Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
fig1 is a block diagram of an information handling system 100 which experiences impedance discontinuity problems when two bus connectors are situated in close proximity of one another on a bus . for purposes of this disclosure , an information handling system ( ihs ) may include any instrumentality or aggregate of instrumentalities operable to compute , classify , process , transmit , receive , retrieve , originate , switch , store , display , manifest , detect , record , reproduce , handle , or utilize any form of information , intelligence , or data for business , scientific , control , or other purposes . for example , an information handling system may be a personal computer , a network storage device , or any other suitable device and may vary in size , shape , performance , functionality , and price . the information handling system may include random access memory ( ram ), one or more processing resources such as a central processing unit ( cpu ) or hardware or software control logic , rom , and / or other types of nonvolatile memory . additional components of the information handling system may include one or more disk drives , one or more network ports for communicating with external devices as well as various input and output ( i / o ) devices , such as a keyboard , a mouse , and a video display . the information handling system may also include one or more buses operable to transmit communications between the various hardware components . information handling system ( ihs ) 100 includes a processor 110 such as an intel pentium series processor or one of many other processors currently available . an intel hub architecture ( iha ) chipset 115 provides ihs system 100 with glue - logic that connects processor 110 to other components of ihs 100 . chipset 115 carries out graphics / memory controller hub functions and i / o functions . more specifically , chipset 115 acts as a host controller which communicates with a graphics controller 120 coupled thereto . graphics controller 120 is coupled to a display 125 . chipset 115 also acts as a controller for main memory 130 which is coupled thereto . chipset 115 further acts as an i / o controller hub ( ich ) which performs i / o functions . input devices 135 such as a mouse , keyboard , and tablet , are also coupled to chipset 115 at the option of the user . a universal serial bus ( usb ) 140 is coupled to chipset 115 to facilitate the connection of peripheral devices to ihs 100 . system basic input - output system ( bios ) 150 is coupled to chipset 115 as shown . bios 150 is stored in nonvolatile memory such as cmos or flash memory . a network interface controller ( nic ) 155 is coupled to chipset 115 to facilitate connection of system 100 to other information handling systems . a media drive controller 160 is coupled to chipset 115 so that devices such as media drive 165 can be connected to chipset 115 and processor 110 . devices that can be coupled to media drive controller 160 include cd - rom drives , dvd drives , hard disk drives and other fixed or removable media drives . an expansion bus 170 , such as a peripheral component interconnect ( pci ) bus , is coupled to chipset 115 as shown . bus 170 is coupled to an expansion connector 175 which receives a riser card 180 therein as seen in fig1 which is a block diagram not drawn to scale . riser card 180 includes a connector 185 which receives an expansion card 190 . expansion card 190 provides additional functionality to the ihs . for example , expansion card 190 may be a modem , network interface , audio card , video card , game card or other card providing desired functionality . bus 170 includes a plurality of signal lines or traces including address , data and control lines in the conventional fashion . connecting lines or traces extend through connector 175 , across riser card 180 , through connector 185 and to expansion card 190 as will now be described . fig2 a includes a main circuit board or motherboard 200 ( not drawn to scale ) on which many of the components of ihs 100 are situated . for example , in one embodiment , processor 110 ( not shown ), chip set 115 , graphics controller 120 ( not shown ), main memory 130 ( not shown ) and other structures are mounted on motherboard 200 using standard techniques . when an ihs is fabricated in the manner subsequently described where significant effort is made to minimize the vertical profile of the ihs , for example to a 1u rack height , an impedance discontinuity problem is encountered in the bus structures employed . this problem and its solution will be explained in detail . a bus , such as a pci or pci - x bus 170 , is situated on motherboard 200 using microstrip transmission line traces . while the bus is made of several such traces to form the address , data and control lines thereof , a representative microstrip transmission line trace 170 ′ is shown in the perspective cross section view of fig2 b . since bus 170 is a microstrip transmission line structure , a ground plane metallization 171 is situated on the side of board 200 opposite that on which trace 170 ′ is situated . returning to fig2 a , bus 170 extends from port 115 a to bus connector 175 . in this particular embodiment , bus connector 175 is a pci or pci - x bus connector . other embodiments are contemplated wherein other bus structures and corresponding bus connectors are employed . connector 175 includes a respective pin for each of the aforementioned address , data and control lines of bus 170 . to decrease the vertical dimension of the ihs as viewed in fig2 a , a short riser card 180 is situated in bus connector 175 . riser card 180 is substantially perpendicular to bus 170 and exhibits a height of approximately one inch to fit within a 1u rack height enclosure in one embodiment . a bus connector 185 is situated on riser card 180 as shown . bus connector 185 is a pci or pci - x type bus connector , but again other types of bus connectors are contemplated for use with different buses as desired . riser card 180 includes an interconnecting bus 187 which couples the address , data and control lines from connector 175 to connector 185 . an expansion card 190 is situated in connector 180 . a chip or other circuit 192 to provide the ihs with additional functionality is situated on expansion card 190 as shown . expansion card 190 includes an bus extension 194 which couples the address , data and control lines from connector 185 to chip circuit 192 as needed . expansion card 190 is situated in connector 180 in an orientation which is substantially perpendicular to riser card 180 and substantially parallel with motherboard 200 . since expansion card 190 is parallel with motherboard 200 rather than the more typical perpendicular orientation with respect to the motherboard , the vertical height of the ihs depicted in fig2 a is smaller than it would otherwise be . however , it has been found that in this approach , impedance discontinuities associated with connectors 175 and 180 are encountered because these connectors are so close to one another . fig2 c shows one of the traces of the above described bus as it passes from port 115 a through connector 175 , up riser card 180 , through connector 185 and to chip 192 so that the connector impedance discontinuity problem can be appreciated . starting on the left side of fig2 c is port 115 a which exhibits an impedance ( z ) of 60 ohms . a trace 170 ′ of microstrip transmission line ( mlin ) connects port 115 a to connector 175 . trace 170 ′, which exhibits an impedance ( z ) of 60 ohms , is 8 mils wide ( w ) and 4000 mils long ( l ). trace 170 ′ is coupled to a pin of connector 175 which exhibits an impedance ( z ) of approximately 80 ohms in this particular example . the impedance of connector 175 does not match that of the 60 ohm microstrip transmission line and thus a first impedance discontinuity is encountered . a trace 187 ′ of microstrip transmission line ( mlin ) is situated on riser card 180 and connects connector 175 to connector 185 . trace 187 ′, which exhibits an impedance ( z ) of 60 ohms , is 8 mils wide ( w ) and 1000 mils long ( l ). trace 187 ′ is coupled to a pin of connector 185 which exhibits an impedance ( z ) of approximately 80 ohms in this particular example . the impedance of connector 185 does not match that of the 60 ohm microstrip transmission line trace 187 ′ and thus a second impedance discontinuity is encountered on the bus . still referring to fig2 c , a trace 194 ′ of microstrip transmission line ( mlin ) is situated on expansion card 190 and connects connector 185 to a port 192 a of chip or circuit 192 . trace 194 ′, which exhibits an impedance ( z ) of 60 ohms , is 8 mils wide ( w ) and 2500 mils long ( l ). port 192 a to which microstrip transmission line trace 194 ′ terminates also exhibits an impedance ( z ) of 60 ohms . the example just described follows a single trace from port 115 a to port 192 a . in actual practice , there are as many of such traces as needed to form the full complement of address , data and control lines of a particular bus . in a vertically compact ihs such as that described above with a 1u height where the space for a riser card 180 is very limited , connectors 175 and 185 are very close together , namely approximately 1 inch apart . under these conditions , connectors 175 and 185 tend to exhibit a higher impedance than the microstrip transmission line traces which connect thereto . connectors 175 and 185 exhibit an impedance of approximately 80 ohms whereas the microstrip transmission line traces exhibit an impedance of approximately 60 ohms in this particular example . since connectors 175 and 185 are so closely spaced , rather than merely causing the ihs to suffer the adverse effects of two separate mismatched connectors , the two connectors effectively appear as one very large merged impedance discontinuity to the surrounding bus structure . this problem is solved in the ihs shown in fig3 a - 3c by using a lowered impedance interconnect to replace microstrip transmission line traces 187 ′ of fig2 b to effectively lower and compensate for the high impedance of the large discontinuity to bring the overall aggregate impedance of the two connectors and the impedance interconnect closer to 60 ohms , or back to approximately 60 ohms , which is the impedance of bus 170 . ihs 300 of fig3 a - 3c is similar to the ihs of fig2 a - 2c except for the low impedance interconnect 387 ( alternatively referenced as low impedance interconnecting bus 387 ) which is employed instead of interconnecting bus 187 . like numbers are used to indicate like components in fig3 a - 3c and fig2 a - 2c . a representative trace 387 ′ of the microstrip transmission line which forms low impedance interconnecting bus 387 is shown in fig3 c . it is noted that the dimensions of trace 387 ′ are changed from the dimensions of 187 ′ to substantially lower the impedance of the trace and thus lower the impedance of the interconnecting bus of which it forms a part . in this particular example , the width ( w ) of trace 387 ′ is 18 mils which is noted to be substantially wider than the 8 mil width ( w ) of trace 187 ′. the increased width of trace 387 ′ lowers the impedance of the trace to approximately 20 ohms which compensates and approximately balances out the impedance increase or discontinuity caused by connectors 175 and 185 . for this reason , low impedance interconnect 387 smoothes out and compensates for the overall merged impedance discontinuity associated with connectors 175 and 185 . fig4 is a graph of complete path return loss ( rl ) from port 115 a which may be regarded as the signal source to port 192 a which may be regarded as the signal load or termination point . frequency in ghz is plotted along the x axis and return loss in db is plotted on the y axis . the uncompensated return loss associated with the ihs of fig2 a - 2c is denoted by the curve marked with triangles . the compensated return loss associated with the ihs of fig3 a - 3c is denoted by the curve marked with diamonds . return loss represents the amount of reflection observed from an interconnect system . lower return loss , such as shown in the compensated case indicated by the diamonds , is indicative of a more closely matched load and diminished discontinuities . in fig4 , it is seen that there is significant improvement in the compensated case indicated by the curve with diamonds since less incident signal is reflected back along the signal path from port 115 a to port 192 a . fig5 is a graph which compares the compensated and uncompensated complete path attenuation of the signal path between port 115 a and port 192 a . frequency is plotted in ghz along the x axis and complete path attenuation is plotted in db along the y axis . zero ( o ) db of attenuation is indicated at the uppermost value of the y axis . the uncompensated path attenuation associated with the ihs of fig2 a - 2c is denoted by the curve marked with triangles . the compensated path attenuation associated with the ihs of fig3 a - 3c is denoted by the curve marked with squares . the closer the attenuation is to 0 db , the more indicative this is of a less lossy path and a more closely matched impedance signal path . the graph of fig5 shows that by using the disclosed low impedance interconnect between the two connectors , system performance is significantly improved . more of the incident signal from port 115 a reaches the load circuit at port 192 a across most of the frequency range illustrated . fig6 is a graph comparing a digital signal in the time domain on the uncompensated vs . the compensated bus . the digital signal on the uncompensated bus of fig2 a - 2c is denoted by triangles . the digital signal on the compensated bus of fig3 a - 3c is denoted by squares . time in nanoseconds ( ns ) is plotted along the x axis and voltage is plotted on the y axis . this time domain comparison of two ideal pulses passing through the uncompensated and compensated signal paths demonstrates suppression of a reflection in the compensated case . in fig6 , a reflection that occurs on the uncompensated path is marked “ reflection before compensation ” and the suppression of that reflection is marked “ compensation eliminates reflection ” so that the improvement will be appreciated . advantageously , the disclosed methodology and apparatus allow a low profile ihs to be fabricated with a riser card exhibiting a very small vertical dimension without suffering impedance mismatch effects caused by bus connectors being located very close to one another . although illustrative embodiments have been shown and described , a wide range of modification , change and substitution is contemplated in the foregoing disclosure and in some instances , some features of an embodiment may be employed without a corresponding use of other features . accordingly , it is appropriate that the appended claims be construed broadly and in manner consistent with the scope of the embodiments disclosed herein .	6
according to the present invention , there are shared secrets ( several secrets are needed in strong authentication cases and also in a case of mutual authentication ) between two parties attempting to establish trust over untrusted electronic communication media . shared secrets are usually established during an account open procedure . though the server password could be shared by the plurality of users , it is assumed , without sacrificing any generality of the disclosed authentication protocol , that the preferred embodiment of this invention is to provide a unique server password for each user . account set / reset online automated utilities would greatly facilitate establishing uniquely personalized server and user passwords . client / server or d2d ( authenticator / peer ) communication sessions would be typical cases , though the client / server protocol would remain the preferred embodiment . there are no limitations on the nature of the shared secrets used . they could be “ what user knows ” secrets , for example , passwords , or “ what user has ” secrets , i . e ., tokens and smart cards , or , alternatively , “ what user is ” secrets , for example , biometrics . however , the preferred embodiments would relate to secrets in the category of “ what user knows ”. also , there are no limitations on the network layer over which the authentication protocol is established — it could be tcp / ip stack , ipsec , or other communication protocols . nevertheless , the preferred embodiments will assume http ( rfc 2068 hypertext transfer protocol — http / 1 . 1 january 1997 ). also , the invention implies contemporary object - oriented software technologies like java , c ++, and net , providing multi - threading , serialization , servlet and applet techniques , library of cryptographic algorithms , gui ( graphical user interface ) capabilities , and connectors / drivers like jdbc to standard commercial databases . fig1 is a graphic illustration of the time interplay limited srk ( session random key ) algorithm ( tilsa ) according to the present invention . before any communication session starts , the server - placed logic continuously and periodically generates ( session random key generator 1005 ) an array ( array of session keys ( ask ) 1013 ) of session random keys ( srk ) 1011 — secret keys ( symmetric cryptography ). each key has two different lifetimes . the first lifetime ( lt 1 ) is the lifetime for establishing a client / server communication session , provided there is a request from a client or plurality of clients ( client 1 1003 , client 2 1007 , . . . , client n - 1 1008 , and client n 1009 ) during lt 1 to initiate a communication session . each client can establish a communication link 1015 , 1006 , . . . , 1016 , 1017 to web server 1002 and compute / applications server 1001 through communication network 1004 . the beginning of lt 1 1014 is synchronized with each srk 1011 generation , placing it into ask 1013 . for instance , in fig1 , srk 1 appears in ask 1013 at the time mark “ 0 minute ”, and at the moment that time mark 1 minute lt 1 of srk 1 has expired , though srk 1 remains inside ask 1013 . srk generator 1005 at this moment generates srk 2 and places it into ask 1013 . by the time mark 2 minutes srk 2 lt 1 has expired , even though srk 2 remains inside ask 1013 . again , at this time srk generator 1005 generates and places into ask 1013 srk 3 , which lt 1 becomes expired at the 3 minutes mark . this procedure is periodically repeated as long as srk generator 1005 is on . client 1 1003 and client n 1009 made a connection request during the time interval between time mark 4 minutes and time mark 5 minutes , since srk generator 1005 began generating srk 1011 and filling them into ask 1013 . the only srk 1011 not yet expired lt 1 in ask 1013 during this time interval is srk 5 . therefore , srk 5 is used to establish communication sessions with these clients . similarly , client 2 requested a communication session between time mark 8 minutes and time mark 9 minutes , whereas client n - 1 requested a communication session between time mark 1 minute and 2 minutes . hence , the srk 1011 used to establish these communication sessions are , respectively , srk 9 and srk 2 . once lt 1 is expired , the server generates and places into ask 1013 another srk 1012 , which lt 1 is just started . srk 1011 second life time lt 2 defines the life time inside the limited size ask 1013 . the maximum size of ask 1013 can be characterized with the parameter nmax which indicates maximum number of srk 1011 in ask 1013 possible ( for instance , nmax = 5 in fig1 ). typically , lt 1 & lt ; lt 2 , and in the most preferred embodiment lt 1 can be derived as lt 1 = lt 2 / nmax . without sacrificing any generality limitations of tilsa , lt 2 was chosen , for example , to be equal to 5 minutes in fig1 . then , lt 1 according to the formulae presented above , is equal to 1 minute . after lt 1 expired , for any given srk 1011 , the key has lt 2 − lt 1 time remaining to support communication session threads having been initiated during lt 1 . once lt 2 expired , srk 1011 is removed from ask 1013 , effectively canceling any futher participation of this particular srk 1011 in the parties &# 39 ; communication session engagements . certainly , each srk 1011 can be used to originate multiple threads of communication sessions with each session elapsed time ( set ) less or equal to lt 2 − lt 1 . however , set = lt 2 − lt 1 is the preferred embodiment . without sacrificing any generality limitations of tilsa , set = 4 minutes in fig1 . taking srk 5 in fig1 as an example of any srk 1011 genesis , one can note that srk 5 is the last key to fulfill ask 1013 to its maximum size nmax = 5 , and srk 5 appears inside ask 1013 at the 4 - minute mark , since srk generator 1005 began generating srk 1011 and filling them into ask 1013 . then , during srk 5 lt 1 = 1 minute , the key can be engaged into initiating multiple communication session threads with the clients requesting connections . from time mark 5 minutes , and until time mark 9 minutes , srk 5 , in accordance with set = 4 minutes , is kept inside ask 1013 available to support communication session threads started during srk 5 lt 1 . during this particular time interval , from time mark 5 minutes to time mark 9 minutes , srk 1 , srk 2 , srk 3 , and srk 4 in ask 1013 are being gradually replaced every minute by srk 6 , srk 7 , srk 8 , and srk 9 , respectively . eventually , at time mark 9 minutes srk 5 is canceled , ultimately being replaced by srk 10 . this time interplay limited srk algorithm ( tilsa ) is the first security tier of the authentication protocol , assuring supply of srk 1011 to initiate any client / server communication session . however , the time to initiate a session ( approximately one minute , without sacrificing any generality limitations of tilsa ) and the time to continue the session authentication protocol ( possibly several minutes , without sacrificing any generality limitation of tilsa ) are quite limited for any given srk 1011 , thus hindering a possible intruding activity . fig2 is a graphic illustration of the array of data encryption keys ( adek ) branch of the tilsa algorithm according to the present invention . the essential part of tilsa is generating ( data random key generator 2005 ) an array of data random keys ( drk ) 2013 — secret keys to support the authentication session for any particular srk 1011 starting a communication session thread . this array of drk ( array of data encryption keys ( adek ) 2012 ) is regenerated and specifically attributed to each srk 1011 , together and concurrently with originating any new srk 1011 with the logic located on the server side ; explaining why there is no latency in the drk supply during a client / server encrypted authentication session . the number of drk 2013 in adek 2012 is fixed , acting as a security parameter for the media authentication protocol being presented . each adek 2012 can be used for a plurality of threads initiated with a particular srk , to which this adek 2012 belongs . the adek 2012 lifetime is limited and equal to the lifetime of the originated srk 1011 in ask 1013 , being lt 2 . deleting srk 1011 from ask 1013 inevitably deletes adek 2013 , corresponding to this srk 1011 . once the client requested a connection to the server supported by the user name of the user on the client platform ( or the client host name ), a suitable srk 1011 , accompanied by lt 1 , not yet expired , is sent to the client by the server . in the most preferred embodiment of this invention , srk 1011 is sent to the client in a compiled form ( for example , as a class file ). this is the second security tier of the authentication protocol , in view of the fact that reengineering a compiled key given a short srk 1011 lifetime lt 2 is a formidable task . therefore , the first two security tiers make srk 1011 quite resilient to the on line attacks during the session time , because of