 ) 87 : 940 . 37 . lee , w a et al ., pharm . res . ( 1990 ) 7 : 161 . 38 . cramer , d v et al ., transplantation ( 1992 ) 53 : 303 . 39 . picker , lj et al ., physiological and molecular mechanisms of lymphocyte homing . ann . rev . immunol . ( 1992 ) 10 ; 561 . 41 . dallman m j , et al ., immunol . rev . ( 1991 ) 119 : 163 . 42 . dallman m j , et al ., ( 1991 ) j . exp . med . 174 : 493 . 43 . wang , j et al ., science ( 1997 ) 275 : 1937 ; shanahan , f , science ( 1997 ) 275 : 1897 . 44 . a . siegling , m . lehmann , c . platzer , f . emmrich , and h . - d . volk . a novel multiple competitor fragment for quantitative pcr analysis of cytokine gene expression in rats . j . immunol . methods ( 1994 ) 177 : 23 - 28 . 45 . t . tanaka , t . masuko , h . yagita , t . tamura , and y . hashimoto , characterization of a cd3 - like rat t cell surface antigen recognized by a monoclonal antibody . j . immunol . ( 1989 ) 142 : 2791 - 2795 . 46 . g . r . woollett , a . n . barclay , m . puklavec and a . f . williams , molecular and antigenic heterogeneity of the rat leukocyte - common antigen from thymocytes and t and b lymphocytes . eur . j . immunol ( 1985 ) 15 : 168 - 173 . 47 . y . masaki , a . hirasawa , s . okuyama , g . tsujimoto , m . iwaya , x - k . li , y . yokoi , s . nakamura , s . baba , miyamoto , m . hara , k shibata . y koga , h . amemiya , and h . kimura , microchimerism and heart allograft acceptance . transplant . proc . ( 1995 ) 27 : 148 . 48 . c . legendre , h . kreis , j . f . bach , and l . chatenoud , prediction of successful allograft rejection retreatment with okt3 . transplantation ( 1992 ) 53 : 94 - 94 ; other immunosuppressive and / or anti - lymphocyte antibodies are known in the art , for example , mcevoy , l . m ., sun , h ., frelinger , f . g ., and butcher , e . c ., anti - cd43 anhibition of t cell homing . j . exper . med . ( 1997 ) 185 : 1493 - 1498 . 49 . t . tamatani , f . kitamura , k . kuida , m . shirao , m . mochizuki , m . suematsu , g . w . schmid - schonbein , k . watanabe , s . tsurufuzi and m . miyasaka , characterization of rat lecam - 1 ( l - selectin ) by the use of monoclonal antibodies and evidence for the presence of soluble lecam - 1 in rat sera . eur . j . immunol . 23 , 2181 - 2188 ( 1993 ). 50 . t . b . issekatz , inhibition of in vivo lymphocyte migration to inflammation and homing to lymphoid tissues by ta - 2 monoclonal antibody , j immunol ., 147 , 4178 - 4184 ( 1991 ). 51 . t . tamatani , m . kotani , and miyasaka , m ., characterization of the rat leukocyte integrin , cd1 1 / cd18 , by the use of lfa - 1 subunit - specific monoclonal antibodies . eur . j immunol . 21 , 627 - 633 ( 1991 ). | 8 |
the embodiments of the present invention will now be described with reference to the drawings . fig1 is a block diagram of a semiconductor memory device ( feram ) according to a first embodiment of the present invention . the semiconductor memory device according to the first embodiment comprises a memory cell array 1 , a sense amp circuit 2 , a plate line drive circuit 3 , a bit line connection circuit 4 , and a reference potential control circuit 5 . the sense amp circuit 2 , the plate line drive circuit 3 , the bit line connection circuit 4 and the reference potential control circuit 5 have functions of controlling the potentials on signal lines connected to the memory cell array 1 at “ high ” and “ low ”. the memory cell array 1 comprises a memory cell mc including a ferroelectric capacitor c and a transistor tr . in the memory cell mc the ferroelectric capacitor c and the transistor tr are connected in parallel . in the shown example , such eight memory cells mc are connected in series to configure a cell block mcb . namely , each cell block mcb configures a tc parallel unit serial connection type ferroelectric memory . in the figure , the memory cell array 1 includes a pair of bit lines bl , / bl and shows cell blocks mcb , / mcb connected to the bit lines bl , / bl . the pair of bit lines bl , / bl are connected at one end to the sense amp circuit 2 . the cell block mcb has one end , which is a node n 1 connected via block selection transistors bst , / bst to the bit line bl at a node n 3 , and the other end , which is a node n 2 connected to plate lines pl , / pl . the plate lines pl , / pl are connected to the plate line drive circuit 3 . in connection with the bit line bl between the node n 3 and the sense amp circuit 2 , a bit line connection transistor bct ( decoupling transistor ) is provided . similarly , in connection with the bit line / bl , a bit line connection transistor / bct ( decoupling transistor ) is provided apart an almost equidistance from the sense amp circuit 2 as the bit line connection transistor bct . the bit line connection transistors bct , / bct have respective gates , which are connected to a bit line connection line sl . the bit line connection line sl is connected to the bit line connection circuit 4 . the bit line connection circuit 4 brings the bit line connection transistors bct , / bct into conduction and out of conduction via the bit line connection line sl . dummy capacitors ca , / ca are connected at one end to portions between the bit line connection transistors bct , / bct and the sense amp circuit 2 . the dummy capacitors ca , / ca are connected at the other end to the reference potential control circuit 5 via dummy plate lines dpl , / dpl . the reference potential control circuit 5 provides potentials to the dummy capacitors ca , / ca via the dummy plate lines dpl , / dpl . with reference to fig1 and 2 , the following description is given to reading a signal potential on a memory cell mc 5 in the semiconductor memory device according to the first embodiment . fig2 is an operating waveform diagram on reading from a memory cell in the semiconductor memory device according to the first embodiment . fig2 shows the potentials on the word line wl 5 , the plate line pl , the bit lines bl , / bl , the bit line connection line sl , and the dummy plate lines dpl , / dpl . the bit lines bl , bbl for use in the following description includes portions of which names are herein defined . namely , a portion of the bit line bl from the bit line connection transistor bct to the sense amp circuit 2 is defined as a partial bit line blsa . a portion of the bit line / bl from the bit line connection transistor / bct to the sense amp circuit 2 is defined as a partial bit line / blsa . as shown in fig2 , in the state before the beginning of reading , only the potential on the bit line connection line sl is kept at “ high ” and the potentials on the other signal lines ( wl 5 , pl , bl , / bl , / dpl , dpl ) are controlled “ low ”. in a word , the bit line connection transistors bct , / bct are kept “ on ”. first , in reading the signal potential on the memory cell mc 5 , the signal on the word line wl 5 is boosted to “ high ” ( time t 11 ). then , the plate line drive circuit 3 boosts the potential on the plate line pl connected to the word line wl 5 up to “ high ” ( time t 12 ). as a result , the bit line bl moves to a potential corresponding to the data retained in the memory cell mc 5 . also at time t 12 , the reference potential control circuit 5 holds the potential on the dummy plate line / dpl at “ low ”. subsequently , the bit line connection circuit 4 changes the potential on the bit line connection line sl to “ low ” ( time t 13 ) to turn “ off ” the bit line connection transistors bct , / bct . next , the reference potential control circuit 5 boosts the potential on the dummy plate line / dpl up to “ high ” ( time t 14 ). the operation of the reference potential control circuit 5 at time t 14 sets a reference potential on the partial bit line / blsa . the sense amp circuit 2 compares the reference potential with the read potential caused on the partial bit line blsa and generates and provides an output signal of “ high ” or “ low ”. as described above , in the semiconductor memory device according to the first embodiment , the bit line connection transistors bct , / bct can be brought out of conduction ( turned “ off ”). in this case , the partial bit lines blsa , / blsa shorter in wiring length than the bit lines bl , / bl can be connected to the sense amp circuit 2 . therefore , the sense amp circuit 2 is cut from the capacities of the memory cells mc and connected only to the smaller - capacity partial bit lines blsa , / blsa . in a word , the capacities of the dummy capacitors ca , / ca may be designed smaller than the dummy capacitors contained in the semiconductor memory device of prior art , thereby making the area occupied by the dummy capacitors ca , / ca smaller than the conventional art . referring next to fig3 , a semiconductor memory device according to a second embodiment of the present invention is described . fig3 is a block diagram of the semiconductor memory device ( feram ) according to the second embodiment of the present invention . in the second embodiment the same elements as those in the first embodiment are denoted with the same reference numerals and omitted from the following description . the above - described semiconductor memory device according to the first embodiment reduces the area occupied by the dummy capacitors ca , / ca . on the other hand , the capacities of the bit lines bl , / bl are small ( because they are only the partial bit lines blsa , / blsa ) and accordingly α rays may cause failed program possibly . the semiconductor memory device according to the second embodiment eliminates such the problem about the first embodiment . the semiconductor memory device according to the second embodiment comprises a dummy word line drive circuit 6 in addition to the configuration in the first embodiment . further formed between the dummy capacitors ca , / ca and the bit lines bl , / bl are dummy capacitor selection transistors dst , / dst . these dummy capacitor selection transistors dst , / dst have respective gates , which are connected via dummy word lines dwl , / dwl to the dummy word line drive circuit 6 . the dummy word line drive circuit 6 controls the signal potentials on the dummy word lines dwl , / dwl at “ high ” and “ low ”. in a word , the dummy word line drive circuit 6 brings the dummy capacitor selection transistors dst , / dst into conduction or out of conduction via the dummy word lines dwl , / dwl . with reference to fig3 - 5 , the following description is given to reading a signal potential on the memory cell mc 5 in the semiconductor memory device according to the second embodiment . reading the signal potential on the memory cell mc 5 in the semiconductor memory device according to the second embodiment has two modes . the first mode is a normal mode in which the reference potential can be fluctuated within a small range . the second mode is a test mode in which the reference potential can be fluctuated within a large range . fig4 is an operating waveform diagram in the normal mode on reading from the memory cell mc 5 in the semiconductor memory device according to the second embodiment . fig5 is an operating waveform diagram in the test mode on reading from the memory cell mc 5 in the semiconductor memory device according to the second embodiment . referring to fig3 and 4 , the normal mode reading is described first . in the normal mode reading , the bit line connection circuit 4 keeps the signal potential on the bit line connection line sl at “ high ” during the operation . in a word , the bit line connection transistors bct , / bct are kept “ on ”. although not shown , the block selection transistors bst , / bst are kept “ on ”. first , at time t 21 , the signal potential on the word line wl 5 is boosted up to “ high ”. subsequently , at time t 22 , the plate line drive circuit 3 boosts the potential on the plate line pl to “ high ”. similarly , at time t 22 , the dummy word line drive circuit 6 boosts the potential on the dummy word line / dwl to “ high ”, and the reference potential control circuit 5 boosts the potential on the dummy plate line / dpl up to “ high ”. the sense amp circuit 2 compares the reference potential with the read potential caused on the partial bit line blsa and generates and provides an output signal of “ high ” or “ low ”. referring to fig3 and 5 , the test mode reading is described next . as shown in fig5 , in the state before the beginning of reading , only the potential on the bit line connection line sl is kept at “ high ” and the potentials on the other signal lines ( wl 5 , pl , bl , / bl , / dpl , dpl ) are controlled “ low ”. in a word , the bit line connection transistors bct , / bct are kept “ on ”. first , in reading the signal potential on the memory cell mc 5 , the signal on the word line wl 5 is boosted to “ high ” ( time t 31 ). then , the plate line drive circuit 3 boosts the potential on the plate line pl connected to the word line wl 5 up to “ high ” ( time t 32 ). simultaneously , at time t 32 , the dummy word line drive circuit 6 boosts the potentials on the dummy word lines dwl , / dwl up to “ high ”. these operations at time t 32 cause a potential corresponding to the data retained in the memory cell mc 5 on the bit line bl . also at time t 32 , the reference potential control circuit 5 holds the potential on the dummy plate line / dpl at “ low ”. through the above operations , the signal potential on the memory cell mc 5 can be read out . subsequently , the bit line connection circuit 4 changes the potential on the bit line connection line sl to “ low ” ( time t 33 ) to turn “ off ” the bit line connection transistors bct , / bct . next , the reference potential control circuit 5 boosts the potential on the dummy plate line / dpl up to “ high ” ( time t 34 ). the operation of the reference potential control circuit 5 at time t 34 sets a reference potential based on the partial bit line / blsa . the sense amp circuit 2 compares the reference potential with the read potential generated on the partial bit line blsa and generates and provides an output signal of “ high ” or “ low ”. it is assumed herein that a “ 0 ” signal quantity distribution and a “ 1 ” signal quantity distribution are present on the opposite sides of a gap g of a certain potential difference in the semiconductor memory device according to the second embodiment as shown in fig6 . in this case , desirably , the reference potential for deciding whether the read potential is “ low ” or “ high ” locates in the gap g . if the “ 0 ” signal quantity distribution and the “ 1 ” signal quantity distribution are unknown , it is required to vary the reference potential from the low potential side of the “ 0 ” signal quantity distribution to the high potential side of the “ 1 ” signal quantity distribution to measure the “ 0 ” signal quantity distribution and the “ 1 ” signal quantity distribution based on the output from the sense amp circuit 2 . in the second embodiment , reading is executed also in the test mode . in the test mode reading , the partial bit lines blsa , / blsa electrically disconnected from the mass storage memory cells mc allow the reference potential to fluctuate over a wide range from a lower potential than the “ 0 ” signal quantity distribution to a higher potential than the “ 1 ” signal quantity distribution ( see fig6 ). in a word , in the second embodiment of the present invention , the test mode reading fluctuates the reference potential wider to measure the “ 0 ” signal quantity distribution and the “ 1 ” signal quantity distribution . in this regard , the second embodiment is similar to the first embodiment . further , in the second embodiment , the partial bit lines blsa , / blsa are not disconnected in the normal mode reading . in this case , the reference potential settable range is made smaller than that in the test mode as shown in fig6 ( such as a potential range from the skirt on the low energy side of the “ 0 ” signal quantity distribution to the skirt on the low energy side of the “ 1 ” signal quantity distribution ). the bit lines bl , / bl are not disconnected from the partial bit lines blsa , / blsa and have large parasitic capacities . accordingly , it is possible to prevent failed program caused by α rays from occurring . therefore , in the second embodiment , after determination of the reference potential in the test mode , signal reading in the normal mode can be executed while suppressing failed program caused by α rays . with the above configuration , the semiconductor memory device according to the second embodiment can exert the same effect as in the first embodiment . the dummy capacitor selection transistors dst , / dst enable the dummy capacitors ca , / ca to be selectively connected to or disconnected from the bit lines bl , / bl . accordingly , in accordance with the parasitic capacities on the bit lines bl , / bl in the normal mode , it is possible to eliminate the imbalance between the capacities better than the first embodiment . referring next to fig7 , a semiconductor memory device according to a third embodiment of the present invention is described . fig7 is a block diagram of the semiconductor memory device ( feram ) according to the third embodiment of the present invention . in the third embodiment the same elements as those in the second embodiment are denoted with the same reference numerals and omitted from the following description . in the semiconductor memory device according to the third embodiment , the reference potential control circuit 5 is connected to one end of the dummy capacitor ca ′ via an inverter i . the inverter i is provided in connection with one end of the dummy capacitor ca ′ on the side not connected to the bit lines bl , / bl . the other end of the dummy capacitor ca ′ is connected to the dummy plate lines dpl , / dpl . the dummy plate lines dpl , / dpl are connected to the bit lines bl , / bl via the dummy capacitor selection transistors dst , / dst . the gates of the dummy capacitor selection transistors dst , / dst are connected to the dummy word line drive circuit 6 via the dummy word lines dwl , / dwl like in the second embodiment . the operation of the semiconductor memory device according to the third embodiment is similar to the second embodiment and accordingly omitted from the following description . the semiconductor memory device according to the third embodiment thus configured can exert the same effect as in the first and second embodiments . it is structured with only a single dummy capacitor ca ′ and accordingly the area occupied by the entire semiconductor memory device ( entire chip ) can be designed narrower than the first and second embodiments . the semiconductor memory device according to the third embodiment can exert the effect if the imbalance between the capacities on the bit lines bl , / bl is small . the first through third embodiments of the present invention have been described above though the invention is not limited to the above embodiments . for example , in the above embodiments , the bit line bl is used for the read potential and the bit line / bl for the reference potential in the described example though the bit line bl may be used for the reference potential and the bit line / bl for the read potential . | 6 |
referring now in detail to embodiments of the present invention , examples of which are illustrated in the accompanying drawings , each example is provided by way of explanation of the invention , not as a limitation of the invention . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention . for instance , features illustrated or described as part of one embodiment can be used on another embodiment to yield a still further embodiment . thus , it is intended that the present invention cover such modifications and variations that come within the scope of the invention . in preferred embodiments , the invention uses various methods to collect data about the actual purchases of individuals , households , and / or businesses (“ prospects ”); uses statistical modeling techniques to create segments or clusters based on the actual purchases , provides the information on how , or the actual means , to reach these prospects when the actual prospects are known to the user of the invention ( e . g . customers of the user , or names and addresses acquired through third parties ); and uses actual purchases of others to enhance methodologies that provide predictions of segment / cluster membership or specific behavior (“ index values ” and / or scores ) for prospects for whom actual purchase information is not available . in preferred embodiments , the invention can use similar data collection and segmentation methods , and then provides information and insights on how actual purchases of customers of a specific client ( e . g . a retailer or product / service provider ) compare to purchases by those same customers at competitors or at non - competitors , how the behavior of that client &# 39 ; s customers may or may not differ from the behavior of non - customers , and / or how the customers themselves may differ . methods of data acquisition include those methods through which data is acquired directly by the user , and those which collect data from others who possess it . among the former are : issuance of payment devices ( e . g . credit and debit cards , rfid devices , etc . ), where purchase data can be a byproduct of facilitating the purchase transaction ; issuance of a “ benefit credential ” ( e . g . a loyalty program or “ frequent shopper ” identifier ), where , again , data collection is a byproduct of facilitating other customer benefits ; or by collecting information directly from the actual customers themselves through various means ( e . g . warranty cards , rebate forms requiring proof of purchase , scanning of barcodes received in the house , premiums and prizes requiring proof of purchase or collection of multiple proofs , etc .). among the latter are collection of customer and / or purchase information directly or indirectly from other issuers of payment devices or benefit credentials , collection of customer and / or purchase information directly or indirectly from one or more merchants , and collection of customer and / or purchase information from other third party sources who use various means to obtain that information . in embodiments of the present invention , for each retailer or product / service provider who is interested in obtaining better information , or for categories of retailers or products / services , statistical modeling and / or clustering methods are used to create segments or clusters of relatively more likely and relatively less likely purchasers , with varying degrees in between . key statistical drivers of the segments or clusters will be actual purchases at the specific retailer or of the product / service providers &# 39 ; products , and similar purchases in related stores or categories . other factors which appear to drive the actual purchases will also be used to create further differentiation among , and maximum homogeneity within , segments or clusters , including purchases at other stores or categories , methods of purchase , and geodemographic and psychographic / lifestyle factors ( e . g ., a heavy shopper in the category who does not live near any outlets of a retailer should be significantly less likely to shop at that retailer , even though actual purchases in the category would , on their own , indicate otherwise ). the segments or clusters , which may be expressed as names , ordinal numbers , indices , or statistically - based scores , can then be used by retailers or product / service providers in various ways , including , in embodiments of the present invention : by choosing mass media more likely to reach individuals / households in the highest - potential segments or clusters , by observing and understanding differences in their own customers &# 39 ; behaviors and competitive customers &# 39 ; behaviors from segment or cluster to segment or cluster and adjusting offers , products , product mixes / merchandising , store formats and locations , and other means of doing business and attracting and serving customers accordingly . in embodiments of the present invention , the user or its retailer and product / service provider clients may also combine the information created from segments or clusters with its own and other data to market to known individuals / households in the highest potential segments or clusters , and to identify other individuals likely to be in the highest potential segments or clusters , but for whom specific purchase information is not known to the user . this can be performed through the techniques of indexing and / or scoring . embodiments of this invention include indexing to specific individual factors or sets of factors ( e . g . customers in a specific high potential segment or cluster have an index of 250 for home ownership , that is , they are 2 . 5 times as likely to own a home than average . this could indicate that targeting homeowners would be an efficient means of reaching unknown potential customers ), or indexing to existing clustering methodologies using other , non - purchase - driven clustering techniques ( e . g . customers in a specific high potential segment or cluster have an index of 600 in another clustering methodology &# 39 ; s “ cluster twelve ”). the advantage to marketers of indexing to other factors or clusters is that , for certain means of marketing , the relationship of the marketing channel to the other factors or clusters is already established and known . for example , there are not , at present , indices of television viewers by show for the segments or clusters created in the embodiments of the invention described here , nor , as many of the segments or clusters created will be custom for particular clients , are there likely to be . however , indices of television viewers by show are widely available for many specific geodemographic and psychographic / lifestyle variables , and for at least two clustering methodologies provided by commercial companies ( personicx ® and prizm ®). by providing an index or similar overlay measure to existing factors or clusters , then , marketers can use these known factors and clusters to select media . using the numbers in the example above , marketers would seek to advertise on television shows disproportionately appealing to homeowners ( for example , home improvement shows ), or to those in the other clustering methodology &# 39 ; s cluster twelve . in embodiments of this invention related to understanding customers of competitors or non - competitors versus their own customers , retailers and product / service providers can use segments or clusters in several ways . when segments or clusters are created for an overall category , retailers and product / service providers can compare the relative presence of their and others &# 39 ; customers in each segment or cluster , and use the characteristics of the segment or cluster to generate insights about the nature of their own and competitors &# 39 ; or non - competitors &# 39 ; clients . when segments or clusters are created separately for the customers of the retailer or product / service provider and for customers of the competitors or non - competitors , the characteristics of overlapping and non - overlapping segments or clusters can be identified and compared . in either case , as with all of the above , the ability of the segmentation or clustering in embodiments of the present invention to be based on actual purchase behavior or actual purchase transactions provides a significant advantage in improving the results of marketing and research efforts , leading to increased efficiency in marketing , sales , and other business functions . fig1 is a schematic diagram that illustrates an example of key components and relationships between key components of the process of purchased - based segmentation of potential customers utilizing data regarding actual , observed purchases and statistical modeling and clustering techniques for embodiments of the invention . referring to fig1 , there is a large data warehouse ( 10 ) of purchases . using those purchases , if , for example , there is an interest in looking for customers who had a high likelihood of eating at casual dining restaurants , clusters of purchasers who show casual dining restaurants behavior can be developed . some of those clusters might be , as examples , customers who go to casual dining restaurants during the week but not on weekends ; customers who go on weekends but not during the week ; customers who go very frequently ; people who go infrequently ; non - customers ( those who never go ); customers who go to casual dining restaurants and also to white - tablecloth restaurants ; customers who go to casual dining restaurants and quick service restaurants but not to white - tablecloth ; and so on . the characteristics of both restaurant purchase behavior and non - restaurant purchase behavior that creates the greater differentiation among segments for various types of purchasing behavior ( restaurants 12 , car rentals 14 , department stores 16 , clothing , etc .) are identified . it should be understood that the differentiating behaviors could be within or outside the category . several things can be done with the segments or clusters . marketing to the people in those specific segments or clusters can be facilitated and customized either by a particular restaurant , by a category , or more broadly . marketing to the customer base can therefore be facilitated . in the present embodiment , the customer base refers to the base of people for whom there is knowledge . additionally , “ birds of a feather ” can be determined , that is , potential customers who appear to be just like the customers in the desired segments or clusters but are not exhibiting the behaviors . these may be potential customers who are in the customer base but who make their purchases via methods which cannot be observed in the data , or may be potential customers who are not in the customer base . furthermore , the segments or clusters that are developed can be compared to existing known segmentation or clustering schemes and incidences of high overlap may be determined in particular to other segmentation or clustering schemes . in the embodiment shown in fig1 , in the restaurant cluster 12 and personicx cluster “ one ” ( 18 ), the person in restaurant cluster “ eight ” ( 20 ) is 3 . 3 times as likely to occur in personicx cluster “ one ” ( 18 ) and only about 60 percent as likely to occur in personicx cluster “ six ” ( 22 ). the advantage of knowing that is that certain clustering schemes have already been mapped to external sources . for example , for almost every magazine , the readership has already been indexed to personicx clusters . therefore , media buyers already know in which magazines to advertise to reach prospects in the desired personicx clusters . further , in reference to restaurant cluster “ eight ” ( 20 ), indexing can be done directly between all the media and this cluster , or instead , as illustrated , the restaurant cluster determined in the illustrated embodiment can be mapped over to other existing customer schemes , e . g ., personicx . this cluster can similarly be correlated with geographic or demographic information to identify prospective customers . fig2 is flow diagram that illustrates an example of the process of purchased - based segmentation of potential customers utilizing data regarding actual , observed purchases and statistical modeling and clustering techniques for embodiments of the invention . referring to fig2 , at s 1 , a service provider collects empirical data for a client on actual purchasing behavior of a group of customers . at s 2 , statistical modeling techniques are applied to the empirical purchasing behavior data collected by the service provider in order to identify clusters of the customers that exhibit similar purchasing propensity characteristics . at s 3 , the clusters are further differentiated according to other factors that have a tendency to directly affect actual purchasing behavior of the customers within the clusters , and at s 4 , potential customers for customized marketing are identified according to a correlation with the clusters . although some embodiments use credit card purchase data , there are many other sources of data that can be used to create the segments or clusters . for example , debit card data or data using the merchants &# 39 ; benefit credentials ; or by purchasing from others that have the data or allying with others that have it on a partnership basis to obtain the data they have . for example , credit card issuers have data ; acnielsen has data that is obtained directly from stores ; issuers of id devices and other credentials have data ; issuers of debit cards have data ; and the stores themselves have data . embodiments of the present invention have now been generally described in a non - limiting manner . it will be appreciated that these examples are merely illustrative of the present invention . many variations and modifications will be apparent to those of ordinary skill in the art . | 8 |
in fig2 a , a semiconductor substrate , for example silicon substrate 200 , is provided . a pad layer 205 with a pad silicon oxide layer 202 and a pad silicon nitride layer 204 is formed on the surface of the silicon substrate 200 . the pad silicon oxide layer 202 about 100 - 600 å thick is formed on the surface of the silicon substrate 200 by oxidization method , and the pad silicon nitride layer 204 about 1600 - 3000 å thick is formed by cvd . next , part of the pad layer 205 is removed to define an opening ( not shown ), then the pad layer 205 is used as a mask to perform anisotropic etching to form shallow trenches 206 in the silicon substrate 200 . next , “ pull - back ” is performed on the pad layer 205 : an anisotropic etching is performed to remove part of the pad layer 205 around the opening of shallow trenches 206 and thus enlarge the opening of shallow trenches 206 , then part of the surface of the silicon substrate 200 and its corner 207 between the opening of shallow trenches 206 are exposed . then a thermal oxide film 210 is formed on the exposed surface of silicon substrate 200 inside the shallow trenches 206 by thermal oxidation . the thickness of the thermal oxide film 210 is about 80 - 140 å . for convenience , the pad silicon oxide layer 202 and the thermal oxide film 210 are represented together as a first oxide layer 212 . then a nitride liner film 220 is deposited evenly by cvd on the surface of the first oxide layer 212 at inner walls of the shallow trenches 206 and the sidewalls of the pad layer 205 around the opening of the shallow trenches 206 . the thickness of the nitride liner film 220 is about 80 - 140 å . next , in fig2 b , an insulating layer ( not shown ) of hdp oxide is formed to fill up the shallow trenches 206 by , for example , cvd . then , part of the insulating layer is removed by a deglaze step using hf - type etching agents to form a first opening 208 . the rest of the insulating layer is represented as the insulating layer 230 . the insulating layer 230 is divided into the top part 234 and the bottom part 232 by position , because the top part 234 is formed in the space surrounded by the “ pulled - back ” pad layer 205 , thus its width is greater than the bottom part 232 . next , in fig2 c , etching , for example , isotropic etching , is performed to remove the pad silicon nitride layer 204 and part of the nitride liner film 220 not covered with the top part of the insulating layer 234 , thus the top part of the insulating layer 234 , its sidewalls and part of the first oxide layer 212 are exposed . furthermore , part of the nitride liner film 220 under the top part of the insulating layer 234 is over - etched , thus the second opening 224 is formed . the rest of the nitride liner film 220 is represented as the rest of the nitride liner film 220 ′. next , in fig2 d , a second oxide layer 240 of about 100 - 200 å is deposited on the exposed upper surface of the top part of the insulating layer 234 , its sidewalls , and the exposed surface of the first oxide layer 212 , to fill up the second opening 224 . the second oxide layer 240 of , for example , hdp oxide , is formed by , for example , cvd . [ 0022 ] fig2 e shows etching , for example isotropic etching , performed to remove the second oxide layer 240 and the first oxide layer 212 not covered with the top part of the insulating layer 234 , thus the surface of the silicon substrate 200 is exposed . furthermore , part of the first oxide layer 212 under the top part of the insulating layer 234 is removed by over - etching and drawn back under the rest of the nitride liner film 220 ′, thus the third opening 324 is formed . during this etching , the top part of the insulating layer 234 is etched as well due to similar composition with the first oxide layer 212 and the second oxide layer 240 . the rest of the top part of the insulating layer is represented as the rest of the top part of the insulating layer 234 ′, and the rest of the first oxide layer 212 is represented as the rest of the first oxide layer 212 ′. the purpose of this step is to confirm that corner 207 is well covered with the first oxide layer 212 to avoid the drawback of short protection of the rest of the first oxide layer 212 ′, thereby exposing the corner 207 . next , in fig2 f , oxidization is performed to form a sacrificial oxide layer 250 on the exposed surface of the silicon substrate 200 . part of the third opening 242 is filled with the sacrificial oxide layer 250 . next , in fig2 g , a third oxide layer 260 of about 100 - 200 å is deposited on the upper surface of the rest of the top part of the insulating layer 234 ′, its sidewalls , and the surface of the sacrificial oxide layer 250 . the third opening is filled up with the third oxide layer 260 . the third oxide layer 260 of , for example , hdp oxide , is formed by , for example , cvd . for convenience , the rest of the first oxide layer 212 ′ and the sacrificial oxide layer 250 are represented together as oxide layer 255 . next , in fig2 h , etching , for example an isotropic etching , is performed to remove the third oxide layer 260 and part of the oxide layer 255 , thus the upper surface of the rest of the top part of the insulating layer 234 ′, its sidewalls , and the surface of the silicon substrate 200 is exposed . the rest of the oxide layer 255 is represented as the rest of the oxide layer 255 ′. the purpose of this step is to confirm that the corner 207 is covered with the rest of the oxide layer 255 ′ to avoid the drawbacks of the prior art . during this etching , the top and the sidewalls of the rest of the top part of the insulating layer 234 ′ is etched as well due to similar composition with the third oxide layer 260 and the oxide layer 255 , thus its width and height are slightly reduced . eventually , the rest of the top part of the insulating layer 234 ′ is cut at the same level with the rest of the oxide layer 255 ′ and the sidewalls of the rest of the nitride liner film 220 ′. the rest of the top part of the insulating layer 324 ′, together with the bottom part of the insulating layer 232 , composes the shallow trench isolation ( sti ). so far the fabrication of the sti is completed . while the invention has been described by way of example and in terms of the preferred embodiment , it is to be understood that the invention is not limited to the disclosed embodiments . on the contrary , it is intended to cover various modifications and similar arrangements as would be apparent to those skilled in the art . therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 7 |
acids which are useful in preventing the accumulation of gaseous ammonia are defined by four criteria : the molecular weight per acid functionality should be low so that only a small amount of acid will be needed to function effectively . preferably , the acid should have a molecular weight of less than 250 per available proton . more preferably , this value will be less than 150 , and most preferably less than 75 . an available proton is defined as a hydrogen ion in the molecule which may be donated to free ammonia , so that an acid ammonium salt is formed . the acidity should be high also to limit the amount of acid which must be used for control . one measure of acidity is the pk a , which is the negative of the common logarithm of the acid dissociation constant . a molecule which contains several acidic groups will have several pk a values , one for each of these groups . preferably , the first pk a of the acid should be less than 5 . more preferably , this will be less than 4 , and most preferably less than 3 . the lack of volatility is defined in terms of smell . an acid should be selected which will not annoy or irritate the occupants of these animal areas . any acid which has a noticeable smell should not be used . finally , the lack of toxicity is essential to avoid endangering animal or human health . preferably , the acute oral ld 50 value for the acid should be greater than 500 mg / kg . more preferably , this value will be greater than 1000 mg / kg , most preferably , greater than 2000 mg / kg . many acids will meet the criteria of the instant invention . these include certain naturally occurring and artificial carboxylic and substituted carboxylic acids , as well as phosphoric acid . some particularly useful acids are indicated in table 1 . these all have low volatilities and hence no odors , low toxicities , good acidities , and low molecular weights per available proton . other acids meet some but not all of the criteria , and therefore are not suitable . for example , acetic acid has reasonable acidity , low molecular weight , and low toxicity , but is volatile and thus has a strong and unpleasant smell . boric acid is low in molecular weight , toxicity , and volatility , but is not very acidic . it should be noted that having acidic protons is a crucial point of this invention . thus , salts of acids meeting the above criteria are not generally effective . the sodium salt of citric acid is not a useful ammonia control agent . table 1______________________________________some acids processing desirable attributesfor use in preventing the accumulation of ammonia . molecular first weight / oral ld . sub . 50acid pk . sub . a available proton ( mg / kg ) smell______________________________________citric 3 . 1 64 11 , 700 ( rat ) nonefumaric 3 . 0 58 -- nonemaleic 1 . 8 58 700 ( rat ) faintmalic 3 . 4 67 5 , 000 ( rabbit ) nonemalonic 2 . 8 52 1 , 300 ( rat ) nonephosphoric 2 . 1 33 1 , 500 ( rat ) nonesorbic 4 . 8 112 7 , 400 ( rat ) nonesuccinic 4 . 2 59 -- nonetartaric 3 . 0 75 -- none______________________________________ the conventional animal litter , bedding and absorbent materials used in animal areas includes straw , wood shavings , wood chips , saw dust , clay , rice hulls , corn cobs , sand , vermiculite , etc . mixtures of these materials can also be used . methods of application must ensure a uniform and continuous distribution of the acid . if patches of bedding , litter , or absorbent material exist which are not treated with acid , substantial amounts of ammonia may be formed . one suitable application method is merely to sprinkle or dust compound over the bedding , litter , or absorbent material as a pure solid . compounding with one or more additional solids prior to sprinkling or dusting would be acceptable . these solids might absorb moisture from animal wastes , prevent the formation of some gaseous toxicant other than ammonia from said wastes , be colored to indicate the presence of the compound , or have some other purpose . examples of such solids include zeolites , iron oxide , vermiculite , and other inorganic oxides and similar materials . in addition to being sprinkled or dusted onto bedding , litter , or other absorbent material as a pure solid or in admixture with other solids , the acid may be impregnated onto a solid carrier prior to application . such a carrier may serve merely as a vehicle for the dispersal of the enzyme inhibitor , or it may have some additional function . suitable carriers include natural and synthetic zeolites and clays , as well as other materials . as an alternative to dispersal as a solid , the acid may be dissolved in water or other solvent , and the resulting solution sprayed or poured onto the bedding , litter , or other absorbent material . spraying of a solution is a preferred method of application , as it may yield a very uniform distribution of the compound . a hand - pumped sprayer or other device may be used for this purpose . slurries may be used in place of solutions for solvents in which the compound is sparingly soluble . the acid may be applied to bedding , litter , or other absorbent materials before they are placed in animal areas . this application may take the form of simple physical mixing . alternatively , the acid may be impregnated onto the bedding or other material . this impregnation may be done using a spray , immersion into a bath , or other suitable method , with an optional drying step . if the bedding or other material is artificial , the compound may be added to the raw materials during production . the treated bedding , litter or other absorbent material can be used for larger farm animals such as horses , cows , sheep and pigs ; for domestic animals such as cats and dogs ; and for smaller animals such as mice , rats , guinea pigs , hamsters , gerbils and other small mammals . it is recognized that for birds the primary form of nitrogen waste is uric acid and not urea . however , as the uric acid decomposes , it forms urea which can be hydrolyzed enzymatically to form ammonia . control of the levels of this ammonia can be achieved using the present treated bedding , litter or other absorbent material . accordingly , the bedding , litter or other absorbent material can also be used for fowl and poultry such as chickens , turkeys , ducks , etc . to test the effectiveness of the acid the following procedure has been used . a synthetic urine is made by combining 2 . 3 wt % urea and 1 . 1 wt % sodium chloride . to mimic the presence of bacteria , 200 units of jack bean urease is added to the synthetic urine . jack bean urease is a readily available form of urease which is suitable for use in this context because useases from most natural sources appear to act similarly . see &# 34 ; jack bean urease ( ec 3 . 5 . 1 . 5 ). 8 . on the inhibition of urease by amides and esters of phosphoric acid &# 34 ; by r . k . andrews et al , j . am . chem . soc . 1986 , 108 , 7124 - 7125 . this urine is then poured over a sample of bedding or other absorbent material to which the acid has been applied . the treated sample is covered so that any gases produced may accumulate . the presence of ammonia is tested for by using draeger tubes . having described the basic aspect of the invention , the following examples are given to illustrate the specific embodiments thereof . this example illustrates the use of citric acid in the presence of two different types of bedding material . two 8 oz . polyethylene bottles were charged with 15 g of rice hulls and 15 g of sawdust , respectively . into each was added 15 g of the synthetic urine described above , which is a 2 . 3 wt % urea / 1 . 1 wt % nacl solution with 200 units of the enzyme urease . also present in this mixture was 12 mg of citric acid . the bottles were capped , and incubated in a shaker bath at 37 . 5 ° c . after 4 hr , no ammonia smell could be detected in either bottle . by contrast , identical bottles not containing citric acid smelled strongly of ammonia . this example illustrates the use of other acids to control the accumulation of ammonia . following the procedure of example 1 , 12 mg of malic acid , 6 mg of fumaric acid , and 6 mg of phosphoric acid were found to be sufficient to prevent the accumulation of noticeable amounts of ammonia . this example illustrates that acids which do not meet the stated criteria may not be effective . following the procedure of example 1 , boric acid ( 36 mg ) was tested and found to not control the accumulation of ammonia . boric acid has a first pk a of 9 . 1 , and this does not have a first pk a which is within the stated preferred range . this example illustrates that the salts of acids , which lack acidic protons , may not be effective . following the procedure of example 1 , sodium citrate ( 24 mg ) was found not to control the accumulation of ammonia . this example illustrates the effectiveness of citric acid when live urease - producing bacteria were substituted for urease . an 8 oz . polyethylene bottle was charged with 6 g of rice hulls and 24 g of synthetic urine , which is a 2 . 3 wt % urea / 1 . 1 wt % nacl solution to which 24 mg of citric acid had been added . bacillus pasteurii then was added to this mixture , which subsequently was incubated in a shaker bath at 37 . 5 ° c . after one day , no ammonia was evident in this bottle ( less than 5 ppm as measured using a draeger tube ). by contrast , the dead space in an identical bottle not containing citric acid contained more than 700 ppm of ammonia . it is understood that the foregoing detailed description is given merely by way of illustration and that many variations may be made therein without departing from the spirit of this invention . | 0 |
while the making and using of various embodiments of the present invention are discussed in detail below , it should be appreciated that the present invention provides many applicable inventive concepts which can be embodied in a wide variety of specific contexts . the specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention . in particular , while the invention is described in the context of mail piece identification and processing , it will be appreciated that the method and system described herein may be utilized in numerous other applications where it is desired to label items for the purposed of identification with minimal impact on the appearance of the article . sunlight and most forms of artificial light are electromagnetic waves whose electric field vectors vibrate in all perpendicular planes containing or orthogonal to the vector which indicates the direction of propagation . when the electric field vectors of such radiation are restrained to a single plane , the light is said to be polarized relative to the direction of propagation and the electric field waves vibrate in the same plane . light may be polarized to a certain degree when it is reflected from a surface such as water or a highway . in this case , light waves that have electric field vectors parallel to the reflecting surface are reflected to a greater degree than those with different orientations . light may also be polarized through the use of certain filters . in one aspect , the invention takes advantage of the properties of light , in particular polarization , to provide a label and system for coding mail pieces and in particular pieces such as magazines , catalogues , brochures and similar items with a machine - readable code in a form that minimizes the visual impact of the label on the appearance of the cover of the publication . referring now to fig1 and 1 ( a ) there is illustrated a portion of a mail piece 10 such as a catalogue or magazine cover with a label 12 according to the invention applied thereto . in one embodiment , the label is formed from a non - opaque material such as a transparent polymer . preferably , the label is formed from an oriented film such that a dichroic ink will form a polarized image on or in the film . “ dichroic ” as used herein refers to the characteristic of differential absorption of incident radiation in the visual , uv , and ir spectrum depending upon the direction of vibration of the electromagnetic waves comprising the radiation . a “ dichroic ink ” refers to an ink containing a dye or stain having molecules that tend to align with the molecules of a substrate , such as an oriented film , resulting in a substrate that will selectively absorb differently polarized components of an incident light beam . such inks and techniques for applying such inks are known , for example u . s . pat . no . 6 , 013 , 123 issued jan . 11 , 2000 to scarpetti for “ inking methods and compositions for production of digitized stereoscopic polarizing images ” discusses the use and application of inks containing a dichroic dye , water and a humectant . also , as used herein the term “ light ” encompasses radiation in the visible spectrum (“ visible light ”) as well as non - visible uv and ir radiation . as illustrated the label comprises a machine - readable indicia 14 , in this case a bar code printed with a dichroic ink . alternatively , the portion 16 of the label 12 excluding bar code 14 may be printed with a dichroic ink , leaving the bar code as an unpolarized area . positioned between label 12 and indicia 14 is a reflective layer 18 which as illustrated is coextensive with indicia 14 or , alternatively , with the larger surface 16 . the purpose of reflective layer 18 is to reflect incident light so as to provide sufficient contrast for the machine readable indicia 14 . the degree of opaqueness of reflective layer 18 is preferably maintained at a level sufficient to reflect enough light to contrast bar code 14 for the purpose of scanning as hereinafter described , while transmitting as much light as possible to minimize the visual impact of the label . depending upon the particular application , reflective layer 18 may be formed from a number of known materials capable of reflecting light in the spectrum of interest , including light in the visible spectrum , infrared or near infrared and ultraviolet . for example , the reflective layer may be a plastic film including one or more additives that modify the optical properties of the film such that the desired spectrum is reflected from the film . in other applications , a metalized layer formed with known methods of applying an extremely thin layer of metal to a substrate such as plastic may be used . a metalized layer would be particularly suitable for labeling gift and decorative items covered with a metallic foil or where a metallic foil is used to protect an item from sunlight . in other applications the reflective layer may be silica or a similar material incorporated into a plastic film in one preferred embodiment , reflective layer 18 is partially transparent to visible light , thereby minimizing the visual impact of the label . the term “ partially transparent ” as used herein refers to the capability of a material to pass sufficient visible light to enable normal visual recognition of an underlying image . thus , “ partially transparent ” may encompass materials allowing differing degrees of light transmission depending upon the particular application . while a translucent or partially transparent reflective layer 18 is preferable , it is not required for all applications . in some applications it may be desirable for reflective layer 18 to be opaque and colored to match an underlying surface and / or be coextensive with the entire area of label 12 . in one preferred embodiment , label 12 is formed from an oriented transparent plastic film with a transparent or translucent reflective layer 18 printed or applied to the label 12 . machine readable indicia 14 is formed from a dichroic dye which is preferable fully transparent to visible light and constitutes a polarizing filter in the uv or ir wavelengths of light . in this case , the reflective layer 18 is formed from a material that is transparent to light in the visible spectrum (“ visible light ”) while reflecting light in the non - visible uv or ir spectrum . in this embodiment the visual impact of the label 12 upon the overall appearance of the labeled article is minimized . referring now to fig2 , an apparatus 20 for preparing and applying labels according to the invention includes an applicator 22 which applies a reflective layer 18 ( fig1 and 1 a ) onto an oriented film 26 fed from roll 28 . in one embodiment , film 26 has been perforated along lines defining individual labels and an adhesive coating or layer has been applied to one side of the film for adhering the labels to an item or article to be labeled . after reflective layer 18 has been applied to the film , the film is then conveyed through a printer 30 that applies a bar code or other machine readable indicia 14 ( fig1 and 1 a ) representing a unique numeric or alpha numeric code to the label using a dichroic ink . one or more heaters 25 may be used to dry or cure the reflective layer as well as the ink . heaters 25 may be forced air or radiant heaters depending upon the particular design and application . after printing and curing , the preprinted labels are re - wound into a roll 32 on winder 33 for subsequent use . film 26 comprising preprinted labels 34 is fed to a labeling machine 36 from roll 32 along with a singulated stream of mail pieces 10 . destination information for each of mail pieces 10 has been acquired by reference to a mailing list for the mail pieces , scanning the mail pieces for previously applied destination information , manual input of destination information or a combination of thereof and stored on computer 40 . the codes previously applied to labels 34 have also been transferred to and stored on computer 40 . as the mail pieces 10 are fed through labeling machine 36 a label having a unique code as previously described is applied to the mail piece and the code is associated with the record stored in computer 40 for that particular mail piece . thus , the mail pieces can subsequently be identified , sorted and processed using the code imprinted on labels 34 along with the record of the mail piece stored on computer 40 . as will be appreciated , in this respect the invention may be particularly advantageous for use by mailers and / or presorters of magazines , brochures , catalogues and similar items having covers designed to convey a distinct visual impact . turning now to fig3 , a sorting apparatus 41 for scanning and sorting mail pieces labeled as described above is illustrated . a stream of singulated mail pieces is fed from feeder 42 to conveyor 44 for processing in accordance with the invention . the location of the mail pieces on the conveyor may be monitored with one or more photocells ( not shown ) or by other conventional means so as to produce a signal for transmission to computer 40 for use in further processing of the mail stream . additionally , an edger ( not shown ) may be incorporated into the apparatus 41 to ensure proper placement of the mail piece to enable scanning as hereinafter described . singulated mail pieces 10 pass under light source 46 which directs a beam 48 of non - polarized visible or invisible , e . g ., near - infrared light onto the mail piece 10 . depending upon the reflective nature of the substrate , the illumination is chosen to be diffuse or beamed . reflected light 50 from the mail piece 10 travels to camera 52 which includes one or more dividers such as beam splitters to generate three machine detectable beams 54 which are each directed to polarized filters 56 . the axis of each of polarized filters 56 is rotated sixty degrees ( 60 °) relative to the axes of each of the other filters . the filtered beams 58 are directed to impinge upon a detector 60 such as a charge coupled array ( ccd ). each of the charge coupled arrays generates a digitized electrical image of the mail piece 10 from the filtered beam 58 and transmits the electronic image 62 to a computer 64 . computer 64 receives the electronic images 62 from each of the charge coupled arrays and compares the images . in one embodiment , computer 64 compares the images 62 by subtracting one image from another on a pixel - by - pixel basis . ideally , when an un - polarized image is subtracted from another un - polarized image of the same subject , the resulting image will be completely black . thus , when an unlabeled mail piece passes under the camera or scanner 52 the resultant electronic images 62 are all identical and the resulting combined electronic images will be entirely black . however , when a mail piece bearing a label according to the invention passes under the scanner 52 , the image of the polarized area of the label 12 , as observed via filtered beams 58 , will depend upon the alignment of the polarized portion or indicia 14 with respect to the axis of each of the polarized filters 56 . computer 64 will therefore generate up to three images from the three electronic images 62 in which the polarized portion of the label 12 will appear white or nearly white , while the remainder of the image will be black . computer 64 may be programmed to select the better images , combine images or other wise manipulate the images to create a high - contrast image . after computer 64 has subtracted the digitalized images , the result is an image in which the barcode or indicia 14 will appear white against a black background . in practice , minor misalignments and variations due to the application procedure , focusing and camera element alignment are observed . however , the high contrast white image against the background of black is sufficient to overcome such variations for the purpose of reading the indicia . once the machine readable indicia 14 has been isolated as set forth above , the computer 64 may electronically scan or process the indicia using known techniques and read the printed code 14 for the particular mail piece 10 . computer 64 then uses this information and a data base associating this code with a destination to send a sorting signal or information corresponding to the mail piece to a down stream conventional mail sorter or sorting equipment 66 , where the mail pieces 10 may be sorted by destination code or other criteria , with or without mail pieces originating from other sources , depending upon the particular application . referring now to fig4 , there is illustrated an alternate system 70 for applying labels in accordance with a method of the invention to a plurality of mail pieces such as magazines , brochures or catalogues . feeder 72 feeds a stream of singulated mail pieces 10 onto conveyor 74 . the location of the mail pieces on the conveyor may be monitored with one or more photocells ( not shown ) or by other conventional means so as to produce a signal for transmission to computer 76 which controls the process . a label applicator 78 applies a label , for example a piece of oriented transparent polymer film with a pre - applied adhesive , to each of the mail pieces 10 as the mail pieces are conveyed though the system 70 . in order to ensure placement of the label in the desired position , the mail piece may be edged , as is known in the art with an edger ( not shown ). as the mail pieces travel down the conveyor 74 , a reflective layer 18 ( fig1 and 2 ) is applied to the label , by for example , printing the layer 18 onto the label with a first media applicator 78 . as will be appreciated , the reflective layer 18 could have been previously applied to the label film , in which case , this operation could be eliminated . as the mail pieces travel further , a second media applicator 80 applies a machine readable indicia 14 ( fig1 and 2 ), by , for example , printing the indicia 14 over the reflective layer 18 with a dichroic ink . the machine readable indicia may include a destination code for the particular mail piece or some other code , symbols , or text to be used in subsequent handling or processing . a computer 82 , including a database 84 controls the operation of the second media applicator 80 , suppling the destination code from data , for example , a mailing list , stored in database 84 . in an alternative embodiment , second media applicator 80 may comprise a laser or uv light source , the light source imprinting a polarized or non - polarized indicia on a pre - sensitized or treated film label . in the case of a pre - sensitized polarized film , the light source may depolarize an area of the label corresponding to a machine readable indicia . in the alternative , the pre - treatment of the film may allow the laser to selectively polarize areas of the label corresponding to a desired indicia . following application of a machine readable indicia 14 upon the label 12 , the mail pieces 10 are transported for further processing , for example stacking and bundling with stacker 66 . the labeled mail pieces may then be transported to a postal service sorting system which may use a scanning apparatus of the type described herein to readily sort the mail pieces 10 for delivery based upon the destination code printed on the label . as will be appreciated , numerous variations and permutations of the above - described process may prove advantageous . in the case where the address of the recipient is printed upon the mail piece , and an optical character scanner ( ocr ) may be used to read the information which could then be transmitted to the computer 82 for labeling purposes . it is also anticipated that the reflective layer could be pre - applied to the label film , or during production of the film . as will be appreciated , variations on the above system may be readily discerned . for example while the system is described as having a light divider that directs beams to a plurality of filters , multiple cameras may be used with different filters and filter configurations to produce the same result . similarly purpose - built electronics and / or multiple computers or microprocessors may be employed to perform the various functions described above . these and other combinations and permutations are within the scope of the invention . in order to fully illustrate the principles of the invention , reference is now made to fig5 - 11 . turning first to fig5 there is shown the cover of a popular magazine as would be perceived by the human eye , including label 12 . fig6 a , 6 b and 6 c correspond to the images as the images are captured by each of three 2048 pixel ( from left to right ) charge coupled arrays . as shown , the images are nearly identical except that the image of the bar code varies in brightness between the images . fig7 a , 7 b and 7 c are the result of digitally subtracting each of the images of fig6 a , 6 b and 6 c from each other , i . e ., 6 a - 6 b , 6 a - 6 c and 6 b - 6 c . in each of the images presented in fig7 a - 7 c , the only non - black portion of the image is the bar code and the brightness of the code in each of the images is a function of the brightness of the images in the particular pair of subtracted images . in operation , it is anticipated that all three images will be generated with one being selected for reading based upon its relative brightness . fig8 - 11 illustrate anticipated deviations from the ideal . fig8 shows the effect of a one - pixel shift horizontally combined with a one - pixel shift vertically to simulate the translational misalignment of two charge coupled arrays . fig9 illustrates the anticipated effect of a small rotational misalignment with the arc of the misalignment corresponding to a shift of one pixel at a corner of the image . fig1 shows the anticipated effect of a possible scaling error resulting from one of the charged coupled arrays observing a slightly larger image , i . e ., 2 pixels along the horizontal axis , than observed by the other charge coupled arrays . fig1 illustrates the image resulting from a combination of the misalignments shown in fig8 - 10 . as illustrated , while some of the background is not entirely black , the degree of contrast is still sufficient to enable scanning and reading the label . thus , the label and system of the invention are capable of tolerating minor variations that may be encountered in manufacturing , imprinting and scanning operations without affecting the operation of the system . while this invention has been described with reference to illustrative embodiments , this description is not intended to be construed in a limiting sense . various modifications and combinations of the illustrative embodiments , as well as other embodiments of the invention , will be apparent to persons skilled in the art upon reference to the description . it is , therefore , intended that the appended claims encompass any such modifications or embodiments . | 6 |
reference will now be made in detail to embodiments , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to the like elements throughout . in this regard , the embodiments discussed below may have different forms and should not be construed as being limited to the descriptions set forth herein . accordingly , the embodiments are merely described below , by referring to the figures , to explain certain aspects of the present description . fig1 illustrates a battery unit 100 according to an embodiment of the present invention . referring to fig1 , the battery unit 100 can include a case 102 in which a plurality of battery cells 101 are accommodated , electrode tabs 103 that electrically connect the plurality of battery cells 101 to one another , a plurality of electrode terminals 104 that are electrically connected to the electrode tabs 103 and are drawn out of the case 102 , and a communication connector 105 that transmits an electrical signal that indicates temperatures or charging states of the battery cells 101 . each battery cell 101 may be a cylindrical secondary battery . as well known in the art , a cylindrical secondary battery can include an electrode assembly that includes a positive electrode plate , a negative electrode plate , and a separator that is interposed between the positive and negative electrode plates and that is wound in a jelly - roll type manner , a cylindrical can in which the electrode assembly is accommodated , and a cap assembly that seals an opening portion of the cylindrical can . according to the current embodiment of the present invention , the battery cells 101 may be arranged parallel to one another and electrically connected to each other to form a high output and high capacity battery unit 100 . the battery cells 101 are not limited to being cylindrical secondary batteries and may instead be prismatic secondary batteries or polymer secondary batteries . the case 102 may include an upper case 106 , and a lower case 107 that is coupled to the upper case 106 . when the upper case 106 and the lower case 107 are coupled to each other , an inner space that accommodates the plurality of battery cells 101 can be formed . a plurality of heat dissipation holes 108 , for dissipating heat generated during driving of the battery unit 100 out of the battery unit 100 , can be formed in the upper case 106 , the lower case 107 , or in both . the plurality of battery cells 101 may be arranged parallel to one another in the case 102 continuously in a length direction , and may be connected to one another via the electrode tabs 103 . the electrode tabs 103 may include a first electrode tab 109 connected to a first side of the battery cell 101 and a second electrode tab 110 connected to a second side of the battery cell 101 . the first electrode tab 109 and the second electrode tab 110 may be conductive plates formed of , for example , nickel , and be strip - shaped . the first electrode 109 and the second electrode tab 110 may be electrically connected to each of the battery cells 110 by welding . the first electrode tab 109 may be mounted at an inner side of a first sidewall 107 a in a length direction of the lower case 107 , and the second electrode tab 110 may be mounted at an inner side of a second sidewall 107 b that is opposite to the first sidewall 107 a . the plurality of battery cells 101 may be connected to one another in parallel via the first electrode tab 109 and the second electrode tab 110 . alternatively , the plurality of battery cells 101 may be connected serially or in a serial - parallel combined manner . a plurality of electrode terminals 104 may be formed at a front side of the case 102 . the electrode terminals 104 may include a first electrode terminal 111 that is electrically connected to the first electrode tab 109 and a second electrode terminal 112 that is electrically connected to the second electrode tab 110 . the first electrode terminal 111 and the second electrode terminal 112 may extend from an inner portion of the case 102 and drawn out of the case 102 . the first electrode terminal 111 and the second electrode terminal 112 may be bolt type terminals but are not limited thereto . the communication connector 105 may be disposed at the front side of the case 102 in which the first electrode terminal 111 and the second electrode terminal 112 are installed while a plurality of connection pins 113 are installed in a connector housing unit 114 . the communication connector 105 may be electrically connected to a plurality of thermistor lines 115 and a plurality of balancing lines 116 so as to transmit an electrical signal that indicates data regarding states of the battery cells 101 , such as temperature or charging states of the battery cell 101 to a controller such as a bms . a thermistor sensor 117 is a device that detects the temperature of one battery cell 101 and can be installed at an end portion of each thermistor line 115 . a balancing sensor 118 can detect an amount of electric charge stored inside one battery unit 100 and can be installed at an end portion of each balancing line 116 . as long as the thermistor sensors 117 and the balancing sensors 118 are electrically connected to the plurality of battery cells 101 , the placement of the thermistor sensors 117 and the balancing sensors 118 are not limited to that as described above . the pluralities of thermistor lines 115 and balancing lines 116 may be electrically connected to the connection pins 113 . the number of the connection pins 113 is not limited to that described in the present embodiment , and may be various . bus bars 119 that electrically connect the battery unit 100 to adjacent battery units 100 may be installed at each of the first electrode terminal 111 and the second electrode terminal 112 of the battery unit 100 . each bus bar 119 can be a conductive plate . insertion holes 120 through which the first electrode terminal 111 of a first battery unit 100 and the second electrode terminal 112 of a battery unit 100 adjacent to the first battery unit 100 are inserted may be formed in each bus bar 119 . while a washer 121 may be interposed around each of the first electrode terminal 111 and the second electrode terminal 112 , the bus bars 119 may be coupled thereto by using nuts 122 . fig2 illustrates a battery module 200 in which the battery unit 100 of fig1 is stacked a plurality of times . referring to fig2 , a plurality of battery units 100 can be formed . the battery units 100 may be arranged such that polarities of adjacent battery units 100 alternate . the first electrode terminal 111 of a first battery unit 100 may be connected to the second electrode terminal 112 of a battery unit 100 that is adjacent to the above battery unit 100 for all first and second electrode terminals 111 and 112 via the bus bars 119 . the plurality of battery units 100 may be continuously connected to one another , thereby forming the battery module 200 . the number of battery units 100 may be determined in consideration of required charging and discharging capacities . while being connected serially or in parallel via the bus bars 119 , the plurality of battery units 100 may be arranged in a case 201 . the case 201 includes an upper case 202 and a lower case 203 that is coupled to the upper case 202 . a plurality of guide grooves 204 through which the plurality of battery units 100 are mounted when the upper case 202 and the lower case 203 are coupled to each other may be formed in the upper case 202 and the lower case 203 . accordingly , each of the battery units 100 may be coupled to the case 201 by being guided by the guide grooves 204 . a circuit substrate module 300 may be installed at an opening portion 205 of the case 201 , that is , at an inlet where the battery units 100 are inserted to be mounted . the circuit substrate module 300 may include a circuit substrate 302 that may be detachably coupled to the case 201 via a groove of a guide unit 206 formed along two sidewalls of the lower case 203 that are adjacent to the opening portion 205 . alternatively , the circuit substrate 302 may be coupled to the upper case 202 or the lower case 203 by installing a coupling member , such as a boss and screw - coupling , and then coupling the circuit substrate 302 thereto . the communication connectors 105 of the battery units 100 may be electrically connected to a plurality of circuit substrate connectors 301 mounted on the circuit substrate module 300 by connection lines 210 , and the plurality of circuit substrate connectors 301 may be electrically connected to a single external connector 303 . fig3 is a front view illustrating a portion of the battery module 200 where the circuit substrate module 300 of fig2 is mounted , and fig4 is a separated perspective view illustrating a portion of the battery module 200 where the circuit substrate module 300 of fig3 is mounted . referring to fig3 and 4 , the circuit substrate module 300 may include the circuit substrate connectors 301 electrically connected to the communication connectors 105 formed in the plurality of battery units 100 via the connection lines 210 , the circuit substrate 302 to which the circuit substrate connectors 301 are mounted , and the external connector 303 that is electrically connected to the circuit substrate connectors 301 and that is to be connected a controller such as a bms via a cable 304 . the number of circuit substrate connectors 301 may correspond to the number of communication connectors 105 , and the circuit substrate connectors 301 may be connected to the communication connectors 105 via the connection lines 210 , respectively . accordingly , in each battery unit 100 , the thermistor lines 115 and the balancing lines 116 electrically connected to the battery cells 101 ( see fig1 ) may be connected to one circuit substrate connector 301 , and data signals indicating the temperatures or the charging states of the battery cells 101 in the battery unit 100 may be transmitted . the circuit substrate connectors 301 may be separated a predetermined distance from one another along an edge of the circuit substrate 302 . the plurality of circuit substrate connectors 301 may be electrically connected to a plurality of leads 305 , respectively , and the plurality of leads 305 may be patterned in the circuit substrate 302 . the plurality of leads 305 may be collected and respectively connected to the external connector 303 . accordingly , in the plurality of battery units 100 , the communication connectors 105 and the circuit substrate connectors 301 may be connected to each other via the connection lines 210 , and the leads 305 connected to each of the circuit substrate connectors 301 may be collected and respectively connected to the external connector 303 , and the cable 304 drawn from the external connector 303 may be electrically connected to a controller such as a bms . as described above , the pluralities of thermistor lines 115 and balancing lines 116 electrically connected to the battery cells 101 may be electrically connected to the plurality of communication connectors 105 , the plurality of connection lines 210 , the plurality of circuit substrate connectors 301 , and the plurality of leads 305 , and collected in the external connector 303 , thereby easily controlling the states of the battery cells 101 . the bus bars 119 may electrically connect the first electrode terminal 111 of the battery units 100 and the second electrode 112 of adjacent battery units 100 and may be installed between the battery units 100 and the circuit substrate 302 . the circuit substrate module 300 may further include a unit that not only connects the communication terminals described above but also to which the bus bars 119 may be coupled for convenience of assembling . fig5 may be an extended separated perspective view illustrating a portion of a battery module where a circuit substrate module 500 is mounted , according to another embodiment of the present invention . fig6 is a cross - sectional view illustrating the portion of the circuit substrate module 500 of fig5 . referring to fig5 , a circuit substrate 502 may be disposed on the plurality of battery units 100 disposed adjacent to one another . a plurality of circuit substrate connectors 501 may be mounted on the circuit substrate 502 in a length direction . a plurality of communication connectors 105 electrically connected to thermistor lines 115 ( see fig1 ) and balancing lines 116 within battery units 100 via a plurality of connection lines 210 may be connected to the plurality of circuit substrate connectors 501 . the circuit substrate connectors 501 may be electrically connected to a plurality of leads 505 , and the leads 505 may be patterned in the circuit substrate 502 . the patterned leads 505 are collected and respectively connected to a single external connector 503 , and one cable 504 that is electrically connected to the external connector 503 may be electrically connected to a controller such as a bms . a plurality of coupling holes 506 may be formed in the circuit substrate 502 . first electrode terminals 111 and second electrode terminals 112 may be inserted into the coupling holes 506 , respectively . the first electrode terminals 111 and the second electrode terminals 112 may be bolt - type terminals , but are not limited thereto . a gasket 511 may be installed between the battery unit 100 and the circuit substrate 502 along circumferences of each of the first electrode terminals 111 and the second electrode terminals 112 for insulation , and washers 512 and first nuts 513 may be interposed on upper surfaces of the gaskets 511 . bus bars 119 may be positioned on the first nuts 513 to electrically connect the first electrode terminals 111 and the second electrode terminals 112 of pairs of the battery units 100 that are adjacent to each other . the bus bars 119 may be coupled to the first electrode terminals 111 and the second electrode terminals 112 of pairs of battery units 110 that are adjacent to each other . second nuts 514 may be positioned on the bus bars 119 so that the first electrode terminals 111 and the second electrode terminals 112 are firmly fixed with respect to the bus bars 119 . the first electrode terminal 111 and the second electrode terminal 112 may be coupled to the bus bar 119 by not only using a bolt and nut coupling method but also by any of various other methods such as , for example , a welding coupling method or a laser coupling method . also , the number or shape of the coupling members including the gaskets 511 , the washers 512 , the first nuts 513 , and the second nuts 514 is not limited . as described above , the first electrode terminal 111 and the second electrode terminal 112 may be inserted through the coupling holes 506 of the circuit substrate 502 between the battery unit 100 and the circuit substrate 502 . thus , ends of the first electrode terminal 111 and the second electrode terminal 112 may protrude through the circuit substrate 502 , and the bus bar 119 may be coupled to the first electrode 111 and the second electrode 112 on the circuit substrate 502 . also , sizes of the coupling holes 506 formed in the circuit substrate 502 may be greater than sizes of the first electrode terminal 111 and the second electrode terminal 112 . that is , when an internal pressure of the battery units 100 increases while being driven , the battery units 100 can thermally expand . when the battery units 100 are deformed , portions where the battery units 100 are connected via the bus bars 119 can also be deformed . even though portions where the first electrode terminal 111 and the second electrode terminal 112 are coupled with respect to the bus bar 119 are deformed , the circuit substrate 502 in which the coupling holes 112 are formed can be formed so as to maintain a movement space in which the deformation described above may be accommodated . thus , deformation of the portion where the first electrode terminal 111 and the second electrode terminal 112 are coupled with respect to the bus bar 119 may be prevented in advance . as described above , the plurality of circuit substrate connectors 501 and the plurality of leads 505 connected to the circuit substrate connectors 501 and patterned so as to transmit electrical signals to the single external connector 503 are formed in the circuit substrate module 500 , and thus the battery cells 101 in the plurality of battery units 100 may be easily controlled . furthermore , the first electrode terminal 111 and the second electrode terminal 112 may be positioned through the coupling holes 506 formed in the circuit substrate 502 , and the first electrode terminal 111 and the second electrode terminal 112 may be coupled and fixed on the circuit substrate 502 , and thus the battery unit 100 and the circuit substrate module 500 may form a module . fig7 is a cross - sectional view illustrating a portion where a circuit substrate module 700 is mounted , according to another embodiment of the present invention . referring to fig7 , a circuit substrate 702 is disposed on a plurality of battery units 100 that are adjacent to each other . a plurality of coupling holes 706 may be formed in the circuit substrate 702 . a first electrode terminal 111 and a second electrode terminal 112 may be inserted into the coupling hole 706 , and end portions of the first electrode terminal 111 and the second electrode terminal 112 may protrude through the circuit substrate 702 . the first electrode terminal 111 and the second electrode terminal 112 in the illustrated embodiment are bolt - type terminals but are not limited thereto . a washer 712 and a first nut 713 may be stacked on an upper surface of a gasket 711 along a circumference of the first electrode terminal 111 for insulation and the same structure may also be stacked along a circumference of the second electrode terminal 112 for insulation between the battery units 100 and the circuit substrate 702 . a bus bar 119 may be disposed on each first nut 713 to electrically connect the first electrode terminal 111 and the second electrode terminal 112 of a pair of battery units 100 that are adjacent to each other . sizes of the coupling holes 706 formed in the circuit substrate 702 may be greater than sizes of the bus bar 119 . that is , a number of coupling holes 706 corresponding to the number of bus bars 119 may be formed in the circuit substrate 702 , and the coupling holes 706 may be formed with a size in which the bus bar 119 may be accommodated . when the bus bar 119 is inserted into the coupling hole 706 , there can be a gap g between an inner wall of the circuit substrate 702 in which the coupling hole 706 is formed and a boundary of the bus bar 119 . the bus bar 119 may be coupled to the first electrode terminal 111 and the second electrode terminal 112 of a pair of battery units 110 that are adjacent to each other . a second nut 714 may be disposed on the bus bar 119 so as to firmly fix the first electrode terminal 111 and the second electrode terminal 112 with respect to the bus bar 119 . the bus bar 119 may preferably fix the first electrode terminal 111 and the second electrode terminal 112 on substantially the same plane as the circuit substrate 702 substantially . accordingly , when the battery units 110 are thermally expanded due to an increase of internal pressure , even though portions of the circuit substrate 702 where the first electrode terminal 111 and the second electrode terminal 112 are inserted can be deformed with respect to the bus bar 119 , since there is the gap g between the inner wall of the circuit substrate 702 in which the coupling holes 706 are formed and the boundary of the bus bar 119 , a movement space for the portions of the circuit substrate 702 where the first electrode terminal 111 and the second electrode terminal 112 are coupled with respect to the bus bar 119 may be provided . fig8 is a cross - sectional view illustrating a portion where a circuit substrate module 800 is mounted , according to another embodiment of the present invention . referring to fig8 , a circuit substrate 802 may be disposed on a plurality of battery units 100 that are disposed adjacent to one another . a plurality of circuit substrate connectors 801 may be mounted on the circuit substrate 802 in a length direction . the plurality of circuit substrate connectors 801 may be connected to a plurality of communication connectors 105 that are electrically connected to thermistor lines 115 and balancing lines 116 in the battery units 100 via a plurality of connection lines 210 . the circuit substrate connectors 801 may be electrically connected to leads 805 , respectively , and the plurality of the leads 805 may be patterned in the circuit substrate 802 . the patterned leads 805 may be collected in a single external connector 803 , and one cable 804 that is electrically connected to the external connector 803 may be electrically connected to a controller such as a bms . a bus bar 119 may be formed in the circuit substrate 801 by insert injection molding . a first electrode terminal 111 and a second electrode terminal 112 may be inserted into the bus bar 119 . the first electrode terminal 111 and the second electrode terminal 112 are bolt - shaped in the illustrated embodiment but are not limited thereto . a gasket 811 is installed between the battery unit 100 and the circuit substrate 802 along a circumference of the first electrode terminal 111 and another gasket 811 may be similarly installed along a circumference of the second electrode terminal 112 , and a washer 812 and a first nut 813 may be interposed above each gasket 811 . a second nut 814 may be disposed on the bus bar 119 so as to firmly fix the first electrode terminal 111 and the second electrode terminal 112 with respect to the bus bar 119 . as described above , since the bus bar 119 is inserted and injected on the circuit substrate module 800 , the battery units 100 and the circuit substrate module 800 may be formed as a module . fig9 is a cross - sectional view illustrating a portion where a circuit substrate module 900 is mounted , according to another embodiment of the present invention . referring to fig9 , a circuit substrate 902 may be disposed on a plurality of battery units 100 that are disposed adjacent to each other . a mounting groove 906 may be formed in a surface of the circuit substrate 902 that faces the battery units 100 . the mounting groove 906 has a size that is sufficient for each of a plurality of bus bars 119 to be inserted thereinto . the number of mounting grooves 906 can correspond to the number of bus bars 119 . a first electrode terminal 111 and a second electrode terminal 112 may be respectively inserted into the bus bar 119 . the first electrode terminal 111 and the second electrode terminal 112 are bolt - type terminals in the illustrated embodiment , but are not limited thereto . a gasket 911 for insulation , a washer 912 , and a first nut 913 may be interposed between the battery unit 100 and the bus bar 119 along a circumference of the first electrode terminal 111 and the same structure may be similarly interposed along a circumference of the second electrode terminal 112 . a second nut 914 may be disposed on the circuit substrate 902 so as to firmly fix the first electrode terminal 111 and the second electrode terminal 112 with respect to the bus bar 119 . as described above , as the bus bar 119 that is fixed with respect to the first electrode terminal 111 and the second electrode terminal 112 may be mounted in the mounting groove 906 in the circuit substrate 902 , the battery units 100 and the circuit substrate module 900 may be formed as a module . as described above , according to the one or more of the above embodiments of the present invention , when using the circuit substrate module and the battery modules using the circuit substrate modules , effects as follows may be obtained . first , a thermistor line and a balancing line drawn from the battery unit may be connected to a communication connector , and two end portions of a connection line may be coupled between a plurality of communication connectors and a plurality of circuit substrate connectors , and thus the assembling operation of the circuit substrate module can be simplified . second , since a plurality of leads connected to the plurality of circuit substrate connectors formed in the circuit substrate can be collected and respectively connected to a single external connector , it is easy to work on the circuit substrate module . third , a bus bar may be disposed on or under the circuit substrate or in the circuit substrate , and an electrode terminal is coupled to the bus bar , and thus the battery unit and the circuit substrate may be formed as a module . it should be understood that the exemplary embodiments described therein should be considered in a descriptive sense only and not for purposes of limitation . descriptions of features or aspects within each embodiment should typically be considered as available for other similar features or aspects in other embodiments . | 7 |
referring to fig1 , a preferred embodiment of the invention , adaptor 10 comprises a housing 12 containing a first switch 14 , a second switch 16 , a first relay 18 , a second relay 20 and a transformer 22 . the relays 18 and 20 along with the switches 14 and 16 may be composed of two physically separate relay and switch devices or may be composed of a physically integrated double relay and switch device . in the embodiments shown in fig1 through 3 , 24 - volt relays are used . however , 120 - volt relays may be used as well as is described in an alternate embodiment below . by way of appropriate connectors , first switch 14 is connected to building wire 24 and is further connected to adaptor lead wire 34 . second switch 16 is connected to building wire 26 and is further connected to adaptor lead wire 36 . first switch 14 is further connected to plug wire 44 . second switch 16 is further connected to plug wire 46 . building wires 24 and 26 connect at the opposite ends to a standard building power source . building wires 24 and 26 are standard building wires used in various commercial , residential , and industrial buildings , as well as other structures . in the prior art building wires 24 and 26 would connect directly to an hvac system 50 . in the exemplary embodiment shown in fig1 , relay 18 is electrically connected to transformer 22 . transformer 22 is in turn electrically connected to plug wires 44 and 46 . switch 14 is operable by relay 18 . in like manner switch 16 is operable by relay 20 . relay 20 is electrically connected to transformer 22 . plug wires 44 and 46 are connected at their ends distal from switches 14 and 16 to a standard , commercially available electrical plug 48 . electrical plug 48 is of a type useable for connection to a standard , commercially available electrical generator 52 , including , for instance , a portable gasoline - powered generator . adaptor lead wires 34 and 36 are connectable to an hvac power connector 54 of a standard commercially available hvac system 50 . switches 14 and 16 are each double pole switches . through appropriate connectors , switch 14 is connectable to building wire 24 , lead wire 34 and plug wire 44 . relay 18 and switch 14 are operable to connect lead wire 34 to either building wire 24 or plug wire 44 . relay 20 and switch 16 are operable to connect lead wire 36 with either building wire 26 or plug wire 46 . in the embodiment depicted in fig1 , switch 14 is shown connected to building wire 24 and switch 16 is shown connected to building wire 26 . in an exemplary embodiment , relays 18 and 20 are spring and solenoid - operated . by way of example , a spring ( not shown ) normally biases an electrically - conductive switch lever ( not shown ) of switch 14 to an electrical connection with plug wire 44 . when no power is provided to switch 14 through building wire 24 , a solenoid ( not shown ) provides sufficient force to overcome the spring bias and push the switch lever of switch 14 to an electrical connection with plug wire 44 . accordingly , when building power is on , switch 14 electrically connects building wire 24 to lead wire 34 . when building power is off , switch 14 electrically connects plug wire 44 to lead wire 34 . in like manner , a spring ( not shown ) normally biases an electrically - conductive switch lever ( not shown ) of switch 16 to an electrical connection with plug wire 46 . when no power is provided to switch 16 by way of building wire 26 , a solenoid ( not shown ) provides sufficient force to overcome the spring bias and push the switch lever of switch 16 to an electrical connection with plug wire 46 . accordingly , when building power is on , switch 16 electrically connects building wire 26 to lead wire 36 . when building power is off , switch 16 electrically connects plug wire 46 to lead wire 36 . referring to fig2 , in an exemplary embodiment , housing 12 is a closeable container . transformer 22 , relays 18 and 20 , and switches 14 and 16 are contained within housing 12 . plug lines 44 and 46 are connected to switches 14 and 16 respectively and extend through housing 12 to plug 48 ( not shown in fig2 ). opening 60 is provided in housing 12 to allow building wire lines 24 and 26 to be inserted there through for connection to switches 14 and 16 , opening 62 is provided in housing 12 to allow lead wires 34 and 36 to extend there through for connection with switches 14 and 16 . in operation , electrical power to the hvac system 50 is normally provided through the building power lines 24 and 26 . when power is available to switch 14 through building wire 24 , relay 18 biases switch 14 to connect building wire with lead wire 34 . thus , relay 18 operates to maintain switch 14 at a setting wherein switch 14 electrically connects building wire 24 to lead wire 34 . when no power is available to switch 16 , relay 20 biases switch 16 to connect building wire 26 with lead wire 36 . thus , relay 20 operates to maintain switch 16 at a setting wherein switch 16 electrically connects building wire 26 to lead wire 36 . in such configuration , power to the hvac system 50 is provided from the building power source . upon interruption of building power , electric power to lines 24 and 26 is interrupted . with no power available through lines 24 and 26 , power is not available to switches 14 and 16 , and relays 18 and 20 . in the event of power interruption to relay 18 , the relay will no longer be actively oriented to bias switch 14 to building wire 24 . the switch will then , without power , be biased to operate switch 14 to electrically connect plug wire 44 to lead wire 34 . relay 20 operates switch 16 in a similar manner to electrically connect plug wire 46 to lead wire 36 . accordingly , plug 48 may be connected to a generator 52 to provide power to the hvac system 50 . accordingly , switches 14 and 16 will be biased to connect lead wire 34 with plug wire 44 and lead wire 36 with plug wire 46 until building power is restored . upon restoration of building power , switches 14 and 16 will again be powered by means of building lines 24 and 26 , allowing the solenoids of relays 18 and 20 to again bias switches 14 and 16 to provide electrical connection of building power line 24 to lead wire 34 and building power line 26 to lead wire 36 . fig3 depicts an alternate embodiment of the invention . in this alternate embodiment building lines 24 and 26 are electrically connected to transformer 22 rather than plug lines 44 and 46 being connected to transformer 22 . switch 14 is connected to plug wire 44 and is further connected to adaptor lead wire 34 . second switch 16 is connected to plug wire 46 and is further connected to adaptor lead wire 36 . switch 14 is further connected to building wire 24 . switch 16 is further connected to building wire 26 . in the alternate embodiment shown in fig3 , relays 18 and 20 are electrically connected to transformer 22 . transformer 22 is in turn electrically connected to building wires 24 and 26 . switch 14 is operable by relay 18 . in like manner switch 16 is operable by relay 20 . in this alternate embodiment when power is provided to transformer 22 by way of building wires 24 and 26 , relay 18 operates to push the switch lever of switch 14 to an electrical connection between building wires 24 and 26 and lead wires 34 and 36 respectively . when power is provided to transformer 22 by way of building wire 24 , a solenoid ( not shown ) provides sufficient force to overcome the spring bias and push the switch lever of switch 14 to an electrical connection with building wire 24 . accordingly , when building power is on , switch 14 electrically connects building wire 24 to lead wire 34 . when building power is off , switch 14 electrically connects plug wire 44 to lead wire 34 . in like manner , relay 20 operates switch 16 to an electrical connection with plug wire 46 . when power is provided to transformer 22 by way of building wire 26 , a solenoid ( not shown ) provides sufficient force to overcome the spring bias and push the switch lever of switch 16 to an electrical connection with building wire 26 . accordingly , when building power is off , switch 16 electrically connects plug wire 46 to lead wire 36 . while a transformer 22 is depicted in the exemplary embodiment , one skilled in the art would recognize that relays 18 and 20 could be powered from the building wires 24 and 26 or the plug wires 44 and 46 without voltage transformation by utilizing relays configured to operate on building voltage . in an alternate embodiment of the invention a 120 - volt relay is used rather than a 24 - volt relay . by using a 120 - volt relay rather than a 24 - volt relay the necessity for a transformer is removed . fig4 depicts this alternate embodiment of the invention . the building wires 24 and 26 are directly electrically connected to switches 14 and 16 respectively . in a like manner , plug wires 44 and 46 are directly electrically connected to switches 14 and 16 . switches 14 and 16 are further connected to lead wires 34 and 36 . plug wires 44 and 46 are electrically connected to relays 18 and 20 . switch 14 is operable by relay 18 . in like manner , switch 16 is operable by relay 20 . in this alternate embodiment , when power is not provided to relays 18 and 20 by way of plug wires 44 and 46 , relays 18 and 20 operate to push the switch lever of switches 14 and 16 to an electrical connection between building wires 24 and 26 and lead wires 34 and 36 respectively . to further explain , when power is provided to relay 18 by way of plug wire 44 , a solenoid ( not shown ) provides sufficient force to overcome the spring bias and push the switch lever of switch 14 to an electrical connection with plug wire 44 . accordingly , when the generator 52 power is on , switch 14 electrically connects plug wire 44 to lead wire 34 . when generator 52 power is off ; switch 14 electrically connects building wire 24 to lead wire 34 . in like manner , relay 20 operates switch 16 to an electrical connection with either building wire 26 or plug wire 46 . when generator 52 power is provided to relay 20 by way of plug wire 46 , a solenoid ( not shown ) provides sufficient force to overcome the spring bias and push the switch lever of switch 16 to an electrical connection with plug wire 46 . accordingly , when generator power is on , switch 16 electrically connects plug wire 46 to lead wire 36 . in another alternate embodiment of the invention , depicted in fig5 , using a relay 120 - volt relay rather than a 24 - volt relay , both building wires 24 and 26 as well as both plug wires 44 and 46 are directly connected to switches 14 and 16 respectively . building wires 24 and 26 may be electrically connected to the relays 18 and 20 . fig5 depicts this alternate embodiment of the invention . the building wires 24 and 26 are directly electrically connected to switches 14 and 16 respectively . in a like manner , plug wires 44 and 46 are directly electrically connected to switches 14 and 16 . switches 14 and 16 are further connected to lead wires 34 and 36 . building wires 24 and 26 are electrically connected to relays 18 and 20 . switch 14 is operable by relay 18 . in like manner , switch 16 is operable by relay 20 . in this alternate embodiment , when power is provided to relays 18 and 20 by way of building wires 24 and 26 , relays 18 and 20 operate to push the switch lever of switches 14 and 16 to an electrical connection between building wires 24 and 26 and lead wires 34 and 36 respectively . to further explain , when power is provided to relays 18 by way of building wire 24 , a solenoid ( not shown ) provides sufficient force to overcome the spring bias and push the switch lever of switch 14 to an electrical connection with building wire 24 . accordingly , when building power is on , switch 14 electrically connects building wire 24 to lead wire 34 . when building power is off , switch 14 electrically connects plug wire 44 to lead wire 34 , in like manner , relay 20 operates switch 16 to an electrical connection with either building wire 26 or plug wire 46 . when power is provided to relay 20 by way of building wire 26 , a solenoid ( not shown ) provides sufficient force to overcome the spring bias and push the switch lever of switch 16 to an electrical connection with building wire 26 . accordingly , when building power is off , switch 16 electrically connects plug wire 46 to lead wire 36 . the invention includes a method of installation of adaptor 10 as depicted in fig6 . the method includes : ( 1 ) a preparation step , ( 2 ) a disconnection step , ( 3 ) a connection step , and ( 4 ) a source power step . the preparation step consists of turning off the source power to the hvac system 50 . the disconnection step consists of disconnecting the building wires 24 and 26 from the hvac power connector 54 . the connection step consists of connecting building wires 24 and 26 to switches 14 and 16 respectively . opposite to building wires 24 and 26 , lead wires 34 and 36 are then connected to switches 14 and 16 respectively . the opposite ends of lead wires 34 and 36 are then connected to hvac system 50 at hvac power connector 54 . the source power step consists of turning on the source power to the hvac system 50 . although various exemplary embodiments have been shown and described , the invention is not limited to the embodiments shown . no single embodiment is representative of all aspects of the present invention . | 7 |