incommensurate times to reengineer srk 1011 versus srk 1011 expiration time lt 2 . however , srk 1011 is still vulnerable against off line attacks and needs to be enhanced further to avoid any loss of authentication credentials and the eventual session final secret key ( fsk ). since srk 1011 is sent to the client as the first message , the logic located on the server and on the client sides generates a series of messages having been sent from the server to the client , and back to the server with the following key encryption / decryption iterative algorithm ( kedia ). fig3 is a graphic illustration of the key encryption / decryption iterative algorithm ( kedia ) according to the present invention . in step 1 3005 , client 3002 sends a connection request to server 3001 over communication network 3003 . in step 2 3006 , srki ( with the currently active lt 1 — between time mark i - 1 minutes and time mark i minutes ) is sent to client 3002 , and stored there , initiating the communication interface . in step 3 3007 , client 3002 enters the user name , the user password , and the server password , if it is a user at the client platform 3002 , or the host name , the host id , and the server password , if it is the client platform ( the peer ). in step 4 3008 , the user name ( or the host name ) is hashed , encrypted with srki and sent to server 3001 , while the user password ( or the host id ) and the server password were not sent , remaining at client 3002 . in step 5 3009 , server 3001 checks the validity of the user name ( or the host name ), obtained in the step 4 , through the database to which it is connected . the session is terminated , if the user name ( or the host name ) is not valid . otherwise , server 3001 in step 3009 sends drk 1 encrypted with srki to client 3002 , where drk 1 is decrypted with srki , and stored at client 3002 . during the same step 3009 , client 3002 sends a drk 1 , which is converted to its hash equivalent and encrypted with drk 1 , to server 3001 . this message confirms to server 3001 that client 3002 obtained and decrypted drk 1 , and it is ready for receiving another secret key . in step 6 3010 , server 3010 first decrypts hashed drk 1 , received in step 5 from client 3002 , with drk 1 . if drk 1 is correct , server 3001 sends drk 2 encrypted with drk 1 to client 3002 , where drk 2 is decrypted with drk 1 , and stored at client 3002 . otherwise , the communication session is terminated . during the same step 6 3010 , client 3002 sends a drk 2 , converted to its hash equivalent , and encrypted with drk 2 , to server 3001 . this message confirms to server 3001 that client 3002 obtained and decrypted drk 2 , and it is ready for receiving another secret key . this iterative process continues up to step n 3014 . parameter n is actually the maximum number of drk 2013 in adek 2012 ( fig2 ), and should be chosen for any practical implementation of this encrypted authentication protocol . then , assuming drkn - 1 hash received from client 3002 in the previous step n − 1 is correct , server 3001 , sends drkn , encrypted with client 3002 hashed password ( taken from server database 3004 , as server 3001 knows from step 4 3008 , the identification of the client ( or the user on the client platform )) to client 3002 , where drkn is decrypted with the client 3002 password , stored at the client side in step 3 . during the same step n , client 3002 sends to server 3001 hashed drkn encrypted with the client 3002 password , stored at client 3002 at step 3 and converted to its hash equivalent . step n is an important first phase towards client / server mutual authentication . indeed , the client can decrypt drkn only in the case where client 3002 knows the user 3002 password . then , client 3002 encrypts hashed drkn with the client 3002 hashed password , as a secret key and sends it back to server 3001 in same step n 3014 . having received drkn encrypted with client 3001 password , server 3001 decrypts it with the client 3001 password , and , if it is correct , server 3001 , in step n + 1 3015 , sends to client 3002 drkn encrypted with hashed server 3001 password as a key . certainly , client 3002 , already aware of drkn from the previous step n 3014 , compares the result of decrypting the last message with the server 3001 password , stored at client 3001 in step 3 3007 , and converted to its hash equivalent , with drkn . if they are the same , the client is assured that the communication session is with the correct server , as only client 3002 and server 3001 know the server 3001 password . otherwise , the client 3002 terminates the communication session , and intrusion detection is reported . eventually , during same step n + 1 3015 , client 3002 sends to server 3001 hashed drkn encrypted with the server password , stored at client 3002 , at step 3 3007 , and converted to its hash equivalent . this message , transmitted back to server 3001 , means that client 3002 has established trust to server 3001 . in step n + 2 3016 , server 3001 decrypts hashed drkn with the server password from the 3004 database connected to the server , and compares the result with drkn at server 3001 . depending on the comparison results , server 3001 , during same step n + 2 3016 , sends to client 3002 the authentication signal “ go / no ” encrypted with drkn - 1 , stored at client 3002 , at the step , prior to step 3014 . this completes the client / server mutual authentication and final secret key ( fsk ) exchange according to the kedia algorithm . one encryption / decryption algorithm used in an embodiment of the invention is the triple data encryption standard block cipher algorithm . triple - des ( 3des ), based upon the triple data encryption algorithm ( tdea ), is described in fips 46 - 3 . other block cipher algorithms are also suitable , including rc6 , blowfish / twofish , rijndael , and aes . see , bruce schneier , applied cryptography , second edition , john wiley and sons , inc ., cited above . in this form the kedia algorithm , described above as part of the authentication communication protocol , is the third security tier , efficient against online and offline intruding attacks . among other factors , the security against online attacks is increased due to effectively extending the time , needed by an intruder to decrypt the entire series of drk 2013 in adek 2012 , whereas the adek 2012 life time is quite limited and is actually equal to lt 2 , the same as for srk 1011 , which originated this adek 2013 . as mentioned above , the number of drk 2013 in adek 2012 is the authentication protocol security parameter and can be chosen according to the security requirements , considering the actual system cpu and network resources . security against offline attacks is assured through the mutual client / server authentication utilizing shared secrets known only to the client , and to the server . moreover , the client supposed to perform a strong ( two factors ) authentication , as the kedia algorithm requires the client to enter correctly the client ( the user on the client platform ) password and the server password , unique to the client ( the user on the client platform ). important security feature of the kedia algorithm are ( 1 ) that client / server passwords never enter communication lines in either form , ( 2 ) client / server pair performs mutual authentication in steps n 3014 , n + 1 3015 , and n + 2 3016 , and ( 3 ) client / server pair exchanges fsk enabling transmitted data encryption during the post - authentication stage of the communication session . in the case where an intruder intercepts the last message in step n + 2 , and somehow knows the format of the “ go / no ” authentication signals , a brute force computer processing attack could be applied to uncover drkn - 1 . however , the intruder would only gain limited access as drkn - 1 is detached from client / server authentication credentials , and from drkn ( which is fsk in this particular embodiment of the kedia algorithm ). therefore , an offline attack is senseless , as the intruder going backward through steps 3013 , 3010 , 3009 , and 3008 could find drkn - 2 drkn - 3 , . . . , drk 1 , and eventually srki , which are all only one - time session random keys , and they can not be reused . certainly , the intruder could further decrypt the user name ; however , this is not regarded as a secret . the time drkn - 1 , operating during the client / server communication session , is excruciatingly small for attempting an online computer processing attack . even assuming this attack successful , all , the intruder could do is to send to client 3002 an incorrect authentication signal , which will be visualized in the user &# 39 ; s session gui , but would never take effect in the actual system . this is because the authentication signal “ go / no ” enables functionality through the server 3001 side logic . the kedia algorithm security has been further significantly enhanced by integrating and synthesizing it with the byte - veil - unveil ( bytevu ) algorithm , the bit - veil - unveil ( bitvu ) algorithm , and the byte - bit - veil - unveil ( bbvu ) algorithm . all three algorithms are built around the idea that every encrypted message in the client / server dialogue in the kedia algorithm is a fixed byte size , relatively small ( typically 16 bytes ) message . the algorithms employ the fact that the server already has identified who the client pretends to be , after receiving the user name ( or the host name ) during the initial connection request . at this time , the server finds the password , or another shared secret , corresponding to the user name ( or the host name ), in the server database 3004 , connected to the server . then , the server employs this information to disassemble only message bytes , or only bits , or the combination thereof , inside a certain conversion array , making their reassembling a highly improbable task , unless the client knows the shared secret . in this case , the message , which is the encrypted key , is easily recovered and eventually decrypted with the secret key , learned from the previous message . fig4 is a graphic illustration of the kedia algorithm . this is a typical message encryption at the server and its decryption at the client , applying along with encryption and decryption procedures one of byte - veil - unveil ( bytevu ), bit - veil - unveil ( bitvu ), or byte - bit - veil - unveil ( bbvu ) algorithms , according to the present invention . step 6 3010 has been chosen as a typical message example in the kedia algorithm . according to fig3 , during this step , server 3001 sends drk 2 encrypted with drk 1 to client 3002 , where drk 2 is decrypted with drk 1 , received by client 3002 in the previous step 3009 from server 3001 . in fig4 , step 3010 is split for clarity into two parts 4001 and 4002 , which are related to preparing the message at server 3001 , and treating the received message at client 3002 , respectively . blocks 4003 , 4005 , 4007 , and 4009 depict the process the message is going through , before it is sent to client 3002 . drk 2 ( for instance , 16 bytes long , secret key to be used with a block - cipher encryption algorithm ) is supplied by server drk generator 2005 ( see fig2 ) 4003 . in the following step 4005 , server 3001 , already having identified who claims to be the user on the client platform , ( or what is the claimed client platform host name ), extracts the respective user password ( or the client host id ) from the database 3004 attached to server 3001 . eventually , according to block 4007 , server 3001 uses this information to trigger operation of one of bytevu , bitvu , or bbvu algorithms , having been chosen by a particular security system , considering security requirements vs . cost trade - offs ( time of operations , cpu power of client / server platforms , and the network throughput ). as a final result 4009 , the conversion array , containing disassembled drkj bytes , or bits , or the combination thereof , gets encrypted with drk 1 , and sent to client 3002 . part 4002 of step 3010 , related to the received message treatment at client 3002 , is expanded by the series of blocks 4004 , 4006 , 4008 , and 4010 in fig4 . according to block 4004 , client 3002 decrypts the conversion array with drkj - 1 , stored by client 3002 from the previous message 3011 from server 3001 . then , client 3002 supplies the user password ( or the client host id ) which was entered into the kedia algorithm at step 3 3007 ( see fig3 ), enabling reassembling of drk 2 from the decrypted conversion array 4006 . as it is shown in block 4008 , the operation is triggered for one of bytevu , bitvu , or the bbvu algorithms , having been chosen on the client side the same one , as on the server side . eventually , according to block 4008 , either the message bytes , or bits , or the combination thereof , get reassembled , and finally , as it is shown in block 4010 , drk 2 is reconstructed to its original form . in compliance with fig4 , each message of the kedia algorithm employs additional treatment as compared to the standard encryption / decryption operations . this treatment is triggered by the client / server shared secret at the sending and receiving communication channel ends . fig5 is a block diagram of the byte - veil - unveil ( bytevu ) algorithm according to the present invention . block 5001 shows drkj , where each byte is separated from a neighboring byte with a vertical bar . without sacrificing any generality of the bytevu algorithm , drkj is assumed to be a 16 - bytes key in fig5 . the user password ( or the client host id ), supplied by server 3001 in a hashed form , plays a seed role for server sequential random number generator ( srng ) 5002 . srng 5002 generates a random sequence of integers , and it is the same sequence of integers , each from 1 to 10 , for any given seed . in other words , the password ( or the client host id ) and the srng sequence of integers are uniquely associated . block 5005 introduces a conversion array which , without sacrificing any generality limitations of bytevu algorithm , has 16 equal sections 5006 , 5007 , 5008 , 5009 , and 5010 , with 10 bytes per each section . fig5 presents an exemplary case , when srng 5002 generated 16 sequential integers 4 , 9 , . . . , 2 , and 7 . the first integer 4 is used by the logic located by the server 3001 to replace byte r 1 , 4 in the first section 5006 of conversion array 5005 by the first byte xh 1 of drkj in 5001 . similarly , the second integer 9 is used by that same logic to replace byte r 2 , 9 in the second section 5007 of conversion array 5005 by the second byte xh 2 5012 of drkj in 5001 . the same procedure is applied to all integers in the sequence generated by srng 5002 , until drkj 15 th byte xh 15 in 5001 is replacing the 2 nd byte r 15 , 2 in the 15 th section 5009 of conversion array 5005 , and eventually drkj 16 th byte xh 16 in 5001 is replacing the 7 th byte r 16 , 7 in the 16 th section of conversion array 5005 . once all bytes of drkj are veiled in this manner inside conversion array 5005 , the entire conversion array 5005 is encrypted with drkj - 1 , and the message is sent to client 3002 . at client 3002 , the encrypted conversion array is decrypted with drkj - 1 , saved at client 3002 , from the previous server message ( step 3011 in kedia , fig3 ). the next procedure , reversed as compared to the procedure described above on the server 3001 side , is applied . the user password ( or the client host id ) saved at the client platform in step 3007 of the kedia algorithm ( see fig3 ) is supplied in a hashed form as a seed to client sequential random number generator ( srng ) 5003 , identical to the one on the server 3001 side . this password ( or host id ) triggers srng 5003 to generate the same sequence of integers , as on server 3001 side before 4 , 9 , ..., 2 , 7 . then , the logic placed on client 3002 used the first integer 4 to extract drkj first byte xh 1 from the fourth position in first 10 bytes section 5006 of conversion array 5005 , and place it back in the 1 st position of drkj 5001 . consequently , the second integer 9 is used to extract drkj second byte from the 9 th position in 10 bytes section 5007 of conversion array 5005 , and place it back into the 2 nd byte position of drkj 5001 . this procedure is going on , until , eventually , the 15 th byte of drkj xh 15 is extracted from the 2 nd byte position in 15 th 10 bytes section 5009 of conversion array 5005 , and placed back into 15 th byte position of drkj 5001 as well as the 16 th byte of drkj xh 16 5011 extracted from the 7 th byte position in 15 th 10 bytes section 5010 of conversion array 5005 , and placed back into 15 th byte position of drkj 5001 . this completes the reassembling procedure of the bytevu algorithm to restore drkj at client 3002 . a suitable sequential random number generator srng for use in embodiments of the invention is a java version of the well known “ lehmer generator .” see , park & amp ; miller , “ random number generators , good ones are hard to find ,” communications of the acm , vol . 31 , no . 10 , ( 1988 ), pages 1192 - 1201 . fig6 is a block diagram of the bit - veil - unveil ( bitvu ) algorithm according to the present invention . the bitvu algorithm is a natural extension of the bytevu algorithm . instead of veiling bytes of drkj , the bitvu algorithm veils bits of drkj . it is assumed , without sacrificing any generality limitations of the bitvu algorithm , that drkj bit size is 128 bits 6001 . each bit of drkj in 6001 is separated from a neighboring bit with a vertical bar . server sequential random number generator ( srng ) 6002 uses the user password ( or the client host id ) supplied by the server in a hashed form as a seed , allowing for the generation of a random series of 128 integers with values ranging from 1 to 128 ( for instance , 4 , 127 ,..., 4 , 2 ), and each one pointing to a drkj consecutive bit veiled position in conversion array 6005 , respective sections 6006 , 6007 , . . . , 6008 , . . . , 6009 , and 6010 of 128 bit size each . in other words , the password ( or the client host id ) and the srng 6002 sequence of integers are uniquely associated . block 6005 introduces a conversion array which , without sacrificing any generality limitations of bitvu algorithm , has 128 equal sections 6006 , 6007 , . . . , 6008 , . . . , 6009 , and 6010 , with 128 bits per each section . fig6 presents an exemplary case , when srng 6002 generated 128 sequential integers 4 , 127 , . . . , 4 , and 7 . for this exemplary case disclosed in fig6 , the 1 st bit of drkj 6001 yh 1 is put into the 4 th bit position of first section 6006 instead of r1 , 4 bit ; then the 2 nd bit of drkj 6001 yh 2 6012 is put into 127 th bit position of second section 6007 instead of r2 , 127 bit , and so on , until 127 th bit of drkj 6001 is put into the 4 th position of 127 th section 6009 instead of r127 , 4 bit . ultimately , the 128 th bit of drkj 6001 is put into the 2 nd bit position of the 128 th section 6010 of conversion array 6005 instead of r128 , 2 bit . once all bites of drkj are veiled in this manner inside conversion array 6005 , the entire conversion array 6005 is encrypted with drkj - 1 , and the message is sent to client 3002 . at client 3002 , the encrypted conversion array is decrypted with drkj - 1 , saved at client 3002 , from the previous server message ( step 3011 in the kedia algorithm , fig3 ). then the procedure , a reversed one as compared to that which is described above for the bitvu algorithm on server 3001 side , is applied . the user password ( or the client host id ) saved at the client platform in step 3007 of the kedia algorithm ( see fig3 ) is supplied in a hashed form as a seed to client sequential random number generator ( srng ) 6003 , identical to the one on the server 3001 side . this password ( or host id ) triggers srng 6003 to generate the same sequence of integers as on server 3001 side before , that is 4 , 127 , ..., 4 , 2 . then , the logic placed on client 3002 used the first integer 4 to extract drkj 1 st byte yh 1 from the 4 th position in 1 st 128 bits section 6006 of conversion array 6005 , and placed it back in the 1 st position of drkj 6001 . consequently , the second integer 127 is used to extract drkj 2 nd bit from the 127 th position in 2 nd 128 bits section 6007 of conversion array 6005 , and place it back into the 2 nd bit position of drkj 6001 . this procedure continues until , ultimately , the 127 th bit of drkj yh 127 is extracted from the 4 th bit position in 127 th 128 bits section 6009 of conversion array 6005 , and placed back into 127 th bit position of drkj 6001 , as well as the 128 th bit of drkj yh 128 6011 being extracted from the 2 nd bit position in 128 th 128 byte size section 6010 of conversion array 6005 , and placed back into 128 th bit position of drkj 6001 . this completes the reassembling procedure of the bitvu algorithm to restore drkj at client 3002 . fig7 is a block diagram of the byte - bit - veil - unveil ( bbvu ) algorithm according to the present invention . block 7001 shows drkj , where each byte is separated from a neighboring byte with a vertical bar . without sacrificing any generality limitations of the bbvu algorithm , drkj is assumed to be a 16 - bytes key in fig7 . the user password ( or the client host id ), supplied by server 3001 in a hashed form , plays a seed role for server sequential random number generator ( srng ) 7002 . srng 7002 generates a random sequence of 16 integers , and then the server &# 39 ; s sequential direct bit position scrambler ( sdbps ) 7006 scrambles all bit positions in the veiled byte 7010 . sdbps 7006 generates a random series of non - repeating eight digits within the range from 1 to 8 , for each of srng 7002 integers in the sequence . in other words , the password ( or the client host id ), the srng 7002 sequence of integers , and the series of digits generated by sdbps 7006 are uniquely associated . applying the same seed ( the user password , or the server host id , in a hashed form ) will result in the same sequence of integers generated by srng 7002 , and the same series of digits generated by sdbps 7006 for each integer in the sequence . block 7006 introduces a conversion array which , without sacrificing any generality limitations of the bbvu algorithm , has 16 sections similar to 7008 , with 10 bytes per section . similarly to the bytevu algorithm , each section will veil one byte of drkj 7001 in a position , respective to the particular integer value generated by srng 7002 . for instance , the 1 st byte of drkj 7001 xh 1 occupies the 4 th byte position in section 7008 , replacing r1 , 4 byte . fig7 presents an exemplary case , where the 1 st drkj byte xh 1 has an 8 - bit representation from the most significant bit xh 1 , 8 to the least significant bit xh 1 , 1 7009 , and chosen as 01011101 in fig7 . srng 7002 generated 16 sequential integers 4 , . . . , while sdbps 7006 generated a series of eight non - repeating digits 3 , 1 , 8 , 5 , 4 , 2 , 7 , and 6 for the first integer 4 7011 , and a similar series of digits for the rest of the integers . eventually , all bits of the 1 st drkj 7001 byte in 7008 occupy new bit positions , consecutively specified in the sdbps 7006 generated series of digits for the first integer 4 . for a particular example in fig7 , it is 01011011 . the same process 7013 of scrambling bits for each veiled byte of drkj 7001 in conversion array 7007 is continued , until all bytes of drkj are veiled , and all bit positions of each veiled byte are scrambled . then , the entire conversion array 7007 is encrypted with drkj - 1 , and the message is sent to client 3002 . at client 3002 , the encrypted conversion array is decrypted with drkj - 1 , saved at client 3002 , from the previous server message ( step 3011 in kedia , fig3 ). then the procedure , a reversed one as compared to that which is described above for the bbvu algorithm on server 3001 side , is applied . the user password ( or the client host id ), saved at the client platform in step 3007 of the kedia algorithm ( see fig3 ), is supplied in a hashed form as a seed to client sequential random number generator ( srng ) 7005 identical to the one on the server 3001 side . this password ( or host id ) triggers srng 7005 to generate the same sequence of integers as on server 3001 side before 4 , . . . . client sequential reverse bit position scrambler ( srbps ) 7003 generates the reversed series of digits for each integer , as compared to its server counterpart sdbps 7006 . for instance , for the first integer 4 , srbps 7003 generates the reversed series 2 , 6 , 1 , 5 , 4 , 8 , 7 , and 3 , which allows the logic placed on client side 3002 to restore bits in the original order for the 1 st byte of drkj - 2 means that the 2 nd bit of the scrambled byte will become the least significant bit in the restored 1 st drkj byte , and so on , until 3 , the last digit in the series , is reached , indicating that the 3 rd bit in the scrambled byte will become the most significant bit in the restored 1 st byte . meanwhile , integer 4 points to the 4 th position in section 7008 of conversion array 7007 , where the 1 st drkj byte has been veiled . the same procedure continues , until all byes of drkj 7001 and their respective bits are returned to their original positions . this completes the reassembling procedure of the bbvu algorithm to restore drkj at client 3002 . at this time it is important to note that the bytevu , bitvu , and bbvu algorithms , disclosed above , require assessment of security of these algorithms against possible computer processing attacks now and in the future . table 1 below presents a summary of this assessment . srng 5002 , 5003 ( fig5 ), 600 , 6003 ( fig6 ), and 7002 , 7003 ( fig7 ) generate integers pseudo - randomly , as well as sdbps 7006 and srbps 7003 ( fig7 ). hence , probabilities of veiling each byte and bit inside a conversion array ( ca ) for each algorithm can be viewed as independent ones . best microprocessors achieved ˜ 1 ghz clock rate barrier by the beginning of the 21 st century . previously , forecasting allowed for at least 25 - 35 years , until the clock rate would reach ˜( 100 - 1000 ) ghz . thus , currently available ˜ 1e10 instructions per second could reach ˜( 1e12 - 1e13 ) instructions per second in a distant future , ( assuming microprocessor risc pipelined architecture with up to 10 stages per cycle ). a very conservative assumption is made that the attacking computers have 100 % efficiency of their cpu utilization during an attack . in other words , testing each possible combination of all bytes , bits , or the combination thereof , of a veiled message in ca will consume only one microprocessor instruction . column 1001 in table 1 presents particular geometries of ca chosen in each algorithm for the assessment . column 1002 gives the bit size of each algorithm ca for every geometry selected in 1001 . column 1003 presents the total number of pseudo - random integers generated by srng of each algorithm with respect to the geometries chosen in 1001 . column 1004 introduces probability models for each algorithm with respect to the geometries of ca chosen in 1001 . every position in 1004 gives probability to estimate the entire combination of veiled bytes , bits , or the combination thereof , for each algorithm , under given geometry of ca in 1001 . column 1005 presents for each ca its transit time , given the slowest standard modem of 28 . 8 kbps ( kilobits per second ) of contemporary networks ( for example , the internet ). column 1006 presents assessed time , required for a brute force attack now and in a distant future , for each algorithm and their respective geometries of ca chosen in 1001 . column 1007 presents an approximate time for one advanced microprocessor ( 1 ghz / 100 ghz ) instruction now , and in a distant future . summarizing the assessment results in table 1 , it can be noted that each of bytevu , bitvu , and bbvu algorithms give extremely high security now and in a distant future for the respective geometries selected in 1001 . at the same time , one ca message transit times 1005 , even for the slowest standard modems , are reasonable enough for the disclosed algorithms &# 39 ; practical utilization in the media protocol . certainly , geometry parameters in 1001 can be regarded as security parameters of the media protocol , and these parameter changes could allow for security trade - offs vs . cost ( cpu power of client / server or authenticator / peer platforms , and the network throughput ). also , replacing slow modems by contemporary high - speed network connections , like dsl , would significantly reduce message transit times in 1005 . the combination of the kedia algorithm and any one of bytevu , bitvu , and bbvu algorithms comprise the fourth security tier , which makes the encrypted authentication protocol highly secure against online and offline attacks . the algorithms described above allow for the encryption key management security to be scaled with cpu and network throughput resources . during the encryption key distribution stage over communication lines , shared secrets never leave the server , or the client . however , they are repeatedly employed for each iterative message encryption / decryption by kedia and any of bytevu , bitvu , or bbvu algorithms on the server and the client platform as well . only when the client and the server eventually have in their possession the final secret key ( fsk ) satisfying the required security level , then the server and the client will perform mutual authentication in a way that neither of authentication credentials enter communication lines in either form . the authentication session is denied , provided the parties &# 39 ; mutual authentication is not successfully completed . this part of the encrypted authentication protocol completes the client / server mutual authentication . at the same time , it is the final fifth security tier of the encrypted authentication protocol . fig8 a and fig8 b illustrate the server and the client side of the message encrypt / decrypt iterative authentication ( media ) protocol according to the present invention . without sacrificing any generality limitations of the media protocol , the exemplary case presented in fig8 a and fig8 b is assuming http communication protocol ( rfc 2068 hypertext transfer protocol — http / 1 . 1 january 1997 ), java applet / servlet multi - threading object - oriented communication technology , and a standard web server technology . however , the media protocol can be integrated into any other network communication protocol , and enabled with various object - oriented technologies . the bytevu algorithm has been included into the media protocol in fig8 a and fig8 b , though any of bitvu and bbvu algorithms could serve there equally well . messages sent to the client and received at the server are numbered in 8000 . key functional message destinations on the server side are in 8001 , and on the client side they are in 8016 . for each message received at the server , its content description is in 8003 , whereas for each message received at the client , its content description is in 8014 . similarly , for each message sent from the server , its content description is in 8002 , whereas for each message sent from the client , its content description is in 8015 . the choice of any one of bytevu , bitvu , or bbvu algorithms to be used in the media protocol and the parameters of the respective conversion array are in 8006 for the server side , and in 8010 for the client side . seeds , having been used to trigger srng ( sequential random number generator ), are in 8007 for the server side , and they are in 8009 for the client side . which direction a particular media message is sent towards , is in 8008 . the bytevu algorithm conversion array parameters , chosen in fig8 a and fig8 b ( 10 sections with 25 bytes size of each ), give extremely high security protection against online and offline intruding attacks , even for one media message as it was shown above . therefore , it is practically justifiable to reduce iterations in the kedia algorithm by limiting drkn in fig3 to drk 2 only . it saves client / server platforms cpu and network resources , while keeping a very high security level . it is assumed , without sacrificing any generality of the media protocol , that for this particular embodiment of the media protocol ( fig8 a and fig8 b ), the client is a user at the client platform . the communication session begins with the user &# 39 ; s request ( message 1 ) to the server to reach a protected network resource , for example , a url ( universal resource locator ), a protected link , a protected file , a protected directory , or another protected network resource . this message initiates the media protocol on the server side . the server replies to the user ( message 2 ), sending srk 1011 ( see fig1 ) over the communication line ( the internet ) in a compiled class form , which prevents any easy key reuse or reengineering , if it is intercepted by an intruder . the user enters into the gui ( graphical user interface , designed into the applet and sent from the server to the client in message 2 along with the srk ) the user name , the user password , and the server password . the passwords stay stored at the client , while the user name gets encrypted with the srk and sent to the server in message 3 . the server ( logic on the server side in this exemplary case could be implemented in the java servlet technology ) replies in message 4 with drk 1 2012 ( fig2 ) bytes veiled with the bytevu algorithm , triggered by the server , supplying the hashed password of the assumed user as a seed . the resulting bytevu conversion array is encrypted with the srk and sent to the client . the client , having known the srk and the user password , entered into the gui in the previous message 3 , decrypts the conversion array and reassembles drk 1 bytes . in message 5 , from the client to the server , hashed drk 1 bytes are veiled with bytevu algorithm , triggered by the user password , stored at the client earlier in step 3 ( fig8 b ), and converted to its hash equivalent . then , the conversion array is encrypted with drk 1 and sent to the server , which decrypts the conversion array with drk 1 , and triggers bytevu with the hashed password of the assumed user , taken from the database attached to the server . if the hashed drk 1 is correct , reassembled in this way , it is actually the authentication signal from the client to the server , as nobody except the client knows the user password used to trigger the bytevu algorithm when receiving message 4 , and sending message 5 . if drk 1 is incorrect , the media protocol is terminated by the server sending a “ no ” authentication message ( or an error message : “ user password is incorrect ”) to the client , encrypted with srk . otherwise , the server sends to the client message 6 containing drk 2 , which bytes are disassembled by the bytevu algorithm , triggered by the user hashed password , used as a seed for srng 5002 ( fig5 ). then , the conversion array is encrypted with drk 1 and sent to the client , where it is decrypted with drk 1 stored at the client from the previous message 5 , and drk 2 bytes get reassembled by the bytevu algorithm , triggered by the user password , stored at the client earlier in step 3 ( fig8 b ). the client replies to the server with message 7 , sending to the server hashed drk 2 , which bytes are veiled by the bytevu algorithm , triggered by the user password , stored at the client in the previous message 3 , and converted to its hash equivalent . the server decrypts message 7 from the client with drk 2 , and reassembles the hashed drk 2 bytes with the bytevu algorithm , triggered by the user password , taken from the attached to the server database , and converted to its hash equivalent . if drk 2 is correct , the server sends to the client message 8 with drk 2 , which bytes are disassembled with the bytevu algorithm , triggered by the server password . otherwise , if drk 2 is not correct , the media protocol is terminated . the conversion array of the bytevu algorithm in message 8 is encrypted with drk 2 and sent to the client . the client , receiving message 8 from the server , decrypts it with drk 2 , and reassembles the hashed drk 2 bytes with the bytevu algorithm , triggered by the server password , stored on the client side in message 3 . then , the client compares the decrypted and reassembled drk 2 with drk 2 from the previous message 6 . if they are the same , it is viewed by the client as the authentication signal from the server , because only the client and server share the server password . hence , it was the only server , which could send the last message 8 to the client . now , as the trust is established by the client to the server , the client sends to the server message 9 with hashed drk 2 , which bytes are disassembled with the bytevu algorithm , triggered by the server password , stored on the client side in message 3 , and converted to its hash equivalent . eventually , the conversion array of the bytevu algorithm is encrypted with drk 2 and sent to the server . the server , having received message 9 from the client , decrypts it with drk 2 , and reassembles the hashed drk 2 bytes with the bytevu algorithm , triggered by the hashed server password . if drk 2 is correct , it is viewed by the server as a second authentication factor from the client ( the client confirmed the server password ), in addition to the first factor , having been checked in the message 6 from the client ( the client confirmed the user password ). this completes the mutual authentication of the client / server pair according to the media protocol , and the server is now ready to make an authentication decision . in the end , the server sends to the client message 10 , which has either a “ go ” authentication signal , assuming drk 2 in message 9 from the client was correct , or an error message : “ the server password is incorrect ”, assuming drk 2 in message 9 from the client was incorrect . each signal byte is disassembled with the bytevu algorithm , triggered by the user password from the database , attached to the server , and then the conversion array of the bytevu algorithm is encrypted with drk 1 and sent to the client in message 10 . having received the message 10 , the client decrypts it with drk 1 , stored at the client platform during message 4 , and reassembles the signal bytes with the bytevu algorithm , triggered by the user password , stored at the client side in message 3 . this effectively completes the entire media protocol of the client / server communication session as presented in fig8 a and fig8 b . as one can see , authentication credentials ( the user password and the server password in this particular embodiment ) have never passed through communication lines in any form . also , the client / server mutual authentication has been completed within the media protocol , as well as the exchange of fsk ( final secret key , which is drk 2 in this particular embodiment ) having been performed within the client / server pair . the server password and the user password enable secure mutual authentication , according to the media protocol architecture . at the same time , they are both playing a role of a strong two - factor authentication of the client at the server platform . fig9 illustrates the graphical user interface ( gui ) enabling client / server mutual authentication at the client platform according to the media protocol , and a graphical illustration of the distributed protected network resources , including the authentication server , and the user base the media protocol is used for , according to the present invention . this gui has already been mentioned or assumed along with the preferred embodiments of this invention , described herein , for instance , in fig3 step 3 3007 , fig8 b messages 3 , 5 a , and 10 8016 . the user on a client platform 9015 , or 9021 in fig9 is trying to reach a protected network destination 9020 . it invokes the media protocol through an interactive communication session between web server 9018 , compute server 9024 , program logic 9017 , and security and account databases 9022 and 9023 , all located on the server side , with gui 9003 located on the client side . there are different means to implement this scheme , for example , thick or thin software client , permanently placed on a client platform , or a java applet , loading gui 9003 , and its respective client - side logic into a browser . the latter case in the preferred embodiment in fig9 is assumed here . also , the network , over which the communication session is established , could be either only lan ( local area network ), or wan ( wide area network ), or a combination of lan and wan together . in the particular embodiment in fig9 , internet 9019 is assumed as a preferred embodiment , enabling client / server dialogue through communication links 9016 . gui 9003 has several operation modes 9009 : login session mode 9010 , account set - up mode 9011 , user password reset mode 9012 , and server password reset mode 9013 . login session 9010 is the default operation mode . the user enters the user name in window 9004 , the user password in window 9005 , and the server password in window 9006 . the user has a choice to enter alphanumeric characters , or their echo dots for security reasons by toggling button 9014 . the session elapsed time clock 9007 visualizes this value to the user , and signals communication session termination once the session time has expired . after the authentication credentials are all entered into 9004 , 9005 , and 9006 , the client indicates login button 9008 , which completes step 3 3007 in fig3 , or message 3 in fig8 b . then the other steps of the media protocol are initiated . stoplight 9001 turns yellow , when button 9008 is indicated , signaling the media protocol is in progress for the first authentication factor ( the user password ) examination . message 8 in fig8 b , having arrived at the client , initiates stoplight 9001 to change color from red at the beginning of the session to green , once it is checked by the client placed logic that drk 2 delivered in the message 8 is identical to drk 2 , delivered in message 6 . similarly , stoplight 9002 turns from red to the yellow color right after stoplight 9001 turned green , signaling that the media protocol is in progress for the second authentication factor ( the server password ) examination . indeed , once the client received message 10 in fig8 b , stoplight 9002 turns green , signaling successful client / server mutual authentication , fsk exchange , and completion of the media protocol . if the client received message 5 a from the server ( fig8 a and fig8 b ), stoplight 9001 turns red , back from the yellow color , and the error message “ the user password is incorrect ” appears in system window 9014 , signaling the media protocol termination . also , if the client received authentication signal “ no ” in message 10 from the server ( fig8 a and fig8 b ), stoplight 9002 turns red , back from the yellow color , and the error message “ the server password is incorrect ” appears in system window 9014 , signaling the media protocol termination . though , a server password unique to each user remains the preferred embodiment of this invention , various business environments , or enterprise / organization / agency it resource configurations may require some modifications to the media protocol . the exemplary case would be when users of all computer platforms logged - in from the same server in an isolated lan environment ( or the same cluster of servers ). then the system administrator may preset the same server password at all platforms , during each platform configuration and setup on the network . this would require any user to enter only the user name , and the user password in gui 9003 inside an enterprise , organization , or agency . alternatively , messages 8 and 9 in the media protocol ( fig9 ) could be eliminated entirely for the above case , which effectively excludes the need for server password to perform a user ( a client platform ) authentication and a session key exchange . however , any connection with servers and users outside the particular lan perimeter would probably require the reinstatement of server passwords for security reasons . while the present invention is disclosed by reference to the preferred embodiments and examples detailed above , it is to be understood that these examples are intended in an illustrative rather than in a limiting sense . it is contemplated that modifications and combinations will readily occur to those skilled in the art , which modifications and combinations will be within the spirit of the invention and the scope of the following claims .	7