fig1 illustrates a first coupling element 10 of the replaceable heel construction of this invention shown secured by glue , nails or the like to a sole 11 of a heel portion of a shoe . the coupling element comprises a pair of laterally extending and horizontally disposed wings 12 having curved outer edges which taper rearwardly for purposes hereinafter explained . it should be understood that coupling element 10 could be molded to be integrally formed with sole 11 , if so desired . an elongated channel is defined between wings 12 and has a locking groove 13 defined therein , towards the forward end of coupling element 10 . referring to fig2 a second coupling element 20 of the replaceable heel construction of this invention comprises a pair of inwardly extending flanges 21 having a flexible stem disposed in cantilevered relationship between the flanges . the stem extends forwardly on coupling element 20 and terminates adjacent the free end thereof at a resilient locking tab 23 which is adapted to engage locking groove 13 ( fig1 ) in locked relationship therewith , as hereinafter described . furthermore , serrations ( not numbered ) are formed on the extreme end of stem 22 to be gripped for release of locking tab 23 from locking groove 13 , as also hereinafter more fully described . it should be understood that coupling element 20 , defining a heel thereon , is composed of a standard rubber or plastic heel material which will exhibit sufficient elastomeric properties and flexibility to facilitate the hereinafter described coupling of elements 10 and 20 together . coupling element 10 may be constructed in a like manner . a standard leather heel layer may be secured exteriorly on coupling element 20 , if so desired . referring to fig3 and assuming that coupling element 20 in fig2 has been turned - over 180 °, the slot defined in coupling element 20 is positioned to receive wings 12 of coupling element 10 . upon full insertion of wings 12 in such slot whereby flanges 21 will underly the wings , the slot generally conforming to the configuration of wings 12 of coupling element 10 , resilient locking tab 23 will snap - down into locking groove 13 , as shown in fig3 . a wedge 24 , more clearly illustrated in fig5 is then inserted between the flat surface of stem 22 and a flat opposing surface portion of coupling member 20 to wedge locking tab 23 downwardly into locked relationship in groove 13 of coupling member 10 . wedge 24 , which may be composed of a metal or plastic material exhibiting sufficient springback and flexibility characteristics for the following purpose , has a pair of outwardly disposed flexible fingers ( fig5 ) which bend towards each other upon insertion of wedge 24 in place and then spring - back to engage the unnumbered notches illustrated in fig1 formed on the inner sides of wings 12 . such engagement will thus prevent disengagement of tab 23 from groove 13 . should it be desired to remove coupling element 20 , having the wearable heel formed thereon , from coupling element 10 , a person need only depress his thumb against the serrated end of stem 22 to depress the stem downwardly for release of wedge 24 from the notches illustrated on wings 12 in fig1 . removal of the wedge will then permit compression of stem 22 upwardly to release tab 23 from groove 13 whereby coupling element 22 may be removed from coupling element 10 . fig4 illustrates a modification of the replaceable heel construction of this invention wherein a first coupling element 10 &# 39 ; has wings 12 &# 39 ; formed thereon , corresponding to wings 12 in fig1 - 3 , which coincide with a base 25 of coupling element 10 &# 39 ;. the heel defined on a second coupling element 20 &# 39 ;, corresponding to coupling element 20 in fig1 - 3 , thus extends completely down to the sole of the shoe and is uninterrupted when viewed exteriorly . the slot formed in second coupling element 20 &# 39 ; will , of course , closely approximate the configuration of wings 12 &# 39 ; and base 25 of first coupling element 10 &# 39 ; to facilitate the illustrated coupling together of the elements . it should be further noted that wedge 24 is inserted in place to retain the elements in locked condition , in the manner described above . | 0 |
[ 0018 ] fig1 shows an enlarged cross sectional view of a part of a conductive resin plate mentioned as an example of the present invention , and the reference numeral 1 is an insulating resin skin , the reference numeral 2 a conductive core coated with the insulating skin 1 . the conductive resin plate is obtained by injection molding a composite conductive material with which a carbon nano material is blended . it is a flat plate with a thickness of 1 . 5 to 3 . 0 mm and an upper face area of 30 to 40 cm 2 , and consists of the insulating skin 1 with a thickness of 0 . 1 to 0 . 2 mm and the core 2 having conductivity brought by the carbon nano material inside of it . the surface of the conductive resin plate has an insulation characteristics of 10 10 ωcm or more in electric resistance . even if the above - mentioned conductive resin plate is in the state insulated by the surface resin , an end of a conductive part breaks through the insulating skin 1 and reaches the core 2 when the part sticks into the resin plate , therefore , the part becomes to be electrically connected with the conductive core 2 . such conductive resin plate can be used as an electromagnetic wave shield material having an insulating skin as it is , and can also be used as a base material for a laminated connector . the conductive resin plate is also applicable to many other uses than those . since the conductive core 2 is coated with the insulating skin 1 in the use as the electromagnetic wave shield material , it is unnecessary to take into account electric damage caused by contact with other electronic equipment , parts , or the like . moreover , since the surface is made by resin , the surface treatment such as mirror finishing of the surface and embellishment is also easily carried out by a conventional treatment method employed for the resin up to now . although an illustration is omitted here , the laminated connector can easily be manufactured by adhering a necessary number of stack sheets together into a laminated plate , cutting this at equal intervals into plate bodies in which the insulating skin and the conductive core are alternately placed , and only cutting the plate body to a necessary dimension in the direction orthogonal to the insulating skin . thus , a connector constituted of the conductive cores of the number equal to the stacked sheets is formed into the laminated type connector divided by the insulating skins . in a conventional laminated connector made of rubber , after a thin film of rubber provided with conductivity is alternately laminated with a thin film of insulating rubber and fix them together , the fixed one is then cut to manufacture the rubber - made laminated connector . on the other hand , using the conductive resin molded product having the insulating skin 1 eliminates the alternate lamination of the insulating skins , and the laminated plate is easily formed by mutual adhesion between the insulating skins , therefore , the manufacture is more simplified than that using rubber , and the laminated type resin connector which has been regarded as difficult to manufacture can be provided at a lower cost . moreover , the carbon nano material is ultrafine particulate and , in a blending quantity not exceeding 15 weight %, since it does not damage the characteristics of resin and injection molding can be performed under the conditions set according to a resin , special techniques are not required for molding and there is little change in the properties . therefore , the resin does not lose its characteristics by the molding , and the conductive resin plate further improved in dimensional accuracy can be obtained as the base material for parts . in order to produce the above - mentioned conductive resin plate by injection molding , composite conductive material blended the carbon nano material not exceeding 15 weight % with nonconductive resin is used . as the nonconductive resin , thermoplastic resin used as a molding material , for example , polyethylene , polyester , polyamide , polycarbonate , abs resin , and liquid crystal polymer can be used . moreover , as a carbon nano materials to be blended with the nonconductive resin , nano fiber ( having a diameter of 50 - 200 nm , preferably , 80 - 150 nm , and aspect ratio of 100 1000 ), nano carbon tube ( having a diameter of 1 - 50 nm , preferably , 10 - 50 nm , and aspect ratio of 100 - 1000 ), fullerene ( having a diameter of 0 . 7 - 1 nm ), or the like can be mentioned . since they are more ultrafine particulate than the metal powder and metal fiber which have been blended as the conductive material in the composite conductive material , they have good conformability to the resins , and have a good dispersion efficiency by kneading . as a result , the properties of the resins such as flexibility , moldability , and processability are not lost . in the aforementioned case , it is most preferable that such composite conductive material is pelletized beforehand and supplied to an injection molding machine . however , there is no difficulty in the molding even if both of the resin and carbon nano material are sufficiently kneaded by a kneader and then supplied to the injection molding machine . therefore , the composite conductive material may be supplied by either method . the molding conditions of the injection molding machine such as temperature of a heating cylinder , cooling temperature of a product mold , screw speed , injection speed and pressure are arbitrarily set according to the kind of resin adopted there . after the composite conductive material supplied from a hopper into the heating cylinder with a built - in screw is plasticized ( melted and kneaded ) by ordinary injection molding operation , the material is measured and then filled by injection into the mold by forward stroke of the screw . each illustration in fig2 shows the behaviors of the molten body 13 of the composite conductive material flowing in the cavity 12 of the mold 11 before completing the filling , and as shown in the illustration ( a ), the molten body 13 flows at the highest speed in the center part , and flows slower as it approaches to a cavity surface 12 a . moreover , as shown in the illustration ( b ), the molten body is increased in viscosity due to cooling of the mold 11 and gets difficult to flow , and the resin is cooled and solidified into the surface layer ( the skin ). from this difference in flow , a velocity gradient , namely , a rate of shear arises between the center part of the molten body 13 and the contact part with the cavity surface 12 a . thus , the resin on the cavity surface 12 a which is getting cooled and solidified is extended in the direction of the flow because of large shearing stress applied on it from the molten body 13 being press - fitted , and at the same time , the carbon nano material on the skin side is also pulled and aligned in the direction of the flow , and also becomes to be easily centralized in the center of the molten body from the skin 13 a . on the other hand , since the core 13 b is little influenced by the shearing stress and the carbon nano material exhibits anisotropy , conductivity appears . it is difficult to express conductivity by using fullerene , but an effect is obtained by using another carbon nano material together . this phenomenon is conditional on a blending quantity of a carbon nano material ; the blending quantity is preferred to be 5 - 15 weight %. in the case of a blending quantity exceeding 15 weight %, conductivity appears also on the skin 13 a and this makes it difficult to form the insulating skin 13 a out of the resin . after having completed filling the resin , the resin is cooled and solidified into the conductive resin plate comprising the skin 13 a of the resin having non - conductivity and the conductive core 13 b coated with the skin 13 a as shown in the illustration . namely , the insulating skin formed out of resin and the core coated with the insulating skin are formed by the difference in fluidity between the resin and the carbon nano material flowing in the cavity and shearing stress on the cavity surface obtained by controlling a blending quantity of a carbon nano material . conductive resin molded product form and dimensions ; flat plate ( rectangular shape ), plate thickness : 2 . 0 mm plane area of its upper face : 36 cm 2 resin ; polypropylene compounding ingredient ; carbon nano tube , 10 nm diameter , 1 to 10 μm long blending quantity ; 10 weight % conductivity ( volume surface : 10 10 ωcm or more , resistivity ); inside : 10 3 ωcm or less injection molding machine ; ps40 ( manufactured by nissei plastic industrial co ., ltd .) molding conditions ; plasticizing temperature 210 ° c . injection speed 100 mm / s injection pressure 100 mpa mold temperature 30 ° c . | 1 |
the discussion of the present invention is best broken up into two parts . the first is a physical description of the device that refers in the main to fig2 and 3 . the second is a description of the engagement and interaction of the device and a conventional stepladder . referring now to fig2 and 3 . the stepladder dolly d has one lower main frame support 5 and two vertical frame supports 10 , 20 . spanning the two supports 10 , 20 is a crossbrace and handle 30 . attached to the lower main frame support and extending completely along its length is a ladder support member 40 . as best seen in fig2 the ladder support member 40 has a pair of ladder stop means 42 integral with it and proximate the bottom edge 44 thereof . also integral to both the support member 40 and each of the stop means 42 are a pair of side member extensions 46 that extend downward and away from the support member 40 . the interaction of the ladder support member 40 , the stop means 42 , the vertical frame supports 10 , 20 , and the side member extensions 46 form a stepladder leg stop means , as will be discussed further below . it should be noted that , though in fig2 only one of the ladder stop means 42 can be seen , the other is configured identically . there is a pivotable load stop 48 that spans the two side member extensions 46 . the pivotable load stop 48 rotates on a pair of load stop pins 48 &# 39 ; that both extend through the side member extensions 46 . an example of this rotation is shown by the arrows a &# 39 ; in fig2 . also shown in fig2 is an optional tool box t , shown in broken lines frictionally attached by a pair of clips t1 , t2 to the pivotable load stop 48 . extending from the junctures of the crossbrace and handle 30 and the two supports 10 , 20 , are a pair of ladder step engagement means 50 , 60 . these extend forward parallel to one another and each further includes an angled section that has thereon a cushioned rest , 52 , 62 . at the end of each of the step stop means 50 , 60 are engagement support members 70 , 80 . these members 70 , 80 each extend vertically at a 90 ° angle to each of the stop means 50 , 60 . thus each of the engagement support members 70 , 80 lie in a plane substantially parallel to the main body supports 10 , 20 . located on each of the engagement support members 70 , 80 are ladder crossbrace engagement means 72 , 82 . both the pairs of engagement support members 70 , 80 , and the crossbrace engagement means 72 , 82 along with the adjustment means linking them will be discussed further below . rotatably attached to both of the side member extensions 46 are two wheels w . the wheels w could be thus rotatably engaged with the side members 46 by a number of means that would be obvious to any one of normal skill in the art , and these means will not be discussed further in this specification . the wheels should be of sufficient size , however , to allow the ladder , the dolly , and the lead carried thereon to be moved easily up and down stairs and the like . turning now to fig4 and 5 , the discussion turns to the way that the present invention cooperates with a conventional stepladder s . for the purposes of this discussion , a conventional stepladder will be defined as the well known household utility that has two main sections that pivot relative to one another about one pivot point ( not shown ). this point is proximate one end designated 100 in the accompanying illustrations , specifically fig1 and 4 . the two main sections of the conventional stepladder s consist of the steps 105 and step frame supports 110 and the cross braces 115 and cross brace supports 120 . the present invention is used by inverting the dolly d and placing it on a conventional stepladder s that is in an unfolded or standard usage configuration , i . e . one in which the two main sections discussed above are forming the largest angle possible at the pivot point ( not shown ). the device is placed so that a step 105 , which in the preferred embodiment discussed herein is the step nearest the end 100 , is in solid contact with the cushioned rests 52 , 62 , as seen in fig3 and 4 . thus , as also can be seen in fig3 each of the step supports 110 pass externally of either the vertical frame support 10 or the frame support 20 and the stepladder end 100 is supported on both the ladder stop means 42 . at this point the stepladder s is folded into the closed position where the two main sections are generally parallel to one another . as seen in fig4 each of the crossbrace engagement means 72 , 82 have , when viewed from the side , three crossbrace engaging slots 72a , 72b , 72c and 82a , 82b , and 82c ( see fig2 ). the crossbrace engaging slots are arranged and configured such that they engage the protruding portions 115 &# 39 ; of the cross braces 115 , as clearly seen in fig4 . at this point , the stepladder s is held securely in relation to the dolly d . laterally , it is engaged by the side members 46 , the stop means 42 , the ladder support member 40 , and the vertical frame supports 10 , 20 . these elements form a ladder leg engagement means as mentioned above . anterior or posterior movement ( towards or away from the user u as seen in fig1 ) is prevented by virtue of the crossbrace engaging members 72 , 82 and the ladder step engagement means 50 , 60 . any up or down movement that would tend to disturb the load l &# 39 ; ( shown in fig1 ) is halted by the presence of the engagement support means 70 , 80 between the two main sections of the stepladder s . turning to fig5 it is seen that the crossbrace engagement means 72 , 82 are adjustably attached to the engagement means supporting members 70 , 80 by means of a slot 200 in the crossbrace engagement means 72 , 82 and a bolt 210 that has an engaging nut ( not shown ). as above , though only crossbrace engagement means 72 is shown in fig5 it should be understood that the arrangement for engagement means 82 is similar . thus , the engagement means 72 , 82 can be moved in the directions of the arrow b &# 39 ; and fixed in place at a predetermined location . with his arrangement , the dolly d can be adapted for various brands of stepladders s wherein the spacing of the steps and crossbracings vary . likewise , the various shapes of the crossbrace engaging slots 72a , 72b , 72c , 82a , 82b , 82c in combination with the above - described adjustment means allows for even more varieties of crossbracings to be accommodated by the dolly d . it is to be understood that the present invention is not limited to the sole embodiment described above , but encompasses any and all embodiments within the scope of the following claims . | 1 |
methods and compositions are provided for the treatment of a host with a cellular proliferative disease , particularly a neoplasia . in the subject methods , a pharmaceutically acceptable cephalotaxine is administered , preferably systemically , in conjunction with an antiproliferative agent to improve the anticancer effects . in a preferred embodiment , the cephalotaxine provides a chemopotentiator effect . the agents are provided in amounts sufficient to modulate a cellular proliferative disease . in one embodiment , modulation of a cellular proliferative disease comprises a reduction in tumor growth . in another embodiment , modulation of a disease comprises inhibition of tumor growth . in another embodiment , modulation of a cellular proliferative disease comprises an increase in tumor volume quadrupling time ( described below ). in another embodiment , modulation of a cellular proliferative disease comprises a chemopotentiator effect . in another embodiment , modulation of a disease comprises a chemosensitizing effect . in other embodiments , modulation of a disease comprises cytostasis . in still other embodiments , modulation of a disease comprises a cytotoxic effect . a chemical agent is a “ chemopotentiator ” when it enhances the effect of a known antiproliferative drug in a more than additive fashion relative to the activity of the chemopotentiator or antiproliferative agent used alone . in some cases , a chemosensitizing effect may be observed . this is defined as the effect of use of an agent that if used alone would not demonstrate significant antitumor effects but would improve the antitumor effects of an antiproliferative agent as compared to use of the antiproliferative agent by itself . as used herein , the term “ cephalotaxine ” includes all members of that chemical family including alkaloid derivatives of the chinese evergreen , cephalotaxus fortueni and analogs thereof . the cephalotaxine family is defined by chemical structure as the ring structures in fig1 . a cephalotaxine analog is further defined but not limited to the structure depicted in fig1 having substituent or substitute groups at r1 and r2 . examples of r1 and / or r2 include esters , including herringtonine , isoharringtonine , homoharringtonine , deoxyharringtonine , acetylcephalotaxine and the like . table 1 lists structures of r1 and r2 for some of these analogs . r1 and r2 substitutions are typically employed to improve biological activity , pharmaceutical attributes such as bioavailability or stability , or decrease toxicity . in one embodiment , r1 and / or r2 include alkyl substitutions ( e . g ., methyl , ethyl , propyl etc .). in another embodiment , r1 and / or r2 include esters ( e . g ., methoxy , ethoxy , butoxy , etc .). r1 and r2 are not limited to the above examples , however , in the scope of this invention . as used herein , antiproliferative agents are compounds which induce cytostasis or cytotoxicity . “ cytostasis ” is the inhibition of cells from growing while “ cytotoxicity ” is defined as the killing of cells . specific examples of antiproliferative agents include : antimetabolites , such as methotrexate , 5 - fluorouracil , gemcitabine , cytarabine , pentostatin , 6 - mercaptopurine , 6 - thioguanine , l - asparaginase , hydroxyurea , n - phosphonoacetyl - l - aspartate ( pala ), fludarabine , 2 - chlorodeoxyadenosine , and floxuridine ; structural protein agents , such as the vinca alkaloids , including vinblastine , vincristine , vindesine , vinorelbine paclitaxel , and colchicine ; antibiotics , such as dactinomycin , daunorubicin , doxorubicin , idarubicin , bleomycins , plicamycin , and mitomycin ; hormone antagonists , such as tamoxifen and luteinizing hormone releasing hormone ( lhrh ) analogs ; nucleic acid damaging agents such as the alkylating agents mechlorethamine , cyclophosphamide , ifosfamide , chlorambucil , dacarbazine , methylnitrosourea , semustine ( methyl - ccnu ), chlorozotocin , busulfan , procarbazine , melphalan , carmustine ( bcnu ), lomustine ( ccnu ), and thiotepa , the intercalating agents doxorubicin , dactinomycin , daurorubicin and mitoxantrone , the topoisomerase inhibitors etoposide , camptothecin and teniposide , and the metal coordination complexes cisplatin and carboplatin . the following examples are offered by way of illustration and not by way of limitation . transplantable experimental murine fibrosarcomas ( 2 × 10 5 rif - 1 cells ) were grown intradermally in the flanks of 3 month old female c3h mice ( charles river , holister , calif .). when the tumors reached a volume of approximately 100 mm 3 , the mice were randomly assigned to each experimental group ( 4 mice per group ). the chemopotentiator , homoharringtonine , was obtained from nci and was made to the appropriate concentration in dmso . cisplatin ( david bull laboratories - mulgrave , australia , lot . 5201844x ) was made to the appropriate concentration in water for injection . the compositions were injected systemically ( i . e ., intraperitoneally , i . p . ), in a volume of 100 microliters . for the treatment of group 3 , the chemopotentiator , homoharringtonine , was injected 30 minutes prior to the injection of cisplatin . after treatment , the growth of the tumors was monitored three times per week by caliper measurements of three perpendicular diameters of the tumor and calculation of tumor volume from the formula : the tumors were followed until they reached a size of four times their day zero treatment volume ( tvqt ), or up to 30 days after treatment , whichever came first . the data is expressed as the “ tumor volume quadrupling time ” ( tvqt ) mean and as the “ delay .” mean tvqt is the mean days required for individual tumors to grow to four times the tumor volume at the initial treatment day . the “ delay ” is the median of days required for a tumor to grow to four times the mean size of the treated group , minus the median of days required to grow to four times the mean size of the control group . the data is also expressed as the ratio of the tumor volume quadrupling time of the treated tumor over the untreated control group ( tvqt / ctvqt ). increasing values of this ratio indicate increased antitumor response . the data is presented in table 3 below and in fig3 . the results of table 3 indicate that the antiproliferative activity of cisplatin is enhanced by the use of the chemopotentiator , homoharringtonine in that a more than additive effect was observed when both compounds were used to treat the tumor bearing mice ( group 3 ) in comparison to the use of cisplatin alone ( group 4 ) or homoharringtonine alone ( group 2 ). effect of homoharringtonine , alone and in combination with other chemotherapeutics on rif - 1 tumor growth in c3h mice the rif - 1 murine fibrosarcoma tumor model was used to evaluate the antitumor activity of homoharringtonine , alone and in combination with various antiproliferative agents . the antiproliferative agents used include those that affect nucleic acid ( e . g ., dna ) integrity ( e . g ., cisplatin , cytarabine , camptothecin , etoposide , 5 - fluorouracil , or amonafide ), agents that affect structural proteins ( e . g ., paclitaxel , vinblastine , or colchicine ) or cytoplasmic enzymes ( e . g ., genistein ). homoharringtonine ( hht - nci ) was obtained from nci as a powder . homoharringtonine ( hht - clin ) was obtained from hangzhou minsheng pharmaceutical group ( hangzhou , china ), in 1 ml vials , prediluted with water to 1 mg / ml . cisplatin for injection , usp , was obtained from david bull labs ( mulgrave , australia ), lot no . 5201844x , as a lypholized powder . paclitaxel was obtained from bristol myers squibb co . ( princeton , n . j . ), lot no . 9j16241 , exp . september 2001 , prediluted to 6 mg / ml in cremaphor / el . cytarabine was obtained from bedford labs ( bedford , ohio ), lot no . 86968a , exp . june 2002 , as a lypholized powder . camptothecin was obtained from boehringer - ingelheim , lot no . 142088 , as a powder . vinblastine was obtained from bedford labs ( bedford , ohio ), lot no . 112647 , as a lypholized powder . etoposide was obtained from pharmacia ( kalamazoo , mich . ), lot no . eta013 , exp . may 1999 , as a liquid prediluted to 20 mg / ml . 5 - fluorouracil was obtained from pharmacia ( kalamazoo , mich . ), lot no . ffa191 , exp . july 2000 , as a liquid prediluted to 50 mg / ml . amonafide was obtained from penta biotech ( union city , calif . ), lot no . 039 - 01 , as a powder . colchicine was obtained from sigma ( st . louis , mo . ), lot no . 55h0685 , as a powder . genistein was obtained from chemcon gmbh ( freburg i . br . ), lot no . cc - 6700 - 26 , as a powder . dmso was obtained from sigma ( st . louis , mo . ), lot no . 80k3695 0 . 9 % sodium chloride for injection , usp ( saline ) was manufactured by abbott laboratories ( lot no . 55 - 199 - dk ). sterile water for injection , usp ( wfi ) was manufactured by lyphomed , inc . ( lot no . 390849 ). for preparation of formulations 1 - 4 , hht - nci was weighed into vials and dissolved in dmso at the stated concentrations . for formulation 5 , the contents of a 10 - mg vial of lyophilized cddp ( cisplatin for injection ) was resuspended with 10 ml wfi to produce a 1 mg / ml cddp suspension . for formulation 6 , paclitaxel , prediluted in cremaphor / el and dehydrated alcohol to 6 mg / ml was further diluted to 3 . 3 mg / ml with wfi . formulations 7 and 8 were prepared by further diluting hht - clin to the stated concentrations with wfi . formulation 9 was undiluted hht - clin , used as received . formulation 10 was prepared by adding 1 ml of wfi to 100 mg of cytarabine as a lypholized powder . formulation 11 was prepared by adding dmso to camptothecin at a concentration of 1 mg / ml . formulation 12 was made by adding 0 . 9 % sodium chloride for injection to a vial of 10 mg of vinblastine lypholized powder . formulations 13 - 17 were prepared by diluting the appropriate amount of each test agent into saline ( 13 - 2 . 5 mg / ml etoposide , 14 - 7 . 5 mg / ml 5 - fluorouracil , 15 - 7 . 5 mg / ml amonafide , 16 - 2 . 5 mg / ml colchicine , 17 - 3 . 75 mg / ml 5 - fluorouracil ). formulation 18 was prepared by diluting 15 mg of genistein in 1 ml of dmso . female c3h mice ( charles river laboratories , holister , calif . ), approximately 3 months old , were used for the study . the average body weight was approximately 25 g . animals were maintained in isolator cages on a 12 - hour light - and - dark cycle . food and water were available ad libitum . the rif - 1 murine fibrosarcoma cell line was maintained in in vitro culture ( waymouth medium supplemented with 20 % fetal bovine serum ) at 37 ° c . in a humidified 5 % co 2 incubator . log - phase rif - 1 cells were trypsinized and harvested from cell culture flasks to yield a concentration of 4 × 10 6 cells / ml , then injected intradermally in a volume of 50 μl ( equivalent to 2 × 10 5 cells per injection ) into both flanks of each mouse . nine days later , when tumors reached approximately 100 mm 3 in size , the animals were randomized to different treatment groups . treatment groups are summarized in table 4 . four to five animals were assigned to each treatment group . the intraperitoneal injection volume was 100 μl . intratumoral injections ( 50 μl ) were made into one of the two tumors on each animal with the contralateral tumor serving as an untreated control . the oral administration volume was 100 μl . combination treatments using two test agents were administered as two separate injections , with the second one following the first either immediately or after 30 minutes . tumors were measured three times weekly for up to 22 days with vernier calipers . tumor volume ( cubic millimeters , mm 3 ) was calculated according to the formula : in which d 1 - 3 are perpendicular diameters measured in millimeters ( mm ) tumor volume quadrupling time ( tvqt ), defined as the time required for a tumor to grow to four times its initial volume ( at the time of treatment ), was used as a study endpoint . the tvqt was determined for each treatment group and expressed in days as the mean ± standard error ( se ). antitumor activity or modulation of tumor growth ( as measured by delayed tumor growth , i . e . increases in tvqt values ) by homoharringtonine administered as a single agent or in combination with other chemotherapeutics is presented in table 5 . results from eight separate experiments are included in this study . in experiment e010 , tumors in untreated control animals quadrupled in size in an average of 7 . 2 days . intraperitoneal administration of homoharringtonine from nci at 5 mg / kg had a tvqt of 14 . 5 days and intratumoral administration of homoharringtonine at that dose resulted in a tvqt of 15 . 6 days . in experiment e011 , untreated control animals quadrupled in size an average of 8 . 3 days while intraperitoneal administration of homoharringtonine from nci at 2 mg / kg extended the mean tvqt to 10 . 1 days , and the additional intraperitoneal administration of cddp further extended the mean tvqt to 14 . 9 days . while paclitaxel ( 10 mg / kg ), alone , demonstrated a tvqt of 8 . 8 days , the addition of homoharringtonine ( 2 mg / kg ) did not change the tvqt , making paclitaxel the only agent with combinatorial activity less than that of homoharringtonine , alone . homoharringtonine from hangzhou minsheng pharmaceutical group ( hangzhou , china ), formulated in sterile water at either 2 mg / kg or 4 mg / kg was used for the remainder of the combination studies . at 2 mg / kg , homoharringtonine had an average tvqt of 10 . 4 days in e026 while the untreated controls quadrupled in 7 . 4 days . combination administration of cisplatin ( 4 mg / kg ) with homoharringtonine ( 2 mg / kg ) yielded a tvqt of 11 . 1 days , which was greater than homoharringtonine ( tvqt = 10 . 4 days ) or cisplatin ( tvqt = 9 . 4 days ), alone . in experiment e030 , where untreated controls quadrupled in 6 . 7 days , homoharringtonine treatment ( 2 mg / kg ) yielded a tvqt of 7 . 9 days and camptothecin or cytarabine gave tvqt &# 39 ; s of 9 . 4 or 7 . 6 days , respectively . combination administration of homoharringtonine ( 2 mg / kg ) with camptothecin ( 6 mg / kg ) or cytarabine ( 400 mg / kg ) increased the tvqt &# 39 ; s to 10 . 1 and 8 . 6 days , resepectively . in e032 , where untreated controls quadrupled in 6 . 5 days , homoharringtonine at 4 mg / kg had an average tvqt of 8 . 5 days . administration of homoharringtonine ( 4 mg / kg ) in combination with 5 - fluorouracil ( 30 mg / kg ) resulted in a tvqt of 17 . 9 days versus 13 . 6 days for 5 - fluorouracil , alone . combination administration of homoharringtonine ( 4 mg / kg ) and vinblastine ( 2 mg / kg ) yielded a tvqt of 10 . 9 days versus 8 . 6 days for vinblastine , alone . combination administration of homoharringtonine ( 4 mg / kg ) and cisplatin ( 4 mg / kg ) or amonafide ( 30 mg / kg ) yielded tvqt &# 39 ; s of 10 . 4 and 10 . 2 days , respectively , versus 9 . 9 and 7 . 6 days for those agents , alone . homoharringtonine in combination with etoposide ( 10 mg / kg ) gave a tvqt of 8 . 7 days while etoposide , alone , was 8 . 5 days . orally administered colchicine ( 10 mg / kg ), in e033 , yielded a tvqt of 6 . 3 days , while untreated contols and homoharringtonine ( 4 mg / kg ) gave tvqt &# 39 ; s of 7 . 8 and 8 . 3 days . homoharringtonine in combination with colchicine at these doses increased the tvqt to 9 . 4 days . in e036 , genistein ( 60 mg / kg ) in combination with homoharringtonine ( 4 mg / kg ) had a tvqt of 9 . 2 days , which was greater than that of genistein , alone ( 7 . 1 days ). there were animal deaths in some groups that were recorded as follows . three of four mice died after treatment of homoharringtonine obtained from nci and formulated in dmso at 1 . 25 mg / ml . two of five mice died after receiving this formulation intratumorally . four of four mice died after treatment of this same homoharringtonine formulated to 2 . 5 mg / ml in dmso . the combination of homoharringtonine ( 0 . 5 mg / ml ) in dmso with paclitaxel ( 2 . 5 mg / ml ) was lethal to two of four mice , and the combination of homoharringtonine ( 0 . 5 mg / ml ) in dmso with cisplatin ( 1 mg / ml ) was lethal to one of four mice . the combination of homoharringtonine ( 1 mg / ml ) in vinblastine ( 0 . 5 mg / ml ) was lethal to one of four mice given that treatment , and the combination of homoharringtonine ( 1 mg / ml ) and genistein ( 15 mg / ml ) was lethal to two of five mice . in summary , intraperitoneal administration of homoharringtonine had antitumor activity , i . e . modulated tumor growth , in the rif - 1 murine fibrosarcoma tumor model . intraperitoneal administration of homoharringtonine in combination with cisplatin , cytarabine , camptothecin , vinblastine , etoposide , 5 - fluorouracil , amonafide , colchicine and genistein had antitumor activity levels greater than homoharringtonine alone , or the individual test agents . the best combinatorial activity used 5 - fluorouracil , amonafide and vinblastine . homoharringtonine in combination with paclitaxel had antitumor activity less than homoharringtonine alone . homoharringtonine obtained from nci and formulated in dmso showed some lethal toxicity while homoharringtonine obtained from hangzhou minsheng pharmaceutical group ( hangzhou , china ) and formulated in sterile water for use in humans did not show lethal toxicity at the doses used . | 0 |
fig1 shows a basic embodiment of the invention . here the peripheral part of a display board 1 can be seen . the display board may be made using any of a variety of materials . a maze pattern 2 is displayed and made visible on said display board 1 by electronic means selectively displaying optical display elements forming a grid on said display board 1 . the optical display elements may , for example , be liquid crystal display ( lcd ) elements or light - emitting diode ( led ) elements . the electronic means may include a memory which stores information defining the maze pattern , and means for translating this information into the actual display of the maze pattern . a variety of particular hardware and software means could be used in the said electronic means , within the scope of the invention . while it is obvious that a variety of alternative maze patterns could be displayed , within the scope of the invention , the particular maze pattern illustrated here is that of a garden maze of the british mathematician w . w . rouse ball , as cited in the 2nd scientific american book of mathematical puzzles & amp ; diversions , by martin gardner , published by simon and schuster , new york , 1961 . for this particular maze the starting point is at the location designated 3 and the goal is at the location designated 4 . again , alternative mazes of different sizes and complexity are clearly possible . the physical size of the entire electronic maze game invention can also be varied to a considerable extent , within the scope of the invention . a transparent cover element , on which lines may be marked and erased , may be installed over the grid of optical display elements . the user can then attempt to solve the maze by drawing paths on this transparent cover element . fig2 shows an embodiment of the invention with some additional features . here a memory module 5 is provided which is physically detachable from the body of the electronic maze game invention . note here that any memory in the invention may be a read only memory ( rom ), a random access memory ( ram ), or some other type of memory . any memory in this invention may also store information defining more than one maze pattern . the embodiment of fig2 is also provided with a control panel 6 , which provides a means for user interface with the invention . the control panel may be fitted with one or more buttons , touch sensors , knobs , dials , slide controls , and / or joysticks . preferably a keyboard will be provided on the control panel , with buttons or touch sensors . the control panel may be used by the user to select a given maze pattern for display . another possible use of the control panel involves commanding the display of a position marker 7 . in this embodiment additional optical display elements are provided in the interstitial blocks of the grid , and the position marker 7 is produced by the display of one of these additional optical display elements . now the user may press up / down / left / right &# 34 ; move &# 34 ; buttons which will cause the position marker to effectively move up , down , left , or right , by causing the appropriate adjacent additional optical display element to be displayed in place of the additional optical display element formerly associated with the position marker . electronic means for forbidding movement of the position marker across boundaries of the displayed maze pattern can be provided . therefore in this embodiment the user can attempt to solve the maze by pressing the &# 34 ; move &# 34 ; buttons in some appropriate time sequence ( or by operating a joystick or other control means ) so as to cause the position marker to move through the maze , hopefully from the starting point to the goal . an alternative &# 34 ; move &# 34 ; command may move the position marker , but cause the additional optical display element corresponding to the former position of the position marker to continue to be displayed . in this way a space sequence or visible path of additional optical display elements can be built through the maze . optionally , when the position marker is made to retrace its path , the retraced portion display may be &# 34 ; erased &# 34 ;. several other variations and alternative games may also be implemented using the device invented here . the embodiment of fig2 is finally also provided with a digital display 8 . this display may display the identifying alphanumeric code of the maze pattern currently displayed ; or the number of steps taken or the time elapsed from the start to the finish of the maze solution . one more interesting possible variant of the invention incorporates means for producing a time varying maze pattern display . the maze pattern may be varied in a predetermined manner governed by some algorithm , or in some random manner . in this way an additional element of excitement and difficulty can be added to the solution of the maze . fig3 shows a variety of grids formed by optical display elements , which grids may be used in alternative embodiments of the invention . several different grids may also be superposed in a single embodiment of the invention . all the optical display elements are visible here to more clearly illustrate the grid patterns - note that only selected optical display elements will be visible in any given maze pattern display . note that optical display elements with width to length ratios larger than those shown here may be used in the invention . fig3 a shows a rectangular grid . fig3 b shows a square grid . fig3 c shows a triangular grid . fig3 d shows a hexagonal grid . in each of these four illustrations , one of the optical display elements is designated 9 , and one of the interstitial blocks of the grid is designated 10 . numbering is not applied to all of the optical display elements nor to all of the interstitial blocks of the grids , to keep the illustrations from getting too cluttered . note that any two - dimensional space filling regular polygonal grid pattern may be used in the invention . a variety of other grids may also be used in the invention . the power supply for the invention will preferably be an electric power supply . one or more batteries or househiold ac power may be used . if one or more batteries are used , means for battery recharging may also be provided . while certain preferred embodiments of the invention have been described in detail above , it is to be understood that further modifications and variations can be made within the scope of the invention as defined in the appended claims . | 0 |
the following examples are intended to describe the invention in detail , without limiting it to exemplary disclosed substances and methods . the proteins uvsxh6 , uvsxh6 - 2 , h6uvsx und h6uvsx - 2 were used as npf forming proteins ( see fig1 ). amino acids 1 - 391 : uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 1 - 391 ), amino acids 392 - 394 : linker consisting of the amino acids g 392 gs 394 , amino acids 395 - 400 : h 395 hhhhh 400 for purification by nickel chelate affinity chromatography , amino acid exchange : l 43 → p . amino acids 1 - 391 : uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 1 - 391 ), amino acids 392 - 394 : linker consisting of the s 392 yg 394 , amino acids 395 - 400 : h 395 hhhhh 400 , amino acids 401 - 403 : c - terminus consisting of the amino acids m 401 ys 403 amino acids 1 - 4 : n - terminus consisting of the amino acids m 1 sys 4 , amino acids 5 - 10 : h 5 hhhhh 10 , amino acids 11 - 13 : linker consisting of the amino acids s 11 yg 13 , amino acids 14 - 404 : uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 1 - 391 ), amino acid exchange : q 340 → l . amino acids 1 - 4 : n - terminus consisting of the amino acids m 1 gys 4 , amino acids 5 - 10 : h 5 hhhhh 10 , amino acids 11 - 13 : linker consisting of the amino acids s 11 yg 13 , amino acids 14 - 404 : uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 1 - 391 ). for the expression of the aforementioned proteins in suitable escherichia coli cells , plasmids were constructed containing a coding sequence for uvsxh6 , uvsxh6 - 2 , h6uvsx or h6uvsx - 2 under the control of the lac promotor ( pexh - uvsxh6 , pexh - uvsxh6 - 2 , pexh - h6uvsx or pexh - h6uvsx - 2 , see fig1 ). the plasmids were generated by ligation of two pcr products . the first pcr product was amplified from pmcs5 ( mobitec , göttingen , germany ). pmcs5 is constructed in a similar way as pbluescript sk (−) ( stratagene ) and is only different in the 5 ′ region of the coding sequence of the laczα fragment . pmcs5 therefore contains the lac promotor followed by the lac operator , by which the expression of an inserted coding sequence is based on the absence of active lac repressor . in order to achieve constitutive expression in any case , the amplification primers were selected in such way , that the lac operator is not present anymore in the pcr product . the resulting pcr product corresponded to pmcs5 from position 992 to 664 plus restriction overhangs . the nucleotides gaattc ( ecori restriction site ) as well as tgtgtg were added before position 992 ( 3 ′ to the lac promotor ), and the nucleotides actagt ( spe i restriction site ) and cacaca were added behind position 664 to enable the ligation after digestion with the restrictions enzymes ecori and spei . the coding sequence for uvsxh6 , uvsxh6 - 2 or h6uvsx and h6uvsx - 2 was obtained by pcr amplification of t4 dna using primers which contain the desired restriction sites , a ribosomal binding site and the additional codons . at their 5 ′ end before the start codon , the pcr products contained the additional nucleotides 5 ′- cacacagaattcataaaggaagatatcat - 3 ′ ( seq id no : 2 ), as well as the additional nucleotides 5 ′- actagttgtgtg - 3 ′ ( seq id no : 3 ) at their 3 ′ end after the stop codon . an overnight culture of pexh - h6uvsx in dh5 was inoculated with 1 . 5 - 3 l dyt / ampicillin ( 200 μg / ml ) 1 : 1000 , and was grown over night at 37 ° c . with 250 upm . the cultures were harvested at 7000 × g , and yielded approx . 5 - 15 g bacteria sediment . this was frozen for 1 - 3 days at − 20 ° c . the sediment was thawed on ice and resuspended in 10 - 20 ml cold starting buffer . the lysis was carried out under slow stirring for 1 h at 4 ° c . using 10 ml lysozym ( serva , 190 . 000 u / mg ) and approx . 4 g glass beads ( sigma , g - 8893 ). then , 50 μl dnase i ( serva , 2 mg / ml ) were added and further incubated for another 30 min . after centrifugation of the lysate ( 45 min , 11 . 000 × g , 4 ° c . ), the supernatant was filtered through a sterile filter ( pore size 0 . 45 μm ) and loaded on an equilibrated 1 ml hitrap ™ chelating column ( pharmacia ) preloaded with ni ++ ions . the further purification steps were carried out according to the respective pharmacia protocol for proteins containing a histidin hexamer . aliquots of the various elution fractions were added to sds / coomassie gels . the purest fractions were combined and further concentrated in centriplus ym30 columns ( millipore ) according to the respective protocol . then , it was dialyzed twice ( dialysis tube : spectra / por , mwco : 25 . 000 ) against an at least one thousand - fold volume of zi buffer for at least one hour at 4 ° c ., then over night at 4 ° c . against zi buffer / 50 % glycerine . the dialysate was aliquoted in 30 - 50 μl fractions and stored at − 80 ° c . zi buffer : 76 mm k 2 hpo 4 , 17 mm kh 2 po 4 , 14 mm nah 2 po 4 , ph = 7 . 2 starting buffer : 20 mm pi , 0 . 5 m nacl , 10 mm imidazole , ph = 7 . 4 washing buffer : 20 mm pi , 0 . 5 m nacl , 20 - 50 mm imidazole , ph = 7 . 4 elution buffer : 20 mm pi , 0 . 5 m nacl , 100 - 500 mm imidazole , ph = 7 . 4 the concentration of the uvsx proteins was determined by measuring the od 280 using the extinction coefficient calculated with the gene inspector ™ ( textco , inc .) software . for h6uvsx it was 2 . 5 - 3 . 5 μg / 11 . h6uvsx , purified over ni ++ sepharose , was incubated with 200 ng of a 1 kb pcr fragment ( with and without 1 mm atp - γ - s ). a shift of the dna in the agarose gel caused by protein binding shows , that h6uvsx binds double - stranded dna based on the concentration , and that this binding is enhanced by atp - γ - s . with atp - γ - s , protein - dna complexes are formed which can be stained more intensely with ethidium bromide than without atp - γ - s , which indicates a topological change of the nucleoprotein filament by the nucleotide analog . generation of a transfecting agent , based on uvsx as npf forming protein with a nuclear localization signal as a functional component as in example 1 , plasmids were generated which permit the expression of the fusion proteins uvsxh6n2 , uvsxh6n2 - 2 , n2h6uvsx and n2h6uvsx - 2 , which are based on the proteins described in example 1 , and in addition contain a nuclear localization signal ( see fig1 ). amino acids 1 - 391 : uvsx from the phage t4 ( ncbi protein accession no . : aad42669 , amino acids 1 - 391 ), amino acids 392 - 394 : linker consisting of the amino acids g 392 gs 394 , amino acids 395 - 400 : h 395 hhhhh 400 , amino acids 401 - 403 : linker consisting of the amino acids g 401 gs 403 , amino acids 404 - 417 : nuclear localization signal nls - 2 ( amino acids 2 - 15 , seq id no : 9 from wo 00 / 40742 ), amino acids 418 - 421 : c - terminus of uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 388 - 391 ), amino acids 422 - 426 : c - terminus consisting of the amino acids k 422 lvtg 426 , amino acid exchange : y 238 → v . amino acids 1 - 391 : uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 1 - 391 ), amino acids 392 - 394 : linker consisting of the amino acids s 392 yg 394 , amino acids 395 - 400 : h 395 hhhhh 400 , amino acids 401 - 403 : linker consisting of the amino acids m 401 s 403 , amino acids 404 - 417 : nuclear localization signal nls - 2 ( amino acids 2 - 15 , seq id no : 9 from wo 00 / 40742 ), amino acids 418 - 420 : c - terminus consisting of the amino acids g 418 yp 420 . amino acids 1 - 3 : n - terminus consisting of the amino acids m 1 sy 3 , amino acids 4 - 17 : nuclear localization signal nls - 2 ( amino acids 2 - 15 , seq id no : 9 from wo 00 / 40742 ), amino acids 18 - 20 : linker consisting of the amino acids l 18 ys 20 , amino acids 21 - 26 : h 21 hhhhh 26 , amino acids 27 - 29 : linker consisting of the amino acids s 27 yg 29 , amino acids 30 - 420 : uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 1 - 391 ), amino acid exchange : q 356 → l . amino acids 1 - 4 : n - terminus consisting of the amino acids m 1 gyp 4 , amino acids 5 - 18 : nuclear localization signal nls - 2 ( amino acids 2 - 15 , seq id no : 9 from wo 00 / 40742 ), amino acids 19 - 21 : linker consisting of the amino acids s 19 ys 21 , amino acids 22 - 27 : h 22 hhhhh 27 , amino acids 28 - 30 : linker consisting of the amino acids s 28 yg 30 , amino acids 31 - 421 : uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 1 - 391 ). for the expression in suitable escherichia coli cells , plasmids were constructed containing a coding sequence for uvsxh6n2 , uvsxh6n2 - 2 , n2h6uvsx or n2h6uvsx - 2 under the control of the lac promotor ( pexh - uvsxh6n2 , pexh - uvsxh6n2 - 2 , pexh - n2h6uvsx or pexh - n2h6uvsx - 2 , see fig1 ). the plasmids were generated as described in example 1 by ligation of two pcr products ( see fig1 ). the purification of uvsxh6n2 was carried out as described in example 1 ) for h6uvsx . uvsxh6n2 binds to double - stranded dna . the binding is stabilized by atp - γ - s : in order to examine the influence of various atp analogues on the binding performance of uvsxh6n2 to dna , the protein was first incubated with a 1 kb dna fragment and various atp analogues . then , a 1 . 7 kb dna fragment was added for competition . if the binding of the protein to the dna is stabilized by addition of an atp analog , it can be expected that uvsxh6n2 less likely binds a competing dna fragment as long as no equilibrium is present . as can be seen in fig3 , the protein - dna complex which was generated with the 1 kb fragment and uvsxh6n2 , remains stable in absence of atp - γ - s and the 1 . 7 kb fragment , compared to all other used atp analogues , i . e . the 1 . 7 kb fragment apparently is not or only marginally occupied by liberated uvsxh6n2 molecules within the observation time . generation of a transfection agent with a mixture of modified and unmodified npf - forming protein various ratios of h6uvsx and uvsxh6n2 were incubated with a 1 kb dna fragment . the two proteins retarded the dna in different degrees , due to their different molecular weight ( see column 2 and 3 of fig4 ). if the proteins are mixed before addition of dna , intermediate complexes are formed based on the ratio of h6uvsx to uvsxh6n2 , which yield a sharp band and therefore have an equal mean molecular weight . this shows that the dna is statistically equally occupied by both proteins . transfection of a cell line ( nih3t3 ) with uvsx - nls in combination with electroporation nih3t3 - zellen ( adherent , cultivated until 70 - 80 % confluent ) were transfected with a vector coding for the heavy chain of the murine mhc class i proteins h - 2k k . 1 × 10 6 cells were electroporated with 25 ng vector dna which has been preincubated in binding buffer ( 76 mm k 2 hpo 4 , 17 mm kh 2 po 4 , 14 mm nah 2 po 4 , 5 mm mgcl 2 ph 7 . 21 ) with 14 μg uvsx or uvsx - nls as well as with or without 1 mm atp - γ - s for 30 minutes at room temperature . for this , the cells were added to a total volume of 100 μl electroporation buffer ( 103 mm nacl , 5 . 36 mm kcl , 0 . 41 mm mgcl 2 , 23 . 8 mm nahco 3 , 5 . 64 mm na 2 hpo 4 , 11 . 2 mm glucose , 0 . 42 mm ca ( no 3 ) 2 , 20 mm hepes , 3 . 25 μm gluthathione ) and electroporated in a cuvette with 2 mm electrode spacing . the electroporation was carried out by an exponential discharge at a voltage of 240 v and a capacity of 450 μf . the half - life of the voltage drop was typically 12 msec . immediately after the electroporation , the cells were flushed out of the cuvettes with culture medium ( rpmi with 10 % fcs ), incubated for 10 min at 37 ° c ., and then transferred to a culture dish with prewarmed culture medium . after 6 h incubation , the cells were harvested and washed twice with pbs , and then incubated with a cy5 - coupled anti - h - 2k k antibody and analyzed flow - cytometrically ( facscan ). the number of dead cells was determined by staining with propidium iodine . six hours after the electroporation , 7 . 4 % or 8 . 7 % of the cells transfected with free vector dna express the h - 2k k protein ( minus the background of 0 . 25 % in average ). in comparison , the expression rate of the cells that have been transfected with vector uvsx was 2 . 9 % or 3 . 8 %. the expression rate after a transfection with vector uvsx - nls was 19 . 2 % or 18 . 9 % ( see fig5 a - 5 d ). for examination of the nuclear transport , the physical procedure of electroporation was chosen so that no other biochemical components except uvsx influence the transfection . the tight binding of uvsx with atp - γ - s to dna , however , impairs the mobility of the complex in the electric field and therefore reduces the efficiency of the electroporation by approx . 60 %. the attachment of a nuclear transport signal alone results in an increase of the expression shortly after the transfection by a factor of averagely 5 . 7 in this system . the increase of the expression rate by uvsx - nls compared to uvsx therefore demonstrated that using a nuclear transport signal as functional component , dna is transported into the nucleus by uvsx . an analysis performed shortly after the transfection is significantly improved since even cells become accessible that have not divided between transfection and analysis . transfection of a cell line ( nih3t3 ) with uvsx - scrambled - nls or uvsx - nls in combination with electroporation in order to test the influence of the nuclear localization signal on the transfection , an uvsx derivative was generated for comparison purposes which corresponds in its net charge to an uvsx protein with a nls , but itself does not contain a functional nls . using partly homologous oligonucleotide primers , the uvsx gene was amplified from plasmid pexh - uvsxh6n2 - 2 ( compare fig1 ), so that the amino acid sequence seq id no : 1 (“ scrambled ”, i . e . a mixed nls sequence ) is expressed at the c - terminus of the resulting protein uvsxh6n2sc instead of the amino acid sequence eedtppkkkrkved ( seq id no : 4 ) (“ nls - 2 ”, corresponding to the amino acids 2 - 15 from seq id no : 9 from wo 00 / 40742 ). the scrambled amino acids correspond to the described nls - 2 with respect to their composition but not with respect to their order . the net charges of uvsxh6n2 - 2 and uvsxh6n2sc are therefore equal , but only uvsxh6n2 - 2 contains an intact nuclear localization signal . the protein uvsxh6n2sc was purified as described for the proteins in example 1 . nih3t3 cells ( adherent , cultivated until 70 - 80 % confluent ) were transfected with this vector coding for a fluorescent marker protein . for this purpose , 25 ng vector dna in binding buffer ( see example 1 ) were initially incubated with 1 . 5 mm atp - γ - s and 16 - 18 μg of the described proteins for 30 min at room temperature . the protein - dna complexes were each added to 3 × 10 5 nih3t3 - zellen , resuspended in 80 μl electroporation buffer ( 140 mm na 2 hp 4 / nah 2 po 4 , 10 mm mgcl 2 , 5 mm kcl , ph 7 . 2 ). the electroporation was carried out in a cuvette with 2 mm electrode spacing by an exponential discharge at a voltage of 240 v and a capacity of 450 μf , the half life of the voltage drop was typically 12 msec . after addition of 400 μl medium , composed of rpmi 1640 , gibco company , 5 % fcs , 2 mm glutamax ( l - alanyl - l - glutamine , invitrogen ), 100 u / ml penicillin / streptomycin , 0 . 5 mm β - mercaptoethanol , the cells were added to culture dishes ( 6 - well plates ) with 1 ml prewarmed medium and were incubated at 37 ° c . and 5 % co 2 . after 6 h , the flow - cytometric analysis was carried out ( facscan ). the result is graphically shown in fig6 : 9 % of the cells transfected with free vector dna express the marker protein . the expression rate of the cells that have been transfected with vector - uvsx - nls ( dna + uvsxh6n2 - 2 ), however , was 21 %. in comparison , the expression rate of the cells after transfection with vector - uvsx - scrambled - nls ( dna + uvsxh6n2sc ) was only 4 %. uvsx , modified with a nuclear localization signal therefore results in a markedly increased efficiency compared to free dna and also compared to the modification by a non - functional nuclear localization signal . since the latter transfection represents the control , this means that the transfection efficiency could be increased to 5 - fold by modification of the uvsx . therefore , the transfection efficiency can be markedly increased by the method according to the invention or the transfection agent . furthermore a targeted control of the transfection method , here , for example , a directing into the nucleus , is possible in an advantageous way when the npf - forming protein is modified ( see also example 6 ). 140 ng of a 1 . 7 kb expression vector dna fragment were incubated with 9 μg modified uvsx protein as described above in binding buffer and 1 mm atp - γ - s in a final volume of 20 μl for 30 min at rt . bsa - cy5 was used as injection marker immediately before the injection in a concentration of approx . 1 μg / μl . nih3t3 cells that had been seeded to subconfluency the day before on cellocate coverslips ( eppendorf ) were microinjected through samples loaded onto femtotipps ( eppendorf ) using a micromanipulator and transjector ( eppendorf ) under an inverse fluorescence microscope ( leica dmil ). the analysis was carried out in a fluorescence microscope ( olympus bx 60 fluorescence microscope , digital b / w camera spot - rt from diagnostic instruments inc ., analysis software : metaview imaging system from universal imaging corporation ) after 5 hours of further incubation of the cells at 37 ° c . and 5 % co2 . fig7 shows microinjected nih3t3 cells . the images 1 and 2 show cells that were injected with dna and uvsxh6n2sc into the cytoplasm , the images 3 and 4 show cells that were injected with dna and uvsxh6n2 - 2 , and images 5 and 6 show cells that were injected only with dna . expression was only observed when the protein - dna complexes contained uvsxh6n2 - 2 , i . e . an uvsx protein modified with a nuclear localization signal ( fig7 , image 3 ). in the cells of the controls ( fig7 , image 5 : only dna , or fig7 , image 1 : dna with uvsx - scrambled - nls ) that had been clearly injected only in the cytoplasm and not in the nucleus during microinjection , no expression was observed , not even using a very long exposure . cloning , expression and purification of the sasp protein from b . subtilis the sspc gene from bacillus subtilis , which codes for a sasp (“ small acid - soluble spore protein ”), was synthesized from 8 oligonucleotides according to the khorana method ( described in bertram and gassen : gentechnische methoden , gustav fischer verlag , 1991 , p . 212 - 213 ) and ligated between the ncoi and bglii restriction sites of the plasmid para13 ( cagnon et al ., 1991 ; protein engng . 4 : 843 - 847 ). this was based on the protein sequence with the ncbi protein accession no : np — 389876 . the reverse transcription to dna was carried out using the codon preferences of genes , strongly expressed in e . coli and described in ( andersson and kurland 1990 ; microbiol . rev . 54 : 98 - 210 ). the resulting plasmid para13 - sasp served as a matrix for the cloning of two other plasmids , which code for sasp proteins , carrying a polyhistidine sequence of 6 histidines either at the n - terminus ( h6 - sasp ) or at the c - terminus ( sasp - h6 ) ( fig8 ). the plasmids were transformed into the e . coli strain bl21 ( de3 ) plyss ( novagen , madison ) and plated out on lb / ampicillin / glucose ( 0 . 2 %). 20 ml m9 minimal medium ( 0 . 2 % glucose ) each was inoculated with single colonies and grown over night at 37 ° c . and 220 rpm . the following day , the cultures were induced with 0 . 2 % arabinose at an od 600 of approx . 1 . 0 and were grown for another 6 hours . raw extracts ( 0 . 5 ml pelleted culture in pbs / loading buffer ) were applied to high resolution sds gels ( according to schägger and von jagow 1987 ; anal . biochem . 166 : 368 - 79 ) and stained with coomassie blue ( fig9 a ). for preparative purification , 2 l m9 / glucose were inoculated 1 : 200 with an overnight culture . again , the culture was induced with 0 . 2 % arabinose at an od 600 of approx . 1 . 0 , and further grown for 6 h . the bacteria were then pelleted and frozen at − 20 ° c . in the following , the purification of sasp - h6 is described exemplary . approx . 7 g of the pellet was thawed and resuspended in 14 ml starting buffer ( see example 1 ), supplemented with a tablet of complete edta - free protease inhibitor cocktail , roche , mannheim , and sonificated on ice for 3 min at 280 watts ( labsonic u , braun biotech , melsungen repeating duty puls ; 0 . 5 sec ). the extract was centrifuged at 4 ° c . apart from this , the purification was carried out as described for the uvsx proteins over hitrap chelating columns ( amersham pharmacia , uppsala ). the fractions between 200 mm and 500 mm imidazole , containing the protein in high concentration , were combined and concentrated to approx . 3 ml using centriplus columns ( ym - 3 , millipore , eschborn ). the sasp protein was then dialyzed three times against 1 × zi buffer ( see example 1 ), and aliquots were frozen at − 80 ° c . in a concentration of approx . 5 μg / 11 . 125 ng ( in each case ) of a 1 . 7 kb dna fragment were preincubated with different amounts of sasp - h6 protein in 1 × zi buffer or 1 / 10 × zi buffer for 30 min at room temperature , and then applied to an 0 . 8 % tae - agarose gel . fig9 b shows that the dna is completely bound by the protein . the diffuse appearance of the dna - protein bands may be due to a dissociation of the proteins from the dna during the gel run . generation of a transfection agent based on sasp as npf - forming protein with a nuclear localization signal as modification for generation of an sasp with a nuclear localization signal ( nls ) as functional component , a dna sequence coding for a nuclear localization signal (“ nls - 2 ”, amino acids 2 - 15 , seq id no : 9 from wo 00 / 40742 ) was added to the c - terminus of the already available clone para13 - sasp - h6 ( see fig8 ) by pcr amplification . the aforementioned plasmid served as pcr template . the resulting plasmid para13 - sasp - h6n2 ( see fig8 ) was transformed as described in example 7 , and the protein sasp - h6n2 was purified accordingly . 125 ng each of a 1 . 7 kb dna fragment were preincubated with different amounts of sasp - h6n2 protein in 1 × zi - puffer for 30 min at room temperature , and then applied to a 0 . 8 % tae - agarose gel . fig1 b shows that the dna is held back by the nls - modified sasp as well . the dna protein bands appear diffuse . generation of a transfection agent with a integrin binding motif for the association of the complex to the cell surface as functional component integrins are membrane - anchored adhesion proteins on the cell surface some of which recognize a peptide motif of three amino acids ( arginine - glycine - aspartic acid or “ rgd ” motif ) as binding partner . the binding results in clustering of several integrin molecules on the cell surface and in endocytosis ( plow et al ., 2001 ). by modification of uvsx as npf - binding protein with an rgd motif , it can be achieved that the transfection agens can be taken up specifically via integrins into the endosomal compartments of the cells . the used proteins h6uvsx and uvsxh6n2 - 2 are identical to the ones shown in fig1 and described in example 1 and 2 . the protein h6uvsx *( rgd2 ) was generated by chemical coupling . the protein named rgd2 is a nonapeptide ( nitrgdtyi ) consisting of the penton base protein of adenovirus type 7 ( bal et al ., 2000 ), which has been synthesized in such way that a chemically active group is present at the n - terminal amino group ( smcc , succinimidyl 4 -[ n - maleimidomethyl ]- cyclohexane - 1 - carboxylat ) which permits the coupling to free cysteine sh groups in the uvsx protein . for the coupling , 6 nmol h6uvsx were incubated with 60 nmol peptide in 76 mm k 2 hpo 4 , 17 mm kh 2 po 4 , 14 mm nah 2 po 4 , ph = 7 . 2 for one hour at 37 ° c ., and was then purified by several washing steps with incubation buffer over a microcon filter ( 10 kda cut off ) to remove excess peptide . the successful coupling was detected by an altered running performance in an sds polyacrylamide gel electrophoresis . fig1 shows two independently generated preparations of h6uvsx *( rgd2 ) on an sds polyacrylamide gel . the coupled peptide results in an increase of the molecular weight and thus in an alteration of the running performance in sds gels . binding of uvsx - nls and uvsx - rgd to double - stranded dna and formation of mixed npfs : reactions with 140 ng ( in each case ) of a purified 1 . 6 kb pcr dna fragment with a mixture of 15 μg h6uvsx *( rgd2 ) and 4 μg uvsxh6n2 - 2 , with 4 μg uvsxh6n2 - 2 alone and with 15 μg h6uvsx *( rgd2 ) alone were incubated in 76 mm k 2 hpo 4 , 17 mm kh 2 po 4 , 14 mm nah 2 po 4 , ph = 7 . 2 , 5 mm mgcl 2 and 1 mm atp - γ - s in a final volume of 20 μl for 30 min at room temperature and were then transferred to a 0 . 8 % tae / agarose gel which was afterwards stained with ethidium bromide . the electrophoresis was carried out at 100 v for 1 h . fig1 shows that the two differently modified proteins form npfs with the dna which markedly differ in their running performance . npfs consisting of a double - stranded dna fragment and a mixture of h6uvsx *( rgd2 ) and uvsxh6n2 - 2 ( lane 1 ), or of uvsxh6n2 - 2 alone ( lane 2 ) or of h6uvsx *( rgd2 ) alone ( lane 3 ), were separated electrophoretically in an agarose gel . since protein is present in low amounts , free dna fragment is present as well . both proteins in a reaction bind together to the dna fragment and result in a mixed npf that has a molecular weight that lies between that of the npfs of the pure proteins ( lane 1 ). from this it can be concluded that uvsx - nls and uvsx - rgd bind to double - stranded dna and can form mixed npfs . as in example 1 , plasmid uvsxh6n2nit - 2 ( fig1 ) which permits the expression of a fusion protein of uvsx and an integrin - binding rgd motif , was generated recombinantly . amino acids 1 - 391 : uvsx from the phage t4 ( ncbi protein accession no . : aad42669 , amino acids 1 - 391 ), amino acids 392 - 394 : linker consisting of the amino acids s 392 yg 394 , amino acids 395 - 400 : h 395 hhhhh 400 , amino acids 401 - 403 : linker consisting of the amino acids m 401 ys 403 , amino acids 404 - 417 : nuclear localization signal nls - 2 ( amino acids 2 - 15 , seq id no : 9 from wo 00 / 40742 ), amino acids 418 - 420 : c - terminus consisting of the amino acids g 418 yp 420 and amino acids 421 - 432 : rgd motif “ nit ”: n 421 trgdtyipyp 432 ( seq id no : 5 ). 1 μg each of a purified 1 . 6 kb pcr dna fragment containing alexafluor488 - labeled dutp ( molecular probes , eugene , oreg ., usa ) instead of dttp , was incubated in 76 mm k 2 hpo 4 , 17 mm kh 2 po 4 , 14 mm nah 2 po 4 , ph = 7 . 2 , 5 mm mgcl 2 and 1 mm atp - γ - s with 100 μg purified uvsxh6n2 or uvsxh6n2nit - 2 in a final volume of 200 μl for 30 min at room temperature . then , 10 μl of each npf reaction was applied to a 0 . 8 % tae / agarose gel which was subsequently stained with ethidium bromide . the electrophoresis was carried out for 1 hour at 100 volts . fig1 shows that the dna was completely retarded . thus , the dna binding of the proteins is not hampered by the fluorescein labelling of the dna . nih3t3 cells were plated in 6 well plates ( 3 × 10 5 per well ), incubated over night at 37 ° c . and 5 % co 2 , and were washed the next morning with prewarmed fcs - free medium ; afterwards 2 ml fcs - free medium was added . 190 μl of the npf reactions were added ( see above ), incubated for 30 min at room temperature , the supernatant was removed , the cells were washed and covered with 3 ml medium ( with 10 % fcs ). after another incubation for 1 hour at 37 ° c . in the incubator , the analysis was carried out under the fluorescence microscope . in fig1 a and 14 b , one picture each is shown in bright field ( lower ) and reflected light fluorescence ( upper ) in the bright field , vesicular intracellular compartments are visible which glow in the fluorescent light due to the endocytosed dna ( fig1 a , b , upper ). from each well , several pictures were taken . the cells were counted and the proportion of cells containing at least one fluorescent vesicular compartment was determined in percent ( shown in fig1 ). each picture shows a mean of 35 cells . of the reactions with uvsxh6n2nit - 2 , nine pictures were analyzed , and of the reactions with uvsxh6n2 - 2 , five pictures were analyzed . the result shows that the modification of uvsx with an integrin - binding motif as a functional component ( uvsxh6n2 - nit - 2 ) results in a markedly increased endocytotic uptake of the transfection agents in the cells compared to the control ( uvsxh6n2 - 2 ). generation of a transfection agent based on hrad51 as npf - forming protein the proteins hrad51h6 and hrad51h6n2 were used as npf - forming proteins ( see fig1 ). amino acids 1 - 339 : human rad51 ( ncbi protein accession no : q06609 , amino acids 1 - 339 ), amino acids 340 - 343 : linker consisting of the amino acids y 340 syg 343 , amino acids 344 - 349 : h 344 hhhhh 349 for purification by nickel chelate affinity chromatography , amino acids 350 - 352 : c - terminus consisting of the amino acids m 350 ys 352 . amino acids 1 - 339 : human rad51 ( ncbi protein accession no : q06609 , amino acids 1 - 339 ), amino acids 340 - 343 : linker consisting of the amino acids y 340 syg 343 , amino acids 344 - 349 : h 344 hhhhh 349 for purification by nickel chelate affinity chromatography , amino acids 350 - 352 : linker consisting of the amino acids m 350 ys 352 , amino acids 353 - 366 : nuclear localization signal nls - 2 ( amino acids 2 - 15 , seq id no : 9 from wo 00 / 40742 ), amino acids 367 - 369 : c - terminus consisting of the amino acids g 367 yp 369 . for expression of the above mentioned proteins in suitable escherichia coli cells , plasmids were constructed that contain a coding sequence for hrad51h6 or hrad51h6n2 under the control of the lac promoter ( pexh - hrad51h6 or pexh - hrad51h6n2 , see fig1 ). pexh - uvsxh6 - 2 and pexh - uvsxh6n2 - 2 were used as source plasmids ( see fig1 ). the coding region for uvsx was cut out with ecor v and bsiw i , and replaced by a pcr fragment with the coding region for hrad51 which had been cut out in the same way . this was amplified from a human cdna library using hrad51 - specific primers that contain the desired restriction sites . at the 5 ′- end before the start codon , the pcr products contained the additional nucleotides 5 ′- cacacatctagacgtacggatatcat - 3 ′ ( seq id no : 6 ), and at their 3 ′- end they contained the additional nucleotides 5 ′- tactcgtacggaggtggcggccgctgtgtg - 3 ′ ( seq id no : 7 ) instead of the stop codon . a preculture of 5 ml dyt / ampicillin ( 100 μg / ml ) was inoculated with a colony of pexh - rad51h6 or pexh - rad51h6n2 in dh5 , and was grown for 5 hours at 37 ° c . with 250 rpm . 10 l dyt / ampicillin ( 100 μg / ml ) was inoculated with this preculture , and was allowed to grow for another 24 hours at 37 ° c . with 210 upm . the cultures were harvested at 7000 × g , and yielded approx . 30 - 50 g bacterial pellet . this was frozen for 1 - 3 days at − 20 ° c . the pellet was thawed on ice , and resuspended in 100 ml cold starting buffer . the cells were then solubilized by ultrasound using a b . braun labsonic u ( large probe , parameters : 300 watts , 0 . 5 sec pulse duration per second , 8 min sonification ). then it was incubated with 10 mg lysozyme ( serva , 190 . 000 u / mg ) for 1 hours at 4 ° c . and for another 30 min after addition of 50 μl dnase i ( serva , 2 mg / ml ) with slow stirring . after removing the lysate by centrifugation ( 45 min , 18000 × g , 4 ° c . ), the supernatant was filtered through sterile filters ( pore sizes 0 . 45 μm and 0 . 2 μm ) and loaded on an equilibrated 1 ml hitrap ™ chelating column ( pharmacia ) preloaded with ni ++ ions . the further purification steps were carried out according to the respective pharmacia protocol for proteins that have been provided with a histidine hexamer . aliquots of the various elution fractions were applied to sds / coomassie gels . the purest fractions were combined and were further concentrated over centriplus ym30 columns ( millipore ) according to the respective protocol . then it was dialyzed twice ( dialysis tubing : spectra / por , mwco : 25 . 000 ) against an at least one thousand - fold volume of zi buffer for 1 hour each at 4 ° c ., then over night at 4 ° c . against zi buffer / 50 % glycerine . the dialysis product was aliquoted in 30 - 50 μl fractions and stored at − 80 ° c . fig1 a shows the purified hrad51 - h6 and hrad51 - h6n2 proteins . as in example 1 , but different elution buffer : 20 mm pi , 0 . 5 m nacl , the concentrations of the hrad51 proteins was determined by measurement of the od 280 using the extinction coefficient calculated with the gene inspector ™ software ( textco , inc .). hrad51h6n2 purified over ni ++ - sepharose was incubated with 100 ng each of a 0 . 9 kb pcr fragment . a dna shift in the agarose gel caused by the protein binding shows that hrad51h6n2 cooperatively binds double - stranded dna based on the concentration ( fig1 b ). even with low amounts of hrad51h6n2 , single dna molecules are completely bound by hrad51h6n2 , and are therefore retarded maximally , so that the retardation of the dna does not increase any more by increasing the amount of protein . it is concluded that hrad51h6n2 binds dsdna . generation of a transfection agent based on uvsx with a signal for the non - endosomal membrane permeation and a nuclear localization signal as functional component as in example 1 , a plasmid was generated that permits the expression of the fusion protein uvsxh6n2vp22c50 ( see fig1 ), which additionally contains a part of the tegument protein vp22 ( gene ul49 ) of the human herpes virus 1 and is based on the protein uvsxh6n2 - 2 described in example 2 . the here used vp22 peptide acts as a signal for the non - endosomal permeation through the cell membrane . thus , the fusion protein uvsxh6n2vp22c50 contains a membrane transduction signal in addition to a nuclear localization signal ( nsl ). amino acids 1 - 391 : uvsx from the phage t4 ( ncbi protein accession no : aad42669 , amino acids 1 - 391 ), amino acids 392 - 394 : linker consisting of the amino acids s 392 yg 394 , amino acids 395 - 400 : h 395 hhhhh 400 , amino acids 401 - 403 : linker consisting of the amino acids m 401 ys 403 , amino acids 404 - 417 : nuclear localization signal nls - 2 ( amino acids 2 - 15 , seq id no : 9 aus wo 00 / 40742 ), amino acids 418 - 422 : linker consisting of the amino acids g 418 ypgs 422 , amino acids 423 - 472 : part of the tegument protein vp22 ( gen ul49 ) of the human herpes virus 1 ( ncbi protein accession no : np — 044651 , amino acids 252 - 301 ), amino acids 473 - 474 : c - terminus consisting of the amino acids p 473 r 474 . for the expression in suitable escherichia coli cells , pexhuvsxh6n2 - 2 ( see example 1 and fig1 ) was opened by restriction enzyme digestion with acc65 i and spe i , and was ligated with a pct product cut with acc65 i and nhe i , which contains at the 5 ′- end the additional nucleotides 5 ′- cacacaggtacccgggatcc - 3 ′ ( seq id no : 8 ) and at its 3 ′- end the additional nucleotides 5 ′- cctaggtaataataagcggccgcgctagctgtgtg - 3 ′ ( seq id no : 9 ), in addition to the coding sequence for the last 50 amino acids of the tegument protein vp22 ( gene ul49 ) of the human herpes virus 1 ( ncbi nucleotide accession no : nc — 001806 , complementary sequence of the nucleotides 105486 - 106391 ) ( see fig1 ). the purification of uvsxh6n2vp22c50 was carried out as described in example 1 for h6uvsx ( see fig1 a ). binding of a mixture of various modified uvsx ( uvsx - nls - vp22 and uvsx - nls ) to double - stranded dna : 140 ng ( in each case ) of a purified 1 . 7 kb pcr fragments were incubated in 96 mm k 2 hpo 4 , 21 . 5 mm kh 2 po 4 , 18 mm nah 2 po 4 , ph = 7 . 2 , 5 mm mgcl 2 and 1 . 3 mm atp - y - s with the amounts according to fig1 b of purified uvsxh6n2vp22c50 or uvsxh6n2 - 2 for 30 min at room temperature , then , all reactions were applied to a 0 . 8 % tae / agarose gel which was afterwards stained with ethidium bromide . the two proteins were different regarding their molecular weight and net charge , and therefore retarded the dna differently during electrophoresis , with the complex with uvsxh6n2vp22c50 remaining stuck in the gel pocket and not migrating any more ( see lanes 1 and 7 of fig1 b ). when the proteins are mixed before they are added to the dna , intermediate complexes are formed depending on the ratio of uvsxh6n2 - 2 and uvsxh6n2vp22c50 , the migration performance of which is between those of the unmixed complexes ( fig1 b ). this shows that the dna is occupied by both proteins . also possible is a mixture of differently modified or one - or two - times modified npf - forming proteins . transfection of a cell line ( nih3t3 ) with complexes of dna and a mixture of uvsx - nls - vp22 and uvsx - nls 2 . 5 × 10 5 cells ( nih3t3 ) were plated out in each well of a 6 - well plate , and transfected on the following day with a vector containing a gene for the expression of a fluorescent reporter protein . for this , 0 μg - 1 μg linear or 1 μg circular dna was preincubated with 36 μg uvsxh6n2vp22c50 or a mixture of 19 μg uvsxh6n2vp22c50 and 39 μg uvsxh6n2 - 2 in binding buffer ( 76 mm k 2 hpo 4 , 17 mm kh 2 po 4 , 14 mm nah 2 po 4 , 5 mm mgcl 2 , 1 mm atp - γ - s , ph 7 . 21 ) for 30 min at room temperature , and together with 1 ml rpmi was added to cells that have before been washed once with pbs / bsa . after a 1 h incubation at 37 ° c ., 5 % co 2 in the incubator , 1 ml rpmi / 20 % fcs was added respectively and further incubated in the incubator . 4 h or 24 h later , the cells were analyzed in the fluorescence microscope . cells were observed that expressed the reporter gene after treatment with complexes of linear or circular dna and the mixture of uvsxh6n2vp22c50 and uvsxh6n2 - 2 ( see fig1 ). the number of the transfected cells increased with the amount of used dna or dna - protein complexes . however , no expression of the reporter gene was achieved with dna complexes containing only uvsxh6n2vp22c50 , or in absence of dna . therefore it appears that by modification of an npf - forming protein , here uvsx , with a membrane - active peptide , here vp22 , the transfection of cells and here especially the membrane permeation is facilitated . the modular character of the method or transfection agent according to the invention is underlined by the combination of differently modified proteins , here modification with vp22 and nls ( see also fig2 ). whereas the vp22 - modified uvsx permits the non - endosomal membrane permeation , the nls - modified uvsx directs the transfected dna from the cytoplasma to the nucleus ; the transfected dna can then be expressed there . thus , individual steps of the complex transfection procedure can be controlled specifically , flexible and with high efficiency in especially advantageous manner . andersson , k . ( 1990 ). codon preferences in free - living microorganisma . micobiol rev 54 , 98 - 210 . bal , h . p ., chroboczek , j ., schoehn , g ., ruigrok , r . w ., and dewhurst , s . ( 2000 ). adenovirus type 7 penton purification of soluble pentamers from escherichia coli and development of an integrin - dependent gene delivery system . eur j biochem 267 , 6074 - 6081 . baumann , p ., and west , s . c . ( 1998 ). role of the human rad51 protein in homologous recombination and double - stranded - break repair . trends biochem sci 23 , 247 - 251 . bianco , p . r ., tracy , r . b ., and kowalczykowski , s . c . ( 1998 ). dna strand exchange proteins : a biochemical and physical comparison . front biosci 3 , d570 - 603 . boulikas , t . ( 1993 ). nuclear localization signals ( nls ). crit . rev eukaryot gene expr 3 , 193 - 227 . boulikas , t . ( 1996 ). nuclear import of protein kinases and cyclins . j cell biochem 60 , 61 - 82 . boulikas , t . ( 1997 ). nuclear import of dna repair proteins . anticancer res 17 , 843 - 863 . cagnon , c ., valverde , v ., and masson , j . m . ( 1991 ). a new family of sugar - inducible expression vectors for escherichia coli . protein eng 4 , 843 - 847 . cerutti , h ., osman , m ., grandoni , p ., and jagendorf , a . t . ( 1992 ). a homolog of escherichia coli reca protein in plastids of higher plants . proc natl acad sci usa 89 , 8068 - 8072 . collins , l ., sawyer , g . j ., zhang , x . h ., gustafsson , k ., and fabre , j . w . ( 2000 ). in vitro investigation of factors important for the delivery of an integrin - targeted nonviral dna vector in organ transplantation . transplantation 69 , 1168 - 1176 . delcayre , a . x ., salas , f ., mathur , s ., kovats , k ., lotz , m ., and lernhardt , w . ( 1991 ). epstein barr virus / complement c3d receptor is an interferon alpha receptor . embo j 10 , 919 - 926 . di capua , e ., engel , a ., stasiak , a ., and koller , t . ( 1982 ). characterization of complexes between reca protein and duplex dna by electron microscopy . j mol biol 157 , 87 - 103 . ellouze , c ., selmane , t ., kim , h . k ., tuite , e ., norden , b ., mortensen , k ., and takahashi , m . ( 1999 ). difference between active and inactive nucleotide cofactors in the effect on the dna binding and the helical structure of reca filament dissociation of reca - dna complex by inactive nucleotides . eur j biochem 262 , 88 - 94 . evan , g . i ., lewis , g . k ., ramsay , g ., and bishop , j . m . ( 1985 ). isolation of monoclonal antibodies specific for human c - myc proto - oncogene product . mol cell biol 5 , 3610 - 3616 . feero , w . g ., li , s ., rosenblatt , j . d ., sirianni , n ., morgan , j . e ., partridge , t . a ., huang , l ., and hoffman , e . p . ( 1997 ). selection and use of ligands for receptor - mediated gene delivery to myogenic cells . gene ther 4 , 664 - 674 . feldherr , c . m ., and akin , d . ( 1997 ). the location of the transport gate in the nuclear pore complex . j cell sci 110 ( pt 24 ), 3065 - 3070 . fominaya , j ., and wels , w . ( 1996 ). target cell - specific dna transfer mediated by a chimeric multidomain protein . novel non - viral gene delivery system . j biol chem 271 , 10560 - 10568 . griffith , j ., makhov , a ., santiago - lara , l ., and setlow , p . ( 1994 ). electron microscopic studies of the interaction between a bacillus subtilis alpha / beta - type small , acid - soluble spore protein with dna : protein binding is cooperative , stiffens the dna , and induces negative supercoiling . proc natl acad sci usa 91 , 8224 - 8228 . harbottle , r . p ., cooper , r . g ., hart , s . l ., ladhoff , a ., mckay , t ., knight , a . m ., wagner , e ., miller , a . d ., and coutelle , c . ( 1998 ). an rgd - oligolysine peptide : a prototype construct for integrin - mediated gene delivery . hum gene ther 9 , 1037 - 1047 . hong , s . s ., gay , b ., karayan , l ., dabauvalle , m . c ., and boulanger , p . ( 1999 ). cellular uptake and nuclear delivery of recombinant adenovirus penton base . virology 262 , 163 - 177 . karlin , s ., and brocchieri , l . ( 1996 ). evolutionary conservation of reca genes in relation to protein structure and function . j bacteriol 178 , 1881 - 1894 . karlin , s ., weinstock , g . m ., and brendel , v . ( 1995 ). bacterial classifications derived from reca protein sequence comparisons . j bacteriol 177 , 6881 - 6893 . knight , k . l ., and mcentee , k . ( 1985 ). affinity labeling of a tyrosine residue in the atp binding site of the reca protein from escherichia coli with 5 ′- p - fluorosulfonylbenzoyladenosine . j biol chem 260 , 10177 - 10184 . kukowska - latallo , j . f ., bielinska , a . u ., johnson , j ., spindler , r ., tomalia , d . a ., and baker , j . r ., jr . ( 1996 ). efficient transfer of genetic material into mammalian cells using starburst polyamidoamine dendrimers . proc natl acad sci usa 93 , 4897 - 4902 . lee , c . k ., and knipe , d . m . ( 1985 ). an immunoassay for the study of dna - binding activities of herpes simplex virus protein icp8 . j virol 54 , 731 - 738 . masson , j . y ., davies , a . a ., hajibagheri , n ., van dyck , e ., benson , f . e ., stasiak , a . z ., stasiak , a ., and west , s . c . ( 1999 ). the meiosis - specific recombinase hdmc1 forms ring structures and interacts with hrad51 . embo j 18 , 6552 - 6560 . mengaud , j ., ohayon , h ., gounon , p ., mege , r . m ., and cossart , p . ( 1996 ). e - cadherin is the receptor for internalin , a surface protein required for entry of l . monocytogenes into epithelial cells . cell 84 , 923 - 932 . midoux , p ., mendes , c ., legrand , a ., raimond , j ., mayer , r ., monsigny , m ., and roche , a . c . ( 1993 ). specific gene transfer mediated by lactosylated poly - l - lysine into hepatoma cells . nucleic acids res 21 , 871 - 878 . mosig , g . ( 1987 ). the essential role of recombination in phage t4 growth . annu rev genet . 21 , 347 - 371 . neumann , g ., castrucci , m . r ., and kawaoka , y . ( 1997 ). nuclear import and export of influenza virus nucleoprotein . j virol 71 , 9690 - 9700 . ogawa , t ., shinohara , a ., nabetani , a ., ikeya , t ., yu , x ., egelman , e . h ., and ogawa , h . ( 1993 ). reca - like recombination proteins in eukaryotes : functions and structures of rad51 genes . cold spring harb symp quant biol 58 , 567 - 576 . ohno , k ., sawai , k ., lijima , y ., levin , b ., and meruelo , d . ( 1997 ). cell - specific targeting of sindbis virus vectors displaying igg - binding domains of protein a . nat biotechnol 15 , 763 - 767 . pack , d . w ., putnam , d ., and langer , r . ( 2000 ). design of imidazole - containing endosomolytic biopolymers for gene delivery . biotechnol bioeng 67 , 217 - 223 . plow , e . f ., haas , t . a ., zhang , l ., loftus , j ., and smith , j . w . ( 2000 ). ligand binding to integrins . j biol chem 275 , 21785 - 21788 . pooga , m ., soomets , u ., hallbrink , m ., valkna , a ., saar , k ., rezaei , k ., kahl , u ., hao , j . x ., xu , x . j ., wiesenfeld - hallin , z ., et al . ( 1998 ). cell penetrating pna constructs regulate galanin receptor levels and modify pain transmission in vivo . nat biotechnol 16 , 857 - 861 . provoda , c . j ., and lee , k . d . ( 2000 ). bacterial pore - forming hemolysins and their use in the cytosolic delivery of macromolecules . adv drug deliv rev 41 , 209 - 221 . richardson , s ., ferruti , p ., and duncan , r . ( 1999 ). poly ( amidoamine ) s as potential endosomolytic polymers : evaluation in vitro and body distribution in normal and tumour - bearing animals . j drug target 6 , 391 - 404 . roca , a . i ., and cox , m . m . ( 1990 ). the reca protein : structure and function . crit . rev biochem mol biol 25 , 415 - 456 . rosenkranz , a . a ., yachmenev , s . v ., jans , d . a ., serebryakova , n . v ., murav &# 39 ; ev , v . i ., peters , r ., and sobolev , a . s . ( 1992 ). receptor - mediated endocytosis and nuclear transport of a transfecting dna construct . exp cell res 199 , 323 - 329 . sandler , s . j ., satin , l . h ., samra , h . s ., and clark , a . j . ( 1996 ). reca - like genes from three archaean species with putative protein products similar to rad51 and dmc1 proteins of the yeast saccharomyces cerevisiae . nucleic acids res 24 , 2125 - 2132 . schägger , h ., and von jagow , g . ( 1987 ). tricine - sodium dodecyl sulfate - polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kda . anal biochem 166 , 368 - 379 . schoeman , r ., joubert , d ., ariatti , m ., and hawtrey , a . o . ( 1995 ). further studies on targeted dna transfer to cells using a highly efficient delivery system of biotinylated transferrin and biotinylated polylysine complexed to streptavidin . j drug target 2 , 509 - 516 . seitz , e . m ., brockman , j . p ., sandler , s . j ., clark , a . j ., and kowalczykowski , s . c . ( 1998 ). rada protein is an archaeal reca protein homolog that catalyzes dna strand exchange . genes dev 12 , 1248 - 1253 . steinhauer , d . a ., wharton , s . a ., skehel , j . j ., and wiley , d . c . ( 1995 ). studies of the membrane fusion activities of fusion peptide mutants of influenza virus hemagglutinin . j virol 69 , 6643 - 6651 . surdej , p ., and jacobs - lorena , m . ( 1994 ). strategy for epitope tagging the protein - coding region of any gene . biotechniques 17 , 560 - 565 . tang , m . x ., and szoka , f . c . ( 1997 ). the influence of polymer structure on the interactions of cationic polymers with dna and morphology of the resulting complexes . gene ther 4 , 823 - 832 . thoren , p . e ., persson , d ., karlsson , m ., and norden , b . ( 2000 ). the antennapedia peptide penetratin translocates across lipid bilayers — the first direct observation . febs lett 482 , 265 - 268 . thyagarajan , b ., padua , r . a ., and campbell , c . ( 1996 ). mammalian mitochondria possess homologous dna recombination activity . j biol chem 271 , 27536 - 27543 . wagner , e . ( 1999 ). application of membrane - active peptides for nonviral gene delivery . adv drug deliv rev 38 , 279 - 289 . wang , p ., palese , p ., and o &# 39 ; neill , r . e . ( 1997 ). the npi - 1 / npi - 3 ( karyopherin alpha ) binding site on the influenza a virus nucleoprotein np is a nonconventional nuclear localization signal . j virol 71 , 1850 - 1856 . weisbart , r . h ., baldwin , r ., huh , b ., zack , d . j ., and nishimura , r . ( 2000 ). novel protein transfection of primary rat cortical neurons using an antibody that penetrates living cells . j immunol 164 , 6020 - 6026 . yamada , m ., and kasamatsu , h . ( 1993 ). role of nuclear pore complex in simian virus 40 nuclear targeting . j virol 67 , 119 - 130 . yu , x ., and egelman , e . h . ( 1993 ). dna conformation induced by the bacteriophage t4 uvsx protein appears identical to the conformation induced by the escherichia coli reca protein . j mol biol 232 , 1 - 4 . zauner , w ., blaas , d ., kuechler , e ., and wagner , e . ( 1995 ). rhinovirus - mediated endosomal release of transfection complexes . j virol 69 , 1085 - 1092 . | 2 |
preferred embodiments of a liquid crystal display device according to the present invention are explained hereinafter in conjunction with attached drawings . fig1 is a cross - sectional view of an essential part for explaining the constitution of the first embodiment of a reflective - type liquid crystal display device according to the present invention . in the drawing , reference symbol sub 1 indicates one substrate and reference symbol sub 2 indicates another substrate . in this embodiment , the present invention is applied to the reflective - type liquid crystal display device of an active - matrix type . on an inner surface of one substrate sub 1 , gate electrodes gl , a gate insulation film gi , amorphous semiconductor layers asi , a protective film pas are formed sequentially thus constituting thin film transistors . each amorphous semiconductor layer asi includes a source electrode sd 1 and a drain electrode sd 2 . the gate insulation film gi and the protective film pas are also formed on pixel regions . on the above - mentioned layer structure , a resin film ( resin binder ) boc which is prepared by mingling fine particles bz into photosensitive resin is formed . the fine particles bz are constituted of fine particles made of epoxy resin or glass and have the average particle size of approximately 3 μm . then , the film thickness of the resin film is approximately 2 μm and hence , portions of the fine particles bz are protruded from the resin film boc toward a reflective - electrode - ref side ( another - substrate - sub 2 side ). in other words , the fine particles bz are formed such that the fine particles bz are fixed by the resin film boc which is embedded between the fine particles bz . on the resin film boc , reflective electrodes rfe having a shape which follows the protrusions of the fine particles bz are formed . the reflective electrodes rfe are pixel electrode / light reflective films formed of thin metal films which are preferably made of al , al — nd , cr , ag or an alloy of these metals . the reflective electrodes rfe are connected to the source electrodes sd 2 of the thin film transistors via contact holes th thus constituting so - called pixel electrodes . an orientation film ori 1 is formed on the reflective electrodes rfe and a given orientation treatment is provided to the orientation film ori 1 by rubbing or the like . the one substrate sub 1 and another substrate sub 2 are laminated to each other while sandwiching liquid crystal lc therebetween . to an inner surface of another substrate sub 2 , color filters fil which are defined in accordance with respective pixels by a black matrix bm , a leveling layer oc 2 , a common electrode it 02 and an orientation film ori 2 are provided . in this embodiment , a protective film oc 1 is provided as a layer below the reflective electrodes rfe and between the fine particles bz and the resin film boc so as to adjust the rough surface formed on the reflective electrodes . rfe . however , the rough surface formed on the reflective electrodes rfe may be adjusted by changing the distribution density , the height or the particle size of the fine particles bz which are protruded from the resin film boc or the thickness of the resin film boc . in such a case , the above - mentioned protective film oc 1 is not always necessary . the same goes for other embodiments which will be explained later . further , at the time of performing the patterning of the reflective electrodes rfe , by forming light - transmitting portions such as openings or slits in the reflective electrodes rfe per se or portions of peripheries thereof , the liquid crystal display device is formed into a semi - transmissive liquid crystal display device . this also goes for other embodiments which will be explained later . due to this embodiment , the light reflection efficiency of the reflective electrodes rfe is enhanced so that a reflective - type liquid crystal display device of high quality which enables a viewer to observe bright images from any viewing angles can be obtained . [ 0045 ] fig2 a to fig2 c are cross - sectional views of an essential part of one substrate of the liquid crystal display device for explaining the summary of manufacturing steps of the first embodiment of the reflective - type liquid crystal display device according to the present invention and fig3 a to fig3 d are similar cross - sectional views showing manufacturing steps which follow the manufacturing step shown in fig2 c . first of all , using a process similar to a known semiconductor manufacturing process , the thin film transistors are formed on an upper surface of a glass substrate which is employed as one substrate sub 1 out of a pair of substrates which constitute the liquid crystal display device ( fig2 a ). although the thin film transistor uses the amorphous silicon semiconductor asi , the thin film transistor is not limited to such a semiconductor . that is , the thin film transistor may be constituted of a polysilicon semiconductor or a low - temperature polysilicon semiconductor . the thin film transistor includes the gate electrode gl , the gate insulation layer gi , a layer formed of the amorphous silicon semiconductor asi ( hereinafter referred to as the semiconductor asi ), the drain electrode sd 1 and the source electrode sd 2 . the gate insulation layer gi is also formed on another inner surface of one substrate sub 1 . an insulation film pas is formed on this gate insulation layer gi ( see fig2 b ). the contact hole th is formed in the source electrode sd 2 portion of the insulation layer pas ( fig2 c ). here , other necessary contact holes th are also formed in the insulation layer pas simultaneously . the photosensitive resin film boc constituting the binder resin into which the fine particles of acrylic resin having the average particle size of 3 μm are mingled as the fine particles bz is applied onto the insulation layer pas as an upper layer . a film thickness of the photosensitive resin film boc is approximately 2 μm . accordingly , the portions of the fine particles bz are protruded upwardly from the photosensitive resin film boc . that is , spaces defined between respective fine particles bz are filled with the photosensitive resin film boc ( fig3 a ). subsequently , the leveling film oc 1 is applied to the substrate sub 1 such that the leveling film oc 1 covers the fine particles bz and the photosensitive resin film boc ( fig3 b ). the leveling film oc 1 performs a function of adjusting the degree of roughness of the reflective electrodes rfe generated by the fine particles bz and the photosensitive resin film boc . thereafter , the reflective electrode rfe is formed using aluminum alloy films ( fig3 c ). the reflective electrode rfe is formed by a film forming method which may preferably be a sputtering method such that the reflective electrode rfe exhibits a rough surface which follows the rough surface of the lower layer . the formed reflective electrode rfe is divided into a plurality of reflective electrodes rfe in accordance with respective pixels ( fig3 d ). in fig3 d , a region indicated by an arrow pxa defines a range of one pixel . thereafter , the orientation film ori 1 ( fig1 ) is formed on these pixels thus completing the manufacturing of one substrate . [ 0051 ] fig4 is a cross - sectional view of an essential part for explaining the constitution of the second embodiment of the reflective - type liquid crystal display device according to the present invention . in fig4 reference symbol sub 1 indicates one substrate and reference symbol sub 2 indicates another substrate . this embodiment relates to a case in which the present invention is applied to a simple - matrix - type liquid crystal display device . on an inner surface of a glass substrate which constitutes one substrate sub 1 , a resin film boc into which fine particles bz similar to those of the first embodiment are mingled is formed . portions of the fine particles bz are protruded from the resin film boc toward a reflective - electrode ref side ( another - substrate - sub 2 side ). in other words , the fine particles bz are formed such that the fine particles bz are fixed by the resin film boc which is embedded between the fine particles bz . on the resin film boc , reflective electrodes rfe having a shape which follows the protrusions of the fine particles bz are formed by way of a leveling film oc 1 . the reflective electrodes are also light reflection films formed of thin metal films which are preferably made of al , al — nd , cr , ag or an alloy including these metals in the same manner as the previous embodiment . an insulation film pas is formed on the reflective electrodes rfe and ito 1 s which constitute pixel electrodes are patterned on the insulation film pas . then , an orientation film ori 1 is formed such that the orientation film ori 1 covers the ito is and is subjected to a given orientation treatment such as rubbing or the like . one substrate sub 1 and another substrate sub 2 are laminated to each other while sandwiching liquid crystal lc therebetween . to an inner surface of another substrate sub 2 , color filters fil which are defined in accordance with respective pixels by a black matrix bm , a leveling layer oc 2 , a counter electrode it 02 and an orientation film or 12 are provided . in this embodiment , the protective film oc 1 is provided as a layer below the reflective electrodes rfe and between the fine particles bz and the resin film boc so as to adjust the rough surface formed on the reflective electrodes rfe . however , the rough surface formed on the reflective electrodes rfe may be adjusted by changing the distribution density , the height or the particle size of the fine particles bz which are protruded from the resin film boc or the thickness of the resin film boc . in such a case , the above - mentioned protective film oc 1 is not always necessary . further , at the time of performing the patterning of the reflective electrodes rfe , by forming light - transmitting portions such as openings or slits in the reflective electrodes per se or portions of peripheries thereof , the liquid crystal display device is formed into a semi - transmissive liquid crystal display device . due to this embodiment , the light reflection efficiency of the reflective electrodes is enhanced so that a reflective - type liquid crystal display device of high quality which enables a viewer to observe bright images from any viewing angles can be obtained . [ 0057 ] fig5 a and fig5 b are cross - sectional views of an essential part of one substrate of the liquid crystal display device for explaining the summary of manufacturing steps of the second embodiment of the reflective - type liquid crystal display device according to the present invention and fig6 a to fig6 d are cross - sectional views of an essential part which show steps following the manufacturing step shown in fig5 b . first of all , the photosensitive resin film boc which is used as the binder resin in which fine particles made of acrylic resin are mingled as fine particles bz is applied to an upper surface of a glass substrate as one substrate sub 1 of a pair of substrates which constitute the liquid crystal display device . thereafter , the patterning defined in accordance with respective pixels is performed . portions of the fine particles bz are protruded upwardly from the photosensitive resin film boc . the space defined between respective fine particles bz are filled with the photosensitive resin film boc ( fig5 a ). subsequently , the leveling film oc 1 is applied to the substrate sub 1 such that the leveling film oc 1 covers the fine particles bz and the photosensitive resin film boc ( fig5 b ). the leveling film oc 1 performs a function of adjusting the degree of roughness of the reflective electrodes rfe generated by the fine particles bz and the photosensitive resin film boc . thereafter , the reflective electrode rfe is formed using an aluminum alloy film ( fig6 a ). the reflective electrode rfe is formed by a film forming method which may preferably be a sputtering method such that the reflective electrode rfe exhibits a rough surface which follows the rough surface of the lower layer . the insulation film pas is formed on the formed reflective electrode rfe ( fig6 b ). thereafter , ito 1 which constitutes pixel electrodes is formed ( fig6 c ) and divided in accordance with respective pixels by patterning ( fig6 d ). in fig6 d , a region indicated by an arrow pxa constitutes a range of one pixel . thereafter , an orientation film ori 1 ( fig4 ) is applied onto the pixel thus completing the manufacturing of one substrate . [ 0060 ] fig7 is a cross - sectional view of an essential part for explaining the constitution of the third embodiment of the reflective - type liquid crystal display device according to the present invention . in fig7 reference symbol sub 1 indicates one substrate and reference symbol sub 2 indicates another substrate . this embodiment also relates to a case in which the present invention is applied to a simple - matrix - type liquid crystal display device . on an inner surface of a glass substrate which constitutes one substrate sub 1 , a resin film boc into which fine particles bz similar to those of the first and the second embodiments are mingled is formed . portions of the fine particles bz are protruded from the resin film boc toward a reflective - electrode - ref side ( another - substrate - sub 2 side ). in other words , the fine particles bz are formed such that the fine particles bz are fixed by the resin film boc which is embedded between the fine particles bz . on the resin film boc , a reflective electrode rfe having a shape which follows the protrusions of the fine particles bz is formed by way of a leveling film oc 1 . the reflective electrodes also constitute light reflection film formed of a thin metal film which is preferably made of al , al — nd , cr , ag or an alloy including these metals in the same manner as the previous embodiment . in this embodiment , color filters fil which are defined by a black matrix bm are formed on the reflective electrode rfe by way of a second leveling film oc 2 . an insulation film pas is formed on the color filters fi 1 and ito 1 s which constitute pixel electrodes are formed on the insulation film pas . then , an orientation film ori 1 is formed such that the orientation film ori 1 covers the ito 1 s and is subjected a given orientation treatment such as rubbing or the like . one substrate sub 1 and another substrate sub 2 are laminated to each other while sandwiching liquid crystal lc therebetween . to an inner surface of another substrate sub 2 , a counter electrode ito 2 and an orientation film ori 2 are provided . in this embodiment , a protective film oc 1 is provided as a layer below the reflective electrode rfe and between the fine particles bz and the resin film boc so as to adjust the rough surface formed on the reflective electrode rfe however , the rough surface formed on the reflective electrode rfe may be adjusted by changing the distribution density , the height or the particle size of the fine particles bz which are protruded from the resin film boc or the thickness of the resin film boc . in such a case , the above - mentioned protective film oc 1 is not always necessary . further , at the time of performing the patterning of the reflective electrode rfe , by forming light - transmitting portions such as openings or slits in the reflective electrode per se or portions of peripheries thereof , the liquid crystal display device is formed into a semi - transmissive liquid crystal display device . due to this embodiment , the light reflection efficiency of the reflective electrode is enhanced so that a reflective - type liquid crystal display device of high quality which enables a viewer to observe bright images from any viewing angles can be obtained . [ 0065 ] fig8 a to fig8 c are cross - sectional views of an essential part of one substrate of the liquid crystal display device for explaining the summary of manufacturing steps of the third embodiment of the reflective - type liquid crystal display device according to the present invention and fig9 a and fig9 b are cross - sectional views of an essential part which show steps following the manufacturing step shown in fig8 c . first of all , a photosensitive resin film boc which is used as binder resin in which fine particles made of acrylic resin are mingled as fine particles bz is applied to an upper surface of a glass substrate as one substrate sub 1 of a pair of substrates which constitute the liquid crystal display device . thereafter , the patterning defined in accordance with respective pixels is performed . portions of the fine particles bz are protruded upwardly from the photosensitive resin film boc . the space defined between respective fine particles bz are filled with the photosensitive resin film boc . subsequently , a leveling film oc 1 is applied to the substrate sub 1 such that the leveling film oc 1 covers the fine particles bz and the photosensitive resin film boc . the leveling film oc 1 performs a function of adjusting the degree of roughness of a reflective electrode generated by the fine particles bz and the photosensitive resin film boc . thereafter , the reflective electrode rfe is formed using an aluminum alloy film . the reflective electrode rfe is formed by a film forming method which may preferably be a sputtering method such that the reflective electrode rfe exhibits the rough surface which follows the rough surface of the lower layer . on the reflective electrode rfe formed in this manner , another leveling film oc 2 is formed ( fig8 a ). further , the black matrix bm is formed on another leveling film oc 2 ( fig8 b ). then , the color filters fil are formed and , thereafter , an insulation film pas is formed on the color filters fil ( fig8 c ). thereafter , ito 1 which constitutes pixel electrodes is formed ( fig9 a ) and divided in accordance with respective pixels by patterning ( fig9 b ). in fig9 b , a region indicated by an arrow pxa constitutes a range of one pixel . thereafter , an orientation film ori 1 ( fig7 ) is applied onto the pixels thus completing the manufacturing of one substrate . the color filters which are formed on another substrate in the first embodiment according to the present invention which are explained in conjunction with fig1 to fig3 d can be also formed on one substrate sub 1 side in the same manner as the third embodiment explained in conjunction with fig7 to fig9 b . in this case , the color filters and the black matrix are formed as layers which are disposed above the reflective electrodes and below the orientation film . although the fine particles bz are formed of fine particles made of epoxy resin or glass in the above - mentioned respective embodiments , the fine particles may be formed of black fine particles having photo - absorbency . due to such a constitution , at the time of performing the patterning of the resin layer , the reflective electrode and other constituent layers using a photolithography technique , the halation which is generated when the exposure light is scattered due to the minute particles and is reflected on a exposure mask can be prevented so that the formation of the undesired patterns on regions other than the pattern forming regions can be obviated . further , by adding an ultraviolet ray absorbent into the photosensitive resin in which the fine particles are mingled , the ultraviolet rays can be absorbed in an ultraviolet - ray sensible region and hence , the above - mentioned halation at the time of exposure can be prevented . alternatively , die having an ultraviolet ray absorbing effect ( for example , yellow die ) may be added into the photosensitive resin . further , a colored resist which is prepared by scattering pigment in the photosensitive resin may be used . [ 0071 ] fig1 is a plan view of one pixel of the reflective - type liquid crystal display device according to the present invention which is obtained by observing the display device from another substrate sub 2 side after removing an orientation film of one substrate corresponding to the first embodiment of the present invention . in fig1 , gl indicates gate lines and dl indicates drain lines . the fine particles bz according to the present invention are distributed in a region of a reflective electrode rfe and the surface of the reflective electrode rfe has a rough surface which follows the fine particles bz . due to such an reflective electrode rfe , the incident light from another substrate side can be efficiently reflected on and hence , the bright image can be obtained . [ 0072 ] fig1 is a plan view which shows the surface of the reflective electrode provided to the reflective - type liquid crystal display device according to the present invention in an enlarged form . on the surface of the reflective electrode rfe , a large number of protrusions nv formed of the above - mentioned fine particles bz are formed . these protrusions nv efficiently scatter the incident light so that it is possible to provide images which are bright in a wide viewing angle . subsequently , the light reflection effect of the reflective electrode in the reflective - type liquid crystal display device of the present invention is explained to confirm the presence of such an effect . [ 0073 ] fig1 is a constitutional view f a change - angle gross measuring device served for confirming the light reflection effect of the reflective electrodes in the reflective - type liquid crystal display device of the present invention . in fig1 , lpr indicates a light projector , ldr indicates a light receiver and spl indicates a sample . further , fig1 is an explanatory view of a result of the measurement . the change - angle gross measuring device used in the measurement is [ vg - 1d - type ] made by nihon denshoku kogyo co ., ltd , wherein a light projecting angle was fixed to 45 ° and a light receiving angle was changed in a range of 0 to 450 . the reflection effect of samples was relatively measured in view of the gloss measured values ( intensity ). in this measurement , the density and the surface roughness of the fine particles in the resin binder film in which the fine particles are mingled were changed and were subjected to a comparison evaluation with a sample on which aluminum was applied by vapor deposition and a sample which was obtained by laminating a diffusion sheet to an aluminum - matted vapor deposition film . the vapor deposition condition of aluminum was set such that the degree of evacuated vacuum is 1 . 8 × 10 − 2 pa , the vapor deposition time is 16 seconds and a thickness of the aluminum film is 0 . 1 μm . according to the result of the measurement shown in fig1 , with respect to the roughness of the sample spl , a is 0 . 4 μm , b is 1 . 2 ( 1 . 25 ) μm , c is 1 . 8 μm , d is 1 . 95 μm , e is 2 . 0 μm . also in fig1 , f indicates the roughness value of a leveling film made of aluminum and g indicates gross of the diffusion sheet for comparison . from the result of the measurement , it is understood that when the roughness is not less than 1 . 2 μm , the reflection intensity can be increased in a wide angular range . in this manner , due to the embodiments of the present invention , it is possible to provide the reflective - type liquid crystal display device having the reflective electrodes which can simplify the structure and the manufacturing steps of the liquid crystal display device and , at the same time , can exhibit the high reflection performance . as has been described heretofore , according to the present invention , the patterning of the resin layer which requires the complicated steps is unnecessary . further , by adjusting the degree of dispersion and the size of the mingled fine particles or the degree of protrusion of portions of the fine particles protruded from the surface of the resin binder layer , the magnitude of the roughness of the reflective electrode which are formed as the layer above the resin binder layer can be controlled . accordingly , it is possible to provide the reflective - type liquid crystal display device of high quality which can simplify the manufacturing steps and yet is provided with the reflective electrode having desired reflection performance . | 6 |
reference numerals are used in this description to designate the various components and elements of the instrument of this invention . identical reference numerals designated in the various drawings refer to the identical element or component of the surgical penetration instrument . as used in this description , “ proximal ” or “ proximally ” refers to that portion of the instrument , component , or element which extends toward the user . conversely , “ distal ” or “ distally ” refers to that portion of the instrument , component , or element which extends away from the user . referring to fig1 and 2 , there is shown trocar 2 which incorporates obturator 20 and cannula 8 of the present invention . as illustrated in fig2 obturator 20 is inserted into and through valve 10 and into sleeve housing 14 and sleeve 12 . during insertion , an internal valve ( not shown ) connected to valve lever 18 is opened . seal 10 is preferably a septum valve which surrounds shaft 22 preventing any fluid or gas from escaping through cannula 8 . when shaft 22 is fully inserted into cannula 8 , hub 24 is secured to sleeve housing 14 by handle 26 . penetrating tip 32 of obturator 20 , and a portion of the distal end of shaft 22 , extend distally from sleeve 12 . in an actual surgical procedure utilizing the device of the present invention , a surgeon , using a scalpel , makes a small incision where trocar 2 , shown in fig1 is to be positioned during the surgical procedure . the distal end of trocar 2 is then inserted into the tissue exposed by the small incision . after insertion into the tissue , trocar 2 is oscillated back and forth around its axis to facilitate penetration . separators 34 and 36 on penetrating tip 32 help to separate tissue during oscillation to facilitate the advancement of trocar 2 into the abdominal cavity . after penetration into the abdominal cavity is complete , obturator 20 is removed from cannula 8 by pressing buttons 51 and 52 ( not shown ) which releases handle 26 from sleeve housing 14 . when obturator 20 is removed an internal valve ( not shown ) connected to valve lever 18 closes preventing any fluid or gas from escaping cannula 8 . if desired , a pressurizing gas such as carbon dioxide can be selectively pumped through sleeve 12 via stopcock 16 . surgical instruments , such as linear staplers , graspers , clip appliers , scopes etc . can now be inserted through cannula 8 to perform a procedure at the surgical site . referring again to fig1 and 2 , cannula 8 includes sleeve 12 and sleeve housing 14 . sleeve 12 extends distally from sleeve housing 14 . sleeve housing 14 includes stopcock 16 , valve lever 18 , and seal 10 . obturator 20 , as shown in fig3 has a shaft 22 having a proximal end 42 attached to handle 26 , and a distal end 44 extending therefrom . handle 26 and shaft 22 are formed from single piece of molded polymer . shaft 22 preferably includes a conical penetrating tip 32 which is integrally molded to shaft 22 at its distal end 44 . tip 32 includes first and second separators 34 and 36 which extend outwardly from penetrating tip 32 . handle 26 has a cap 46 attached to the proximal end 42 of shaft 22 . cap 46 is snapped onto handle 26 and is secured thereon by an interference fit . referring now to fig4 and 5 , penetrating tip 32 is molded integrally to shaft 22 at distal end 44 . penetrating tip 32 has circular base 40 and blunt point 38 extending distally from base 40 . base 40 is positioned adjacent to the distal end 44 of shaft 22 . first and second separators 34 and 36 , respectively , have generally straight , linear edge surfaces . each first and second separator 34 and 36 extends longitudinally from adjacent to base 40 toward point 38 of penetrating tip 32 . first and second separators 34 and 36 are spaced about 180 ° from each other , and are positioned proximally to point 38 . referring again to fig3 shaft 22 further includes a reinforcing member 30 disposed thereon . in the embodiment illustrated in fig6 member 30 is a rigid reinforcing hollow tube made of stainless steel , titanium or any other suitable material known to those skilled in the art . using manufacturing methods like injection molding , a polymer such as polycarbonate , or any other suitable polymer known to those skilled in the art , can be injected through member 30 wile forming shaft 22 and handle 26 . other manufacturing methods , readily apparent to those skilled in the art , could also be used to make the present invention . an alternate embodiment of the present invention is shown in fig7 . in this embodiment , shaft 122 , similar to shaft 22 , includes a reinforcing member 130 disposed within the shaft 122 . member 130 is a solid cylindrical rod made of a reinforcing material such as stainless steel , aluminum or any other material known to those skilled in the art . using manufacturing methods like injection molding , shaft 122 and handle 126 ( not shown ) can be integrally molded as a single piece around member 130 . fig8 shows another alternate embodiment , similar to that shown in fig7 wherein shaft 222 includes of a member 230 disposed therein . member 230 is similar to member 130 but has a plus shaped cross - section . as will be appreciated by those skilled in the art , many other suitable cross - sectional configurations other than circular and plus , can be used in the present invention . although particular embodiments of the present invention have been shown and described , other embodiments will become apparent to those skilled in the art without departing form the spirit and scope of the present invention . the terms used in describing the invention are used in their descriptive sense and not as terms of limitations . | 0 |
embodiments of the invention include , separately or both in combination , two types of research surveys : a large , routinely fielded survey , referred to herein as the detail performance monitor sm survey , which assesses changes in respondent attitudes across disciplines , for example , therapeutic areas ; and a smaller , ad - hoc survey , referred to herein as the detail assessment sm survey , which is run , for example , in parallel with the detail performance monitor for a specific campaign . these two surveys may be utilized interdependently . the detail performance monitor provides an in - depth understanding of the real - world impact of sales details on respondent consumer behavior , for example , prescribing behavior . the detail assessment uses these data obtained from the detail performance monitor and applies them to , for example , an individual detail under consideration . in one embodiment , for both the detail performance monitor survey and the detail assessment survey , a group of respondents , for example , physicians , are randomly selected from some relevant pool , for example , the american medical administration physician list , or a list provided by a client . the respondents can cover a number of different areas of concern , for example , practice specialties in the case of physicians . respondents are recruited by , for example , fax , email and / or other means to participate in web - based surveys via a website . a respondent who responds to the invitation may then visit the website to , for example , establish a new account or to visit a previously established personal page to check for survey opportunities . for new respondents , sufficient demographic data are gathered to allow verification of the respondent &# 39 ; s identity and credentials , to include , for example , the respondent &# 39 ; s particular discipline and other data used to build a representative sample . if a respondent has been recruited for a survey and logs on to his personal page within the allotted timeframe and while sufficient slots for the survey exist , he will see , for example , a link to the survey . a respondent may agree to take one or more detail performance monitor surveys . the surveys themselves can be offered to respondents in specific locations , such as a conference room , or preferably in remote locations via , for example , one or more web servers or other types of networks . the number of respondents should be on the order of thousands or more qualified respondents , who respond to the surveys contemporaneously . a mixture of , for example , java , xml , html and oracle database processes are employed to customize the survey for the respondents , perform validation on the responses , store the results data and trigger the fulfillment process . in contrast to the customization mentioned with respect to prior art survey processes , the customization referred to here merely renders a subgroup of the larger group of respondents , who may only be concerned with particular aspects of the more general survey . this customization allows the survey to retain comparability with respect to the respondent pool as a whole . the detail performance monitor survey is a periodic ( e . g . monthly ) survey of market activities and respondent attitudes across various disciplines . for example , the survey may be administered monthly to physicians across , for example , fifteen or more therapeutic areas , completed by , for example , 1500 physicians . the detail performance monitor survey has discrete groups of questions — or modules — that each form individual research topics . as will be described later in more detail , the module that contributes to the detail assessment invention is the detailing module . after successfully logging onto the website and clicking on the survey link , respondents answer a series of screening questions to determine which research modules they should receive for which disciplines . for a cardiologist , for example , this might involve access to hypertension and angina market surveys while their psychiatric peers might see surveys related only to depression treatment . transparent to each respondent , aspects of their survey are thus conformed to their discipline . as discussed previously , this limited customization makes the survey relevant to each respondent , however , care is taken to preserve the core consistency of the survey instrument . beyond selection of disciplines , another screening question determines if the respondent has received a sales call for products of interest , such as pharmaceuticals , within a certain time period , for example , the past 7 - 30 days . this retrospective approach enforces a double - blind approach to the sales call : the respondent does not know which products will be asked about and the researcher does not know which products the respondent has seen . respondents are not induced to report only on the activities of selected representatives prior to the sales call . such preparation could introduce a subtle bias into a respondent &# 39 ; s approach to the detail : specific details are now renumerative , and as such , are no longer part of the respondent &# 39 ; s normal environment . in response , the respondent is likely to be more interested in the interaction for the specific product than normal , and is more likely to cite awareness of the product , retain key messages , etc . as a result , such pre - preparation imparts a bias to survey results that make them less representative of how the detail will actually be received in the marketplace when no inducement is offered . in the detail performance monitor , respondents complete a questionnaire battery for sales calls they have received within , for example , the past 7 days . these questions ask respondents to evaluate an actual product detail given by a representative across a number of call dynamics , to include , for example : the type of call ( scheduled appointment , lunch , dinner meeting , professional conference , etc . ); messages recalled from the presentation ; ratings of effectiveness of the detail ; reporting of competitive product mentions and messages ; and / or intent to change behavior on the basis of the interaction . responses from this study are routinely compared to the ensuing respondent consumer behavior of the survey respondents . in the case of marketing research in the pharmaceutical industry , the respondent consumer behavior would be physician prescribing behavior . these prescribing data are collected at pharmacies and then cleaned , aggregated and sold by a variety of vendors . some of these vendors claim greater than 95 % capture of prescriptions filled in retail pharmacies nationwide ; others capture a smaller but representative data set . prescribing data are available at the individual physician level , and each physician is identified by one of several unique physician identifiers extant in the industry . by collecting these same unique identifying data at registration or via demographic questions , attitudinal data from survey research may be linked with the same physician &# 39 ; s exact prescribing pattern at the same time point . this comparison results in a wealth of data available for statistical processing and the production of predictive models . the actual modeling and other analytic processes can be performed in a wide variety of statistical and database software packages . following a deployment of the detail performance monitor survey , pooled regression is performed against the survey responses and subsequent behavioral data to correlate the pattern of respondent attitudes , beliefs and self - reported respondent consumer behaviors that best forecast discrete respondent consumer behaviors . this statistical processing identifies the question / response pairs that are most predictive of future respondent consumer behavior , and produces a weighting of the contribution of each to the strength of the prediction . this weight , or coefficient , is , for example , the mathematical share of relative contribution of each attribute to the total behavior under study and underpins the predictive model . based on subsequent waves of this routine collection of attitudinal and behavioral data , these predictive models can be continually monitored and readjusted as needed to adjust to changes in attitudes , beliefs , behavioral patterns and their interrelationships . providing methodologic factors are properly controlled , the same question asked in a separate study can share these coefficients to model respondent consumer behavior from response data . the detail performance monitor survey comprises “ in the field ” responses to the research question : “ how are consumers responding to current campaigns in the marketplace ?” when these same questions are asked again in a subsequent study , the new survey responses can be weighted with these same coefficients and benefit from the same predictive model of how those responses will ultimately affect respondent consumer behavior . this process of comparing a subset of results against historical data produced by the same research instrument over time and in various circumstances is described as a “ normative ” dataset , as it purports to represent a “ normal ” distribution of responses . a research instrument describes a combination of survey questions , survey logic , flow , sample size , and certain other aspects of methodology that can be expected to produce comparable results in separate deployments . with continued accumulation of similar data points , better confidence can be obtained to corroborate these findings , and researchers can explore many more paths of inquiry around how consumers , for example , physicians , will respond to marketing efforts . some , more subtle findings may become apparent , for example , only after an extraordinary number of data points are collected and the experiment reaches sufficient power . at root , however , is the creation and analysis of a large , carefully controlled dataset of survey response and behavioral data . from this basis , a number of innovative data products may be created . one such feature , according to one or more embodiments of the present invention , is a statistical model derived from the detail performance monitor data , referred to herein as the detail performance score , or dps . fig1 illustrates a method for calculating the dps , as defined by one or more embodiments of the present invention . dps 110 represents the overall ability of the detail for the profiled product to influence respondent consumer behavior , for example , physicians &# 39 ; prescribing behavior . the dps ranges , for example , from 1 to 100 , where a score of 1 may indicate that all of the product &# 39 ; s details fail to influence , for example , in a medical marketing scenario , any physicians to prescribe the detailed product . dps 110 is modeled , for example , from detail performance monitor survey 120 results that represent a large number , for example , on the order of tens of thousands of historical details across a variety of disciplines , for example , fifteen therapeutic areas , and over a various sample of products , such as , 100 products . the dps 110 is developed , according to one or more embodiments of the present invention , from a weighted combination of individual components of the detail , where the weights for each individual component are determined by the relative importance of the detail component to , for example , the physician &# 39 ; s prescribing decision . these components are comprised of selected question / response pairs with known contribution to a consumer behavior , a process explained above . it should be noted that other methods of calculating the dps are also possible according to one or more embodiments of the present invention . another feature , according to one or more embodiments of the present invention , is a metric that compares the calculated dps of the profiled product &# 39 ; s details to an expected dps , given the profiled product &# 39 ; s lifecycle . this metric is referred to herein as the lifecycle performance index , or lpi . these lifecycle stages may be described as , for example : 0 - 3 months — launch , awareness and trial ; 4 - 6 months — launch and adoption ; 7 - 12 months — growth , phase 1 ; 13 - 18 months — growth , phase 2 ; and 19 or more months — mature . consumers are typically more interested in new products , and their interest in receiving additional information declines as they gain experience with the product or as the product ages . in the pharmaceutical industry , for example , for all products across all treatment areas , dps scores tend to follow a similar descending curve as they move further away from launch . an expected dps is estimated by , for example , fitting this curve ; the data are then normalized to a baseline of , for example , 100 to represent the intersection of expected score at point in lifecycle . other methods of estimating the estimated dps are possible according to one or more embodiments of the present invention . the expected dps — the score typically expected of a product of like lifecycle stage — is compared to the actual dps to produce a lifecycle - adjusted measure of variance from the expected norm . this variance is then computed through statistical processing to produce a lifecycle - normalized score used to further evaluate sales performance . this score is the lpi . a lpi above 100 indicates , for example , that the profiled product &# 39 ; s details are more effective than expected given the length of time since the profiled product &# 39 ; s launch . a lpi below 100 indicates , for example , that the profiled product &# 39 ; s details are more effective than expected given the length of time since the profiled product &# 39 ; s launch . another such feature , according to one or more embodiments of the present invention , is a statistical model derived from the detail performance monitor data , referred to herein as the regional performance score , or rps . whereas the dps is a model to predict effectiveness at the national , or census , level , the rps model calculates the dps from data collected from autonomous geographic regions and provides a measure of regional variation in receptivity to the detail . using a similar method as previously delineated for calculation of the dps , researchers evaluate the value of this score versus the national dps . for example , a score of 50 on this measure is considered an average score , while a score of 100 is the highest attainable and 1 is the lowest . by comparing this score at regional levels across the nation , marketers can hone their materials and presentations to achieve optimal results despite regional variability in acceptance and response . as an example , in the case where a detail earns a rps of 40 in the northeast and 70 in the southeast , a marketer might commission additional research to fully understand the dynamics that result in this disparity . on the basis of this understanding , they might further tailor their materials and presentations used with customers in the southeast to more effectively influence the desired respondent consumer behaviors . they could then continue to use the rps generated for subsequent dpms to track progress against this goal . this regionalization divides the total sample by as many regions as are included in the segmentation . the dpm may not achieve sufficient sample size during each dpm fielding to express significant differences among populations . as a result , the rps is calculated as the average of the prior three months regional dps in order to achieve a sufficient quantity of observations per region . another such feature , according to one or more embodiments of the present invention , is a statistical model derived from the detail performance monitor data , referred to herein as the message performance score , of mps . this model tests one or discrete marketing messages for predicted impact on respondent consumer behavior . in the pharmaceutical market , the mps predicts the impact on physician prescribing behavior . the detail has one or more messages that are designed to present to the physician the benefits of the detailed product . these messages may have a visual component , e . g ., graphics , text , photos , graphs , and / or other visual materials . these messages may also have an audio component , e . g ., an audio voiceover , music , and / or other types of audio . the ability to influence physician prescribing decisions varies by message . the message performance score presents a performance score for each message that indicates the ability of that message to influence physicians to prescribe the detailed product . similar to calculation of the dps , selected question / response pairs — this time surrounding specific marketing messages — are analyzed against respondent consumer behavioral data to determine which messages produce the greatest change in respondent consumer behavior . messages are then scored , for example , on a 1 - 100 scale , where a score of 1 indicates no effect of the message on changes in respondent consumer behavior . this subdivision of the group by message divides the total sample by as many messages as are included in the segmentation . the dpm may not achieve sufficient sample size during each dpm fielding to express significant differences in mps among populations . as a result , the mps is calculated as the average of the prior two months responses in order to achieve a sufficient quantity of observations per region . according to one or more embodiments of the present invention , in order to evaluate a specific detail under consideration , a detail assessment survey is conducted . the detail assessment survey serves as an “ in the lab ” complement to the “ in the field ” detail performance monitor . in this survey , responses at a particular time point can be compared to historical responses to the same question to provide a measure of “ skew ” from the mean , historical response . the detail assessment survey is a standardized research instrument designed to simulate , for example , the sales representative / respondent detail experience . a sequence of research questions and multimedia presentations , for example , are exposed to the respondent in a controlled fashion over , for example , the internet or some other wide area network (“ wan ”). because this survey shares standard research questions or modules with the detail performance monitor , survey results from the detail performance monitor may be used with the same predictive prescribing model to forecast respondent consumer behavior . in the detail assessment , respondents are recruited by , for example , fax and / or email to participate in a survey over the internet that last for a certain period of time , for example , 30 - 45 minutes . by conducting the survey over the internet ( or other wan ), respondents can take the survey at home or office conveniently , and a geographically dispersed sample is obtained . the sample size of the survey is modeled , for example , by comparing the research instrument , the number and subgroups in the population and the desired resolving power to detect differences in responses . respondents who qualify for the study see , for example , a link on their welcome page , and may click this link to initiate the detail assessment survey . respondents then participate in a series of questions designed to evaluate their response to a representative detail . these questions are divided into discrete , standardized modules and include , for example : the pre - stimulus questions , the full detail exposure , the post - stimulus questions , an optional counter detail and the detail piece drill down . fig2 illustrates a methodology of conducting a detail assessment survey , according to one or more embodiments of the present invention . the modules of the detail assessment survey include , for example : pre - stimulus module 210 ; full detail module 220 ; post stimulus module 230 ; optional counter - detail module 240 ; and detail piece module 250 . it should be noted that the modules represented in fig2 and described below may be presented to respondents in any number of sequences and is not limited to the particular sequence illustrated and described . in the first module , referred to herein as pre - stimulus questions module 210 , respondents answer questions about their particular area of interest , for example , in the case of physicians , the questions may pertain to their practice and include , for example , the volume of patients , the density of specific patient types and a self - reported estimate of their prescribing behavior . in the second module , referred to herein as full detail exposure 220 , respondents are exposed to a full detail via , for example , a proprietary multimedia presentation . technology may be used to present the multimedia presentation that allows visual images to be synchronized with , for example , an audio voiceover . in one or more embodiments of the present invention , this technology is optimized for transmission of multimedia presentations over a 28 . 8 kbps dial - up link as well as for broadband users . images may be , for example , scanned pictures of the proposed promotional material , rendered as , for example , . gif , jpeg , . pdf , or html images to be shown over , for example , a web browser . a representative sales pitch may be recorded and synchronized with the images . once created , these multimedia presentations can be offered at any point in the survey . they can also be emailed and presented as a link . in one or more embodiments of the present invention , the multimedia presentations are presented in a continuous flow of information elements displayed through the web browser . respondents will answer questions , see a multimedia presentation , answer more questions , etc . these survey and multimedia components can be packaged in any number of novel ways to support a research exercise . for example , the multimedia technology employed may allow respondents to view and pause the presentation , and the respondent may be prevented from reversing or fast - forwarding the presentation . in this way , researchers gain greater assurance that the respondent will see the stimulus in the way it was designed , with the only concession to real - world conditions that of a pause for the invariable bathroom break , phone call or other event that takes the respondent away from his or her computer . the technology further allows , for example , the ability for respondents to view a page and then drill into a portion of the page for greater clarity . when a detail assessment survey involves the testing of multiple details , according to one or more embodiments of the present invention , the sample may be increased proportionally so that each respondent views , for example , a single presentation once , and their results are then compared . this “ monadic design ” removes the bias produced by respondent learning as a result of viewing multiple presentations . following the presentation of full detail module 220 , respondents move to a third module , post - stimulus questions module 230 , where they are asked a variety of standardized questions to assess the impact of the detail . these questions may mirror the pre - exposure questions , and as such include , for example , a number of normative questions reflecting the effectiveness of the detail — questions that have historical data correlates that are used in reporting or forecasting . fig3 illustrates an example of results provided to assess changes in prescribing associated with viewing the detail . many of the same questions used in the detail assessment survey may also be asked in conjunction with the detail performance monitor survey . these shared questions provide a consistent linkage with which to correlate the findings of the mock detail tested “ in the lab ,” using the detail assessment survey , with the results of details recalled from “ in the field ,” using the detail performance monitor survey . it is to the results of these shared questions that the coefficients that predict future prescribing behavior are applied . it is in this manner that the detail assessment survey about the detail at hand uses previously collected data to predict respondent consumer behavior , for example , future prescribing behavior as a result of the proposed detail , according to one or more embodiments of the present invention . by varying the components and delivery of the detail , marketers can thus “ tune ” the detail to achieve the largest predicted impact on prescribing . for example , for a particular detail , results of the detail assessment survey may indicate that the graphics component of the detail score below expectations . the graphics could , thus , be “ tuned ” to remedy any defects or weaknesses . it should be noted that other methods of using previously collected data to predict future respondent consumer behavior are also possible according to one or more embodiments of the present invention . a fourth module of the survey is an optional module , referred to herein as counter detail module 240 , whereby one or more simulated competitive responses — also shown , for example , via multimedia graphics with or without streaming audio . respondents are asked a series of questions to ascertain if the counter detail affected their responses . these findings provide the marketer with an assessment , for example , of the durability of the sales pitch when exposed to criticism . normative questions asked in the counter detail module focus on reassessment of the original detail , again providing opportunities for cross - time , cross - therapeutic area analysis of the impact of counter detail campaigns on a marketing campaign . after viewing the detail and counter detail ( if included ) the respondent is exposed to a fifth module of the survey , referred to herein as detail piece drill down module 250 . here , the respondent is asked a series of in - depth normative drill - down questions about the promotional materials . these normative drill - down questions provide insight into , for example , how the materials should be physically produced to achieve a desired affect . other normative data may be gathered to assess the respondents &# 39 ; emotional responses to the detail and to evaluate , for example , the creative and graphical content of the promotional materials . respondents also are asked about elements of stopping and staying power , for example , does the detail capture the attention , pique interest , summarize pertinent information , leave a lasting impression , and is it relevant to the respondent &# 39 ; s discipline . each question is asked , for example , consistently over time , thus continuing to contribute to the normative dataset of historical responses to detailing . in one or more embodiments of the present invention , results of the detailed assessment survey are tabulated and standard statistical measures of difference are performed . fig4 illustrates an example of a representative results set from a detail piece drill down . these analyses are performed in a variety of tools available from a variety of vendors , for example , sas software , spss inc . software , wincross software from the analytic group , inc ., and other statistical analysis and reporting software packages . these results are analyzed and built into a report for the sponsor of the research . these reports may take the form of , for example , a graphical presentation of the data and may include , for example , cross - tabular data tables that show the data with statistical testing applied . the report explains the methodology , the findings , the implications for the marketer , and recommendations on next steps in improving the marketing process . the results provide , for example , a summary of how the respondent &# 39 ; s impressions change in response to the detail . these impressions may be compared at the outset of the detail assessment survey process , after viewing the presentation ( s ), and at the end of the detail assessment survey process . this provides a means , according to one or more embodiments of the present invention , of determining how the detail itself — and counter detail , if so included — contributes to changes in respondent attitudes and beliefs surrounding the product . these results may also be calculated among subgroups — as an example , primary care physicians versus specialists — and against the normative results values seen to date . the researcher can select the normative dataset from , for example , across all markets , within a selected market over time , within a particular company or product , etc . it should be noted that other methods of analysis of the detail assessment survey are possible according to one or more embodiments of the present invention . another finding provided by an embodiment of the present invention is , for example , the predictive modeling of future respondent consumer behavior . by using shared questions and methodologies , researchers can apply the same correlation coefficients used in the empiric detail performance monitor to the detail assessment to develop a model for how the detail at hand can be expected to affect future respondent consumer behavior . specifically , a specific detail assessment survey is conducted to test marketing materials relating to , for example , one product . separately , the same questions from the specific detail assessment survey may be asked about , for example , all products within the same market using the detail performance monitor survey . the detail assessment survey may be administered to a group of respondents that is distinct from the group of respondents used in the detail performance monitor survey , although there may be some overlap between the groups of respondents . the results of each study may be analyzed to produce dps scores . these dps scores are then compared to evaluate how well the detail “ in the lab ,” tested using the detail assessment survey , would be expected to perform “ in the field ,” as tested using the detail performance monitor survey . a detail assessment - based dps score that is higher than the market average represented by the detail performance monitor - based dps score would tell the marketer that their approach is superior to those currently in the marketplace . in order to account for differences in lifecycle , each product - specific dps may be subsequently run through a stage of lifecycle adjustment to produce the lpi scores for each product . as with the dps , these lpis then may be evaluated to further hone the predictive - impact model . these models , among others , provide clear , simple metrics that allow a summarized assessment of propensity to change behavior . in this way , responses to details as produced according to one or more embodiments of the present invention may serve as a leading indicator for future prescribing behaviors , and marketers can start to react weeks or months ahead of receipt of the corroborating prescribing data . the detail performance monitor and the detail assessment impart a substantial competitive advantage to the marketer by placing them in a proactive position to influence market share . when compared to competitors who have to wait until the prescribing behavior are available and then hypothesize the effects of a current campaign on those behaviors , the detail assessment user can gain advantage in speed , accuracy and momentum . when compared to the marketer who uses only qualitative data in their testing , the detail assessment user can gain advantage in knowing exactly which elements contribute to or detract from a desired effect , and reap improved productivity among team members by reducing testing - related travel . as each subsequent deployment adds to the power of the normative detailing data set , the marketer using the detail assessment solution can expect their results and predictions to improve in accuracy and predictability over time . ultimately , the same marketer , who learns from and applies the findings obtained from these surveys and methods , can expect to enjoy improvements in market share and usage as a result . fig5 illustrates an example of a network over which the present invention may be implemented . as described previously , the detail performance monitor survey and the detail assessment survey may be presented to one or more respondents over a wide area network (“ wan ”), for example , the internet 510 . a respondent , for example , a physician , accesses one or more web server ( s ) 512 a - n through various user terminals , shown as user terminals 502 a - n . web server ( s ) 512 may host and administer the detail performance monitor survey and / or the detail assessment survey to the respondent ( s ), as described above . various aspects of the present invention that can be controlled by a computer can be ( and / or be controlled by ) any number of control / computer entities , including the one shown in fig6 . fig6 is an illustration of a computer 658 used as a respondent user terminal in accordance one or more embodiments of the present invention . the procedures described above may be presented in terms of program procedures executed on , for example , a computer or network of such computers , or user terminals . viewed externally in fig6 , computer 658 has a central processing unit ( cpu ) 668 having disk drives 669 , 670 or other such devices that may accommodate removable media such as floppy disks , cd roms , digital video disks , etc . computer 658 also has a display 671 upon which information may be displayed . a keyboard 672 and / or a pointing device 673 , such as a mouse 673 , may be provided as input devices to interface with central processing unit 668 . the pointing device 673 may be a mouse , touch pad control device , track ball device , or any other type of pointing device . fig7 illustrates a block diagram of the internal hardware of the computer of fig6 . cpu 775 is the central processing unit of the system , performing calculations and logic operations required to execute a program , such as accepting respondent input to survey questions . read only memory ( rom ) 776 and random access memory ( ram ) 777 constitute the main memory of the computer . disk controller 778 interfaces one or more disk drives to the system bus 774 . these disk drives may be floppy disk drives such as 779 , or cd rom or dvd ( digital video / versatile disk ) drives , as at 780 , or internal or external hard drives 781 . as previously indicated these various disk drives and disk controllers are optional devices . a display interface 782 permits information from bus 74 to be displayed on the display 783 . in addition to the standard components of the computer , the computer may also include an interface 785 , which allows for data input through the keyboard 786 or pointing device , such as a mouse 787 . the foregoing detailed description includes many specific details . the inclusion of such detail is for the purpose of illustration only and should not be understood to limit the invention . in addition , features in one embodiment may be combined with features in other embodiments of the invention . various changes may be made without departing from the scope of the invention as defined in the following claims . as one example , the user may interact with the system via e . g ., a personal computer or over pda , e . g ., the internet , an intranet , etc . either of these may be implemented as a distributed computer system rather than a single computer . similarly , the communications link may be a dedicated link , a modem over a pots line , and / or any other method of communicating between computers and / or users . the user interfaces may be developed in connection with an html display format . although html is utilized in the illustrated examples , it is possible to utilize alternative technology for displaying information , obtaining user instructions and for providing user interfaces . the invention has been discussed in connection with particular examples . however , the principles apply equally to other examples and / or realizations . naturally , the relevant data may differ , as appropriate . the system used in connection with the invention may rely on the integration of various components including , as appropriate and / or if desired , hardware and software servers , database engines , and / or other content providers . the configuration may be , preferably , network - based and uses the internet as a primary interface with the user . the system according to one or more embodiments of the invention may store collected information and / or indexes to information in a database . an appropriate database may be on a standard server , for example , a small sun ™ sparc ™ server , or other remote location . the information may , for example , optionally be stored on a platform that may , for example , be unix - based . the various databases maybe in , for example , a unix format , but other standard data formats may be used . the system on the server side according to one or more embodiments of the invention is optionally suitably equipped with a one or a combination of processors or storage devices . for example , the computer may be replaced by , or combined with , any suitable processing system operative in accordance with the principles of embodiments of the present invention , including sophisticated calculators , hand held , laptop / notebook , mini , mainframe and super computers , as well as processing system network combinations of the same . further , portions of the system may be provided in any appropriate electronic format , including , for example , provided over a communication line as electronic signals , provided on floppy disk , provided on cd rom , provided on optical disk memory , etc . any presently available or future developed computer software language and / or hardware components can be employed in such embodiments of the present invention . for example , at least some of the functionality mentioned above could be implemented using visual basic , c , c ++ or any assembly language appropriate in view of the processor being used . it could also be written in an interpretive environment such as java and transported to multiple destinations to various users . although various embodiments that incorporate the teachings of the present invention have been shown and described in detail herein , those skilled in the art can readily devise many other varied embodiments that incorporate these teachings . the many features and advantages of the invention are apparent from the detailed specification , and thus , it is intended by the appended claims to cover all such features and advantages of the invention , which fall within the true spirit and scope of the invention . further , since numerous modifications and variations will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction illustrated and described , and accordingly , all suitable modifications and equivalence may be resorted to , falling within the scope of the invention . for example , although particular reference is made with regard to the use of embodiments of the present invention with regard to marketing strategies in the pharmaceutical industry , it should be noted that the present invention is not limited to this use and may be applied to any area in which marketing strategies are utilized and , thus , are desired to be evaluated . it is to be understood that the invention is not limited in its application to the details of construction and to the arrangements of the components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced and carried out in various ways . also , it is to be understood that the phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting . | 6 |
fig1 a shows a first exemplary embodiment of an integrated circuit according to the invention . the integrated circuit according to the invention comprises , as active semiconductor component , an npn - bipolar transistor 10 and a protective diode 9 . the latter is provided for protecting the npn - bipolar transistor 10 against voltage breakdowns . in the exemplary embodiment presented in accordance with fig1 a npn - bipolar transistor 10 and protective diode 9 are embodied in customary silicon technology . the circuit arrangement is situated on a p - conducting substrate 19 , a silicon wafer or the like . an n + - conducting embedding layer 18 , a so - called buried layer , is introduced into the p - conducting substrate 19 by ion implantation or diffusion . an epitaxially n - conducting layer 11 is situated on said buried layer 18 . said n - conducting epitaxial layer 11 is formed as an outer n - conducting well into which a p - conducting well 12 for the active semiconductor component , namely the npn - bipolar transistor 10 , is introduced for example by ion implantation . this inner p - conducting well 12 is provided with a heavily p - doped base connection zone 15 , from which the base connection b is led away . furthermore , a heavily n - doped emitter zone 14 is introduced as connection for the emitter e into the p - type well 12 by ion implantation or diffusion . the collector c of the npn - transistor is formed by the n - conducting epitaxial layer 11 , the contact - connection of which is effected by means of the heavily n - conducting embedding layer 18 and a heavily n - doped connection pillar 17 — reaching through the n - conducting outer well 11 — to the collector connection c . in order to prevent a current overloading as a result of breakdown from the inner p - type well 12 forming the base zone to the outer n - type well 11 forming the collector zone , a further p - conducting well 13 is introduced into the n - conducting epitaxial layer 11 at a small distance from the p - type well 12 . this further p - type well 13 is superficially provided with a heavily p - doped anode connection zone 16 for contact - connection . inner p - type well 13 and outer n - type well 11 form a pn junction , that is to say a diode 9 . the connections ( anode a and cathode k ) of said diode 9 are formed on the one hand by the anode connection zone 16 ( for the anode a ) and on the other hand by the embedding layer 18 and the pillar 17 ( for the cathode k ). the breakdown voltage of the further p - type well 13 with respect to the outer n - type well 11 is chosen to be less than the breakdown voltage of the inner p - type well 12 of the npn - transistor 10 with respect to the outer n - type well 11 . for operation of the npn - bipolar transistor 10 , the anode a of the protective diode 9 is connected up to the bipolar transistor 10 ( for example the anode a of the protective diode 9 and the emitter e of the bipolar transistor 10 may be at an identical potential ) in such a way that in the case of an overloading of the npn - bipolar transistor 10 , on account of a reverse - biasing between the base b and collector c a breakdown 21 is effected between the further p - type well 13 and the outer n - type well 11 and not between the inner p - type well 12 of the bipolar transistor 10 and the outer n - type well 11 . the energy that dissipates during the breakdown 21 is dissipated over the breakdown current path 20 between the p - type well 13 , the n - type well 11 , the n + - type buried layer 18 and the n + - type pillar 17 . destruction of the npn - bipolar transistor 10 is thereby prevented . fig1 b shows a second exemplary embodiment of an integrated circuit according to the invention . the integrated circuit according to the invention comprises , as active semiconductor component , a vdmos field effect transistor 30 and an integrated protective diode 29 protecting the vdmos - fet 30 ( fet = acronym for field effect transistor ) against voltage breakdowns . in the exemplary embodiment presented in accordance with fig1 b , vdmos - fet 30 and protective diode 29 are embodied on a silicon wafer . the circuit arrangement is situated on a p - conducting silicon substrate 39 . an n + - conducting embedding layer 38 ( buried layer ) is introduced into the p − - conducting substrate 39 by ion implantation . as in the exemplary embodiment described above , an epitaxial n - conducting layer 31 is situated on said buried layer 38 . said n - conducting epitaxial layer 31 represents an outer n - type well into which two p - conducting wells 32 . 1 , 32 . 2 , so - called bodies , for the fet 30 are introduced ( for example by ion implantation ). these p - conducting bodies 32 . 1 , 32 . 2 are provided with heavily p - doped source connection zones 34 . 1 , 34 . 2 , from which source connections s are led away . furthermore , n + - doped zones 35 . 1 , 35 . 2 defining a source connection are in each case introduced into the p - conducting bodies 32 . 1 , 32 . 2 by ion implantation or diffusion . the drain d is formed by the n - conducting epitaxial layer 31 , the contact - connection of which is effected by means of the n + - conducting embedding layer 38 and an n + - doped connection pillar 37 — reaching through the n - conducting epitaxial layer 31 ′ to the up - drain connection d . furthermore , a gate g , g 1 , g 2 comprising two gate contacts 41 , 42 is provided . in order to prevent a breakdown from the p - type wells 32 . 1 , 32 . 2 to the n - type well 31 , a further p - conducting well 33 is introduced into the n - conducting epitaxial layer 31 at a small distance from the p - type wells 32 . 1 , 32 . 2 . this further p - type well 33 is superficially provided with a p + - doped connection zone 36 for contact - connection . the further p - type well 33 and the outer n - type well 31 form a pn junction defining the abovementioned protective diode 29 . the connections a , k of said protective diode 29 are formed on the one hand by the anode connection zone 36 ( for the anode a ) and on the other hand by the embedding layer 38 and the pillar 37 ( for the cathode k ). the breakdown voltage of the further p - type well 33 with respect to the outer n - type well 31 is chosen to be less than the breakdown voltage of the p - type wells 32 . 1 , 32 . 2 with respect to the outer n - type well 31 . for operation of the field effect transistor 30 , the anode a of the protective diode 29 is connected up to the field effect transistor 30 ( for example the anode a of the protective diode 29 and the source connection s of the field effect transistor 30 may be at an identical potential ) in such a way that , in the case of an overloading of the field effect transistor 30 , on account of a current loading between body 32 . 1 , 32 . 2 and up - drain d , a breakdown 41 is effected between the further p - type well 33 and the outer n - type well 31 and not between the p - type bodies 32 . 1 , 32 . 2 of the field effect transistor 30 and outer n - type well 31 . the energy that is dissipated during the breakdown 41 is dissipated over the breakdown current path 40 between the p - type well 33 , the n - type well 31 , the n + - type buried layer 38 and the n + - type pillar 37 . destruction of the field effect transistor 30 is thereby effectively prevented . fig1 c shows a third exemplary embodiment of an integrated circuit according to the invention . the integrated circuit according to the invention comprises , as active semiconductor component , an ldmos field effect transistor 50 and an integrated protective diode 49 protecting the ldmos - fet 50 against voltage breakdowns . in the exemplary embodiment presented in accordance with fig1 c , ldmos - fet 50 and protective diode 49 are embodied in a similar manner to the vdmos - fet 30 and the protective diode 29 corresponding to fig1 b . the circuit arrangement is situated on a p - conducting silicon substrate 59 . an n + - conducting buried layer 58 is introduced into the p − - conducting substrate 59 . as in the exemplary embodiment described above , an epitaxial n - type layer 51 is situated on said buried layer 58 . a p - conducting body 52 for the fet 50 is introduced into said n - type epitaxial layer 51 . the body 52 is provided with a p + - type doped body connection zone 54 , from which a source connection s is led away . furthermore , an n + - conducting source zone 55 is introduced into the body 52 . two drain connections d 1 , d 2 with corresponding n + - type drain zones 62 , 57 introduced into the n - type epitaxial layer 51 are provided . a gate g with gate contact g 1 is also provided . in order to prevent a breakdown from the p - type body 52 to the n - type well 51 , a further p - conducting well 53 is introduced into the n - conducting epitaxial layer 51 at a small distance from the n + - type drain zones 62 , 57 . said further p - type well 53 is superficially provided with a p + - doped anode connection zone 56 for contact - connection . the further p - type well 53 and the outer n - type well 51 form a pn junction defining the abovementioned protective diode 49 . the connections a , k of said protective diode 49 are formed on the one hand by the anode connection zone 56 ( for the anode a ) and on the other hand by the embedding layer 58 and the pillar 57 ( for the cathode k ). as in the previous exemplary embodiment , the breakdown voltage of the further p - type well 53 with respect to the outer n - type well 51 is chosen to be smaller than the breakdown voltage of the p - type well 52 with respect to the outer n - type well 51 . for operation of the field effect transistor 50 , the anode a of the protective diode 49 is again connected up to the field effect transistor 50 ( for example the anode a of the protective diode 49 and the source connection s of the field effect transistor 50 may be at an identical potential as in the previous exemplary embodiment ) in such a way that , in the case of an overloading of the field effect transistor 50 , on account of a reverse - biasing between body 52 and drain d 1 , d 2 , a breakdown 61 is effected between the further p - type well 53 and the outer n - type well 51 and not between the p - type body 52 of the field effect transistor 50 and the outer n - type well 51 . the energy that is dissipated during the breakdown 61 is dissipated over the breakdown current path 60 between the p - type well 53 , the n - type well 51 , the n + - type buried layer 58 and the n + - type pillar 57 . destruction of the field effect transistor 50 is effectively prevented in this way . in the case of a vertical technology ( as presented previously ) with integrated components ( smart technology ), the contact - connection of the collector may also be effected on the rear side of the wafer . the protective pn junction may then be configured as part of the edge termination . one or more p - type wells of the active semiconductor structure may lie within the outer n - type well , which p - type wells may be arranged for instance in the form of cells or strips ( as is customary in the case of dmos transistors ). equally , the integrated protective diode may comprise one or more p - type wells which may be adjacent in an arbitrary arrangement with respect to the p - type wells of the active component . fig2 shows an exemplary embodiment in which the integrated protective diode 69 comprises a plurality of p - type wells 81 . 1 , 82 . 2 . the integrated circuit according to the invention in accordance with fig2 comprises , as active semiconductor component 70 , either an npn - bipolar transistor ( like the circuit in accordance with fig1 a ), a field effect transistor or a diode and also a protective diode 69 which is provided for protecting the semiconductor component 70 against voltage breakdowns . in the exemplary embodiment presented in accordance with fig2 , the semiconductor component 70 is embodied in a similar manner to the field effect transistor 30 corresponding to fig1 b . the circuit arrangement is situated on a p - conducting silicon substrate 79 . an n + - conducting buried layer 78 is introduced into the p − - conducting substrate 79 . an epitaxial n - type layer 71 is situated on said buried layer 78 . two p - conducting wells 72 . 1 , 72 . 2 for the semiconductor component 70 are introduced into said n - type epitaxial layer 71 . said wells 72 . 1 , 72 . 2 may be bodies of a field effect transistor , emitter / base zones of a bipolar transistor or anode zones of a diode . it goes without saying that these may be provided with corresponding p + - doped connection zones , from which corresponding source connections , emitter and base connections or anode connections 74 are led away . other regions zones having an identical or different doping and / or doping concentrations may be provided , but are not illustrated in the drawing . collector , up - drain or cathode of the semiconductor component 70 is formed by the n - conducting epitaxial layer 71 , the contact - connection of which is effected by means of the n + - conducting embedding layer 78 and an n + - doped connection pillar 77 — reaching through the n - conducting outer well 71 — to the collector , up - drain or to the cathode of the active semiconductor component 70 . the corresponding connection is identified by the reference symbol 75 in the figure of the drawing . in order to prevent a current loading as a result of a breakdown from the p - type wells 72 . 1 , 72 . 2 to the n - type well 71 , two further p - conducting wells 73 . 1 , 73 . 2 are introduced into the n - conducting epitaxial layer 71 at a small distance from the p - type well 72 . 1 , 72 . 2 . said p - type wells 73 . 1 , 73 . 2 are in each case superficially provided with a heavily p - doped anode connection zone 76 . 1 , 76 . 2 for contact - connection . the two p - type wells 73 . 1 , 73 . 2 and the n - type well 71 in each case form a pn junction , that is to say diodes 69 . 1 , 69 . 2 . the connections of said diodes 69 . 1 , 69 . 2 are formed on the one hand by the anode connection zones 76 . 1 , 76 . 2 ( for the anodes a connected to one another in the exemplary embodiment ) and on the other hand by the embedding layer 78 and the pillar 77 ( for the cathode k ). a single diode 69 is formed by the electrical connection of the anodes of the two partial diodes 69 . 1 , 69 . 2 . the breakdown voltage of the further p - type wells 73 . 1 , 73 . 2 with respect to the outer n - type well 71 is again chosen to be less than the breakdown voltage of the p - type wells 72 . 1 , 72 . 2 with respect to the outer n - type well 71 . the semiconductor component 70 is now connected up externally to the anode a of the protective diode 69 ( for example the anode a of the protective diode 69 and the emitter e of the semiconductor component 70 embodied as a bipolar transistor may be at an identical potential ) in such a way that , in the case of an overloading of the semiconductor component 70 , on account of a reverse - biasing between well 72 . 1 and / or 72 . 2 and well 71 , a breakdown 81 . 1 , 81 . 2 is effected between the further p - type wells 73 . 1 , 73 . 2 and the outer n - type well 71 and not between the p - type wells 72 . 1 , 72 . 2 of the semiconductor component 70 and the outer n - type well 71 . the energy that is dissipated during the breakdown 81 . 1 , 81 . 2 is dissipated over the breakdown current path 80 between the p - type wells 73 . 1 , 73 . 2 , the n - type well 71 , the n + - type buried layer 78 and the n + - type pillar 77 . destruction of the semiconductor component 70 is prevented . the possible splitting and distribution of the breakdown source within the active area of the component to be protected ( see fig2 for example ) has the advantage of distributing the heat in the case of long pulses of relatively high energy ( such as the so - called iso pulses according to iso 7637 - 3 ) better in the silicon . the breakdown of the protective pn junction may also be controlled by layout measures , such as , for instance , spacing and width of adjacent p - type regions . two exemplary embodiments in which the breakdown has been set in a targeted manner are illustrated in fig3 a and 3 b . the circuit arrangement in accordance with fig3 a is situated on a p − - conducting silicon substrate 99 . an n + - conducting buried layer 98 is introduced into the p − - conducting substrate 99 . an epitaxial n - type layer 91 is situated on said buried layer 98 . a p - conducting well 92 for a semiconductor component 90 is introduced into said n - type epitaxial layer 91 . said well 92 may again be the body of a field effect transistor , an emitter / base zone of a bipolar transistor or an anode zone of a semiconductor diode . it goes without saying that these may be provided with corresponding p + - doped connection zones , from which corresponding source connections , emitter and base connections or anode connections 94 are led away . other regions / zones having an identical or different doping and / or doping concentrations may be provided but are not illustrated in the drawing . collector , up - drain or cathode of the semiconductor component 90 is formed , as in the previous exemplary embodiment , by the n − - conducting epitaxial layer 91 , the contact - connection of which is effected by means of the n + - conducting embedding layer 98 and an n + - doped connection pillar 97 — reaching through the n - conducting outer well 91 — to the collector , up - drain or to the cathode of the active semiconductor component 90 . the corresponding connection is identified by the reference symbol 95 in the figure of the drawing . in order to prevent a breakdown from the p - type well 92 to the n - type well 91 , two further p - conducting wells 93 . 1 , 93 . 3 are introduced into the n - conducting epitaxial layer 91 at a small distance from the p - type well 92 . said p - type wells 93 . 1 , 93 . 3 are in each case superficially provided with a heavily p - doped anode connection zone 96 . 1 , 96 . 2 for contact - connection . furthermore , two further p - type wells 93 . 2 , 93 . 4 adjoin the abovementioned p - type wells 93 . 1 , 93 . 3 . the further p - type wells 93 . 1 , 93 . 2 , 93 . 3 , 93 . 4 and the n - type well 91 in each case form a pn junction , that is to say diodes 89 . 1 , 89 . 2 . the connections of said diodes 89 . 1 , 89 . 2 are formed on the one hand by the anode connection zones 96 . 1 , 96 . 2 ( for the anodes a connected to one another in the exemplary embodiment ) and on the other hand by the embedding layer 98 and the pillar 97 ( for the cathode k ). a single diode 89 is formed by the electrical connection of the anodes of the two partial diodes 89 . 1 , 89 . 2 . the breakdown voltage of the further p - type wells 93 . 1 , 93 . 2 , 93 . 3 , 93 . 4 with respect to the outer n - type well 91 is again chosen to be less than the breakdown voltage of the p - type wells 92 . 1 , 92 . 2 , with respect to the outer n - type well 91 . through skillful selection of the dimensions d 3 , d 4 of the p - type wells 93 . 1 , 93 . 2 , 93 . 3 , 93 . 4 and the distances d 1 , d 2 between the latter , the breakdown voltage of the protective diode 89 comprising two partial diodes can be set exactly to a desired value . the semiconductor component 90 is now connected up externally to the anode a of the protective diode 89 ( for example the anode a of the protective diode 89 and the anode of the semiconductor component 90 embodied as a diode may be at an identical potential ) in such a way that , in the case of an overloading of the semiconductor component 90 , on account of a reverse - biasing between well 92 and well 91 , a breakdown 101 . 1 , 101 . 2 is effected between the further p - type wells 93 . 1 , 93 . 2 , 93 . 3 , 93 . 4 and the outer n - type well 91 and not between the p - type well 92 of the semiconductor component 90 and the outer n - type well 91 . the energy that is dissipated during the breakdown 101 . 1 , 101 . 2 is dissipated over the breakdown current path 100 , in particular the breakdown current partial paths 100 . 1 , 100 . 2 between the p - type wells 93 . 1 , 93 . 2 , 93 . 3 , 93 . 4 , the n - type well 91 , the n + - type buried layer 98 and the n + - type pillar 97 . destruction of the semiconductor component 90 is prevented . the exemplary embodiment illustrated in fig3 b comprises a semiconductor component such as has already been shown in fig2 . the semiconductor component 110 is situated on a p - conducting silicon substrate 119 . an n + - conducting buried layer 118 is introduced into the p − - conducting substrate 119 . an epitaxial n - type layer 111 is again situated on said buried layer 118 . two p - conducting wells 112 . 1 , 112 . 2 for the semiconductor component 110 are introduced into said n - type epitaxial layer 111 . said wells 112 . 1 , 112 . 2 may be bodies of a field effect transistor , emitter / base zones of a bipolar transistor or anode zones of a diode . it goes without saying that these may be provided with corresponding p + - doped connection zones , from which corresponding source connections , emitter and base connections or anode connections 114 are led away . other regions / zones having an identical or different doping and / or doping concentrations may be provided , but are not illustrated in the drawing . collector , up - drain or cathode of the semiconductor component 110 is formed by the n - conducting epitaxial layer 111 , the contact - connection of which is effected by means of the n + - conducting embedding layer 118 and an n + - doped connection pillar 117 — reaching through the n - conducting outer well 111 — to the collector , up - drain or to the cathode of the active semiconductor component 110 . the corresponding connection is identified by the reference symbol 115 in the figure of the drawing . in order to prevent a breakdown from the p - type wells 112 . 1 , 112 . 2 to the n - type well 111 , four further p - conducting wells 113 , 113 . 1 , 113 . 2 , 113 . 3 are introduced into the n - conducting epitaxial layer 111 at a small distance from the p - type well 112 . 1 , 112 . 2 . the p - type wells 113 . 1 , 113 . 2 , 113 . 3 are connected to one another by the p - type well 113 . the p - type well 113 is superficially provided with a heavily p - doped anode connection zone 116 for contact - connection . the p - type wells 113 , 113 . 1 , 113 . 2 , 113 . 3 and the n - type well 111 in each case form a pn junction . since the p - type wells 113 , 113 . 1 , 113 . 2 , 113 . 3 are connected to one another , the sum of the abovementioned pn junctions represents a diode 109 . the connections of said diode 109 are formed on the one hand by the anode connection zone 116 ( for the anode a ) and on the other hand by the embedding layer 118 and the pillar 117 ( for the cathode k ). the breakdown voltage of the further p - type wells 113 , 113 . 1 , 113 . 2 , 113 . 3 with respect to the outer n - type well 111 is again chosen to be less than the breakdown voltage of the p - type wells 112 . 1 , 112 . 2 with respect to the outer n - type well 111 . the semiconductor component 110 is now again connected up externally to the anode a of the protective diode 109 ( for example the anode a of the protective diode 109 and the emitter e of the semiconductor component 110 embodied as a bipolar transistor may be at an identical potential ) in such a way that in the case of an overloading of the semiconductor component 110 , on account of a reverse - biasing between well 112 . 1 and / or 112 . 2 and well 111 , a breakdown 121 . 1 , 121 . 2 , 121 . 3 is effected between the further p - type wells 113 . 1 , 113 . 2 , 113 . 3 and the outer n - type well 111 and not between the p - type wells 112 . 1 , 112 . 2 of the semiconductor component 110 and the outer n - type well 111 . the energy that is dissipated during the breakdown 121 . 1 , 121 . 2 , 121 . 3 is dissipated over the breakdown current path 120 between the p - type wells 113 . 1 , 113 . 2 , 113 . 3 , the n - type well 111 , the n + - type buried layer 118 and the n + - type pillar 117 . destruction of the semiconductor component 110 is reliably prevented . the breakdown voltage and the volume in which the energy is dissipated during a breakdown are determined by the dimensions d 5 , d 6 of the p - type wells 113 , 113 . 1 , 113 . 2 , 113 . 3 , the geometrical arrangement thereof with respect to one another and the geometrical shape thereof . these variables can therefore ( largely ) be chosen freely . in a further embodiment , the component to be protected contains an outer p - type well ( n - type well ). the component breakdown to be protected is effected relative to an n - type region ( p - type region ) which is integrated in the outer p - type well ( n - type well ) and is connected to the semiconductor surface . an nmos transistor which is integrated into an outer p - type well and whose p - type well ( bulk )/ drain breakdown is to be protected shall be mentioned by way of example . a pmos transistor which is integrated into an outer n - type well and whose n - type well ( bulk )/ drain breakdown is to be protected shall likewise be mentioned by way of example . a plurality of active ( semiconductor ) components may likewise be situated in the p - type well ( n - type well ). the components integrated into the outer p - type well ( n - type well ) are defined by further p - type or n - type regions within the well ( for instance a further n - type region in the p - type well , which serves as source connection of an nmos transistor ). according to the invention , a further diode breakdown is integrated into the outer p - type well ( n - type well ), the breakdown voltage of said further diode breakdown lying below that of the well breakdown with respect to the active component . for this purpose , use is made of one or more n - type and / or p - type wells within the outer p - type well ( n - type well ) which serve for setting the breakdown voltage of the protective diode and the connection thereof to the semiconductor surface . a preferred embodiment according to the invention is illustrated in fig4 . additional n - type and p - type wells 133 , 143 , 137 , which serve for connecting the protective diode 129 to the semiconductor surface , are integrated within a p - type well 131 — enclosed for example by an n - type region — of the active component ( s ) 130 . one or both of these connections may also optionally be shared with the connection of an active component . the setting of the breakdown voltage of the p - type well 131 with respect to the connection of the n - type region 133 ( e . g . drain of an nmos ) is effected by means of an additional p - type well 143 . for the sake of completeness , fig4 depicts the location of the breakdown 141 and the breakdown current path 140 for the case of breakdown of the protective diode 129 . in another embodiment , which is illustrated in fig5 , the anode of the protective diode is not integrated within an outer n - type well 151 , rather a breakdown 161 to a substrate 159 of the p - conductivity type serves for protecting the active component . the breakdown of the outer n - type well 151 with respect to an inner ( not illustrated ) p - type well ( for instance a body connection of a vdmos transistor ) is intended to be protected . the setting of the breakdown voltage can be realized for instance by means of a p - type implantation prior to the processing of the outer n - type well . the anode may be connected to the contact - connected rear side of the wafer or for instance ( illustrated in fig5 ) may be led to the surface via the insulation implantations 153 for isolating adjacent components . as in the previous exemplary embodiments , the cathode connection may be produced by means of a pillar 157 reaching to a buried layer 158 . the p - type implantation 163 prior to the processing of the outer n - type well 151 need not be effected in planar fashion , but rather may be effected by means of a plurality of p - type regions of arbitrary form ( round , polygonal ) which are arranged at an arbitrary distance from one another ( not illustrated ). the distance is oriented to the outdiffusion of the implanted p - type well in a preferred embodiment . 151 outer well ( with further p - type and n - type wells of the active components ( not illustrated )) | 7 |