fig1 to 8 show schematically the last steps in the production of a curtain airbag according to a preferred embodiment of the invention : fig1 is a bird eye &# 39 ; s view onto an unfolded curtain airbag 10 . fig2 is a sects view along plane a - a in fig1 . the curtain airbag 10 comprises an - airbag skin 12 with two side walls 14 and 16 . the side walls 14 and 16 and thus the airbag skin 12 enclose a gas chamber g which has in the embodiment shown two sub - chambers g 1 , g 2 . the airbag skin has four edges , namely an upper edge 12 a , a lower edge 12 b , a right edge 12 c and a left edge 12 d . the two side walls are connected to each other by means of an edge seam 18 , but it needs to be emphasized that other kinds of connections between the side walls are also possible . for example the airbag skin can be made in a one - piece - woven technique . mounting lugs 30 , 30 ′, 30 ″ are attached to the upper edge ; in the embodiment shown by means of the edge seam 18 . a gas feed element extends into the gas chamber through a section of the upper edge . this gas feed element 20 whose upper 22 section serves to accommodate a gas generator ( not shown ) is only drawn very schematically . it can be built like the gas feed element which is disclosed in wo 2006 / 117121 a1 . other possibilities of feeding the gas into the gas chamber can of course also be used . preferably the airbag skin is made of a plastic fabric . a suitable and preferred material for this plastic fabric is polyamide ( pa , nylon ). it is further preferred that the airbag skin is coated , especially with a coating made of thermoplastic components . the next step after the assembly of the airbag as such is the rolling of the airbag skin 12 . since it is desired that the rolled package of the airbag skin 10 is hollow , such that the rolled package 25 has the shape of a tube , the rolling can be done by wrapping the airbag skin around a cylinder 60 , as is shown fig3 and 4 . after the rolling of the package is completed , the cylinder is removed , such that the rolled package 25 of the airbag skin remains in a state as shown in fig5 , namely in form of a tube . in the next step the curtain airbag 10 is inserted between two plates 52 , 54 of a press 50 . in this step it can be necessary to keep the rolled package 25 in shape by arranging some elastic bands around its outer surface ( not shown ). the two plates are heatable and are heated to preferably 80 ° c . to 110 ° c . the maximum temperature is limited by the material of the airbag skin and / or the coating of the airbag skin ( if any ). with the materials described above , the preferred temperature is 110 ° c . as shown in fig7 , the press is actuated by lowering the upper plate 54 towards the lower plate 52 . the force is preferably between 5000 and 10000 n per meter of the rolled airbag skin . a good value for the pressure for the materials and the temperature given above is 7500 n / m . the curtain airbag remains in the press for some time , for example for 5 minutes . in the press , the airbag skin of the rolled package is flattened such that it shows layers that are basically parallel to each other and sharp bending lines along which the airbag skin is bent around 180 °. especially in the areas of the bends , the airbag skin and / or the coating of the airbag skin is thermoplastically deformed . further it is possible that by the heating and the pressing a certain gluing effect between adjacent layers of the airbag skin in the shaped package occurs . when the press is opened , the rolled package expands to some extend but does not return to its original shape with a circular cross - section due to thermoplastic deformation . this package being obtained form the original rolled package with circular cross - section by the described plastic conversion ( or plastic deformation ) is referred to as shaped package 27 ( fig8 ). the shape of the shaped package 27 is permanent as long as no sufficient forces are applied , thus in the resting state of the airbag . of course the shaped package looses its shape when the gas generator is triggered , the pressure inside the gas chambers rises and the airbag deploys . the cross - section of the shaped package 27 is oval after the plastic deformation of the rolled package 25 with circular cross - section . the areas of the bends show the strongest curvature . it is to be noted here that the amount of the curvature of the airbag skin building the shaped package 27 is not constant ( as is a characteristic of an oval ) but that the direction of the curvature does not change within the shaped package 27 ( as is also a characteristic of an oval ). in mathematical terms : the curvature of the airbag skin in the shaped package 27 is monotonous . even though mathematically not exact one can say that the shaped package has a longer side with a length a and a shorter side with a length b . mathematically correct “ a ” denotes the maximum diameter and “ b ” denotes the minimum diameter . preferably a is between 20 mm and 50 mm and b is between 10 mm and 25 mm . further it is preferred that a is at least 1 , 5 × b . as one can see from fig8 , the upper edge 12 a of the airbag skin extends along the longer side ( taking the above given definition ). as one can also see from fig8 , the mounting lugs ( shown is mounting lug 30 ) extend basically parallel to the longer side and end on the upper edge 12 a , so that the mounting lug 30 and the shaped package 27 form a “ b ” in the shown cross - section . a stiff mounting element ( shown in fig8 is the stiff mounting element 32 ) can be attached to each mounting lug 30 , 30 ′, 30 ″. for example it is possible to glue this stiff mounting element 32 — which can especially being made of sheet metal or of plastic — or to lay it inside the mounting lug 30 if this mounting lug 30 is double - walled . with these stiff mounting elements 32 it is achieved that the curtain airbag can be mounted in such a way at the roof rail 65 of a vehicle , that the longer side of the shaped package extends basically in an up - down - direction which is usually preferred ( fig9 ). fig1 shows a second embodiment in a sectional view according to claim 8 . the difference to the first embodiment is that the orientation of the mounting lugs 30 and the stiff mounting elements 32 is opposite : the mounting lug 30 and the shaped package form a “ p ”. fig1 shows a third embodiment in a sectional view according to claim 8 . here , the airbag skin has two sections : a first section being rolled to a rolled package and deformed to a shaped package with an oval cross - section as described above , and a second section extending between the first section and the upper edge showing one fold 19 . this fold can be applied before or after the plastic deformation of the package . in the first two embodiments usually no wrapper or similar is needed in order to keep the shaped package in its shape . the third embodiment will usually need one or more wrappers in order to keep its shape . in the embodiments described the shaped packages have a basically oval cross section and are obtained by plastic deformation of rolled packages with usually circular cross - sections . this shape is usually preferred since it can be made with a simple press with two plates . but it is also possible to generate a shaped package with a more complex cross - section , for example a triangular cross - section . the advantage of such a shape can be that the curtain airbag does even better fit into the space available between the roof rail and the ceiling . a drawback is that a more complicated press , namely one with at least three plates is necessary . although the invention has been described at the example of curtain airbags , which is likely to be the most important application , it needs to be emphasised that an airbag according to the invention can also be another kind of airbag , especially a side airbag or a knee airbag .	1
to better appreciate the present invention , it will be helpful to consider a conventional tvs design in detail ( section a below ), followed by a description of the new approach ( section b below ). a transient voltage suppressor ( tvs ) clamping device must be able to sustain high current when surge voltage is above a required breakdown voltage ( bv ). the clamping device , typically a zener diode , a punch through diode , or a thyristor ( scr ) device , physically has to be large enough in area to withstand the power requirements . the conduction resistance must be low , in order that the voltage is clamped as closely as possible to the breakdown voltage , requiring a relatively large junction area . additionally , the typically low bv requires a relatively heavily doped junction . these factors in general result in a very large device capacitance , which makes the tvs unsuitable for connection directly across high speed signal applications . in a tvs diode array , one or more pairs of “ steering diodes ” are connected to a high power reverse biased zener or avalanche tvs diode . when in circuit , a positive or negative voltage will be clamped in either direction by the top or bottom steering diodes . a typical array is shown in fig1 . here 102 is the tvs clamping device , and 104 are the steering diodes . the steering diodes are relatively small , as they only ever conduct high current in the forward direction . being physically small compared to the tvs , they have lower capacitance , and thus cause minimal loading on the signal line . these diodes are created using high resistivity p and n type silicon to create a junction with a wide depletion layer and hence low capacitance . one diode connects to the cathode , and the other to the anode of the tvs clamping diode 102 , with the signal applied to the connection of the pair of steering diodes . the steering diodes are reverse biased in normal signal operation by a biasing voltage applied to the tvs . such diode arrays can be build using discrete diodes assembled together in a “ multi - chip module ” ( mcm ), which is advantageous in performance as the individual diodes can be designed and processed in a manner that results in optimal performance : 1 ) the steering diodes can be easily made with low doped junctions , so as to create a wide depletion region , and hence very low capacitance . 2 ) the separate tvs clamping device can be made using highly doped substrate and junctions , resulting in low forward resistance and good clamping characteristics a disadvantage of the mcm approach is that the assembly costs of multiple die in one package can be very high . it is desirable to integrate the devices into a single ( monolithic ) die to drastically reduce the assembly cost . in a fully integrated tvs array , all device types are built on the same semiconductor chip . however , because all the processing has to be done on a single wafer , designs using conventional prior art have not been able to achieve the same level of low capacitance and low forward voltages as achieved by mcm designs . in a conventional monolithic tvs array structure , two relevant device types are shown on fig2 ( excluding top metal connections and passivation layers etc .). a vertical diode structure 210 is used for the bottom , negative clamping , steering diode . a lateral diode ( not shown ) can be used for the top , positive clamping , steering diode . a large vertical diode 220 is used as the main tvs clamping element . a highly doped p + type substrate 202 is used . very high doping is required to reduce the resistivity of the substrate to a low level , to minimize conduction resistance of both the tvs 220 and the vertical steering diode 210 . two layers of epi are grown , the first epi layer 204 being a low doped p − epi , the second epi payer 206 being an n − doped epi . note that in practice , due to the thermal processing , p dopant from the heavily doped substrate diffuses up through the bottom p − epi 204 . this diffusion can extend beyond the p −/ n − epi interface , effectively moving the junction formed by the two epi layers up further into the n − epi layer . the conventional construction of these two vertical diodes is as follows . 1 ) the tvs device is made by implanting a highly doped p + buried layer 212 at the interface between the p − and n − epi . a p + implant 214 is diffused from the top followed by an n + implant 216 to form the n +/ p + tvs junction . the buried layer 212 diffuses under thermal drive to connect the top p + implant 214 to the substrate 202 , as shown by the arrows on fig2 . buried layer 212 is important , as otherwise this connection cannot be satisfactorily made , and the effective conduction resistance of the tvs would be unacceptably high . fig3 shows a spreading resistance profile ( srp ) measurement through a tvs , showing doping concentration as affected by diffusion of the buried layer . it can be seen that the minimum p doping concentration remains significantly higher than 1e16 cm 3 , giving low tvs resistance . the minimum concentration occurs about 10 μm from the surface where the diffusion from the buried layer 212 meets the diffusion coming up from the substrate 202 . it can be seen that the thickness of the epi layers cannot be made too thick , or else the concentration level in these “ valleys ” will drop and the effective series resistance will increase significantly . thus it can be seen that narrow p − epi and n − epi layers ( i . e ., layers 204 and 206 ) are desirable to reduce this tvs resistance to a minimum . 2 ) the vertical steering diode utilizes the junction formed by the top n epi layer 206 and the bottom p epi layer 204 . an n + contact region 208 is implanted at the top to provide a low resistance connection to the top metal layer . ideally , for lowest capacitance , the junction of this diode should be formed by the interface of the n − and p − epi . for example , using epi doping concentrations that can give resistivity levels normally reached in a typical fab of 5e13 cm − 3 n − and 1 . 5e14 cm − 3 p − epi ( approx . 80 ohm . cm ), we would expect to form an abrupt junction with a depletion region of approximately 4 μm total width , with a capacitance per unit area of approx . 2 . 5 nf / cm 2 . however , the p dopant diffusing up from the substrate 202 , beyond the first and second epi interface , converts the lower region of the n − epi layer 204 into heavier doped p type , and effectively moves the junction closer to the surface , where the substrate p dopant then intersects with the highly doped n + contact dopant diffusion from contact 208 . fig4 shows an srp measurement of the doping concentration of a typical integrated vertical steering diode . here , the first p − epi layer 204 has a thickness of 12 μm and the second n − epi layer 206 has 7 μm thickness . it can be seen that the substrate p dopant diffuses about 5 μm into the n − epi 206 . the concentration of the p type at the junction interface is around 1e14 cm − 3 , but rises rapidly away from the junction . the n type doping is very high , rising to 1e15 cm − 3 less than 0 . 1 μm from the junction . this results in a mostly one sided depletion region width of approx . 2 μm and a capacitance of over 5 nf / cm 2 , double the ideal value . it can readily be seen that wider p − epi and n − epi layers are desirable to allow the doping concentration from the substrate diffusion to subside completely to the intended epi doping levels , and hence give the lowest doping levels at the diode junction , and therefore a wider depletion region . this in turn gives a lower capacitance junction . as the p dopant from the substrate has defused approximately 17 μm away from the substrate - epi interface , and we desire sufficient low doping concentration depth extending at least around 2 . 5 μm either side of the junction to accommodate the depletion region , it implies we need a total p − epi thickness of approx . 20 μm to ensure this objective can be met . fig5 shows the nominal positions of typical implants , and the initial state of the epi doping before diffusion caused by thermal processing , which yields the profile previously illustrated in fig2 . it can be readily seen that the conventional design requires careful optimization to provide the optimum performance . while a narrow epi ( 204 and 206 ) is best for the main tvs clamping diode , wide epi layers ( 204 and 206 ) are better for the vertical steering diode construction . the prior art design described above therefore requires a compromise of epi thicknesses to give the overall best forward tvs resistance and steering diode performance . while a compromise value can be reached , the result is an integrated diode with inferior capacitance compared to the discrete diode , and thus , in today &# 39 ; s market , low capacitance , high current tvs diode arrays are most often constructed using mcm techniques with separate tvs and steering diode dies , each independently optimized for performance . in order to overcome the above - described limitations of the existing design , we provide the following approach for building low capacitance tvs arrays : step 1 ) as shown on fig6 a , grow a first epi layer 604 to a thickness whereby the diffusion from the substrate 602 during subsequent thermal processing will ensure doping to p type throughout this layer . this epi type is typically near intrinsic as grown ( i . e ., the doping level is preferably 5e14 cm − 3 or less ). as the subsequent doping from the substrate diffusion is far higher in concentration than the deposited doping of this layer , the dopant level and species is not critical . the thickness of this layer is preferably between about 5 μm and about 15 μm ( typically approx . 11 μm ) and is chosen so that it allows the concentration due to substrate diffusion to drop significantly at the top of this epi layer ( e . g . typically to approx . 1e15 cm − 3 ) after the thermal processing has been completed , and so that the subsequent p type buried layer in step 2 can diffuse down and form a continuous highly doped region all the way to the substrate 602 . step 2 ) as shown on fig6 b , implant or diffuse in a heavy dose of p type material to form a buried layer 606 underneath the tvs clamping diode area . this will be subsequently thermally driven to diffuse both upwards and downwards to form a low resistance , high p concentration region under the tvs clamping diode . step 3 ) as shown on fig6 c , grow a second epi layer 608 of low p − doping concentration that will form part of the p − side of the vertical steering diode . the doping level is normally as low as can be reliably controlled by the epi growth process , for example 100 ohm . cm ( i . e ., the doping level is preferably 5e14 cm − 3 or less , and is more preferably approx . 1 . 3e14 cm − 3 ). the epi thickness should be such the that diffusion of p dopant from the substrate drops below the second epi layer p concentration level within a defined and controlled distance from the top surface of the second layer after the thermal processing has been completed , typically requiring a second epi layer thickness preferably between about 5 μm and about 15 μm ( e . g ., approx . 7 μm ). step 4 ) as shown on fig6 d , implant or diffuse in a second heavy dose of p type material to form a second buried layer 610 underneath the tvs clamping diode area . again , this will be subsequently thermally driven to diffuse both upwards and downwards to form a low resistance , high p concentration region under the tvs diode , connecting to the first buried layer below , and to the top p implant that forms the tvs diode . step 5 ) as shown on fig6 e , grow a third epi layer 612 of n − doping concentration that is required to form the n − side of the vertical steering diode , normally of as high resistivity as can be reliably controlled by the epi growth process , ( i . e ., the doping level is preferably 5e14 cm − 3 or less ). for example , a resistivity of approx . 100 ohm . cm , corresponds to a concentration of approximately 5e13 cm − 3 . the thickness of the third epi layer will be such that the region of n − at the n −/ p − interface after a n + top contact is implanted , will be sufficient to allow for the full depletion width expected under reverse voltage bias for the vertical diode to provide the required lowest capacitance . assuming the epi concentration of 5e13 cm − 3 , we must allow approx . 3 μm for the depletion region , and approx . 2 μm for the top n + contact . in addition , a region of near intrinsic concentration would result from the compensation caused by the diffusion between the n − and p − epi , so we must also allow 1 - 2 μm for this , and hence between about 3 μm and about 10 μtm ( e . g ., approx . 6 μm ) would be a preferred thickness for the n − epi 612 . this top layer epi thickness may be further increased due to normal considerations of the design of the lateral diode , or of any other devices to be integrated with the tvs diode array . step 6 ) as shown on fig6 f , p + and n + implants ( 616 and 618 respectively ) are made to complete the tvs clamping diode , an n + contact 614 is made for the top connection to the vertical steering diode , and other implants and processing are made for any other device structures , such as lateral diodes . metallization and passivation are carried out as per usual processing . thermal processing during the fabrication process will result in the diffusion of the dopants , and the resulting profile will resemble that shown on fig6 g - h . here the vertical steering diode is referenced as 620 and the tvs clamping diode is referenced as 622 . note that the vertical steering diode junction is now formed by the junction of the low doped epi layers 608 and 612 . the two buried layers 606 and 610 beneath the tvs allow a low resistance path 630 to the substrate for low forward voltage drop . even with the additional buried layer , it is possible that a small increase in the effective series resistance may be found due to the additional buried layer . this may be compensated by proportionally increasing the area of the tvs . the final structure results in an srp for the vertical diode that provides the desired low concentration regions on either side of the n −/ p − epi interface , as shown on fig7 . the tvs clamping element srp shows that the resistivity below the tvs remains low , giving low clamping resistance , as shown on fig8 . in conclusion , a unique device design is provided that eliminates the need to compromise between tvs resistance and steering diode capacitance by utilizing a third epi layer . the design can be characterized by 1 ) a requirement to provide a continuous low resistance path to the substrate below the tvs by virtue of multiple buried layers , which can be accommodated by a third epi allowing a second interface at which an additional buried layer is provided . 2 ) sufficient thickness of first and second epi layers to allow for diffusion of p dopant up from the substrate to drop to a level less than the epi level dopant concentration , with an additional region of p − epi in the second layer wide enough to accommodate the depletion region of the vertical steering diode on the p − side . 3 ) a third n − epi of sufficient thickness to allow for diffusion of n dopant down from the vertical diode n + contact implant to drop to a level less than the top epi level dopant concentration , with an additional region of n − epi in the top layer wide enough to accommodate the depletion region of the vertical steering diode on the n − side . illustrations of epi depth computation have been given by way of example to show how this design may be optimized for specific epi dopant concentrations . specific thickness may be adjusted dependent upon variations in epi doping levels due to design consideration , and the amount of thermal processing which will consequently alter the amount of diffusion up from the substrate using the same considerations as outlined in this design process . other variations of the given examples can also be considered , e . g ., exchanging p - type and n - type doping .	7