referring to the figures and to fig1 in particular , a variable buoyancy float engine or system for generating work 10 is shown . the system 10 includes a fluid chamber 12 that is filled with a stored fluid 14 such as water . the fluid chamber 12 has an upper reservoir 16 and a lower reservoir 18 . the reservoirs 16 , 18 are connected by a channel 20 which permits free flow of the fluid 14 between the two reservoirs 16 , 18 . while two distinct reservoirs 16 , 18 are illustrated , in alternative embodiments , the fluid chamber 12 may be comprised of a single reservoir or a plurality of reservoirs . contained within the upper reservoir 16 is a float tank 22 . the float tank 22 has an inner chamber 24 that can hold a fluid ballast 14 such as water . the float tank 22 has a water vent or drain valve 26 through which the fluid 14 can be let in as trapped air is released through an upper hatch or air vent valve 28 . the air vent valve 28 is connected to a source of air , like the atmosphere , through a pipe 30 or other like conduit . the system 10 also contains a drain tank 32 which is positioned in the lower reservoir 18 of the fluid chamber 12 so as to allow fluid 14 from the float tank 22 to gravitationally flow into the drain tank 32 . a float tank drain receiver valve 34 attached to the drain tank 32 operationally connects with the float tank drain valve 26 . as shown in fig2 , a retractable pipe 36 and an elbow pipe 38 can be used between the two valves 26 , 34 to facilitate fluid 14 communication from the float tank 22 and the drain tank 32 . the retractable pipe 36 could be an accordion pipe , a telescopic pipe , or any like pipe which allows for longitudinal expansion and retraction . however , in alternative embodiments the float tank 22 and the drain tank could be positioned so as to allow the two tanks 22 , 32 to be directly coupled to each other , without the need for any retractable pipes . in addition , the movement of the float tank 22 and / or the drain tank 32 could be used to facilitate the mating and the operation of the valves 26 , 34 . the drain tank 32 also contains an air vent valve 40 . the air vent valve 40 is connected to a source of air , such as the atmosphere , via a pipe 42 or other like conduit . the air pipe 42 has an upper valve 44 and a lower valve 46 . here retractable pipes 48 , 50 and an elbow pipe 52 can be used to facilitate the connection between the air vent valve 40 and the respective air pipe valves 44 , 46 . the retractable pipes 48 , 50 could be accordion pipes , telescopic pipes , or any like pipes which allow for longitudinal expansion and retraction . however , in alternative embodiments the air vent valve 40 and the respective air pipe valves 44 , 46 could be positioned so as to allow direct coupling , without the use of retractable pipes . in addition , the vertical movement of the drain tank 32 could be used to facilitate the mating and operation of the valves 40 , 44 , 46 . as shown , the drain tank 32 has a pair of drain tank equalizing valves 54 , 56 which allow fluid to flow from the drain tank 32 into the lower reservoir 18 . while two valves 54 , 56 are shown , in alternative embodiments , any number may be used . additionally , in alternative embodiments the float tank drain receiver valve 34 and / or the air vent valve 40 could function as equalizing valves . a plug 58 is slidably connected within the drain tank 32 . in operation , the drain tank 32 descends over the plug 58 and the plug 58 can descend below the floor or base 60 of the lower reservoir 18 . the drain tank 32 has a seal ring ( not shown ) which prevents fluid from flowing between the drain tank 32 and the lower reservoir 18 at the area where the plug 58 contacts the drain tank 32 . similarly , the base 60 of the lower reservoir 18 also contains a seal ring ( not shown ) which prevent fluid 14 from escaping from the lower reservoir 18 . the base or bottom 62 of the plug 58 is supported by at least one ( two shown ) mechanical plug stops 64 . one embodiment of the present invention includes a float tank guide 66 which constrains the float tank 22 to translate vertically in the upper reservoir 16 . as shown , the float tank guide 66 is comprised of a pair of generally vertical guide posts 68 , to which the float tank 22 slidably contacts or is connected , a float tank upper stop 70 , and a float tank lower stop 72 . a discharge piston 74 is connected to the bottom 76 of the float tank 22 . the opposite end of the piston 74 terminates in a discharge piston seal 78 . the piston 74 fits and vertically translates within a discharge shaft 80 . a piston ring access room 82 is provided to aid in maintaining the discharge piston ring 78 that would be expected to wear during operation . in one embodiment , the piston 74 can be connected directly to a converter such as gear assembly , a pump like mechanical system ( not shown ) which is adapted to convert mechanical energy into work . alternatively , the converter could be directly and operatively connected to the float tank 22 . as shown , the lower portion 84 of the shaft 80 contains a second fluid 86 such as water . while the first fluid 14 and the second fluid 86 may be the same , and will typically be water , the two bodies of fluid 14 , 86 will typically not mix . in some embodiments , however , it may be advantageous to use fluids in the two fluid bodies 14 , 86 with different buoyancy , viscosity , or corrosive properties . a shown , the shaft 80 is connected to a convertor 88 in the form of a hydroelectric generator which has a turbine intake ( not shown ) and a turbine discharge ( not shown ). any suitable generator , including induction type generators like a pelton turbine , may be used . as shown , a generator valve 90 is interposed between the lower portion 84 of the shaft 80 and the generator 88 . the generator valve 90 may be in the form of a vein valve . the second fluid 86 is forced through the generator 88 by the piston 74 and passes out of the turbine discharge and into a discharge or recycling pool 92 . the recycling pool 92 is typically positioned substantially lower than the upper reservoir 12 so that the base or bottom 94 of the recycling pool 92 and the feedback line 96 is vertically positioned at an elevation to permit an equal amount of the fluid 86 that was discharged into the recycling pool 92 from the generator 88 to be recycled back into the shaft 80 . a recycling pool valve 98 is interposed between the recycling pool 92 and the shaft 80 and is adapted regulate the flow of the fluid 86 from the recycling pool 92 back into the shaft 80 . the recycling pool valve 98 may be in the form of a vein valve . in alternative embodiments , the feedback line 96 could be shortened or even eliminated , allowing for the recycling pool valve 98 to directly connect the recycling pool 92 with the shaft 80 . the generator valve 90 and the recycling pool valve 98 can further - be used to regulate the vertical motion of the float tank 22 . for example the generator valve 90 and the recycling pool valve 98 can be closed to prevent air or fluid from exiting the shaft 80 . this will keep the float tank 22 from beginning to descend before it is filled with fluid 14 . thus , when the generator valve 90 is opened and the float tank 22 begins to descend , the filled float tank 22 will exert a sufficient pressure on the piston 74 for efficient operation of the hydroelectric generator 88 . similarly , when the float tank 22 is at its lower position , the generator valve 90 and the recycling pool valve 98 can again remain closed to keep the float tank 22 at its lower position until the fluid 14 is drained into the drain tank 32 . at that point , the recycling pool valve 98 can be opened , allowing the now buoyant float tank 22 to ascend . in operation , the system 10 begins with the upper reservoir 16 being filled with fluid 14 , and the inner chamber of the float tank 22 and the drain tank 32 substantially empty of fluid 14 . the float tank 22 is thus positively buoyant and positioned at or near its upper limit near the top of the upper reservoir 16 . the trapped air in the inner chamber 24 offsets the weight of the empty float tank 22 . the water vent 26 is opened to allow fluid 14 to be taken into the inner chamber 24 of the float tank 22 as air trapped within the inner chamber 24 is released through the upper air hatch 28 . once the float tank 22 is filled with fluid 14 , the generator valve 90 is opened and the now negatively buoyant float tank 22 is allowed to descend . in some embodiments , other mechanical stops or braces may also need to be released to allow the float tank 22 to begin its descent . as the negatively buoyant float tank 22 descends , its weight is transferred through the discharge piston 74 into pressurizing the fluid in the shaft 80 . the discharge piston seal 78 prevents this pressurized fluid in the shaft 80 from bypassing back into the upper reservoir 16 . the pressurized fluid 86 , unable to go directly into the recycling pool 92 because the recycling pool valve 98 is closed , goes through the generator valve 90 and into the turbine intake of the hydroelectric generator 88 . once the float tank 22 reaches its lower limit in the upper reservoir 16 , the generator valve 90 is closed to keep the float tank 22 at its lower position while it drains it fluid 14 into the drain tank 32 . as shown in fig3 , a pipe 36 is extended to connect the float tank drain valve 26 ( fig1 ) with the float tank drain receiver valve 34 which is connected to the drain tank 32 . alternatively , the two valves 26 , 34 could be directly coupled . the air vent 28 in the float tank 22 is also connected and opened to an air supply pipe 30 which permits the fluid 14 in the float tank 22 to gravitationally flow into the drain tank 32 . after the float tank 22 has drained , the float tank drain valve 26 is closed and the recycling pool valve 98 is opened , allowing the float tank 22 to ascend . while the float tank 22 is ascending , as shown in fig4 , the drain tank equalizing valves 54 , 56 are opened and the mechanical stops 100 are disengaged from the drain tank support member 102 allowing the drain tank 32 to gravitationally descend over the plug 58 . the drain tank 32 will descend to a point at or near the top 104 of the plug 58 and may in alternative embodiments be supported by the plug 58 , by the bottom 60 of the lower reservoir 18 , or by another mechanical stop ( not shown ). next , as shown in fig5 , the drain tank air valve 40 is connected and opened to the air supply pipe 42 via the lower air supply valve 46 . once the air connection is established , the mechanical plug stops 64 holding the plug 58 are released and the plug 58 is allowed to gravitationally descend . the plug 58 will descend to a point where its top 104 is at or near the bottom 106 of the drain tank 32 . as the plug 58 descends , air is drawn into the drain tank 32 and it becomes buoyant . the drain tank 32 may be kept in place by means of other mechanical stops ( not shown ) until it is filled with air . the air valve 40 is then closed and the drain tank 32 along with the plug 58 buoyantly ascend back to their starting positions . a set of upper mechanical stops 108 may be used to position the drain tank 32 in its proper position . this closed system 10 lends itself to a number of variations . for example , an upper reservoir vent cap ( not shown ) and recycling pool vent cap ( not shown ) could be use to maintain atmospheric pressure within each containment chamber while also providing protection from the elements . in addition , the upper reservoir 12 could be filled from an available water supply at a higher elevation , thus allowing gravity feed with the corresponding energy savings . also , the float tank 22 could be structurally held during draining or filling rather than relying on the pressure of suction in the shaft 80 . moreover , some applications could omit the holding of the float tank 22 at its upper or lower limit during transitions . also , more than one float tank 22 may be able to feed a single generator 88 and discharge into a single drain tank 32 , allowing for a nearly constant motive fluid flow to be provided to the hydroelectric generator 88 , thus allowing for continuous generation of power . another embodiment of the present invention provides for a float actuated hydroelectric generator open system . in one implementation , there is not a need for a drain tank 32 but rather the float tank 22 can be drained directly to a destination outside of the fluid chamber 12 . a fluid source ( not shown ) refills the upper reservoir 16 . the operation of the float tank 22 with its discharge piston 74 and piston seal 78 within the shaft 80 is as described above . similarly , another embodiment of the present invention provides for a separate fluid replenishment source for refilling the shaft 80 . the fluid replenishment source could be closed during descent of the float tank 22 by an interposed replenishment valve ( not shown ). in yet another variation , the fluid replenishment source could also be a source for refilling the upper reservoir 16 . another embodiment consistent with the principles of the present invention would be to use the hydro engine system 10 as a large volume water pump to transfer water through an aqueduct for irrigation . in this application , instead of a generator , a one - way valve allowing the hydro engine to pulse streams of water is used . the advantage of these versions and other versions consistent with the invention is that during descent of the float tank 22 , the motive force of fluid 86 passing through the hydroelectric generator 88 can be increased , allowing efficient operation . also , the storing of fluid , such as water , in an upper reservoir minimizes the need for ecologically unsound dams . although ground water is assumed to be the most plentiful and practical fluid for practicing the hydro engine invention , obviously many other fluids could be substituted . for example , operation of the hydro engine in sub - freezing temperatures may require mixtures that would remain liquid . corrosion of materials may be of consideration . in addition , versions consistent with this invention could utilize manufacturing effluents , consumer waste water , or nuclear power plant cooling water , etc . the hydro engine lends itself to augmenting an existing hydroelectric facility . given constraints on the amount of water that can be drained from behind the hydroelectric dam , the hydro engine could fulfill a way of continuing to provide pressurized water to the generators . while the present invention has been illustrated by a description of various embodiments and while these embodiments have been described in considerable detail , it is not the intention of the applicants to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . the invention in its broader aspects is therefore not limited to the specific details , representative apparatus and method , and illustrative example shown and described . accordingly , departures may be made from such details without departing from the spirit or scope of applicant &# 39 ; s general inventive concept . | 5 |
in the description that follows , the present invention will be described in reference to embodiments that test subsystems on a platform for a software application , such as a database application . however , embodiments of the invention are not limited to any particular architecture , environment , application , or implementation . for example , although embodiments will be described in reference to network database applications , the invention may be advantageously applied to any software application . therefore , the description of the embodiments that follows is for purposes of illustration and not limitation . checking the compliance of a file with standards before storing the file in a repository is crucial to maintain the integrity of applications or files that may build on or use the file . global standards compliance checkers ( gsccs ) are often used to check the standards compliance of files before the files may be checked into a repository . while effective , gsccs typically must be updated when compliance with new or custom standards is to be checked . recoding or rewriting gsccs to account for new or custom standards is often time consuming and , hence , inefficient . creating a wrapper for a gscc that provides the functionality to perform standards compliance checks on new or custom standards allows standards compliance to be checked without causing a gscc to be recoded . further , the use of a wrapper allows the functionality of a gscc to be used . as will be appreciated by those skilled in the art , a wrapper acts as an interface between a caller and code that is wrapped . often , a wrapper is used to enable a program written in a particular programming language to use different calling conventions . a wrapper may also allow a program to be used with a scripting language . a wrapper or an adapter may support coding standards used in java xml , jrad xml , and perl that may not typically be supported by a standard gscc . a wrapper may be created or updated relatively efficiently . substantially any time compliance to new standards is to be checked , a wrapper may be created or updated . in one embodiment , a standards wrapper / adapter may be implemented using at least one of perl scripts and xml files . a standards wrapper / adapter may be arranged to be used such that once a gscc checks for standards compliance , the standards wrapper / adapter is used to check the compliance to standards that are not incorporated into the gscc . it should be appreciated , however , that the standards wrapper / adapter may instead check for compliance to standards before a gscc is used or while a gscc is used . in any case , a standards wrapper / adapter allows the functionality provided by an existing standards checking engine , as for example a gscc , to be used to check the overall standards compliance of a file with custom standards . with reference to fig5 , a system which utilizes a gscc and a standards / wrapper adapter will be described in accordance with an embodiment of the present invention . when a file 502 is to be checked into a repository 506 , the standards compliance of file 502 is typically checked . it should be appreciated that although one file 502 is described , any number of files may be checked into repository 506 . that is , one file 502 or a plurality of files may be processed to determine standards compliance . a gscc 504 generally includes functionality to check for compliance with a set of standard standards , while a standards wrapper / adapter 510 may include functionality to check for compliance with substantially any standards which are not accounted for by gscc 504 . standards wrapper / adapter 510 is arranged to interface with gscc 504 . in one embodiment , standards wrapper / adapter 510 wraps gscc 504 . gscc 504 may be arranged to be accessed , or run , from a command line that allows for a selection to be made as to a file 502 that is to be checked . in general , file 502 may be located substantially anywhere on a database system or a file system . gscc 504 may be arranged to allow parameters to be set that affect how gscc 504 runs , as well as how reports that are generated by gscc 504 are arranged , e . g ., in terms of content and layout . before file 502 is checked into repository 506 , file 502 is processed by both standards wrapper / adapter 510 and global standards compliance checker 504 to determine whether file 502 is compliant with standards . if file 502 is determined to be compliant with standards , then file 502 may be checked into repository 506 . running , executing , or invoking standards wrapper / adapter 510 may include running a script associated with standards wrapper / adapter 510 , and identifying file 502 as an input to the script . in one embodiment , standards wrapper / adapter 510 may cause at least one log file 514 to be generated . log file 514 may include a listing of errors such as errors associated with a lack of compliance to global and specialized standards . log file 514 may list errors along with a corresponding line numbers associated with a locations of the errors in file 502 , along with a name of file 502 . although log file 514 may list errors in substantially any format , suitable formats may include , but are not limited to , html , xml , and txt formats . certain programs or applications may include a set of specialized standards that are used to create a file or are associated with a file . fig6 is a block diagram representation of specialized standards of a program or an application being incorporated into a standards wrapper / adapter in accordance with an embodiment of the present invention . a program or application 608 , which may be a database application or a web - based application , has specialized standards 612 associated therewith . program 608 may also generally have global standards 614 associated therewith , as well . in one embodiment , program 608 is associated with an enterprise management system . functionality that allows compliance with the specialized standards 612 to be checked is incorporated into standards wrapper / adapter 610 . that is , standards wrapper / adapter 610 is written or otherwise created such that when a file that is to be checked for standards compliance in provided as an input to standards wrapper / adapter 610 , standards wrapper / adapter 610 has knowledge of specialized standards 612 and may perform a standards compliance check . a wrapper such as standards wrapper / adapter 610 may generally be used substantially anytime during development to effectively ensure that standards and specialized or customized standards , as well as to generate a log file for tracking errors . a standards wrapper / adapter may generally be implemented as a script , e . g ., a perl script . in one embodiment , a relatively generic standards wrapper / adapter script may be provided such that a developer may augment the script using information associated with specialized standards . referring next to fig7 , a standards wrapper / adapter script will be described in accordance with an embodiment of the present invention . a standards wrapper / adapter script 710 is generally written to include a gscc interface 720 that allows standards wrapper / adapter script 710 to be interfaced with gscc 704 . gscc interface 720 may allow standards wrapper / adapter script 710 to call gscc 704 . standards wrapper / adapter script 710 is configured to allow specialized standards 722 a , 722 b to be incorporated therein . that is , standards wrapper / adapter script 710 is scripted either to allow portions of standards wrapper / adapter script 710 to be rescripted to accommodate specialized standards 722 a , 722 b , or to allow scripts written to accommodate specialized standards 722 a 722 b to be called by standards wrapper / adapter script 710 . when a program or an application has a custom set of standards that are not accounted for in a gscc , an overall system that includes the program and the gscc may be configured such that a file created by or associated with the program is inputted to a standards wrapper / adapter and the gscc . fig8 a is a process flow diagram which illustrates a method of setting up a system to check the standards compliance of a file associated with a program that has specialized standards in accordance with an embodiment of the present invention . a process 800 of setting up a system begins at step 802 in which a program with specialized standards is obtained . obtaining the program may include obtaining a list of the standards associated with the program . after obtaining the program , a standards wrapper / adapter that accounts for the specialized standards is obtained in step 806 . the standards wrapper / adapter that accounts for the specialized standards is arranged to interface with a gscc . that is , the standards wrapper / adapter generally includes an interface that allows the standards wrapper / adapter to cooperate with the gscc to perform standards compliance checks . the steps associated with obtaining a standards wrapper / adapter will be described below with reference to fig8 b and fig8 c . once the standards wrapper / adapter is obtained , the standards wrapper / adapter is interfaced with a gscc in step 810 . interfacing the standards wrapper / adapter to the gscc may include utilizing hooks in the gscc to effectively integrate the standards wrapper / adapter with the gscc . upon interfacing the standards wrapper / adapter with the gscc , the process of setting up a system is completed . with reference to fig8 b , one method of obtaining a standards wrapper / adapter will be described in accordance with an embodiment of the present invention . a process 806 ′ of obtaining a standards wrapper / adapter begins at step 820 in which script or code associated with a standards wrapper / adapter is obtained . in general , the script may be a perl script , although it should be appreciated that the script may be created using any suitable programming language . the script , which may be provided by a provider of a gscc to which the standards wrapper / adapter is to be interfaced , generally includes a gscc interface . in addition , the script may include sections that may be augmented or altered by a customer . specialized script may be created in step 822 to augment the standards wrapper / adapter script . in the described embodiment , the specialized script is arranged to contain functionality to check specialized standards associated with a program . once the standards wrapper / adapter script has been augmented , the process of obtaining a standards wrapper / adapter is completed . in lieu of utilizing effectively standard standards wrapper / adapter script to create a standards wrapper / adapter , a standards wrapper / adapter may be created without using pre - existing script . fig8 c is a process flow diagram which illustrates steps associated with a method of obtaining a standards wrapper / adapter that does not use pre - existing script in accordance with an embodiment of the present invention . a process 806 ″ of obtaining a standards wrapper / adapter begins at step 840 in which a standards wrapper / adapter is created based on specialized standards . creating a standards wrapper / adapter may include using any suitable programming language , e . g ., perl or java . after the standards wrapper / adapter is created to enable compliance with specialized standards to be checked , an interface between the standards wrapper / adapter and a gscc is created in step 842 . the interface is then implemented or incorporated into the standards wrapper / adapter in step 844 , and the process of obtaining a standards wrapper / adapter is completed . a standards wrapper / adapter may generally be implemented with respect to a database management system . one suitable database management system architecture is the three - tiered architecture that is shown in fig9 . at the core of a database management system is a central storage 901 that stores a database 903 or a repository . database 903 is typically stored on one or more hard drives , and is typically part of a larger computer system . the information may be stored on database 903 in a variety of formats with relational database management systems relying heavily on tables to store the information . database servers 905 are instances of a program that interacts with database 903 . each instance of a database server 905 may , among other features , independently query database 903 and store information therein . in some instances , database servers 905 may not include user friendly interfaces , such as graphical user interfaces . accordingly , at least one application server 907 may provide the user interfaces to database servers 905 . by way of example , application server 907 may be a web application server on the internet , or any other network . application server 907 may provide user friendly mechanisms for accessing database 903 through database servers 905 . a web browser 909 may be utilized to access application server 907 . fig1 shows a block diagram of components that may be present in computer systems that implement embodiments of the invention . a computer system 911 includes a processor 913 that executes instructions from computer programs , including operating systems . processor 913 may be utilized to enable a gscc to run . although processor 913 typically has memory caches , processor 913 may utilize memory 915 , which may store instructions or computer code and data . a fixed storage 917 may store computer programs and data such . fixed storage 917 is typically persistent and provides more storage when compared to memory 915 . a common fixed storage 917 for databases is multiple , e . g ., arrays , hard drives . a removable storage 919 provides mobility to computer programs and / or data that are stored thereon . removable storage 919 may include , but is not limited to , floppy disks , tape , cd / rom , dvd , flash memory devices , and the like . memory 915 , fixed storage 917 , and removable storage 919 provide examples of computer readable storage media that may be utilized to store and retrieve computer programs incorporating computer codes that implement the invention , data for use with the invention , and the like . an input device 921 allows a user to interface with computer system 911 . input device 921 may be a keyboard , a mouse , buttons , dials , or any other suitable input mechanism . an output device 923 allows system 911 to provide output to the user . output device 923 may include devices such as monitors , display screens , leds , printers , or substantially any other output mechanism . a network interface 925 allows system 911 to interface with a network to which it is connected . the system bus architecture of computer system 911 is represented by arrows 927 . the components shown in fig1 may be found in many computer systems . however , components may be added , deleted , and combined without departing from the spirit or the scope of the present invention . for example , fixed storage 917 may be a file server that is accessed through a network connection . thus , fig1 is for illustration purposes and not limitation . although only a few embodiments of the present invention have been described , it should be understood that the present invention may be embodied in many other specific forms without departing from the spirit or the scope of the present invention . by way of example , a standards wrapper / adapter may be arranged as a part of a framework that enables code or script including custom standards to be plugged into the standards wrapper / adapter . in other words , functionality that checks compliance to custom standards may be created as a pluggable adapter that may be plugged into a standards wrapper / adapter which serves as an interface between the pluggable adapter and a gscc . within such a framework , a standards wrapper / adapter may also be arranged to be interfaced with more than one gscc such that a single pluggable adapter may effectively be used with a set of different gsccs . in one embodiment , a standards wrapper / adapter may be arranged to be interfaced with more than one gscc . that is , a standards wrapper / adapter may be coded such that it includes different interfaces that may be used with different gsccs . in such an embodiment , the functionality to check the compliance of files to custom standards may be used with different gsccs substantially without having to create different standards wrapper / adapters that are suitable for use with each different gscc . while a gscc has been described as being suitable for use with a standards wrapper / adapter , substantially any suitable checking application may be used with a wrapper / adapter . that is , wrappers that augment the checking ability of a checking tool may be used with a variety of different checking tools . a standards wrapper / adapter may generally be arranged such that when a gscc is called , the standards wrapper / adapter is substantially automatically called . alternatively , a system may be arranged such that a standards wrapper / adapter is called when a file is to be checked . the standards wrapper / adapter may then call a gscc without departing from the spirit or the scope of the present invention . a standards wrapper / adapter may be arranged to perform a variety of other functions in addition to performing checks of standards compliance . for instance , a standards wrapper / adapter may be arranged to create a log file that details why a file did not pass a standards compliance check . such a log file may be accessed by a developer , or even sent via an electronic mail message to a developer . a gscc may be a stand alone application , or may be incorporated into a part of another application or tool . an application or tool that a gscc may be a part of is a checking tool that is used to verify the integrity of a file . in general , a gscc and a standards wrapper / adapter may be a part of an enterprise management system . in general , the steps associated with methods of the present invention may vary widely . steps may be added , removed , altered , combined and reordered without departing from the spirit or the scope of the present invention . therefore , the present examples are to be considered as illustrative and not restrictive , and the invention is not to be limited to the details given herein , but may be modified within the scope of the appended claims . | 8 |
the apparatus shown in the drawings has parts that are examples of the elements recited in the apparatus claims , and can be operated in steps that are examples of the elements recited in the method claims . the following description thus includes examples of how a person of ordinary skill in the art can make and use the claimed invention . it is intended to meet the requirements of enablement and best mode without imposing limitations that are not recited in the claims . a holder 10 for an electrode 12 is shown in fig1 . the holder 10 is configured for mounting on a cnc machine tool . in this particular embodiment , the electrode 12 is an edm electrode , and the holder 10 is configured for mounting on an edm machine for movement along and about a first axis 15 . the electrode 12 is an elongated part that projects longitudinally outward from the holder 10 along a second axis 17 at an acute angle to the first axis 15 . an outer end portion 18 of the electrode 12 is thus arranged for engagement with a workpiece in an edm process for shaping the workpiece . the configuration of the outer end portion 18 of the electrode 12 , as well as the location and orientation of the electrode 12 relative to the axes 15 and 17 , is predetermined with reference to the size and shape specified for the structural feature of the workpiece to be formed in the edm process . in this particular embodiment , the structural feature to be formed by the electrode 12 is a turbine airfoil . as multiple features are formed by repeated engagement of the electrode 12 with the workpiece , the resulting wear causes the shape of the outer end portion 18 to change . wear at the outer end portion 18 also reduces the length of the electrode 12 . it is therefore necessary to redress the outer end portion 18 of the electrode 12 , and also to reposition the electrode 12 axially , after multiple cycles of use . the parts of the holder 10 shown in fig1 - 3 include a main body 30 , a cover 32 , and a back plate 34 . as best shown in fig4 and 5 , these parts of the holder 10 together define an elongated chamber 37 with an open front end 39 for receiving the electrode 12 . specifically , a major length portion of the electrode 12 has planar side surfaces 42 ( fig3 ) that provide a rectangular cross sectional shape . the main body 30 and the cover 32 have corresponding planar surfaces 44 and 46 . those surfaces 44 and 46 provide the chamber 37 with a rectangular cross sectional shape that is sized for the major length portion of the electrode 12 to fit closely within the chamber 37 . the back plate 34 defines the rear end of the chamber 37 , and has an elastomeric pad 50 on its inner side . a pneumatic port 61 is centered on the first axis 15 at the rear of the main body 30 . passages 63 in the main body 30 communicate the port 61 with the chamber 37 . a pull stud 64 ( fig6 ) extends through a central opening 65 in a mounting plate 68 at the rear of the main body 30 . the pull stud 64 and mounting plate 68 are configured to couple and decouple the holder 10 with a chucking apparatus on an edm machine in a known manner . an edm fluid passage 69 extending through the pull stud 64 communicates with the port 61 . this enables the pull stud 64 to serve as a pneumatic coupling for communicating the holder 10 with a source of pneumatic pressure when the holder 10 is decoupled from an edm machine . a pair of locking pins 70 , one of which is shown in fig5 a , are arranged in the pneumatic passages 63 beside a pair of air inlet slots 71 at the chamber 37 . each locking pin 70 has an inclined , flat wedge surface 72 that projects transversely inward of the chamber 37 through the corresponding slot 71 . when the passages 63 are pressurized pneumatically , the locking pins 70 are moved lengthwise against springs 74 . this shifts the wedge surfaces 72 outward of the chamber 37 to provide clearance for insertion of the electrode 12 into the chamber 37 . when the pressure is relieved , the springs 74 push the locking pins 70 back toward their original positions . this presses the wedge surfaces 72 against the electrode 12 to secure it in the chamber 37 . other parts of the holder 10 include a spring 80 and a link 82 . the spring 80 extends alongside the cover 32 in a direction parallel to the second axis 17 . a front end 84 of the spring 80 is anchored to the cover 32 . a rear end 86 of the spring 80 is connected to the link 82 , which is movable lengthwise relative to the cover 32 . the link 82 extends through a guide 88 on the cover 32 , and is fastened to the back plate 34 at the rear of the cover 32 . when the spring 80 is in the original , unstressed condition shown in the drawings , it holds the back plate 34 against the cover 32 to close the rear end of the chamber 37 . the electrode 12 is installed in the holder 10 in a series of steps , as shown in fig6 - 9 . first , the holder 10 is mounted on a chucking apparatus 100 on a milling machine . the chucking apparatus 100 is adapted to communicate the pneumatic coupling / pull stud 64 with a source 104 of pneumatic pressure . as shown schematically , the pneumatic connection includes a standard pneumatic hose swivel 105 for rotation with the chucking apparatus 100 , and a valve 106 between the swivel 105 and the source 104 . when the valve 106 is open , pneumatic pressure is supplied from the source 104 to the chamber 37 through the valve 106 , the swivel 105 , the pneumatic coupling / stud 64 , and the passages 63 in the main body 30 of the holder 10 . the electrode 12 can then be inserted into the chamber 37 past the locking pins 70 . as shown in fig7 , a probe 108 on a multi axis spindle 110 is moved against the outer end 112 of the electrode 12 to move the electrode 12 more fully inward of the chamber 37 . the probe 108 may push the inner end 114 of the electrode 12 against the elastomeric pad 50 on the back plate 34 . the spring 80 can extend to allow the back plate 34 to move rearward from the cover 32 under the force applied by the electrode 12 , and can then contract to return the back plate 34 to the cover 32 . this protects the electrode 12 by damping the impact of the inner end 114 against the pad 50 and the back plate 34 . in the step shown in fig8 , the spindle 110 carries the probe 108 to a position that is spaced from the holder 10 a predetermined distance d along the axis 17 . as the probe 108 is being moved away from the holder 10 , a pneumatic thrust acts on the inner end 114 of the electrode 12 to push the electrode against the probe 108 , and thus moves the electrode 12 along the axis 17 with the probe 108 . when the probe 108 is stopped at its spaced position , it stops the advancing electrode 12 in a position projecting the predetermined distance d outward from the holder 10 . when the electrode 12 has been advanced to the position of fig8 , the pneumatic pressure in the chamber 37 is relieved , and the probe 108 is withdrawn as shown in fig9 . the holder 10 is then transferred from the chucking apparatus 100 on the milling machine to a chucking apparatus 118 ( fig1 ) on an edm machine for multiple machining cycles on the edm machine . at the conclusion of a predetermined number of edm cycles , or when inspection of the electrode 12 indicates wear for which redressing is needed , the holder 10 is removed from the edm machine , but the worn electrode 12 is not removed from the holder 10 . the holder 10 and worn electrode 12 are transferred together from the edm machine back to the milling machine for redressing of the worn electrode 12 in the holder 10 . with the holder 10 again mounted on the chucking apparatus 100 on the milling machine , the probe 108 is again deployed to move the worn electrode 12 inward of the chamber 37 . this is accomplished in the manner described above with reference to fig7 , but the reduced length of the worn electrode 12 may prevent the inner end 118 from impacting the pad 50 on the back plate 34 . the probe 108 is next moved away from the holder 10 along the axis 17 , and the chamber 37 is again pressurized to move the redressed electrode 12 back outward with the probe 108 until the probe 108 is stopped at the location where the worn electrode 12 projects outward the distance d , as described above with reference to fig8 . in the next step , as shown in fig1 , a milling cutter 120 on the spindle 110 is deployed to restore the outer end portion 18 of the worn electrode 12 to its original configuration . the chucking apparatus 100 on the milling machine can rotate the holder 10 about the first axis 15 as needed for the cutter 120 to access the electrode 12 from all sides in the cutting step . when reshaping of the outer end portion 18 is complete , the holder 10 with the redressed electrode 12 is ready to be transferred back to the edm machine for another series of machining cycles with the redressed electrode 12 . in the initial step described above with reference to fig6 , the electrode 12 is preferably inserted into the chamber 37 manually , and the holder 10 is preferably mounted on the milling machine automatically . the steps of transferring the holder 10 between the milling machine and the edm machine , with the electrode 12 remaining in place in the holder 10 , also are preferably performed automatically . for example , a system 140 for transferring the holder 10 is shown schematically in the top view of fig1 . this system 140 includes a robot 142 mounted on a horizontal track 143 . the robot 142 has an arm 144 with a fork 148 . the arm 144 is pivotal about a vertical axis 149 , and is telescopic radially relative to the axis 149 to move the fork 148 into and out of operative association with work stations that are spaced apart along the track 143 . the number of components and work stations in such a system may vary , but the illustrated embodiment includes a milling machine 150 , multiple cnc machine tools 154 , and a carousel 158 . the milling machine 150 includes the chucking apparatus 100 described above . the milling machine 150 also includes the multi - axis spindle 110 for the probe 108 and the cutter 120 . each cnc machine tool 154 in this particular embodiment is an edm machine with a chucking apparatus 118 as described above . the carousel 158 has a supply of holders 10 , each of which is edm - ready with a pneumatic coupling / stud 64 and a new or redressed edm electrode 12 projecting the predetermined distance d outward from the holder 10 . the new electrodes 12 could be placed in their holders 10 on the milling machine 150 as described above , or on a similar machine that is not necessarily adapted for milling . the fork 148 on the robot arm 144 is configured to move into and out of engagement with a pneumatic coupling / stud 64 to lift , carry , and release a holder 10 in a known manner . a controller 160 , as shown schematically in fig1 , is operatively associated with the robot 142 , the milling machine 150 , the edm machines 154 and the carousel 158 . the controller 160 may comprise any suitable programmable logic controller or other control device , or combination of such control devices among the various machines , and has hardware and / or software configured to operate the robot 142 , the milling machine 150 , the edm machines 154 and the carousel 158 as described and claimed . the controller 160 is also configured to operate the valve 106 between the milling machine 150 and the source 104 of pneumatic pressure as described and claimed . in an example of operation of the system 140 , the robot 142 loads each edm machine 154 with an edm - ready holder 10 from the supply on the carousel 158 . when any one of the electrodes 12 at the edm machines 154 requires redressing after multiple machining cycles , the robot 142 transfers the holder 10 with the worn electrode 12 back to the carousel 158 , and replaces it with another edm - ready holder 10 taken from the supply on carousel 158 . while the machining operations are being performed at the edm machines 154 , the robot 142 can replenish the supply of edm - ready holders 10 at the carousel 158 without interrupting the edm operation . this is accomplished by transferring holders 10 with worn electrodes 12 back and forth from the carousel 158 to the milling machine 150 for redressing while edm machining operations continue at the edm machines 154 with other holders 10 having either new or redressed electrodes 12 . this written description sets for the best mode of the invention , and describes the invention so as to enable a person of ordinary skill in the art to make and use the invention , by presenting examples of the elements recited in the claims . the patentable scope of the invention is defined by the claims , and may include other examples that occur to those of ordinary skill in the art . such other examples are intended to be within the scope of the claims if they do not differ from the literal language of the claims , or if they have insubstantial differences from the literal language of the claims . | 1 |
as will be appreciated by one skilled in the art , aspects of the present invention may be embodied as a system , method or computer program product . accordingly , aspects of the present invention may take the form of an entirely hardware embodiment , an entirely software embodiment ( including firmware , resident software , micro - code , etc .) or an embodiment combining software and hardware aspects that may all generally be referred to herein as a “ circuit ,” “ module ” or “ system .” furthermore , aspects of the present invention may take the form of a computer program product embodied in one or more computer readable medium ( s ) having computer readable program code embodied thereon . one embodiment , in accordance with the claimed subject , is directed to a programmed method for validating file attachments . the term “ programmed method ”, as used herein , is defined to mean one or more process steps that are presently performed ; or , alternatively , one or more process steps that are enabled to be performed at a future point in time . the term ‘ programmed method ” anticipates three alternative forms . first , a programmed method comprises presently performed process steps . second , a programmed method comprises a computer - readable medium embodying computer instructions , which when executed by a computer performs one or more process steps . finally , a programmed method comprises a computer system that has been programmed by software , hardware , firmware , or any combination thereof , to perform one or more process steps . it is to be understood that the term “ programmed method ” is not to be construed as simultaneously having more than one alternative form , but rather is to be construed in the truest sense of an alternative form wherein , at any given point in time , only one of the plurality of alternative forms is present . any combination of one or more computer readable medium ( s ) may be utilized . the computer readable medium may be a computer readable signal medium or a computer readable storage medium . a computer readable storage medium may be , for example , but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , or device , or any suitable combination of the foregoing . more specific examples ( a non - exhaustive list ) of the computer readable storage medium would include the following : an electrical connection having one or more wires , a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , a portable compact disc read - only memory ( cd - rom ), an optical storage device , a magnetic storage device , or any suitable combination of the foregoing . in the context of this document , a computer readable storage medium may be any tangible medium that can contain , or store a program for use by or in connection with an instruction execution system , apparatus , or device . a computer readable signal medium may include a propagated data signal with computer readable program code embodied therein , for example , in baseband or as part of a carrier wave . such a propagated signal may take any of a variety of forms , including , but not limited to , electro - magnetic , optical , or any suitable combination thereof . a computer readable signal medium may be any computer readable medium that is not a computer readable storage medium and that can communicate , propagate , or transport a program for use by or in connection with an instruction execution system , apparatus , or device . program code embodied on a computer readable medium may be transmitted using any appropriate medium , including but not limited to wireless , wireline , optical fiber cable , rf , etc ., or any suitable combination of the foregoing . computer program code for carrying out operations for aspects of the present invention may be written in any combination of one or more programming languages , including an object oriented programming language such as java , smalltalk , c ++ or the like and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the program code may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). aspects of the present invention are described below with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ) and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer program instructions . these computer program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which - execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer program instructions may also be stored in a computer readable medium that can direct a computer , other programmable data processing apparatus , or other devices to function in a particular manner , such that the instructions stored in the computer readable medium produce an article of manufacture including instructions which implement the function / act specified in the flowchart and / or block diagram block or blocks . the computer program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other devices to cause a series of operational steps to be performed on the computer , other programmable apparatus or other devices to produce a computer implemented process such that the instructions which execute on the computer or other programmable apparatus provide processes for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . over the past several decades , computer users have become increasingly connected by networks , including the internet . this connectivity has enabled users to communicate via electronic mail , or “ email .” as email has become more ubiquitous , the utility has also expanded . today , most people use email for a variety of personal and business reason . one common utility associated with email is the attachment of files . in addition to a typical text message , people transmit as attachments photographs , documents , spreadsheets and so on as file attachments . if a user who is in the process of editing a document , transmits the document as an email attachment before the latest changes have been saved to memory , currently available email programs will attach a copy of the document that is out of date , i . e . the attached document does not include any changes made after the last save . this is because many programs such as , but not limited to , word processors , photo editors and spreadsheets create a temporary file when a particular file is opened . these programs save changes to the temporary file and only update the original file when the user explicitly saves the file . in another scenario , an email program displays a file listing so that a user can select a particular file to attach to an email . if there are multiple files with similar names such as a file with multiple versions or multiple files with the same name that are stored in different directories , a user may inadvertently select the wrong version or the wrong file for attachment . provided is a method for validating file attachments to ensure that the attached files are not , among other things , stale or outdated . the specification uses a word processing program as an example but it should be understood that the disclosed techniques are applicable to , but not limited to , word processing , spreadsheet and any other document application that relies upon making , or relies upon another application that makes , a temporary copy of a document . the disclosed techniques are also applicable to any operating systems , or “ platform ,” including but not limited to , windows ®, published by the microsoft corporation of redmond , wash ., and versions of linus / unix . turning now to the figures , fig1 is a block diagram of one example of a computing system architecture 100 that may incorporate the claimed subject matter . a client system 102 includes a processor 104 , coupled to a monitor 106 , a keyboard 108 and a mouse 110 , which together facilitate human interaction with computing system 100 and client system 102 . also included in client system 102 and attached to processor 104 is a data storage component 112 , which may either be incorporated into processor 104 , i . e . an internal device , or attached externally to processor 104 by means of various , commonly available connection devices such as but not limited to , a universal serial bus ( usb ) port ( not shown ). data storage 112 is illustrated storing an operating system ( os ) 114 that controls the operation of computing system 102 , an example of an application that employs file attachments , or app_ 1 116 , a attachment verification component ( avc ) 118 that implements the claimed subject matter , a file used as an example throughout the description , or file_ 1 120 , and a file used throughout the description as an example of attachment , or atth_ 1 122 . in this example , avc 118 is configured to work in conjunction with os 114 to implement the claimed subject matter and is described in more detail below in conjunction with fig3 - 5 . in the alternative avc 118 could be incorporated into app_ 1 116 , either as an integral component or as a plug - in module . those with skill in the computing arts should appreciate that there are multiple oss , or “ platforms ,” to which the claimed subject matter applies . client system 102 and processor 104 are connected a local area network ( lan ) 124 , which is also connected to a server computer 126 . although in this example , processor 104 and server 126 are communicatively coupled via lan 124 , they could also be coupled through any number of communication mediums such as , but not limited to , the internet ( not shown ). further , it should be noted there are many possible computing system configurations , of which computing system 100 is only one simple example . server computer 126 is coupled to a data storage 128 , which like data storage 114 , which may either be incorporated into server 126 , i . e . an internal device , or attached externally to server 126 by means of various , commonly available connection devices such as but not limited to , a usb port ( not shown ). also communicatively coupled to the lan 124 is a second client computer 132 , which like client computer 102 , includes a data storage 134 . data storage 134 also includes an avc component 136 , which may handle file attachment issues with respect to various applications ( not shown ) on client 132 in a fashion similar to avc 118 on client computer 102 . although not shown in fig1 , it should be understood that each of server 126 and client 132 include a processor , monitor , keyboard and mouse like components 104 , 106 , 108 and 110 , respectively . fig2 is a block diagram of avc 118 , first introduced in fig1 , in more detail . in this example , avc 118 is stored on data storage 112 ( fig1 ) and executed on processor 104 ( fig1 ) of client system 102 ( fig1 ). of course , avc 118 could also be stored and executed on another computing system such as server 122 that executes services for client system 102 . for example , electronic mail servers are often located on remote computing systems . avc 118 includes an input / output ( i / o ) module 140 , an avc configuration module 142 , an avc control module 144 and a data cache component 146 . it should be understood that the representation of avc 118 in fig2 is a logical model . in other words , components 140 , 142 , 144 , 146 and other components described below may be stored in the same or separate files and loaded and / or executed within system 100 either as a single system or as separate processes interacting via any available inter process communication ( ipc ) techniques . i / o module 140 handles communication avc 118 has with other components of computing system 102 and system 100 . avc configuration module 142 stores parameters defined by an administrator to control the setup and operation of avc 118 . examples of such configuration parameters include , but are not limited to , security settings , display options and so on . in addition , parameters may be defined that list potential users , applications and computing hosts and corresponding degrees of file matching and specific implementations of the claimed technology . avc control module 144 stored the logic that controls the operation of avc 118 . examples of logic modules that may be included in module 144 include a discovery engine 150 and a sort module 152 . control logic 144 extracts filenames and directories corresponding to an attachment and feed this information into discovery engine 150 . discovery engine 150 scans file directories of data storage 112 to locate possible alternative files for any particular attached file . particular portions of data storage 112 that are searched as well as the degree of correspondence between an attached file and a potential alternative are controlled by parameters stored in avc configuration 142 . discovery engine 150 includes a discovery algorithms module 154 and a directory explorer module 156 , both of which execute logic associated with discovery engine 150 . discovery algorithms module 154 includes a regular expression ( re ) generator 158 , which generates regular expressions corresponding to a file under examination , and a associate filename ( afn ) generator 160 , which employs the regular expressions generated by module 158 to create a list of possible alternative file names . avc control 144 also includes sort module 152 that organizes the information collected by discovery engine 150 . the operation of discovery engine 150 , discovery algorithms module 154 , re generator 158 , afn generator 160 , directory explorer 156 and sort module 152 are explained in more detail below in conjunction with fig3 - 5 . data cache 146 is a data repository for information , including settings and lists that avc 118 requires during operation . examples of the types of information stored in cache 146 include , but are not limited to , specific files and directories employed in conjunction with avc control 144 , corresponding patterns associated with the processing of modules 154 and 156 . in addition , cache 146 may store intermediate results associated with the processing of avc 118 . fig3 is a flow chart illustrating an process file process 200 that is one example of an application the incorporates the claimed subject matter . in this example , logic associated with process 200 is stored on data storage 112 ( fig1 ) as part of avc 118 ( fig1 ) and executed on processor 104 . in the alternative , process 200 may be incorporated into app_ 1 116 ( fig1 ). process 200 starts in a “ begin process file ” block 202 and proceeds immediately to a “ retrieve file ” block 204 . during block 204 , a file , in this example file_ 1 120 ( fig1 ), associated with app_ 1 116 is transmitted to avc 118 as part of an example of an implementation of the claimed subject matter . typically , file_ 1 120 is transmitted to avc 118 once has user has indicated that processing of file_ 120 is complete . for example once an email has been prepared and a “ send ” button has been clicked . in the alternative , app_ 1 116 may provide the option of checking a file at any time . during a “ file attachment ?” block 206 , process 200 determines whether or not file_ 1 120 includes one or more attachments such as attch_ 1 122 . if so , process 200 proceeds to a “ check attachments ” block 208 , which is described in detail below in conjunction with fig4 . during an “ attachments approved ” block 210 , process 200 determines whether or not the attachments detected during block 206 and checked during block 208 have been approved for transmission . it should be noted that parameters may be set to establish automatic approval procedures , e . g . the attached file is the most current , or require that all attachments be subjected to user scrutiny . if all attachments have not been approved , either automatically or explicitly by a user depending upon setup parameters , process 200 proceeds to a “ process attachment ” block 212 during which the user who attached the file is given the opportunity to either select another file form a list provided by avc 118 or cancel the attachment and start over with a selection . processing associated with block 212 is described in more detail below in conjunction with fig5 . control then returns to check attachments block 208 and processing continues as described above . if process 200 determines during block 206 that file_ 1 120 does not include an attachment or if , during block 210 , the user has indicated that attached files are the intended attachments , control proceeds to a “ complete processing ” block 214 . during block 214 , the original intention of app_ 1 116 is executed . for example , if app_ 1 116 is an email program , the file and the attachment , if there is one , is transmitted , or sent , to the intended recipient ( s ). finally , during an “ end process file ” block 219 , process 200 is complete . fig4 is a flow chart illustrating a check attachment process 250 that is one example of processing that may implement the claimed subject matter ( see 208 , fig3 ). in this example , logic associated with process 250 is stored on data storage 112 ( fig1 ) as part of avc 118 ( fig1 and 2 ) and executed on processor 104 . in the alternative , process 200 , as well as avc 118 , may either be incorporated into either os 114 ( fig1 ) or an application such as app_ 1 116 ( fig1 ). process 250 starts in a “ begin check attachment ( attch . )” block 252 and proceeds immediately to a “ get attch . info ” block 254 . during block 254 , process 250 gathers information about file that is being processed , in this example attch_ 1 122 ( see element 150 , fig2 and process 200 , fig3 ). information typically includes , but is not limited to , the name of the file , dates and times associated with the file , the directory from which the file originated and a version number if the file is part of a series of related files . during a “ generate regular expression file names ( refn )” block 256 , process 250 , based upon the name of the file of attch_ 1 122 and information from avc configuration 142 ( fig2 ), generates regular expressions corresponding to the name of attch_ 1 122 ( see element 158 , fig2 ). for example , if attch_ 1 122 has a name of “ filename v1 . txt ” a regular expression may be “ filename *. txt ,” which would match and files such as “ filename v2 . txt ” and “ filename v3 . txt .” regular expressions may be based upon the name of a file and / or on conventions associated with os 114 such as , but not limited to , particular directory naming or file extension conventions . for example , some platforms store temporary files in a specific directory , e . g . a “/ tmp ” directory while other platforms store temporary in a current directory and either add a ‘˜’ character at the beginning of a file name or modify the file extension . during a “ generate associated names ” block 258 , process 250 generates the names of possible alternative file name that may be associated with attch_ 1 122 ( see element 160 , fig2 ). for example , if a user is working with revisions of documents , alternative files include the different revision numbers . files names may be collected based upon the date and time the files were created and modified . the names of files that have similar spellings may also be generated employing algorithms typically associated with spell - checking logic . in addition , names are generated that may be associated with any temporary versions of a file . for example , if a file entitled “ file . txt ” is currently opened by a word processing application ( wpa ), the wpa may be storing unsaved changes to a file entitled “˜ file . txt .” those with skill in the computing arts should appreciate the many variations that could be employed to generate associated file names . control of how thorough the generation of alternative files is to be depends upon configuration parameters set by a system administrator or user ( see element 142 , fig2 ). during a “ search system ” block 260 , process 250 scans memory associated with client system 102 , which may include such memory as data storage 112 and remote storage such as data storage 128 ( fig1 ) to locate actual files that match the file names generated during block 258 ( see element 150 , fig2 ). during a “ sort list ” block 262 , process 250 sorts the list of actual file names collected during block 260 to produce a sorted list of file names ( see element 152 , fig2 ). depending upon configuration parameters , the list may be sorted by version number , date / time of creation or modification or any of a number of possible scenarios . files may be sorted based upon the closeness of a name or directory match . in this manner , more likely alternative files may be listed first and less likely files listed later . a displayed listing may also include a degree of correlation between a particular selected files and possible alternatives . during a “ meet parameters ?” block 264 , process 250 determines whether or not the original file , which in this example is attch_ 1 122 , meets the configuration parameters established for automatic acceptance . as noted above , the parameters may also be set so that any attachment must be verified by a user , i . e . there is not automatic approval . if so , attch_ 1 122 is marked as “ approved ” during a “ mark not approved ( na )” block 266 and , if not , attch_ 122 is marked as not approved during a “ make not approved ” block 268 . control then proceeds to a “ more attach . ?” block 266 during which process 250 determines whether or not there are more attachments associated with file_ 1 120 . if so , control returns to block 254 and processing continues as described above with respect to the next attachment . if not , control proceeds to an “ end check attach .” block 269 in which process 250 is complete . fig5 is a flow chart illustrating a process attachment process 300 that is one example of processing that may implement the claimed subject matter ( see element 212 , fig3 ). in this example , logic associated with process 300 is stored on data storage 112 ( fig1 ) as part of avc 118 ( fig1 and 2 ) and executed on processor 104 . in the alternative , process 300 , as well as avc 118 , may either be incorporated into either os 114 ( fig1 ) or an application such as app_ 1 116 ( fig1 ). process 300 starts in a “ begin process attachment ( attch . )” block 302 and proceeds immediately to a “ get attch . list ” block 304 . during block 304 , process 300 receives a list associated with an attachment such as attch_ 1 122 ( fig1 ) that has been checked and possibly marked for closer review in conjunction with a list of alternative file names that have been generated ( see process 250 , fig4 ). during an “ offer selection ” block 306 , process 300 generates a graphical user interface ( gui ) for display on monitor 106 so that the user can see the alternative files and make a selection . during a “ attch . approved ?” block 308 , process 300 determines whether or not the user has selected a file in the list displayed during block 306 or has indicated that more attachments need to be scrutinized for selection . if the user has approved an attachment , control proceeds to a “ select attch .” block 310 during which the selected file is added to file_ 1 120 as an attachment for transmission . if no attachment is a list of attachments has been approved during block 308 , process 300 proceeds to a “ delete selection ” block 314 during which attch_ 1 122 is deselected for attachment . once processing has completed in blocks 310 or 316 , control proceeds to a “ more lists ?” block 312 during which process 300 determines whether or no there are more lists of attachments to process . if so , control returns to block 304 and processing continues as described above on the next list . if not , control proceeds to an “ end process file ” block 319 in which process 300 is complete . the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ”, “ an ” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . the corresponding structures , materials , acts , and equivalents of all means or step plus function elements in the claims below are intended to include any structure , material , or act for performing the function in combination with other claimed elements as specifically claimed . the description of the present invention has been presented for purposes of illustration and description , but is not intended to be exhaustive or limited to the invention in the form disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention . the embodiment was chosen and described in order to best explain the principles of the invention and the practical application , and to enable others of ordinary skill in the art to understand the invention for various embodiments with various modifications as are suited to the particular use contemplated . the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods and computer program products according to various embodiments of the present invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of code , which comprises one or more executable instructions for implementing the specified logical function ( s ). it should also be noted that , in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts , or combinations of special purpose hardware and computer instructions . | 6 |
the following is a description of embodiments of the present invention , with reference to the accompanying drawings . throughout all the figures , members and parts having the same functions are assigned the same or similar reference numerals and redundant explanations are omitted . the following two matters are set forth as premises of each embodiment of the present invention . 1 ) all nodes ( terminals ) have certificates of rout ca ( certificate authority ), and can issue their own certificates and create secret keys , by any means . 2 ) it is possible to know correspondent node address prior to start communication , by any means . with reference to fig4 and 5 , a first embodiment of the present invention is explained below . a mobile node ( terminal ) 400 according to the first embodiment of the present invention comprises a request / reply generator 422 , a controller 424 , a transmitter / receiver 426 , an address storage 427 , an address comparator 428 , a random number generator 430 , a certificate issuing unit 440 , a digital signature creator 450 , a secret key processor 460 , an operating unit 470 and a verifying unit 480 . this structure is not limited to a transmitting node . not only a transmitting node but also a relaying node or receiving node may have a similar structure . the present invention can be applied to not only radio mobile communications but also to wire communications . a route request control message rreq generated by the request / reply generator 422 is broadcast - transmitted by the transmitter / receiver 426 to a network . in the first embodiment , as shown in fig5 , an authentication is applied to the rreq at each hop ( that is , the transmitting node s — the relaying node t1 — the relaying node t 2 — the receiving node d ). to an rrep signal , one authentication is applied only to end - to - end ( that is , the receiving node d - the transmitting node s ). fields in fig5 that are different from fig3 , are shown shaded . a symbol “ nonce ” shown in fig5 means a random number generated by the random number generator 430 . “ cert x ” means a certificate of a node x issued by the certificate issuing unit . “ sig x ” means a digital signature by a node x , which is created by the digital signature creator . in a prior dsr , no authentication is applied to an rreq signal or an rrep signal . in the present invention , authentications are applied to these signals . since an authentication is applied to the rreq at each relaying node , it is believed that one authentication applied to the returning rrep only during end - to - end is enough . operation of each node is explained below . first , the random number generator 430 of the transmitting node s determines a random number “ nonce ”. the certificate issuing unit 440 issues a “ cert s ”. the controller 424 adds the “ nonce ” and its own certificate “ cert s ” to the control message rreq . the purpose of adding the random number “ nonce ” is to protect the ad hoc network from re - sending attacks . since the receiving node d does not necessarily know transmitting node information , the certificate “ cert s ” of the transmitting node itself is added . against the total fields of the rreq signal accompanied by the “ nonce ” and the certificate “ cert s ”, the digital signature creator 450 creates its own digital signature “ sig s ”. the rreq signal accompanied by the “ nonce ”, “ cert s ” and “ sig s ” is broadcasted to the network by the transmitter / receiver 426 . the verifying unit 480 of the relaying node t 1 that has received the signal rreq performs verification on the “ nonce ” added to the received signal rreq by a known method . if the present “ nonce ” is the same as a previously received nonce , the present rreq is considered to be a re - sent one and is discarded . if the present “ nonce ” is the first received one , the verifying unit 480 verifies the digital signature “ sig s ” by a known method , by using the added certificate “ cert s ”. if there is no problem as a result of the verification , the relaying node t 1 compares the “ add d ” with its own address and confirms that the received signal is not directed to oneself . next , the relaying node t 1 adds its own address “ add t1 ” and certificate “ cert t1 ” to the received signal , and creates a its own digital signature “ sig t1 ” against the total signal accompanied by “ add t1 ′ and “ cert t1 ”. the rreq accompanied by “ add t1 ”, “ cert t1 ” and “ sig t1 ” is forwarded to the network by broadcasting . the receiving node d receives the rreq signal from the relaying node t 2 , and the verifying unit 480 of the receiving node d verifies the received “ nonce ”. if the received “ nonce ” is the same as a previously received nonce , the present rreq is considered to be a re - sent one and is discarded . if the present “ nonce ” is the first received one , the verifying unit 480 of the receiving node d verifies a digital signature “ sig t2 ” added by the relaying node t 2 by a known method , by using an added certificate “ cert t2 ”. if there is no problem as a result of the verification , the receiving node d compares the “ add d ” with its own address and confirms that the received signal is directed to itself . using the added certificate “ cert t1 ”, the receiving node d verifies the digital signature “ sig t1 ” of the relaying node t 1 . using the added certificate “ cert s ”, the receiving node d verifies the digital signature “ sig s ” of the transmitting node s . the order of these processing can be changed . a duplication of the total contents of the rreq signal is added to a reply control message rrep generated by the request / reply generator of the receiving node d . the receiving node d creates its own digital signature “ sig d ” against the total fields of the rrep signal accompanied by the rreq duplication . the rrep signal accompanied by “ sig d ” is transmitted to the transmitting node s by uni - casting . the relaying node t 2 receives the rrep signal from the receiving node d , and verifies the nonce . the relaying node t 2 finds its own address “ add t2 ” in the relaying address list , and forwards this signal as it is by uni - casting . the relaying node t 1 performs the same processing as the relaying node t 2 did . the transmitting node s receives the rrep signal via the relaying node t 1 , and the verifying unit 480 of the transmitting node s verifies the nonce first and then performs the following processing . since the transmitting node s can not find its own address add s in the relaying address list , verifies whether this rrep signal is directed to oneself . based on combination of “ add s ”, add d ”, “ nonce ”, “ cert s ” and “ sig s ”, the transmitting node recognizes that this rrep is a response to the rreq previously sent by itself . the “ sig d ” is verified . the “ sig ” for each relaying route is verified . that is , the rrep is replaced by the rreq and the “ sig d ” is deleted . after verifying the “ sig t2 ”, the “ add t2 ”, “ cert t2 ”, “ sig t2 ” are deleted . after verifying the “ sig t1 ”, the “ add t1 ”, “ cert t1 ”, “ sig t1 ” are deleted . the relaying route information ( s - t 1 - t 2 - d ) is fixed . with reference to fig6 through 10 , a second embodiment of the present invention is explained below , fig6 is the same as fig5 except that the information about nodes s and d is shown shaded . as shown in fig6 , the first embodiment cannot protect privacy . for example , in an area where users are limited , there is a risk that the cert s and therefore the transmitting node s are exposed by trying all certificates . in this embodiment , the shaded fields in fig6 are encrypted and hided so as to be known only by nodes s and d in order to improve privacy protection . the common key encryption system is known as a basic encryption system . in the common key encryption system , a transmitting node s encrypts plain data using a common secret key and transmits the cipher data , and a receiving node d receives the cipher data and decrypts them using the same common secret key . since the procedures for encrypting and decrypting use the equivalent but opposite directed process , the common key encryption is referred to as “ symmetric algorithm ” also . because the encryption and decryption use the same key , the processing speed is high . however , there is a risk that once after the “ common key ” is leaked to third parties , all the cipher data thereafter may be broken . in an example shown in fig7 , a temporary address is used as the address add s of the transmitting address s , and the public key encryption is applied to other factors . the public key encryption system or asymmetric algorithm is a system in which keys used for encrypting and decrypting are different from each other . a receiving node creates a pair of a “ public key ” and a “ secret key ( or private key )”. one key publicly disclosed to other parties is referred to as a “ public key ”, and another key “ secret key ” is kept by the receiving node . a transmitting node obtains the public key of a receiving party , encrypts plain data using the public key , and transmits the cipher data . the receiving party receives the cipher data and decrypts the cipher data using the secret key kept by the receiving party . e x [ y ] means encrypting a plain text y using a public key of a node x herein . in the transmitting node s shown in fig7 , the address add d of the receiving node d , and the certificate cert s and the digital signature sig s of the transmitting node s may be encrypted using the public key of the receiving terminal d ( e d [ add d ], e d [ cert s ], e d [ sig s ]). the receiving node d receives these encrypted data and decrypts them using its secret key . when sending back , the receiving node d encrypts its own digital signature sig d using the public key of the transmitting node s ( e s [ sig d ]). this procedure , however , has the following problems . 1 ) under some algorithm of public key encryption system , the same plain text may be encrypted to the same result . although the add d is unknown , new address e d [ add d ] is always exposed and there is a risk of tracing . accordingly , it gives stronger privacy protection to encrypt the same plain text so as to get different result each time . in order to solve the above problems , a second embodiment employing a hybrid encryption system as shown in fig8 is explained below . in the hybrid encryption system , the following procedures are carried out . the transmitting node s and the receiving node d previously share a common key . the receiving node d creates a pair of a “ secret key ( or private key )” and a “ public key ”. the “ private key ” is disclosed and the “ secret key ” is kept in the receiving node d . the transmitting node s obtains the “ public key ” of the receiving node d , encrypts the common key using the public key , and transmits the encrypted common key to the receiving node d . the transmitting node s symmetrically encrypts plain data using the encrypted common key , and transmits the encrypted data . the receiving node d receives the encrypted common key and encrypted data , and decrypts the common key using the secret key . then , using the decrypted common key , the receiving node d decrypts the encrypted data . since the plain data is encrypted by the high speed common key encryption system , high processing speed is obtained . since the common key itself is encrypted , high level security is obtained . in order to improve the security level , the above common key can be changed at each session . in this case , the transmitting node s symmetrically encrypts plain data using a disposable common key ( session key ) at each session , and encrypts the session key with the public key and send it to the receiving node d . in an example shown in fig8 , a temporary address is applied to the transmitting node address adds , the hybrid encryption is applied to other factors . operation ( especially portions different from fig3 ) in the example shown in fig8 is explained below . the random number generator 430 of the transmitting node s ( cf . fig4 ) randomly determines a temporary address of the transmitting node s . the random number generator 430 further randomly determines a session key . the secret key processor 460 encrypts the session key with the public key of the receiving node d to create e d [ session key ]. since the e d [ session key ] can take a role of nonce , the nonce shown in fig3 is deleted and replaced by the e d [ session key ]. the secret key processor 460 uses the session key , and obtains symmetric key encryption output ( pseudo random number series ). the operating unit 470 calculates an exclusively or between the above pseudo random number series and the transmitting node temporary address add s , the receiving node address add d , the transmitting node certificate cert s and their digital signature sig s ( against all the fields ). the transmitter / receiver 426 transmits the total rreq by broadcasting . the relaying node t 1 that has received the rreq assumes that an rreq having a certain length is the true rreq from the transmitting node s , does not verify the sig s , performs processing similar to fig3 case and forwards the rreq signal . the relaying node t 2 also performs similar processing and forwards the signal . the receiving node that has received the rreq signal from the relaying node t 2 performs the following processing . the receiving node decrypts the encrypted common key e d [ session key ] with its own secret key to obtain the common key ( session key ). using the obtained session key , the receiving node d gets a symmetrical encryption output ( pseudo random number series ). data is decrypted and recovered by calculating exclusive or between the obtained pseudo random number series and the hided fields . when sending back , the random number generator 430 of the receiving node d creates new pseudo random number series ( different from the received random number series ), and encrypts again the signal with the new pseudo random number series . that is , the receiving node d calculates exclusive or between the new pseudo random number and the adds , add d , cert s , sig s and sig d . that means that the add s , add d , cert s , sig s and sig d of the rrep signal are masked with the random number series of nodes s and d . the transmitting node that has received the rrep signal forwarded via the relaying nodes t 1 , t 2 performs the following processing . before verifying whether the rrep signal is directed to itself , the transmitting node s deletes the pseudo random number series set by the receiving node d . in order to output pseudo random number series , a ctr mode is generally employed . fig9 generally shows the concept of the crt mode . it is desired that an initialization vector ( referred to as “ iv ” herein after ) is secretly shared by transmitting and receiving nodes . a counter ( referred to as “ ct ” herein after ) should be synchronized between the transmitting and receiving nodes , and therefore it is desired to add a counter value to a packet to send it in order to reduce the influence of out of synchronization . fig1 shows an example in which the ctr mode is used in the symmetrical key encryption system . operation ( portions different from fig5 ) is explained below . the iv is sent together with the session key ( represented by “∥” herein after ), that is seed - session key ∥ iv . a ct can be independently selected by the transmitting node s and the receiving node d respectively ( each represented by ct s , ct d ), which is added to the top of the packet . if the ct increases continuously , the order of the transmitted packets is known to third parties , and therefore the ct should be random . the ct can take a role of the nonce . with reference to fig1 and 12 , a third embodiment of the present invention is explained below . fig1 is the same as fig1 except that portions of the relaying node information exposable to third parties are shown shaded . considering the necessity of relaying node information , although the transmitting node s and the receiving node d need to know all the relaying node information , the relaying nodes themselves only have to determine the following matters . 1 ) as for the rreq signal , confirmation whether the signal is directed to itself , authenticity of information from the preceding node . 2 ) as for rrep signal , whether itself is included in a forwarding address list . accordingly , since unnecessary information exposure may be a target for attacking , it is desired to hide the relaying node information as much as possible from any other than the transmitting node s and the receiving node d . an example is explained below , in which the shaded portions in fig1 are hidden from any other than the nodes s and d in order to improve privacy protection . in fig1 , a temporary public key is applied to the rreq in order to hide the shaded portions in fig1 , a symmetric key is applied to widen portions of the rrep . operation ( especially portions different from fig8 ) is explained below . before transmitting the rreq signal , the random number generator 430 of the transmitting node s determines a pair of a temporary public key ( k +) and a temporary secret key ( k −). both the temporary public key k + and the temporary secret key k − are added to the rreq and sent , and only the temporary secret key k − is a target for calculating exclusive or of pseudo random number series . the relaying node t 2 that has received the rreq signal accumulatively encrypts the preceding relaying node information ( add t1 , cert t1 , sig t1 in this case ) using k +. in this manner , even if a malicious node intentionally deletes the preceding relaying node information in the reverse order , the receiving node d can detect such malicious act , due to the accumulative encryption . the receiving node d has received the rreq signal performs the following processing . the receiving node d verifies the sig of every relaying node . after verifying the sig t2 , the receiving node d deletes add t2 , cert t2 , sig t2 . the receiving node d decrypts all the relaying node information using the temporary secret key k −. the receiving node d verifies the sig t1 , deletes add t1 , cert t1 , sig t1 , and verifies the sig s . in general , the following sequential processing is repeated at the number of time same as the number of relaying , which can be expected based on the length of all the relaying information . the sequential processing is a series of processing of decrypting using the temporary secret key k −, verifying the outermost sig and deleting the outermost added information . when sending back , the receiving node d calculates exclusive or between all the information duplicated from the rreq and pseudo random number series ( different from the received random number series ) newly created by the receiving node d , to encrypt again and create the rrep . an area covered by the mask pattern is widened , k −, k +, e d [ seed ], add t1 , cert t1 , sig t1 , add t2 , cert t2 , and sig t2 are also mask - patterned . since all the information duplicated from the rreq is mask - patterned , the add t1 and add t2 are concealed and not known to the relaying nodes . then the values of the add t1 and add t2 are stored in the newly established relaying node address list field . the transmitting node s that has received the rrep signal performs the following processing . the transmitting node s decrypts the received encrypted common key e d [ seed ] and verifies it . since the transmitting node s cannot find out its own address in the relaying address list , it removes the random number series . based on the combination of the add s , add d , seed , cert s , and sig s , the transmitting node s recognizes that the rrep is a response to the rreq previously sent by itself . sig d is verified . every sig of each relaying route is verified . that is the rrep is replaced by the rreq , and the sig d is removed . after verifying the sig t2 , the fields add t2 , cert t2 , and sig t2 are removed . after verifying the sig t1 , the fields add t1 , cert t1 , and sig t1 are removed . the relaying route information ( s - t 1 - t 2 - d ) is fixed . with reference to fig1 and 14 , a fourth embodiment of the present invention is explained below . fig1 is the same as fig1 except that portions of the relaying node information that are exposed to third parties are shown shaded . it is desired to hide the relaying node addresses from any other than the transmitting node s and the receiving node d as much as possible . an example in which the shaded fields in fig1 are hidden from any other than the transmitting node s and the receiving node d in order to improve privacy protection is explained below . a simple way is to temporary addresses are used as the add t1 , add t2 . in this way , however , the same addresses are used during plural packets , and therefore there is a risk where the packet relations are exposed . accordingly , the temporary addresses may be changed for each packet , resulting in stronger protection against privacy leakage . in order to deal with this issue , a temporary public key and the hasche function can be considered . fig1 shows an example where the random number is encrypted with a temporary public key in the rreq signal , and the hasche function is applied to the random number in the rrep signal , in order to hide the shaded fields . operation ( especially portions different from fig9 ) is explained below . a symbol “ rand x ” means a random number determined by a node x , and “ h ( y )” means a hasche value of y . the hasche function is a function or procedure for summarizing a series of characters such as numbers or documents into data having a certain length . an output obtained by operating the hasche function is referred to as a “ hasche value ”. typical examples of the hasche function are “ sha - 1 ” and “ md5 ”. these functions are uni - direction function , and therefore it is impossible to estimate the original text based on created data . when transmitting and receiving data through a communication line , if hasche values of data are obtained at both ends of the line and compared with each other , it is possible to detect whether the transmitted data is altered on the way of the communication line . the relaying node t 1 receives the rreq signal and establishes e k + [ rand t1 ] in place of its own address add t1 . the relaying node t 2 performs the same processing as the relaying node t 1 . the receiving node d receives the rreq signal , obtains the rand t1 , rand t2 , and applies h ( rand t1 ∥ c td ), h ( rand t2 ∥ c td ) in place of the raw value of add t1 , add t2 . the relaying node t 2 receives the rrep signal , and recognizes h ( rand t2 ∥ c td ) as its address . the relaying node t 1 performs the same node t 2 . the transmitting node s receives the rrep signal and performs the following processing . when finding its own address in the relaying address list , the transmitting node s checks h ( rand s ∥ ct d ), then obtains the rand t1 , rand t2 . with reference to fig1 through 16 , a fifth embodiment of the present invention is explained below . it is understood from fig1 , that there is a high risk that the information about the transmitting node s and receiving node d are leaked based on the rreq packet length and the rrep relaying address list , as follows . as for rreq , it is understood from the packet length that the relaying node t 1 is next to the transmitting node s . as for rrep , if the relaying node t 1 and the relaying node t 2 are conspire , it is understood from the relaying address list that the receiving node d is next to the relaying node t 2 ( the transmitting node s is next to the relaying node t 1 ). an example is explained below , in which dummy information ( random number ) is utilized to have the transmitting node s and the receiving node d behave as relaying nodes , in order to hide the information about the transmitting node s and the receiving node d as much as possible . fig1 shows an example in which dummy information is given to the rreq signal and the rrep signal , to have both the transmitting and receiving nodes behave as relaying nodes . operation ( especially portions different from the above example ) is explained below . the transmitting node s gives dummy relaying information ( dummy 1 and dummy 2 meaning relaying nodes in fig1 ) during the rreq signal . due to dummy information , even if the information about the transmitting node s is exposed , third party cannot distinguish a transmitting node from a relaying node . the relaying node t 1 receives the rreq , and verifies the sig s . in the above example , since that the sig s cannot be verified , the sig s is not verified by assuming that the rreq having a specific length is the rreq from the transmitting node s . in this example , since that the transmitting node s behaves as a relaying node , the cert s can be disclosed and authentication becomes possible . the receiving node that has received the rreq performs the following processing . the receiving node decrypts the received signal using a temporary secret key k −, verifies the sig of each relaying route in turn from the outermost one until the cert s appears . in the immediately above example , the processing is repeated at the number of times that is expected from the total length of the relaying node information . that way cannot be used in this example , because that the transmitting node s pretends to be a relaying node . the receiving node d adds dummy addresses ( dummy add 1 and dummy add 2 in fig1 ) to the relaying node address list in the rrep signal , and calculates exclusive or of pseudo random number series . the transmitting node s receives the rrep signal , and verifies the sig of each relaying route as the receiving node d does . it is understood from fig1 that there is a risk that information relating to the relaying stage number is leaked based on the rrep signal packet length . it is enough that the contents of the rrep signal is recognized by the transmitting node s and the receiving node d , third party does not have to identify . an example where the rrep signal is hidden as much as possible is explained below . fig1 shows an example where the rrep signal is hidden as much as possible . operation ( especially portions different from the above example ) is explained below . the receiving node d performs the following processing in order to create the rrep signal . in place of the rrep , the receiving node d adds a second identification field ( rrep / data ), which only the transmitting node s can distinguish between the rrep and data . dummy information ( random number ) padding is added ( dummy padding in fig1 ). a length field is added to set the length excluding the dummy padding . the second identification field , the dummy padding and the length field are mask - patterned . the transmitting node s receives the rrep / data , removes the mask pattern set by the receiving node d , and performs the following processing . fig1 shows a sixth embodiment of the present invention . the sixth embodiment shown in fig1 is an example in which the above examples are all included , and therefore an explanation is omitted . assuming that the relaying node t 2 is a malicious relaying node , the relaying node t 2 may intentionally discard the information about the relaying node t 1 . an example dealing with such malicious act is explained below . with reference to fig1 , by having the information about the relaying node t 1 and the information about the immediately preceding node dummy 2 have inseparable relation , it may be detected that the relaying node t 1 is discarded . as shown in fig1 , the relaying node t 1 block - encrypts the dummy 2 information using a key of k t1 = h ( rand t1 , cert t1 ) based on the information of the relaying node t 1 . a symbol “ rand t1 ” means a random number determined by the transmitting node t 1 , “ cert t1 ” is a certificate of the transmitting node t 1 issued by the certificate issuing unit , “ h ( y )” means a hasche value of y . the relaying node t 2 also block - encrypts the information of the immediately preceding node t 1 using a key of k t2 = h ( rand t2 , cert t2 ) based on the information of the relaying node t 2 . in order to decrypt this encryption , the receiving node d needs to know the correct relaying node information . although this embodiment is explained using dummy , this embodiment can be applied to existing relaying nodes and other variety of structures . not only the immediate precedent node information but also more upstream node information can be encrypted . by having the above structure , even if a malicious relaying node intentionally discards upstream relaying node information , the information of the node immediately before the discarded relaying node is not correctly decrypted . in this manner , the receiving node d can see through such a forged rout . according to the embodiments of the present invention , without increasing processing burdens on relaying nodes , it is possible to prevent a malicious node from forging relaying node information , hide routing information so as to be unforgeable and improve privacy protection for a transmitter and a receiver . communication nodes and ad hoc network routing controlling methods can be utilized in radio or wired communication field requiring secrecy . the present application is based on japanese priority applications no . 2004 - 058072 filed on mar . 2 , 2004 and no . 2004 - 250816 filed on aug . 30 , 2004 with the japanese patent office , the entire contents of which are hereby incorporated by reference . | 7 |
turning now to the drawings wherein like reference characters indicate like or similar parts throughout , fig1 illustrates a winch 10 with a planetary gear drive 12 . fig2 - 4 provide cross section views to better explain the invention . in this case the planetary gear drive 12 has a first , a second and a third planetary gear set 14 , 16 and 18 . the winch 10 has a frame 20 carrying a motor 22 , drum 24 and planetary gear drive 12 . line 26 is wound on the drum 24 . rotational power is transferred from the motor 22 to the planetary gear drive 12 via a drive shaft 28 passing through the hollow center of the drum 24 . the rotational power is transferred from the planetary gear drive 12 . thus the motor 22 can be used to wind and unwind the line 26 from the drum 24 . the drum 24 can also be placed in a free wheel condition by disengaging the clutch 40 . this allows the line 26 to freely unwind from the drum 24 . each of the first , second and third planetary gear set 14 , 16 and 18 have a sun gear 30 with a plurality of planet gears 32 engaging with and orbiting around the sun gear 30 . each planet gear 32 is mounted on the planet carrier 34 by a planet pin 36 . each gear set 14 , 16 and 18 also has a ring gear 38 extending around and engaging with the planet gears 32 . rotational power is transmitted from the first gear set 14 to the second gear set 16 and on to the third gear set 18 in a manner that is well known in the art . when the clutch 40 is disengaged the ring gear 38 of the third gear set 18 is allowed to rotate relative to the frame 20 . thus the rotational power is not transmitted onto the drum 24 . this rotational power can be transmitted to the drum by engaging the clutch 40 . this locks the ring gear 38 of the third gear set 18 relative to the frame 20 of the winch 10 and causes the rotation power to be transferred through the third gear set 18 and into the drum 24 . the clutch 40 can be manually engaged or disengaged through operation of the handle 42 . the frame 20 has a cavity 44 located adjacent to the ring gear 38 of the third gear sets 18 . the exterior surface 46 of the ring gear 38 has one or more cavities 48 which pass next to the cavity 44 in the frame 20 . there is a pin 50 adjacent to the handle 42 such that movement of the handle 42 causes the pin 50 to move into and out of the cavities 44 and 48 . when the pin 50 is extended it fits into the cavities 44 and 48 . this locks the ring gear 18 stationary relative to the frame 20 and places the clutch 40 in the engaged position . the rotational power is then transferred to rotating the drum 24 either in or out . the planet carrier 34 of the second gear set 16 has a clutch actuator finger 52 . the finger 52 is located such that as the planet carrier 34 of the second gear set 16 rotates it contacts the clutch actuator 54 . this moves the pin 50 into the engaged position such that the ring gear 38 of the third gear set 18 is locked relative to the frame 20 of the winch 10 . thus the clutch 40 is engaged and the motor 22 is engaged with the drum 24 . in the preferred embodiment , the clutch actuator finger 52 is elongated and extends beyond the edge of the planet carrier 34 . it is also cut or stamped from the same material as the planet carrier 34 . thus , when the planet carrier 34 is formed or cut the clutch actuator finger 52 is cut from the same plate or material . further , a plurality of clutch actuator fingers 52 may be located on the planet carrier 34 . thus , the planet carrier 34 would only have to rotate a fraction of a revolution before one of the clutch actuator fingers 52 contacts the clutch actuator 54 and engages the clutch 40 . for example , if there are two clutch actuator fingers 52 , the planet carrier 34 does not have to rotate more than 180 degrees before the clutch 40 is engaged . if there are four clutch actuator fingers 52 , the planet carrier 34 does not have to rotate more than 90 degrees before the clutch 40 is engaged . the foregoing description details certain preferred embodiments of the present invention and describes the best mode contemplated . it will be appreciated , however , that changes may be made in the details of construction and the configuration of components without departing from the spirit and scope of the disclosure . therefore , the description provided herein is to be considered exemplary , rather than limiting , and the true scope of the invention is that defined by the following claims and the full range of equivalency to which each element thereof is entitled . | 1 |
the package shown in these drawings essentially comprises a container 1 , namely in this instance a bottle of polyethylene having elastically terminating in a plug 3 at the end nearest the container 1 and in a delivery nozzle 18 at the other end is inserted in the neck 2 of said container in an axial sliding movement . a cap 26 which covers the unit is screwed on the exterior of the neck 2 . the lock - chamber 4 is constituted by a tubular body 7 of revolution , the crenellated base 31 of which is provided internally with an annular peripheral bearing shoulder 10 for a first filter element or upstream filter element 8 which may be constituted by a perforated membrane , a woven fabric element or a sintered plate , as well as a snap - action engagement groove 11a for the plug 3 . the plug 3 has the same external diameter as the tubular body 7 and forms an extension of this latter . its end face is full whilst its opposite face , namely the face located opposite to the first filter element 8 , has an annular peripheral edge 12 located opposite to the annular shoulder 10 of the body 7 . radial channels 13 cut in said peripheral edge open externally opposite to the crenellated recesses 31 of the body 7 and internally into a set - back axial face studded with villosities 22 . intercommunicating channels 24 formed between said villosities ensure that the liquid flows freely beneath the first filter element from or towards the radial channels 13 . the crenellated edge 12 of the plug has an external diameter which is slightly smaller than the internal diameter of the crenellated recesses 31 so as to form a peripheral collector duct 34 of the channels 13 . the periphery of the first filter element 8 is thus maintained applied in fluid - tight manner against the annular shoulder 10 of the body 7 by means of the peripheral edge 12 of the plug 3 which is snap - actingly engaged by means of a lateral peripheral rib 11b in the groove 11a at the end of the body 7 . moreover , the entire remaining portion of its surface on the side nearest the container 1 is held in position by the villosities 22 of the plug 3 . at the end remote from the plug 3 , the body 7 terminates internally in a flared - out portion 14 and externally in an annular flange 15 , the external radial face 16 of which forms a fluid - tight annular support for the periphery of a second filter element or downstream filter element 5 which may be constituted by a microporous membrane or a bacteriological filter . the external lateral face of the annular flange 15 has a circular groove 17a which cooperates with an internal peripheral rib 17b of the pipe of the delivery nozzle 18 in order to ensure snap - on engagement of this latter . the nozzle 18 has an axial delivery duct 21 , one end of which opens to the exterior and the other end of which has its opening at the center of a face studded with villosities 23 between which are formed interconnecting channels 20 . said face is surrounded by a peripheral annular shoulder 19 forming a fluid - tight annular support for the periphery of the second filter element 5 located opposite to the external radial face 16 of the body 7 . the second filter element 5 is thus maintained in fluid - tight manner , by means of its periphery , between the body 7 and the nozzle 18 which are snap - fastened to each other . in addition , said element is supported by the villosities 23 over the remainder of its surface and the liquid can flow freely through the element from or towards the delivery duct 21 . between the first filter element 8 , the second filter element 5 and the internal wall of the body 7 , there is delimited an enclosure forming a lock - chamber 4 which may be filled either partially or completely with a soluble or insoluble substance for modifying the liquid 32 to be delivered . the substance considered may be a salt or a lyophilizate or a purifying substance . fluid - tightness of the unit consisting of lock - chamber 4 and plug 3 within the neck is ensured at each end of neck 2 in the storage position ( fig1 b ) by means of peripheral annular ribs 9a of the plug 3 and 9c of the body 7 and in the position of use ( fig2 ) by means of peripheral annular ribs 9b and 9d of the body 7 . the length of the unit consisting of lock - chamber 4 and plug 3 is such that , in the storage position ( fig1 b ), the base of the plug 3 practically does not project beyond the inner edge of the neck 2 within the container 1 whereas in the position of use ( fig2 ), the plug 3 penetrates into the interior of the container 1 to a sufficient depth to ensure that the channels 13 open freely beneath the inner edge of the neck 2 whereas the bottom radial edge of the annular flange 15 is abuttingly applied on the outer edge 25 of the container neck 2 . in a position of use ( fig2 ), the peripheral edge of the nozzle 18 is applied against the outer edge 25 of the container neck without any interruption of continuity , which thus prevents any possibility of gripping and inopportunely returning the lock - chamber / plug unit to the storage position ( fig1 b ). by way of alternative , the edge of the nozzle could be fitted in an annular recess in the edge of the neck . the cap 26 is screwed onto the threaded outer edge of the neck 2 of the container 1 . its internally threaded skirt has an extension in the form of a breakable guarantee ring 29 which can readily be torn - off for initial use of the package . during storage , said guarantee ring 29 is normally in abutment with the neck base 33 of the container ( fig1 b ) in order to prevent any untimely screwing towards the position of use ( fig2 ). an axial stud 27 seals off the delivery duct 21 of the nozzle 18 whilst an internal annular extension 28 bears on the external face of the nozzle 18 . when the guarantee ring 29 has been torn - off , the cap 26 is screwed - down by hand and produces the downward displacement of the unit consisting of nozzle 18 , lock - chamber 4 and plug 3 until the annular flange 15 abuts against the edge 25 of the neck , thus determining the position of use ( fig2 ) whilst the delivery duct 21 remains closed by the stud 27 . it is then possible to unscrew and remove the cap 26 from the package without displacing the unit consisting of nozzle 18 , lock - chamber 4 and plug 3 . the liquid 32 within the container 1 can then be delivered by pressing the walls in order to force it through the lock - chamber 4 and its filter elements 8 and 5 and in order to deliver it through the duct 21 of the nozzle 18 . in the event of fractional deliveries of liquid , the cap 26 is replaced in position , thus isolating the lock - chamber 4 and consequently the container 1 from the exterior . the air sucked - in by elastic return of the container walls is filtered by the filter elements 5 and 8 and also by the substance 6 which may be enclosed within the lock - chamber , and protects the remaining liquid 32 from any pollution , as well as the interior of the lock - chamber . the alternative embodiments shown in fig8 and 9 relate to a package primarily intended for applications in which it is desired that the interior of the lock - chamber 4 should be isolated from the interior of the container 1 between different periods of use irrespective of the position in which the package is stored . the figures illustrating these alternative embodiments are schematic and the filter elements are not shown in these figures for reasons of clarity . the package of fig8 comprises a lock - chamber 4 associated with a closure device with axial translational motion within the smooth - walled neck 2 of a container 1 . at its outer end , the lock - chamber 4 is covered by a welded , bonded or screwed conical end - piece 35 terminating in an axial nozzle 36 which can be sealed - off at will by means of a conventional cap 37 , said end - piece being such as to constitute gripping means enabling a user to impart a movement of translation to the unit consisting of lock - chamber 4 and plug 38 . the inner end of the lock - chamber 4 constituted by the plug 38 is slidably mounted in a blind end - piece 39 snap - fastened in an internal annular flange 40 derived from the neck base of the container 1 and provided with lateral openings 41 in the vicinity of the blind end - wall . the plug 38 is provided at its outer end with an externally - fitted frusto - conical annular flange 38a whilst the blind - end wall of the end - piece 39 is provided internally with a conicity which is complementary to that of the flange 38a of the plug 38 . the respective dimensions of the plug 38 within the blind end - piece 39 and their displacement are such that , when the unit consisting of end - piece 35 , lock - chamber 4 and plug 38 is moved downwards to the full extent within the blind end - piece 39 and the base of the end - piece 35 is abuttingly applied against the end of the neck 2 , the plug 38 shuts - off the openings 41 and isolates the interior of the container 1 from the lock - chamber 4 and from the exterior , as shown in the right - hand half - view of fig8 . on the other hand , when the end - piece assembly 35 is pulled outwards and the plug 38 is abuttingly applied against the base of the neck 2 , the openings 41 are freed , the interior of the container communicates freely with the lock - chamber 4 and the nozzle 36 opens to the exterior after removal of the cap 37 , as shown in the left - hand half - view of fig8 . fig9 illustrates another alternative embodiment of the package in accordance with the invention and of the obturator in which a lock - chamber 4 is associated with a rotational closure device within the inverted neck 42 of a container 1 . the lock - chamber 4 is limited by a body 43 closed by a snap - fastened conical end - piece 44 terminating in an axial delivery nozzle 45 which can be closed at will by means of a conventional cap 46 . the plug 47 is provided with open portions and with an internal annular shoulder 48 on which is applied the peripheral edge of an upstream filter element , the bottom central face of which is thus freed from the end - wall of the plug 47 . an axial stud 49 extending from the plug 47 is latched in rotation in a wall 50 which partly shuts - off the inner end of the inverted neck 42 . the wall 50 and the plug 47 of the body 43 are provided with identical openings 51 , 52 respectively in circular arcs of less than 180 degrees ( 90 degrees , for example ) which can be moved at will by rotation of the body 43 , either opposite to each other so as to cause the interior of the container 1 to communicate with the lock - chamber 4 and with the exterior via the nozzle 45 after removing the cap 46 , or each and respectively opposite to the plug 47 of the body 43 and to the wall 50 of the inverted neck 42 in order to isolate the interior of the container 1 from the lock - chamber 4 and from the exterior , as shown in fig9 . irrespective of the mode of utilization of the lock - chambers 4 , it is imperative to ensure that the assemblies have seals such that the liquid cannot flow in any direction other than through the lock - chamber . this can be achieved in accordance with conventional practice by means of ribbed lips , beaded edges or elastic seals . fig1 illustrates a preferred embodiment of the package in accordance with the invention in which the unit consisting of lock - chamber 4 and plug 3 is formed in a single piece by a tubular body 7 . the plug 3 constituting that end of the body 7 which is intended to communicate with the interior of the container 1 has a chamber 53 for receiving a product to be mixed with the liquid within the container 1 during initial setting of the package in the position of use . this chamber 53 has a first lateral opening 54 in the periphery of the body 7 at the level of the plug 3 between two peripheral annular ribs 9a , 9b of the body 7 , the rib 9a being applied in fluid - tight manner against the internal periphery of the neck 2 of the container 1 in the storage position of the unit consisting of lock - chamber 4 and plug 3 and the rib 9b being applied in fluid - tight manner against the internal periphery of the neck 2 , irrespective of the position of the unit comprising lock - chamber 4 and plug 3 . an additional peripheral annular rib 9d of the body 7 is provided for perfecting fluid - tightness in the position of use and for ensuring that fluid - tightness is achieved irrespective of the position of use or of storage , by means of two ribs . a second opening 55 of the chamber 53 provides an access to the lock - chamber 4 opposite to an upstream filter element 8 . once the product contained in the chamber 53 has been mixed with the liquid , this second opening serves to establish a communication between the interior of the container 1 and the lock - chamber 4 by means of the chamber 53 which accordingly performs the function of the channels 13 of the embodiment shown in fig1 a , 1b to 5 . the package illustrated in fig1 is also provided with a nozzle 18 having an axial delivery duct 21 , one end of which opens to the exterior whilst the other end has its opening at the center of a face studded with villosities 23 forming intercommunicating channels 20 . said face is surrounded by a peripheral annular shoulder 19 which forms a fluid - tight annular support for the periphery of a downstream filter element 5 opposite to the external radial face 16 of the body 7 . the separation between the lock - chamber 4 and the plug 3 is constituted by a fluid - tight annular shoulder 10 which supports the upstream filter element 8 at the periphery and which forms the opening 55 . a cap which is similar to that described with reference to fig1 a , 1b to 5 and which performs the same function is provided for covering the entire assembly . all the elements of the package can be readily formed by molding identical or different plastic materials or else can be made of various machined materials . the invention is naturally not limited in any sense to the particular features specified in the foregoing or to the details of the particular embodiment which has been chosen in order to illustrate the invention . consideration can be given to all kinds of variants of the particular embodiment which has been described by way of example and of its constituent elements without thereby departing from the scope of the invention . this invention accordingly includes all the means constituting technical equivalents of the means described as well as their combinations . | 0 |
particular embodiments of the present disclosure will be described below with reference to the accompanying drawings . in the following description , well - known functions or constructions are not described in detail to avoid obscuring the present disclosure in unnecessary detail . those skilled in the art will understand that embodiments of the present disclosure may be adapted for use with any electrosurgical system , generator , and / or instrument . it should also be appreciated that different electrical and mechanical connections and other considerations may apply to each particular type of instrument . briefly , an overlapping shield assembly according to the present disclosure is described below with respect to shielding planar magnetic devices in an electrosurgical generator . although the present disclosure is described with respect to an electrosurgical generator , it is envisioned that the overlapping shield assembly may be utilized with any planar magnetic device in any electronic device in which emi protection is desired . the electrosurgical generator according to the present disclosure may be used in monopolar and / or bipolar electrosurgical procedures , including , for example , cutting , coagulation , ablation , and vessel sealing procedures . the generator may include a plurality of outputs for interfacing with various electrosurgical instruments ( e . g ., monopolar instruments , return electrode pads , bipolar electrosurgical forceps , footswitches , etc .). further , the generator may include electronic circuitry configured to generate radio frequency energy specifically suited for powering electrosurgical devices operating in various electrosurgical modes ( e . g ., cut , blend , coagulate , division with hemostasis , fulgurate , spray , etc .) and procedures ( e . g ., monopolar , bipolar , vessel sealing ). referring to fig1 , an electrosurgical system 10 according to the present disclosure includes one or more monopolar electrosurgical instruments 20 having one or more active electrodes 23 ( e . g ., electrosurgical cutting probe , ablation electrode ( s ), etc .) for treating tissue of a patient . electrosurgical alternating rf current is supplied to the instrument 20 by a generator 200 via a supply line 24 that is connected to an active terminal 350 ( fig3 ) of the generator 200 , allowing the instrument 20 to cut , coagulate , and / or otherwise treat tissue . the rf current is returned to the generator 200 through a return electrode pad 26 via a return line 28 at a return terminal 352 ( fig3 ) of the generator 200 . for monopolar operation , the system 10 may include a plurality of return electrode pads 26 that , in use , are disposed on a patient to minimize the chances of tissue damage by maximizing the overall contact area with the patient . in addition , the generator 200 and the return electrode pads 26 may be configured for monitoring tissue - to - patient contact to ensure that sufficient contact exists therebetween . the system 10 may also include one or more bipolar electrosurgical instruments , for example , a bipolar electrosurgical forceps 30 having one or more electrodes for treating tissue of a patient . the electrosurgical forceps 30 includes a housing 31 and opposing jaw members 33 and 35 disposed at a distal end of a shaft 32 . the jaw members 33 and 35 have one or more active electrodes 34 and a return electrode 36 disposed therein , respectively . the active electrode 34 and the return electrode 36 are connected to the generator 200 through cable 38 that includes the supply and return lines 24 , 28 , which may be coupled to the active and return terminals 350 , 352 , respectively ( fig3 ). the electrosurgical forceps 30 is coupled to the generator 200 at a port having connections to the active and return terminals 350 and 352 ( e . g ., pins ) via a plug ( not shown ) disposed at the end of the cable 38 , wherein the plug includes contacts from the supply and return lines 24 , 28 as described in more detail below . with reference to fig2 , a front face 240 of the generator 200 is shown . the generator 200 may include a plurality of ports 250 - 262 to accommodate various types of electrosurgical instruments ( e . g ., monopolar electrosurgical instrument 20 , electrosurgical forceps 30 , etc .). the generator 200 includes a user interface 241 having one or more display screens 242 , 244 , 246 for providing the user with variety of output information ( e . g ., intensity settings , treatment complete indicators , etc .). each of the screens 242 , 244 , 246 is associated with a corresponding port 250 - 262 . the generator 200 includes suitable input controls ( e . g ., buttons , activators , switches , touch screen , etc .) for controlling the generator 200 . the screens 242 , 244 , 246 are also configured as touch screens that display a corresponding menu for the instruments ( e . g ., electrosurgical forceps 30 , etc .). the user can adjust inputs by simply touching corresponding menu options . screen 242 controls monopolar output and the devices connected to the ports 250 and 252 . port 250 is configured to couple to a monopolar electrosurgical instrument ( e . g ., electrosurgical instrument 20 ) and port 252 is configured to couple to a foot switch ( not shown ). the foot switch provides for additional inputs ( e . g ., replicating inputs of the generator 200 ). the port 254 is configured to couple to the return electrode pad 26 . screen 244 controls monopolar and bipolar output and the devices connected to the ports 256 and 258 . port 256 is configured to couple to other monopolar instruments . port 258 is configured to couple to a bipolar instrument ( e . g ., electrosurgical forceps 30 ). screen 246 controls the electrosurgical forceps 30 that may be plugged into one of the ports 260 and 262 , respectively . the generator 200 outputs energy through the ports 260 and 262 suitable for sealing tissue grasped by the electrosurgical forceps 30 . in particular , screen 246 outputs a user interface that allows the user to input a user - defined intensity setting for each of the ports 260 and 262 . the user - defined setting may be any setting that allows the user to adjust one or more energy delivery parameters , such as power , current , voltage , energy , etc . or sealing parameters , such as energy rate limiters , sealing duration , etc . the user - defined setting is transmitted to a controller 324 ( fig3 ) where the setting may be saved in a memory ( not shown ). in embodiments , the intensity setting may be a number scale , such as for example , from one to ten or one to five . in embodiments , the intensity setting may be associated with an output curve of the generator 200 . the intensity settings may be specific for each electrosurgical forceps 30 being utilized , such that various instruments provide the user with a specific intensity scale corresponding to the electrosurgical forceps 30 . the active and return terminals 350 and 352 ( fig3 ) may be coupled to any of the desired ports 250 - 262 . with reference to fig3 , the generator 200 also includes a controller 324 , a power supply 326 , and a power converter 332 . the power supply 326 may be a high voltage , dc power supply connected to an ac source ( e . g ., line voltage ) and provides high voltage , dc power to the power converter 332 , which then converts high voltage , dc power into rf energy and delivers the energy to the active terminal 350 . ( fig2 ) the energy is returned thereto via the return terminal 352 . in particular , electrosurgical energy for energizing the monopolar electrosurgical instrument 20 and / or electrosurgical forceps 30 is delivered through the active and return terminals 350 and 352 . the active and return terminals 350 and 352 are coupled to the power converter 332 through an isolation transformer 340 . more specifically , the isolation transformer 340 includes a primary winding 340 a coupled to the power converter 332 and a secondary winding 340 b having an active lead 342 coupled to the active terminal 350 and a return lead 344 coupled to the return terminal 352 . the output of power converter 332 transmits current through the isolation transformer 340 to the load “ z ”, e . g ., tissue being treated . the power converter 332 is configured to operate in a plurality of modes , during which the generator 200 outputs corresponding waveforms having specific duty cycles , peak voltages , crest factors , etc . it is envisioned that in other embodiments , the generator 200 may be based on other types of suitable power supply topologies . power converter 332 may be a resonant rf amplifier or a non - resonant rf amplifier . a non - resonant rf amplifier , as used herein , denotes an amplifier lacking any tuning components , e . g ., inductors , capacitors , etc ., disposed between the power converter and the load “ z ” intended to establish a fixed operating frequency . the controller 324 includes a processor ( not shown ) operably connected to a memory ( not shown ), which may include one or more of volatile , non - volatile , magnetic , optical , or electrical media , such as read - only memory ( rom ), random access memory ( ram ), electrically - erasable programmable rom ( eeprom ), non - volatile ram ( nvram ), or flash memory . the processor may be any suitable processor ( e . g ., control circuit ) adapted to perform the operations , calculations , and / or set of instructions described in the present disclosure including , but not limited to , a hardware processor , a field programmable gate array ( fpga ), a digital signal processor ( dsp ), a central processing unit ( cpu ), a microprocessor , and combinations thereof . those skilled in the art will appreciate that the processor may be substituted for by using any logic processor ( e . g ., control circuit ) adapted to perform the calculations and / or set of instructions described herein . the controller 324 includes output ports that are operably connected to the power supply 326 and / or the power converter 332 allowing the controller 324 to control the output of the generator 200 according to either open and / or closed control loop schemes . a closed loop control scheme is a feedback control loop , in which a plurality of sensors measure a variety of tissue and energy properties ( e . g ., tissue impedance , tissue temperature , output power , current and / or voltage , etc . ), and provide feedback to the controller 324 . the controller 324 then controls the power supply 326 and / or the power converter 332 , which adjusts power delivered to and / or from the power converter 332 , respectively . the controller 324 also receives input signals from the input controls of the generator 200 , the electrosurgical instrument 20 and / or electrosurgical forceps 30 . the controller 324 utilizes the input signals to adjust power outputted by the generator 200 and / or performs other control functions thereon . the controller 324 may perform various mathematical computations in order to control the power supply 326 and / or the power converter 332 to generate an rf waveform having a desired shape and energy content . examples of computations performed by the controller 324 include , but are not limited to , calculating instantaneous and / or root mean square power levels , amount of energy delivered on a cycle by cycle basis , load impedance , etc . the generator 200 according to the present disclosure may also include a plurality of sensors , namely , a voltage sensor 336 and a current sensor 338 . the voltage sensor 336 is coupled to the active and return leads 342 , 344 and measure rf voltage supplied to the active and return terminals 350 , 352 . the current sensor 338 is coupled to the active and / or return leads 342 , 344 and measures rf current supplied to the active and return terminals 350 , 352 . in embodiments , the generator 200 may also include additional sensors ( not shown ) coupled to the power supply 326 . with reference to fig4 and 5 , the current sensor 338 includes a planar magnetic device 460 , e . g ., a current sense coil , which is disposed on a printed circuit board (“ pcb ”) 400 . the pcb 400 may be a multilayer pcb formed from any suitable dielectric material , including , but not limited to composite materials composed of woven fiberglass cloth with an epoxy resin binder such as fr - 4 grade as designated by the national electrical manufacturers association . the pcb 400 defines an opening 402 therethrough for passage of the active lead 342 . the planar magnetic device 460 includes an outer coil 470 and an inner conductor 472 . the outer coil 470 is formed by a plurality of upper and lower conductive traces 470 a and 470 b interconnected by a plurality of inner conductive vias 470 c and outer conductive vias 470 d . the upper and lower conductive traces 470 a and 470 b may be printed on respective upper and lower surfaces 400 a , 400 b ( fig5 ) of the pcb 400 . the inner conductor 472 is disposed in between the upper and lower conductive traces 470 a and 470 b and is embedded within the pcb 400 ( fig5 ). fig6 shows an overlapping shield assembly 500 disposed over the upper surface 400 a of the pcb 400 . the overlapping shield assembly 500 includes a first layer 502 and a second layer 504 , which are separated by one or more dielectric layers 400 c , 400 d , . . . 400 n of the pcb 400 . in embodiments , the overlapping shield assembly 500 may also be disposed on the bottom surface 400 b of the pcb 400 . in other embodiments , the overlapping shield assembly 500 may be disposed internally , i . e ., within the planar magnetic device 460 , namely , between the upper conductive traces 470 a and lower conductive traces 470 b . this configuration provides significant internal device e - field shielding and isolation and is suitable to control crosstalk and leakage currents . in further embodiments , the first layer 502 may be disposed on the upper surface 400 a of the pcb 400 and the second layer 504 may be disposed on the lower surface 400 b of the pcb 400 . a single layer of shielding ( e . g ., the first layer 502 or the second layer 504 ) may be on each surface 400 a , 400 b of the pcb 400 and may provide sufficient e - field shielding and may be adequate for many applications . in additional embodiments , a pair of overlapping shield assemblies 500 may be disposed on the pcb 400 , one on each surface 400 a , 400 b , respectively , to provide an additional order of magnitude of shielding . with reference to fig6 - 9 , the first and second layers 502 and 504 may be formed as conductive traces on their corresponding dielectric layers 400 c and 400 d ( fig6 ) of the pcb 400 . thus , the first layer 502 is disposed in a first plane “ a - a ” and the second layer 504 is disposed in a second plane “ b - b ” ( fig6 ). each of the layers 502 and 504 includes a plurality of strips 506 and 508 , respectively . the strips 506 and 508 are arranged in parallel with periodic gaps 510 and 512 that are defined therebetween . as shown in fig7 , the strips 506 of the first layer 502 have a strip width s 1 and the gaps 510 have a gap width w 1 . similarly , the strips 508 of the second layer 504 have a strip width s 2 and the gaps 512 have a gap width w 2 . the strip width s 1 of the strips 506 is substantially equal to the gap width w 2 of the gaps 512 of the second layer 504 and conversely , strip width s 2 of the strips 508 is substantially equal to the gap width w 1 of the gaps 510 of the first layer 502 . this configuration allows for the strips 506 , 508 and the gaps of 510 , 512 to overlap , respectively , thus forming an emi shield . strip widths s 1 or s 2 may be from about 0 . 1 millimeters ( mm ) to about 10 mm , in embodiments from about 1 mm to about 5 mm . since gap widths w 1 and w 2 are related to the strip widths s 1 and s 2 , gap widths w 1 and w 2 may also have the same dimensions . in further embodiments , the strip width s 1 or s 2 of each of the strips 506 and 508 may be different , i . e ., have a non - uniform width . each of the first layer 502 and the second layer 504 also includes a perimeter conductor 514 and 516 , respectively . the perimeter conductor 514 is coupled to each of the strips 506 of the first layer and the perimeter conductor 516 is coupled to each of the strips 508 of the second layer 504 . in addition , the first and second layers 502 and 504 are interconnected by one or more conductors 518 to form the emi shield . because the strips 506 and 508 are spaced apart , i . e ., do not form a continuous conductive surface across one plane “ a - a ” or “ b - b ,” respectively , and are open ended , they do not form a complete circuit for stray current to flow therethrough . furthermore , because the strips 506 and 508 are relatively narrow , eddy currents , also known as foucalt currents , do not have a significant impact . however , because the first and second layers 502 and 504 are separated by one or more pcb layers of the pcb 400 , the height between the layers is comparatively small , thereby forming a continuous surface when viewed along an axis “ c - c ,” which is transverse with respect to each of the planes “ a - a ” and “ b - b ” ( fig6 ). put differently , the first and second layers 502 and 504 complement each other to form , i . e ., complete , the overlapping shield assembly 500 . while several embodiments of the disclosure have been shown in the drawings and / or described herein , it is not intended that the disclosure be limited thereto , as it is intended that the disclosure be as broad in scope as the art will allow and that the specification be read likewise . therefore , the above description should not be construed as limiting , but merely as exemplifications of particular embodiments . those skilled in the art will envision other modifications within the scope of the claims appended hereto . | 0 |
fig1 illustrates selected portions of an example gas turbine engine 10 , such as a gas turbine engine 10 used for propulsion . the gas turbine engine 10 is circumferentially disposed about an engine centerline 12 . in this example , the engine 10 includes an inlet section 13 having a first fan 14 a and a second fan 14 b . a compressor section 16 , a combustion section 18 , and a turbine section 20 are located downstream from the inlet section 13 . the fan 14 b is decoupled from the fan 14 a , as disclosed for example in co - pending application ser . no . 11 / 977 , 874 filed oct . 26 , 2007 , now u . s . pat . no . 8 , 028 , 513 issued on oct . 4 , 2011 ( pa - 2618 ). for example , the fan 14 b is mounted to an outer shroud ( not shown ) outboard of the fan 14 a to enable the fans 14 a and 14 b to rotate at different speeds . in this example , the fan 14 a is coupled in a known manner with the turbine section 20 , such as through a low spool shaft of the engine 10 . an electric drive may be used to drive the fan 14 b at a different speed than the fan 14 a . in other examples , the engine 10 may be modified from the illustrated example , depending on the type of engine and its intended use . as is known , air compressed in the compressor section 16 is mixed with fuel that is burned in the combustion section 18 to produce hot combustion stream that is expanded in the turbine section 20 to drive the fans 14 a and 14 b . fig1 is a somewhat schematic presentation for illustrative purposes only and is not a limitation on the disclosed examples . the example engine 10 includes a cooling arrangement 28 having a core passage 30 , a first airflow source 32 , and a second airflow source 34 that receive inlet air 37 that enters the engine 10 . in this example , the first airflow source includes a first bypass passage 39 a , and the second airflow source 34 includes a second bypass passage 39 b . the inlet section 13 divides the inlet air 37 between the core passage 30 , the first bypass passage 39 a , and the second bypass passage 39 b . the compressor section 16 , the combustion section 18 , and the turbine section 20 are included at least partially within the core passage 30 . in the disclosed example , the first bypass passage 39 a is located radially outwards of the core passage 30 relative to the engine centerline 12 , and the second bypass passage 39 b is located radially outwards of the first bypass passage 39 a relative to the engine centerline 12 . the core passage 30 , the first bypass passage 39 a , and the second bypass passage 39 b each terminate at an engine exhaust section 36 , such as an exhaust nozzle . in this example , the engine exhaust section 36 includes a convergent section 38 and a divergent section 40 for discharging an exhaust flow from the core passage 30 . the first bypass passage 39 a includes a first outlet 42 located at the divergent section 40 and another outlet 44 located axially forward of the divergent section 40 at the convergent section 38 . each of the outlets 42 and 44 of the first bypass passage 39 a may include a plurality of film cooling slots 46 that provide a fluid connection between the first bypass passage 39 a and the core passage 30 . the second bypass passage 39 b also includes an outlet 48 that is located at the divergent section 40 of the engine exhaust section 36 and that is axially aft of the outlets 42 and 44 of the first bypass passage 39 a . it is to be understood that relative positional terms such as “ forward ,” “ aft ,” “ upper ,” “ lower ,” “ above ,” “ below ,” and the like are with reference to the normal operational attitude of the vehicle and should not be considered otherwise limiting . the cooling arrangement 28 also includes a heat exchanger 54 that is thermally connected with the first bypass passage 39 a and the second bypass passage 39 b . in this example , the heat exchanger 54 includes a plurality of heat pipes 56 each having one end that is at least partially within the first bypass passage 39 a and another end that is at least partially within the second bypass passage 39 b . alternatively , other types of heat exchangers may be used . given this description , one of ordinary skill in the art will recognize suitable types of heat exchangers to meet their particular needs . in operation , the engine 10 receives inlet air 37 into the inlet section 13 . the inlet section 13 divides the inlet air into a core flow 60 , a first airflow 62 , and a second airflow 64 . the core flow 60 flows through the core passage 30 , the first airflow 62 flows through the first bypass passage 39 a , and the second airflow 64 flows through the second bypass passage 39 b . the core flow 60 is utilized for combustion within the combustion section 18 . the engine 10 utilizes the first airflow 62 and the second airflow 64 for cooling the engine exhaust section 36 . in the disclosed example , the first airflow 62 and the second airflow 64 have different associated air pressures and temperatures . for example , the first airflow 62 has a first temperature and a first pressure , and the second airflow 64 has a second temperature that is less than the first temperature and a second pressure that is less than the first pressure . the difference in temperature and pressure may be controlled using the fans 14 a and 14 b , such as by controlling fan speed of each fan 14 a and 14 b . the first airflow 62 and the second airflow 64 stream over the heat pipes 56 of the heat exchanger 54 . the heat pipes 56 transfer heat from the first airflow 62 to the second airflow 64 to thereby cool the first airflow 62 . the cooled first airflow 62 is then discharged through the outlet 42 to cool the divergent section 40 of the engine exhaust section 36 . in the illustrated example , the obstruction caused by the heat pipes 56 within the first bypass passage 39 a causes a natural pressure loss of the first airflow 62 . the pressure loss provides the benefit of reducing liner blow - off loads to the divergent section 40 . in some instances , it may be possible to directly use the second airflow 64 for cooling ; however , if the second pressure of the second airflow 64 is relatively low , it may not be suitable for direct cooling of the engine exhaust section 36 , for example . in the illustrated example , a portion of the first airflow 62 is also discharged through the outlet 44 to cool the convergent section 38 . the second airflow 64 is discharged through the outlet 48 at the divergent section 40 to provide additional cooling of the divergent section 40 . the disclosed cooling arrangement 28 thereby utilizes the different temperature of the first and second airflows in the heat exchanger 54 to provide cooled air to the divergent section 40 of the engine exhaust section 36 . using air - to - air heat exchange in combination with the first and second bypass flows may provide the benefit of avoiding or eliminating heat exchangers that utilize somewhat more complex circulatory coolant systems . additionally , the added cooling provided by the “ cooled ” first airflow 62 may permit the use of other materials within the engine exhaust section 36 . for example , the additional cooling may allow the use of lighter weight or less expensive alloy or organic composite materials . as will now be described , at least the second airflow source 34 need not be a bypass passage as in the previous example . fig2 illustrates another example in which like components are represented with like reference numerals . in this example , a gas turbine engine 100 includes a second airflow source 134 having an external airflow scoop 102 . the external airflow scoop 102 extends radially outwards from an outer perimeter 104 of the engine 100 , such as on an outer cowl or nacelle . the external airflow scoop 102 is connected with a passage 106 that receives an inlet airflow 137 that flows around the outer perimeter 104 . in operation , the inlet air 137 flows into the inlet section 13 and around the outer perimeter 104 of the engine 100 . the inlet section 13 divides the inlet air 137 into a core flow 60 and a first airflow 62 , and the external airflow scoop 102 directs at least a portion of the inlet airflow 137 into the passage 106 as a second airflow 164 that then flows over the heat pipes 56 of the heat exchanger 54 . similar to the example of fig1 , the first airflow 62 and the second airflow 164 have different associated air pressures and temperatures and stream over the heat pipes 56 of the heat exchanger 54 to subsequently cool the divergent section 40 of the engine exhaust section 36 as previously described . fig3 illustrates another example in which like components are represented with like reference numerals . in this example , a gas turbine engine 200 includes a second airflow source 234 having an auxiliary power unit 202 . for example , the auxiliary power unit 202 may be used to provide compressed air to start the engine 200 . in this regard , a passage 204 a connects the auxiliary power unit 202 to the engine 200 . a valve 206 is disposed within the passage 204 a . the valve 206 is operative to direct flow through the passage 204 a between the engine 200 and another passage 204 b that is thermally connected with the heat exchanger 54 . in operation , the inlet air 237 flows into the inlet section 13 , which divides the inlet air 237 into a core flow 60 and the first airflow 62 . the auxiliary power unit 202 produces a second airflow 262 that flows through the passage 204 a . when the valve 206 is in a first position , the second airflow 262 continues to flow through the passage 204 a to the engine 200 for the starting function . however , when the valve 206 is moved to a second position , the second airflow 262 flows through the passage 204 b and over the heat pipes 56 of the heat exchanger 54 . similar to the example of fig1 , the first airflow 62 and the second airflow 264 have different associated air pressures and temperatures and stream over the heat pipes 56 of the heat exchanger 54 to subsequently cool the divergent section 40 of the engine exhaust section 36 as previously described . thus , as disclosed by the examples herein , the heat exchanger 54 may be used in combination with the first airflow 62 from the first airflow source 32 and a second airflow ( e . g ., 62 , 162 , and 262 ) from a second airflow source ( e . g ., 34 , 134 , and 234 ) to cool the divergent section 40 of the engine exhaust section 36 , or even other sections of an engine . as can be appreciated , the source of the second airflow is not limited to any particular source and may be any airflow from any airflow source that is relatively cooler than the first airflow 60 . fig4 illustrates an example of one of the heat pipes 56 . in this example , the heat pipe 56 includes a sealed hollow tube 70 that contains a coolant 72 , such as water , ethylene glycol , methane , liquid sodium , or other suitable coolant . the heat pipe 56 includes a first end 74 that is thermally connected with the first bypass passage 32 , and a second end 76 that is thermally connected with the second bypass passage 34 . the interior of the heat pipe 56 defines a cooling circuit 78 for transporting the coolant 72 in an evaporated and liquid state . in the disclosed example , the heat pipe 56 includes a porous material 80 that facilitates transport of the coolant 72 , such as by using capillary forces . operationally , the coolant 72 transfers heat from the warmer first bypass flow 62 at the first end 74 to the relatively cooler second bypass flow 64 at the second end 76 . the coolant absorbs heat from the first bypass flow 62 and evaporates into vapor . the evaporated coolant 72 then moves through the open central portion of the heat pipe 56 toward the second end 76 . at the second end 76 , the second bypass flow 64 cools the evaporated coolant 72 and condenses it into a liquid , thereby rejecting the heat into the second bypass flow 64 . the porous material 80 then transports the condensed coolant 72 using capillary forces toward the first end 74 for another cooling cycle . in this manner , the coolant transfers the heat from the warmer first bypass flow 62 to the second bypass flow 64 . additionally , the heat pipe 56 provides the benefit of passive heat transfer . that is , the heat exchanger 54 operates without mechanical assistance , such as without a mechanical pump or the like . although a combination of features is shown in the illustrated examples , not all of them need to be combined to realize the benefits of various embodiments of this disclosure . in other words , a system designed according to an embodiment of this disclosure will not necessarily include all of the features shown in any one of the figures or all of the portions schematically shown in the figures . moreover , selected features of one example embodiment may be combined with selected features of other example embodiments . the preceding description is exemplary rather than limiting in nature . variations and modifications to the disclosed examples may become apparent to those skilled in the art that do not necessarily depart from the essence of this disclosure . the scope of legal protection given to this disclosure can only be determined by studying the following claims . | 5 |
[ 0014 ] fig1 shows the structure of a transceiver , which is formed by a transmission path se and a reception path em — each indicated by a dashed - dotted rectangle — for a multicarrier frequency signal . a multicarrier signal such as this is used for the ofdm ( orthogonal frequency division multiplex ) transmission method . in this case , a bit stream bs to be transmitted is stored in blocks in a coder cod , and the individual bits in a block are distributed optimally between the n carrier frequencies or n sub - channels . the distributed bits in the n sub - channels are mapped by means of the coder cod onto n complex sub - symbols nfb — frequency domain . the n complex sub - symbols are then transformed by means of inverse fourier transformation ( inverse fast fourier transform )— generally in the form of an integrated circuit ifft — to n reel sample values ntb — discrete time domain , and are converted by means of a parallel / serial converter psc to a serial format , forming a transmission block σtb . a time interval or a prefix cp is placed in front of the serial digital transmission block stb in a unit add and , after digital / analog conversion by means of a digital / analog converter dac , is sent as an analog transmission signal x ( t ) to a transmission channel or to the transmission medium — not shown . the prefix cp represents a guard interval between successive transmission blocks tb , and contains a predetermined number of sample values of the preceding transmission block tb . [ 0015 ] fig3 shows a method of operation of the adaptation of a time domain equalizer teq , which operates in accordance with the method according to the invention , in the receiver path . the adaptation is carried out in an adaptation unit adp — see fig1 — with signal processors preferably being used for the determination process . in the method according to the invention , estimated channel impulse responses h chan are in principle used for the adaptation process , with these being determined by means of a suitable estimation method — for example the least square error method as described in golub , van loan : matrix computations , john hopkins university press , 1996 , page 236 . an impulse response h chan for a transmission block tb may , as illustrated in fig2 in principle be broken down to three impulse response elements : a central impulse response element h cent , whose length is equal to the length of the prefix cp plus one sample value , a delay module z npre , z − npost is in each case provided for modeling precursor impulse response element h pre and the postcursor impulse response element h post — see fig1 . the central impulse response element h cent makes a positive contribution to the signal - to - noise ratio , that is it increases the signal - to - noise ratio , while the precursor impulse response element h pre and the postcursor impulse response element h post reduce the signal - to - noise ratio . during the initialization phase , the estimated channel impulse response h chan , that is three impulse response elements h cent , h pre , h post , are used as the basis for the adaptation process , that is for determining the coefficients of the transversal filter in the time domain equalizer teq — see also fig3 . from these three estimated impulse response elements h cent , h pre , h post , it is possible to derive those matrices whose eigen vectors define a relatively small - dimensional ( d = 2 to 4 ) optimum vector subspace p opt for determining the coefficients h eq , opt of the transversal filter ( k = 32 - 64 ) to be adapted . this optimum vector subspace p opt is determined once on activation of a given physical transmission channel or of a transmission medium and / or at the start of data transmission , and remains unchanged during the data transmission . orthogonal vector iteration , as described by way of example in golub , van loan : matrix computations , john hopkins university press , 1996 , page 332 , can advantageously be used for determining the vector subspace p opt . the input parameters for the adaptation are in this case the length of the cyclic prefix cp len , the estimated channel impulse response h chan , and the dimension d of the vector subspace p opt to be determined . the optimum vector subspace p opt is represented for a subsequent non - linear optimization process by basic vectors e k — whose length corresponds to the number of transversal filter coefficients — that is to say the coefficients considered for the non - linear optimization process can be described mathematically as follows : h eq ( n ) = ∑ k = 1 d a k e k ( n ) in this case , d corresponds to the dimension of the vector subspace and a k represents the coefficients that are still to be optimized . the non - linear optimization process in the vector subspace p opt is carried out continuously during data transmission , that is to say the adaptation relates only to those n coefficients a k , opt which are required for identification of one element in the vector subspace p opt . the optimum coefficients of the transversal filter teq are thus given by : h eq , opt ( n ) = ∑ k = 1 d a k , opt e k ( n ) the influences of additive disturbances w ( n ) are taken into account in the non - linear optimization of the vector subspaces p opt . furthermore , the adaptation of the time domain equalizer teq also influences the signal - to - noise power ratio . in order to avoid instabilities as a result of the disturbances w ( n ) and the influence during the adaptation of the time domain equalizer teq , it is thus sensible to use small step widths in conventional non - linear optimization methods . after time - domain equalization of the channel impulse response h chan and / of the transmission block σtb + cp in the time domain equalizer teq , the prefix cp is removed once again in a device drop . the transmission blocks stb are broken down once again into n time - discrete sample values by means of a serial / parallel converter spc , and are then transformed by means of a fourier analysis fft ( fast fourier transformation ) to the n frequency - discrete sub - symbols nfb . the sub - symbols which represent the n carrier frequencies can be broken down in the frequency domain by means of a frequency domain equalizer feq . the information contained in the n carrier frequencies is decoded by means of a downstream decoder dec , and is combined to form a bit stream bs . in the course of decoding the sub - symbols , the signal - to - noise power ratio snr is measured in a signal unit snr which is connected to the decoder . the signal - to - noise power ratio snr is supplied via a switch s to the adaptation unit adp , in which the filter coefficients h eq , opt are determined for the time domain equalizer teq . the signal - to - noise power ratio snr is included in the optimization method for determining the filter coefficients h eq , opt during data transmission , that is after the initialization phase . during the initialization phase , that is at the start of data transmission , the central impulse response element h cent is included in the optimization method , by which means the filter coefficients h eq , opt are determined for a maximum transmission rate . either the signal - to - noise power ratio snr or the central impulse response element h cent is applied to the adaptation unit adp by means of the switch s , depending on the current transmission phase — start or during data transmission . the use of the method according to the invention is not restricted to the exemplary embodiment described above , but may also be used for all transmission methods in which an extensive , multidimensional vector space is determined from a channel impulse response h chan , and the aim is to determine as small a number of filter coefficients as possible for optimization of a time domain equalizer . in this case , different optimization methods may be used for determining the vector subspace and / or the eigen value problem , and also for the non - linear optimization of the vector subspace . | 7 |
referring to fig1 there is shown a battery characteristic detection apparatus 10 having a charger 30 , including a charging circuit 30a and a charger pocket comprising connector means 30b , and a battery 12 . the charger pocket 30b is coupled to a positive and negative charger contact 22 and 26 , respectively . to differentiate among the radio family types , the charger pocket 30b is uniquely shaped to fit each radio family type . when charging is desired , the battery 12 and / or the portable device ( not shown ) such as a radio attached , is inserted into the charger pocket 30b . the battery 12 comprises a series of cells 14 coupled either in series or in parallel and having a positive electrode 14a and a negative electrode 14b , the negative electrode 14b being coupled to a ground point 20 and a negative battery contact 27 . the positive electrode 14a is coupled to both the positive charger contact 22 and a positive battery contact 23 . contacts 23 and 27 provide the radio with the coupling points for powering the radio . finally , the battery 12 preferably comprises an impedance such as a resistor r18 coupled between the negative charger contact 26 and the negative electrode 14b . the charging circuit 30a comprises a transformer 32 , typically for stepping down the 120vac ( 28 ) from a conventional outlet . the stepped down voltage is rectified and filtered ( 34 ) as is known in the art . the current ( 50 ) supplied to the battery 12 is regulated by a current control circuit 36 which is in turn controlled by a charge current control signal 58 provided by a microprocessor 38 . a diode 42 is further provided having a polarity selected to prevent the cells ( 14 ) from discharging into the charger 30 which is coupled to the charger contacts 22 and 26 . the microprocessor 38 is either connected to or includes conventional analog - to - digital ( a / d ) converter functions or the like . as is known , the microprocessor 38 is programmed to periodically measure the value of voltage connected to the a / d input . to form a charging algorithm sensing circuit , the resistor r18 is connected to the negative charger contact 26 so that a predetermined external impedance ( or voltage source ) may be connected to complete a voltage divider with a pull - up resistor r62 . in this manner , predetermined values of voltage at the negative charger contact 26 can be calculated to provide one factor relating to the battery capacity . it is appreciated that the measured voltage vm is directly related to the resistance of the connected resistor r18 in accordance with the usual voltage divider relationship : vm equals the measured voltage at the negative battery charger contact 26 or the a / d input ( line ); b + = the supply voltage ( i . e . as may have also just previously been measured with the aid of the a / d converter ) at the a / d input ; r62 equals the known pull - up resistance internal to the charging circuit 30a ; r18 equals the unknown resistance , not necessarily associated uniquely with a particular capacity . after solving for the resistance of r18 , one factor relating to the battery capacity can thus be determined . to expand the present capability of battery capacity sensing and to allow for radio family type differentiation , utilizing the non - ideal presently coded resistor implementation , a coded capacitor c72 , within the charger pocket 30b , is connected in parallel with the coded resistor 18 , when the battery 12 is inserted into the pocket 30b . the coded capacitor c72 is uniquely coded for each radio family type such as seen in the exemplary table of fig2 where 47uf denotes a type a radio , 27uf denotes a type b radio , and 68uf denotes a type c radio . referring to fig4 a time constant t1 = r18 × c72 developed by the coded resistor r18 and capacitor c72 has to elapse before the voltage vm is stabilized enough for the resistance of the coded resistor r18 to be measured . this time constant provides a second factor which is also related to the battery capacity , aside from relating to the radio family type . from determining the time constant alone or in combination with the resistance value of the coded resistor r18 , the battery capacity and the family type of the associated radio can be identified by the microprocessor 38 accessing its look - up table of fig2 stored in memory . operationally , the charger 30 receives several feedback inputs from the battery ( 12 ) to be connected and the charger ( 30 ) itself that allows the microprocessor 38 to determine the charge algorithm to be provided to the battery 12 . preferably , these inputs would include a battery voltage sense signal 52 and a programming charge capacity control input 56 . these inputs may or may not be required , depending on the batteries and radio family type involved and the charging algorithms to be used . other inputs may be used to provide further selectivity in charging schemes . the battery voltage sense signal 52 from the current control circuit 36 determines the polarity of the battery 12 or any other battery inserted into the charger 30 , so as to provide the appropriate charge current direction . the signal 52 may also provide the battery peak voltage or latched voltage information that may be required in order to provide the appropriate charge to a variety of batteries for the corresponding radios which have different peak or latched voltages for optimal charging . the electronic element 18 , indicative of battery characteristics , such as the battery capacity , embodied in this example , as the code resistor 18 , is used to provide the programming of battery charge capacity control input 56 . it is appreciated that any electronic element providing distinguishable and measurable values such as a resistor , inductor , capacitor , diode , memory device ( ram , rom , eeprom , etc . ), or a pulse train modulator could be used for this function . in other words , the electronic component 18 ( or in this embodiment the code resistor ) will indicate to the charger one factor relating to the battery capacity . another factor relating to the battery capacity is time constant provided by the capacitance of the coded capacitor c72 and the resistance of the coded resistor r18 . from both the resistor and time constant indications , or the time constant alone , a charging algorithm is chosen by the microprocessor from a look - up table of fig2 or an appropriate memory source ( ram , rom , eeprom , etc .) known in the art . then , the microprocessor , using one or more of the available a / d inputs ( i . e ., 52 and 56 ) adjusts the charge algorithm according to the inputs received to provide the appropriate charging rate . optionally , the microprocessor 38 can provide a status signal or signals 60 to an output source or status indicator or indicators ( 40 ) that would allow a user to know such information as to what type of battery and from which radio family is being charged , or any other parameter desired . referring to both fig3 . and fig4 a typical algorithm and discharge operation , respectively , in accordance with the present invention , is illustrated . in step 101 , the a / d line connected to the regative charger contact 26 is periodically monitored . a decision block 103 determines whether the a / d line still measures the original supply voltage , which in this case is 5 volts . before the battery is inserted , this constant voltage can be seen in the voltage versus time curve of fig4 . the voltage measured at the negative battery contact 26 is a floating constant due to the absence of the battery including the coded resistor r18 to complete the circuit . if the a / d line still measures 5v , then the &# 34 ; yes &# 34 ; path returns to the beginning of the monitoring routine in step 105 . on the other hand , when a battery is first inserted into the charger 30 , the voltage on the a / d line will fall from the original supply voltage of 5 volts to the proper resistor divider level provided by the pull - up resistor r62 and the coded resistor r18 as seen in fig5 . the &# 34 ; no &# 34 ; path then proceeds to a decision block 107 to determine whether a counter has been started . if not , the &# 34 ; no &# 34 ; path begins an rc time constant counter in step 109 before returning to the beginning of the monitoring routine in step 111 . however , if the counter has already been started , a decision block 113 determines whether the a / d line has been stabilized yet . if &# 34 ; no &# 34 ;, step 115 returns to the beginning of the monitoring routine . on the other hand , if the counter is now stabilized , step 117 stops the counter . the counter now provides the time constant t1 as the second factor needed for the look - up table of fig2 . the voltage at this point is also stabilized for the microprocessor to determine the resistance value of the coded resistor r18 . knowing these two factors , a multitude of characteristics about the battery and the radio type can be known by referring to the look - up table of fig2 . now that all the factors are known , step 124 clears the counter and step 126 returns to the beginning of the monitoring routine . actually , just knowing the time constant alone may be sufficient , since the time constant , as provided by a unique coded capacitor associated with a radio family type and the coded resistor associated with a battery capacity type ( high , low , medium and degrees of battery capacity in between ), is a unique number associated with a particular battery of a specific radio family in this application . thus , the time constant alone can identify what latch voltage is necessary , the capacity of the battery , or the radio family type . however , by utilizing two factors , the time constant and the resistance value , the battery capacity sensing can be greatly expanded . in addition , the use of both the resistance value and the time constant eliminates the problem of tolerance overlap for particular time constant values that are too close . thus , in step 119 , the counter value providing the time constant t1 is used in the look - up table of fig2 to determine the radio type along with other information . in step 122 , since the voltage has been stabilized , the voltage measured on the a / d line will now be the voltage associated with the coded resistor r18 and the voltage divider circuit such that the resistance can be measured . the resistance value is then used in the look - up table of fig2 along with the time constant previously measured to determine the capacity for the battery type . instead of two separate steps 119 and 122 , the values of the code resistors and the time constant can together be matched up with the look - up table of fig2 stored in memory . after the combination of values is matched in the look up table , then the initial charge conditions including current , voltage , and time are set up . these conditions allow the microprocessor to alter the charging algorithm periodically ( or continuously if desired ) in accordance with the optimal charging profiles known for a given battery capacity and radio family type . accordingly , the charger adjusts the charging current for a particular charging rate to provide for a 1 hour charge time ( or alternatively , adjusts for a particular charge time for the same charge rate ) for the appropriate battery capacity rating . once the intial charge conditions are set , the battery charging commences . finally , the microprocessor poles the appropriate input or inputs to determine if the charge is complete . for instance , the battery voltage sense signal 52 could sense a peak voltage that the battery needs to be latched or clamped at for a particular radio family type , as dictated by the table of fig2 . the tailoring and adjustments of algorithms is simply a function of the status inputs received and the software or look - up comparators used to manipulate the algorithm in response to the status inputs . if the charge is not complete or the voltage is not at its peak voltage yet , the charger continues charging . once the charger determines that a charge is complete , the charger stops charging and a display can indicate &# 34 ; complete &# 34 ;. as seen in fig4 when the battery is removed , the a / d line will charge back up to the original supply voltage of 5 volts in the time constant t2 developed by the pull - up resistor r62 and the coded capacitor c72 . of course , if this time constant t2 is too high , a smaller resistor , in parallel with the pull - up resistor r62 , can be switched in , to reduce the pull - up time constant t2 . in summary , the present invention allows a charger to expand its present capability of battery capacity sensing and allows for a radio family type differentiation by using both a coded resistor and a coded capacitor simultaneously to provide a time constant . this time constant uniquely identifies the battery capacity and associated radio family type in a predetermined look - up table previously stored in the charger &# 39 ; s memory . | 8 |
a preferred seal assembly 20 for the trocar of this invention is illustrated in fig1 . the seal assembly is an integrated unit which is designed to snap onto the housing of the trocar cannula . it has a frame 21 which is sized to fit over the top of the cannula housing . the frame has an exterior planar face 22 and an interior region 23 which is positioned within the cannula housing . the interior region includes a resilient latches 24 which secures the seal assembly to the housing . it also includes a neck 25 to facilitate the guidance of surgical instruments through the cannula as they are inserted into and withdrawn from the cannula , and to seal the assembly 20 against the outer gasket of the trocar to prevent the escape of gas around the frame 21 . the seal assembly depicted in fig1 has an elastomeric seal 26 to seal against instruments which are inserted into and withdrawn from the cannula . the seal is positioned centrally within the seal assembly . the seal includes a centrally positioned aperture 27 to permit the passage of the instruments . advantageously , the aperture has a diameter between about 2 . 5 to about 5 mm so it can seal not only against the smallest endoscopic instruments but also 12 mm instruments and larger ones as well . referring to fig2 the trocar 28 of this invention is seen to provide access for the insertion for a surgical instrument 29 into a body cavity . the body wall 30 of the surgical patient is punctured with the trocar obturator ( not shown ), and the obturator is subsequently withdrawn from the cannula 31 . the cannula has a housing 32 with an interior chamber 33 ( see fig7 and 8 ), and an elongated , cylindrical sleeve 34 extending from the housing . the sleeve extends through the opening made in the body wall . at the proximal end of the cannula housing , the seal assembly 20 is secured . a passageway 35 is provided through the aperture of the seal assembly , into the chamber of the cannula housing , and finally through the lumen of the tubular sleeve to provide a path for the insertion and withdrawal of a surgical instrument into the body cavity . the components of the preferred seal assembly 20 are illustrated in fig3 . the frame is a subassembly which has a top frame half 36 and a bottom frame half 37 . sandwiched between the top and bottom frame halves is the elastomeric seal 26 . the seal is positioned between upper and lower rigid rings , 38 and 39 , respectively . the upper ring has a plurality of prongs 40 which are fitted through the seal and are received in a plurality of receiving holes 41 in the lower ring . the top and bottom frame halves define an internal cavity 42 for receiving the seal 26 . the top frame half has a circular opening 43 sized to fit an instrument with the largest diameter contemplated . correspondingly , the bottom frame half has a similarly sized opening 44 which is funneled to form the neck 25 of the seal assembly . a detailed description of a seal assembly with similar components is described in u . s . pat . no . 5 , 342 , 315 . referring now to fig4 - 6 , the seal component 26 of the preferred seal assembly is illustrated . the seal is made of a medical grade elastomer . examples of suitable elastomers include , but are not limited to , silicone rubber , polyurethane elastomer , chlorobutyl rubber , latex rubber , polyisoprene rubber and ethylene propylene diene monomer (&# 34 ; epdm &# 34 ;) rubber . the preferred elastomer are silicone rubber and polyurethane rubber . the most preferred elastomer is medical grade silicone , for example , dow coming slastic ™ brand medical grade silicone rubber . the seal has inner and outer portions , 45 and 46 , respectively . the inner and outer portions are divided by the upper and lower rigid rings . the outer portion of the seal has a bellows configuration . as disclosed in u . s . pat . nos . 5 , 073 , 169 and 5 , 209 , 736 , the bellows facilitates the maintenance of a seal during radial motion of surgical instruments which are inserted into and withdrawn from the cannula . the inner portion of the seal has a centrally located interior region 47 which contains the aperture 27 for passage of the surgical instruments . the circumferential surface of the aperture seals against instruments because it provides the surface against which the instruments come into contact . a sealing region 48 is concentrically located about the interior region of the seal . it is this sealing region which supports the aperture 27 of the interior region of the seal assembly when instruments are inserted and withdrawn , and prevents or minimizes the escape of insufflation gas from the body cavity through the trocar cannula . accordingly , the seal region must have the dual properties of elasticity to enable the passage of large instruments through the aperture 27 , and toughness to prevent ripping when misaligned instruments are forced against the sealing region . significantly , the sealing region has two layers . it has a first underlying layer 49 located interiorly towards the surgical patient , and a second overlaying layer 50 positioned on top of the first layer . the two layers are integral with each other to create an integral laminate . the laminate of the elastomer can be made using conventional injection co - molding techniques which are well known in the art . in other words , the first underlying layer of the elastomer is initially molded , and then the second overlaying layer of the elastomer is subsequently molded on top of the first layer to create the integral laminate . the underlying layer is elastic so that the aperture will stretch in response to instrument insertion , and the overlaying layer is tear resistant to prevent ripping . accordingly , the tear resistance of the overlaying layer is advantageously greater than that of the underlying layer . generally , the specific tear strength chosen for the underlying and overlaying layers will depend on the degree of resistance to seal tearing desired , which correspondingly depends on the size of surgical instruments inserted into and withdrawn from the trocar cannula and the shape of the end effectors of these instruments . in addition , the tear strength will also depend on the particular configuration of the elastomeric seal . for example , a seal which has a configuration with a large surface area to facilitate expansion of the seal aperture may need less tear strength than a seal with a configuration with a small surface area . therefore , the specific hardness for the underlying and overlaying layers may be readily determined empirically . nevertheless , the first underlying layer of the elastomer in the sealing region of the sealing assembly preferably has a hardness between about 5 shore a durometer scale and about 40 shore a durometer scale . the second overlaying layer has a hardness which is preferably between about 40 shore a durometer scale and about 80 shore d durometer scale . the hardness of the elastomer can be determined using the standard test method for hardness of the thermoplastic elastomers set forth in astmd 2240 - 91 . overall , if the hardness of the first underlying layer is less than about 5 shore a durometer scale , then the underlying layer may become very adherent or &# 34 ; sticky &# 34 ; to the instrument inserted through the seal assembly , consequently causing high friction and leading to the possible tearing of the seal assembly . correspondingly , if the hardness of the first underlying layer is greater than about 40 shore a durometer scale , then the underlying layer becomes increasingly stiff , minimizing the flexibility or elongation of the layer which may cause the possible tearing of the layer or an increase in instrument insertion force . if the second overlaying layer has a hardness less than about 40 shore a durometer scale , then there is the potential for increased friction and surface contact between the instrument and the seal which may cause tearing of the seal assembly . correspondingly , if the second overlaying layer has a hardness greater than about 80 shore d durometer scale , then there is the potential for the shearing of the first underlaying layer upon instrument withdrawal which may cause tearing of the seal assembly . also , a hardness greater than 80 shore d durometer scale minimizes the elastic flexibility of the overlaying layer , thus potentially inhibiting tissue removal and causing instrument snags . preferably , the first underlying layer of the sealing region of the sealing assembly has a hardness between about 30 shore a durometer scale and about 40 shore a durometer scale . the second overlaying layer of the sealing region preferably has a tear resistance between about 50 shore a durometer scale and about 80 shore d durometer scale . most preferably , the second overlaying layer has a tear resistance between about 60 shore a durometer scale and about 70 shore a durometer scale . the sealing region of the seal assembly depicted in fig4 - 6 is configured as a shallow cone . the overlaying layer of the co - molded integrate laminate is displayed as a plurality of separate concentric plates 51 in the form of truncated triangles . fig7 and 8 depict the insertion of surgical instruments of varying diameter through the trocar cannula 31 , and the seal which is created between the instrument 29 and the sealing region 48 of the seal assembly 30 . as the instrument is inserted through the aperture of the seal , the aperture expands to accommodate the outside diameter of the instrument inserted through the seal . referring briefly now to fig9 - 15 , there are illustrated alternative embodiments for the configuration of the seal component 26 of the seal assembly for the trocar of this invention . fig9 depicts a second overlaying layer of the sealing region 48 as a plurality of interconnected concentric plates 52 . fig1 illustrates the second overlaying layer region of the sealing region as a continuous layer 53 co - molded over substantially the entire surface of the underlying layer . in fig1 - 13 , the sealing region of the seal assembly is configured as a flat seal instead of a shallow cone . alternatively , the sealing region can be configured as a deep cone as shown in fig1 and 15 . in the embodiments of fig1 and 15 , the outer portion 46 of the seal depicted in fig4 and 9 - 13 have been eliminated . in another embodiment of this invention , the seal assembly may be insert molded directly to the interior wall of the cannula housing of the trocar instead of the latch attachment illustrated in fig1 and 2 . for example , the cannula housing can be initially inserted into a mold . the first underlying layer of the sealing region of the seal assembly can be injected into the mold to form the outer perimeter of the seal as well as to form a mechanical interlock with the cannula housing . subsequently , the second overlaying layer may be co - injected into the mold . once the elastomer is fully cured , the cannula housing can be demolded . although this invention has been described in connection with its most preferred embodiments , numerous additional embodiments can readily be contemplated by those skilled in the art and therefore fall within the scope and spirit of the claimed invention . the detailed description of the preferred embodiments are exemplary only , and should not be construed in any way to limit the scope of the claimed invention . | 0 |
embodiments of the present disclosure are described herein . it is to be understood , however , that the disclosed embodiments are merely examples and other embodiments can take various and alternative forms . the figures are not necessarily to scale ; some features could be exaggerated or minimized to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . as those of ordinary skill in the art will understand , various features illustrated and described with reference to any one of the figures can be combined with features illustrated in one or more other figures to produce embodiments that are not explicitly illustrated or described . the combinations of features illustrated provide representative embodiments for typical applications . various combinations and modifications of the features consistent with the teachings of this disclosure , however , could be desired for particular applications or implementations . fig2 - 4 illustrate a rzeppa - type cv joint suitable for use at 26 , 28 , 30 , 32 , 34 , and / or 36 in fig1 . fig2 is a cross section in the plane defined by the centerlines 50 and 52 of the two sides of the joint . ring 54 is adapted for fixation to the driveline component such as the transmission output shaft , the wheel , or the differential as described in detail below . stub shaft 56 is adapted for fixation to driveshaft 16 or to an axle shaft 22 or 24 . stub shaft 56 may be fixed to the shaft by welding at the circumference of flange 58 , for example . six concave grooves 60 are formed in ring 54 and six convex grooves 62 are formed in stub shaft 52 . six balls 64 , each positioned within a concave groove 60 and a convex groove 62 , position stub shaft radially with respect to ring 54 . the balls can roll within the grooves to accommodate the angle between axis 50 and axis 52 . for example , as shown in fig2 , the ball at the top has rolled toward the left of the groove in ring 54 and has rolled toward the right end of the groove in stub shaft 56 . the ball on the bottom has rolled the opposite direction . as either the ring or the stub shaft rotates about its respective axis , the balls force the other member to rotate by an equal amount such that the grooves line up at the ball locations . the balls may be retained by a cage ( not shown ). proper function of the joint requires lubrication , typically in the form of grease . a back plate 66 and a flexible boot 68 seal a cavity to retain the grease and to prevent contaminants from entering . flexible boot 68 may be a j - shaped boot fixed to front plate 72 which , in turn , is fixed to ring 54 . boot 68 is made of a flexible material to accommodate the different axes of rotation . during each revolution of the shafts , a particular circumferential portion of the boot changes from the shape shown at the top of fig2 to the shape shown at the bottom of fig2 and then back . in some applications , such as the underside of an off - road vehicle , the joint may be vulnerable to projectiles that may puncture the j - boot . if the grease leaks out or contaminants get in , friction may lead to rapid temperature increase and joint failure . another failure mode , called ballooning , occurs when the pressure builds up inside the grease cavity . this may occur , for example , due to friction causing the temperature of the grease and air in the cavity to increase . centrifugal forces also contribute to internal pressure in the cavity . the increased pressure may cause boot 68 to deform such that the convex surface facing the grease cavity becomes concave . this type of deflection weakens the boot material over time , eventually leading to loss of sealing function and eventual joint failure . fig3 is a cross section taken through the plane defined by the six balls 64 . fig4 is a pictorial view of the joint . ring 54 defines six holes 70 that are used to fix the ring to the component , such as the transmission , differential , or wheel . specifically , six bolts are inserted through the holes 70 , from the side with the j - boot , into threaded holes in a flange of the component . washers may be inserted to distribute the compressive force from the bolt head across the face of the front plate 72 . in some cases , it may be necessary to rotate the shaft after inserting some of the bolts in order to be able to reach the remaining bolts with an appropriate tool . the shaft may be welded to the stub shaft 54 prior to positioning the shaft assembly into the vehicle . fig5 and 6 show the cv joint of fig2 - 4 with a protective shield . fig5 is a cross section in the same plane as fig2 . the protective shield includes a rigid portion 74 and a flexible portion 76 . the rigid portion 74 is fixed to the ring . for example , the rigid portion may be fixed to the ring by the same bolts 78 that fix the ring to the driveline component . a flange of the rigid portion may be compressed between the washer 80 and the front plate . the rigid portion 74 also constrains boot 68 from ballooning outward . the rigid portion protects the flexible j - boot from damage . the flexible portion seals off the gap between the rigid portion and the shaft , preventing any projectiles from reaching the j - boot and potentially rupturing it . in order to accommodate the non - coincident axes of rotation , an inner edge of the flexible portion must be capable of moving to a position not concentric with an outer edge . this may be accomplished , for example , by forming the flexible portion with an accordion shape having a number of truncated conical panels with alternating orientation . unlike the flexible j - boot , however , the flexible portion of the protective shield does not need to form a seal against the shaft . if a projectile , such as a rock , creates a small hole in the flexible portion , the universal joint will continue to function properly . fig6 is a pictorial view of the cv joint with protective shield 74 and 76 . fig6 also shows the six bolts 78 and the washers 80 used to fasten ring 54 to a component flange . note that both the rigid portion 74 and the flexible portion 76 of the shield may be formed from multiple circumferential segments which collectively surround the circumference of the j - boot . each circumferential portion can be fastened to the cv joint separately . while exemplary embodiments are described above , it is not intended that these embodiments describe all possible forms encompassed by the claims . the words used in the specification are words of description rather than limitation , and it is understood that various changes can be made without departing from the spirit and scope of the disclosure . as previously described , the features of various embodiments can be combined to form further embodiments of the invention that may not be explicitly described or illustrated . while various embodiments could have been described as providing advantages or being preferred over other embodiments or prior art implementations with respect to one or more desired characteristics , those of ordinary skill in the art recognize that one or more features or characteristics can be compromised to achieve desired overall system attributes , which depend on the specific application and implementation . as such , embodiments described as less desirable than other embodiments or prior art implementations with respect to one or more characteristics are not outside the scope of the disclosure and can be desirable for particular applications . | 5 |
fig1 shows a cathode ray tube 10 having a glass envelope 12 comprises a rectangular face plate panel 14 and a tubular neck 16 connected by a rectangular funnel 18 . the funnel 18 has an internal conductive coating ( not shown ) that extends from an anode button 20 to a neck 16 . the panel 14 comprises a viewing face plate 22 and a peripheral flange or sidewall 24 that is sealed to the funnel 18 by a glass frit 26 . a three - color phosphor screen 28 is carried by the inner surface of the face plate 22 . the screen 28 is a line screen with the phosphor lines arranged in triads , each triad including a phosphor line of each of the three colors . a tension focus mask 30 is removably mounted in a predetermined spaced relation to the screen 28 . an electron gun 32 ( schematically shown by the dashed lines in fig1 ) is centrally mounted within the neck 16 to generate three in - line electron beams , a center beam and two side beams , along convergent paths through the tension focus mask 30 to the screen 28 . the tube 10 is designed to be used with an external magnetic deflection yoke , such as the yoke 34 shown in the neighborhood of the funnel to neck junction . when activated , the yoke 34 subjects the three beams to magnetic fields which cause the beams to scan horizontally and vertically in a rectangular raster over the screen 28 . the tension focus mask 30 , shown in greater detail in fig2 includes two longs sides 36 and 38 and two short sides 40 and 42 . the two short sides 40 and 42 of the mask parallel a central minor axis , y , of the tube . the tension focus mask 30 includes two sets of conductive lines : strands 44 that are parallel to the central minor axis y and to each other ; and wires 46 , that are parallel to the central major axis x and to each other . in a preferred embodiment , the strands 44 are flat strips that extend vertically , having a width of about 13 mils and a thickness of about 2 mils , and the cross wires 46 have a round cross section , having a diameter of about 1 mil and extend horizontally . in the completed mask , the strands 44 and wires 46 are separated from each other by suitable insulators such as lead - zinc - boro - silicate . fig3 depicts a side view , cross - section , of the tension focus mask 30 for constructing a rigid busbar . to best understand the invention , the reader should simultaneously refer to both fig2 and 3 . the short sides 40 and 42 of the tension focus mask 30 includes a base segment 314 , which can be seen in both fig2 and 3 , formed of a stainless steel 90 ° angle segment having two respective ends . a massive side rail 310 is formed of an alloy steel material also in the shape of an angle and having two respective ends . together , these two side rail segments 314 and 310 establish the structural portions of the two short sides 40 and 42 . each side , 40 and 42 are fabricated to mirror one another . the stainless steel base segment 314 is arranged such that it is perpendicular to the long sides 36 and 38 and attached to the long side on each of its respective ends by welding . the second element , the massive side rail 310 , is arranged such that it is aligned in the same vertical plane as the first segment 314 , but the second segment 310 is positioned above segment 314 in the z direction . the massive side rail segment 310 is also affixed to the long sides 36 and 38 on each of its &# 39 ; respective ends , perpendicular to the long sides 36 and 38 similar to that of the base segment 314 . the arrangement of the segments 314 and 310 forms the short sides 42 and 40 . this arrangement allows workers and technicians to grasp the tension focus mask 30 without handling the mask portion of the assembly . the side rails also prevent damage when mask frame assemblies are jarred impacted by objects or other mask assemblies during fabrication . the cross wires 46 are especially fragile and require the utmost care to avoid damage . the massive side rail segment 310 further comprises a set of elements that aids in the performance of the mask frame assembly and allows the assembly to be used as a tension focus mask or a color selection electrode . these elements include a beam shield 302 , an insulator / spacer 308 and a rigid busbar 306 . the beam shield 302 is formed along the upper inside portion of the massive side rail 310 . the beam shield 302 runs the entire length of the massive side rail 310 and prevents stray electrons from the electron gun 32 of the crt 10 from scattering and landing on the screen to produce an anomalous effect in the edge regions during use . the insulator / spacer 308 is affixed to the outside of the massive side rail 310 . the insulator / spacer 308 is sandwiched between the side rail 310 and the busbar 306 . the insulator / spacer 308 acts to provide electrical insulation for preventing busbar 306 from making electrical contact with the massive side rail 310 . the busbar 306 is attached to the outside of the insulator / spacer 308 and runs the length of the short side 40 and 42 of the tension focus mask 30 . a plurality of crosswires 46 of the focus mask are applied over strands 44 and terminate on the busbar 306 . the crosswires 46 are laid parallel to one another and equidistantly spaced from each other . the crosswires 46 are affixed to the busbar 306 by , for example , a structural adhesive 304 , such as carbon loaded kasil , applied across the top portion of the busbar 306 . after the adhesive 304 has dried or cured , the crosswires 46 are trimmed flush to the busbar 306 . during operation of tube 10 , a voltage difference , not shown , is applied between crosswires 46 and strands 44 . the voltage is applied to crosswires 46 via the conductivity of busbar 306 . thereby , focus action is provided , in a known manner . the tension focus mask 30 is assembled in three separate processes . in the first process the frame portion is assembled , while in the second process the etched mask strands 44 are affixed to the tension focus mask 30 and finally in the third process , the crosswire 46 are attached . this forms the frame portion of the tension focus mask 30 . once all the elements have been properly aligned and assembled , a plurality of crosswires 46 are laid across the top of the busbar 306 . the crosswires 46 are glued using a fast - curing , high - temperature adhesive 304 such as carbon loaded kasil to the top of the busbar 306 . after attachment , the crosswires 46 may be trimmed flush with the busbar 306 . short sides 40 and 42 are reinforced with a rigid busbar 306 for the purpose of preventing damage to tension focus mask 30 due to handling during the manufacturing process . rigidity refers to the ability of the busbar 306 to resist deformation , during manufacture of the crt 10 and in use . the busbar 306 is formed to be rigid so as to prevent a transmittal of force to crosswires 46 from , for example , side rail 310 . thereby , advantageously , beam misregister is prevented during use of the crt 10 . for preventing beam misregistration , the deviation of the beam landing location from the ideal on the screen 28 may not be more than 2 - 4 mils depending on the screen 28 size . this rigid busbar apparatus allows technicians and workers to handle the tension focus mask 30 by the short sides 40 and 42 at base segments 314 , thus preventing physical contact with tension focus mask 30 that could potentially damage the crosswires 46 and strands 44 . fig4 is a side view , cross - sectional , of another embodiment of the present invention . in this embodiment , a rigid busbar 306 ′ is supported by a frame assembly 320 ′. rigid busbar 306 ′ is made of an insulator such as glass . an electrically conductive layer , not shown , provides a connection for a focus voltage , not shown . in this embodiment as in the previous embodiment , the rigid busbar 306 ′ prevents the tension focus mask crosswires 46 from damage or shifting during manufacture and use . a busbar clip 314 ′ secures the rigid busbar 306 to the mask frame 320 ′. an adhesive 304 ′ that may be structural or non - structural is used to adhere the crosswires 46 to the rigid busbar 306 ′. the adhesive 304 ′ is applied over the crosswires 46 onto the busbar 306 ′ and allowed to cure or dry . as in the previous embodiment , the rigid busbar 306 ′ will not deform during manufacture and will prevent electron beam misregistration . as the embodiments that incorporate the teachings of the present invention have been shown and described in detail , those skilled in the art can readily devise many other varied embodiments that still incorporate these teachings without departing from the spirit of the invention . | 7 |
before the present apparatus and methods are described , it is to be understood that this invention is not limited to particular mechanisms , materials or methods described , as such may , of course , vary . it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only , and is not intended to be limiting , since the scope of the present invention will be limited only by the appended claims . where a range of values is provided , it is understood that each intervening value , to the tenth of the unit of the lower limit unless the context clearly dictates otherwise , between the upper and lower limits of that range is also specifically disclosed . each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention . the upper and lower limits of these smaller ranges may independently be included or excluded in the range , and each range where either , neither or both limits are included in the smaller ranges is also encompassed within the invention , subject to any specifically excluded limit in the stated range . where the stated range includes one or both of the limits , ranges excluding either or both of those included limits are also included in the invention . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention , the preferred methods and materials are now described . all publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited . it must be noted that as used herein and in the appended claims , the singular forms “ a ”, “ and ”, and “ the ” include plural referents unless the context clearly dictates otherwise . thus , for example , reference to “ a pillar ” includes a plurality of such pillars and reference to “ the motor ” includes reference to one or more motors and equivalents thereof known to those skilled in the art , and so forth . the publications discussed herein are provided solely for their disclosure prior to the filing date of the present application . nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention . further , the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed . the present invention includes appparatus that function both as a retractable full cover sun visor and full windshield cover , as well as a sun visor , so that there is no need for the sun visors that are currently provided by the manufacturer of an automobile . the present apparatus may be designed and manufactured as original equipment of a motor vehicle , so the consumer is not faced with an additional expenditure to provide protection of the interior of the vehicle from the sun , or to provide security for articles left within the vehicle when it is not being operated . the present apparatus may also be provided for the rear windshield as well . the present invention can provide a barrier against the effects of the sun by completely covering the windshield or rear windshield to prevent or reduce ultraviolet ( uv ) from entering and degrading interior components made of fabric , leather or polymers . further , the present invention may restrict generation of heat in the interior of a vehicle , thereby reducing the ambient temperature for efficient functioning of air conditioning , cooler seats and steering wheel etc . and reduce the “ oven ” effect in summer and hot weather conditions . to prevent theft or burglary of the car , an apparatus covering the windshield of the vehicle may be arranged to prevent itself from retracting if the vehicle is not properly started , such as with the key , or by entering a required code of some form . the present invention may also provide a privacy barrier to prevent external viewing of the contents in the vehicle interior , as noted above . the present apparatus may be automatically driven , but may alternatively be manually operated . additionally , automatic versions may have the option of being manually operated . further , the apparatus may include a logo , advertisement , written message , or other markings on one or both sides thereof . in one embodiment of the present invention , an apparatus that functions as a retractable full cover sun visor and full windshield cover are provided , including a flexible screen 17 which is electromechanically driven to be coiled or rolled up into an integrated longitudinal compartment 5 ( see fig2 and 4 ) when not in use ( i . e ., when retracted ). compartment 5 may be housed in a roof interior of a motor vehicle adjacent to an upper edge of the windshield frame 27 , and may be partially or completely covered by the roof liner 3 of the interior of the vehicle . two rotatable screws 10 ( one of which is shown in fig5 a ) mounted on bidirectional electric motors 11 that may be housed under the dashboard on either side below “ a ” pillars 12 , drive the screen in up and down directions to retract and deploy the screen , respectively . motors 11 are powered by the electrical system of the vehicle to operate the sun visor and the full windshield cover . an interlock 21 ( fig6 ) may be provided to ensure the proper sun visor position for safe driving when the car is in drive mode . the interlock 21 may be programmable to select preferred visor positions , depending upon the height of the driver , but may be limited to a maximum deployment position , beyond which the department of transportation has regulated as being an unsafe , illegal setting . when switch 29 is activated to deploy screen 17 while the car is operating ( e . g ., in drive 33 or reverse modes ), interlock 21 may prevent screen from deploying beyond the visor position , with the result of the operator &# 39 ; s deployment of switch 29 being a deployment of screen 17 to the visor position 37 . further , the same interlock may also enable the deployment of the screen 17 as a full windshield cover 35 only when the car is engaged in “ park ” setting 32 ( or , other safety requirement , such as when the vehicle is turned off and the parking brake is set , in the case of manual transmission vehicles , for example ), and to prevent full deployment otherwise to the full windshield cover deployment position . interlock 21 may further prevent screen 17 from being retracted from the windshield cover deployment position until the vehicle is shifted out of “ park ” ( or other safety requirement is met ). optionally , the interlock may automatically retract screen 17 from the full windshield cover deployment position when the vehicle is shifted out of “ park ”. such retraction may automatically take place to position screen in the visor deployment positioning . alternatively , the apparatus may be programmed to automatically fully retract screen 17 when the vehicle is shifted out of “ park ”. if the vehicle is not running , the interlock may prevent screen 17 from being retracted from the windshield cover deployment 36 position unless the vehicle is properly started 34 . by properly started is meant that the vehicle is started by turning the key in the ignition , or by using various other keyless ignition starting codes or methods intended by the manufacturer to be used by the owner of the vehicle for starting it . in addition to properly starting the vehicle , the interlock may optionally require the input of a code to allow screen 17 to be retracted after starting the vehicle . still further optionally , in combination with the proper starting ( and optionally the code ), the gear lever of the vehicle may be required to be shifted to a “ drive ” position , or into gear to retract screen 17 . these requirements cause screen 17 to block the view through the front windshield and help to prevent car theft or at least be a significant deterrent for a possible car theft . once the requirements have been met , screen 17 may be automatically retracted either to the visor position , or the fully retracted position . the choice of these options may be user programmable . provision may be made to accommodate the post 14 of the rear view mirror 15 of the vehicle when screen 17 retracts all the way up in to its longitudinal housing 5 ( see fig2 and 4 ), with the use of bristle or brush - edge 16 . however , if the rear view mirror is designed so that post 14 is located behind the longitudinal housing of screen 17 , then a single screen 17 can be used , and it is not necessary to provide a brush - edge gap eliminator 16 . a screen stiffener 20 may be provided in any embodiment , to provide more structural rigidity of the leading edge of the screen which helps to deploy and retract it . screen stiffener 20 may be a metallic wire , rod , or other stiffening element attached to or sewn into the leading edge of screen 17 . an embodiment of an apparatus may also be installed on a rear windshield of a vehicle to function as a visor as well as a full cover . when installed on the rear windshield , the interlock may also disable rolling up of the screen in the event of improper ignition / start of an automobile . this may also help to deter car theft . additionally , the interlock may also activate the screen 17 to be retracted when the vehicle is shifted into a “ reverse ” gear . screen 17 may also be made of a semi - transparent material to allow it to be deployed while an automobile is in drive mode to enable a driver to see the cars behind but cut off the glare from the sun . a control mechanism , such as a switch 29 , for example , may be provided for manually initiate automatic control of one or more apparatus , such as to actuate motors 11 to deploy one or more screens to the visor position or to fully retract one or more screens . switch 29 may also be used to control the motors to deploy to the full cover position or retract therefrom , but these functions may be overridden by the interlock , depending upon how the interlock is set up . further , the interlock 21 may be integrated with the switch 29 . one embodiment of the present apparatus includes a flexible screen 17 which is configured to be coiled or rolled into an integrated longitudinal compartment 5 when not in use . screen 17 may be made of a flexible fabric or a reflective film such as mylar . a drive mechanism of the apparatus includes at least one motor 11 and long screw 10 . long screw 10 may be flexible in bending about its longitudinal axis to allow it to conform to the contours of a pillar or other vertical guide structure in which it is placed , but is relatively rigid under compression along the longitudinal axis to permit it to drive screen 17 properly . a control mechanism , such as a simple power switch may be located near other , like controls , such as on the dashboard of the vehicle . an electrically powered , electronically - controlled interlock may be configured to enable multi - position deployment of screen 17 as well as to prevent accidental full deployment when safety prohibits ( as when driving down the road in a car ). the invention may also be used in a manual , non - motorized version by foregoing the motor , drive and electronic control . for manual deployment , one or more hooks 23 or other anchors may be provided for attaching screen 17 to one or more fixed visor locations , to function as a visor , and one or more hooks 22 may be provided at a location at the bottom of the windshield 1 ( e . g ., on the dashboard ) to hold ( restrain ) the screen down to function as a full windshield cover . in the example of fig1 , u - shaped member 18 is configured to be releasably engaged by hook 22 to temporarily lock screen 17 in the fully deployed configuration . other hooks or engagement features may be provided on screen 17 to temporarily lock its leading edge to one or more anchors fixed at or near the bottom of the windshield to be covered . fig3 shows a manually deployable apparatus where engagement member 18 is releasably engaged by mating engagement member 22 to temporarily lock screen 17 in the fully deployed configuration . side engaging members 23 are provided to releasably engage cooperating side engaging members 25 provided at the end portions of the leading edge of screen 17 to fix screen 17 in the visor position . multiple cooperating side engagement members 25 ( see fig2 ) may be provided on screen 17 ( or alternatively , multiple side engagement members 23 may be provided along the frame of the windshield ) to allow screen 17 to be fixed at varying visor height levels . housing 5 may include one or more spring loaded rollers 19 to retract screen 17 in manual mode , or to assist retraction under automatic , motor driven mode . the current apparatus may thus function as a replacement for conventional visors to block the sun , additionally , with screen 17 also optionally providing a reflective interior surface ( as a ‘ vanity mirror ’). when fully deployed , screen 17 may provide a barrier against the effects of the sun by completely covering the windshield . at the same time , a restriction of heat may be provided into the protected chamber behind the windshield . still further , a logo , advertisement or other marking may be provided on either or both of the outside and inside surfaces of screen 17 . the drive mechanism may automatically deploy screen 17 to variable positions , and can double as a guide for the travel of the screen 17 . that is , the long screws ( and additional guides , if used ) can be bent ( without kinking ) or otherwise conformed to the curvature of a windshield , so that the deployment of the screen 17 closely follows the curvature of the surface of the windshield . the vertical guides ( such as pillars 12 or other vertical guiding structure provided ) control the position of screen 17 against the surface of the windshield . the enclosure 5 provides the ‘ home ’ for the non - extended screen when not in use , and is generally hidden within the roof of the vehicle above front and / or rear windshields , and is designed to not protrude or otherwise present a safety hazard . the control switch may be a momentary - type version which allows variable deployment to a predetermined distance which is prescribed by , for example department of transportation ( dot hereafter ) regulations for safe driving conditions . the interlock may be engaged by actuation of control mechanism ( e . g ., the switch ), and may prevent full vision blocking deployment of screen 17 while an automobile is in drive mode . further , when changing from a driving mode to a non - driving mode , the interlock may control one or more motors 11 to automatically , fully deploy screen ( s ) 17 . in one embodiment of use of the apparatus in an automotive application , for first setting level deployment , the control switch is manually actuated ( the switch may be actuated by pulling it down to emulate the action of screen 17 , for example ), to engage drive motor ( s ) 11 which rotate to drive long screws 10 in rotation to translate drive members ( e . g ., drive nuts 24 ) along the long screws 10 in a downward direction to deploy screen 17 . screen 17 is attached to drive members 24 . further , screen 17 may be provided with one or more guide features 26 on each side thereof that slide over long screws 10 as screen 17 is deployed , to help maintain screen fully deployed along its width . screen 17 is thus drawn out of it housing along long screws 10 to a predetermined position , which is either programmed into the interlock mechanism according to a user &# 39 ; s choice ( there may be multiple program settings for multiple users ) or is a default setting , that corresponds to a vertical dimension analogous to that of conventional sun visors . in automotive applications the second setting level deployment ( full deployment ) may only be possible when the auto is parked , thereby allowing the interlock to release the drive mechanism for full extension . in what can be a configurable actuation , the screen 17 can be set to automatically deploy to full extension at the ‘ park ’ setting , or selectively actuated via the control switch and governed by the interlock . for the manual implementation , one or more screens 17 may be pulled down to a preset governed detent — one of two ; driving and park . when pulled fully down , one or more engagement features ( e . g ., loop 22 ) may be secured by a stationary cooperating engagement feature ( e . g ., hook ) mounted onto the vehicle &# 39 ; s dashboard or rear deck . guidance and stowing of the screens 17 are the same , with the exception of a substitution of a smooth rod instead of a ‘ threaded ’ long screw . for deployment to the visor position , one or more engagement features 23 ( e . g ., hooks , or the like ) may be provided along side the windshield at a height or heights where the leading edge of the screen 17 is desired to be deployed to . features 23 may be installed on the a pillars 12 , or on the side framing of the windshield , etc . the screen enclosure / housing 5 and guides can either be built into the structure of the parent assembly ( motor vehicle ) or exist outside or independently from the structure . methods for creating the drive mechanism can vary widely , including the spiral long screw type drive described above , gear - driven drive , cable driven mechanism , etc . screen 17 may be made of many material types , depending on the desired design direction for the invention : a stable , metallized mylar film could be used where stretching to gain non - rectilinear coverage is not required ; a perforated , stretchable cloth may be used to allow stretching . other plastics , including , but not limited to , nylon , kevlar or polyester may be used . methods for ensuring full coverage for the windshield application about the rear - view mirror can be substituted , varying from the use of a dual - sided brush closure 16 , to the use of an over - lapping design of the screen . guidance of deployment and retraction of screen 17 may be performed by long screws 10 alone , and pillars or other vertical guide features are not necessarily required . alternatively the long screws may be installed in the pillars of a vehicle . the ‘ a ’ pillar long screws 10 may be installed in the a pillars ( pillars adjacent the windshield of a vehicle ) to drive screen 17 for the front windshield . long screws may be made of steel , aluminum , nitinol , nylon , or other metals or durable polymers suitable for the driving function and that provide the requisite bending flexibility and rigidity under compression . while the present invention has been described with reference to the specific embodiments thereof , it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention . in addition , many modifications may be made to adapt a particular situation , material , composition of matter , process , process step or steps , to the objective , spirit and scope of the present invention . all such modifications are intended to be within the scope of the claims appended hereto . | 1 |