first , in which circumstances the accumulated rounding errors as described in the “ related art ” occur must be considered . an example of an image sequences encoded by coding methods which can perform both unidirectional prediction and bidirectional prediction such as in mpeg . 1 , mpeg . 2 and h . 263 is shown in fig5 . an image 501 is a frame - coded by means of intraframe coding and is referred to as an i frame . in contrast , images 503 , 505 , 507 , 509 are called p frames and are coded by unidirectional interframe coding by using the previous i or p frame as the reference image . accordingly , when for instance encoding image 505 , image 503 is used as the reference image and interframe prediction is performed . images 502 , 504 , 506 and 508 are called b frames and bidirectional interframe prediction is performed utilizing the previous and subsequent i or p frame . the b frame is characterized by not being used as a reference image when interframe prediction is performed . since motion compensation is not performed in i frames , the rounding error caused by motion compensation will not occur . in contrast , not only is motion compensation performed in the p frames but the p frame is also used as a reference image by other p or b frames so that it may be a cause leading to accumulated rounding errors . in the b frames on the other hand , motion compensation is performed so that the effect of accumulated rounding errors appears in the reconstructed image . however , due to the fact that b frames are not used as reference images , b frames cannot be a source of accumulated rounding errors . thus , if accumulated rounding errors can be prevented in the p frame , then the bad effects of rounding errors can be alleviated in the overall image sequence . in h . 263 a frame for coding a p frame and a b frame exists and is called a pb frame ( for instance , frames 503 and 504 can both be encoded as a pb frame ). if the combined two frames are viewed as separate frames , then the same principle as above can be applied . in other words , if countermeasures are taken versus rounding errors for the p frame part within a pb frame , then the accumulation of errors can be prevented . rounding errors occur during interpolation of intensity values when a value obtained from normal division ( division whose operation result is a real number ) is a half ( ½ ) integer ( 0 . 5 added to an integer ) and this result is then rounded up to the next integer in the direction away from zero . for instance , when dividing by 4 to find an interpolated intensity value is performed , the rounding errors for the cases when the residual is 1 and 3 have equal absolute values but different signs . consequently , the rounding errors caused by these two cases are canceled when the expectation for the rounding errors is calculated ( in more general words , when dividing by a positive integer d ′ is performed , the rounding errors caused by the cases when the residual is t and d ′ − t are cancelled ). however , when the residual is 2 , in other words when the result of normal division is a half integer , the rounding error cannot be canceled and leads to accumulated errors . to solve this problem , a method that allows the usage of two rounding methods can be used . the two rounding methods used here are : a rounding method that rounds half ( ½ ) integers away from zero ( 0 ); and a rounding method that rounds half ( ½ ) integers towards zero ( 0 ). by combining the usage of these two rounding methods , the rounding errors can be canceled . hereafter , the rounding method that rounds the result of normal division to the nearest integer and rounds half integer values away from 0 is called “ positive rounding ”. additionally , the rounding method that rounds the result of normal division to the nearest integer and rounds half ( ½ ) integer values towards zero ( 0 ) is called “ negative rounding ”. the process of positive rounding used in block matching with half ( ½ ) pixel accuracy is shown in equation 3 . when negative rounding is used instead , this equation can be rewritten as shown below . hereafter motion compensation methods that performs positive and negative rounding for the synthesis of interframe prediction images are called “ motion compensation using positive rounding ” and “ motion compensation using negative rounding ”, respectively . furthermore , for p frames which use block matching with half ( ½ ) pixel accuracy for motion compensation , a frame that uses positive rounding is called a “ p + frame ” and a frame that uses negative rounding is called a “ p − frame ” ( under this definition , the p frames in h . 263 are all p + frames ). the expectation for the rounding errors in p + and p − frames have equal absolute values but different signs . accordingly , the accumulation of rounding errors can be prevented when p + frames and p − frames are alternately located along the time axis . in the example in fig5 , if the frames 503 and 507 are set as p + frames and the frames 505 and 509 are set as p − frames , then this method can be implemented . the alternate occurrence of p + frames and p − frames leads to the usage of a p + frame and a p − frame in the bidirectional prediction for b frames . generally , the average of the forward prediction image ( i . e . the prediction image synthesized by using frame 503 when frame 504 in fig5 is being encoded ) and the backward prediction image ( i . e . the prediction image synthesized by using frame 505 when frame 504 in fig5 is being encoded ) is frequently used for synthesizing the prediction image for b frames . this means that using a p + frame ( which has a positive value for the expectation of the rounding error ) and a p − frame ( which has a negative value for the expectation of the rounding error ) in bidirectional prediction for a b frame is effective in canceling out the effects of rounding errors . just as related above , the rounding process in the b frame will not be a cause of error accumulation . accordingly , no problem will occur even if the same rounding method is applied to all the b frames . for instance , no serious degradation of decoded images is caused even if motion compensation using positive rounding is performed for all of the b frames 502 , 504 , 506 , and 508 in fig5 . preferably only one type of rounding is performed for a b frame , in order to simplify the b frame decoding process . a block matching section 1600 of an image encoder according to the above described motion compensation method utilizing multiple rounding methods is shown in fig1 . numbers identical to those in other drawings indicate the same part . by substituting the block matching section 116 of fig1 with 1600 , multiple rounding methods can be used . motion estimation processing between the input image 101 and the decoded image of the previous frame is performed in a motion estimator 1601 . as a result , motion information 120 is output . this motion information is utilized in the synthesis of the prediction image in a prediction image synthesizer 1603 . a rounding method determination device 1602 determines whether to use positive rounding or negative rounding as the rounding method for the frame currently being encoded . information 1604 relating to the rounding method that was determined is input to the prediction image synthesizer 1603 . in this prediction image synthesizer 1603 , a prediction image 117 is synthesized and output based on the rounding method determined by means of information 1604 . in the block matching section 116 in fig1 , there are no items equivalent to 1602 , 1604 of fig1 , and the prediction image is synthesized only by positive rounding . also , the rounding method 1605 determined at the block matching section can be output , and this information can then be multiplexed into the bit stream and be transmitted . a prediction image synthesizer 1700 of an image decoder which can decode bit streams generated by a coding method using multiple rounding methods is shown in fig1 . numbers identical to those in other drawings indicate the same part . by substituting the prediction image synthesizer 211 of fig2 by 1700 , multiple rounding methods can be used . in the rounding method determination device 1701 , the rounding method appropriate for prediction image synthesis in the decoding process is determined . in order to carry out decoding correctly , the rounding method selected here must be the same as the rounding method that was selected for encoding . for instance the following rule can be shared between the encoder and decoder : when the current frame is a p frame and the number of p frames ( including the current frame ) counted from the most recent i frame is odd , then the current frame is a p + frame . when this number is even , then the current frame is a p − frame . if the rounding method determination device on the encoding side ( for instance , 1602 in fig1 ) and the rounding method determination device 1701 conform to this common rule , then the images can correctly be decoded . the prediction image is synthesized in the prediction image synthesizer 1703 using motion information 202 , decoding image 210 of the prior frame , and information 1702 related to the rounding method determined as just described . this prediction image 212 is output and then used for the synthesis of the decoded image . as an alternative to the above mentioned case , a case where the information related to the rounding method is multiplexed in the transmitted bit stream can also be considered ( such bit stream can be generated at the encoder by outputting the information 1605 related to the rounding method from the block matching section depicted in fig1 ). in such case , the rounding method determiner device 1701 is not used , and information 1704 related to the rounding method extracted from the encoded bit stream is used at the prediction image synthesizer 1703 . besides the image encoder and the image decoder utilizing the custom circuits and custom chips of the conventional art as shown in fig1 and fig2 , this invention can also be applied to software image encoders and software image decoders utilizing general - purpose processors . a software image encoder 600 and a software image decoder 700 are shown in fig6 and fig7 . in the software image encoder 600 , an input image 601 is first stored in the input frame memory 602 and the general - purpose processor 603 loads information from here and performs encoding . the program for driving this general - purpose processor is loaded from a storage device 608 which can be a hard disk , floppy disk , etc . and stored in a program memory 604 . this general purpose processor also uses a process memory 605 to perform the encoding . the encoding information output by the general - purpose processor is temporarily stored in the output buffer 606 and then output as an encoded bit stream 607 . a flowchart for the encoding software ( recording medium readable by computer ) is shown in fig8 . the process starts in 801 , and the value 0 is assigned to variable n in 802 . next , in 803 and 804 , the value 0 is assigned to n when the value for n is 100 . n is a counter for the number of frames . 1 is added for each one frame whose processing is complete , and values from 0 to 99 are allowed when performing coding . when the value for n is 0 , the current frame is an i frame . when n is an odd number , the current frame is a p + frame , and when an even number other than 0 , the current frame is a p − frame . when the upper limit for the value of n is 99 , it means that one i frame is coded after 99 p frames ( p + frames or p − frames ) are coded . by always inserting one i frame in a certain number of coded frames , the following benefits can be obtained : ( a ) error accumulation due to a mismatch between encoder and decoder processing can be prevented ( for instance , a mismatch in the computation of dct ); and ( b ) the processing load for acquiring the reproduced image of the target frame from the coded data ( random access ) is reduced . the optimal n value varies when the encoder performance or the environment where the encoder is used are changed . it does not mean , therefore , that the value of n must always be 100 . the process for determining the rounding method and coding mode for each frame is performed in 805 and the flowchart with details of this operation is shown in fig9 . first of all , whether n is a zero ( 0 ) or not is checked in 901 . if n is 0 , then ‘ i ’ is output as distinction information of the prediction mode , to the output buffer in 902 . this means that the image to be coded is will be coded as an i frame . here , “ output to the output buffer ” means that after being stored in the output buffer , the information is output to an external device as a portion of the coded bit stream . when n is not 0 , then whether n is an odd or even number is identified in 904 . when n is an odd number , ‘+’ is output to the output buffer as the distinction information for the rounding method in 905 , and the image to be coded will be coded as a p + frame . on the other hand , when n is an even number , ‘−’ is output to the output buffer as the distinction information for the rounding method in 906 , and the image to be coded will be coded as a p − frame . the process again returns to fig8 , where after determining the coding mode in 805 , the input image is stored in the frame memory a in 806 . the frame memory a referred to here signifies a portion of the memory zone ( for instance , the memory zone maintained in the memory of 605 in fig6 ) of the software encoder . in 807 , it is checked whether the frame currently being coded is an i frame . when not identified as an i frame , motion estimation and motion compensation is performed in 808 . the flowchart in fig1 shows details of this process performed in 808 . first of all , in 1001 , motion estimation is performed between the images stored in frame memories a and b ( just as written in the final part of this paragraph , the decoded image of the prior frame is stored in frame memory b ). the motion vector for each block is found , and this motion vector is sent to the output buffer . next , in 1002 , whether or not the current frame is a p + frame is checked . when the current frame is a p + frame , the prediction image is synthesized in 1003 utilizing positive rounding and this prediction image is stored in frame memory c . on the other hand , when the current frame is a p − frame , the prediction image is synthesized in 1004 utilizing negative rounding and this prediction image is stored in the frame memory c . next , in 1005 , the differential image between frame memories a and c is found and stored in frame memory a . here , the process again returns to fig8 . prior to starting the processing in 809 , the input image is stored in frame memory a when the current frame is an i frame , and the differential image between the input image and the prediction image is stored in frame memory a when the current frame is a p frame ( p + or p − frame ). in 809 , dct is applied to the image stored in frame memory a , and the dct coefficients calculated here are sent to the output buffer after being quantized . in 810 , inverse quantization is performed to the quantized dct coefficients and inverse dct is applied . the image obtained by applying inverse dct is stored in frame memory b . next in 811 , it is checked again whether the current frame is an i frame . when the current frame is not an i frame , the images stored in frame memory b and c are added and the result is stored in frame memory b . the coding process of a frame ends here , and the image stored in frame memory b before going into 813 is the reconstructed image of this frame ( this image is identical with the one obtained at the decoding side ). in 813 , it is checked whether the frame whose coding has just finished is the final frame in the sequence . if this is true , the coding process ends . if this frame is not the final frame , 1 is added to n in 814 , and the process again returns to 803 and the coding process for the next frame starts . a software decoder 700 is shown in fig7 . after the coded bit stream 701 is temporarily stored in the input buffer 702 , this bit stream is then loaded into the general - purpose processor 703 . the program for driving this general - purpose processor is loaded from a storage device 708 which can be a hard disk , floppy disk , etc . and stored in a program memory 704 . this general - purpose processor also uses a process memory 605 to perform the decoding . the decoded image obtained by the decoding process is temporarily stored in the output frame memory 706 and then sent out as the output image 707 . a flowchart of the decoding software for the software decoder 700 shown in fig7 is shown in fig1 . the process starts in 1101 , and it is checked in 1102 whether input information is present . if there is no input information , the decoding process ends in 1103 . when input information is present , distinction information of the prediction mode is input in 1104 . the word “ input ” used here means that the information stored in the input buffer ( for instance 702 of fig7 ) is loaded by the general - purpose processor . in 1105 , it is checked whether the encoding mode distinction information is “ i ”. when not “ i ”, the distinction information for the rounding method is input and synthesis of the interframe prediction image is performed in 1107 . a flowchart showing details of the operation in 1107 is shown in fig1 . in 1201 , a motion vector is input for each block . then , in 1202 , it is checked whether the distinction information for the rounding method loaded in 1106 is a “+”. when this information is “+”, the frame currently being decoded is a p + frame . in this case , the prediction image is synthesized using positive rounding in 1203 , and the prediction image is stored in frame memory d . here , frame memory d signifies a portion of the memory zone of the software decoder ( for instance , this memory zone is obtained in the processing memory 705 in fig7 ). when the distinction information of the rounding method is not “+”, the current frame being decoded is a p − frame . the prediction image is synthesized using negative rounding in 1204 and this prediction image is stored in frame memory d . at this point , if a p + frame is decoded as a p − frame due to some type of error , or conversely if a p − frame is decoded as a p + frame , the correct prediction image is not synthesized in the decoder and the quality of the decoded image deteriorates . after synthesizing the prediction image , the operation returns to fig1 and the quantized dct coefficients is input in 1108 . inverse quantization and inverse dct is then applied to these coefficients and the resulting image is stored in frame memory e . in 1109 , it is checked again whether the frame currently being decoded is an i frame . if the current frame is not an i frame , images stored in frame memory d and e are added in 1110 and the resulting sum image is stored in frame memory e . the image stored in frame memory e before starting the process in 1111 is the reconstructed image . this image stored in frame memory e is output to the output frame memory ( for instance , 706 in fig7 ) in 1111 , and then output from the decoder as the reconstructed image . the decoding process for a frame is completed here and the process for the next frame starts by returning to 1102 . when a software based on the flowchart shown in fig8 – 12 is run in the software image encoders or decoders , the same effect as when custom circuits and custom chips are utilized are obtained . a storage media ( recording media ) with the bit stream generated by the software encoder 601 of fig6 being recorded is shown in fig1 . it is assumed that the algorithms shown in the flowcharts of fig8 – 10 is used in the software encoder . digital information is recorded concentrically on a recording disk 1301 capable of recording digital information ( for instance magnetic disks , optical disk , etc .). a portion 1302 of the information recorded on this digital disk includes : prediction mode distinction information 1303 , 1305 , 1308 , 1311 , and 1314 ; rounding method distinction information 1306 , 1309 , 1312 , and 1315 ; and motion vector and dct coefficient information 1304 , 1307 , 1310 , 1313 , and 1316 . information representing ‘ i ’ is recorded in 1303 , ‘ p ’ is recorded in 1305 , 1308 , 1311 , and 1314 , ‘+’ is recorded in 1306 , and 1312 , and ‘−’ is recorded in 1309 , and 1315 . in this case , ‘ i ’ and ‘+’ can be represented by a single bit of zero ( 0 ), and ‘ p ’ and ‘−’ can be represented by a single bit of one ( 1 ). using this representation , the decoder can correctly interpret the recorded information and the correct reconstructed image is synthesized . by storing a coded bit stream in a storage media using the method described above , the accumulation of rounding errors is prevented when the bit stream is read and decoded . a storage media with the bit stream of the coded data of the image sequence shown in fig5 being recorded is shown in fig1 . the recorded bit stream includes information related to p +, p −, and b frames . in the same way as in 1301 of fig1 , digital information is recorded concentrically on a record disk 1501 capable for recording digital information ( for instance , magnetic disks , optical disks , etc .). a portion 1502 of the digital information recorded on this digital disk includes : prediction mode distinction information 1503 , 1505 , 1508 , 1510 , and 1513 ; rounding method distinction information 1506 , and 1512 ; and motion vector and dct coefficient information 1504 , 1507 , 1509 , 1511 , and 1514 . information representing ‘ i ’ is recorded in 1503 , ‘ p ’ is recorded in 1505 , and 1510 , ‘ b ’ is recorded in 1508 , and 1513 , ‘+’ is recorded in 1505 , and ‘−’ is recorded in 1511 . in this case , ‘ i ’, ‘ p ’ and ‘ b ’ can be represented respectively by two bit values 00 , 01 , and 10 , and ‘+’ and is ‘−’ can be represented respectively by one bit values 0 and 1 . using this representation , the decoder can correctly interpret the recorded information and the correct reconstructed is synthesized . in fig1 , information related to frame 501 ( i frame ) in fig5 is 1503 and 1504 , information related to 502 ( b frame ) is 1508 and 1509 , information related to frame 503 ( p + frame ) is 1505 and 1507 , information related to frame 504 ( b frame ) is 1513 and 1514 , and information related to frame 505 ( p − frame ) is 1510 and 1512 . when coding image sequences are coded using b frames , the transmission order and display order of frames are usually different . this is because the previous and subsequent reference images need to be coded before the prediction image for the b frame is synthesized . consequently , in spite of the fact that the frame 502 is displayed before frame 503 , information related to frame 503 is transmitted before information related to frame 502 . as described above , there is no need to use multiple rounding methods for b frames since motion compensation in b frames do not cause accumulation of rounding errors . therefore , as shown in this example , information that specifies rounding methods ( e . g . ‘+’ and ‘−’) is not transmitted for b frames . thus for instance , even if only positive rounding is applied to b frames , the problem of accumulated rounding errors does not occur . by storing coded bit streams containing information related to b frames in a storage media in the way described above , the occurrence of accumulated rounding errors can be prevented when this bit stream is read and decoded . specific examples of coders and decoders using the coding method described in this specification is shown in fig1 . the image coding and decoding method can be utilized by installing image coding and decoding software into a computer 1401 . this software is recorded in some kind of storage media ( cd - rom , floppy disk , hard disk , etc .) 1412 , loaded into a computer and then used . additionally , the computer can be used as an image communication terminal by connecting the computer to a communication lines . it is also possible to install the decoding method described in this specification into a player device 1403 that reads and decodes the coded bit stream recorded in a storage media 1402 . in this case , the reconstructed image signal can be displayed on a television monitor 1404 . the device 1403 can be used only for reading the coded bit stream , and in this case , the decoding device can be installed in the television monitor 1404 . it is well known that digital data transmission can be realized using satellites and terrestrial waves . a decoding device can also be installed in a television receiver 1405 capable of receiving such digital transmissions . also , a decoding device can also be installed inside a set top box 1409 connected to a satellite / terrestrial wave antenna , or a cable 1408 of a cable television system , so that the reconstructed images can be displayed on a television monitor 1410 . in this case , the decoding device can be incorporated in the television monitor rather than in the set top box , as in the case of 1404 . the layout of a digital satellite broadcast system is shown in 1413 , 1414 and 1415 . the video information in the coded bit stream is transmitted from a broadcast station 1413 to a communication or broadcast satellite 1414 . the satellite receives this information , sends it to a home 1415 having equipment for receiving satellite broadcast programs , and the video information is reconstructed and displayed in this home using devices such as a television receiver or a set top box . digital image communication using mobile terminals 1406 has recently attracted considerable attention , due to the fact that image communication at very low bit rates has become possible . digital portable terminals can be categorized in the following three types : a transceiver having both an encoder and decoder ; a transmitter having only an encoder ; and a receiver having only a decoder . an encoding device can be installed in a video camera recorder 1407 . the camera can also be used just for capturing the video signal and this signal can be supplied to a custom encoder 1411 . all of the devices or systems shown in this drawing can be equipped with the coding and / or decoding method described in this specification . by using this coding and / or decoding method in these devices or systems , images of higher quality compared with those images obtained using conventional technologies can be obtained . the following variations are clearly included within the scope of this invention . ( i ) a prerequisite of the above described principle was the use of block matching as a motion compensation method . however , this invention is further capable of being applied to all image sequence coding and decoding methods in which motion compensation is performed by taking a value for the vertical and horizontal components of the pixel motion vector that is other than an integer multiple of the sampling period in the vertical and horizontal directions of the pixel , and then finding by interpolation , the intensity value of a position where the sample value is not present . thus for instance , the global motion compensation listed in japanese patent application no . 