within this specification , “ puck ” is used to described a standard ice hockey puck , as well other similar objects used for playing and practicing hockey , such as plastic pucks , rollers pucks ( used in roller hockey ) and hockey balls ( used in floor hockey and dry land practicing ). referring to fig1 , there is shown a loop hockey stick 10 , with a shaft 12 and a blade 14 , with a preferred embodiment of the present invention as shown in fig2 and 3 consisting of a loop 16 of material which is coupled to the blade 14 . the loop 16 is of sufficient size to fully enclose a standard hockey puck 18 and acts to trap the puck 18 against the backhand ( convex curve ) side of the blade 14 . the blade 14 is shown curved for clarity in the drawing and description , however , the loop 16 can be equally used with a straight blade 14 . in order to keep the weight of the hockey stick 10 to a minimum , the loop 16 need not be a solid piece of material , but can have holes cut into it or even be a mesh , as long as the shape of the loop 16 can be generally maintained . the puck 18 is readily removed from the loop 16 by raising the blade 14 off the ice ( playing surface ) and transitioning the puck 18 to the forehand ( concave curve ) side of the blade 14 in a standard stickhandling motion . the loop 16 can be attached to the blade 14 in either a permanent or temporary fashion . a permanent attachment is shown in fig4 , where the loop 16 is attached by securing the ends of the loop 16 through slots 20 in the blade 14 . alternatively , the loop 16 can be formed as an integral part of the blade 14 , made out of the same material as the blade 14 ( wood or composites ) or of a different material . a variety of different methods of affixing the loop 16 to the blade 14 can be contemplated , non - exhaustively including tape ( hockey , duct , industrial ), contact cement , velcro ™, staples , bolts , rubber or elastic bands that slip over the blade , or a special sleeve that fits over the blade and has two slits at the back . in all cases conventional hockey stick tape can be used to further secure the loop 16 as part of the normal application and usage of stick tape . it is considered preferable that the loop 16 be attached so the opposite surface of the blade 14 is not altered , e . g . for a loop 16 attached on the backhand side of the blade 14 , there should be no protrusions or other alterations on the forehand side of the blade 14 . one type of attachment is shown in fig5 , where the ends of the loop 16 consist of slip loops 22 which are passed over the blade 14 and secured in place by tightening the slip loops 22 . for additional security , the slip loops 22 can be taped over with conventional hockey stick tape to prevent slippage during use . a benefit of temporary attachment is that players can quickly adapt their regular sticks for use in practice and restore them to their original condition for a game . also , in game situations , a damaged loop 16 can be replaced without the need to replace the blade 14 , and vice - versa , where an undamaged loop 16 can be attached to a new blade 14 . other variations of the loop 16 include a sleeve which fits over the entire blade 14 , covering the front and rear faces . the sleeve can be stretchable to secure itself to the blade 14 , or held in place with hockey tape . a tight - fitting sleeve is preferred to minimize interference with the feel and control of the puck 18 on the surface of the blade 14 . by positioning the loop 16 on the backhand side of the blade 14 , the player can use the forehand side of the blade 14 to execute normal passing and shooting plays . furthermore , a backhand shot or pass can be executed by tilting the angle of the blade 14 sufficiently to allow the puck 18 to slide under the loop 16 . this can be made easier by positioning the loop 16 such that it is not in contact with the whole puck 18 , but only the top half or third , which is still sufficient in most cases to keep the puck 18 trapped in the loop 16 . while the loop 16 is preferably contemplated as having its bottom surface flush with the bottom surface of the blade 14 , alternative positions and shapes can be readily used to meet the same functional purposes . for example , the loop 16 can be secured to the blade 14 near the middle or top , and be positioned at an angle to be flush with the playing surface at the outer edge of the loop 16 . alternatively , the loop 16 can be tapered , being thinner near the blade 14 , to allow for some angular tilt of the blade 14 , and thicker near the outer edge of the loop 16 , to provide containment for the puck 18 . in alternative embodiments , the loop 16 could be placed on the forehand side of the blade 14 or there can be a loop 16 located on both the forehand and backhand sides of the blade 14 , for use in different drills and skill training exercises . as another alternative , the loop 16 can be hinged so that it can be repositioned to the top of the blade 14 , enabling the loop 16 to be moved from the forehand side to the backhand side or even to a neutral position above the blade . the hinges can be spring - loaded to lock the loop 16 into position once moved . the spring - loaded hinges can further be designed to trigger under pressure to allow the loop 16 to be repositioned during play . for example , with the loop 16 attached on the forehand side of the blade 14 , it may interfere with attempts to make a forehand shot , as the shot motion involves cupping ( tilting ) the blade 14 towards the ice surface . a pressure - sensitive spring - loaded hinge can be used so that the cupping motion triggers the hinge and causes the loop 16 to spring into a neutral position over the blade 14 , clearing the path for the shot . alternatively , triggering the hinge may merely raise the loop 16 to a position sufficient to provide clearance for the puck 18 , such as a 45 - degree angle from the playing surface . the loop 16 can be made from a rigid material ( hard plastic , laminated wood , fibreglass ) or a flexible material ( nylon , soft plastic , polyethylene ) as desired . a rigid loop 16 provide a more secure enclosure , but is vulnerable to fracture or breakage from contact with another stick . a flexible loop 16 is less likely to be broken , but provides a less secure enclosure . either type of loop 16 is suitable for use , although particular drills or games can require one type of loop preferentially over the other . a flexible loop 16 is preferred , as in order to provide for proper shooting of the puck the stick blade 14 must be tilted and the loop 16 needs to flex in response to the tilting motion . when a rigid loop 16 is used , the attachment point of the loop 16 to the blade 14 provides the flexibility instead . alternatively , the loop 16 can be enclosed with a solid or mesh netting cover 20 , which prevents the puck from inadvertently being bounced or knocked out of the loop 16 . the cover 20 is particularly preferable for use with balls , which have less contact surface with the ground and are subject to more bouncing than pucks . rather than a complete enclosure , the loop 16 may instead have a partial covering extended over a fraction of the surface or from specific regions of the loop . in particular , a loop 16 with an edge or lip along the top edge at the outermost section of the loop 16 provides most of the benefits of a full enclosure , while keeping the weight and material require for the loop 16 to a minimum . the dimensions and shape of the loop 16 can be tailored for different purposes , the most significant of which is the difference between carrying the puck on the forehand side of the blade 14 and the backhand side of the blade 14 . on the forehand side , the puck 18 is being pushed by the blade 14 and is partially contained by the curvature of the blade 14 . by contrast , on the backhand side of the blade 14 the curvature of the blade 14 does not provide any assistance in containing the puck 18 . thus , a loop 16 located on the forehand side of the blade 14 can be effective in a smaller size than a loop 16 located on the backhand side as the containment requirements for the forehand loop are less demanding . additionally , the parameters of the loop 16 are governed by the same parameters used for the blade 14 . hockey stick blades are defined by several characteristics . first is the lie , which reflects the angle formed between the blade 14 and the shaft of the stick . typical values for the lie range from 2 to 8 , with higher numbers representing angles closer to 90 degrees . the next factor is the location of the curve of the stick , defined in one of three locations , heel ( near the shaft ), mid ( center of blade ) and toe ( end of blade ). related to the location of the curve is the depth of the blade 14 , as determined relative to a flat blade . two other blade measurements are commonly used . an open blade is tilted upwards ( bottom forward , top back ) relative to a flat blade , whereas a closed blade is tilted downwards ( top forward , bottom back ). lastly , rockering is a term used to describe a blade which has a curved contact surface , as opposed to a flat contact surface , allowing the blade to maintain contact while moving into and away from the player &# 39 ; s body . in the preferred use of the loop 16 , a non - rockered blade is used , with a closed face and a mid - curve of shallow depth . a higher lie ( 6 or 7 ) is preferred for beginners , as the blade 14 ( and puck 20 ) is kept closer to the body , allowing for easier control . other blade modifications can be made to accommodate the loop 16 . for example , a longer blade 14 provides for a larger loop 16 , making the puck 20 easier to locate and handle within the loop 16 . another variant of the loop 16 is a partial loop , where the loop is split into two separate pieces coupled to the blade 14 and the separation between the pieces is small enough to prohibit the puck from escaping the resulting partial loop . the partial loop has the advantage of being lighter than a full loop , as well as enabling a larger range of motion for the blade , while still providing an enclosure for the puck 18 . using the loop stick 10 , a player can develop puck carrying , passing and team - play skills without needing to look down for fear of losing the puck . the effect is that the learning curve for these basic hockey skills is advanced and reduced , increasing the novice player &# 39 ; s enjoyment of the sport . additionally , the player develops into a more complete player who is better able to coordinate with other players , and is potentially even capable of achieving a higher overall skill level than would otherwise be possible . fundamentally , by using the loop stick 10 , a player is taught to give up their pre - occupation with control of the puck to gain control of the game . by eliminating concerns , which are often raised to an excessive level , over controlling and losing control of the puck , a player can watch and focus on the game as a whole . through observing the movement and position of the other players , the individual player gains control over the whole game . the trade - off leads to players who have a higher skill level , are able to get the most from their physical talents , and who enjoy the game to their fullest potential . this concludes the description of a presently preferred embodiment of the invention . the foregoing description has been presented for the purpose of illustration and is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above teaching and will be apparent to those skilled in the art . it is intended the scope of the invention be limited not by this description but by the claims that follow . | 0 |
the donation management system 10 of the present invention includes a central controller 12 , a transmission means 14 , and a donor interface 16 . as used herein , a donor may be an individual , a corporation , a partnership , a government , or any other entity . fig . i illustrates a high - level block diagram of central controller 12 which may used to implement the method of the present invention . central controller 12 includes a central processor 18 , an optional cryptographic processor 20 , memory 22 , operating system 24 , network interface 26 , data storage device 28 , peripheral device ( s ) 30 , portable storage medium drive ( s ) 32 , input device ( s ) 34 , graphics subsystem 36 , and display 38 . the components of central controller 12 are those typically found in general purpose computer systems , and are intended to represent a broad category of such computer components that are well known in the art . in one embodiment , central controller 12 may be a conventional personal computer or computer workstation with sufficient memory and processing capability to perform the necessary functions of the present invention . in another embodiment , central controller 12 operates as a web server , both receiving and transmitting queries and requests generated by donors or philanthropic organizations . regardless of its architecture , central controller 12 must be capable of high volume transaction processing and performing a significant number of mathematical calculations in processing communications and repository searches . one skilled in the art will also appreciate that the functionality of central controller 12 may also be distributed over a plurality of computers such as network of computers or a plurality of stand - alone computers . central controller 12 may be configured in a distributed architecture wherein the repositories and processors are housed in separate units or locations . some controllers perform the primary processing functions and contain , at a minimum , both memory and a general processor . each of these controllers is attached to a wan hub which serves as the primary communication link with the other controllers and interface devices . the wan hub may have minimal processing capability itself , serving primarily as a communications router . those skilled in the art will appreciate that an almost unlimited number of controllers may be supported . this arrangement yields a more dynamic and flexible system that is less prone to catastrophic hardware failures affecting the entire system . central processor 18 may contain a single microprocessor or it may contain a plurality of microprocessors for configuring central controller 12 as a multi - processor system . examples of currently available processors that may be suitable as central processor 18 include 64 bit amd opteron and 64 bit itanium from intel . equivalent processors may also be used . however , one skilled in the art will appreciate that newer and faster models will be developed and would be suitable for use in the present invention . cryptographic processor 20 is a processor that supports the authentication of communications from and to donors , philanthropic organizations , and central controller 12 . cryptographic processor 20 is also suitable for providing anonymity in transactions , secure processing of electronic transactions , secure electronic data interchange ( edi ), internet commerce servers and all other applications that require high - volume transactions and maximum security . examples of suitable , currently available apparatus include the ibm ® pci cryptographic coprocessor , the okiok rac / m ix icp cryptographic processor and the like . equivalent processors may also be used . however , one skilled in the art will appreciate that newer and faster models will be developed and would be suitable for use in the present invention . memory 22 includes random access memory ( ram ), dynamic random access memory ( dram ), read - only memory ( rom ) as well as high - speed cache memory . memory 22 may also include an application program 40 that stores , in part , instructions and data for execution by central processor 18 . if the system 10 of the present invention is wholly or partially implemented in software , including a computer program , memory 22 stores the executable code when in operation . controller 12 , as shown in fig1 , illustrates operating system 24 as a windows ®- based platform available from microsoft corporation that may be used for implementing the method of the present invention . however , numerous other platforms can also suffice for use as operating system 24 , such as macintosh - based platforms available from apple computer , inc ., platforms with different bus configurations , networked platforms , multi - processor platforms , other personal computers , personal digital assistants ( e . g ., palm pilot ®, blackberry ®, clié ®, 3com , etc . ), workstations , mainframes , navigation systems , and the like . network interface 26 is the gateway to communication with donors through donor interface 16 as well as with other users of system 10 . network interface 26 may be a network interface card for interfacing central controller 12 to a network , a modem , or the like . conventional internal or external modems may also serve as network interface 26 . network interface 26 supports modems at a range of baud rates from 1200 upward , but may combine such inputs into a t1 or t3 line if more bandwidth is required . in a preferred embodiment , network interface 26 is connected with the internet and / or any of the commercial on - line services such as america online , msn , etc ., allowing donors and other users access from a wide range of on - line connections . several commercial electronic mail servers include the above functionality in , for example , mail software packages designed to link people and information over enterprise networks and the internet . these types of products are platform independent and utilize open standards based upon internet protocols . users can exchange messages with enclosures such as files , graphics , video and audio . the system also supports multiple languages . alternatively , network interface 26 may be configured as a voice mail interface , web site , bbs , or electronic mail address . data storage device is a non - volatile storage device for storing data , software and instructions for use by central processor 18 and is typically implemented with a magnetic disk drive or an optical disk drive . data storage device 28 also contains data repositories used in the processing of transactions in the present invention , including a philanthropic organization repository 42 and a donor account repository 44 . philanthropic organization repository 42 maintains data 46 on philanthropic organizations with fields such as name , address , telephone number , mission statements , impact statements , backgrounds , histories , executive director statements , geographic information , management information , governance information , board of directors information , organizational infrastructure information , board of directors demographics , board of directors and management biographies , awards , recognition , national affiliations , related organizations , educations , diversity , staffing , contractors , volunteers , financial history , revenue sources , resource allocations , programs , committees , recommendations , reviews , and strategic plans . donor account repository 44 maintains account data 48 for individual donors such as donor fund balance , grant history , donation history , contribution history , vouchers , investments , and associated philanthropic organization information . as one skilled in the art will appreciate , any suitable type of software may be used to create and manage these repositories . in another embodiment , data storage device 28 may also store application program 40 or the purpose of loading program 40 to memory 22 . computer software , instructions or data , including data 46 and 48 , may also be stored in central processor 18 rather than data storage device 28 . controller 12 may further include peripheral device ( s ) 34 , portable storage medium drive ( s ) 36 , input device ( s ) 38 , graphics subsystem 40 and display 42 . for purposes of simplicity , the components shown in fig1 are depicted as being connected via a single bus 50 however , one skilled in the art will appreciate that the components may be connected through one or more data transport means . for example , processor 18 and memory 22 may be connected via a local microprocessor bus , and data storage device 28 , peripheral device ( s ) 30 , portable storage medium drive ( s ) 32 , and graphics subsystem 36 may be connected via one or more input / output ( i / o ) buses . peripheral device ( s ) 30 may include any piece of hardware or computer support device , such as an input / output ( i / o ) interface , used to add additional functionality to central controller 12 . other examples of peripheral device ( s ) 30 include , but are not limited to , printers , scanners , disk and tape drives , microphones , speakers , joysticks , plotters , and cameras . portable storage medium drive ( s ) 32 operates in conjunction with a portable non - volatile storage medium , such as a floppy disk , cd - rom , or other computer - readable medium , to input and output data and code to and from central controller 12 . in one embodiment , program 40 or data 46 and 48 is stored on a portable medium , and is then inputted to central controller 12 via portable storage medium drive 32 . input device ( s ) 34 provides a portion of a user interface with central controller 12 . input device ( s ) 34 may include an alpha - numeric keypad for inputting alphanumeric and other key information , or a pointing device , such as a mouse , a trackball , stylus , wheel , cursor or direction keys . such devices provide additional means for interfacing with repositories 42 and 44 . in order to display textual and graphical information , central controller 12 includes graphics subsystem 36 and display 38 . graphics subsystem 36 receives textual and graphical information and processes the information for output to display 38 . display 38 may include a cathode ray tube ( crt ) display , liquid crystal display ( lcd ), projection displays , other suitable display devices , or means for displaying , that enables a user to view data . display 38 can be used to display data , component interfaces and / or display other information that is part of a user interface . in a further embodiment , the present invention also includes a computer program 52 that includes a storage medium ( media ) component having instructions stored thereon which can be used to program a computer to perform the method of the present invention . the storage medium can include , but is not limited to , any type of computer - readable medium including floppy disks , optical disks , dvd , cd - roms , magnetic optical disks , rams , eprom , eeprom , magnetic or optical cards , or any type of media suitable for storing electronic instructions . stored on any one of the computer - readable medium ( media ), the present invention may also include software 54 for controlling both the hardware of central controller 12 or processors 18 and 20 , and for enabling central controller 12 , processor 18 and cryptographic processor 20 to interact with a human user or other mechanism utilizing the results of the present invention . software 54 may include , but is not limited to , device drivers , operating systems and user applications . ultimately , such computer - readable media further includes donor management software 56 for performing the method of the present invention . in a preferred embodiment , software 56 is downloaded to central controller 12 and stored in memory 22 as part of application program 40 . for the purposes of simplicity , all references herein to application program 40 include software 56 . however , it will be appreciated by those skilled in the art that software 56 may also be stored and executed separately from application 40 . as illustrated in fig1 , central controller 12 is connected via network interface 26 to transmission means 14 such as a network 48 ( e . g ., an intranet , the internet , or other network ), across communications lines 60 . preferably , communications lines 60 are dedicated lines ( e . g ., lan , wan , standard dial - out telephone line , satellite , dedicated lease line , dsl ) with a frame relay ( or point - to - point ) connection . central controller 12 may also be directly linked to third party computer systems 62 rather than communicating with central controller 12 through network 48 . third party computer system 62 may be , for example , a mainframe or pcs of at least xx486 processing ability ( e . g ., pentium cpu ) having at least one gigabyte drive , 16 megabytes of ram , with typical i / o accessories including a keyboard , mouse , and printer or similar workstation . each third party computer system 62 and central controller 12 and , more specifically , an output device or a server 64 , also have a modem 66 ( e . g ., csdsu , t1 communication , dsl , satellite or cable modems ) for coupling to communication lines 60 and enabling communications between central controller 12 and third party computer system 62 . data storage device 28 , output device or server 64 and memory 22 may be implemented by one digital processor 18 . in that case , consolidation , scheduling , initial and subsequent segmenting of end users and execution of working programs are accomplished through the one processor 18 . in using the present invention , end users may be assisted by a third party . alternatively , rule - based expert systems may be similarly employed in the present invention to provide dynamic end user behavioral and characteristics segmentation . in a preferred embodiment , donor interface 16 is a conventional personal computer having , at a minimum , an input device , such as a keyboard , mouse or conventional voice recognition software package , a display device , such as a video monitor , a processing device such as a cpu , and a network interface such as a modem . a cryptographic processor may also be included for stronger authentication protection . these devices interface with central controller 12 . alternatively , donor interface 16 may also be a voice mail system , or other electronic or voice communications system such as a pda , digital telephone , pocket personal computer or the like . referring now to fig2 , donor interface 16 is described in more detail . donor interface 16 includes a central processor 68 , a memory 70 , an operating system 72 , a network interface 74 , a data storage device 76 , a peripheral device ( s ) 78 , a portable storage medium drive ( s ) 80 , a graphics subsystem 82 , a display 84 , and an input device ( s ) 86 . cryptographic processor 88 may also be added for stronger authentication and verification capabilities . central processor 68 may contain a single microprocessor , such as a pentium microprocessor , or it may contain a plurality of microprocessors for configuring donor interface 16 as a multi - processor system . cryptographic processor 88 is a processor that supports the authentication of communications to and from donor interface 16 and central controller 12 . cryptographic processor 20 is also suitable for providing anonymity in transactions , secure processing of electronic transactions , secure electronic data interchange ( edi ), internet commerce servers and all other applications that require high - volume transactions and maximum security . examples of suitable , currently available apparatus include the ibm ® pci cryptographic coprocessor , the okiok rac / m ix icp cryptographic processor and the like . equivalent processors may also be used . however , one skilled in the art will appreciate that new and faster models will be developed and would be suitable for use in the present invention . memory 70 includes random access memory ( ram ), dynamic random access memory ( dram ), read - only memory ( rom ) as well as high - speed cache memory . memory 70 may also include an application program 90 that stores , in part , instructions and data for execution by central processor 68 . if donor interface 16 is wholly or partially implemented in software , including a computer program , memory 70 also stores the executable code when in operation . operating system 72 is shown in fig . x as a windows ®- based platform available from microsoft corporation . however , numerous other platforms can also suffice for use as operating system 72 , such as macintosh - based platforms available from apple computer , inc ., platforms with different bus configurations , networked platforms , multi - processor platforms , other personal computers , personal digital assistants ( e . g ., palm pilot (®, blackberry ®, clié ®, 3com , etc . ), workstations , mainframes , navigation systems , and the like . network interface 74 is the gateway to communication with central controller 12 . network interface 74 may be a network interface card for interfacing donor interface 16 to a network , a modem , or the like . conventional internal or external modems may also serve as network interface 74 . network interface in a preferred embodiment , network interface 74 is connected with the internet and / or any of the commercial on - line services such as america online , msn , etc ., allowing donors and other users access to central controller 12 from a wide range of on - line connections . several commercial electronic mail servers include the above functionality in , for example , mail software packages designed to link people and information over enterprise networks and the internet . these types of products are platform independent and utilize open standards based upon internet protocols . users can exchange messages with enclosures such as files , graphics , video and audio . the system also supports multiple languages . alternatively , network interface 74 may be configured as a voice mail interface , web site , bbs , or electronic mail address . data storage device 76 is a non - volatile storage device for storing data , software and instructions for use by central processor 68 and is typically implemented with a magnetic disk drive or an optical disk drive . data storage device 76 may be used for archiving philanthropic organization data 46 or donor account data 48 . in another embodiment , data storage device 76 may also store application program 90 for the purpose of loading program 90 to memory 70 . computer software , instructions or data , including data 46 and 48 , may also be stored in central processor 68 rather than data storage device 76 . donor interface 16 may further include peripheral device ( s ) 78 , portable storage medium drive ( s ) 80 , graphics subsystem 82 , display 84 , and input device ( s ) 86 . for purposes of simplicity , the components shown in fig . x are depicted as being connected via a single bus 92 . however , one skilled in the art will appreciate that the components may be connected through one or more data transport means . for example , processor 68 and memory 70 may be connected via a local microprocessor bus , and data storage device 76 , peripheral device ( s ) 78 , portable storage medium drive ( s ) 80 , and graphics subsystem 82 may be connected via one or more input / output ( i / o ) buses . peripheral device ( s ) 78 may include any piece of hardware or computer support device , such as an input / output ( i / o ) interface , used to add additional functionality to donor interface 16 . other examples of peripheral device 78 include , but are not limited to , printers , scanners , disk and tape drives , microphones , speakers , joysticks , plotters , and cameras . portable storage medium drive 80 operates in conjunction with a portable non - volatile storage medium , such as a floppy disk , cd - rom , or other computer - readable medium , to input and output data and code to and from donor interface 16 . program 90 or data 46 and 48 may be stored on a portable medium , and then inputted to donor interface 16 via portable storage medium drive 80 . in order to display textual and graphical information , donor interface 16 includes graphics subsystem 82 and display 84 . graphics subsystem 82 receives textual and graphical information and processes the information for output to display 84 . display 84 may include a cathode ray tube ( crt ) display , liquid crystal display ( lcd ), projection displays , other suitable display devices , or means for displaying , that enables a user to view data . display 84 can be used to display data , component interfaces and / or display other information that is part of a user interface . input device ( s ) 86 provides a portion of a user interface with donor interface 16 . input device ( s ) 86 may include an alpha - numeric keypad for inputting alphanumeric and other key information , or a pointing device , such as a mouse , a trackball , stylus , wheel , cursor or direction keys . such devices provide additional means for interfacing with donor interface 16 and , ultimately , central controller 12 . in a further embodiment , the present invention also includes a computer program 94 that includes a storage medium ( media ) component having instructions stored thereon which can be used to program a computer to perform the method of the present invention . the storage medium can include , but is not limited to , any type of computer - readable medium including floppy disks , optical disks , dvd , cd - roms , magnetic optical disks , rams , eprom , eeprom , magnetic or optical cards , or any type of media suitable for storing electronic instructions . stored on any one of the computer - readable medium ( media ), the present invention may also include software 96 for controlling both the hardware of donor interface 16 or processors 68 and 88 , and for enabling donor interface 16 , processors 68 and 88 to interact with a human user or other mechanism utilizing the results of the present invention . software 54 may include , but is not limited to , device drivers , operating systems and user applications . ultimately , such computer - readable media may further includes donor management software 98 for performing the method of the present invention . many commercial software applications are available to enable the communications required by donor interface 16 . when central controller 12 acts as a web server , conventional communications software such as the internet explorer web browser from microsoft corporation or the netscape navigator ® web browser from netscape corporation may also be used . no proprietary software is required . the present invention also provides a method for developing , accessing and managing information regarding philanthropic organizations and enabling donations thereto by donors . the preferred method includes inputting desirable philanthropic organization data 46 into central controller 12 wherein data 46 is collected and stored in philanthropic organization repository 42 . philanthropic organization data 46 is collected , inputted , and stored in such a way as to correspond to a specific philanthropic organization . referring now to fig3 , more particularly , an operator of central controller 12 or other persons associated with the operator or under the operator &# 39 ; s direction ( collectively the “ operator ”) first makes contact with a particular philanthropic organization via personal contact , telephone , electronic messaging , facsimile transmission or the like to request an appointment and interview as shown in step 102 . the operator then conducts any necessary research into the organization and prepares any necessary documentation or paperwork preparatory to the appointment at step 104 . simultaneously , the organization gathers or prepares information for use by the operator in hard copy or electronic form at step 106 . at step 108 , the operator conducts a personal interview with a representative of the organization such as the president , vice - president , chainman of the board , ceo , cfo or the like . during the interview , the operator confirms information already gathered and reviews information provided by the organization as shown in step 110 . the information may include , but is not limited to , the organization &# 39 ; s name , address , telephone number , mission statements , impact statements , backgrounds , histories , executive director statements , geographic information , management information , governance information , board of directors information , organizational infrastructure information , board of directors demographics , board of directors and management biographies , awards , recognition , national affiliations , related organizations , educations , diversity , staffing , contractors , volunteers , financial history , revenue sources , resource allocations , programs , committees , recommendations , reviews , and strategic plans . the information developed , gathered or provided regarding the organization is then confirmed and assessed by the operator for suitability for inclusion into operator &# 39 ; s method at step 112 . assessment of the information includes , but is not limited to , the organization &# 39 ; s future and current needs and risks , outcomes , measures , fund or donation development , leadership development , interest in setting up an endowment , fund or other accounting service , and the like . the information or data is then inputted into central controller 12 for inclusion in philanthropic organization repository 42 as philanthropic organization data 46 at step 113 . data 46 is then sent via any communications means to the organization for review , confirmation and approval at step 114 . upon receipt of the organization &# 39 ; s approval , at step 116 , data 46 is finalized for storage in repository 42 and for use in the method of the present invention . one skilled in the art will appreciate that any type of software or hardware suitable for conducting steps 102 - 116 may be used in accordance with the present invention . in use , application program 40 instructs central controller 12 to connect to transmission means 14 via network interface 26 and sends philanthropic organization data 46 to donor interface 16 which is then displayed for the donor in order to aid the donor &# 39 ; s management of charitable funds . both audio and visual data may be included in data 46 and transmitted in such a manner . similarly , desired donor account data 48 may be inputted into central controller 12 and application program 40 wherein donor account data 48 is collected in such a way as to correspond to a specific donor . application program 40 then connects to transmission means 14 via network interface 26 and sends donor account data 48 to donor interface 16 which is then displayed for the donor in order to aid the donor &# 39 ; s management of charitable funds . in accordance with the method of the present invention , when central controller 12 acts as a web server , a donor logs on to the central controller 12 , makes queries or requests regarding philanthropic organizations or the donor &# 39 ; s account , and then disconnects from the network . central controller 12 is connected to a corresponding web site on the internet thereby allowing the donor to provide and request information through the interface of conventional web browser software such as internet explorer from microsoft corporation . the web site has a home page with topic selections and links ( e . g ., hypertext html technology ) to application program 40 thereby triggering searches and initiating transfer of data 46 and 48 and other desired information . in particular , for each topic or field selection there is a respective hyperlink to application program 40 and optionally an event for initiating program 40 . upon the donor &# 39 ; s selection of a topic from the web page page , the present invention applies the linked event , if any . if the criteria of the event are met ( or if there is no initiating event ), then the present invention executes the corresponding application program 40 . referring now to fig4 - 6 , a process is described by which a donor accesses data 46 and 48 . it will be appreciated by those skilled in the art that buttons or drop - down menus may be provided on the web page for ease of selection and linking to appropriate web pages during performance of the method of the present invention . the donor logs on to central controller 12 using network interface 74 of donor interface 16 thereby establishing a communication link as shown in step 118 . a unique username and password may be provided to the donor which allows information particular to the donor to be made available for viewing by the donor . the donor inputs an assigned username and password into appropriate fields on the web page at step 120 and the donor &# 39 ; s identity is verified by transmitting the information to central controller 12 which then matches the username and password against a particular account in donor account repository 44 at step 122 . a representative screen shot of the donor log - in page is shown in fig5 . if a correct username and password has been provided by the donor , at step 124 , central controller 12 transmits that portion of donor account data 48 that corresponds to the donor &# 39 ; s account information to donor interface 16 . the donor may then select to view its account information including , but not limited to , the account &# 39 ; s balance , grant history , contribution history , vouchers , and investments as shown in step 126 . the donor may also choose during this step to transfer additional monies into the account or provide suggestions regarding donations to particular philanthropic organizations . referring now to fig7 - 9 , a donor may select a field ( s ) 100 from which to search for a desired philanthropic organization at step 128 . searchable field ( s ) 100 includes , but is not limited to , a philanthropic organization &# 39 ; s name , a keyword , a geographic location , an organization type , a ntee identifier , program types , and populations served . a screen shot is shown of a search screen provided by the graphical user interface of controller 12 in fig7 . the donor inputs the desired information into the relevant field 100 thereby requesting controller 12 to search within the fields 100 and search criteria inputted as shown in step 130 . for example , the donor may want information regarding philanthropic organizations located in the kansas city urban core that focuses on civil rights and social action programs . the donor would either input or select from drop - down menus these search criteria in the geographic location and program type fields . once the search criteria have been selected , the donor transmits them to central controller 12 . this is done by clicking on a “ search ” button , or functionally - equivalent action , located on the search screen provided by the graphical user interface . the search criteria are received by controller 12 and checked for matches against philanthropic organization repository 42 in step 132 . philanthropic organization data 46 meeting the search criteria is then copied or otherwise transferred from repository 42 and transmitted to donor interface 16 for viewing by the donor in step 134 . fig8 shows a screen shot of the search results . at step 136 , the donor may choose to start over and enter new search criteria in fields 100 or the donor may choose to refine the search criteria to narrow the number of results achieved . if , however , the donor is satisfied with the search results , the donor may select a particular philanthropic organization developed by the search for viewing at step 138 . once selected , a screen is provided having the data 46 applicable to the philanthropic organization selected by the donor thereon at step 140 as shown in fig9 . data 46 may be provided in a report or other easily - viewable format . after reviewing data 46 , the donor may choose to view additional available data 46 at step 142 , get a more detailed report containing data 46 at step 144 , add data 46 to a list of philanthropic organizations of interest maintained as donor account data 48 at step 146 , or make a donation , pledge , allocation or the like to the philanthropic organization ( s ) selected at 148 . if the donor has elected to allocate funds , the donor inputs a request to allocate funds from the donor &# 39 ; s account to the selected philanthropic organization at step 150 . the request is transmitted to central controller 12 where an order to so allocate the donor &# 39 ; s funds is generated at step 152 . finally , at step 154 , the order is fulfilled and donor account data 48 is amended to reflect the allocation of funds to the selected philanthropic information . it will be appreciated by those skilled in the art that the order to allocate funds may include transactions actually transferring such funds from one account to another or may simply provide instructions to the operator of controller 12 that such a transfer should be initiated . in an off - line embodiment of the present invention , donors communicate in an off - line manner with central controller 12 . rather than sending electronic mail or using web - based servers , donors use a telephone , fax machine , postal mail , or other off - line communication tool . for example , the donor may call central controller 12 and be connected with an agent . the donor may request account information data 48 or philanthropic organization data 46 . the donor also provides a unique id , username , password or private key so that central controller 12 can authenticate the donor &# 39 ; s identity . the agent puts this data into digital form by typing it into a terminal or other input device 34 and retrieves data 46 and / or 48 to convey to the donor . in an alternative embodiment , the donor calls central controller 12 and is connected with a conventional interactive voice response unit which allows the donor to enter an account number or other data without the aid of a live agent . the donor initially selects from a menu of subjects using the touch - tone keys of a telephone , and then the call is either directed to a live agent specializing in that subject area , or the donor is prompted for further information . the foregoing description of the embodiments of the invention has been presented for purposes of illustration and description , and is not intended to be exhaustive or to limit the invention to the precise form disclosed . the description was selected to best explain the principles of the invention and practical application of these principles to enable others skilled in the art to best utilize the invention in various embodiments and modifications as are suited to the particular use contemplated . it is intended that the scope of the invention not be limited by the specification , but be defined by the claims set forth below . | 6 |
looking generally at fig1 a a motor is shown and generally designated by the numeral 10 . the motor includes among other features a rotor assembly 12 having a rotor 14 and a drive link 16 having an engagement end 18 . the drive link 16 is normally attached to a shaft 20 which provides power to the drive link 16 . this general configuration of a motor is known in the art . however , one of the improvements of the current disclosure is the rotor 14 having an inner surface 22 with a plurality of internal projections 24 , which can also be described as teeth 24 . the rotor 14 has an initial fatigue life and more specifically the teeth 24 have an initial fatigue life wherein the initial fatigue life of the teeth 24 of the inner surface 22 of the rotor 14 have been increased by the induction of compressive stresses as indicated by depressions 26 in fig2 . the manifestation of the compressive stresses by the depressions 26 in the teeth 24 improves the fatigue life of the teeth 24 of the inner surface 22 of the rotor 14 . as best illustrated in fig2 , the depressions 26 are preferably positioned along the entire width of the inner surface 22 of the rotor 14 . additionally , the circumferential base section 28 of the inner surface 22 can also contain the depressions 26 thereby increasing the overall fatigue life of the inner surface 22 . preferably both sides 30 and 32 of each tooth 24 have been introduced to the compressive stresses and exhibit the depressions 26 . also included is the drive link 16 having an outer surface 34 substantially corresponding with the inner surface 22 of the rotor 14 . the outer surface 34 of the drive link 16 also includes initial fatigue life which has been increased by the induction of compressive stresses in the outer surface 34 as manifested by depressions 36 as best seen in fig3 . the external projections 38 , which can also be described as teeth 38 , of the engagement end 18 of the drive link 16 have been preferably subjected to compressive stresses along the full width of the engagement end 18 and on both sides 40 and 42 of each tooth 38 . the drive link 16 , and more specifically the engagement end 18 of the drive link 16 includes an exterior circumference 44 that substantially corresponds with the base section 28 of the rotor 14 . this exterior circumference 44 is also preferably subjected to the compressive stresses to increase the fatigue life thereof . now referring generally to fig4 a - 4f , an exemplary method of producing an improved rotor and / or improved drive link is shown . the method includes providing a rotor 14 having an inner surface 22 with the teeth 24 . spherical indenting elements 46 ( fig4 c ), which can also be described as shot 46 , are also provided . the method includes forceably pressing the shot 46 against the inner surface 22 of the rotor 14 to induce compressive stresses in the rotor 14 to improve the fatigue life of the rotor 14 . the inducement of these compressive stresses is best illustrated by the depressions 26 as previously discussed . the method preferably includes forceably pressing the entire width of the inner surface 22 of the rotor 14 with the shot 46 as well as both sides 30 and 32 of the each tooth 24 as well as the base section 28 between the individual teeth 24 with the shot 46 . in a preferred embodiment the drive link 16 , with its outer surface 34 substantially corresponding with the inner surface 22 of the rotor 14 , is used to forceably press the shot 46 into the inner surface 22 of the rotor 14 . additionally , the shot 46 can be pressed between the outer surface 34 and inner surface 22 such that both the outer surface 34 and inner surface 22 are compressively stressed , or prestressed , to increase fatigue life , durability , and wear characteristics of both the rotor 14 and drive link 16 . alternately described , the method can include using a static load , or fixed load , to compressively stress , at individual locations , the inner surface 22 of a rotor 14 and the outer surface 34 of a drive link 16 in order to increase the wear characteristics , for example the fatigue life , of the rotor 14 and drive link 16 . this static load can be applied through the shot 46 that can create the depressions 26 and 36 in the rotor 14 and the drive link 16 , respectively . referring back to fig4 a - 4f , an exemplary method of producing the rotor and / or drive link can be described as follows . an assembly unit 50 is assembled to control the movement of the rotor 14 and drive link 16 . more specifically the assembly unit 50 can restrict and contain the rotor 14 , drive link 16 , and the shot 46 before , during , and after the application of the force used to impart the compressive stress in the parts 14 and 16 . the assembly unit 50 includes a bottom base 51 which can include a counter bore 54 on the center to allow various size rotors and drive links to be processed . a plunger 56 is placed into the counter bore 54 to establish a centering location for the rotor . this plunger 56 can include a plate 55 and stem 57 as shown . next the rotor is inserted such that the stem 57 passes through the opening 13 of the rotor 14 . the shot 46 , which can also be described as balls 46 , is inserted into the opening 13 of the rotor 14 . preferably this shot 46 has a diameter in the range of approximately 0 . 5 millimeters to 4 . 0 millimeters . next the shot 46 can be mixed , stirred , or otherwise shifted or moved to facilitate that the inner surface , or at least the bottom portion of the inner surface , is substantially covered with the shot 46 . next a plunger rod 58 is inserted onto the stem 57 of the plunger 56 and turned such that the splines 60 of the plunger rod 58 engage with the teeth 24 , which can also be described as rotor splines 24 , of the rotor 14 . in a preferred embodiment the plunger rod 58 is replaced with a drive link 16 having an engagement end 18 which corresponds to the rotor 14 . a retaining cap 62 is placed over the base 51 , which can also be described as housing 51 , and secured into place with fasteners , such as bolts . if needed a plunger alignment sleeve ( not shown ) can be positioned around a plunger rod to ensure proper force transfer . next the assembly unit 50 is positioned in the bay of a press 64 . retaining cap spacers 66 can be applied around a plunger rod 58 to hold the retaining cap in position and to keep the cap 62 from separating from the housing 51 . the press 64 is then brought down and brought into contact with first the retaining cap spacer 66 and then the plunger rod 58 . the hammer 68 of the press 64 engages the plunger rod 58 and continues pressing until a desired force is reached . preferably this desired force is 25 tons , but can vary according to application and the type of metal of which the rotor 14 and / or drive link 16 are comprised . preferably this force is held for a desired period of time and then released . this length of time is preferably approximately 5 seconds but can vary as desired . preferably the force is then reapplied for another time period to ensure the application of proper compressive stresses into the parts . in one embodiment this application of force in the assembly unit imparts the preferred compressive stresses in the bottom section of the rotor . the assembly unit 50 can then be disassembled , the rotor flipped , and the process repeated until the other half of the rotor has been processed . in an alternate embodiment this force is applied throughout the full rotor in a single application . various tests have been performed on rotors made in accordance with the current disclosure . these tests determined that after more than 806 , 000 motor revolutions there was an absence of noticeable and / or discernible chipping , nicks , pitting , or cracks in the teeth of the rotors . this is typically unprecedented in the metal parts industry and can be explained by the theory that the compressive stresses have created depressions and resist the effects of imposed bending stresses from external loads during the operation of the motors . as such these surfaces treated are much harder and fatigue resistance is greatly improved . some metal items made in accordance with the current disclosure went through more than 1 , 000 , 000 test cycles before developing a failure point , or a chip on one of its teeth . the applicants are unaware of any prior art metal rotors that achieve these levels . the test data measuring the level of residual compressive stress in a metal part , or rotor , showed marked improvement in comparison to conventional metal rotors . for example , the level of residual compressive stress in a rotor made in accordance with the current disclosure measured 50 , 000 psi . the level of residual compressive stress in conventional rotors that had not been subject to the current disclosure measured 0 psi . in increased levels of compressive stress are believed to directly equate to longer life of the part . the test data indicates that rotors and drive links made in accordance with the current disclosure could increase this level to 150 , 000 psi . additionally , parts made in accordance with the current disclosure possessed a recognizably more uniform residual compressive stress distribution than conventional parts , which can reduce the likely of weak spots in the rotor . additional benefits received from the exposure of the parts to the compressive stresses and the subsequent depressions formed in the parts therein could also lead to improved rotor and / or drive link performance . for example , these depressions are believed to provide locations where islands of contained fluid , such as oil or lubricant , were stored during operation of the motors . this in essence provides a self - lubricating surface that can reduce friction in the operation of the rotors , drive links and motors . this can further facilitate a longer fatigue life and reduced wear on the parts . thus , although there have been described particular embodiments of the present invention of a new and useful method for imparting residual compressive stress in metal parts , it is not intended that such references be construed as limitations upon the scope of this invention except as set forth in the following claims . | 5 |
as required , detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention , which may be embodied in various forms . therefore , specific details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention in virtually any appropriate manner a system designed to measure the conductivity of fluids in a closed fluid system by using a pre - calibrated disposable in - line conductivity sensor is shown in fig1 . the conductivity sensor assembly is generally designated as 100 . the assembly 100 is designed to be integrable with a fluid circuit and to be disposable . contained with the conductive sensor assembly 100 is a short tubular fluid conduit 102 , designed for a particular manifold flow rate range of the fluid circuit . typically , the fluid conduit 102 is tubular and has a diameter between about 3 mm and about 25 mm ( about ⅛ inch and about 1 inch ). the flow conduit 102 is made of a polymer such as a polyolefin , for example polypropylene , but any other appropriate plastic tubing or material may be substituted . the tubing material should be suitable for engaging and containing the fluid being handled , such as valuable proteins , biotechnical compositions or pharmaceutical solutions . the flow conduit 102 has molded - in fluid - tight connections 103 and 104 , which may consist of luer , barb , triclover , or any connection method suitable to connect the flow conduit 102 in a processing system or fluid circuit , such as the illustrated polymeric tubing 106 . a sensing portion or conductivity sensor 108 protrudes through the wall of the conduit in a manner that will be more evident in the subsequent discussion and from the drawings . leads such as the illustrated electrical connecting wires 110 connect the conductivity sensor 108 to a conductivity readout device or user interface 112 . the user interface , generally designated as 112 , is any computer like device that communicates with the sensor 108 and measures conductivity by sending and receiving both digital and analog electrical signals along the leads 110 . the user interface 112 has a display 114 to display information , for example , the conductivity reading , the temperature reading , and information stored on the conductivity sensor 108 relating to the calibration , validation and tracking of the sensor . fig2 is a more detailed view of the conductivity sensor assembly 100 . the housing 200 of the assembly 100 preferably is over - molded with a durable material such as a hard polyurethane polymer such as tpe . the durable housing material seals and protects the interior components from moisture and outside contaminants . the sensor 108 can be further protected by a sheath 202 as illustrated . the fluid conduit 102 traverses the assembly 100 such as along its width as illustrated . electrodes 204 are in electrical communication with the interior of the fluid conduit 102 . in the illustrated embodiment , the fluid conduit is intersected by four electrodes of the conductivity sensor 108 . these electrodes 204 can be positioned along the interior of the conduit 102 , such as at the middle portion of the conduit . gold - plated electrodes can be used such as ones that are about 1 mm to about 2 mm in diameter or between about 0 . 025 inches to 0 . 05 inches in diameter . such electrodes preferably are arranged in - line approximately 2 to 2 . 5 m ( about 0 . 08 inch to 0 . 10 inch ) apart . in the illustrated embodiment , the electrode pins 204 are press - fitted into and through four linearly arranged holes in the wall of the fluid conduit 102 and extend into the hollow interior of the fluid conduit 102 . typical protrusion into the conduit is on the order of about 3 mm to about 13 mm ( about ⅛ inch to about 0 . 5 inch ). the electrodes 204 are epoxied , cemented or otherwise sealed to the wall of the fluid conduit 102 to prevent leaks or contamination . additionally , the electrodes 204 are in electrical communication with their respective traces on the sensor 108 . in other embodiments , the electrodes 204 may only have two electrodes or pins rather than four of the preferred embodiment . in addition , the electrodes may be constructed from other materials , such as stainless steel wire , titanium wire , or any other non - corrosive material . disposability is a criteria to be considered in selecting these or any other materials of the device . fig3 shows a component view of the fluid conduit 102 , sensor 108 , and sheath 202 . the illustrated sheath 202 has a top portion 302 and a bottom portion 304 . the illustrated electrodes 204 are press - fitted into and through the wall of the fluid conduit 102 and are connected to the printed circuit board ( pcb ) 306 of the conductivity sensor 108 . the preferred pcb 306 is a double sided pcb with conductive solder traces . each pin of the electrodes 204 is in direct contact with its respective trace , and each is shown soldered onto the printed circuit board ( pcb ) 306 . opposite the electrodes 204 , the pc 3 306 is wedged between two rows of five pins of a miniature , 8 - pin din connector 308 . these five pins of the din connector 308 are in direct contact with the pcb 306 and are soldered to the pcb 306 . the three remaining pins of the din connector 308 are wired and soldered to the pcb 306 . the end of the sensor 108 is capped and sealed by the cap - ring 310 . the din connector 308 is detachably connected to the user interface 112 by the connecting wires 110 . each pin of the din connector 308 is associated with an individual wire of the connecting wires 110 . fig4 a shows the top view or the component view of the sensor 108 . the electrodes 204 are connected to the underside of the pcb 306 . a surface - mounted thermistor 402 is in thermal contact with two of the conductivity electrode pins when four are provided . a second , important function of the thermistor is to act as a pull - up resistor for the non - volatile memory chip , thereby assuring proper functioning of the memory device . the thermistor 402 is used to monitor the temperature of the solution in the fluid conduit 102 , via thermal conductance , such being transmitted to the user interface 112 . the user interface 112 reports the solution temperature data and utilizes the temperature data to correct or normalize the solution conductivity reading . a sensor - embedded non - volatile memory chip or an eeprom 404 is mounted on the surface of the pcb 304 . the non - volatile memory chip or eeprom 404 is used to store sensor - specific information . this information can be called up , displayed and printed out , on demand , by the user interface 112 . the pcb 306 also contains a surface - mounted capacitor 406 that is visible in fig4 a . fig4 b is an illustration of the underside of the pcb 306 in the four electrode embodiment . the electrodes 204 are soldered to their respective traces 410 , 411 , 412 , and 413 . fig4 b also further demonstrates the wedging of the pce 306 between the pins of the din connector 308 . fig5 a is a plan view of the underside of a pcb 306 a of the conductivity sensor 10 a . hand soldered connections 501 and 502 to the pcb connect two pins 503 , 504 of the 8 - pin din connector 308 a that are not in direct contact . fig5 b is an elevation view of the conductivity sensor 108 a . fig5 b also shows how the pcb is sandwiched between the pins of the din connector . the low profiles of the capacitor 406 a , non - volatile memory chip 404 a and the thermistor 402 a are also evident in fig5 b . fig5 c is a plan view of the conductivity sensor 108 a that is shown in fig5 a and fig5 b fig6 is an electric circuit diagram illustrating the various connections of the sensor 108 in the preferred embodiment that is illustrated . four connections from the 8 - pin din connector 308 are connected to the four pins of the electrode 204 . one pin of the din connector 308 provides a 5 . 0 volt power supply to the capacitor 406 , the non - volatile memory chip ( or eeprom ) 404 , and a bidirectional serial data line 602 . one pin of the din connector 308 provides the ground for the capacitor 406 and the non - volatile memory chip ( or eeprom ) 404 . the non - volatile memory chip ( or eeprom ) 404 uses the bi - direction serial data line 602 and a serial clock line 604 to communicate with the user interface . different non - volatile memory chips or eeproms have different protocols , which are known in the art . in this embodiment , the serial data and serial clock lines allow a user interface 112 or a calibration device to read , erase , and write data to the non - volatile memory chip 404 . the serial data line 602 is an open drain terminal . therefore , the serial data line requires a pull - up resistor 606 connected to the voltage source coming from the din connector 308 . in this embodiment , the thermistor 402 also serves as the pull - up resistor 606 . the sensor - specific information is electronically entered into the non - volatile memory chip 404 during factory calibration of the conductivity sensor 108 . the sensor - specific information may include the following : cell constant ( k ), temperature offset , the unique device id , and the calibration date , the production lot number of the sensor , the production date of the sensor , the type of fluid used for calibration , the actual temperature of the fluid used , and “ out - of - box ” sensor performance value . during production , small differentiations in the electrodes 104 , the respective angles of the electrodes , and the gaps between the individual electrodes will result in different conductivity readings for each sensor produced . these differences can significantly affect accuracy . in keeping with the invention , these differences are successfully addressed by having each sensor normalized or calibrated as a part of its manufacturing procedure . in the illustrated example , each conductivity sensor 108 is calibrated using certified 0 . 100 molar kcl ( potassium chloride ) solution maintained at 25 . 0 ° c . the conductance , which is dependent on the cell geometry and the solution resistivity , is determined by measuring the voltage drop across the electrodes . the measured conductance together with known solution conductivity allows the calculation of the sensor - specific cell constant ( k ). the cell constant ( k ) is determined by the following equation : [ solution conductivity , ( s / cm )]/[ conductance ( s )]=[ cell constant , k , ( cm − 1 )] the sensor - specific cell constant ( k ) is then stored in the non - volatile memory 404 of the conductivity sensor 108 . for example , the solution conductivity for a 0 . 100 molar kcl solution is known to be 12 , 850 μs ( or 0 . 01285 s ) at 25 . 0 ° c . the typical measured conductance for a 0 . 100 molar kcl solution using a sensor with a ⅛ inch luer conductivity cell with a 0 . 10 inch electrode separation is 0 . 0379 siemens . using the equation above , the corresponding cell constant ( k ) for the particular disposable sensor of this illustration is calculated to be 0 . 339 cm − 1 . once the cell constant ( k ) is calculated it is stored on the sensor . the user interface will recall the cell constant ( k ) from the sensor . when undergoing normal operations , the user interface 112 measures the conductance in siemens of the solution flowing through the fluid conduit 102 by passing a current through the electrodes 204 and measuring the current across the two inner electrodes 204 . the user interface 112 will then use the cell constant ( k ) for this particular disposable sensor to determine the conductivity of the solution flowing through the fluid conduit . the user interface calculates the solution &# 39 ; s conductivity by multiplying the measured conductance by the cell constant ( k ), as demonstrated in the following equation : [ cell constant , k , ( cm − 1 )]×[ conductance ( s )]=[ solution conductivity , ( s / cm )] the sensor , once calibrated , provides a linear response for nist traceable standard solutions ranging from 1 to 200 , 000 μs . the temperature of a solution will also affect its conductivity . as a result , the sensor must also measure and account for the temperature of the solution to achieve an accurate conductivity measurement ordinarily , un - calibrated thermistors will have a variance of ± 5 % between their measured reading and the actual temperature . a calibrated thermistor may achieve a variance of ± 1 % or less . in this regard , a sensor - specific temperature offset is calibrated at the factory . to determine the temperature offset , temperature readings are made while a 25 . 0 ° c . kcl solution is pumped through the fluid conduit and over the electrodes . a comparison is then made between the temperature reading of the un - calibrated thermistor on the sensor ( tref ) with that of a nist - traceable thermometer or thermistor ( tsen ). the difference between the two readings is the temperature offset ( tref - tsen = tempoffset ). the temperature offset may have either a positive or a negative value . the sensor - specific temperature offset is then stored in the non - volatile memory on the sensor . each sensor has an “ out - of - box ” performance variance value which is also stored on the sensor , typically in the non - volatile memory chip . this “ out - of - box ” value is a statistically derived performance variance ( measured in 0 . 100 molar kc 1 at 25 . 0 ° c .) that represents the maximum measurement error for that specific sensor within a 98 % confidence limit . the statistically derived variance value is based on the performance analysis of all calibrated sensors within a production run , typically of between about 100 and about 500 sensor assemblies . the factory determined performance variance represents a predictive , “ out - of - box ” sensor performance level . this statistical treatment is analogous to and representative of a sensor validation procedure . factory pre - validated conductivity sensors are thereby provided . the meaning of “ pre - validated ” is further illustrated herein , including as follows . in the illustrated embodiment , each conductivity sensor undergoes two factory measurements . the first measurement involves sensor calibration and determination of the specific cell constant ( i . e . response factor ) using a 0 . 100 molar kc 1 solution at 25 . 0 ° c . as described herein . in another separate and distinct measurement with 0 . 100 molar kcl solution at 25 . 0 ° c ., the solution conductivity is experimentally determined using the pre - calibrated sensor when taking into account the experimentally derived solution conductivities for all pre - calibrated sensors , the mean conductivity value closely centers around the theoretical value of 12 , 850 μs with a 3 - sigma standard deviation of +/− 190 μs or +/− 1 . 5 % an operator may access this information via the user interface 112 or conductivity monitor . in addition to the calibration information , such as the cell constant ( k ) and the temperature offset , the sensor - specific device id , calibration date , and statistical information are store in the non - volatile memory . the device id is stored as a string of numbers , for example : nn - ss - xxxx - mmyy . in this example , the variables represent the sensor lot number ( nn ), fluid conduit size ( ss ), the device serial number ( xxxx ) and the manufacturing date by month and year ( mmyy ). for example , sensor containing the device id of 02 - 02 - 0122 - 1105 means that this sensor was the 122 nd sensor made in lot 02 of conduit size 02 ( a fluid conduit with a diameter of ⅜ ″ or 9 . 5 mm having a barb connector ), manufactured in november of 2005 . in this illustration , the sensor - specific calibration date or the date on which the sensor was calibrated using 0 . 100 molar kcl solution at 25 . 0 ° c . is also stored in the sensor &# 39 ; s non - volatile memory as a separate data entry . additionally , statistical information or statistical data about the entire lot may also be stored in the non - volatile memory . for example , the average cell constant for lot 122 may be stored in the non - volatile memory of each sensor in lot 122 . the standard deviation for cell constants for each lot may also be stored ( i . e . “ out - of - box ” variance value ) in the non - volatile memory of each sensor produced in that lot . this allows the user to determine whether a particular sensor is within the statistical range to achieve the proper margin of error for a specific experiment or bio - processing operation . as those skilled in the art will appreciate , other known statistical methods may be utilized , the results of which may be stored in the non - volatile memory on the sensing device . in addition to storing the cell constant ( k ), temperature offset , device id , the calibration date , and other information in the non - volatile memory on the sensor , a summary of this information may be printed on the outside of the sensor . this information may be consulted by the user , used to later re - calibrate the sensor , and allows the user to input the printed information directly into the user interface . some or all the information which is stored in non - volatile memory may also be printed or etched on to the sensor in the form of a barcode or label containing a barcode . as shown in fig7 , an etched or printed label 702 containing one or more barcodes 702 a and 702 b is affixed to the exterior housing 701 of the sensor assembly 700 . the sensor assembly has an 8 - pin din connector 704 which operates as described above . the sensor assembly also has a fluid conduit 706 , designed for receiving fluids at particular manifold flow rate range of the fluid circuit . the barcodes encode some or all of the sensor - specific information contained in the sensor memory device , eeprom or memory chip . the barcodes are not affected by gamma or electron - beam irradiation . thus , if the sensor memory is erased , becomes non - function , or is destroyed , the sensor - specific information is recoverable from the barcodes affixed to the sensor housing 701 by using a barcode reader or scanner . as shown in fig8 , a handheld optical barcode scanner 800 is hooked up to a digital i / o port of the user interface device or monitor 112 . additionally , the sensor 700 is also connected to the user interface 112 via the 8 - pin din serial port 704 as described above . the user interface 112 has software for connecting with a barcode scanner 112 and decoding the barcode label 702 on the sensor 700 and memory for storing the information read from the barcode . by scanning the barcode with the barcode reader 800 , the sensor specific information is read and stored by the user interface 112 . the sensor specific information is then accessible to the user interface 112 such that the user interface 112 may use that information to calculate the sensor - specific response , when fluid or solution is passed through the fluid conduit 706 , the user interface 112 collects analog measurements from the sensor . the user interface 112 then uses this raw analog data along with the sensor - specific calibration factor ( i . e . the cell constant ) and the temperature offset factor ( tempoffset ) obtained from the barcodes to calculate the sensor - specific response ( i . e . the actual conductivity of the fluid ). as shown in fig7 the calibration factor is printed on the label as “ cf 0 . 182 ” and the temperature offset is printed as “ to − 06 .” other types barcodes or marking conventions may be used other than the linear barcodes as shown in fig7 . for example multidimensional barcodes , 2d barcodes or matrix codes may be used in place of the linear barcodes . the barcodes may also be affixed or etched on portions other than the sensor housing , such as on the fluid conduit 706 or the shipping bag or container an important sensor design consideration is accessibility of the sensor analog circuitry ( for example , the circuit connected to the thermistor and electrodes ) by the user interface 112 , even when the sensor memory device is non - functional or destroyed . experimentation by the applicant suggests that the analog circuitry of the sensor as depicted in fig2 - 6 is unaffected by gamma or electron - beam irradiation . thus , separation of analog circuits and digital circuits ( i . e . circuits to the memory device ) of the sensor is desirable . by separating the analog and digital circuits , the analog circuits maintain functionality and can provide the user - interface 112 with raw data . as gamma or electron - beam irradiation renders the memory chip or eeprom non - functional , it is contemplated that sensor units may be manufactured without memory chip . in these embodiments , the analog components are manufactured and assembled into sensors . the sensors are validated and the sensor specific information is then printed on the sensors or shipping bags in print or barcode form . the sensors are then placed in shipping bags or other suitable containers , irradiated via gamma rays or electron - beam , and then delivered to the user . the sensor specific information is entered into the user - interface 112 either by a barcode scanner 800 as shown in fig8 , or manually by the user . this embodiment saves the costs associated with the including the memory chip with the sensor . the present invention also incorporates the method of preparing a sensor for use in bio - pharmaceutical industry , as shown in fig9 , the sensors are first manufactured . the sensors may be manufactured to include analog and / or digital circuits . the analog circuits may be used for data collection purposes , while the digital circuits may be used to store sensor specific information . the sensors are then calibrated and validated using the techniques mentioned above and / or those known in the art . the sensor specific information obtained during the calibration and validation steps is then stamped or printed on the sensor in the form of a barcode or other readable form . if the sensor includes a memory chip , the sensor specific information is also stored on the memory chip . the sensor is then placed in a shipping bag or other container 908 . the container and / or the sensor are then sterilized by autoclaving , time - limited exposure to an ethylene oxide gas , gamma ray irradiation , electron - beam irradiation , or by any other method known in the art 910 . the sensor and container are then stored until they are deliver to the user 912 the user then removes the sensor from the shipping bag or other container 914 . the user then connects the sensor to the user interface 916 . if the sensor includes a memory chip containing sensor specific information , the user interface downloads that information 918 . otherwise , the user uses a barcode scanner connected to the user interface to read and enter the information into the user interface 920 or enters the sensor specific information found on the label 922 . either before or after entering the sensor specific information , the sensor is connected to the in - line system , closed - circuit or fluid transfer system 924 . the user interface and the sensor are then used to collect data 926 , such as conductivity , from the fluid passing through the system . because the sensors are designed to be disposable , at the end of its life cycles the sensors may be destroyed , thrown out , or recycled . the aforementioned embodiments include a selection of novel sensor materials , innovative circuit designs which separate the analog and digital circuits , labeling to preserve sensor - specific information , and a user interface that includes supporting software and procedures to accommodate , retrieve , interpret and calculate sensor - specific information . these materials , circuits , and labeling , are designed to withstand the conditions of the sterilization methods used by the bio - pharmaceutical industry . it will be understood that the embodiments of the present invention which have been described are illustrative of some of the applications of the principles of the present invention . numerous modifications may be made by those skilled in the art without departing from the true spirit and scope of the invention . | 0 |
referring to the drawings in greater detail and by reference characters thereto , there is illustrated in fig1 a golf club head generally designated by reference numeral 10 and which golf club bead 10 is connected to a shaft 12 by means of a hosel 14 in a substantially conventional manner . golf club head 10 includes a bottom sole 16 which extends between the club head toe generally designated by reference numeral 18 and the club head heel generally designated by reference numeral 20 . club head 10 also includes a top edge 22 , a side edge 24 at toe 18 and a side edge 26 at heel 20 . club head 10 also has a front face generally designated by reference numeral 28 and a back face 30 . front face 28 includes a plurality of grooves 32 in a substantially conventional arrangement . front face 28 , as may be best seen in fig3 has a recessed portion which extends inwardly towards back face 30 with respect to a plane extending between top edge 22 and sole 16 . in the illustrated embodiment of fig3 the recessed portion is of a generally concave configuration . in the embodiment of fig1 to 3 , there is provided a protuberance 34 which is of a generally convex configuration and which is located proximate top edge 22 and extends in a line generally parallel to sole 16 . protuberance 34 extends from toe side edge 24 to a point proximate heel side edge 26 . in use , a golf ball 38 , as best seen in fig3 when hit in a conventional manner with club head 10 such that a lower portion of front face 28 contacts golf ball 38 , will cause golf ball 38 to & lt ;& lt ; roll up & gt ;& gt ; front face 28 and due to the grooves 32 and / or other conventional friction creating means , will impart a spin as indicated by arrows 36 . it will be noted that as golf ball 38 reaches a point adjacent top edge 22 , it will contact protuberance 34 which will further accelerate the rotation of golf ball 38 prior to its separation from club head 10 . as previously mentioned , the distance between sole 16 and top edge 22 preferably approximates the circumference of a golf ball — i . e . approximately 44 mm . as will be seen from fig3 the spin imparted to the golf ball is that normally referred to as & lt ;& lt ; backspin & gt ;& gt ; which normally implies that the ball will attain a greater height and stop relatively quickly upon impact with the ground . various configurations for the recessed portion are possible and reference will now be made to fig4 to 15 illustrating some of the possible embodiments according to the present invention . in fig4 there is illustrated a club head 10 which is of a left - hand configuration , but otherwise identical to that shown in fig1 to 3 . as shown in this figure , front face 28 is of a concave outline and has a curvature as indicated by arrow 40 which is of a substantially uniform radius . in the embodiment of fig5 front face 28 has a first lower arcuate segment indicated by arrow 44 which is of a first radius and a second upper arcuate segment indicated by arrow 46 of a differing larger radius compared to the lower segment . in the embodiment of fig6 golf club head 10 has a recessed portion which is opposite to that shown in fig5 — i . e . there is a first lower arcuate segment indicated by arrow 48 having a larger radius compared to a second lower arcuate segment indicated by arrow 50 which has a smaller radius . in the embodiment illustrated in fig7 golf club head 10 has a lower arcuate segment indicated by arrow 54 which connects to an upper straight or flat segment indicated by arrow 56 . in the embodiment of fig8 golf club head 10 has a lower straight segment shown by arrow 60 which merges with an arcuate upper segment indicated by arrow 62 . fig9 illustrates an embodiment wherein golf club head 10 has a lower straight segment indicated by arrow 66 which connects to an upper straight segment indicated by arrow 68 , with the angles between the segments being designated by angle . in the embodiment of fig1 , golf club head 10 has a lower relatively short straight or flat segment indicated by arrow 72 and an upper relatively long straight or flat segment indicated by arrow 74 . fig1 illustrates a reverse embodiment to that shown in fig1 — there is provided a lower relatively long straight segment indicated by arrow 78 and a shorter upper straight or flat segment indicated by arrow 80 . fig1 illustrates an embodiment wherein golf club head 10 has a front face 28 which is formed of five straight or flat segments 84 , each segment 84 being of a substantially identical height . in fig1 , the arrangement is similar to that of fig1 in that golf club head 10 has a front face 28 defined by ten relatively short straight or flat segments 88 when the segments become small enough , this configuration approaches the concave configuration previously described in fig4 . variations of the above embodiments are illustrated in fig1 and 15 . in the embodiment of fig1 , there is provided a pair of triangularly shaped flat sections 92 divided by a concave portion 94 which extends diagonally across front face 28 of golf club head 10 from proximate the point of juncture of sole 16 and heel side edge 26 to a point proximate the point of juncture of top edge 22 and toe side edge 24 . the reverse configuration is illustrated in fig1 wherein flat sections 96 are separated by a concave portion 98 which extends diagonally upwardly from proximate the point of juncture of toe side edge 24 and sole 16 to proximate the point of juncture of top edge 22 and heel side edge 26 . it will be seen from the above that many different arrangements are possible to provide a recessed portion within front face 28 . these embodiments are intended for illustration of the possibilities and it will be understood that further modifications may be made thereto without departing from the spirit and scope of the invention . | 0 |
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the term module refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that execute one or more software or firmware programs , a combinational logic circuit , and / or other suitable components that provide the described functionality . referring now to fig1 , a hard disk drive system 100 is shown to include a processor 110 that performs data and / or control processing . the processor 110 executes instructions that are stored in a boot rom 108 . the processor 112 can also include an analog - to - digital converter 112 . a controller 114 transmits and receives application data with an interface 118 of a host device 120 via an interface 124 . the interface 124 can be a standard type established by industry . by way of non - limiting example , these types include serializing / deserializing ( serdes ) types such as serial advanced technology attachment ( sata ), integrated device electronics ( ide ), fiber channel ( fc ), serial attached scsi ( sas ), secure digital input / output ( sdio ), universal serial bus ( usb ), multimedia cards ( mmc ), high - speed multimedia cards ( hs - mmc ), advanced technology attachment ( ata ), or other interface . the controller 114 also transmits and receives data , write data and control data to a read / write channel 130 . the read / write channel sends write data to and receives read data from a preamplifier 140 that includes one or more write amplifiers 142 and one or more read amplifiers 144 . one or more control signal lines 145 connect the read / write channel 130 to the preamplifier 140 in addition to differential read and write channels . in some implementations , the processor 110 , the controller 114 and the read / write channel 130 are implemented as a system on chip ( soc ) 150 . the soc 150 is attached to a printed circuit board ( pcb ) 154 . a memory module 156 is used to buffer data during operation , store control data , etc . a power circuit 158 , which may be an integrated circuit , controls the supply of power to other components of the hard disk drive system 100 . a spindle / voice coil motor ( vcm ) driver 162 , which may be part of an integrated circuit , receives control signals from the controller 114 and outputs drive signals to a voice coil motor ( vcm ) 164 and / or a spindle motor 166 . one or more decoupling capacitors may be connected to components of the hdd system 100 . referring now to fig2 , the hdd system 100 of fig1 is shown in further detail . components of the hdd system 100 are shown to include integrated system testing ( ist ) modules . depending upon the configuration and / or interconnection of components within the hdd system and / or the type of testing that is desired , some of the components may include master components and / or slave components . for example , the controller 114 in fig2 is designated a master test component and includes a master ist module 200 . since the controller 114 is connected to all of the remaining components of the hdd system 100 , the remaining components include slave ist modules . in particular , the processor 110 includes a slave ist module 204 , the read / write channel 130 includes a slave ist module 210 , the memory 154 includes a slave ist module 214 , the power circuit 158 includes a slave ist module 216 , the spindle / vcm driver 162 includes a slave ist module 218 and the preamplifier 140 includes a slave ist module 220 . skilled artisans will appreciate , however , that there can be more than one master ist module in the system and / or each component may include one or more master and / or slave ist modules as needed . in some configurations , an ist module can be operated by the processor 110 as master using software in a boot rom . such an arrangement allows improved flexibility over a pure hardware arrangement to enhance an algorithm in the boot rom . referring now to fig3 , the hdd system 100 is shown configured to execute several integrated system tests . the hdd system 100 receives test configuration instructions through the interface 124 . the hdd system 100 also sends test results to the host 120 through the interface 124 . an integrated memory module test verifies that the memory module 156 is functional . the test configuration instructions configure the slave ist module 214 to enable a pattern generator 224 and a pattern comparator 226 . the pattern generator 224 can be routed through a first - in first - out ( fifo ) buffer 228 included in the slave ist module 214 . the pattern generator 224 provides a predetermined bit pattern . a buffer / direct memory access module ( dma ) 230 receives the predetermined bit pattern and writes it to an sdram 222 . the buffer / dma module 230 then reads data from the sdram 222 and provides the sdram data to the pattern comparator 226 . the pattern comparator 226 compares the sdram data to the predetermined bit pattern originally provided by the pattern generator 224 . the slave ist module 214 concludes that the memory module 156 is fully functional when the sdram data and the predetermined bit patterns are identical . an interface / sdram test verifies that the interfaces 118 and 124 are able to communicate with the memory module 156 . the test configuration instructions configure the slave ist module 214 to enable the pattern generator 224 and the pattern comparator 226 . the pattern generator 224 communicates the predetermined bit pattern to the controller 114 over a communication path 232 . the controller 114 forwards the predetermined bit pattern to the second interface 124 . during a first section of the interface / sdram test , the test configuration instructions cause the interface 124 to enter a local loopback mode . a local loopback path 234 connects an output of the interface 124 to an input of the interface 124 . the controller 114 reads a returning data pattern from the second interface 124 input and forwards it to the memory module 156 over a communication path 236 . the pattern comparator 226 then compares the returning data pattern to the original predetermined bit pattern provided by the pattern generator 224 . the slave ist module 214 concludes that the communication path between the interface 124 and the memory module 156 is fully functional when the sdram data and the predetermined bit patterns are identical . the master ist module 200 receives the test conclusion from the slave ist module 214 and forwards it to the host 120 . a second section of the interface / sdram test verifies the communication links between the first and second interface modules 118 , 124 . the test configuration instructions open the loop back path 234 and close a loopback path 238 . the test configuration instructions configure the slave ist module 214 to enable the pattern generator 224 and the pattern comparator 226 . the pattern generator 224 communicates the predetermined bit pattern to the controller 114 over the communication path 232 . the controller 114 forwards the predetermined bit pattern to the first interface 118 via the second interface 124 . the loopback path 238 connects an output of the interface 118 to an input of the interface 118 . the controller 114 reads a returning data pattern from the second interface 124 and forwards it to the memory module 156 over the communication path 236 . the pattern comparator 226 then compares the returning data pattern to the original predetermined bit pattern provided by the pattern generator 224 . the slave ist module 214 concludes that the communication links between the first and second interface modules 118 , 124 are fully functional when the sdram data and the predetermined bit patterns are identical . the master ist module 200 receives the test conclusion from the slave ist module 214 and forwards it to the host 120 . a read / write test verifies that the read / write channel 130 is able to communicate with the memory module 156 . the test configuration instructions configure the slave ist module 214 to enable the pattern generator 224 and the pattern comparator 226 . the test configuration instructions also configure the slave ist module 210 to provide a local loopback path 244 between a write precompensation ( wp ) module 242 and a variable gain amplifier ( vga ) 246 . the wp module 242 provides an analog write signal to be applied to the preamplifier 140 . the vga 246 receives an analog read signal from the preamplifier 140 . data processors 240 convert the analog signals used by the wp module 242 and the vga 246 , to digital signals used by the controller 114 . during the read / write test , the pattern generator 224 provides the predetermined bit pattern to the controller 114 via the communication path 232 . the controller 114 forwards the predetermined bit pattern to the read / write channel 130 . the data processor 240 converts the predetermined bit pattern to an analog signal and communicates it to the wp module 242 . the local loopback path 244 communicates the analog signal to the vga 246 , bypassing the preamplifier 140 . the data processor 240 then converts the analog signal back to digital data for communication to the controller 114 . the controller 114 forwards the digital data to the pattern comparator 226 . the pattern comparator 226 compares the digital data to the original predetermined bit pattern provided by the pattern generator 224 . the slave ist module 214 concludes that the communication paths between the memory module 156 , controller 114 and the read / write channel 130 are intact when the digital data and the predetermined bit patterns are identical . the master ist module 200 receives the test conclusion from the slave ist module 214 and forwards it to the host 120 . a second section of the read / write test operates identical to a first section described above , except the test configuration instructions cause the read / write channel 130 and the preamplifier 140 to enter a remote loopback mode . the remote loopback mode opens the local loopback path 244 and uses an internal loopback path 248 of the preamplifier 140 to return the analog signal to the vga 246 . a write test verifies that the write portion of the read / write channel 130 is able to receive data from the memory module 156 . the test configuration instructions configure the slave ist module 214 to enable the pattern generator 224 and a pattern comparator in the slave ist module 210 . during the write test , the pattern generator 224 provides the predetermined bit pattern to the controller 114 via the communication path 232 . the controller 114 forwards the predetermined bit pattern to the read / write channel 130 . the data processor 240 converts the predetermined bit pattern to an analog signal and communicates it to the wp module 242 . the slave ist module monitors and decodes the analog signal . the slave ist module 120 compares the decoded analog signal to the original predetermined bit pattern provided by the pattern generator 224 . the slave ist module 210 concludes that the write portion of the communication path between the memory module 156 , controller 114 and the read / write channel 130 is intact when the decoded analog signal and the predetermined bit patterns are identical . the master ist module 200 receives the test conclusion from the slave ist module 210 and forwards it to the host 120 . referring now to fig4 a , a solder joint testing module 250 is shown . the solder joint testing module tests the integrity of a solder joint 252 between an integrated circuit 254 and an associated pcb trace 256 . each of the ist modules can include one or more solder joint testing modules 250 . the test instructions can then individually configure each ist modules to test selected solder joints associated with a particular ist module and its solder joint testing modules 250 . each solder joint testing module 250 includes a pulse generator 258 , a receiver 260 , and a comparator 262 . the receiver 260 can include the analog - to - digital converter 112 , a peak - detect circuit , and / or other circuits . referring now to fig4 b , waveforms of the solder joint testing module 250 are shown . the pulse generator 258 applies a pulse 264 having a predetermined amplitude and width to the solder joint 252 . the receiver 260 then monitors a resultant waveform produced by interference between the applied pulse 250 and a reflected waveform . if the solder joint 252 is short - circuited to an adjacent solder joint 266 , the reflected waveform will destructively interfere with the applied waveform and the resultant waveform at the receiver 260 will appear similar to a waveform 268 . if the solder joint 252 is open , the reflected waveform will constructively interfere with the applied waveform , and the resultant waveform at the receiver 260 will appear similar to a waveform 270 . the comparator 262 compares the resultant waveform to at least one predetermined parameter , such as amplitude , to determine whether the solder joint 252 is satisfactory . it should be appreciated that the shapes of the resultant waveforms 268 and 270 are examples only and the actual waveforms will be dependent on the waveform of the applied pulse 250 , a distance between the pulse generator 258 and a defect that causes the reflected waveform , and a degree of the circuit failure ( e . g . short circuit vs . lower than desired impedance and open circuit vs . higher than desired impedance , etc .). in some embodiments , the comparator 262 can improve an accuracy and / or repeatability of its determinations by including a digital signal processor ( dsp ) 263 that enhances the resultant waveforms 268 , 270 prior to making the comparisons . the dsp 263 can apply complex digital signal processing to enhance testing for short / open , soft pcb trace , and / or solder connections . referring now to fig5 , steps that are performed by the hard disk drive integrated systems testing are shown generally at 300 . control begins with steps 304 . in step 306 , a test mode is started using the host pins as a test port . in step 310 , a master test component is selected . in step 314 , the master test component sends and / or receives test messages to / from one or more slave test components in the hard disk drive system 100 . in step 318 , connectivity between the master test component and the one or more other components is measured and / or tested . in step 320 , control determines whether there are additional tests to be performed in addition to the connectivity test . in step 320 is true , additional testing is performed in step 322 . control continues with step 324 from step 320 ( if step 320 is false ) or from step 322 . in step 324 , control determines whether all of the slave test components associated with the master test component have been tested . if step 324 is false , control continues with step 328 and selects another component to be tested by the current master test component and control continues with step 314 . if step 324 is true , control determines whether there are other master test components in the hard disk drive system 100 . if step 332 is true , but other master test components is selected in step 336 and control continues with step 314 . otherwise , results of the connectivity and other tests are reported to the host device in step 340 and control ends in step 350 . referring now to fig6 , an hdd system 400 is shown that includes the components of the hdd system of fig1 connected in a daisy - chain configuration . in some implementations , the memory module 156 , the power module 158 , and the spindle / vcm driver module 162 are each implemented in a respective chip that is mounted to the pcb 154 . the controller 114 includes a master ist module 400 . the master ist module 400 controls a pattern generator 404 and receives test results from a pattern comparator 406 . a daisy - chain data path 408 serially links hard disk drive components or nodes . the nodes include the master ist module 400 in the controller 114 , the memory module 156 , the power module 158 , and the spindle / vcm driver module 162 . test data is returned back to the controller 114 . during test operations , the master ist module 402 receives the test configuration instructions and causes the pattern generator 404 to generate the predetermined bit pattern . the pattern generator 404 communicates the predetermined bit pattern ( with and / or without modification by each of the nodes ) through the daisy - chain data path 408 to the memory module 156 , the power module 158 , and the spindle / vcm driver module 162 and returns test data back to the controller 114 . the nodes selectively perform a respective internal test using the predetermined bit pattern and forward the respective test result via the daisy - chain data path 408 to the next node and / or back to the controller 114 . the pattern comparator 406 can read data from the daisy - chain data path 408 and determine whether the returned data meets the predetermined criteria , matches a predetermined bit pattern , and / or has a predetermined relationship with the predetermined bit pattern . the pattern comparator 406 determines that the daisy - chain data path 408 is functional when the returned data meets the predetermined criteria , matches and / or falls within the relationship . if not , the pattern comparator determines that one or more components in the daisy - chain are not functional . the master ist module communicates test result information to the host via the interface 124 . while the teachings of the present invention were described in the context of the hard disk drive systems 100 and 400 , it should be appreciated by those skilled in the art that the present invention is also applicable to other systems . referring now to fig7 , a functional block diagram is shown of a wireless hard disk drive system 100 ′. a host 120 ′ includes an ist module 420 that communicates with the interface 118 . the interfaces 118 , 124 are of a wireless type , such as sdio , and communicate over a wireless channel 422 . the test configuration data can configure the ist module 420 to be included in tests of the soc 150 . by including the ist module 420 in the host 120 ′, the hard disk drive system 100 ′ includes integrated system test capability for the host 120 ′, soc 150 , and / or the pcb 154 . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the present invention can be implemented in a variety of forms . therefore , while this invention has been described in connection with particular examples thereof , the true scope of the invention should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , the specification and the following claims . | 6 |
the silicon rubber mixture of the present invention consists of an appropriate mixture of two different fluid polysiloxanes and a non - toxic , physiologically acceptable contrast material . thus , the silicon rubber mixture according to the invention consists of the following components : ( a ) a linear polysiloxane of low viscosity , preferably e . g . the so - called reactive silicon oil , i . e . a dialkyl -, alkylaryl -, alkenylalkyl - or diarylpolysiloxane which may contain reactive functional terminal groups , i . e . hydroxy , acyloxy , alkoxy or amino . preferred polysiloxane is the dimethyl - polysiloxane - α , ω - diol , the so - called &# 34 ; lms &# 34 ;. physical data of the said compound are as follows : n = 80 - 85 , m = 6 - 7000 , d 4 25 ° c .= 0 . 976 g ./ cm 3 , n d 25 ° c .= 1 . 4043 , 25 ° c .= 80 - 100 m . pa . s . ( cp ). ( b ) a cyclic dialkyl - polysiloxane , which has a very low viscosity . such a cyclic dialkyl - polysiloxane derivative may be e . g . a dialkyl - polysiloxane , e . g . the so - called d 4 ([ r 2 sio ] 4 ). or d 5 ([ r 2 sio ] 5 ). for purposes of the invention the d 4 is highly preferred . its sturcute is [( ch 3 ) 2 sio ] 4 , the octamethyl - cyclotetrasiloxane , the physical data of which are as follows : m = 296 , b . p .= 175 ° c ./ 0 . 1 mpa , d 20 ° c .= 0 . 9558 g ./ cm 3 , n d 20 ° c .= 1 . 3968 , 20 ° c .= 2 mpas ( cp ). the viscosity of the mixture of the linear and cyclic polysiloxanes should be between 10 and 100 mps , at 25 ° c . depending on the desired field of use . ( c ) the mixture contains in a given case , methyl - silicon oil of a viscosity of 5 to 20 mpas which serves also to lower the viscosity . ( d ) the fluid contrast material to be added to the mixture may be a physiologically acceptable silicium organic compound , which contains the iodine atom ( s ) giving the x - ray shadow built into a molecule . according to the invention , preferred contrast material is the bis - iodomethyl - tetramethyl - disiloxane . the iodine atom gives also the possibility of isotope labeling the material , when using e . g . i - 131 . the physical data of the said compound are as follows : m = 414 , b . p .= 134 ° c ./ 1333 , 22 pa , d 4 20 = 1 . 172 g ./ cm 3 , n d 20 = 1 . 5263 . mixtures of a viscosity of higher than 100 mpas may also be applied and non - metallic iodine - containing organic x - ray contrast materials in extracted , solid or fine form may also be used . such materials are used in the angiological diagnostics and are commercial products , i . e . amipaque , uromiro , etc . these materials are to be added to the above components in ground homogenized form . however , use of such materials is difficult and requires more attention and the particle size should be chosen in accordance with the field of application so that the particles do not obstruct the microcatheter and in the case of free embolization the particles do not get into the capillar vascular system . the silicon rubber system according to the invention , i . e . the component of the therapeutical set contains the linear polysiloxane mentioned above under paragraph ( a ) and should contain at least one of the materials under paragraphs ( b ) and ( d ). the therapeutic set contains beside the component a mentioned above , the component b which can be any of the catalysts used for medical purposes in polymerizing cold - vulcanizing gums characterized by providing a fluidity of 8 to 10 min and a hardening time of 20 to 25 min . it has been found that under the prescribed heat sterilizing conditions ( 120 ° c . for 30 mins ) both components contain the original chemical characteristics and the ability to polymerize . furthermore , the materials are acceptable in bacteriological aspects . a further element of the therapeutic set is the microcatheter . depending on the field of use , it may contain one or more lumina . the therapeutic set of the present invention may also contain , beside components a and b and the microcatheter , a balloon head made generally of natural silicone latex . this head has the importance for the first time in endovascular embolization wherein the silicon gum component is vulcanized in the ballon by the effect of the catalyst , thus forming a plug for blocking the said vessel . during free embolization , however , the use of balloon is not essential unless the wanted vascular area is not available otherwise . the microcatheter , provided in a given case with the balloon at its end , is led up to the target vessels or other duct - section . then components a and b are ground and mixed to provide a homogenous mixture and the necessary amount is injected into the catheter through a calibrated tuberculin syringe . the injection is controlled by an x - ray fluoroscopic screen . after the rest of the material has hardened , the catheter is detached from the balloon head by a light , shifting and pulling . subsequently the catheter is removed from the artery together with the silicon rubber vulcanized in the catheter . another object of the invention is the use of the said silicones and the mixture thereof for pharmaceutical purposes . the new material has been provided for the endovascular operation technique for the first time . the material and equipment may be used , however , in any case wherein no direct surgical intervention is possible or external operative approach of the concerned vessels is not advised . the most important fields of the endovascular superelective embolization by means of balloon catheter are indicated among other as follows : 3 . embolization of feeding arteries of highly vascularized tumors in order to promote the direct surgical removal of such neoplasms . as mentioned , the embolization can be carried out by building the balloon into the vessel or other duct section to be blocked . the embolization may be performed , however , in the form of the so - called &# 34 ; free embolization &# 34 ; wherein the mixture of the components a and b according to the invention are injected directly into the pathological vascular area to be blocked , respectively , and the material is vulcanized in the vessel itself . it has been found that the materials and mixture of the invention are non - toxic either in themselves or during vulcanization . thus , a further aspect of the present invention is the use of the materials and the mixture , respectively , described above , in the free - embolization technique . based on animal tests , the above materials were used in about 30 successful human operations within a period of one and a half years in cases which could not be operated directly . it was proved that the hardened silicon remained in the natural rubber balloon resulting in a definitive occlusion of the target spot . following the x - ray shadow , the position of the balloon can be seen by a simple x - ray control even years after the operation . in the case of free embolization the position of a polymerized silicon rubber can also be controlled . it has also been found that the materials of the present invention , such as other silicones widely used in the surgery ( i . e . ventricule - atrial shunts , articular and other plastics , dental materials , etc .) are entirely compatible and non - toxic . no infection or abnormal histological reaction could be detected . essentially it is this characteristic which makes possible the free embolization method described above . the following are examples for the silicon rubber mixture of the present invention . component , a 10 g of dimethyl - polysiloxane - α , ω - diol , viscosity 50 to 2000 mpas . 1 g . of powdered , dried x - ray contrast material ( uromiro ), passed through a sieve of a size of 0 . 65 μm . the mixture is homogenized , and , before use , sterilized in vials . compound b , the catalyst , 1 , 5 ccm of t - 5 ( wacker dental catalyst product ) is also sterilized in vial . mixing of the two components provides a &# 34 ; batch - time &# 34 ; of 8 mins and a polymerization time of 15 mins . the catheter can be imparted after 15 to 25 mins . another possible component a is as follows : 10 g . of dimethyl - polysiloxane - α , ω - diol , viscosity 100 mpas , 2 g . of x - ray contrast material as in example 1 , 2 g . of methyl - silicon oil of dimethyl - polysiloxane basis , viscosity of 19 mpas . the catalyst component b and the amount thereof is the same as in example 1 . 2 . 5 g . of dimethyl - polysiloxane - α , ω - diol , viscosity 100 mpas , 2 . 5 g . of d 4 ( cyclic polysiloxane ), viscosity 4 - 5 mpas , 0 . 75 g . of bis - iodomethyl - tetramethyl - disiloxane ( fluid iodo - containing x - ray contrast material ). the misture is homogenized , and then filled into vials and sterilized . as component b , t - 5 or t - 11 catalysts ( wacker dental catalyst product ) may be used in an amount of 1 ccm . 1 . 35 year old man , miner . after craniocerebral trauma , he developed an extreme large fistula between the right internal carotid artery and cavernous sinus , resulting in typical eye - symptoms , bruit , headache , lesion of the right ii ., iii ., iv - and both vi . cranial nerves . via percutan endovascular catherization the fistula had been closed with 2 detached , siliconized balloons . excellent clinical result , the patient is symptom - free even two years after the operation . 2 . 25 year old man , electrotechnician . severe subarachnoidal bleeding , resulted in transient unconsciousness and hemiplegia on the left . the angiographies proved a congenital arteriovenous malformation of the right cerebral hemisphere . there was no possibility of direct surgical operation , because of the size of the angiom . two main feeding arteries of the vascular malformation have been occluded with superselective balloonembolization . significant clinical improvement : the patient can walk alone , is free of mental disturbance , continues his original profession , has married , and had no more hemorrhages since the operation . 3 . 53 year old woman , teacher . giant saccular aneurysms on the cavernous portion of the left internal carotid artery , resulted in an earlier subarachnoidal hemorrhage and actual lesion of the left iii . cranial nerve . for a safe occlusion , both the parent vessel and aneurysmal neck has to be embolized with a large balloon filled with silicone . the transient postoperative hemiparesis and aphasia as well as the oculomotor paresis have improved , the patient is practically free of symptoms after a period of a year and a half . 4 . 24 year old man . after frequent nasal hemorrhages and definitive obstruction of the nose , a large - size haemangiom of the face had been proved histologically . because of the size and location , the direct surgical operation was unsuccessful . after the embolization of the feeding maxillar arterial branches we succeeded in subtotal surgical removal of this benign tumor . although this method has been applied up until the present only when a direct surgical approach was impossible or too dangerous , there is a real possibility to extend the indication for routine cases of the mentioned diseases too , with better results and less hazard . | 2 |
the present invention is in a post system that includes a number of novel and unique elements . fig1 shows an exploded profile perspective view of one arrangement of post system 20 , hereinafter referred to as system . in fig1 and 2 , the system 20 is shown used for mounting a mail or newspaper tube 21 , hereinafter referred to as tube , cantilevered out from the side of a post 22 . which post 22 , its ground mounting arrangements and fastener components , as set out hereinbelow , are also useful for mounting a mail box as shown in fig1 through 12 , and 17 through 19 . though , of course , the system 20 and the other embodiments therein could be utilized as a post alone , for example a fence post , or could be used for mounting any item , within the scope of this disclosure . the system 20 of fig1 includes a ground stake 23 , shown as a section of angle iron 24 that is pointed at a lower end 25 . the upper or top end of which angle iron section includes a cap 26 fixed thereover that is formed as a square tube with walls 27 with a flat plate 28 arranged thereover . the angle iron section 24 top end is telescoped into which square tube , one of which tube walls includes a bar 27a secured thereacross to present an anchor that binds into the ground wherein the ground stake is driven , inhibiting ground stake movement and withdrawal , as set out below . the flat plate 28 that is arranged across the square tube top end is shown as including a keyhole 28a , that allows an eye bolt 29 head end 30 to be fitted therethrough . which head end 30 is holed at 30a to receive a bolt 31 fitted through a hole 31a formed in tube wall 27 and secured in the opposite tube wall . the eye bolt 29 is thereby secured to the square tube 26 , a threaded end extending at a right angle upwardly from the flat plate 28 . shown in fig1 the eye bolt 29 threaded end 29a is fitted through an open center portion or hole 33 of a ball segment 32 . which opening or hole 33 is tapered outwardly from a lesser diameter bottom end to a greater diameter top end , the bolt threaded end 29a thereby being free to swing across which hole 33 top end . the eye bolt 29 threaded end 29a is fitted thorough a gasket 34 that preferable has a like surface area to the ball segment 32 surface , as shown also in the top plan view of fig8 . shown in fig1 and 7a the eye bolt 29 threaded end 29a is for fitting through an adjustable mount that consists of ball segment 32 with tapered hole 33 and gasket 34 and a square post mount 35 containing a seat . the square post mount includes a center hole 36 that eye bolt 29 threaded end 29a is fitted through with a washered nut 37 turned thereover . the washered nut 37 turned on the eye bolt 29 couples the ball section 32 and seat together with gasket 34 therebetween providing a capability for adjusting the attitude to the vertical of a post 40 secured onto which square post mount 35 , as set out hereinbelow . in another mounting embodiment , as shown in fig4 and 5 , as well as the ball segment and seat mounting embodiment of fig6 a post insert 39 is utilized for receiving post 39 telescoped thereover . shown in fig1 , 7a , 13 and 16 , the post 22 is for telescoping over the square post mount 35 , resting on a lip 38 formed around a lower edge of which mount , the post preferably secured thereon as by gluing , with a snap - in arrangement , or the like , in a manufacturing setting . for attaching the square post mount 35 onto the ball segment 32 , the eye bolt threaded end 29a is fitted through the center hole 36 , extending into the post 22 . so arranged , an operator , not shown , positions the post 22 to a desired attitude to the vertical and fits the washer nut 37 through a portal 40 formed through the post side and onto the eye bolt threaded end 29a . he then turns and tightens that washer nut 37 onto the eye bolt threaded end 29a , compressing a seat 51 formed in the undersurface of which square post mount 35 tightly against the ball segment 32 surface , sandwiching gasket 34 therebetween , and locking the post 22 square post mount end in place with the ball segment 32 . which gasket 34 is formed of a course material to provide a non - slip surface between which ball segment surface and seat coupling . thereafter , a window 41 having shoulders 41a is snapped into to cover over portal 40 , completing mounting . fig1 a shows an exploded view of another embodiment of an adjustable mounting 150 that , like the embodiment of fig1 includes a ball section 151 that may have a smooth or grooved outer surface 152 . the ball section is for fitting into a seat 153 that has a hemispherical surface 154 to accommodate the ball section fitting snugly thereagainst and , like the ball section , may be smooth or scored , for promoting a binding between the engaged surfaces when they are clamped together . to further promote which binding , a washer 155 , can be positioned between the ball section and seat surfaces . such washer 155 is preferably formed of an abrasive material . it may be formed as a complete circle or may be a circle that has had sections removed therefrom , as shown . like the ball section and seat combination of fig1 the seat 153 is positionable to ball section 151 to provide for movement therebetween for adjusting the vertical positioning of a post 156 , shown as a hollow square tube , that the seat is mounted to in a lower end thereof . shown best in fig1 a , the ball section 151 is preferably a hemisphere whose outer surface 152 is score thereover and includes a center hole 157 that is to receive a threaded end 158a of a bolt 158 fitted therethrough . the ball section 151 , as shown , is preferably formed of plastic and includes a number of equal spaced curved ribs 159 , that connect to an apex ring 160 that hole 157 is formed through the center of . the underside of the ribs 159 are for positioning on a top surface of a top plate 162 shown mounted across a top end of a ground stake 161 . the ground stake has a blade 163 as a lower end thereof that , like the angle iron 24 of fig1 is for driving into the ground , an angle plate 163a thereof slicing into the ground , securing the ground stake in the ground . for positioning the ball section 151 onto the top plate 162 a slot 164 is formed on the bias across and through the top surface that is to receive a flattened end 158b of bolt 158 that has a hole 158c formed therethrough . with the bolt flattened end 158b fitted through slot 164 , a pin 165 can be fitted through the bolt hole 158c , prohibiting bolt withdrawal with the bolt threaded end 158a extending out from the top of ball section 151 . to mount the ball section 151 and seat 153 together the bolt threaded end 158a is arranged to fit through a center hole 166 of seat 153 and through a center hole 168 of a washer plate 167 and to receive a nut 169 turned thereover . like the ball section 151 , the seat body , as shown , is preferably formed of plastic and includes a number of spaced apart ribs 170 extending radially from a ring 171 wherethrough the hole 166 is formed . the ribs include curved surfaces 170a for supporting the seat 154 that , like ball section surface 152 , may also be scored , or the like , to increase surface friction . side walls 172 are provided across the rib 170 ends , and an outstanding ridge 173 is formed around the seat body 153 , below the lower edges of side walls 172 . to couple the seat 153 into the post 156 end , the seat body , with the seat surface 154 facing out of the post end , is urged into the open post end until the seat body ridge 173 slides into a slot 174 that has been formed around the post interior , adjacent to the post end . shown in fig1 a - 1c , for convenience , both post ends are shown as including inner slot 174 formed therein . the seat ridge 173 when urged into the post end tends to flex inwardly , contracting upon itself , and upon entering the post slot 174 , will immediately expand into that slot , locking the seat 174 in and across the post end . access to the post interior is provided through a port 175 formed in the post side , above slot 174 to allow nut 169 to be turned onto the bolt threaded end 158a , clamping the ball section 151 and seat 153 together , as shown in fig1 b . whereafter a cover , like the window 41 of fig1 can be installed over the port 175 . to provide for adjusting the position of the seat 153 on the ball section surface 152 , the bolt 158 coupling of pin 165 is intentionally loose to allow for movement of the bolt threaded end 158a across that coupling , which movement is provided for by the formation of the ball section hole 157 to allow a loose fit of the bolt 158 fitted therethrough . accordingly , the bolt 158 can be tilted from the vertical , and that tilt will be reflected in the positioning of the seat 155 fitted thereto that is , in turn , translated to post 156 . so arranged , the post can be positioned to the ground stake so as to compensate for an angle that the stake 161 is driven into the ground and for ground conditions , to mount the post 156 at a desired attitude . in practice , the adjustable mount of the invention allows for up to twenty ( 20 ) degrees of change in vertical attitude of post 156 to the ground surface whereto the ball section 151 is maintained . fig1 b shows the assembled adjustable mount 150 , and fig1 c shows the seat 153 directly secured and rigidly mounted by bolt 158 to a top surface of a concrete slab , supporting post 156 mounted thereto . which arrangement does not allow for adjustment of the angle of the post that is seated on and at approximately a right angle to the concrete surface . in this arrangement the bolt 158 lower end 158d is anchored in the slab of concrete 180 , the bolt threaded end 158a extending outwardly therefrom to fit through the center hole 166 . the seat 153 , in turn , is mounted in the open end of post 156 , and passes through hole 168 in washer plate 167 , to receive the nut 169 turned thereover , rigidly mounting the post 156 onto the top surface of cement slab 180 . fig4 and 5 , show another post 22 mounting embodiment that includes a post insert 39 that is a square open tube that utilizes a tapered washer stack , shown also in fig4 a and 5a , as the post 22 mount rather than the ball segment and seat embodiment , as discussed above . the post insert 39 , like the post mount 35 , is to receive the post 22 telescoped thereover , as set out and discussed hereinbelow . further , it should be understood , other post mounts and tubes and tube configurations , such as round , could be so used within the scope of this disclosure . shown best in fig7 and 7a , the ball segment seat 51 formed across the undersurface of the square post mount 35 of fig1 is hemispherical in shape to conform to the surface of the ball segment 32 . this seat 51 is also shown with the square post mount 35 of fig6 and in the bottom plan view of fig9 . further , it should be understood , where the ball segment seat 51 is set out above as formed in the square post mount 35 or across a lower end of the post insert 39 , that seat can also be formed across a lower end of the post 22 itself , within the scope of this disclosure . which post mounts of fig6 , 7a and 16 , do not include the gasket 34 , but instead employ a roughening at 32a of the ball segment surface to provide a friction surface therebetween , that is shown best in fig1 . a ball segment and seat coupling is thereby provided that allows the post 22 to be tilted across the ball segment 32 surface , as illustrated best in fig7 and 7a , for adjusting the post attitude relative to the top surface 28 of the ground stake 23 . fig4 and 6 , as set out above , utilize a post insert 39 that is adjusted to the vertical for receiving the post 22 end telescoped thereover . to maintain a secure coupling of which post insert 39 and post 40 end , spacers 43 are arranged between opposing surfaces of which post insert and post . which spacers 43 are preferably each a saddle having a center slot with parallel legs thereacross and are formed from a resilient material . the spacers 43 are fitted , as shown in fig4 and 6 , across the post insert top edge 39a and across a top edge of a slot 45 , or slots 45 , that are formed in the side of which post insert . two points of spacers 43 contact with the post 22 interior walls are thereby provided for preventing movement of the post 22 relative to the post insert 39 . as set out above , the embodiments of the invention shown in fig1 , 7 and 7a , as do the adjustable mountings shown in fig1 , 15 , and 16 , all employ variations of ball segment and seat mountings between the ground stake and post mount or post insert . the ball and seat arrangement of fig1 and as shown in fig7 and 7a , is a ball segment 32 for fitting it in a hemispherical seat 51 of the square post insert 35 . a gasket 34 is shown sandwiched between which ball segment and seat in fig1 and the ball segment surface is shown roughened at 32a in fig7 and 7a , for prohibiting relative movement or slippage of the mount components when they are clamped together . functionally , the ball segment and seat arrangements of fig1 , 7 and 7a , are alike , as are the ball and seat arrangements of fig1 , 15 and 16 . except that the mountings of fig1 , 13 and 15 include gasket 34 , while the mountings of fig7 a , and 16 , show as a roughened surface 32a included on the ball segment 32 surface . fig1 and 16 , involve a tubular or cylindrical ground stake 52 , shown best in fig1 as a cylinder 53 , that includes a pointed lower end 54 . the upper or top end of which cylinder includes a cap 55 that is formed as a square tube with walls 56 and with a flat plate 57 arranged thereover . the cylinder 53 top end is telescoped into and secured in which square tube 55 , the flat plate 57 closing off the tube end . which flat plate 57 has a hole 58 formed therethrough that is counter sunk on the flat plate undersurface to receive a tapered undersurface of a the head 61 of a flat head bolt 60 that is fitted therethrough . which bolt 60 functions like the described eye bolt 29 except , of course , it relies on a frictional engagement between the countersunk portion of hole 58 and head 61 undersurface to allow a washer nut 37 to be tightened thereover . otherwise the functioning of which eye bolt 29 and bolt 60 should be taken as being the same . as shown in fig1 and 16 , the cylinder 53 is to be driven into the ground , pointed end first , as a ground anchor . for further anchoring which cylinder 53 , each square tube wall 56 includes a tab 59 cut therein , that cut section then bent outwardly to present an edge to engage and bind into the ground wherein the ground stake is driven , inhibiting its withdrawal . fig1 , shows another post 22 mounting that includes the ball segment 32 secured onto a top surface of a bracket 63 that has a raised center portion and planar sides that are holed for receiving cement fasteners 64 fitted therethrough and driven into a cement , concrete , or like surface , securing the bracket thereto . which bracket 63 raised center portion is center holed to receive the bolt 60 fitted therethrough prior to mounting . while the bolt head 61 is shown for receiving a screw driver blade , it should be understood that a hex shaped head could be so used as head 61 that would accommodate a wrench head fitted under the bracket 63 , to hold that head while the washer nut 37 is turned onto the bolt 60 threaded end . as set out above the open center portion or hole 33 through the ball segment 32 is tapered from a lesser diameter at its base to a greater diameter at its top , to allow for tilting of bolt 31 . which angle of taper , as shown as angle a in fig7 a and 13 ; as set out hereinabove , allows for a change in angle of the angle of post 22 of up to twenty ( 20 ) degrees from a right angle to the ground . preferably ; the hole tapers to provide up to a twenty degrees ( 20 °) change of the post longitudinal axis so as to provide an angle of tilt to the attached post of up to ten degrees ( 10 °) either side of a right angle to the plane of the ground or top surface of a ground stake . this tilting capability allows for positioning the post 22 or post insert 39 back to the vertical so as to compensate for the ground stake the top surface not being horizontal . fig4 through 6 , show another embodiment of a ground stake 65 that includes a platform 66 and pointed stake 67 , which stake is shown as having been pounded into the ground . fig5 shows the stake 67 as having displaced from the vertical in that driving , necessitating a tipping of the post insert 39 to compensate to position the post 22 telescoped thereon to the vertical . hereinabove have been set out a number of ball segment and seat configurations for attaching a post insert 39 onto the top of a ground stake to allow for a tilt of that post insert to where it is in a vertical attitude . fig4 a , 5 and 5a , show another post insert mounting arrangement that also allows for tilting of the post insert 39 . as shown , this tilting arrangement consists of a pair of tapered washers 70 and 72 , that overlay one another forming a stack . in fig4 the washers 70 and 72 tapered surfaces are shown to slope oppositely , with the top and bottom surfaces of which stack thereby being essentially parallel . to provide for washer positioning each washer includes a tab 71 and 73 , respectively , that extends outwardly from the thinnest washer side . shown in fig4 a the tab 71 of the washer 70 extends from one side of the stack , with the tab 73 of the washer 72 shown extending outwardly from the other stack side , indicating that the washer tapered surfaces slope oppositely . so arranged , the washer stack would have essentially parallel top and bottom surfaces . fig5 a shows the tapered washers 70 and 72 as having been turned to where the tabs 71 and 73 align , the tapers overlay one another , providing a tilt to the stack top surface relative to the bottom , as shown in fig5 . this tilt , as shown , is to compensate for the positioning of the ground stake pointed stake 67 being at other than the vertical . functionally , with the tapered washers 70 and 72 positioned to provide a desired angle to the post insert 39 , the washer nut 37 is turned onto the bolt , whereafter the post 22 is installed onto the post insert 39 , as described above . the post 22 mounted to the post mount 35 or is telescoped over the post insert 39 is then useful for : mounting a newspaper tube 21 cantilevered outwardly from the post top end , as shown in fig1 and 2 ; mounting a mail box mount 75 across a top post end , as shown in fig1 through 12 , to receive a mail box thereon ; mounting mail box across the post 22 top end by a frame mount , as shown in fig1 , 20 , 23 and 24 ; mounting a newspaper tube 21 cantilevered from the post 22 top end that , in turn , mounts a mail box as shown in fig1 and 18 , or mounting a mail box onto a horizontal wood beam , as shown in fig2 . the newspaper tube 21 , shown in fig1 and 2 , is preferably an open tube or hollow , the top and bottom sides of which tube at one end , are formed into outwardly extending top and bottom end tabs 80 and 81 , respectively . the end tabs 80 and 81 are each for fitting in one of parallel lateral slots 82 formed across a post 22 side , and each end tab 80 and 81 has at least one , and preferably two holes 83 formed therethrough . to install the newspaper tube 21 cantilevered from the post 22 pegs 85 are passed through the post 22 top end and are individually fitted through the end tabs 80 and 81 holes 83 . this operation is preferably performed manually and accordingly the pegs 85 are preferably formed from a molded material , such as a plastic , and are configured for ease of installation . fig1 and 3c show a first peg 85 embodiment that includes a broad head 86 and tapered body 87 . a locking ridge 88 is shown extending outwardly from the peg body 87 , opposite to broad head 86 . which locking ridge 88 , with peg insertion into an end tab hole 83 , as shown best in fig3 c , extends into the post lateral slot 82 , for preventing peg withdrawal . a second peg 90 embodiment is shown in fig3 a and 3b . the peg 90 , like the described peg 85 , has a broad head 91 and includes a tapered body 92 . rather than a locking ridge , however , the peg 90 includes spaced teeth , serrations , barbs , or threads 93 that are formed along and to extend outwardly from the tapered body 92 , below the broad head 90 . shown best in fig3 b , with the peg 90 installed in hole 83 , a side of one or more of the teeth , serrations , barbs , or threads 93 will engage the tab hole 83 edge , prohibiting peg withdrawal . a cap 95 , shown in fig1 and 2 , is preferably installed onto , to cover , the post 22 open top end . prior to which cap 95 installation the pegs , as described , are fitted through that post open end and into the tab holes 83 . which cap 95 , shown in fig1 through 12 , is replaced by mail box mount 75 , or a mail box mounted thereon . which mail box mount 75 consists of a flat top plate 76 that has downwardly extending right angle flanges 77 that project from along opposite edges . equidistantly spaced plates 78 are secured across which downturned flanges 77 , the flanges and plates thereby forming a square center recess that is for receiving a square post 22 end fitted therein . for providing overlying coupling surfaces where the flanges intersect the post surfaces , opposite side end sections of which post 22 may be removed leaving tabs 79 . shown best in fig1 and 12 , the tabs 79 and plates 78 are to be fitted together in juxtaposition arrangement with holes 79a through each aligned to receive pins 79b fitted therein securing the mail box mount 75 onto the post 22 end . so arranged , the flat top plate 76 is for receiving a mail box secured thereon . fig1 and 18 show another mounting 100 for a mail box 110 . the mounting 100 includes a pair of brackets 101 that are each connected to the ends of a pair of parallel bars 102 . the bars 102 space the brackets 101 apart in parallel relationship forming a rectangular frame . to construct this frame , each bracket 101 includes as a pair of flanges 104 that extend outwardly and parallel from along the top and bottom edges , respectively , of a bracket web . the bar 102 ends are for fitting between which flanges 104 , each receiving a coupling device , that is preferably a pivot , and is fitted through the bracket flanges and a bar end . the bars 102 have holes 105 formed through the mid - portions thereof for receiving fasteners 106 , as set out below . which mounting 100 is either for mounting onto the top surface of the newspaper tube 21 that is cantilevered from a top end portion of post 22 , as shown in fig1 and 18 or onto a post 22 end , as shown in fig1 . to provide for mounting mail box 110 , as shown in fig1 and 18 , the bracket 101 webs , proximate to their ends , include longitudinal slots 103 that receive fasteners , shown as bolts 107 , fitted therethrough and through corner holes formed in a cover 111 of mail box 110 . prior to which mail box 110 mounting fasteners 106 , shown as bolts , are fitted through center openings 105 formed through the bars that are , in turn , fitted through holes formed through the newspaper tube 21 top , with nuts 106a , shown in fig1 , turned over the bolt ends . wood screws can be used in place of bolts 106 and nuts 106a , within the scope of this disclosure . with the frame mounted to the newspaper tube 21 , the mail box 110 is seated , as set out above , and the bolts 107 are fitted through the mail box cover corner holes and through the bracket web slots 103 to receive washers 109 and nuts 108 turned onto which bolt 107 ends , as shown best in fig1 . fig1 shows another framed arrangement for mounting a mail box onto a post 22 end , which post 22 is shown as formed of wood , through it could be formed of solid plastic , or could be tubular with a top end insert , or a like arrangement , within the scope of this disclosure . the frame arrangement of fig1 , like that of fig1 , includes a pair of brackets 101 , each with parallel flanges 104 extending from the edges thereof , and with a pair of bars 102 for positioning between which brackets . one of which bars 102 , like the arrangement of fig1 , is connected at its ends between the flanges 104 by fasteners 104a , with the other bar 102 ends mounted to slide freely in longitudinal slots 104b formed in the flanges 104 . with the mounting 100 fitted onto a post top end , shown in fig1 as a wood post , and the bar 102 whose ends are mounted in longitudinal slots 104b moved to where the bar holes 102a in both bars 102 aligned with the wood post top surface , screws 113 , or the like , are turned through holes 102 a and into the post top , securing the mounting 100 thereto . thereafter the mail box 110 is installed to the mounting as described hereinabove with respect to fig1 and 18 . fig2 shows another embodiment of a mounting 120 for mail box 110 . the mounting 120 , like the mounting 100 , includes a pair of brackets 121 with bars 122 arranged therebetween . the brackets 121 each include parallel flanges 123 extending from opposite edges of a mid - section of a web 124 , and include cross braces 125 secured therebetween , providing a rigid bracket structure . shown best in fig2 and 21 , the bar 122 ends are each necked down into sleeve 126 that is drilled longitudinally and threaded to receive a bolt 127 turned therein . each bolt 127 , as shown best in fig2 and 23 , is fitted though a hole 128 formed through the bracket 121 and turned into the bar sleeve 126 end , forming a pivot coupling of which bar to the bracket . the bar 122 pivot coupling allows end bar to be pivoted to the attitudes shown , respectively : in fig2 and 22 , where wide mid - portions 129 of each bar 122 extend oppositely ; in fig2 and 23 where the mid - portions 129 are parallel and point downwardly ; and fig2 , where in mid - portions 129 point towards one another . which bar 122 positioning is maintained by turning the bolt 127 fitted through flange hole 128 tightly into the bar sleeve 126 . with the bar 122 appropriately positioned fasteners , such as screws 130 can be turned through holes 131 formed in the bar mid - portions and into a wood beam , like that shown in fig2 , or into a top end of a wood post , like that shown in fig2 and 24 , securing the mounting 120 onto which beam or post end . thereafter , a mail box 110 can be mounted onto which mounting 120 utilizing the bolts , nuts , and washers 107 , 108 , and 109 , respectively , shown in fig1 , secured through elongate slots 132 , formed in the bracket 121 ends , as shown in fig2 . where the mounting 120 is shown utilized for attaching a mail box 110 onto a wood beam or wood post , it should be understood that , like mounting 100 it can be used also for mounting a mail box onto a cantilevered plastic tube or post end , or like beam or post arrangement , within the scope of this disclosure . herein have been shown and described preferred arrangements of a post system and component elements and mountings thereof of the present invention . it should , however , be understood that the present disclosure is made by way of example only and that changes can be made thereto without departing from the subject matter coming within the scope of the following claims , and a reasonable equivalency thereof , which claims i regard as my invention . | 0 |
in dealing with the present invention , it is possible to form the improved seam of the invention for the drum end closures on a new drum or to form a drum with end closures having a five ply seam at the top or bottom or both and then form the five ply or layer seam into a seven ply seam . in the depicted embodiment , a drum 20 is shown with a bottom closure 22 and a top closure 24 thereon . the bottom closure 22 is sealed to the drum 20 by means of a standard five ply seam 25 and similarly , the top closure 24 is sealed to the drum 20 by means of a standard five ply seam 26 . a pair of conventional rolling rings 28 and 30 are spaced along the side walls of the tubular shell 32 of the drum 20 . drum 20 may be new and of thin gage metal or used and in need of refurbishing or reconditioning . standard forming machinery is employed with modifications as discussed below in regard to the tooling in order to form the five ply seam into an improved seven ply seam . the forming apparatus 34 in general is shown for forming the seven ply seam from the five ply seam 26 at the top end of the drum 20 . it includes a bottom seamer 36 with a drive rod 38 and a chuck 40 . the upper end of the apparatus 34 includes a chuck 42 with a central drive rod 44 coupled therewith . the chuck is surrounded by a support roll 46 , an angle roll 48 , a flat roll 50 , and a contour roll 52 . all of the driver mechanisms and interconnecting apparatus ( not shown ) for these elements of apparatus 34 are conventional and well known in the art . the details of the top end of drum 20 are shown in fig2 whereby the tubular shell 32 terminates in the upper end with a five layer seam 26 forming a coupling with closure 24 . this drum 20 is fed into the machine or apparatus 34 . the chucks 40 and 42 are activated into the bottom and top heads of the container . the thickness of the chucks is smaller than the bottom of the double seam . this holds the drum 20 vertically in position and is depicted in fig4 . as shown in fig5 support roll 46 is then engaged with tubular shell 32 . this holds the side wall of the shell against the side wall of the head or closure 24 thus keeping the container rigid with little chance of flexing . fig6 depicts this interengagement from above . as shown in fig7 angle roll 48 is then activated proceeding inward to force the seam 26 into a bent position at approximately a 45 ° angle with respect to the longitudinal axis of the drum . this angle roll 48 then retracts and , as shown in fig8 flat roll 50 proceeds forward and flattens the seam 26 against the upper surface of support roll 46 . it should be noted that the flat upper surface 53 of support roll 46 has a beveled or angled inner portion 54 at a slight angle . this assists the seam 26 in retaining its contour in the bending process into the position of fig8 where it is approximately perpendicular to the longitudinal axis of the drum and extends transversely outward with respect to the side wall 32 of the drum . thereafter , support roll 46 and flat roll 50 retract and the power contour roll 52 moves into engagement with the transversely extending bent seam 26 . the engaging surface 58 of contour roll 52 has a predetermined configuration for engagement with the transversely extending chime 26 so as to form it into the final configuration . as shown in fig9 the first contact is to apply a force directly inward toward the side wall 32 of the drum as chime 26 is contacted . thereafter , as shown in fig1 , as the contour roll is brought further into contact with seam 26 and in the direction toward the drum 20 , a vertical or axial force is applied to the seam to bend and direct it downward . finally , as shown in fig1 , the shape of engaging surface 58 is such that the seam 26 is finally bent back against the side wall 32 of the shell and the adjacent closure surface to form a seven ply seam 60 . as this final seam 60 is formed a third upward force is applied by the bottom portion of the contour surface 58 of roll 52 so as to compress the seam 60 to provide a seam of minimum length while retaining the improved sealing characteristics and shaping of the seven ply structure . this contour forming of the seven ply reinforced chime produces a seam 60 as shown in fig1 in the final product of minimum height or length with respect to the length of the side wall 32 of the drum . additionally , the reinforced chime 60 includes a long sloping radius 62 from the end 64 to the beginning of the flat portion 66 of the seam 60 . this provides maximum surface engagement against the floor when the drum 20 is rolled on edge . compression of the other end portion 68 of the reinforced chime or seam 60 in the manner depicted in fig1 , forcing the seam upward provides for a very tight seam with little chance of spacing between the layers of metal . in this manner , a sealed drum is provided with a reinforced chime 60 with increased sealing , handling and strength characteristics while retaining a minimum desired length for the seam 60 . as stated above , this type of seam can be provided at both the top and bottom ends of a drum 20 . alternatively , as shown in fig1 , the reinforced chime 60 &# 39 ; can be formed in the same manner as chime 60 of the previously discussed embodiment and , with the use of suitable pressure and perhaps heat , the chime 60 &# 39 ; is formed into an essentially solid mass so as to provide for further desired sealing characteristics where necessary in regard to use with certain products for the container . the layers of a seven ply seam of this type are not readily discernable with the naked eye presumably as a result of the flow of metal of the layers into an essentially adhesive mass . an advantage of the forming apparatus 34 is the superior contour roll 52 designed merely to move horizontally to form the reinforced chime 60 . a standard five ply end closure drum can be quickly and efficiently transformed into a seven ply end closure drum . it is significant that the configuration of the contour surface 58 of contour roll 52 provides a wider surface for rolling the drum in that an increased surface area is provided as distinct from an edge . in dealing with thin gauge metal , rolling on an edge could cause rupture or failure at such locations . rolling on an increased bearing area prevents this from happening . as stated above , the intermediate portion of contour surface 58 provides for an increased gradual sloped surface area to facilitate rolling of the drum . also , the contour 58 of the contour roll 52 has a bottom portion with a predetermined bevel so that a camming action is provided which forces the bead tighter to provide additional strength . it not only tightens but compacts the bead . the ends may be worked on individually or both ends can be worked on simultaneously . the compact reinforced chime 60 is of a relatively short length . in fact , it has been found that the length of the five ply chime 26 is much larger than the seven ply reinforced chime 60 because of the compacting action . by reducing the length of the seam , a more compact bead or chime is provided . in other words , chime 60 adds two layers of thickness but is not two layer thicker in length than chime 26 due to the compacting action . the draw is approximately 3 / 4 to 1 inch deep with a standard five ply seam drum . the top and bottom discs or chucks are raised in a conventional manner such as by hydraulic means from a retracted position to an operative position to facilitate the grabbing of the drum 20 between the two chucks . when the drum goes up as a lower chuck assumes its operative position , the top chuck is inserted into the interior of the end . the top chuck rest right on top of the closure and engages rather tightly the inner edge of the apron of the five ply chime formation . the outer rolls are pivoted on a rotatable arm . cylindrical support roll 46 engages the outside of the drum just below the five ply chime 26 . angle roll 48 rotates about a horizontal axis and comes into contact with the drum from above and includes a cylindrical outer surface and a tapered surface . this horizontally rotatable roller 48 is lowered as the drum 20 starts spinning . upper chuck 42 is rotated in a conventional manner such as by a drive chain and lower chuck 40 can be rotated in a conventional manner such as being mounted on ball bearings to rotate with the drum and top chuck . angle roll 48 turns the bead approximately 40 °- 45 ° with respect to the horizontal . angle roll 48 then rises and flat roll 50 , which is cylindrical , turns the five ply chime horizontal to a transverse position approximately normal to the axis of the drum 20 . due to the inherent spring back of the metal the bend is not totally equal to 90 ° but is normally just a few degrees less . the drawings show the position as being 90 ° with respect to the vertical axis of the drum , however , there is inherent spring back . in bending the chime 26 to the flat position , drum 20 rotates a number of revolutions for each operation . an appropriate number of revolutions is chosen and is a matter of choice in order to spin the metal without tearing it and assuring the full degree of bending . for example , 25 - 30 revolutions per operation can be used in the actual formation of the seam . the final forming operation is provided by the horizontal introduction of the contour roll which forms the seven ply chime 60 as described above . the contour roll 52 is introduced after the flat roll 50 and support roll 46 have been retracted . after final formation of seven ply chime 70 , the contour roll 52 retracts and the finished drum can be removed from the apparatus 34 with a resultant seam as depicted in fig1 . an actual practice , the entire operation can be accomplished in a relatively short period of time at relatively high speeds , for example 3 seconds . it should be understood , that this invention envisions the formation of a seam having more than five plys and a seam of at least seven or more plys . thus the several aforenoted objects and advantages are most effectively attained . although several somewhat preferred embodiments have been disclosed and described in detail herein , it should be understood that this invention is in no sense limited thereby and its scope is to be determined by that of the appended claims . | 1 |
in the following description of the preferred embodiment , reference is made to the accompanying drawings , which form a part hereof , and in which is shown , by way of illustration , specific embodiments in which the invention may be practiced . it is to be understood that other embodiments may be utilized and structural changes may be made without departing from the scope of the present invention . referring now to the figures , wherein like features are referenced with like numerals , a bow 10 is shown in fig1 . bow 10 has a frame 20 and a grip 30 . frame 20 includes a lower portion or arm 22 , an upper portion or arm 24 , and a handle portion 25 with a grip 30 connected to and supporting lower arm 22 and upper arm 24 . handle 25 has a front surface 32 and an opposite back surface 34 . during shooting with the bow , front surface 32 is positioned facing the target and back surface 34 is facing the archer . bow 10 is illustrated as a compound bow , with pulley or cam 42 at the end of lower arm 22 and pulley or cam 44 at the end of upper arm 24 . a bowstring 40 extends along the length l of the bow 10 between cam 42 and cam 44 . cams 42 , 44 provide a mechanical advantage to the archer when drawing bowstring 40 . as shown , a peep sight 46 may be positioned on bowstring 40 to facilitate targeting and aiming . mounted on handle 25 of bow 10 is a bow sight 100 , which facilitates targeting ; that is , bow sight 100 includes a device that can be calibrated to be used to situate the bow so that it accurately shoots arrows at targets position at particular distances and / or directions from the shooter . referring to fig2 and 3 an embodiment of a bow sight is illustrated as bow sight 100 . for purposes of this application , the view of the bow sight as seen from the archer in the shooting position , which is the view illustrated in fig2 , is referred to as the “ front view ” of the bow sight . when the bow sight is mounted on a bow and held in a shooting position , the direction perpendicular to the ground is the upward or downward direction . when the bow sight is mounted on a bow and held in a shooting position , the direction perpendicular to an imaginary line that runs from the shooter &# 39 ; s eye through the sight point 122 to the target that is in a direction that extends generally along the length l of the bow 10 is referred to herein as the transverse height direction . accordingly , the upward and downward directions are relative to the ground whereas the transverse height direction is relative to the shooters line of sight . referring to fig4 , it should be understood that when the bow sight 100 is mounted to a bow 10 and the bow 10 is position for shooting at a target located at the same elevation as the bow 10 , the sight line that extends between the peep sight 46 and the sight point 122 is orientated in a neutral angle relative to a horizontal plane e ( i . e ., the sight line is horizontal ). on the other hand , if the bow 10 is positioned for shooting at a target located at a lower elevation with respect to the bow 10 ( i . e ., aimed downward ), the sight line d that extends between the shooter &# 39 ; s eye and the target through the peep sight 46 and the sight point 122 is orientated at a negative angle ( i . e ., downward angle ) with respect to a horizontal plane . with respect to the sight line d , the transverse height direction is marked with the letter f , the direction towards and away from the target is marked with the letter g , and the direction generally upward and downward is marked with the letter h . with respect to the sight line e , the transverse height direction is marked with the letter j , the direction towards and away from the target is marked with the letter i , and the direction generally upward and downward is also marked with the letter j . to shoot the bow , the archer draws the string 40 and then peers through the peep sight 46 to locate the target . the archer precisely aims the bow 10 by establishing a sight line that extends from the peep sight 46 through the sight point 122 to the target . once the peep sight 46 , the sight point 122 , and the target are all aligned , the string 40 is released to shoot the arrow at the target . when shooting from elevations higher than the target ( e . g ., a tree stand ), the pendulum effect of the bow sight 100 moves the sight point 122 upwardly in the transverse height direction f as compared to a pin that does not pivot so that the arrow shoots lower to compensate for the downward angle of the sight line . as shown in fig4 , position a is the position in which the sight point 122 would be located if the sight point 122 did not pivot . position b is the position in which the sight point 122 would be located if the sight point 122 pivots . as illustrated , position a is relatively lower in the vertical direction f than position b with respect to the peep sight 46 . according to the present disclosure , the sight point 122 can set at a particular location toward or away from the target shooter . when the sight point is adjusted away from the shooter and towards the target , the sight point 122 is moved further upward in the transverse height direction when the bow 10 is aimed downward . as illustrated , the sight point 122 in position c , which is adjusted away from the shooter and towards the target , is relatively higher than the sight point in position b . it should be understood that the method could also be practiced without using a peep sight 46 . in some embodiments , the shooter is trained to shoot accurately without relying on any type of rear sight . in other embodiments a rear sight is attached to the frame of the bow 10 rather than the bowstring 40 . referring back to fig2 and 3 , bow sight 100 generally includes a stationary portion adapted to be fixedly mounted to bow handle 25 and a second portion ( i . e ., a pendulum member ) pivotally mounted to the stationary portion . bow sight 100 is shown to include a housing or support structure 110 for mounting bow sight 100 to bow handle 25 . extending from structure 110 are brackets 115 having apertures 118 therein , for mounting bow sight 100 to bow handle 25 with screws or other attachment means . in a preferred embodiment , support structure 110 is a generally circular shaped piece of material , such as acrylic , polycarbonate , or other plastic , aluminum , or the like . other examples of suitable support structure shapes include , for example , square , elliptical , and oblong . housing support structure 110 may be composed of multiple sections or pieces that together form the support structure . housing support 110 may be solid , or may include various perforations or apertures , to lighten bow sight 100 , to facilitate movement of various parts of bow sight 100 , or to allow more light to enter bow sight 100 . pivotally attached to housing support structure 110 is a plurality of sight pins 120 , each pin 120 defining a sight point 122 . in the embodiment illustrated , sight pins 120 are movably attached to a sight window 130 , which is pivotally attached to support structure 110 at pivot axis 140 . pivot axis 140 extends generally horizontal to the ground and perpendicular to bow handle 25 , so that pivoting of sight window 130 around pivot axis 140 produces swinging movement of sight window 130 away from support structure 110 and the archer in a pendulum - like manner . it is preferred that sight window 130 encompasses and encircles pins 120 at least partially , so that pins 120 are positioned within sight window 130 . similarly , it is preferred that support structure 110 encompasses and encircles sight window 130 at least partially . housing support 110 and sight window 130 are shaped and sized so that sight window 130 can pivot within support structure 110 around pivot axis 140 . a stop may be positioned on housing 110 , on window 130 , or both , to inhibit the movement of window 130 in relation to support 110 . in the embodiment illustrated , a bumper stop 133 extends from housing support structure 110 to limit window 130 from swinging forward of support structure 110 . window 130 includes a notch to accept stop 133 . it should be understood that the sight window 130 can be constructed such that it tends to pivot away from the support structure 110 whenever the bow 10 is orientated such that the sight line that extends between the peep sight 46 and the sight point 122 is orientated at a negative angle ( i . e ., downward angle ) with respect to a horizontal plane . one way to accomplish the above object is to construct the sight window 130 such that it is substantially balanced about the pivot axis 140 . such a construction can , for example , include incorporating a counter weight 180 on the sight window 130 . in the embodiment shown in fig3 , the counter weight 180 is shown to included a threaded end 181 to enable adjusting the distance that it projects from the sight window 130 . other construction methods for balancing the sight window are also possible , for example , using lightweight materials to construct the portion of the sight window 130 that projects away from the pivot axis 140 ( e . g ., the slider 125 and slider casting 135 ), and / or offsetting the pivot axis 140 towards the back side of the bow sight 100 . sight pins 120 support or otherwise define sight points 122 , which the archer uses for targeting an object . sight point 122 may be integral with pins 120 or be a separate piece from pins 120 . a sight or sighting point is any shape , point , or indicia of any sort that is visually placed in line with the target to be shot at for assisting in the proper aiming of the bow . sight points 122 can be circular shapes , other geometrical shapes , colored dots , painted dots , the end of a light gathering cable , or simply the end of sight pins 120 , for example . although five pins 120 and their respective sight points 122 are illustrated in the figures , it is understood that any number of pins 120 and sight points 122 can be utilized ; in most embodiments , however , at least one pins 120 will be present . pins may be straight as shown in fig9 and 10 or may be bent as shown in fig2 and 3 . in a preferred embodiment , sight pin 120 is a pin constructed to support a sight point 122 . an end of a fiber optic cable may be positioned at the end of sight pin 120 to act as sight point 122 . the fiber optic cable collects light along its length , and the light exits the end of the cable forming sight point 122 . the fiber optic cable may be held in place by a slit or other aperture located near the end of pin 120 . since the fiber optic cable collects light along its length , sight points 122 that are associated with long fiber optic cables that are exposed to light are brighter than sight points 122 that are associated with short fiber optic cables that are not exposed to light . as such , in some embodiments the sight points 122 are associated fiber optic cables that are coiled around the structure of the bow sight 100 that is exposed to light , for example , the fiber optic cable 166 ( shown in fig8 ) can be coiled around the hub 168 . the preferred pins 120 for use with bow sight 100 are vertical pins , or , pins that have a vertical component so that at least a portion of the pin extends in a vertical direction . as used herein , a pin is considered a vertical pin if the pin has a vertical portion ( i . e ., a portion aligned in a vertical plane ). additionally , in a preferred embodiment , multiple pins are positioned so that they are aligned when viewed by the archer in the shooting position . the benefit of vertical aligned pins is discussed , for example , in u . s . pat . no . 6 , 418 , 633 , which is incorporated herein by reference . preferably , when multiple vertical pins are aligned , the archer is able to view the sight point of each pin , but only views the widest pin . though only vertical pins are shown in the figures , non - vertical pin arrangements in accordance with the present disclosure are also possible . for example , the pins can be horizontal meaning , when viewed by the archer in the shooting position , pins 120 extend from the left or right side of support housing 110 into the field of view . in such an embodiment , the horizontal pins can be housed in vertical slots to allow for vertical adjustment and the vertical slots can be slidably engaged with horizontal slots to allow for front to back adjustment of the pins without effecting the vertical position of the pins . as stated above , pins 120 are preferably movably attached to sight window 130 , although in some embodiments , the entire pin 120 is not moveable and only the sight points 122 are moveable in relation to sight window 130 . in the embodiment illustrated in fig2 and 3 , pins 120 are held by structure 150 . structure 150 includes various features that provide for vertical and front to back ( horizontal ) adjustment of sight points 122 of pins 120 . in the embodiment shown in fig3 , the vertical adjustment determines the distance vs shown as the distance between the sight point 122 and the bottom or lower portion of the sight window 130 . still referring to fig2 and 3 , front to back , adjustment is accomplished via a configuration that moves sight points 122 towards or away from the target . one embodiment for a front to back adjustment configuration includes sliders 125 housed within a slider casing 135 . sliders 125 and casing 135 allow front to back adjustment of pins 120 in relation to sight window 130 ; that is , sliders 125 and casing 135 allow pins 120 to be moved farther from and closer to the archer . each pin 120 is attached to a slider 125 , which is movable within slider casing 135 . a set screw , locking cam , or other such mechanism can be used to move and lock slider 125 and pin 120 in relation to casing 135 . access to the locking mechanism can be gained through a slot or other structure in casing 135 . that is , the front to back position of sight point 122 is adjusted so that the sight point 122 corresponds to a set target distance ( for example , 20 yards ) whether shooting flat or angled . to use bow sight 100 , an archer would first mount bow sight 100 onto bow handle 25 via mounting brackets 115 . the shortest yardage pin ( typically a 20 yard pin ) is moved up or down in the transverse height direction to provide accurate targeting when the sight point 122 is aligned with a target at roughly the same elevation as the shooter . sight window 130 can be locked in relation to housing support structure 110 for convenience while making this adjustment . after positioning sight point 122 while on flat ground , the transverse height position of pin 120 need not be loosened or adjusted again . once positioned , any locking mechanism is unlocked so that sight window 130 is free to pivot around axis 140 in relation to support structure 110 and bow handle 25 . the bow sight is then targeted on an object positioned on a slope , typically a downward slope . a downward slope of 30 to 45 degrees is typical for shooting from a tree stand . angling the bow 10 down will cause sight window 130 to swing down and away from the archer . to target the bow on a slope , the sight point 122 is adjusted by moving the sight pin 120 towards or away from a target using slider 125 in casing 135 , while maintaining the verse height position of the sight point 122 . in other words , in the illustrated embodiment , the verse height position of sight point 122 relative to the sight window 130 does not changed when the sight point is moved towards or away from the target . in the illustrated embodiment , the entire pin 120 moves forward or backwards relative to the sight window 130 . it should be appreciated that numerous other front to back adjustment configurations are possible according to the disclosure . for example , in some embodiments slider 125 includes a discrete number of front to back locations that are constructed to receive or interlock with the pin 120 once it is adjusted in the transverse height direction . in other embodiments the slider includes a high friction material such as rubber that interfaces with the pins so that the pins can be adjusted by simply pushing them back and forth , yet they stay in place during ordinary use once initially set . in other embodiments the pins can include a spring loaded securing arrangement that holds the pins in place unless the shooter depresses the spring for adjustment . in should also be appreciated that in alternative embodiments , the sight point 122 need not be sighted in for one horizontal shot and one sloped or angled shot . for example , the sight point 122 can be sighted in for two different sloped or angled shots . transverse height adjustment of sight points 122 is accomplished via transverse height adjustment mechanism 160 ; in a preferred embodiment , transverse height adjustment of sight point 122 is accomplished by transverse height adjustment of pins 120 . transverse height adjustment mechanism 160 can be any structure that allows movement of and then locks sight point 122 in relation to structure 150 . examples of suitable mechanism 160 include setscrews , geared cams , worm gears , locking cams , and threads on the pins . example gear and cam arrangements are disclosed in u . s . pat . no . 6 , 418 , 633 , which was previously incorporated herein by reference . in other embodiments , the transverse height position of the sight points 122 can be achieved by moving the entire sight up or down relative to the bow handle . in embodiments where the vertical adjustment mechanism includes cams or gears , the cams or gears can be arranged such that they can be moved towards and away from the shooter to allow for front to back adjustment of the sight pins . one such arrangement would include mounting the cams or gears on a slide or track . referring to fig5 - 9 , an alternative embodiment of the sight according to the invention is shown . the bow sight 100 ′ includes a frame 110 ′ that defines a target viewing opening 116 through which a target can be viewed to visually frame the target for sighting . the frame 110 ′ includes a first frame member 114 including a front portion defining a full ring 120 , and a rear portion defining an upper partial ring 121 . the frame 110 ′ also includes a second frame member 134 in the form of a lower partial ring 132 pivotally connected to the upper partial ring 121 of the first frame member 114 . the upper partial ring 121 cooperates with the lower partial ring 132 to form a substantially full ring that substantially circles the target viewing opening 116 . the bow sight 100 ′ also includes a sight pin 112 carried by the lower partial ring 132 . the lower partial ring 132 is adapted to swing or pivot relative to the first frame member 114 in a pendulum - like manner when the bow sight 100 ′ is moved from a horizontal sight line to a downwardly angled sight line . as discussed above , this pivoting action functions to raise a sight point 126 of the sight pin 112 as the bow 10 is aimed downwardly to compensate for the downward angle of the bow 10 which otherwise can cause archers to shoot above their intended target location . the target viewing window opening 116 is relatively open so as to provide a relatively large and clear field of vision to facilitate aligning the target relative to the sight point 126 . the target viewing opening 116 in some embodiments is unobstructed such that it includes no structures therein that are not constructed to be visually helpful in properly aligning the sight point 126 with the target . unobstructed sight windows may , nonetheless , include the shaft 128 of a sight pin 112 and other structures for facilitating aiming a bow 10 such as a level 133 . in the embodiment shown , the frame 110 ′ defines a generally circular and visually continuous target viewing opening 116 . in addition , the frame 110 ′ and the target viewing opening 116 include a ratio of the maximum width of the frame 110 ′ ( fmax ) to the maximum width of the target viewing opening 116 ( smax ) that is no more than 1 . 5 . with such a ratio the frame 110 ′ and the target viewing opening 116 are relatively close in size . in the embodiment shown , the frame surrounds the sight point 126 to protect it from external impact . as shown in fig7 - 9 , the first frame member 114 defines a notched out back portion 136 that is shaped to nest the lower partial ring 132 . the lower partial ring 132 is pivotally attached below the partial ring 121 of the first frame member 114 and behind a front lower portion 135 of the first frame member 114 . the lower partial ring 132 is oriented behind the first frame member 114 such that at least a portion of the lower partial ring 132 is hidden from a front view when an archer peers through the target viewing opening 116 from the front side of the bow sight 100 ′. in other words , the arrangement of the frame member 114 and the lower partial ring 132 can be coaxial , which provides a visually clean low profile appearance . in certain embodiments a majority or substantially all of the ring 132 is hidden behind the first frame member 114 at least when the bow sight 100 ′ is sighted along a horizontal sight line . such an arrangement avoids obstructing the target viewing opening 116 . also , in the embodiment shown , the notched out back portion 136 is sized such that the back surface 117 of the bow sight 100 ′ is in a single vertical plane when the sight 100 ′ is sighted along a horizontal sight line . the second frame member 134 can be u - shaped in that it includes two opposed connected arms 142 . in the embodiments shown , the arms 142 define a generally semi - circular shape . the arms 142 are positioned to straddle the exterior of the upper partial ring 121 . the two arms 142 can include pivot pins 146 , such as screw , for attachment of the second frame member 134 to the upper partial ring 121 . the pivot pins 146 define a pivot axis pa of the second frame member 134 . the pivot axis pa preferably is oriented to intersect the target viewing opening 116 . however , as discussed above , it is preferred for the target viewing opening 116 to be substantially free of obstructions . therefore , while the pivot axis pa intersects the target viewing opening 116 , it is preferred that no portion of the pivot pins 146 substantially projects into or across the target viewing opening 116 . the support frame 110 ′ can also include one or more stops 154 , which limit the range of motion of the second frame member 134 relative to the first frame member 114 . in the embodiment shown , the stops are shown as bosses . in addition to the stops 154 , the bow sight 100 ′ includes a locking mechanism for limiting the range of pivotal movement of the second frame member 134 relative to the first frame member 114 , and for selectively locking the second frame member 134 in the position of fig5 . though possible , the locking mechanism 160 need not totally prevent the sight pin 112 from moving relative to the support frame 110 ′. the locking mechanism can include a fastener such as a set screw that threads downwardly through a vertical tapped hole defined by the upper partial ring 121 . the tapped hole passes through a downwardly facing surface 138 of the upper partial ring 121 . the downwardly facing surface 138 opposes an upwardly facing surface 152 defined by a shoulder of the lower partial ring 132 . the downwardly facing lower surface 138 is radiused to prevent interference with the pivoting motion of the lower partial ring 132 . referring to fig5 - 9 , the sight pin 112 and sight point 126 , which the archer uses for targeting an object , are shown . sight point 126 may be integral with sight pin 112 or be a separate piece from the sight pins 112 . sight points 126 can be circular shapes , other geometrical shapes , colored dots , reflective structures , the end of an optical fiber 166 or other light emitting structures , or simply the end of sight pin 112 . the sight point 126 is preferably an optical sight point defined by the end of a light collecting member such as an optical fiber 166 . in such embodiments , the end of the fiber optic cable 166 is secured to the free end of a relatively rigid supporting pin 112 to act as a sight point 126 . since the optical fiber 166 collects light along its length , to maximize the brightness of the sight point , it is desired to provide an increased length of optical fiber 166 . to increase the length of optical fiber 166 , the optical fiber 166 extends downwardly from the sight point 126 along the back side of the pin 112 and is wrapped multiple times about the exterior of the hub 168 . fig5 schematically shows the optical fiber 166 wrapped about the hub 168 . a transparent protective sleeve ( not shown ) can be mounted over the hub 168 to hold the wraps of optical fiber in place . a weight 190 can also be attached to the hub to enhance pivoting of the second frame member 134 . the sight can also include a slide arrangement 170 supported on the second frame member 134 . the slide arrangement 170 includes a block 174 slidably mounted within a track 171 that extends in a front - to - back direction . the pin 112 is mounted to the block 174 such that the front - to - back position of the pin 112 can be adjusted by sliding the block 174 forwardly or rearwardly within the track 171 . a first set screw 172 ( see fig9 ) is used to clamp the block 174 at a desired front - to - back position along the track 171 . the set screw 172 extends through a front - to - back extending slot 173 in a first side wall of the track 171 and is threaded in a tapped hole within the block 174 . by tightening the set screw 172 , the block 174 is clamped against the first side wall of the track to secure the block at the desired position along the length of the track 171 . in the event the hub 168 is used as a wrap to increase sight point brightness , slack fiber can be provided between the hub 168 and the pin to accommodate movement of the block 174 . alternatively , the hub 168 can be configured to move with the block . the block 174 can be also constructed to receive a second set screw 175 ( see fig9 ) for engaging the base of the pin 112 for setting the transverse height position of the pin 112 . the set screw 175 is threaded within a tapped hole defined by the block 174 . the head of the screw 174 is positioned within a front - to - back slot defined by a second side wall of the track 171 . by tightening the screw 175 , the pin 112 is clamped in place relative to the block 174 with the sight point at a desired height . by loosening the screw 175 , the pin 112 can be raised or lowered relative to the block to adjust the height of the sight point . the slider arrangement 170 could include many alternative features for enabling the sight pin 112 to be conveniently adjusted along the track 171 . for example , the slider arrangement 170 could include a spring loaded mechanism instead of a first set screw 172 so that the sight pin 112 can be adjusted with one &# 39 ; s fingers without the need to use any tools . alternative mechanisms for setting the transverse height of the pin 112 are also available . for example , the pins 112 can be constructed of multiple parts that telescope to allow for adjustment in the transverse height direction . also , the pins 112 can be simply bent forward or backwards for the transverse height adjustment . in other embodiments , the pins 112 can be threaded into the block 174 and can be moved upward or downward by twisting the pins 112 . yet in other embodiments the transverse height of the pin 112 can be adjusted by moving the entire sight using a gear mechanisms such as the type disclosed in u . s . patent application ser . no . 10 / 661 , 918 incorporated herein by reference in its entirety . the disclosure is also directed to a method of assembling the bow sight 100 ′ that includes at least the steps of providing a lower partial ring 132 and a frame member 114 and coupling the lower partial ring 132 to the frame member 114 such that the lower partial ring 132 and the frame member 114 define an unobstructed sight window and the ring is pivotally movable with respect to the frame . support structure 110 may include a dampening system to reduce vibration caused when bowstring 40 is released . an example of a suitable dampening system includes a material that is softer than the material that makes up the part of the bow handle 25 to which the device is directly attached , such that the dampening system at least partially absorbs the vibrations caused by the release of bowstring 40 when shooting an arrow . dampening systems are described , for example , in u . s . pat . no . 6 , 418 , 633 , which is incorporated herein by reference . the materials for bow sight 100 can include metals ( e . g ., aluminum , steel , brass ), plastics ( e . g ., polycarbonate , acrylics ), and ceramics and composite materials . such materials can be used for any of support structure 110 , mounting bracket 115 , sight window 130 , and any other portion of bow sight 100 . pins 120 are preferably a rigid material , such as metal . any or all of these pieces may include a coating thereon . in the depicted embodiment , the rings have generally circular shapes . however , as defined herein , the term “ ring ” is not limited to circular shapes . to the contrary , square rings , oval rings , and other shapes suitable for framing a target viewing opening are included within the definition of ring . the term “ viewing opening ” includes fully enclosed openings as well as partially enclosed openings such as u - shaped openings ( e . g ., openings with closed bottoms and sides and opened tops ) as well as other partially enclosed openings . as used herein , a full ring means a ring that forms an endless boundary about the target viewing opening 116 . a substantially full ring means a ring that forms a boundary that surrounds at least 75 % of the target viewing opening 116 . a partial ring means a member that forms a boundary that surrounds less than 75 % of the target viewing opening 116 . a “ half ring ” means a member that forms a boundary that surrounds approximately 50 % of the target viewing opening 116 . structures through which a target can be viewed can be referred to as target viewing channels , sighting openings , sight windows , or like terms . structures for supporting a sight pin , such as the lower partial ring 132 , can be referred to as pin supports , pin support members , sight point supports or sight pin support members . structures capable of swinging about a pivot can be referred to as pivot members , pendulum members , pendulums , or like terms . structures capable of protecting pins can be referred to as cages , protective members , shielding members or like terms . the above specification and examples provide a complete description of the manufacture and use of the invention . it is to be understood that other embodiments may be utilized and structural changes may be made without departing from the present invention . although a bow sight has been described , the details of this invention can be incorporated into other projecting shooting applications and systems , such as sights for rifles and shotguns . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended . | 5 |
referring now in detail to the drawings and initially primarily to fig2 - 4 , a starter motor for an internal combustion engine ( not shown ) is indicated generally by the reference numeral 11 . the starter motor 11 is comprised of a stator 12 formed of a cylindrical yoke 13 and four permanent magnets 14 , of arc - shaped cross section ; bonded on the inside surface of the yoke . the permanent magnets 14 are preferably formed from a neodymium ( nd )- based magnetic material that is magnetized after being bonded to the yoke 13 . an armature or rotor , indicated generally at 15 rotatably mounted inside the stator 12 in a manner to be described shortly . the armature 15 is comprised of a core 16 facing the magnets 14 and fixed to a starter motor output shaft 17 . a commutator 18 is fixed adjacent to the core 16 on one end of the starter motor output shaft 17 . the core 16 , as shown in fig2 and 3 , is formed of a plurality of radially disposed core teeth 19 . in the illustrated embodiment there are 14 core teeth 19 . electrical coils ( not shown ) are wound around the core pieces 19 . the commutator 18 is formed of a plurality of contact pieces 21 corresponding in number to the core pieces 19 and that are electrically connected to the coil ends , as is well known in the art . two sets of two brushes 22 and 23 ( fig4 ) held by respective brush holders 24 and 25 are juxtaposed to the commutator 18 at its outside circumference . the brushes 22 and 23 are pressed against the contact pieces 21 of the commutator 18 by coil springs 26 . fitted to the opposite ends sides of the cylindrical yoke 13 are a front cover 27 ( fig2 ) covering the left side of the yoke 13 as seen in the figure and a rear cover 28 covering the right side of the yoke . on the figure , collectively forming , with the yoke 13 , a motor case indicated generally by the reference numeral 29 . the starter motor output shaft 17 is journalled for rotation on the front cover 27 and the rear cover 28 , respectively by bearings 31 . on the rear cover 28 ( fig2 and 4 ) is provided a positive terminal 32 for power supply from the positive electrode of a battery ( described later by reference to fig5 mounted on the vehicle . the positive terminal 32 is suitably connected to the brushes 22 on the positive electrode side . the brushes 23 on the negative electrode side ( ground side ) are connected to the end closure 28 by grounding fasteners 33 . the motor case 29 is grounded to the associated engine by a mounting bracket 34 that fixes the starter motor 11 to the engine thus acting as a negative terminal . on the front cover 27 is mounted an oil seal 35 ( fig2 ) for preventing ingress of oil into the motor case 29 from the associated engine , and an o - ring 36 for sealing the mounting portion to the engine . on the starter motor output shaft 17 at the engine side end is provided a pinion gear 37 meshing with an flywheel gear ( not shown ) to rotate the engine shaft for starting . some form of one way device such as a one way clutch is provided in this connection to permit the engine shaft from driving the starter motor once the engine has started to run under its own power , as is well known in this art . inside the rear cover 28 covering the commutator 18 at the end of the starter motor output shaft 17 is fixed a disk - like brush carrier 38 . the brush holders 24 and 25 are affixed to the brush carrier 38 at four positions spaced radially at right angles to hold the opposing two positive electrode brushes 22 and opposing two negative electrode ( grounding ) brushes 23 . as has been noted , the brushes 22 , 23 are biased radially inwardly toward the commutator 18 by the coil springs 26 . the positive electrode brushes 22 are connected to the positive terminal 32 , and the negative electrode brushes 23 to the negative ( grounding ) terminal 34 . referring now to fig4 this shows a first embodiment for reducing unusual noise measures in accordance with the present invention . this embodiment is one of several that will be described and reduces the noise by reducing the cogging torque , particularly when the electrical power to the windings is discontinued on starting of the related engine . this figure is a developed view of the radial core 16 . in this embodiment each pole tooth 19 of the core 16 is formed on the skew relative to the rotational axis c of the rotor shaft 17 . such a skew arrangement is easily formed by laminating radial shaped thin iron sheets 39 constituting the core 16 and by slightly displacing the each of them to the rotating direction in the lamination . thereby , the pole surfaces 41 which face the permanent magnets 14 are formed on the skew resulting in a parallelogram shape . thus the slot entries 42 formed between the teeth 19 are skewed to the shaft axis c . with such a constitution , pull - in force of the magnets 14 gradually acts along the skewed side edge of the pole tooth 19 , so that cogging action is dispersed and generated gradually . as a result , the cogging is reduced , and the generation of unusual noise is reduced . [ 0038 ] fig5 shows another embodiment for reducing unusual noise by - reducing the cogging torque in accordance with the present invention . the drawing shows a developed view of the magnets 14 of the stator 12 . this embodiment is adapted to skew the magnetizing direction of each magnet 14 . each of the four magnets 14 is disposed in the circumferential direction at a radial spacing of 90 degrees . the dividing line 43 between the magnets 14 is parallel to the shaft axis c . each magnet 14 is skewed and magnetized in the same direction as shown with broken lines . in this embodiment , the pole surface 41 on the core side is , as shown in fig1 parallel to the shaft center c without skewing . thus , by skewing the magnetizing direction of the magnet 14 , the pull - in force of the magnets 14 acts on the core with gradually displacing to the axial direction , so that the cogging action is reduced , and the generation of the unusual noise due to the cogging can be reduced . in this embodiment , it is not necessary to skew the core teeth 19 , so that the assembling work of the core or a coil winding work will not become complicated . [ 0040 ] fig7 shows still another embodiment for unusual noise measures relating to the present invention by reducing the cogging force . in this embodiment the four pieces of the magnets , here indicated at 44 , are of a parallelogram shape . the magnetizing direction is parallel to the shaft axis c as shown by the broken lines . the dividing line 45 between the side edges of the magnets 44 is a skewed straight line to the shaft axis c . thus , by skewing the shape of the magnets 44 to be parallelograms , the pull - in force of the magnet on the core gradually acts with displacing to the axial direction , so that the cogging action is dispersed , and the generation of the unusual noise due to the cogging can be reduced . [ 0042 ] fig8 shows yet another embodiment for unusual noise measures relating to the present invention by reducing the cogging force . this embodiment is adapted to curve and form the side edge of the magnets , indicated here as 51 to be arc - shaped . alternate magnets 51 have convex sides 52 and concave sides 53 to form arcuate slots 54 of uniform thickness between them . thus , by curving and forming the side edge 52 and 53 of the magnets 51 , the pull - in force of the magnet on the core gradually acts with displacing to the axial direction , so that the cogging action is dispersed , and the generation of the unusual noise due to the cogging can be reduced . if the magnet shape is skewed or curved , the cogging action gradually acts with displacing to the axial direction as described above , and thrust force generates along with the displacement in the axial direction . in this case , the present embodiment has a symmetric shape where the dividing line 54 at a magnet boundary part is folded about the center of the axial direction , so that thrust force is canceled out each other on the both sides of the center in the axial direction , and smooth rotational movement can be obtained . [ 0044 ] fig9 and 10 show two other embodiment for unusual noise measures relating to the present invention by reducing the cogging force . in these embodiment this is done by divide the four circumferentially spaced magnets in an axial direction and shift these segments relative to each other in a circumferential direction . the shifted segments overlap circumferentially . this provides an effect similar to the embodiment of fig7 . in the embodiment of fig9 each magnet pole , indicated here at 61 is divided into two axially and circumferentially spaced segments 62 and 63 . these segments overlap in the circumferential direction . in the embodiment of fig1 each of magnets , indicated as 71 is divided into five axially and circumferentially spaced magnet segments 72 , 73 , 74 , 75 and 76 . this provides a result similar to that of fig8 . thus , by dividing each of the magnets 61 and 71 in the axial direction and displacing the segments in the circumferential direction , when the motor rotates the pull - in force of the magnet is divided and acts with a time lag , so that the cogging action is dispersed , and the generation of the unusual noise due to the cogging can be reduced . in each of the embodiments described thus far , the unusual noise has been abated by reducing or smoothing out the cogging torque . next will be described two embodiments as shown in fig1 and 12 wherein these noises are reduced by rigidifying the overall housing assembly of the starter motor , indicated generally in these figures by the reference numeral 81 . these embodiments are adapted to improve the rigidity of the starter motor 81 to reduce resonance from the cogging . the motor 81 , itself may also employ any of the previous embodiments for reducing cogging in addition to the rigidifying structures now to be described . generally , the construction of the motor 81 in each embodiment is the same as that already described by reference to fig2 through 4 . therefore , the external components of the motor 81 as illustrated as well as the starter shaft are identified by the same reference numerals as those previously employed . that is , the starter motor 81 includes an outer case 29 comprised of the stator shell 13 to which the end closures 27 and 28 are affixed and in which the starter motor shaft 17 is journalled in the manner as aforedescribed . in the embodiment of fig1 , a mounting bracket 82 is welded and integrated with the yoke 13 of the motor casing 13 . this bracket 82 is utilized to attach the starter motor 81 to be secured to the vehicle body frame or engine ( not shown ). thus , by welding and integrating the bracket 82 to the motor body 13 , specifically the yoke 13 in this embodiment the rigidity of the casing body 13 increases . thus vibration caused by the cogging is reduced and the generation of the unusual noise due to the cogging is reduced . furthermore , since the starter motor mounting bracket 82 is not fixed directly to either the front cover 27 or the rear cover 28 their constructions are simplified . [ 0051 ] fig1 shows an embodiment utilizing rigidifying the motor housing 29 employing a conventional starter motor mounting bracket 91 attached to or integral with one of the end closures , the rear one 28 in the illustrated embodiment . a pressing bracket 92 is secured to the front cover 27 and the rear cover 28 by attaching screws 93 . this pressing bracket 92 abuts against the motor body 29 and specifically the yoke 13 . thus the rigidity of the motor body 29 is increased and vibration caused by the cogging is reduced . therefore the generation of the unusual noise due to the cogging is reduced . thus it should be readily apparent that the described apparatus achieves the goals set out above in a low cost and highly effective manner . of course those skilled in the art will understand that the embodiments described are only a preferred embodiments of the invention and various changes and modifications may be made without departing from the spirit and scope of the invention , as defined by the appended claims . | 7 |