8 - 60572 published as japanese patent application laid - open no . 9 - 252470 and the warping prediction listed in japanese patent application no . 8 - 249601 published as japanese patent application laid - open no . 10 - 98729 are applicable to the method of this invention . ( ii ) the description of the invention only mentioned the case where a value integral multiple of ½ was taken for the horizontal and vertical components of the motion vector . however , this invention is also generally applicable to methods in which integral multiples of 1 / d ( d is a positive integer and also an even number ) are allowed for the horizontal and vertical components of the motion vector . however , when d becomes large , the divisor for division in bilinear interpolation ( square of “ d ”, see equation 2 ) also becomes large , so that in contrast , the probability of results from normal division reaching a value of 0 . 5 become low . accordingly , when performing only positive rounding , the absolute value of the expectation for rounding errors becomes small and the bad effects caused by accumulated errors become less conspicuous . also applicable to the method of this invention , is a motion compensation method where for instance , the d value is variable , both positive rounding and negative rounding are used when d is smaller than a fixed value , and only positive rounding or only negative rounding is used when the value of d is larger than a fixed value . ( iii ) as mentioned in the “ related art ” section , when dct is utilized as an error coding method , the adverse effects from accumulated rounding errors are prone to appear when the quantized step size of the dct coefficient is large . however a method is also applicable to the invention , in which , when the quantization step size of dct coefficients is larger than a threshold value then both positive rounding and negative rounding are used . when the quantization step size of the dct coefficients is smaller than the threshold value then only positive rounding or only negative rounding is used . ( iv ) in cases where error accumulations occur on the luminance plane and cases where error accumulations occur on the chrominance plane , the bad effects on the reconstructed images are generally more serious in the case of error accumulations on the chrominance plane . this is due to the fact that rather than cases where the image darkens or lightens slightly , cases where overall changes in the image color happen are more conspicuous . however , a method is also applicable to this invention in which both positive rounding and negative rounding are used for the chrominance signal , and only positive rounding or negative rounding is used for the luminance signal . as described in the “ related art ” section , ¼ pixel accuracy motion vectors obtained by halving the ½ pixel accuracy motion vectors are rounded to ½ pixel accuracy in h . 263 . however by adding certain changes to this method , the absolute expectation value for rounding errors can be reduced . in h . 263 that was mentioned in the related art , a value which is half the horizontal or vertical components of the motion vector for the luminance plane is expressed as r + s / 4 ( r is an integer , s is an integer less than 4 and not smaller than 0 ), and when s is 1 or 3 , a rounding operation is performed to obtain a 2 . this operation can be changed as follows : when s is 1 , a rounding operation is performed to obtain a zero “ 0 ”, and when s is 3 a 1 is be added to r to make s a “ 0 ”. by performing these operations , the number of times that the intensity values at positions 406 – 408 in fig4 is definitely reduced ( probability that horizontal and vertical components of motion vector will be an integer become high ) so that the absolute expectation value for the rounding error becomes small . however , even if the size of the error occurring in this method can be limited , the accumulation of errors cannot be completely prevented . ( v ) the invention described in this specification is applicable to a method that obtains the final interframe prediction image by averaging the prediction images obtained by different motion compensation methods . for example , in the method described in japanese patent application no . 8 - 3616 published as japanese patent application laid - open no . 9 - 200763 , interframe prediction images obtained by the following two methods are averaged : block matching in which a motion vector is assigned to each 16 × 16 pixel block ; and block matching in which a motion vector is assigned to each 8 × 8 pixel blocks . in this method , rounding is also performed when calculating the average of the two prediction images . when only positive rounding is continuously performed in this averaging operation , a new type of rounding error accumulates . this problem can be solved by using multiple rounding methods for this averaging operation . in this method , negative rounding is performed in the averaging operation when positive rounding is performed in block matching . conversely , positive rounding is used for the averaging when negative rounding is used for block matching . by using different rounding methods for averaging and block matching , the rounding errors from two different sources is cancelled within the same frame . ( vi ) when utilizing a method that alternately locates p + frames and p − frames along the time axis , the encoder or the decoder needs to determine whether the currently processed p frame is a p + frame or a p − frame . the following is an example of such identification method : a counter counts the number of p frames after the most recently coded or decoded i frame , and the current p frame is a p + frame when the number is odd , and a p − frame when the number is even ( this method is referred to as an implicit scheme ). there is also a method for instance , that writes into the header section of the coded image information , information to identify whether the currently coded p frame at the encoder is a p + frame or a p − frame ( this method is referred to as an explicit scheme ). compared with the implicit method , this method is well able to withstand transmission errors , since there is no need to count the number of p frames . additionally , the explicit method has the following advantages : as described in the “ related art ” section , past encoding standards ( such as mpeg - 1 or mpeg - 2 ) use only positive rounding for motion compensation . this means for instance that the motion estimation / motion compensation devices ( for example equivalent to 106 in fig1 ) for mpeg - 1 / mpeg - 2 on the market are not compatible with coding methods that use both p + frames and p − frames . it is assumed that there is a decoder which can decode bit streams generated by a coding method that uses p + frames and p − frames . in this case if the decoder is based on the above mentioned implicit method , then it will be difficult to develop an encoder that generates bit streams that can be correctly decoded by the above mentioned decoder , using the above mentioned motion estimation / compensation device for mpeg - 1 / mpeg - 2 . however , if the decoder is based on the above mentioned explicit method , this problem can be solved . an encoder using an mfeg - 1 / mpeg - 2 motion estimation / motion compensation device can continuously send p + frames , by continuously writing rounding method distinction information indicating positive rounding into the frame information header . when this is performed , a decoder based on the explicit method can correctly decode the bit stream generated by this encoder . of course , it should be more likely in such case that the accumulation of rounding errors occurs , since only p + frames are present . however , error accumulation is not a serious problem in cases where the encoder uses only small values as the quantization step size for the dct coefficients ( an example for such coders is a custom encoder used only for high rate coding ). in addition to this interoperability between past standards , the explicit method further have the following advantages : ( a ) the equipment cost for high rate custom encoders and coders not prone to rounding error accumulation due to frequent insertion of i frames can be reduced by installing only positive or negative rounding as the pixel value rounding method for motion compensation ; and ( b ) the above encoders not prone to rounding error accumulation have the advantage in that there is no need to decide whether to code the current frame as a p + or p − frame , and the processing is simplified . ( vii ) the invention described in this specification is applicable to coding and decoding methods that applies filtering accompanying rounding to the interframe prediction images . for instance , in the international standard h . 261 for image sequence coding , a low - pass filter ( called a “ loop filter ”) is applied to block signals whose motion vectors are not zero ( 0 ) in interframe prediction images . also , in h . 263 , filters can be used to smooth out discontinuities on block boundaries ( blocking artifacts ). all of these filters perform weighted averaging to pixel intensity values and rounding is then performed on the averaged intensity values . even for these cases , selective use of positive rounding and negative rounding is effective for preventing error accumulation . ( viii ) besides i p + p − p + p − . . . , various methods for mixing p + frames and p − frames such as i p + p + p − p − p + p + . . . , or i p + p − p − p + p + . . . are applicable to the method of this invention . for instance , using a random number generator that outputs 0 and 1 both at a probability of 50 percent , the encoder can code a p + and p − frame when the output is 0 and 1 , respectively . in any case , the less the difference in probability that p + frames and p − frames occur in a certain period of time , the less the rounding error accumulation is prone to occur . further , when the encoder , is allowed to mix p + frames and p − frames by an arbitrary method , the encoder and decoder must operate based on the explicit method and not with the implicit method described above . accordingly , the explicit method is superior when viewed from the perspective of allowing flexibility configuration for the encoder and decoder . ( ix ) the invention described in this specification does not limit the pixel value interpolation method to bilinear interpolation . interpolation methods for intensity values can generally be described by the following equation : r ⁡ ( x + r , y + s ) = t ⁡ ( ∑ j = - x x ⁢ ∑ j = - x x ⁢ h ⁡ ( r - j , s - k ) ⁢ r ⁡ ( x + j , y + k ) ) ( 5 ) where , r and s are real numbers , h ( r , s ) is a function for interpolating the real numbers , and t ( z ) is a function for rounding the real number z . the definitions of r ( x , y ), x , and y are the same as in equation 4 . motion compensation utilizing positive rounding is performed when t ( z ) is a function representing positive rounding , and motion compensation utilizing negative rounding is performed when the function representing negative rounding . this invention is applicable to interpolation methods that can be described using equation 5 . for instance , bilinear interpolation can be described by defining h ( r , s ) as shown below . h ( r , s )=( 1 −\| r \|)( 1 −\| s \|), 0 ≦\| r \|≦ 1 , 0 ≦\| s \|≦ 1 , ( 6 ) h ( r , s )= 1 −\| r \|−\| s \|, 0 ≦\| r \|+\| s \|≦ 1 , rs & lt ; 0 , then an interpolation method different from bilinear interpolation is implemented but the invention is still applicable . ( x ) the invention described in this specification does not limit the coding method for error images to dct ( discrete cosine transform ). for instance , wavelet transform ( for example , n . antonioni , et . al , “ image coding using wavelet transform ” ieee trans . image processing , vol . 1 , no . 2 , april 1992 ) and walsh - hadamard transform ( for example , a . n . netravalli and b . g . haskell , “ digital pictures ”, plenum press , 1998 ) are also applicable to this invention .	6
a purchase assistance system 450 between one or more merchants 310 of products or services selling , among other things , small - value items , and one or more charge card account issuance systems 120 is provided as shown in fig6 . the overall system may include a merchant domain 30 , an interchange domain 20 , and an issuer domain 10 . card payments made at a merchant 310 are authorized via a typical protocol 45 between an acquirer 35 and an issuer 15 via an interchange network 25 . the protocol may be iso 8583 that is independent of the presence or the absence of purchase assistance system 450 since the purchase assistance system 450 does not require the protocols of the typical charge card system to be altered in order to be used with the purchase assistance system . the purchases assistance ( pa ) system 450 may include a merchant purchase assistant unit 350 associated with each merchant 310 and an issuer purchase assistant unit 150 associated with each issuer 130 wherein the units 350 , 150 each have a plurality of lines of computer code , executed by a computing device associated with the merchant and issuer , respectively , that perform the functions and operations of each of these units as described in more detail below . the merchant purchase unit 350 links the merchant to the same issuer 15 , but through a data exchange helper protocol 250 running in parallel with protocol 45 , between merchant purchase unit 350 and the issuer purchase unit 150 . the data exchange helper protocol 250 does not carry payment authorization transactions , which are solely conducted via protocol 45 , such as iso 8583 . instead , data exchange helper protocol 250 handles a series of optional assistance features related to the purchases of goods or services including digital goods . thus , the dedicated data exchange helper protocol 250 allows the merchant purchase assistant 350 and the issuer purchase assistant unit 150 to communicate with each other either in batch mode at regular intervals or in real - time asynchronous mode . the data exchange helper protocol 250 never carries payment authorizations . with reference to table 1 , the data exchange helper protocol 250 can carry a combination of one or more of the following : card holder identification data elements ; purchase transaction data elements ; reward program transaction data elements ; card balance and reservation request data ; administrative commands ; card identification data elements ; and / or card - holder authentication request commands . the card - holder identification data elements allow the issuance system 120 to determine which card - holder is carrying out purchase transactions that may require assistance through the purchase assistance system 450 . the purchase transaction data elements including product genre or product identification such as , by way of example , title , track name , level name , chapter name , etc . that can be further used by the issuer to identify unambiguously digital purchases that may be at fault during a failed fulfillment or erroneous charge , or to warehouse for later commercial analysis , if the merchant agrees to such exploitation of these data elements , for example in exchange for a discount on the interchange rate . the reward program transaction data elements allow , by way of example , a particular transaction to be rewarded with a number of loyalty points different from what the default rules for the loyalty program would otherwise allocate . the data elements representing the card balance and reservation - request amount allow the merchant 310 to verify the amount of funds available from a card - holder and to request that a portion of such amount be reserved for its use , prior to the merchant attempting to aggregate transactions for fee optimization purposes . the various administrative commands allow the merchant purchase unit 350 and the issuer purchase unit 150 to inform each other of various operational states , enter into specific modes of operations and otherwise stay synchronized . the card identification data elements allow a merchant 310 to provision in its online wallet system those cards that can subsequently benefit from the purchase assistance because they are issued by an issuer equipped with issuer purchase assistance 150 . such feature can be found , by way of example , in the typical amazon . com system where visa amazon cards get provisioned automatically inside the amazon storefront &# 39 ; s wallets once issued . the card - holder authentication request commands allow the merchant 310 to delegate to the issuance system 120 the online authentication of the card - holders and thus reduce the risk of later transaction repudiation by such card - holders . such feature can be found , by way of example , in the typical verified - by - visa and mastercard securecode systems . the assistance features provided by the pa system 450 is described with reference to fig7 which depicts schematically the internal modules of the issuer purchase unit 150 (“ ipa ”). the unit 150 may include a data exchange helper protocol handler 151 that receives and sends information from and to the data exchange helper protocol 250 , parses , dispatches and receives relevant data to and from the other modules of the issuer pa . a module 152 is a data repository that stores the details of purchase transactions sent by the merchant 310 . a module 153 handles the real - time verification of accounts balances and the reservation of funds in such accounts by communicating with a card processing platform 140 shown in fig6 . a module 154 also communicates with the card processing platform 140 and handles the provisioning of new or updated card account information back to merchant 310 . a module 155 is in charge of resolving different user - identification syntax conventions used respectively by merchant 310 and the card processing platform 140 , so that each party can keep using its own proprietary name space while enabling the issuer pa to unambiguously handle individual users . by way of example , the issuer system 130 can identify its cardholders with payment application user identifiers data elements or “ pa_id &# 39 ; s ”, managed by the module 155 . a module 156 handles the management of reward events requested by merchant 310 and destined to card processing platform 140 . a module 157 handles the synchronization of the reporting of purchase transactions coming from the merchant 310 with the reporting of transactions handled by card processing platform 140 . a module 158 passes relevant data elements about purchase transactions to a customer relation management system , in particular to assist with possible disputes on such transactions . a module 159 handles user online authentication request from the merchant 310 wishing to delegate such authentication to the issuer . in an exemplary implementation , each module described above may be implemented as one or more lines of computer code on a computing device of the merchant that implement the functions and operations of the module as described herein . symmetrically , fig8 depicts the internal modules of merchant purchase unit 350 (“ mpa ”). in an exemplary implementation , each module described above may be implemented as one or more lines of computer code on a computing device of the merchant that implement the functions and operations of the module as described herein . a data exchange helper protocol handler 351 sends and receives information to and from the data exchange helper protocol 250 , collects , parses and dispatches relevant data elements from and to the other modules of the merchant purchase . a module 353 receives requests for the real - time verification of accounts balances and the reservation of funds in such accounts from merchant storefront 311 . a module 354 also communicates with merchant storefront 311 , and handles the provisioning of new or updated card account information received from the issuer . a module 355 is in charge of resolving different naming convention used respectively by merchant 310 and the card processing platform 140 , so that each party can keep using its own proprietary name space while enabling the merchant purchase unit to unambiguously handle individual users . by way of example , merchant 310 can identify its customers with its own merchant application user identifiers data elements or “ ma_id &# 39 ; s ” managed by the module 355 . a module 356 handles the management of reward events requested by storefront 311 and destined to card processing platform 140 . a module 357 provides the details of purchase transactions coming from the merchant storefront 311 and destined to issuer pa 150 . a module 359 handles user online authentication requests from the merchant storefront 311 and delegates such authentication to the issuer via data exchange helper protocol 250 and the issuer pa 150 . with reference to fig9 , in one embodiment of the system , the merchant purchase unit 350 and the issuer pa 150 can operate only in batch mode , i . e . at regular intervals agreed upon between the merchant 310 and the issuer system 130 , for example every 24 hours at the end of the business day . in such an implementation , modules 353 and 153 for handling balance inquiry and reservation of funds , and modules 159 and 359 for handling delegated user authentication , are not present because a merchant 310 cannot request the issuer 130 to authenticate a cardholder on its behalf nor to verify a card balance and reserve funds . the provisioning of new cards into the merchant &# 39 ; s wallet system through modules 154 , 155 , 354 and 355 is done synchronously at agreed upon intervals , with the consequence that a new card issued to a new consumer will not appear inside the merchant &# 39 ; s system until for example the next business day . the delivery of transactions details and special rewards requests is also done synchronously at agreed upon intervals , with the consequence that purchase details and associated loyalty rewards will not appear inside the cardholder &# 39 ; s account until for example the next business day . while such batch - mode implementation has the limitations described above , it has the benefit of being easier to deploy for merchants , as it places no real - time constraints on the merchants &# 39 ; systems . alternatively , in another embodiment of the system shown in fig1 , the merchant purchase unit 350 and the issuer pa 150 can operate in real - time , i . e . whenever the need arises for the merchant and the issuer to communicate . in such an implementation , all modules can be present as needed . in particular , the merchant 310 can request the issuer 130 to authenticate a cardholder on its behalf and to verify a card balance and reserve funds before attempting an aggregation of subsequent transactions . a first assistance function of the purchase assistance system is to enable merchants 310 to obtain better customer support from the issuer 130 for purchases of goods carried out by cardholders at the merchant &# 39 ; s online storefront . since disputes relative to purchases of digital goods often arise out of a delivery failure of such goods rather than a faulty payment transaction , it is beneficial for the issuer 130 who is likely to be the first responder to cardholder inquiries about disputable transactions , to have the details of which exact digital product was purchased by whom , instead of just knowing the monetary amounts spent by cardholders for what may amount to a succession of separate