fig1 shows one embodiment of the system of the present invention . the system comprises an input unit 101 , a processing unit 102 , a storage unit 103 , and an output unit 104 . a user could enter several information data to the processing unit 102 for calculating by the input unit 101 . the information data are some parameters of pcb , such as type of pcb , types of top layer , thickness of copper foil , numbers of signal layer , numbers of power layer , and total thickness and line - width of pcb etc . the input unit 101 comprises an input user interface of software comprising programs written by java programmable language . the processing unit 102 includes at least one processor and one memory to load and execute program code . all current parameters of pcb are stored in the storage unit 103 which connects the processing unit 102 . therefore , the current parameters related to the input parameters in the storage unit 103 are selected to processing unit 102 for calculation after the input parameters information data of the pcb are inputted . after data are calculated by the processing unit 102 , the result of stacked pattern of pcb would be outputted by the output unit 104 and be displayed . moreover , the result could be outputted and displayed on the same user interface of input interface of software by the output unit 104 . fig2 shows a flowchart of one embodiment of the method of designing stacked pattern of pcb of the present invention . an embodiment accompanying fig3 ˜ 7 is used to describe the method in fig2 . the method comprises the following steps . first of all , in step s 201 , information data of stacked pattern are inputted into user interface of software . nest , in step s 202 , initial solution sets of stacked pattern are generated . then , in step s 203 , duplications of the initial solution sets of stacked pattern are generated according to a fitness function . afterward , in step s 204 , crossover of the duplications of stacked pattern is performed at random . then , in step s 205 , mutations are executed by a probability at random . finally , in step s 206 , identification is performed to check if the solution approaches the standard of demand , and in step s 207 , the result of stacked pattern is shown . otherwise , operational step jumps to duplicate step and repeats above steps until satisfying solution is obtained . moreover , the processes mentioned above could be executed in a computer - readable medium . in step s 201 , information data of stacked pattern are inputted into user interface of software . in this embodiment , the user interfaces of software are shown in fig3 and fig4 . fig3 shows the input user interface of automatic stack mode , wherein the automatic stack mode means that the type of stacked pattern is not needed to be assigned . fig4 shows the input interface of assigned stack mode . the information data of stacked pattern of pcb include some parameters , such as automatic modifying setting of line - width , pcb manufacturer , material of top layer , type of pcb , type of top layer , thickness of copper foil , numbers of signal layer , numbers of power layer , line - width , and total thickness of stacked pattern etc . these information data are provided to the processing system for calculation by using the user interface of software as shown in fig3 . the result of stacked pattern is obtained and displayed after calculation . moreover , the result of stacked pattern is displayed by a form , such as sgppgs , wherein the symbol s means signal layer , the symbol g means ground layer , and the symbol p means power layer . moreover , the user interface of software could be a graphic user interface , which comprises a display device and a selection device . the display device is used to display the information data of stacked pattern of demanded pcb entered by user and the result of stacked pattern of pcb . the selection device could provide a drop - down menu for user to select . here , fig3 shows the user interface of the automatic stack mode of this embodiment of the present invention . the automatic modifying setting of line - width could be selected by selecting symbols yes or no , and the pcb manufacturers also could be selected . the purpose of selection of pcb manufacturers is to choose the current specifications of pcbs of the selected pcb manufacturer from database by this system . material of top layer also could be selected by selecting symbols of yes or no in this embodiment , wherein the selected material is polypropylene ( pp ) if the symbol yes is selected . otherwise , if the symbol no is selected , the material of top layer would be epoxy - glass composite ( fr4 ) automatically . moreover , the type of pcb could be selected by selecting probe card ( p / c ), load board ( l / c ), or dut board ( d / b ). the type of top layer could be selected by selecting signal layer s , power layer p , or ground layer g . moreover , user need to enter some parameters , such as thickness of copper foil , numbers of signal layer , numbers of power layer , line - width , and total thickness of stacked pattern . for example , in fig3 , the value of the thickness of copper foil is 1 oz , the number of signal layer is 2 , the number of power layer is 2 , the value of line - width is 8 mils ( 1 mil = 0 . 0254 mm ), and the value of total thickness of stacked pattern is 122 mils . after all parameters are entered , the input process is done . in step s 202 , initial solution sets of stacked pattern are generated according to the information data . if the thicknesses of pp types of pcb provided by a pcb manufacturer has n types , such as { p 1 , p 2 , . . . , pn }, and the thicknesses of fr4 also has n types , such as { f 1 , f 2 , . . . , fn }. the result of stacked pattern would be sgppgs , which is constructed with several different polypropylene p layers and several different epoxy - glass composite f layers . as the numbers of demand stacked pattern is m , the initial solution sets of stacked pattern generated would be m sets , as shown in fig5 . the stacked pattern of stack 1 is p 1 f 3 p 3 f 2 p 1 , and the stacked pattern of stack 2 is p 4 f 1 p 7 f 2 p 3 and there are m sets of stacked pattern generated by the system selecting several different pp layers and fr4 layers from pcb manufacturer to construct the stacked pattern of pcb . in this step , the generated initial solution sets of stacked pattern are only conformed for the limitation of forms of stacked pattern and pcb manufacturer . other parameters still are not considered , such as type of pcb , thickness of copper foil , line - width , and total thickness of stacked pattern . in step s 203 , the duplications of the initial solution sets of stacked pattern are reproduced according to a fitness function . in this step , a calculating process is used to determine the numbers of offsprings , which need to be eliminated or which need to be reproduced all according to the fitness of species in genetic algorithm . in this embodiment , the fitness function may be f ( x )= 1 /[( thickness of demand minus total thickness of stacked pattern )+ 1 ]. if the thickness of demand equals to the thickness of stacked pattern , the highest value of the fitness function would be 1 . the fitness functions of m sets of stacked pattern can be calculated to obtain the fitness functions f 1 , f 2 , . . . , fm , and the expected value of the offspring is fi /( f 1 + f 2 + . . . + fm ). therefore , the number of reproduced stack could be determined by that the expected value of the offspring multiplying by m , as shown in fig6 . for example , the fitness function of reproduced stack 1 is calculated by f ( 1 )= 1 /[ thickness of demand minus thickness of stack 1 ] and expressed by symbol f 1 . the value of the thickness of stack 1 is got by summing p 1 , f 3 , p 3 , f 2 , and p 1 . then , the numbers of reproduced stack 1 is calculated by the expected value of the stack 1 , f 1 /( f 1 + f 2 + . . . + fm ), multiplying by m . in fig6 , the number of the reproduced stack 1 is a solution sets . the total numbers of reproduction of stack still are m , which are calculated by summing all numbers of each stack , and the expression is shown as [ f 1 /( f 1 + f 2 + . . . + fm )] m +[ f 2 /( f 1 + f 2 + . . . + fm )] m + . . . +[ fm /( f 1 + f 2 + . . . + fm )] m = m . then , the reproduction process is finished . however , the numbers of stack still are the same after the reproduction process , but the rate of matched stack is raise . therefore , even if the first offspring doesn &# 39 ; t reach the standard of demand , the second offspring could more approach to the standard of demand . in step s 204 , crossover of the duplications of stacked pattern is performed at random . this step is crossover process . the crossover point is found from the duplications of the initial solution sets of stacked pattern at random , and crossover of the duplications of stacked pattern is performed for generating offspring . for example , the selected parent stacked patterns are stack 1 and stack 2 , as shown in fig7 . the stacked pattern of stack 1 is p 1 f 3 p 3 f 2 p 1 and stack 2 is p 1 f 3 p 7 f 2 p 3 . if the crossover point is 2 selected at random , the stacked pattern of offspring would be p 1 f 3 p 7 f 2 p 3 . it is kept p 1 f 3 of stack 1 and p 7 f 2 p 3 of stack 2 in the stacked pattern of offspring . even crossover process is performed m times , as long as only one offspring is generated by crossover process each time , the number of stacked pattern of offspring still is m . the offspring of stacked pattern has different characteristics from the parent stacked pattern after crossover process . therefore , the stacked pattern after crossover process could more match the stacked pattern of demand . in step s 205 , mutations are executed by a probability at random and the result of stacked pattern is obtained . this step is mutation process . the purpose of mutation process is to avoid that some useful parameters of pcb would be lost during the reproduction process or crossover process . the lost useful parameters of pcb could be restored by the mutation process . one layer of the stacked pattern could be changed at random by mutation process . for example , the stacked pattern p 2 f 3 p 7 f 2 p 3 is more conformed for the demand stacked pattern than the stacked pattern p 1 f 3 p 7 f 2 p 3 , but the parameter p 2 is lost during the reproduction process or crossover process . if the mutation process is happened , the first layer of stacked pattern p 1 f 3 p 7 f 2 p 3 is changed into p 2 . the stacked pattern p 1 f 3 p 7 f 2 p 3 is mutated to being stacked pattern p 2 f 3 p 7 f 2 p 2 , which is more similar to the demand stacked pattern . however , the mutation process is happened at random , in the other word , the mutation process would happen uncertainly . in step s 206 , identification is performed to check if the solution approaches the standard of demand . if the result of stacked pattern is reached the standard of demand , the step s 207 would be happened that the result of stacked pattern is displayed . otherwise , the result of stacked pattern is not reached the standard of demand , the steps s 203 ˜ s 206 would be repeated by system for generating offspring . in this embodiment , the standard of demand is determined by the information data of demand stacked pattern of pcb , such as automatic modifying setting of line - width , material of top layer , type of pcb , type of top layer , thickness of copper foil , numbers of signal layer s , numbers of power layer p , line - width , and total thickness of stacked pattern etc . in fig3 , the information data is entered as line - width could be modified automatic , material of top layer is selected as pp , type of pcb is selected as probe card , type of top layer is selected as signal layer s , the value of the thickness of copper foil is entered as 1 oz , the number of signal layer is entered as 2 , the number of power layer is entered as 2 , the value of line - width is entered as 8 mils , and the value of total thickness of stacked pattern is entered as 122 mils . then , the calculated result of stacked pattern would be displayed on the below area of the same user interface of software . in fig3 , the total thickness of stacked pattern after calculating is 124 . 1 mils , which has 4 . 1 % error to 122 mils , the total thickness of demand . however , if the error of the result is smaller than 5 % which is the required ranges of standard of demand , the standard of demand is reached and the result would be displayed . therefore , the percentage of error of the result is 4 . 1 % which still reach the standard of demand , and the result of stacked pattern is displayed on the same interface of software for reference . the result of stacked pattern is that the total thickness of stacked pattern is 124 . 1 mils , difference ( thickness of demand minus thickness of stacked pattern ) is 4 . 9 mils , the error is − 4 . 11 %, the line - width of stacked pattern is 8 mils , material of top layer is pp , thickness of top layer is 4 . 8 mils , material of second layer is fr4 , thickness of second layer is 47 . 9 mils , material of third layer is pp , thickness of third layer is 5 . 5 mils , material of forth layer is fr4 , thickness of forth layer is 62 . 0 mils , material of fifth layer is pp , and thickness of fifth layer is 4 . 8 mils etc . moreover , the illustration of result of stacked pattern would be displayed on the up right area of the interface of software for reference . in the area , the correct value of thickness is shown . but , the size of illustration is not the real size of the thickness of stacked pattern . the process of the method of the present invention could be described more clearly after combining all steps mentioned above . first of all , user could enter the information data such as type of pcb , material of top layer , thickness of copper coil , numbers of signal layer , numbers of power layer , line - width , and total thickness of stacked pattern to the system . because the system is stored all parameters of pcb that pcb manufacturers provided , a plurality of arrangement combination are generated by the system selecting the parameters of the database which depend on the information data from the user . these are initial solution sets of stacked pattern in step s 202 . then , numbers of duplications of the initial solution sets of stacked pattern are determined by this system depending on the fitness of solution sets of stacked pattern , and the required parameter is thickness of stacked pattern in this embodiment . after the reproduction process s 203 finished , crossover of the duplications of stacked pattern is performed at random , wherein the crossover points are also selected at random by system . this is crossover process s 204 . next , the mutation process s 205 happens at random . this means whether the mutation process happens or not is determined at random by system . the mutation process is that one layer of stacked pattern is changed at random by system . the advantage of the mutation process is that the stacked pattern of pcb after mutation process would be generated which more approaches to the stacked pattern of demand than the original stacked pattern . even the results of stacked pattern are not reached the standard of demand at first time , but the results of stacked pattern could be the initial populations of the second time . therefore , the results of stacked pattern generated at second time would more approach to the fitness function than the stacked pattern at first time . this is the advantage of the system using genetic algorithm of the present invention . the step s 206 is that identification is performed to check if the solution approaches the standard of demand . if the result is reached the standard of demand , the final step s 207 that the result of stacked pattern is displayed would be performed for reference , as shown in fig7 . otherwise , the results of stacked pattern don &# 39 ; t reach the standard of demand , the results of stacked pattern would be the initial solution sets of stacked pattern in reproduction process s 203 . then , the processes would be repeated by system for generating the offspring , until the results of stacked pattern reach the standard of demand . fig4 shows assigned stack mode of the embodiment of the present invention . this mode is that a specify form of stacked pattern such as sggs is assigned by user . if a user uses the automatic stack mode to calculate , the result of stacked pattern is probably not sggs even all the information data are matched . in this condition , the user could choose the assigned stack mode and assign the form of stacked pattern to be sggs , therefore , the result of stacked pattern must be the form of sggs and match the information data . fig8 shows the calculated result using the stacked pattern design system of the present invention . in fig8 , the result of stacked pattern is got by entering the information data for calculating , which the information data comprise that the demand number of signal layer is 7 , the demand number of power layer is 2 , the thickness of stacked pattern is 143 mils , the value of line - width is 8 mils , the type of pcb is load board , the type of top layer is signal layer and thickness of copper foil is 1 oz . it &# 39 ; s easy to see the result of stacked pattern in fig8 which has seven signal layer and two power layer that match the information data . the total thickness of stacked pattern is 142 . 9 mils and error is 0 . 07 %. because the error is smaller than 5 %, the result of stacked pattern reaches the standard of demand and outputted to display for reference . thus , the most suitable stacked pattern of pcb could be found quickly by using the system of the present invention . only the user enters information data of stacked pattern of pcb , the best stacked pattern mode which match the information data would be displayed after a very short time . using the system to replace manual operation not only saves time and manpower , but also reduces time of designing pcb . moreover , when the structure of stacked pattern is complicated , using this system to find the suitable stacked pattern of pcb is more efficiency . the specific arrangements and methods herein are merely illustrative of the principles of this invention . numerous modifications in form and detail may be made by those skilled in the art without departing from the true spirit and scope of the invention . | 7 |
fig1 illustrates a high level view of the system . through a connectivity data network 2 , such as the internet or an internet , a multitude of audio conferencing service platforms 18 are utilized and managed by a common resource broker 17 . furthermore , users of the system as well as audio conference service providers access and use the system by interacting with the resource broker through the connectivity data network via client interface software such as a web browser user interface 10 . a provider of audio conference services makes a platform 18 available to the resource broker 17 . the platform 18 consists of an audio bridge component 16 , call manager software 15 and a web user interface 11 . the audio bridge could be based on an open programmable switch , a pbx , a cti ( computer telephony integration ) system , or other technologies performing bridging and conferencing functions . different service providers may use different technologies , thus yielding a heterogeneous system each audio bridge is managed by a software entity , referred to as a call manager 15 . the call manager interacts with the audio bridge 16 through a set of telephony application commands . since audio bridges may have different interface specifications , call managers are tailored to the specific audio bridge that they control . a homogeneous interface , however , has to be present to the layer above the call managers , i . e . the software component that is interacting with the various call managers needs to be independent of the audio bridging technology used . thus , a homogeneous interface ( tcp / ip network interface to the various call managers needs to be present . the combination of the call manager 15 and audio bridge is referred to as a conference service center 45 . see fig4 . service providers make information about their respective audio conference platforms available to the resource broker 17 via a web user interface 11 . an example template of such information is provided in fig2 . provided are service provider identification information 20 audio bridge availability 21 , audio bridge capacity 22 , and pricing information 23 . the resource broker balances the load on the available audio conference platforms based on certain criteria . such a criteria might take number of factors into consideration such as current and projected bridge availability , tariff structure , fairness to users and service providers , service location with respect to users , audio bridge features and capacity , and telephony connectivity technology . at the heart of the resource broker is a universal control manager 12 which implements the load balancing criterion . the universal control manager interacts with the multitude of call managers in the system and consults two database systems : a service provider profile database 13 and a user profile database 14 . the service provider profile database contains information about the various providers or conferencing services , such as name , location of service , billing , and attributes of platform . information as shown in fig2 is collected from user interface 11 . the user profile database contains information about users of the conferencing services , such as name , access , and accounting . such information is collected from the user interface as shown in fig3 . users access the system through a web user interface 10 . an example template of such information is provided in fig3 . provided are user identification information 30 , audio conference reservation 31 , telephone numbers of conferees 32 , and user preferences 33 . fig4 shows the connectivity of users 47 , audio conference service providers 42 , conference service centers 45 and resource brokers 17 . a service provider 42 is the owner of one or more conference service centers 45 which comprises an audio bridge 16 and call manager software 15 . the service provider 42 registers its resources with the resource broker 17 from a computer terminal via internet connection 422 . the users 47 also enter their requests for audio conference service from their computer terminals and transmit these requests to the resource broker via internet connections . when the time for audio conference comes , the resource broker sends a request for a conference to the call manager 15 of the selected conference service center 45 . the selection criteria is based on the user preferences 33 , audio bridge availability 21 , audio bridge capacity 22 and the price of the service 23 . for instance , the user may send a request to set up a conference among 10 participants every tuesday afternoon for an hour . the user may prefer a particular audio conference service provider or may request the service from a provider whose price is the lowest . the resource broker 17 selects the service provider that is most suitable to users request . once the call manager 15 of the service provider is invoked , the parties 40 that will participate in this audio conference are either called out or they call in the audio conference bridge to participate to the conference . the connection of a resource broker to the internet and its components are shown in fig5 . the resource broker 17 comprises a universal control manager 12 , a user profile database 14 , and service provider profile database 13 . moreover , the universal control manager comprises audio control manager 51 , optimization processor 52 and a request processor 56 . all the service requests that come from users and the registration requests that come from service providers are received and processed by the request processor 56 . the main function of a request processor is to receive and register the information into either service provider profile database or the user profile database . the service requests ( fig3 ) that come from users are registered into user profile database 14 , and the resource registration information ( fig2 ) that comes from the service providers is registered into the service provider profile database 13 . the request processor can be implemented as a multi - threaded process on the server machine that runs the resource broker . one thread is dedicated to listen to the internet for incoming requests 55 as a tcp / ip socket . incoming requests are then identified according to their types and passed to either the user profile or the service provider profile database . optimization processor 52 reads in the service requests from ( 531 ) the user profile database 14 and from ( 571 ) the service provider profile database . for every request , the optimization processor finds the best match among possibly more than one service providers . this can be implemented as follows . the service request for a conference contains information about the time , the number and possibly the locations of the conference participants as described in fig3 . first , all the service providers that are capable of satisfying this service request are identified based on their capacity and availability . then , the pricing information is obtained from the service provider profile database 13 . if the user &# 39 ; s preference is based on the price , the service provider who charges less for the service is selected . fig7 shows how the optimization processor 52 works . when a request is read 70 from the user profile data base 14 , the counter is set 71 and checked if there is any service provider available 73 . for every service provider 74 , it is checked if the request can be satisfied with the services of that provider 75 . if the request is satisfied then it is checked if the service provider makes a better offer than the previous one 76 . a provider is selected as the prospective candidate if it makes a better offer 77 than the previous ones . this iteration continues until all the service providers are compared . once the match is found the request to start or reserve a conference is sent ( 521 ) to the audio control manager 51 . the request contains information about the number , duration , date and time of the conference , the list of the participants and their telephone numbers , and the identification of the service provider . audio control manager 51 has means to connect ( 54 ) to the call managers 15 ( fig1 ) of conference service centers over the internet 44 . the network addresses of service providers are known to the audio control manager . as soon as the request message ( 521 ) is received from the optimization processor 52 , the audio control manager establishes a network connection with the call manager of the selected service provider and sends a request to setup a conference . for every request , the audio control manager establishes a network connection and exchanges data and commands with the call manager . hence , the audio control manager maintains as many connections with the service providers as the number of conferences . the conferencing commands , such as starting , closing , adding or dropping parties are sent from the audio control manager to the service providers . the service providers , on the other hand , send back acknowledgments to these requests . the audio control manager maintains a connection configuration for every conference service provider . this connection configuration can be implemented as a configuration file which contains all the connection information such as the ip addresses of the service providers , the port numbers , and the audio bridging platform that is used . the audio control manager maintains multiple connectivity options and for every request it establishes a connection based on the connectivity profile of the conference service provider . fig6 shows how the request processor 56 is implemented . the incoming request from internet are read by a tcp socket 60 and their header information is checked 61 . the header information shows whether the request is coming from a user or a service provider 62 . once the originator of the request is identified 63 - 64 , the information regarding the request is registered into the appropriate database 66 - 67 . | 7 |
referring generally to the drawings , there is shown a miniature , electrically - powered vehicle designated generally by the reference numeral 10 . the vehicle 10 is constructed to ride over the surface of a continuous track 12 ( see fig2 ) on its front wheels 14 and its rear or driving wheels 16 . electric power for the vehicle is provided by a pair of continous , parallel , electrical rails 18 ( see fig2 ) which are embedded in track 12 . the rails 18 may , if desired , protrude above track 12 . the rails 18 are made of a material which is attracted by a &# 34 ; magnetic &# 34 ; material , typically , but not limited to , steel . a pair of pick - up shoes 20 extend downwardly from the bottom of the vehicle 10 . the shoes 20 maintain sliding contact with the rails as the vehicle 10 moves along track 12 , thereby delivering electric power to the vehicle . track 12 also includes a continuous slot 15 therein ( see fig4 ) which is parallel to and between rails 18 . the slot 15 is intended to receive a guide pin 22 which extends downwardly from the front of the vehicle 10 . thus , the car 10 is steered through a course around the track as guide pin 22 moves along the slot 15 when the vehicle is propelled by wheels 16 . the vehicle 10 includes a supporting chassis 24 and a body 26 , of any desired configuration , which is fitted to the chassis . chassis 24 is , typically , made of a sturdy plastic material which is lightweight and non - magnetic . the chassis 24 includes a floor 28 and a number of vertical walls or wall components to which the other elements of the vehicle are mounted . in one embodiment , each of front wheels 14 is rotatably mounted on a separate and independent axle 30 which extends outwardly from the floor 28 at the front of the vehicle 10 . guide pin 22 is also mounted at the front of the vehicle between front wheels 14 by conventional means , e . g . a force fit in a slot in the front end of floor 28 . guide pin 22 also extends downwardly below chassis 24 and into the slot 15 in track 12 . the rear wheels 16 , which may be wider than the front wheels and fabricated of or covered with a suitable material having a high coefficient of friction , are secured to the opposite ends of a common rear axle 32 . a crown gear 11 is coaxially secured to axle 32 between the wheels 16 . axle 32 is journaled in parallel side walls 35 of vehicle 10 in suitable fashion . an electric motor is mounted in the chassis 24 and receives electric power from the power rails 18 through shoes 20 and drives wheels 16 to propel the miniature vehicle 10 around the track 12 . the electric motor includes an armature assembly 36 which forms the rotor of the electric motor and is coaxially mounted on drive shaft 38 which is oriented along the length of the vehicle 10 . drive shaft 38 terminates in a coaxially secured pinion 64 which meshes with crown gear 11 to transfer power to rear wheels 16 . drive shaft 38 is journaled in a pair of bearings 40 and 41 which are mounted , respectively , in walls 42 and 44 of chassis 24 . typically , the bearings 40 and 41 are made of brass to present low friction to the rotation of shaft 38 . as seen best in fig1 and 2 , each of bearings 40 and 41 includes a pair of rectangular flanges at its ends which restrain the bearing against axial movement . the bearings 40 and 41 are retained in vertical guideways or slots cut in walls 42 and 44 , respectively . the guideways are slightly narrower than the outside diameter of the respective bearing , but include a detent at the end of the guideways so that the bearings may be pressed down into the guideways and be retained in position therein . the armature assembly 36 includes a generally cylindrical core 46 which is , typically , comprised of a plurality of disk - like soft iron laminations ( as seen best in fig3 ). as best seen in fig4 the core 46 is partly cut away or slotted to form three core segments 46a . a separate winding 47 of insulated wire is wound on each of the core segments 46a in the conventional fashion for miniature electric motors . a segmented commutator 48 is coaxially mounted on shaft 38 between bearing 41 and armature 36 . the commutator 48 serves as an electrical contact for supplying electrical power to the windings 47 . thus , electrical power is provided from rails 18 to commutator 48 by means of contact shoes 20 and a pair of brush assemblies 49 which include brushes 50 . the brush assemblies 49 are mounted on floor 28 on either side of commutator 48 and the brush assemblies 49 are retained by means of spring clips 53 . spring clips 53 each have a first end 53a retained by a lug 55 protruding upwardly from chassis floor 28 . as seen best in fig3 a second end 53b of each clip 53 extends down through a hole 28a in floor 28 and is detachably coupled to a first end 20a of one of shoes 20 . each of shoes 20 extends towards the front of the vehicle and curves upward over a projection 28b of floor 28 as seen in fig1 and 2 . as best seen in fig1 the end 20b of each shoe 20 is bifurcated and curves downward and over projection 28b so that the bifurcation straddles the projection . a spring 51 disposed between the bottom of floor 28 and the top surface of contact shoe 20 keeps the shoe biased for continuous engagement with rail 18 whereby vehicle 10 is continually provided with electric power . the stationary or stator component of the electric motor comprises a pair of magnets 52 each mounted in a compartment of chassis 24 on either side of armature 36 . the compartments are substantially open at the bottom and at the side adjacent to the armature . this permits the magnets to extend through the floor of chassis 24 and to be in close proximity to rails 18 thereby providing an attractive force holding vehicle 10 to track 12 . each of the magnet compartments is formed by a portion of wall 42 , a side wall 56 opposite the armature , a wall 58 , and projections which extend normal to walls 42 and 58 , respectively . this construction of the vehicle is substantially convention . the magnets 52 are identical in configuration and assembly . ( as best seen in fig1 and 3 , each of the magnets 52 conforms to the shape of the compartment 54 in chassis 24 .) that is , both magnets 52 have the south pole on the bottom and the north pole at the top or ( vice versa ). that is , both magnets have the north / south axis vertically aligned ( rather than horizontally as in the prior art ). while the magnets are generally rectilinear , each magnet 52 may have the inner surface thereof curved to conform to armature 36 in a preferred embodiment . flux bridge 60 , preferrably made of ferrous sheet material , is mounted to interconnect the magnets 52 . in particular , flux bridge 60 has the ends thereof joined to the upper surface ( for example the north pole ) of each of the magnets 52 . the center portion of the flux bridge is curved so that it overpasses the motor , in particular the armature portion , of the vehicle . of course , if the motor is made smaller or lower , the flux bridge 60 can be made flat without the curved portion , per se . the flux bridge 60 has the effect of joining the magnets 52 to provide a more complete flux path for the motor . in some versions , as best seen in fig4 and 4a , a pair of pole pieces 52a extend outwardly from the bottom of the magnets 52 toward the motor . it has been found that pole pieces 52a can provide a considerable increase in the magnetic flux applied to the motor 10 by the magnets 52 . the particular configuration for the pole pieces 52a shown in fig4 is adequate to provide magnetic flux to the motor and , as well provide the broad magnetic flux surface from magnets 52 to the rail 18 and , yet , permit utilization of a smaller magnet . that is , because the flux bridge 60 covers and contacts most ( if not all ) of the top surfaces of magnets 52 and is made of a ferrous material , it represents a relatively low reluctance path for magnetic flux or field lines . thus , those magnetic flux lines which normally emanate from the top or back of magnet 52 and disperse into the space surrounding the vehicle 10 are concentrated in flux bridge 60 and are directed downwardly , in parallel , so as to emanate from the bottom of magnets 52 . as can be seen in fig4 the bottom surfaces ( for example , south poles ) of magnets 52 are generally disposed above the rails 18 , whereby the concentrated field lines which emanate from each magnet 52 are directed to the respective rail 18 . this arrangement results in a stronger magnetic attraction than is provided by the horizontally mounted magnets of the prior art even when used with flux collector devices . it has also been found that with the flux bridge 60 the magnetic field applied to armature 36 is strengthened . it is believed that this results from the decrease in reluctance between the magnets 52 because of the complete flux path provided by bridge 60 . owing to this decrease in reluctance , field lines which would normally pass through the air space between the tops of the respective magnets find a lower reluctance path therebetween and the armature 36 and , thus , pass between the armature and the magnet . the resulting increased strength in the magnetic field directed to the armature increases the torque and power of the motor . the motor arrangement described above , with the magnets 52 mounted at the sides of chassis 24 , with the vertical north / south pole configuration , is particularly efficient in providing an attractive force between the vehicle 10 and the power rails 18 . this is due in part to the fact that the magnets 52 extend along the power rails 18 and are able to provide magnetic attraction along the entire length and width thereof . referring to fig4 a , there is shown another version of the car using the instant invention . that is , the side mounted magnets 52 have the north / south axis arranged vertically . however , in this embodiment a much lower profile magnet is used . this can be the result of the use of materials with improved magnetic properties , for example . all other known models employ a motor design wherein the north / south axis orientation of the magnets is horizontal thus limiting the magnetic down force available over the rails . also , additional pole pieces 154 can be provided at the lower surfaces of the magnets 52 . these pole pieces , which function akin to the flux collectors of the prior art , are used primarily to redirect the magnetic flux lines from the magnets 152 toward the armature 36 . however , the advantages described above relative to the instant invention are realized , as well . referring now to fig5 there is shown a schematic representation ( partially in section ) of the front end suspension of miniature electrical vehicles which are known in the art . in this embodiment , the front wheels 514 are the type which are conventional in the art . the wheels 514 are fixed to the chassis 528 of the vehicle by means of suitable mounting means 529 . the separate and independent axle 530 for each wheel 514 is mounted in the mounting 529 . a guide pin 550 is also mounted in the chassis 528 . in particular , the chassis 528 includes a groove or snap - in portion in the front thereof . this groove receives the center core 523 of the guide pin 550 which is disposed between the two horizontal plates 524 and 525 of the guide pin 550 . the dimensions of the snap - in groove and the guide pin components are arranged so that a tight fit is effected so that the depending guide pin 522 can be used to guide the vehicle around the track by depending into slot 515 in the track 12 . if necessary , the guide pin mechanism can be adhered to the chassis by means of glue or other suitable adhesive . in the prior art , the wheels 514 are mounted to fixed axles and a rigid suspension system is provided . this system permits the vehicles to &# 34 ; jump &# 34 ; off the track with any bumps or warped portions of the track . referring now to fig6 there shown a new and improved guide pin 600 which is useful for providing another embodiment of the instant invention . in particular , the new guide pin permits a &# 34 ; live axle &# 34 ; apparatus as described hereinafter . the guide pin 600 includes the plates 624 and 625 as well as the guideplate 661 . the barrel or core 623 is disposed between the plates 624 and 625 . in this regard , the guide pin 600 is similar to the prior art device . however , in the guide pin 600 an additional barrel 659 is provided between the plates 624 and 651 . the barrels 623 and 659 are of substantially the same diameter . however , in a preferred embodiment , the barrel 659 is taller than the barrel 623 . the depending guide pin 622 extends below the lower plate of the guide pin as in the case of the prior art . in essence , the guide pin 600 below plate 624 , i . e . from the plate 624 to the bottom of guide 622 is substantially identical to the guide pin 522 shown in fig5 . in addition , the barrel 623 will mate with the groove or slot in the base of the racing car apparatus which is identical to that of the prior art . however , the barrel 659 and plate 661 extend above the chassis 528 of the vehicle , as described hereinafter . as shown in fig7 and 8 , improved guide pin 600 is mounted into the chassis 528 in the same fashion as in the prior art . however , as noted , the barrel 659 extends above the chassis . in this instance , the vehicle axle , 700 , referred to as a &# 34 ; live axle &# 34 ; is disposed in vertical slots 701 which are formed in vertical walls 702 on opposite sides of the chassis 528 . in the preferred embodiment , the slots 701 are closed at the bottom but open at the top . these slots have a vertical length substantially equal to the height of the side wall 702 . when the axle 700 is placed within these slots , the axle is free to move , vertically , at either end thereof . in addition , the axle 700 is disposed under the plate 661 of guide pin 600 and behind the barrel 659 of pin 600 . the slots 701 are disposed in the wall 702 in an arrangement relative to the guide pin 600 so that the axle 700 is maintained within the slots 701 and below plate 661 . however , the axle 700 is free to move vertically between the plates 651 and 624 . moreover , axle 700 is free to move vertically at either end . the relationship between barrel 659 , plates 623 and 661 and the vertical length of slots 701 is such that the axle does not become disengaged from side wall 702 . as shown in fig8 the &# 34 ; live axle &# 34 ; 700 is permitted to freely move at either end ( or both ends if need be ). this will permit the vehicle to operate on a track which has become warped , for example . the rear wheels of the vehicle are generally not arranged to have such a live axle in order to maintain full contact with the track . referring now to fig9 there is shown a schematic representation of the arrangement of the guide pin 600 relative to the chassis 528 , as well as the side walls 702 . since the bottom portion of pin 600 is mounted substantially perpendicular to chassis 528 and included in the slot or groove in the front thereof , the axle 700 is retained by plate 661 of pin 600 but is free to move , vertically , within slot 701 . this arrangement permits a free , live action suspension . although a specific embodiment of the invention has been shown for illustrative purposes , it will be appreciated by those skilled in the art that many modifications , additions and / or substitutions are possible without departing from the scope and spirit of the invention . any such modifications are intended to be included in this description . the description is illustrative only and is not intended to be limitative . rather , the scope of the invention is limited only by the claims appended hereto . | 0 |
description will now be given of a dram in one embodiment of a semiconductor memory according to the present invention . as shown in fig1 a , the dram includes a main section 100 including a dram memory cell array 101 constituted by a plurality of dram memory cells 23 ( referring to fig2 ) arranged in the form of an array . a spare section 110 as a redundant circuit section includes a spare dram memory cell array 111 constituted by a plurality of dram memory cells 23 arranged in the form of an array . an address decoder 120 specifies addresses respectively of the arrays 101 and 111 . a defective bit replacement control circuit 130 is connected to the address decoder 120 and includes a plurality of electrically rewritable nonvolatile memory cells 24 ( referring to fig3 ). the dram memory cell 23 includes , as shown in fig2 a metal - oxide - semiconductor ( mos ) transistor and a capacitor . the transistor includes a gate oxide layer 4 , a gate electrode 5 formed on the layer 4 , sidewall spacers 9 fabricated respectively on both sides of the electrode 5 , a pair of n - - type impurity diffusion layers 8 manufactured in a silicon substrate 1 below the spacers 9 , and a pair of n + - type impurity diffusion layers 10 formed respectively on outer sides of the layers 8 . the capacitor includes a lower electrode 13 , a dielectric layer 15 , and an upper electrode 17 . the nonvolatile memory cell 24 includes , as can be seen from fig3 a tunnel oxide layer 6 , a floating gate lower portion 7 &# 39 ; formed on the layer 6 , a floating gate upper portion 7 &# 34 ; manufactured on the lower portion 7 &# 39 ;, a dielectric layer 16 formed so as to cover the upper portion 7 &# 39 ;, a control gate 18 manufactured so as to cover the dielectric layer 16 , sidewall spacers 9 fabricated respectively on both sides of the lower portion 7 &# 39 ;, a pair of n - - type impurity diffusion layers 8 formed in a silicon substrate 1 below the spacers 9 , and a pair of n + - type impurity diffusion layers 10 formed respectively on outer sides of the layers 8 . in the dram of this embodiment , when a defect takes place in any one of the plural cells 23 constituting the array 101 of the main section 100 , a word ( or bit ) line specifying an address of the defective cell 23 is disconnected from the address decoder 120 . one of the plural nonvolatile memory cells 24 which is associated with the defective cell 23 is changed from on to off by a defective bit replacement signal 150 supplied to the replacement control circuit 130 . in association therewith , to connect the address decoder 120 to a word ( or bit ) line to be used for the spare cell 23 of the spare cell array 111 , one other of the nonvolatile memory cells 24 , which is associated with the spare cell 23 , is changed from off to on by the defective bit replacement signal 150 supplied to the replacement control circuit 130 . in the embodiment above , the nonvolatile memory cells are of the floating - gate type . however , memory cells of the metal - nitride - oxide - semiconductor ( mnos ) type in which electric charge is accumulated in a boundary between a silicon nitride layer and a silicon oxide layer may be also employed . fig1 b , 12 and 13 show another embodiment of a semiconductor memory ( dram ) in accordance with the present invention , where the same reference characters in all figures denote the same or identical components of the present invention . as shown in fig1 , the address decoder ( standard ) 120 1 comprises a plurality of inverters in 10 - in 1n , a plurality of nand circuits na 1 - na m , and a plurality of clocked inverters in 21 - in 2m . in the inverters in 10 - in 1n , the polarities of address signals x o - x n which are inputted to the address decoder ( standard ) 120 1 through address input terminals are inverted , respectively . in the nand circuits na 1 - na m , the address signals x o - x n are decoded . the output signals of the nand circuits na 1 - na m are inputted to the memory cells 23 in the dram memory cell array 101 through the clocked inverters in 21 - in 2m which operate while a write - clock φ w is high . the write - clock φ w is inputted to the address decoder ( standard ) 120 1 through a write - clock input terminal . however , the address signals x o - x n are decoded only while a select inhibit signal si , which is inputted from the address decoder ( spare ) 120 2 to the nand circuits na 1 - na m , is high . as shown in fig1 , the address decoder ( spare ) 120 2 comprises an eeprom bit replacement signal input circuit 125 , a plurality of address generation circuits 121 1 -- 121 p , an and circuit an , and a plurality of clocked inverters in 41 - 1n 4p . each of the address generation circuits 121 1 - 121 p comprises a plurality of circuits each of which has the electrically rewritable nonvolatile memory cell 24 and a mos transistor m which are connected in series . the drain of each electrically rewritable nonvolatile memory cells 24 is connected to a power source v dd through a resistor r . the control gate of each electrically rewritable nonvolatile memory cells 24 is connected to the eeprom bit replacement signal input circuit 125 . in each of the address generation circuits 121 1 - 121 p , the address signals x o - x n , x o - x n are inputted to the gates of the mos transistors m , respectively . the source of each mos transistors m is connected to the ground . the output signals of the address generation circuits 121 1 - 121 p are inputted to the and circuit an , respectively . the output signals of the address generation circuits 121 1 - 121 o are also inputted to the memory cells 23 in the spare dram memory cell array 111 through the clock inverters in 41 - in 4p which operate while the write - clock φ w is high . when a defective memory cell is detected in the dram memory cell array 101 , the address information of the defective memory cell is transmitted from the defective replacement control circuit 130 to the eeprom bit replacement signal input circuit 125 . then , the address of the defective memory cell is written in the electrically rewritable nonvolatile memory cells 24 of the address generation circuits 121 1 by the eeprom bit replacement signal input circuit 125 . when the address signals x o - x n , x o - x n which correspond to the address of the defective memory cell are inputted to the gates of the mos transistors m of the address generation circuits 121 1 , the output signal of the address generation circuits 121 1 becomes low . as a result , the output signal of the address generation circuits 121 1 is inputted to the spare dram memory cell array 111 through the clocked inverter in 41 , so that data which should be stored in the defective memory cell is stored in the memory cells 23 of the spare dram memory cell array 111 . further , the output signal of the address generation circuits 121 1 , which has low level , is inputted to the and circuit an , so that the select inhibit signal si becomes low . as a result , the data is not stored in the memory cells 23 of the dram memory cell array 101 . referring next to fig4 a to 4d and 5a to 5d , description will be given of one method of manufacturing the dram of fig1 a and 1b . this is the first embodiment of the first semiconductor manufacturing method according to the present invention in which dram memory cells of fig2 are formed in a first element forming region r1 of a silicon substrate 1 and then nonvolatile memory cells 24 of fig3 are fabricated in a second element forming region r2 of the silicon substrate 1 . on the p - type silicon substrate 1 , a silicon oxide layer and a silicon nitride layer , which are not shown , are sequentially manufactured as pads . using a photoresist layer ( not shown ) as a mask thereon , anisotropic dry etching is conducted to remove the silicon nitride layer in other than element forming regions r1 and r2 . an impurity substance is injected by ion implantation , for example , bf 2 into the silicon substrate 1 to prepare p +- type impurity diffusion layers 2 functioning as channel stoppers as shown in fig4 a . after the photoresist layer is removed , the exposed surface is washed . in an h 2 o atmosphere , the substrate 1 is subjected to a thermal treatment at a temperature of 1100 ° c . to selectively oxidize the silicon substrate 1 ( locos ) so as to fabricate element insulation layers 3 in element separation regions other than the regions r1 and r2 . thereafter , the silicon nitride layer as the mask for the thermal treatment is removed . subsequently , as shown in fig4 b , the sacrifice oxide film ( not shown ) is formed and then removed . thereafter , a silicon oxide layer having a film thickness of about 10 nanometers ( nm ) to about 20 nm is fabricated on the overall regions r1 and r2 to be used as a gate oxide layer 4 in the first element forming region r1 and as a tunnel oxide layer 6 of the nonvolatile memory cells in the second element forming region r2 ( first step ). after injecting impurity , for example , bf 2 to control a threshold value into the silicon substrate 1 , a polycrystalline silicon film is manufactured on the overall surface . an ion implantation of n - type impurity atoms , for example , phosphor ( p ) is conducted on the polycrystalline silicon layer to form an n - type polycrystalline silicon layer . applied onto the n - type layer is photoresist ( not shown ) to be subjected to a patterning process . using the patterned photoresist as a mask , anisotropic dry etching is carried out on the polycrystalline silicon layer to form a gate electrode 5 of the mos transistor in the first region r1 and a floating gate lower portion 7 &# 39 ; of the nonvolatile memory cell 24 in the second region r2 ( second step ). then , the anisotropic dry etching may be carried out either on only the polycrystalline silicon layer or on both the silicon oxide layer and the polycrystalline silicon layer . after removing the photoresist , as shown in fig4 c , using the element isolation layer 3 , the gate electrode 5 , and the floating gate lower portion 7 &# 39 ; as mask elements , n - type impurity atoms , for example , phosphor are injected into the overall surface of the silicon substrate 1 to fabricate a pair of n - - type impurity diffusion layers 8 in the first and second regions r1 and r2 . forming a silicon oxide film on the overall surface of the substrate 1 , anisotropic dry etching is conducted on the silicon oxide film to manufacture a pair of sidewall spacers 9 on both sides of each of the gate electrode 5 and the floating gate lower portion 7 &# 39 ;. thereafter , using the element isolation layer 3 , the gate electrode 5 , the floating gate lower portion 7 &# 39 ;, and the sidewall spacers 9 as mask elements , n - type impurity atoms , for example phosphor , are implanted into the entire surface of the silicon substrate 1 to manufacture a pair of n + - type impurity diffusion layers 10 respectively in the first and second regions r1 and r2 ( third step ). as a result , an impurity diffusion layer having a lightly doped drain ( ldd ) structure is fabricated in the silicon substrate . next , as shown in fig4 d , a silicon oxide film 11 is formed on the overall surface of the silicon substrate 1 ( fourth step ). thereafter , using photoresist ( not shown ) as an etching mask , anisotropic dry etching is carried out to remove the silicon oxide layer 11 on the n + - type impurity diffusion layer 10 in the first region r1 and on the floating gate lower portion 7 &# 39 ; in the second region r2 so as to produce contact holes 12 and 12 &# 39 ; at the same time ( fifth step ). after removing the photoresist from the substrate 1 , a polycrystalline silicon film is formed on the overall surface of the substrate 1 . injecting n - type impurity atoms , for example phosphor , into the polycrystalline silicon film by ion implantation , an n - type polycrystalline silicon film is obtained . photoresist ( not shown ) is patterned on the obtained n - type film . utilizing the photoresist as a mask , the n - type silicon film is etched to manufacture a capacitor lower electrode 13 in the first region r1 and a floating gate upper portion 7 &# 34 ; in the second region r2 ( sixth step ). the photoresist is then removed from the silicon substrate 1 . subsequently , as shown in fig5 a , using an oxide - nitride - oxide ( ono ) layer including a silicon oxide layer , a silicon nitride layer , and a silicon oxide layer , a capacitor dielectric layer 15 is formed to cover the capacitor lower electrode 13 in the first region r1 , and a dielectric layer 16 is formed to cover the floating gate upper portion 7 &# 34 ; in the second region r2 ( seventh step ). in this step , in place of the ono layer , a dielectric layer of such a ferroelectric substance as tantalum oxide ( ta 2 o 5 ) or lead ( pz ) zirconate titanate ( pzt ) may be formed . next , as shown in fig5 b , a polycrystalline silicon layer is formed on the overall surface of the silicon substrate 1 , and then n - type impurity atoms of , for example , phosphor are injected into the polycrystalline silicon layer by ion implantation to obtain an n - type polycrystalline silicon layer . thereafter , photoresist ( not shown ) is patterned on the obtained n - type film . using the photoresist as a mask , the n - type polycrystalline silicon layer is etched to fabricate a capacitor upper electrode 17 in the first region r1 and a control gate 18 in the second region r2 ( eighth step ). after removing the photoresist , a silicon oxide layer 19 is formed on the entire surface of the substrate 1 . as shown in fig5 c , photoresist ( not shown ) is applied onto the overall surface of the silicon substrate 1 to be patterned thereafter . using the photoresist as a mask , the n - type polycrystalline silicon layer is subjected to anisotropic dry etching to fabricate contact holes 20 , 20 &# 39 ; and 20 &# 34 ; respectively on the n + - type impurity diffusion layer 10 as a source in the first region r1 and on the paired n + - type impurity diffusion layers 10 respectively as source and drain regions in the second region r2 . as shown in fig5 d , after removing the photoresist , aluminum is sputtered onto the overall surface of the silicon substrate 1 to form an aluminum layer . photoresist ( not shown ) is patterned on the aluminum layer . using the photoresist as a mask , an aluminum wiring region 21 in a desired pattern is formed . after removing the photoresist , a silicon oxide layer 22 is formed on the entire surface of the substrate 1 . as a result of the above processes , a dram memory cell 23 of the one - transistor - per - capacitor type is fabricated in the first element forming region r1 , and an electrically rewritable nonvolatile memory cell 24 is fabricated in the second element forming region r2 . according to the dram manufacturing method described above , when producing the dram memory cell 23 on the silicon substrate 1 in an ordinary mos production , the nonvolatile memory cell 24 of the floating gate type can be fabricated on the silicon substrate 1 without increasing the number of production processes . referring now to fig6 a to 6d and 7a to 7d , description will be given of another method of manufacturing the dram of fig1 a and 1b . this is the second embodiment of the first semiconductor manufacturing method according to the present invention . a dram memory cell having a structure similar to the dram memory cell 23 of fig2 is fabricated in the first element forming region r1 of the silicon substrate 1 , and a nonvolatile memory cell having a structure similar to the nonvolatile memory cell 24 of fig3 is formed in the second element forming region r2 of the substrate 1 . fig6 a to 6c show semiconductor manufacturing processes corresponding to those of fig4 a to 4c of the first semiconductor manufacturing method according to the present invention . after the processes of fig6 a to 6c , a manufacturing process is conducted as shown in fig6 d . as shown in fig6 d , a silicon oxide layer 11 is formed on the overall surface of the silicon substrate 1 . anisotropic dry etching is conducted on the layer 11 using photoresist ( not shown ) as a mask to remove the silicon oxide layer 11 on the n + - type impurity diffusion layer 10 as a drain in the first region r1 and on the floating gate lower portion 7 &# 39 ; in the second region r2 , thereby producing contact holes 12 and 12 &# 39 ; at the same time . after removing the photoresist , a polycrystalline silicon layer a is formed on the overall surface of the silicon substrate 1 , and then n - type impurity atoms of , for example , phosphor are injected into the layer a to obtain an n - type polycrystalline silicon layer a . next , using an ono layer , a dielectric layer b is formed in the first and second regions r1 and r2 . in place of the ono layer , a ferroelectric layer of tantalum oxide ( ta2o5 ) or pzt may be employed . next , a polycrystalline silicon layer c is fabricated on the overall surface of the silicon substrate 1 , and then n - type impurity atoms of phosphor , for example , are injected into the polycrystalline silicon layer c by ion implantation to attain an n - type polycrystalline silicon layer c . as shown in fig7 a , on the n - type layer c , a mask pattern of photoresist ( not shown ) is formed such that the layer c , the dielectric layer b , and the layer a are removed by etching to form in the region r1 a capacitor upper electrode 17 of the polycrystalline silicon layer c , a capacitor dielectric layer 15 of the dielectric layer b , and a capacitor lower electrode 13 of the polycrystalline silicon layer a , and in the second region r2 a control gate 18 of the layer c , a dielectric layer 16 of the dielectric layer b , and a floating gate upper portion 7 &# 34 ; of the layer a . the photoresist is then removed from the substrate 1 . the capacitor dielectric layer 15 is formed only on the surface of the capacitor lower electrode 13 , and the capacitor upper electrode 17 is formed only on the surface of the capacitor dielectric layer 15 . further , the dielectric layer 16 is formed only on the surface of the floating gate upper portion 7 &# 34 ;, and the control gate 18 is formed only on the surface of the dielectric layer 16 . subsequently , as shown in fig7 b , a silicon oxide layer 19 is formed on the overall surface of the silicon substrate 1 . as shown in fig7 c , photoresist ( not shown ) is applied onto the entire surface of the substrate 1 to be patterned into an etching mask . using the photoresist as a mask , anisotropic dry etching is conducted thereon to produce contact holes 20 , 20 &# 39 ;, and 20 &# 34 ; respectively on the n + - type impurity diffusion layer 10 as a source in the first region r1 and on the paired n + - type impurity diffusion layers 10 as source and drain regions in the second region r2 . as shown in fig7 d , after removing the photoresist , an aluminum layer is fabricated on the entire surface of the substrate 1 by sputtering . photoresist ( not shown ) is patterned on the aluminum layer . using the photoresist as a mask , an aluminum wiring layer 21 is formed in a desired pattern . after removing the photoresist , a silicon oxide layer 22 is fabricated on the entire surface of the substrate 1 . through the above processes , a dram memory cell is fabricated having one transistor for each capacitor in the first element forming region r1 , and an electrically rewritable nonvolatile memory cell in the second element forming region r2 . according to the dram manufacturing method described above , when producing the dram memory cell on the silicon substrate 1 in an ordinary mos production , the nonvolatile memory cell of the floating gate type can be fabricated on the same silicon substrate 1 without increasing the number of production processes . referring next to fig8 , 10a to 10d and 11a to 11d , description will be given of the second semiconductor memory manufacturing method according to the present invention . the dram produced in accordance with this method has a structure identical to that of the dram of fig1 a and 1b fabricated by the first embodiment of the first semiconductor memory manufacturing method according to the present invention . as shown in fig8 the dram memory cell of the second manufacturing method has also the same construction as that of the dram memory cell 23 of fig2 . however , a nonvolatile memory cell 24 &# 39 ; is different from the nonvolatile memory cell 24 of fig3 . namely , in the cell 24 &# 39 ;, the dielectric layer 16 is disposed on the floating gate 7 as shown in fig9 whereas in the memory cell 24 , the dielectric layer 16 is provided over the floating gate lower portion 7 &# 39 ;, which corresponds to the floating gate 7 , with the floating gate upper portion 7 therebetween . in the memory cell 24 &# 39 ; of fig9 due to the dielectric layer 16 formed on the floating gate 7 , the floating gate capacity is decreased when compared with that of the memory cell 24 shown in fig3 . consequently , while the memory cell 24 of fig3 is favorably used in the normally - on state , the memory cell 24 &# 39 ; of fig9 is favorably used in the normally - off state . referring now to fig1 a to 10d and 11a to 11d , description will be given in detail of the second semiconductor memory manufacturing method according to the present invention . the constituent components of the dram memory cell are assigned reference numerals used in fig2 . for the components of the nonvolatile memory cell 24 &# 34 ;, reference numerals of fig3 are used except the floating gate 7 . in the dram manufacturing method of this embodiment , the dram memory cell 23 of fig8 and the nonvolatile memory cell 24 &# 39 ; of fig9 are formed respectively in the first and second regions r1 and r2 on the substrate 1 . on a p - type silicon substrate 1 , a silicon oxide layer and a silicon nitride layer ( not shown ) are formed as pads . using photoresist ( not shown ) as a mask , anisotropic dry etching is conducted to remove the silicon nitride layer in other than the regions r1 and r2 . as shown in fig1 a , p + - type impurity diffusion layers 2 are formed by injecting an impurity substance such as bf 2 into the silicon substrate 1 . removing the photoresist , the surface of the substrate 1 is washed . in an atmosphere of h 2 o , a thermal treatment is conducted for the substrate 1 at a temperature of 1100 ° c . to selectively oxidize the substrate 1 ( locos ) so as to fabricate element isolation layers 3 in the element separation regions other than the regions r1 and r2 . the silicon nitride layer used as the mask for the thermal treatment is then removed . as shown in fig1 b , after forming and removing a sacrifice oxide layer ( not shown ), a silicon oxide layer having a thickness of about 10 nm to about 20 nm is applied entirely onto the regions r1 and r2 to manufacture a gate oxide layer 4 in the first region r1 and a tunnel oxide layer 6 of the nonvolatile memory cell in the second region r2 ( first step ). to control a threshold value , an impurity substance , such as bf 2 , is injected into the silicon substrate 1 by ion implantation , and then a polycrystalline silicon layer is formed on the entire surface of the substrate 1 . injecting n - type impurity atoms of phosphor , for example , into the polycrystalline silicon layer , an n - type polycrystalline silicon layer is prepared . photoresist ( not shown ) is applied onto the n - type polycrystalline silicon layer and is then patterned . using the patterned photoresist as a mask , anisotropic dry etching is carried out thereon to produce a gate electrode 5 of an mos transistor in the first region r1 and a floating gate 7 of the nonvolatile memory cell 24 &# 39 ; in the second region r2 at the same time ( second step ). then , the anisotropic dry etching may be carried out either on only the polycrystalline silicon layer or on both the silicon oxide layer and the polycrystalline silicon layer . as shown in fig1 c , after removing the photoresist , n - type impurity atoms of phosphor , for example , are injected into the overall surface of the silicon substrate 1 by ion implantation using the element isolation layer 3 , the gate electrode 5 , and the floating gate 7 as masks . a pair of n - - type impurity diffusion layers 8 are formed in the first and second regions r1 and r2 , respectively . a silicon oxide layer 5 is formed on the overall surface of the substrate 1 to be subjected to anisotropic dry etching to manufacture sidewall spaces 9 on both sides respectively of the gate electrode 5 and the floating gate 7 . thereafter , using the element isolation layer 3 , the gate electrode 5 , the floating gate 7 , and the sidewall spacers 9 as masks , n - type impurity atoms of phosphor , for example , are injected into the overall surface of the silicon substrate 1 to form a pair of n + - type impurity diffusion layers 10 in the first and second regions r1 and r2 , respectively ( third step ). as a result , an impurity diffusion layer of an ldd structure is formed in the silicon substrate 1 . as shown in fig1 d , a silicon oxide layer 11 is fabricated on the overall surface of the silicon substrate 1 ( fourth step ). anisotropic dry etching is conducted on the layer 11 using photoresist ( not shown ) as a mask to remove the silicon oxide layer 11 on the n + - type impurity diffusion layer 10 as a drain in the first region r1 and on the floating gate 7 in the second region r2 to produce contact holes 12 and 12 &# 39 ; at the same time ( fifth step ). after removing the photoresist , a polycrystalline silicon layer is formed on the overall surface of the silicon substrate 1 , and then n - type impurity atoms of phosphor , for example , are injected into the polycrystalline silicon layer to obtain an n - type polycrystalline silicon layer . photoresist ( not shown ) is applied onto the n - type polycrystalline silicon layer and is then patterned . using the patterned photoresist as a mask , the polycrystalline silicon layer is etched to produce a capacitor lower electrode 13 in the first region r1 ( sixth step ). in this embodiment , the polycrystalline silicon layer formed on the floating gate 7 in the second region r2 is substantially entirely removed . thereafter , the photoresist is removed from the substrate 1 . subsequently , as shown in fig1 a , using an oxide - nitride - oxide ( ono ) layer including a silicon oxide layer , a silicon nitride layer , and a silicon oxide layer , a capacitor dielectric layer 15 is manufactured to cover the capacitor lower electrode 13 in the first region r1 , and a dielectric layer 16 is manufactured on the floating gate 7 in the second region r2 ( seventh step ). in this case , in place of the ono layer , a dielectric layer of such a ferroelectric material as tantalum oxide ( ta 2 o 5 ) or lead ( pz ) zirconate titanate ( pzt ) may be used . next , as shown in fig1 b , after a polycrystalline silicon layer is formed on the overall surface of the silicon substrate 1 , n - type impurity atoms of phosphor , for example , are injected into the polycrystalline silicon layer by ion implantation to obtain an n - type polycrystalline silicon layer . thereafter , photoresist ( not shown ) is patterned on the obtained n - type layer such that using the photoresist as a mask , the n - type polycrystalline silicon layer is etched to fabricate a capacitor upper electrode 17 in the first region r1 and a control gate 18 in the second region r2 ( eighth step ). after removing the photoresist , a silicon oxide layer 19 is formed on the entire surface of the substrate 1 . as shown in fig1 c , photoresist ( not shown ) is then applied onto the overall surface of the silicon substrate 1 to be patterned thereafter . using the patterned photoresist as a mask , the n - type polycrystalline silicon layer is subjected to anisotropic dry etching to fabricate contact holes 20 , 20 &# 39 ;, and 20 &# 34 ; respectively on the n + - type impurity diffusion layer 10 as a source in the first region r1 and on the paired n + - type impurity diffusion layers 10 respectively as source and drain regions in the second region r2 . as shown in fig1 d , after the photoresist is removed , aluminum is sputtered onto the overall surface of the silicon substrate 1 to form an aluminum layer . photoresist ( not shown ) is patterned on the aluminum layer . using the photoresist as a mask , an aluminum wiring region 21 is fabricated in a desired pattern . after removing the photoresist , a silicon oxide layer 22 is fabricated on the entire surface of the substrate 1 . as a result of the above processes , the dram memory cell 23 of the one - transistor - per - capacitor type is produced in the first element forming region r1 , and the electrically rewritable nonvolatile memory cell 24 &# 39 ; is produced in the second element forming region r2 . according to the dram manufacturing method described above , in the embodiment of the second semiconductor memory manufacturing method of the present invention , the contact holes 12 and 12 &# 39 ; need not be necessarily produced at the same time in the sixth step shown in fig1 d . namely , the process of fig1 a may be executed after the following process . after the fifth step of fig1 d in which the silicon oxide layer 11 is formed on the entire surface of the silicon substrate 1 , photoresist ( not shown ) is applied onto the silicon oxide layer 11 . anisotropic dry etching is conducted thereon by using the photoresist as a mask to remove the silicon oxide layer 11 on the n + - type impurity diffusion layer as a drain in the first region r1 so as to form a contact hole 12 . thereafter , the photoresist is removed and a polycrystalline silicon layer is fabricated on the overall surface of the silicon substrate 1 . photoresist ( not shown ) is patterned on the n - type polycrystalline silicon layer . using the photoresist as a mask , the polycrystalline silicon layer is etched to fabricate a capacitor lower electrode 13 in the first region r1 . in this step , the polycrystalline silicon layer formed on the second region r2 is substantially entirely removed . next , photoresist ( not shown ) is applied onto the overall silicon substrate 1 such that using the photoresist as a mask , anisotropic dry etching is conducted to remove the silicon oxide layer 11 on the floating gate 7 in the second region r2 , thereby producing a contact hole 12 &# 39 ;. the photoresist is then removed to subsequently conduct the process of fig1 a . while the present invention has been described with reference to the particular illustrative embodiments , it is not to be restricted by those embodiments but only by the appended claims . it is to be appreciated that those skilled in the art can change or modify the embodiments without departing from the scope and spirit of the present invention . | 7 |
an embodiment of the endless belt abrading machine according to the present invention will now be described below with reference to the accompanying drawings . fig1 is a sectional plan view of the endless belt abrading machine of the present invention . to clearly illustrate the structure of the abrading machine of the present invention , in fig1 , a base portion of the abrading machine 24 ( which will be described hereinafter ) is shown in a position rotated by 90 ° relative to a usual position of the machine &# 39 ; s main portion 22 , as viewed along the machine &# 39 ; s longitudinal axis from left to right . fig2 is a plan view of the machine in which the machine &# 39 ; s base portion 24 is shown in its usual operation . fig2 b is a side view of the machine . the machine 10 has the main portion 22 and the base portion 24 . the main portion 22 includes : an air motor 12 having an axis of rotation which is transverse to the machine 10 ; a drive pulley 16 which is drivingly connected to an output shaft 14 , and which extends laterally from one end of the air motor ; a driven pulley 18 , which is positioned forward of the drive pulley 16 ; and an endless belt 20 ( shown in fig2 a , fig2 b ), which is engaged with each of the drive and driven pulleys 16 , 18 . the base portion 24 includes a first air passageway 32 connected to a hose 30 extending from a source of compressed air ( a pump ) for supplying compressed air to the main portion 22 to drive the air motor 12 , a valve 34 for opening or closing the first air passageway 32 , and a lever 36 pivotably fitted on a circumferential top area of the base portion 24 . the lever 36 is movable between a depressed position and a released position , so as to enable the valve 34 to open or close the first air passageway 32 . in the illustrated example , the first air passageway 32 has an axial portion , a radial portion and a slanting portion . the axial portion extends parallel to an axis of the base portion from a joint opening , which is located at a rear end of the base portion and is connected to the hose 30 . the radial portion extends radially from the front end of the axial portion . the slanting portion extends forward and radially inward from the radial portion . the stop valve 34 has a valve member ( a ball ) 34 a set in the radial portion of the first air passageway 32 , and a spring 34 b which urges the valve member 34 a against a valve seat formed on the inner surface of the radial portion of the first air passageway 32 . the lever 36 , which is pivotable about a pivot pin 36 a , is retained in the released position , as shown in fig1 , by way of a lever retainer 42 , which is rotatable about a pivot pin 40 positioned forward of the pivot pin 36 a , and which is urged by a spring to engage with a lower surface of the lever 36 . the lever retainer 42 has an extending portion 42 a extending upwards of the lever 36 . when the extending portion 42 a of lever retainer 42 is moved downwards in a clockwise direction about the pivot pin 40 ( against the action of the spring 34 b ), the lever retainer 42 is rotated clockwise , which enables the lever 36 to be moved downwards counterclockwise about the pivot pin lever 36 a . when the extending portion of lever retainer 42 a is enabled to move upwards again , the lever retainer 42 and the lever 36 are sprung back into the position , as shown in fig1 , under the action of the spring 34 b . further , there is provided a connecting rod 34 c extending vertically between the underside of the lever 36 and the valve member 34 a . when the lever 36 is depressed or released , the connecting rod 34 c acts on the valve member 34 a to cause it to be either seated in or separated from the valve seat , and to thereby either open or close the stop valve 34 . hereinafter , the main portion 22 will be described in more detail . the portion 22 is adapted to be rotated about a longitudinal axis of the base portion of the machine 24 to a first operational position , where the output shaft 14 of the motor extends to the left of the machine ( fig1 , fig2 a ), and can also be rotated to a second operational position , where the output shaft 14 extends to the right of the machine ( fig3 a ). the air motor 12 is a vane motor , as shown in fig4 , and has first and second openings 12 a , 12 b ; and is selectively supplied with compressed air through either the first opening 12 a or the second opening 12 b to be caused to rotate in either a forward or reverse direction . as shown in fig4 , the main portion 22 includes a second air passageway 46 which has a fluid passage extending from an air inlet 44 connected with the slanting portion of the first air passageway 32 of the base portion 24 to the first or the second opening 12 a , 12 b of the air motor . there is further provided a ring valve 48 , which controls an air flow through the second air passageway 46 on an outer surface of the main portion 22 . the ring valve 48 is rotatable between a first and the second position . as will be described later , when the ring valve 48 is in the first position , the air inlet 44 of the second air passageway 32 is adapted to communicate with the first opening 12 a of the air motor ; and when the ring valve 48 is in the second position , the air inlet 44 of the second air passageway 32 is adapted to communicate with the second opening 12 b of the air motor . more specifically , as shown in fig4 , 5 a and 5 b , the main portion 22 includes a columnar portion 51 having a circular cross - section and defines the second air passageway 46 . the columnar portion 51 has a common passage 46 a ( fig5 a and 5 b ), a first branched passage 46 b ( fig5 a and 5 b , fig4 ) and a second branched passage 46 c ( fig5 a and 5 b , fig4 ). the common passage 46 a extends from the air inlet 44 ( fig1 ) to an air outlet 50 opening at an outer surface of the columnar portion 51 . the first branched passage 46 b ( fig5 a and 5 b , fig4 ) extends from a first inlet / outlet opening 52 which is provided on the outer surface of the columnar portion 51 circumferentially spaced apart from the air outlet 50 , to the first opening 12 a of the air motor . the second branched passage 46 c ( fig5 a , fig4 ) extends from a second inlet / outlet opening 54 , which is provided on the outer surface of the columnar portion 51 circumferentially and in symmetrical relation to the first inlet / outlet opening 52 about the air outlet 50 , to the second opening 12 b of the air motor . the ring valve 48 is provided with arcuate recesses 58 , 59 , 60 on an inner surface thereof . when the ring valve 48 is in the first position ( fig5 a , fig4 ), the arcuate recess 58 connects the air outlet 50 and the first inlet / outlet opening 52 to allow flow to flow to the air motor ; and the arcuate recess 59 connects the second inlet / outlet opening 54 to an exhaust passage 46 e formed in the columnar portion to allow exhaust to flow from the air motor , under which condition the air motor rotates . when the ring valve 48 is in the second position ( fig5 b ), the arcuate recess 58 connects the air outlet 50 and the second inlet / outlet opening 54 to allow air to flow to the air motor ; the arcuate recess 60 connects the first inlet / outlet opening to the exhaust passage 46 d in the columnar portion to allow exhaust from the air motor , under which condition the air motor rotates in a reverse direction . the driven pulley 18 is rotatably mounted on a distal end of a tension bar 62 in the same manner as in the abovementioned invention ( japanese patent application no . 2002 - 220567 ). the rear end portion of the tension bar is inserted into a cylindrical portion 64 a which extends forward from a housing 64 of the air motor 12 , and is urged forward by a compression spring 66 provided in the cylindrical portion 64 a . in this way , tension is applied to the endless belt 20 which is engaged with both the driven pulley 18 and the drive pulley 16 . an annular groove 68 is formed on a peripheral surface of the tension bar 62 . when it is required to replace a belt , the tension bar 62 is inserted into the cylindrical portion 64 a against the action of the compression spring 66 , which permits a spring 70 to engage in the annular groove 68 and to retain the tension bar 62 . after replacement of the belt , when the spring 70 is disengaged from the annular groove 68 , the tension bar is returned to its previous state under the action of the compression spring 66 . in fig2 b , the reference numeral 72 denotes a pulley . for the purpose of forming an abutting portion 20 a on the endless belt 20 for a workpiece , the pulley 72 is engaged with the endless belt 20 . also , the pulley 72 is supported by a bracket 74 , which is mounted on the tension bar 62 to project downwardly . the bracket 74 is detachable from the tension bar 62 . in a case where the main portion is reversed between the first position shown in fig2 and the second position shown in fig3 ( upside down as seen in those figures . ), the bracket 74 is detached from an initial position on tension bar 62 to be next attached at a longitudinal opposite position from the initial position on the tension bar 62 so that the pulley 72 supported by the bracket always remains set beneath the tension bar 62 . in fig1 , the numeral 78 denotes a cover which is detachably mounted on the cylindrical portion 64 a by a screw 78 a . as stated , the main portion includes the housing 64 of the air motor , the columnar portion 51 fixed to the rear of the housing , the ring valve 48 rotatably mounted around the outer surface of the columnar portion , and the tension bar 62 mounted on and extending toward from the side of the housing 64 of the air motor , and is rotatable around the longitudinal axis of the cylindrical base portion . as is clearly shown in fig1 and in fig4 , the columnar portion 51 is fixedly connected to the housing 64 by a lock nut 81 threaded into the housing 64 of the air motor 12 through a washer 83 . a rear half of the columnar portion 51 is inserted into the cylindrical base portion 24 coaxially , and is held rotatably about the central axis of the base portion 24 . further , the columnar portion 51 is provided with a through hole which extends from the rear end to the front end of the columnar portion . the rear and front ends of the through hole are blocked by blocking members 79 , 80 which are threadably engaged thereinto , to form the second air passageway 46 between the blocking members . the blocking member 80 engaged with the rear end has a bolt - like form , and has a head portion 80 a , which is positioned in and engaged with the first air passageway 32 to prevent the columnar portion 51 from moving out of the main portion 24 . in fig4 , the reference numeral 82 denotes a hexagonal socket head cap screw . the screw 82 is threadingly engaged with a threaded bore formed radially through the base portion 24 , and is engaged in recess 51 a formed on the outer surface of the columnar portion 51 , which results in prevention of the columnar portion 51 , and hence the main portion 22 , from rotating relative to the base portion 24 . the recesses 51 a , 51 a are arranged in a pair , with each recess being provided on the columnar portion in diametrically opposed positions relative to one another . when the main portion is in the abovementioned first position ( shown in fig2 a ) or in the second position ( shown in fig3 a ), the screw 82 is engaged with a corresponding one of the recesses 51 a to fix the main portion to the base portion . the numeral 84 denotes a through - hole provided in the ring valve 48 for insertion of an allen key for turning the hexagonal socket head cap screw . referring to fig6 , there is shown another embodiment of the present invention in which a ball 88 is used instead of the screw 82 . specifically , in this embodiment , there is provided a bore 90 which extends radially in the columnar portion 51 of the main portion 22 and opens at the outer surface thereof . the ball 88 is set in the bore 90 and is urged radially outwardly by a spring 92 set in the bore 90 . further , the ball 88 is engaged in recesses formed at a circumferentially predetermined position on an inner surface of the base portion 24 surrounding the columnar portion 51 , to prevent the columnar portion 51 , and hence the main portion 22 , form rotating relative to the base portion 24 . the recesses are arranged in a pair , with each recess being provided on the base portion 24 in diametrically opposed positions relative to one another . when the main portion is in the abovementioned first position ( shown in fig6 ) or in the second position ( the reversed position of the main portion shown in fig6 relative to the base portion ), the ball 88 is engaged with a corresponding one of the recesses to fix the main portion to the base portion . next , a second embodiment of the endless belt abrading machine according to the present invention will be described with reference to the accompanying drawings . fig7 is a sectional plan view of the endless belt abrading machine of the present invention . fig8 is a sectional view taken along line viiia — viiia of the fig7 . this endless belt abrading machine 110 has a main portion 116 and a base portion 118 . the main portion 116 includes an air motor 112 and an endless belt 114 driven by the air motor 112 . the base portion 118 is connected to a rear part of the main portion 116 in order to supply and exhaust compressed air for the air motor 112 . the air motor 112 is a vane - type motor and has a rotor 120 rotatable about an axis extending transversely of the machine 110 , a rotor chamber 122 for accommodating the rotor , and a rotor housing 128 including a first and a second air passage 124 , 126 for supplying and exhausting compressed air to and from the rotor chamber 122 . in the illustrated example , the rotor housing 128 has a cylindrical liner portion 128 - 1 provided on the interior surface , and has first and second openings 124 - 1 , 126 - 1 which respectively interconnect with the first and second air passage 124 , 126 . the endless abrading belt 114 is engaged with the drive pulley 132 , which is drivingly connected to an output shaft 130 which extends laterally from one end of the air motor 112 ; with the driven pulley 136 being positioned forward of the drive pulley 132 by a tension bar 134 . the base portion 118 has a base portion member 140 which is rotatably connected with a rear portion of the rotor housing 128 of the air motor 112 about an axis extending forward and rearward . the base portion member 140 has an air inlet passage 142 and an air outlet passage 144 , and is rotatably mounted between the first position and the second position . in the first position ( fig8 a ), the air inlet passage 142 is adapted to communicate with the first air passage 124 and the air outlet passage 144 is adapted to communicate with the second air passage 126 . in the second position ( fig9 a ) where the base portion 118 has been turned 180 ° from the first position , the air inlet passage 142 is adapted to communicate with the second air passage 126 , and the air outlet passage 144 is adapted to communicate with the first air passage 124 . when the base portion member 140 is in the first position , as shown in fig8 a and fig8 b , the rotor 120 and the belt 114 are turned counterclockwise , as indicated by the arrows in those figures . when the base portion member 140 is in the second position , as shown in fig9 a and fig9 b , the rotor 120 and the belt 114 are turned clockwise as indicated by arrows in those figures . on an outer periphery surface of the base portion member 140 , there are provided a lock sleeve 146 , which is movable only forward and rearward relative to the rotor housing 128 , and a coil spring 149 which urges the lock sleeve 146 rearward . the lock sleeve 146 is formed with a notch on a periphery of its rear end for fitting a pin 150 to be fixedly mounted to the base portion , and to be movable between a rotation - restraining position ( fig7 , fig8 ) and a rotation - enabling position ( fig1 ). in the rotation - restraining position ( fig7 , fig8 ), the lock sleeve 146 fits the pin 150 , which prevents the base portion member 140 from turning relative to the rotor housing 128 . in the rotation - enabling position ( fig1 ), the lock sleeve 146 is moved forward from where the lock sleeve is in the holding position and is released by the pin 150 , which allows the base portion member 140 to rotate relative to the rotor housing 128 . further , there is provided a rod - like poppet valve 152 in the base portion member 140 , for closing and opening the air inlet passage 142 . the poppet valve 152 is urged by the coil spring 154 to a position for closing the air inlet passage 142 ( fig8 a ) and an upper end thereof extends outside of the base portion member 140 . further , there is provided a lever 156 in the base portion member 140 . the lever 156 is rotatably fitted on the base portion member 140 to be moved between an opening position ( depressed position ) where the lever 156 is adapted to depress the valve 152 to open the air inlet passage 142 , and a closing position ( undepressed position ) where the coil spring 154 allows the valve 152 to return to the position to close the air inlet passage 142 . the lever 156 with a lever pivot pin 160 is retained in a released position shown in fig8 a by a lever retainer 164 , which is pivotably mounted on a pivot pin 162 positioned forward of the lever pivot pin 160 ; and the lever retainer is urged under the action of a spring to be engaged with an under surface of the lever 156 . the lever retainer 164 has an extending portion 166 which extends upward of the lever 156 . when the extending portion 166 of the lever retainer 166 is moved down clockwise about the pivot pin 162 ( against the action of the spring ), the lever retainer 164 is rotated clockwise , which enables the lever 156 to be moved down counterclockwise about the pivot pin of lever 160 . when the extending portion of lever retainer 166 is released , the lever retainer 164 and the lever 156 are sprung back into the position shown in fig8 a . as will be seen from fig1 , the base portion member 140 is generally cylindrically shaped , and has a cylindrical portion 170 which extends in the direction of the axis of the base portion member 140 . the cylindrical portion 170 has a bore which forms the air inlet passage 142 . an outer surface of the cylindrical portion 170 and an inner surface of the base portion member 140 defines a space which extends axially thereof , and which forms the air outlet passage 144 . the rotor housing 128 of the air motor 112 has a cylindrical joint 172 which extends rearward , and rotatably and hermetically receives a front end portion of the base portion member 140 about longitudinal axis . in the cylindrical joint 172 , there is formed a rearward facing surface 174 ( forming a right angle with the longitudinal axis ) facing a front end of the base portion member 140 . both the first and the second openings 124 , 126 extend from the rotor chamber to the rear end surface of the cylindrical joint 172 . the air inlet passage 142 of the base portion member 140 is provided with a larger diameter portion 180 and a smaller diameter portion 182 , in that order , from a front end thereof adjacent to the rearward facing surface 174 of the rotor housing 128 . in the larger diameter portion 180 , there are provided a cylindrical seal 184 movable in a forward and a rearward direction , and a coil spring which urges the cylindrical seal against the rearward facing surface 174 . a front end surface of the cylindrical seal 184 is hermetically and slidably engaged with the rearward facing surface 174 of the rotor housing 128 . further , in the illustrated example , the cylindrical portion 170 forming the air inlet passage 142 projects beyond the front end surface of the base portion member 140 . the rearward facing surface 174 has a semi - circular form ( fig1 , 13 ) delineating a path along which the front end of the cylindrical portion 170 is moved when the base portion is turned between the first and second positions relative to the main portion . the rearward facing surface 174 is defined by a rear end surface of a columnar potion 176 which axially extends inside the cylindrical joint 172 , and has a semi - circular cross section . the first air passage 124 and the second air passage 126 are formed to extend through the columnar portion 176 in a forward and rearward direction , and are arranged to open through the rearward facing surface at diametrically opposite positions on a circular area on the surface having a center , through which an axis for rotation of the base portion member 140 extends . moreover , a second outlet passage is defined between an inner surface of the cylindrical joint 172 and an outer surface of the columnar portion 176 , and allows exhaust air to flow from the rotor chamber 122 to the air outlet passage 144 in the base portion member 140 . as shown in fig1 and fig1 , there are provided a pair of stop portion 188 , 188 which are engaged with a distal end of the cylindrical portion 170 having the air inlet passage 142 to prevent excess rotation of the base portion member 140 , when the base portion member 140 is rotated to either the first position or the second position . in fig8 a the numeral 190 denotes a pipe for communicating an air inlet ( not shown ) of the base portion member 140 to a pump . the numeral 192 is an installation sleeve for installing the lock sleeve 146 and the coil spring 149 on the base portion member 140 . the tension bar 134 shown in fig8 b is provided with an idle roller 196 at its midpoint via a bracket 194 . the bracket 194 is adapted to be detached from one side of the tension bar 134 and to be transferred to another side ( upper side ) to enable the abrading belt to be adjusted in response to the positional change of the main portion 116 relative to the base portion member , as described above . the endless belt abrading machine 110 according to the second embodiment of the present invention has the arrangement described above . when an operator operates the machine 110 holding it with his / her right hand , the operator holds the base portion member 140 having the arrangement shown in fig7 , 8 a , such that the abrading belt 114 is located to the left side relative to the base portion member 140 , and accordingly is positioned forward and to the center of the operator . in a case where the base portion member 140 is set in the first position as shown in fig8 a , the belt is enabled to be turned in a counterclockwise direction , and in the second position as shown in fig9 a , the belt is enabled to be turned in a clockwise direction . in addition , when an operator operates the machine 110 with holding it with his / her left hand , the main portion 116 is turned through 180 ° relative to the base portion member from the position shown in fig7 , whereby the main portion 116 is located to the right side of the base portion member 140 held by operator &# 39 ; s left hand forward and to the center of the operator . when the base portion member 140 is set to either the first position or the second position as desired by an operator , the belt is enabled to be turned in a desired direction . it should be noted that the present invention is not limited to the foregoing embodiments , and can be modified in a variety of ways without departing from the gist of the present invention . it is therefore intended that the foregoing detailed description be regarded as illustrative rather than limiting , and that it be understood that it is the following claims , including all equivalents , that are intended to define the spirit and scope of this invention . | 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.