downloads of digital content all aggregated into in financial transaction . using the purchase assistant and in particular modules 152 , 155 and 157 inside the issuer pa 150 and modules 355 and 357 inside the merchant purchase unit 350 , the merchant 310 can send to issuer 130 the detailed data elements representing previous transactions relative to purchase by the multiplicity of holders of cards issued by issuer 130 . this is illustrated in the flowchart of fig1 . such sending of transactions details need not be done in real - time , and can be carried out at agreed upon intervals between the merchant and the issuer . a second function of the purchase assistance system is to enable merchants 310 to obtain cheaper merchant fees for purchases of low - priced goods carried out by cardholders at the merchant &# 39 ; s online storefront . one way of achieving lower fees is for issuer 130 to refund part or all of its share of the interchange fees to merchants 310 in exchange for obtaining from merchants 310 data elements detailing which products were purchased by whom . product details relative to goods typically yield interesting personality traits information such as behavior , lifestyle and areas of interest about their purchasers . such personality traits information can subsequently be used by issuer 130 in an anonymous manner to create cardholder profiles and categories and assist other merchants than merchants 310 to create product offers to cardholders as a function of their profile . since such assistance to other merchants can be monetized by issuer 130 , it can afford to give up part or all of the interchange fees received from merchants 310 . using the purchase assistant and in particular modules 152 , 155 and 157 inside the issuer pa 150 and modules 355 and 357 inside the merchant purchase unit 350 , the merchant 310 can send to issuer 130 the details of previous transactions relative to purchase by the multiplicity of holders of cards issued by issuer 130 . this is illustrated in the flowchart of fig1 . such sending of transactions details need not be done in real - time , and can be carried out at agreed upon intervals between the merchant and the issuer . a third function of the purchase assistance system is to enable merchants 310 to reduce the financial risk of aggregating small transactions before requesting an amalgamated payment authorization through the card interchange networks of the background art , in particular when the card presented by a purchaser is a debit card rather than a credit card . using the purchase assistant and in particular modules 153 and 155 inside the issuer pa 150 and modules 353 and 355 inside the merchant purchase unit 350 , the merchant 310 can send to issuer 130 a request to obtain the current remaining balance in the payment card of a particular named user for whom merchant 310 would like to start an aggregation cycle . merchant 310 can also optionally request that a certain amount of funds inside the user &# 39 ; s card balance be pre - reserved for its use during a certain period of time . this is illustrated in the flowchart of fig1 . such balance checks and funds reservation requests need to be done in real - time . a fourth function of the purchase assistance system is to enable merchants 310 to grant special awards to purchasers for certain transactions , where the special awards supersede the default rules that the loyalty program may otherwise allocate . by way of example , the purchase of a given item during a certain period of time may be awarded double the number of loyalty points than usual . using the purchase assistant and in particular modules 155 and 156 inside the issuer pa 150 and modules 355 and 356 inside the merchant purchase unit 350 , the merchant 310 can send to issuer 130 a request to grant a number of loyalty points to a particular named user and for a particular transaction for which merchant 310 would like to provide an exceptional reward . this is illustrated in the flowchart of fig1 . such sending of loyalty points grant requests need not be done in real - time , and can be carried out at agreed upon intervals between the merchant and the issuer . a fifth function of the purchase assistance system ( that may also be provided by typical systems ), is to enable merchants 310 to collaborate more efficiently with the issuer 130 to issue co - branded payment cards , which are cards bearing some distinctive logo or graphics of merchant 310 and carrying some cardholder benefits when used for purchases at such merchant , such as , by way of example , the earning of loyalty points which can be later redeemed against free or discounted goods or services . to make such co - branded cards easier to select and to use when cardholders visit the merchant &# 39 ; s online store , it is customary in the background art for merchants to implement a wallet system , which is a secure repository of the cardholder &# 39 ; s card details , avoiding the need for the cardholder to repeatedly input its card details before a purchase . while populating such merchant wallet system with the details of a new card can always be done manually by the cardholder during his or her first visit to the online store of the merchant , it would be advantageous to enable the automatic provisioning of co - branded cards into the wallet system as soon as the issuer has validly issued such a card to a cardholder . using the purchase assistant and in particular module 154 inside the issuer pa 150 and module 354 inside the merchant purchase unit 350 , the issuer 130 can send to merchant 310 the required cardholder and card details information via the data exchange helper protocol 250 if the merchant is suitably equipped with a wallet system . this is illustrated in the flowchart of fig1 . such sending of card provisioning requests need not be done in real - time , and can be carried out at agreed upon intervals between the merchant and the issuer . a sixth function of the purchase assistance system ( that may also be provided by typical systems ) is to enable merchants 310 to reduce the risk of transactions repudiations by delegating back to the issuer 130 the task of authenticating online users . using the purchase assistant and in particular modules 155 and 159 inside the issuer pa 150 and modules 355 and 359 inside the merchant purchase unit 350 , the merchant 310 can send to issuer 130 a request to authenticate a particular named user with whom the merchant 310 is about to carry out a transaction . this is illustrated in the flowchart of fig1 . such delegated user authentication needs to be done in real - time . while the foregoing has been with reference to particular embodiments of the system and method , it will be appreciated by those skilled in the art that changes in this embodiment may be made without departing from the principles and spirit of the system and method , the scope of which is defined by the appended claims .	6
the sorting unit shown in fig1 is particularly suited to perform the sorting of vegetables such as carrots as a function of predefined selection criteria linked to the diameter , the length , the colour , the curvature , etc . . . of these vegetables . a first station comprising a feeding device 1 suitable for arranging a shipment of the carrots delivered in bulk in parallel rows and a distribution device 2 designed in particular to remove the carrots having diameters smaller and larger , respectively , than given sizes and to deliver the carrots not removed at right angles to two unloading zones : a second station comprising two parallel secondary feeding and distribution assemblies extending at right angles with respect to the distribution device 2 of the first station and each comprising a loading section situated plumb with the distribution device , the secondary assemblies being suited to feed simultaneously twelve transport lines and each comprising successively : a conveyor belt 3 , 4 equipped with an initial loading section arranged plumb with an unloading zone of the distribution device 2 of the first station , a grid conveyor 5 , 6 suitable for the removal of pieces of carrot , a feeding device 7 , 8 suitable for re - arranging the carrots in parallel rows , and a distribution device 9 , 10 designed to make possible the simultaneous unloading of six rows of carrots plumb with six parallel transport lines , the distribution devices being arranged so that their unloading zones are longitudinally displaced so as to feed twelve transport lines , a third station comprising transfer machinery 11 equipped with initial loading sections situated respectively plumb with the distribution devices 9 , 10 of the second station and a grading device 12 with twelve transport lines equipped with means for optical analysis 13 of any known type such as camera , . . . , and conveyor belts such as 14 , 15 for removal of the graded produce . in addition , this sorting unit comprises in the standard manner means for waste disposal able to deliver the waste towards a waste collector 16 and comprising principally : a waste disposal belt 17 arranged plumb with the feeding device 1 of the first station , arranged to make it possible to carry away the produce retrieved manually , three waste disposal belts 18 - 20 arranged plumb with the distribution device 2 of the first station , a waste disposal belt 21 situated plumb with the grid conveyors 5 , 6 and a waste disposal belt 22 situated plumb with the end of the grading device 12 . in the first place , the respective feeding devices 1 , 7 , 8 of the first and second stations are of identical design and comprise a conveyor 23 extending in an upwardly inclined slope at an angle between approximately fifteen and twenty five degrees . this conveyor 23 comprises a number of transverse rollers like 24 mounted in free rotation around transverse axes such as 25 each borne , towards their ends , by two longitudinal endless chains such as 26 driven synchronously , the rollers being spaced so that two successive rollers define a space suitable for accommodating a row of carrots . each of the rollers 24 comprises in addition near one of its ends two separated , toothed wheels 27 , 28 between which are accommodated lateral guidance organs fixed such as 29 suitable for maintaining the toothed wheels along a straight trajectory . it should be noted that the only reason for the interior toothed wheel 28 is to define a groove with the end of the rollers in which is accommodated a return cover designed to avoid the carrots getting stuck laterally . moreover , starting from its low end at which produce is fed in , the conveyor 23 comprises longitudinally three separate sections : a first lower longitudinal section 23a comprising machinery for rotating the rollers 24 in the same direction of rotation as the forward direction of the conveyor 23 . this machinery for rotation comprises a fixed longitudinal chain 30 arranged to mesh with one of the toothed wheels 27 of the rollers 24 . this fixed chain 30 comprises in addition an initial section 30a extending in a slope substantially greater than that of the conveyor 23 so as to progressively &# 34 ; get a grip &# 34 ; on the toothed wheels 27 , a second intermediate longitudinal section 23b with inversion of the direction of rotation of the rollers 24 , including a friction wheel 31 arranged so as to have a tangential contact with the lower generator for the rollers , the friction wheel being borne by a transverse axis mounted on a bearing / and made to rotate with a direction of rotation opposite to that of the conveyor 23 , a third longitudinal section 23c comprising machinery for rotating the rollers 24 with a direction of rotation opposite to that of the conveyor 23 , adapted also to cause the friction wheel 31 to rotate . this machinery of rotation comprises a longitudinal endless chain 33 , adapted to mesh with the toothed wheel 27 of the rollers 24 . this chain 33 comprises in addition an initial section 33a having an inclination substantially greater than that of the conveyor 23 . furthermore , this chain 33 is driven at a speed slightly higher than that of the forward movement of the conveyor 23 . as indicated above such a conveyor 23 makes it possible to arrange the produce between the rollers 24 such that these latter are aligned one after the other in parallel rows . in the second place , the respective distribution devices 2 , 9 , 10 of the first and second stations are similar in principle , the difference between the distribution devices lying in the distribution of the unloading zones of these latter . all these distribution devices comprise a conveyor 34 possessing an inclined loading zone 34a arranged to be plumb with the corresponding feeding devices 1 , 7 , 8 and a horizontal distribution zone 34b . this conveyor 34 comprises several inclined transverse flaps 35 , 36 , 37 , 38 , 39 , 40 able to swivel around transverse axes each borne near their ends by two longitudinal endless chains such as 137 driven synchronously , the flaps being arranged so that two sucessive flaps define between them a groove of width varying as a function of their respective inclination . each of these flaps 35 - 40 is constituted transversally of a v - shaped profile 41 opening in the direction of the axis of rotation , closed off at its base by a hollow tube 42 of diameter greater than the length of the base . this hollow tube 42 accommodates in addition at each of its ends a cap ( not shown ) able to swivel relative to the swivel axis . furthermore , this hollow tube 42 comprises a longitudinal spur 42a arranged so as to protrude with respect to the upper face of the profile 41 and adapted to prevent the produce from &# 34 ; jumping &# 34 ; between two rows of flaps 35 - 40 during the feeding of the distribution device 2 , 9 , 10 . these distribution devices comprise in addition machinery for tilting the flaps 35 - 40 adapted , on the one hand , to arrange them at an inclination defining a groove of minimal width at right angles to the loading zone 34a of the conveyor 34 and , on the other hand , to cause the tilting of the flaps at right angles to the unloading zones . this machinery for tilting comprises in the first instance , two castors for each flap 35 - 40 such as 43a , 43b , 44a , 44b , 45a , 45b , 46a , 46b , 47a , 47b , 48a , 48b with horizontal axes of rotation parallel to the swivel axis , displaced laterally with respect to the flaps by a defined distance variable from one flap to another as explained below . for this purpose each of these castors 43 - 48 is borne by an axis extending transversally in the prolongation of the lower end of the profile 41 of the flaps 35 - 40 . the tilting machinery comprises , in addition , horizontal longitudinal tracks 49 - 53 arranged to constitute rolling surfaces for the castors 43 - 48 , each of the tracks being equipped with zones of interruption of the rolling surface suitable for leading to a tilting of the flaps 35 - 40 . as shown in the fig7 and 8 , the distribution devices 2 , 9 , 10 comprise successively identical series of six flaps 35 - 40 , the flaps of each of these series differing from one another by the arrangement of the castors 43 - 48 associated with these latter . thus each of these series comprises three first flaps 35 - 37 equipped at one of their ends with castors 43a , 44a , 45a displaced laterally with respect to each other , and at their other end with three castors 43b , 44b , 45b aligned longitudinally and separated by a distance &# 34 ; a &# 34 ; from the end of flap . each series of flaps comprises in addition three other flaps 38 - 40 , equipped at one of their ends with three castors 46a , 47a , 48a aligned longitudinally and separated by a distance &# 34 ; b &# 34 ; greater than &# 34 ; a &# 34 ; from the end of the flap and at their other end with three castors 46b , 47b , 48b displaced laterally with respect to each other . furthermore , as shown in fig7 the tracks of the distribution device 2 of the first station are three in number displaced vertically : a first upper track 49 extending at the loading zone 34a and discontinued plumb with the removal belt 18 adapted to cause a tilting of all of the flaps 35 - 40 making it possible to remove all the produce having a diameter smaller than a given size , a second intermediate track 50 equipped with narrowings interrupting the rolling surface suitable for causing the tilting of three flaps 35 - 37 at right angles to a conveyor belt 3 and simultaneously the tilting of three other flaps 38 - 40 at right angles to the other conveyor belt 4 , a third lower track 51 discontinued plumb with the removal belt 19 , adapted to cause a total tilting of all of the flaps 35 - 40 . as an example , the tilting machinery for this first distribution device 2 makes it possible to remove the carrots having a diameter less than 22 mm or greater than 45 mm . as shown in fig8 the distribution devices 9 , 10 comprise an upper track 52 equipped with narrowings interrupting the rolling surface of the castors 43 - 48 suitable for causing the simultaneous tilting of six flaps 35 - 40 at right angles to six transport lines and a lower track 53 suitable for preventing inopportune rebounds of the flaps . finally , the distribution devices 9 , 10 comprise a brush roller 54 , shown in fig2 interposed between the loading zone 34a of the conveyor 34 and the upper end of the feeding devices 1 , 7 and 8 and made to rotate synchronously with the endless chains 137 , in a direction of rotation opposite to the forward direction of the conveyor 34 . the purpose of such a brush roller 54 is to prevent rebounds of the produce and to ensure perfect synchronization . the transfer machinery comprises twelve transport lines such as 55 , 56 each arranged to receive a row of produce distributed by the devices 9 , 10 . in addition , six of these transport lines such as 55 have an initial section 55a adapted to be plumb with the distribution device 9 , whereas the six other transport lines such as 56 are interrupted at right angles to the other distribution device 10 . each of these transport lines 55 , 56 comprises two parallel conveyor belts 57 , 58 driven synchronously , arranged relative to each other so as to define transversally a v - shaped groove able to accommodate and transport the produce . the machinery for driving these transport lines 55 , 56 comprises a geared motor 59 and a transmission system including a bevel gear 60 and a chain 61 / toothed wheel 62 mechanical transmission ( for the purposes of simplification the transmission system of a single transport line 56 has been shown in fig1 ). furthermore , the two conveyor belts 57 , 58 of each transport line 55 , 56 are coupled by means of bevel gears 63 . in addition , the initial section 55a of the transport lines 55 is connected to the principal section of these latter by a transmission of the toothed wheel type 64 / synchronous belt 65 type suitable for conferring the same forward speed to the sections . the transfer machinery comprises , finally , for each transport line 55 , 56 a terminal section such as 55b linking with the grading device / connected to the principal section of the transport lines 55 , 56 by a reduction transmission of the pulley 66 / tension 67 type suitable for conferring to the terminal section a forward speed greater than that of the principal section and equal to that of the grading device 12 . as represented in fig1 , such a terminal section 55b makes it possible to accelerate the displacement of the produce , thus causing a more marked separation of these latter which facilitates their optical analysis . finally , the grading device 12 comprises a conveyor also comprising twelve transport lines driven synchronously , each arranged as an extension of a transport line 55 , 56 of the transfer machinery . this conveyor comprises six endless chains such as 68 driven synchonously , each arranged to run between two friction pads 69 , 70 accommodated in facing grooves arranged in two profiles , upper 71 and lower 72 . as represented in fig1 , each of these chains 68 bears two series of supports such as 73 arranged on opposite sides of the chain on each of which are attached two transverse conveyor pins such as 74 , 75 equipped with a locking mechanism capable of maintaining them in a conveyance position in which each item of produce is borne by a given number of pins depending on the length of the produce . furthermore , the upper profile 72 includes a cap 76 arranged to make a tangent with the upper face of the supports 73 so as to prevent these latter from tilting transversally with respect to the profile . in the first instance , each conveyor pin 74 , 75 has a concave longitudinal shape and an inverted t - shaped cross - section . such a cross - section combined with the mode of distribution of the conveyor pins 74 , 75 enables the surface of the produce to be masked as little as possible so as to provide an optimal view of the produce . furthermore , each of these conveyor pins is extended on the support 73 side by a body 77 arranged to be accommodated in a transversal groove 73a arranged in the support . this body 77 contains in the first instance an oblong aperture with a vertical main axis accommodating an articulation axis 78 integral to the support 73 suitable for giving rise to a clearance of the conveyor pins 74 , 75 in a vertical direction . furthermore , this body 77 includes transversally a quadrant - shaped lower frontal face 79 at the bottom of which is provided a lower slot 80 suitable for accommodating , in the convoyer position , a spur 81 forming an integral part of the support 73 . the body 77 of the conveyor pins 74 , 75 includes moreover an ejector lug 82 projecting downwards from the said body and arranged opposite to the lower face 79 with respect to the slot 80 . each body 77 of the conveyor pins 74 , 75 includes finally a buffer 83 made of a compressible material accommodated in a transverse aperture arranged to emerge in the lower part of the oblong hole and adapted to serve as elastic means able to keep locked the conveyor pins and to prevent an accidental unlocking not due to mechanical causes . the grading device 12 also comprises triggering machinery arranged plumb with the belts 14 , 15 for the removal of the produce adapted to cause the selective tilting of a given number of conveyor pins 74 , 75 for the purpose of unloading the produce borne by these latter onto the removal belts . this triggering mechanism comprises a raised cam 84 borne by an electromagnet 85 suitable for causing it to rotate around a longitudinal axis between two positions : an active position ( shown at the left of fig1 ) where this cam 84 is located on the trajectory of the lugs 82 of the conveyor pins 74 , 75 and which , due to its profile , causes an upward displacement of the lugs and an initial tilting of the pins , and a passive position where this cam 84 allows the lugs 82 to pass . the grading device 12 includes , moreover , final triggering machinery adapted to cause the tilting of all of the conveyor pins 74 , 75 at right angles to the removal belt 22 . as shown in fig1 , this triggering mechanism comprises a ramp 86 arranged to be located on the trajectory of the lugs 82 of the conveyor pins 74 , 75 and raised to initiate the tilting of these latter . the grading device 12 finally includes a supporting device 87 placed downstream from the ramp 86 able to cause a tilting of the conveyor pins 74 , 75 towards their locked conveyor position . as shown in fig1 , this supporting device consists of a disk 87 borne by the rotation shaft of the chains 68 , equipped with an edge comprising slots 88 each suitable for accommodating a conveyor pin 74 , 75 and for causing this latter to tilt upwards . although these latter are not described the sorting unit also comprises in a standard manner all of the control and automation devices making it possible to synchronize the various conveyors and to index the position of the produce on the grading device 12 in order to control the triggering of the conveyor pins 74 , 75 plumb with the adequate removal belts 14 , 15 .	8
the present invention will be described with reference to the drawing figures wherein like numerals represent like elements throughout . hereafter , the terminology “ wtru ” includes but is not limited to a user equipment ( ue ), a mobile station , a fixed or mobile subscriber unit , a pager , or any other type of device capable of operating in a wireless environment . when referred to hereafter , the terminology “ base station ” includes , but is not limited to , a node - b , a site controller , an access point or any other type of interfacing device in a wireless environment . the present invention is applicable to time division duplex ( tdd ), frequency division duplex ( fdd ), and time division synchronous code division multiple access ( tdscdma ), as applied to a universal mobile telecommunications system ( umts ), cdma 2000 and cdma in general , but is envisaged to be applicable to other wireless systems as well . the features of the present invention may be incorporated into an ic or be configured in a circuit comprising a multitude of interconnecting components . fig2 is a block diagram of an apparatus 100 for providing fast detection of a hs - scch in accordance with the present invention . the system includes a plurality of hs - scch decoders 102 , a threshold comparator 104 , and a selector 106 . four ( 4 ) hs - scch decoders are preferably used because a wtru is required to monitor up to four hs - scchs under the current 3 gpp standard . however , it should be understood that any number of hs - scch decoders may be utilized instead of four , and hereinafter the present invention will be described , only as an illustration and not as a limitation , with reference to four ( 4 ) hs - scch decoders . each hs - scch decoder 102 receives messages at the first time slot of a sub - frame of each hs - scch through a respective input 112 . each hs - scch decoder 102 includes a viterbi decoder 305 and a bit error rate ( ber ) calculation unit 310 , which will be described in detail with reference to fig3 below . each hs - scch decoder 102 generates a ber , and optionally , may further generate an accumulated soft metric on the messages received at the first time slot of the hs - scch sub - frame . it should be understood that a ber or an accumulated soft metric are used just as an example of an indicator of a channel quality , and any other parameter that can indicate the degree of correct receipt of a transmitted data without error may be utilized instead of a ber or an accumulated soft metric . each hs - scch decoder 102 receives a designated wtru identity ( id ) which is stored in a memory 108 of the wtru . under the current 3 gpp standard , the first field of the sub - frame of a hs - scch is masked with a wtru id to generate a wtru - specific masking . the wtru id is used in detecting whether the message is directed to a particular wtru . each hs - scch decoder 102 utilizes the wtru id in decoding the message received at the first time slot of the hs - scch . the threshold comparator 104 receives parameters including a ber and / or an accumulated soft metric from each hs - scch decoder 102 and performs a threshold test by comparing the parameters to a predetermined ber threshold and / or a soft metric threshold , respectively , which are stored in a threshold memory 110 . each threshold is a configurable parameter depending on operator &# 39 ; s preference . the threshold comparator 104 then outputs an index indicating a hs - scch having the lowest ber or accumulated soft metric among the hs - scchs having passed the threshold test . the threshold comparator 104 may output one of five possible values including “ na ” indicating that no hs - scch decoder has passed the threshold test . the output of the threshold comparator 104 is based on whether one of the hs - scch decoders 102 has a sufficiently low channel ber , or alternatively low accumulated soft symbol metric , to have high confidence that the hs - scch is addressed to the desired wtru . the selector 106 receives decoder outputs from each hs - scch decoder 102 and selects the decoder output having the lowest ber or accumulated soft metric for further processing . fig3 is a block diagram of the hs - scch decoder 102 used in apparatus 100 in accordance with the present invention . the hs - scch decoder 102 comprises a viterbi decoder 305 and a ber calculation unit 310 . the viterbi decoder 305 is a soft decision decoder which detects originally transmitted bit streams using a viterbi algorithm . the viterbi decoder 305 generates an output sequence which is an estimate of transmit bit streams . the viterbi decoder 305 calculates an accumulated soft metric in each step selecting a surviving path until the last received bit is processed . at the completion of the decoding process , a final accumulated soft metric is determined along with a decoded bit stream . each viterbi decoder 305 outputs a decoded bit stream to the selector 106 , and one of them may be selected by the selector 106 for further processing . the ber calculation unit 310 calculates a ber on the received signal . the ber may be calculated by the ber calculation unit 310 using any conventional method . for example , an additional convolutional encoder may be utilized . the output decoded bit streams generated by one of the viterbi decoders 305 is encoded again and the encoded bit streams are compared with the received bit streams bit by bit for generating bits error count . the received bit streams are stored in a buffer before compared with the re - encoded bit streams . the ber is preferably calculated using the structure of the viterbi decoder 305 . fig4 is an apparatus 400 utilizing a structure of a viterbi decoder in estimating a bit error rate for providing fast detection of a hs - scch in accordance with a preferred embodiment of the present invention . the apparatus 400 receives a signal 405 for processing and forwards the received signal 405 to a modified viterbi decoder 410 , which outputs decoded bits 415 and an encoded bit sequence estimate 420 . a hard - decision unit 425 also receives the signal 405 and outputs a signal 430 to a channel ber estimator 435 which compares the encoded bit sequence estimate 420 with the output signal 430 , and outputs a channel ber estimate 440 . a soft metric accumulator 445 also receives the encoded bit sequence estimate 420 and , in turn , provides an output to a soft - decision unit 450 which outputs accumulated soft metrics 455 . alternatively , the threshold comparator 104 may utilize an accumulated soft metric generated by the viterbi decoder 305 in selecting one of the hs - scch decoder outputs . an accumulated soft metric in the trellis path is calculated in decoding the received bit streams in each viterbi decoder 305 . a final accumulated soft metric is calculated to determine the final surviving path at the completion of decoding process . the accumulated soft metric is input to the threshold comparator 104 to be compared to a soft metric threshold . the threshold comparator 104 outputs an index indicating the hs - scch having the lowest accumulated soft metric among those having passed the threshold test . joint estimation by the viterbi decoder 305 of the accumulated soft metrics and a ber reduces the latency for hs - scch decoding . fig5 is a flow diagram of a process 500 including method steps for implementing fast detection of a hs - scch in accordance with the present invention . in step 502 , a wtru receives downlink control messages at the first time slot of each of four ( 4 ) hs - scchs that the wtru is assigned to monitor . in step 504 , the received messages , which are 40 symbols under the current 3 gpp standard , are decoded by a hs - scch decoder . at the same time , the received bit streams are stored in a memory , and a ber is calculated ( step 506 ). optionally , an accumulated soft metric may be output by the decoder . in step 508 , the ber and / or accumulated soft metric is compared with a predetermined threshold , respectively . if there is any hs - scch having passed the threshold test , the wtru selects one hs - scch having the lowest ber or accumulated soft metric ( step 510 ). in an alternate embodiment , when more than one soft metric exceeds the threshold and are close in value , preference may be given to one of the soft metrics if it had been previously used on the last received message . the wtru then receives downlink messages through a hs - dsch indicated by the hs - scch . with the fast detection algorithm of the present invention , the wtru may avoid unnecessary power consumption for buffering and processing the hs - dsch sub - frame . additionally , the fast detection of a hs - scch allows less stringent timing requirements on the decoding of the hs - dsch . while this invention has been particularly shown and described with reference to preferred embodiments , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention described hereinabove .	7
referring first to fig1 an alarm sensor in accordance with the present invention is generally designated by reference numeral 10 and shown in exploded form . a housing unit comprised of a housing base 12 and a housing cover 14 is shown . within housing base 12 and housing cover 14 is a printed circuit board 16 and a rotatable mounting disc 18 . although shown as coupled to mounting disc 18 , a first mounting pin 20 and a second mounting pin 22 are typically separate from mounting disc 18 and extend outwardly in generally opposite directions . printed circuit board 16 is shown as a pir sensor for illustrative purposes . thus , printed circuit board 16 includes a pir sensor element 24 and a pir lens 26 . also on printed circuit board 16 are terminal strips 28 and 30 . terminal strips 28 and 30 are preferably comprised of “ speaker - jack style ” terminals which simply snap down to secure connecting wires . thus , no terminal screws are necessary . in the instance where alarm sensor 10 is a pir sensor , housing cover 14 can also be split in two components to allow for dual focal lengths for the pir zones . dual focal lengths are often incorporated in pir sensors to eliminate false alarms due to pets . it will be noted by those skilled in the art that the mounting apparatus and method of the present invention can be utilized not only for pir sensors , but also for various security alarm sensors based on microwave technology , ultrasound technology , or any variations thereof . furthermore , the mounting apparatus and method of the present invention is equally applicable to alarm sensors for fire , smoke , temperature , etc . additionally , the mounting apparatus and method of the present invention can be utilized on hardwired or wireless sensors . thus , the actual components shown on printed circuit board 16 are only illustrative ; countless variations are possible . housing base 12 includes corner mount screw hole punch - outs 32 , 34 , 36 and 38 . an installer can selectively utilize screws through corner mount screw holes punch - outs 32 , 34 , 36 and 38 to mount housing base 12 onto corner walls 40 and 42 . similarly , housing base 12 illustrates four flat wall mount screw hole punch - outs 44 , 46 , 48 and 50 . an installer will selectively utilize flat wall mount screw hole punch - outs 44 , 46 , 48 and 50 when the housing base is to be installed onto a flat wall . finally , housing base 12 also includes a swivel mount punch - out 52 that allows installation so that alarm sensor 10 can be made to slightly rotate . while the alternative utilization of corner mount screw hole punch - outs 32 , 34 , 36 and 38 ; flat wall mount screw hole punch - outs 44 , 46 , 48 and 50 ; or swivel mount punch - out 52 allows a by single housing unit to be incorporated in various applications , a screwdriver is required for all installations . particularly when a corner mounting is desired , the use of screws and a screwdriver on a ladder is often burdensome . housing base 12 is adapted to receive rotatable mounting disc 18 , first mounting pin 20 , and second mounting pin 22 . more specifically , housing base 12 includes a first guided groove 54 , a second guided groove 56 , a first guide slot 58 and a second guide slot 60 . as best shown in fig2 first guide slot 58 permits a path upon which first mounting pin 20 can easily travel whereas second guide slot 60 permits a path upon which second mounting pin 22 can easily travel . based on the proper manipulation of rotatable mounting disc 18 by means of a screwdriver slot 62 , first mounting pin 20 can be made to either retract within or extend beyond a first opening 64 on housing base 12 . similarly , second mounting pin 22 can be made to either retract within or extend beyond a second opening 66 on housing base 12 . first opening 64 and second opening 66 are typically on respective planes 65 and 67 of housing base 12 which are contoured at approximately 45 ° angles . this angle permits planes 65 and 67 to rest flatly on corner walls 40 and 42 that generally form a 90 ° angle . this flush alignment is best seen in fig3 . before addressing the interconnection between rotatable mounting disc 18 and housing base 12 , and the manipulation of mounting disc 18 to control the selective movement of first mounting pin 20 and second mounting pin 22 , it should be understood that alarm sensor 10 is typically packaged as a interconnected unit . housing base 12 is snapped together to housing cover 14 with circuit board 16 and mounting disc 18 therein . in order to separate housing base 12 from housing cover 14 , a screwdriver is typically inserted into a slot 68 to release a mounting tab ( not shown ) that holds housing unit 12 and housing base 14 together . at this stage , printed circuit board 16 is coupled to housing base 12 by means of a circuit board height index tab 70 . when slight pressure is applied to circuit board height index tab 70 , circuit is board 16 can be easily removed . circuit board 16 can be wired at this point so that when ultimately replaced within housing base 14 , the wires can be easily displaced through the housing unit by means of a wire entry punch - out 72 . obviously , wireless sensors would not require wire entry punch - out 72 . once housing base 12 and housing cover 14 have been separated and circuit board 16 has been removed , housing base 12 is ready for mounting to walls 40 and 42 . an installer will simply hold housing base 12 at a desired location , insert a screwdriver into screwdriver slot 62 and turn rotatable mounting disc 18 approximately 45 °. the rotational movement of mounting disc 18 will result in first mounting pin 20 and second mounting pin 22 simultaneously moving outwardly so as to sufficiently pierce walls 40 and 42 and secure housing base 12 in place . at this point , printed circuit board 16 would be reconnected to housing base 12 by manipulating circuit board index tab 70 and housing cover 14 would be snapped onto housing base 12 . fig2 - 6 will assist demonstrating precisely how rotational movement of mounting disc 18 results in appropriate linear movement of first mounting pin 20 and second mounting pin 22 to selectively , but securely , attach alarm sensor 10 to corner walls 40 and 42 . as seen in fig2 rotatable mounting disc 18 includes optional directional arrows 74 and 76 to instruct an installer in the direction rotatable mounting disc 18 should be rotated to connect housing base 12 to walls 40 and 42 . fig2 demonstrates the position wherein rotatable mounting disc 18 has already been turned clockwise so that first mounting pin 20 and second mounting pin 22 extend outwardly from housing base 12 . instead of utilizing a screwdriver in screwdriver slot 62 , it may be possible to utilize thumb turns 78 and 80 to rotate mounting disc 18 . in the preferred embodiment of the present invention , a mechanism has been provided to prevent over - rotation of mounting disc 18 which would cause damage to first mounting pin 20 and second mounting pin 22 . referring to fig4 it is shown that rotatable mounting disc 18 includes a first protruding knob 82 and a second protruding knob 84 . first protruding knob 82 travels along first guided groove 54 whereas second protruding knob 84 travels along second guided groove 56 . a first non - protruding engagement end 86 of first mounting pin 20 rests loosely between first protruding knob 82 and a raised portion of mounting disc 18 . similarly , a second non - protruding engagement end 88 of second mounting pin 22 rests loosely between second protruding knob 84 and a raised edge of mounting disc 18 . first non - protruding engagement end 86 and second non - protruding engagement end 88 preferably extend at approximately 90 ° angles respectively from the rest of first mounting pin 20 and second mounting pin 22 . fig4 shows the back of housing base 12 and mounting disc 18 in a position wherein first mounting pin 20 and second mounting pin 22 are retracted within housing base 12 . conversely , fig5 shows the back of housing base 12 and mounting disc 18 in a position wherein first mounting pin 20 and second mounting pin 22 are extended beyond housing base 12 . this difference is caused by an approximately 45 ° turn of mounting disc 18 from the inside of housing base 12 . as shown in fig4 and fig5 mounting disc 18 has been connected to housing base 12 by pressure mounting tabs 90 , 92 , 94 and 96 . while experimentation has shown that mounting disc 18 is most securely attached to housing base 12 by utilizing four pressure mounting tabs , it is also possible to use two pressure mounting tabs . the utilization of pressure mounting tabs is preferred since , should mounting disc 18 break it is easy to attach a new one to the existing housing base without replacing the entire housing unit . however , there are many alternative techniques of connecting mounting disc . 18 to housing base 12 that will become apparent to those skilled in the art . fig6 is a cross - sectional view of fig5 taken along reference line 6 — 6 and effectively shows the different components and shapes of components utilized in the preferred embodiment of the present invention . of significant importance in the preferred embodiment is the fact that not only can housing base 12 be easily installed to corner walls 40 and 42 , but , should the installer have made an error , the device is as easily removable and reinstalled at a new position . the pins are sufficiently narrow so as to cause only negligible damage to any wall . whether rotating mounting disc 18 to either retract or extend first mounting pin 20 and second mounting pin 22 , first guided groove 54 and second guided groove 56 prevent over - rotation of mounting disc 18 in any direction . thus , any potential damage to first mounting pin 20 and second mounting pin 22 is eliminated . although , through experimentation , the rotation of mounting disc 18 has been shown to be the best mode for achieving selective linear movement of first mounting pin 20 and second mounting pin 22 from a first retracted position to a second extended position , the utilization of other means is also foreseen . for instance , the mounting pins can be selectively moved by means of a thumb - controlled , ratcheted device similar to a smaller version of a car jack , by a geared wheel - turn , by a locked collar apparatus , or by other means known in the art for applying sufficient and selective torque to the mounting pins . the various means for achieving selective , linear movement of the mounting pins should be sufficiently small so as not to interfere with the replacement of the printed circuit board on the housing base . it will be apparent from the foregoing description that the present invention provides a new and improved method and apparatus for providing an easy connection of an alarm sensor to the corner of a room with minimal risk to the circuitry and without utilizing of any screws , nails or mounting brackets . while a specific preferred embodiment has been described , many variations may be utilized . for instance , although both first mounting pin 20 and second mounting pin 22 have been shown to incorporate only a single prong , double pronged pins ( similar to staples ) can be incorporated . additionally , first mounting pin 20 and second mounting pin 22 can be threaded pins in certain variations . moreover , while rotatable mounting disc 18 has been shown as being generally circular and of a composite material , it can indeed take various shapes as long as its rotational movement will result in basic linear movement of first mounting pin 20 and second mounting pin 22 . while there has been shown and described what is presently considered to be the preferred embodiment of this invention , it will be obvious to those skilled in the art that various changes and modifications may be made without departing from the broader aspects of this invention . for instance , the preferred embodiment has described a single rotatable mounting disc 18 , which upon proper manipulation , simultaneously moves both first mounting pin 20 and second mounting pin 22 . it is certainly foreseen that separate mounting discs could be utilized for each mounting pin , particularly if the device is wide . moreover , while a particular means for separating the housing base from the housing cover and the printed circuit board from the housing base has been shown , many variations exist in the art . it is , therefore , aimed in the appended claims to cover all such changes and modifications as fall within the true scope and spirit of the invention .	6
the following description of the preferred embodiment is provided to understand the features and the structures of the present invention . please refer to fig1 and fig2 , which are a flow view showing the preferred embodiment according to the present invention ; and a view showing corresponding methods for three intra coding levels . as shown in the figures , the present invention is h . 264 / avc intra coding algorithms for a quality scalability , where , in intra coding of h . 264 / avc , mode decisions are processed to obtain a scaleable picture quality , comprising the following steps : ( a ) when a static coding starts [ 11 ], luma mode decisions [ 12 ] are processed to intra 4 × 4 macroblocks and intra 16 × 16 macroblocks and a chroma mode decision [ 13 ] is processed to chroma macroblocks . all three macroblocks are processed for mode predictions to obtain best predicted modes separately . therein , in the intra coding of h . 264 / avc , near 70 percents (%) of calculation is processed for intra predictor generation and mode decision , which are the most complex parts . hence , the present invention provides three coding levels [ 211 ] for optimizing the mode decision . corresponding intra mode decision algorithms 212 for the three coding levels 211 are as follows : ( i ) level 0 : calculation in the level 0 is the most complex . the algorithms used in this level for intra 4 × 4 macroblocks , intra 16 × 16 macroblocks and chroma macroblocks include full - sa ( full search algorithm ) and normal - sa ( normal search algorithm ), which are conformed to international standards and picture quality is not affected . ( ii ) level 1 : for obtaining best predicted modes in level 1 , a context condition search algorithm ( cc - sa ), a non dc block search algorithm ( ndcb - sa ) and a quarter mb search algorithm ( qmb - sa ) are used for the intra 4 × 4 macroblock , the intra 16 × 16 macroblock and the chroma macroblock , respectively . therein , the cc - sa algorithm and the qmb - sa algorithm save up to 45 % and 75 % of calculation ; and the cc - sa algorithm comprises a condition - correlation search method , a half - full search method and a context - correlation search method for a mode decision . ( iii ) level 2 : level 2 has the least calculation . a probability context condition search algorithm ( pcc - sa ) is processed to further reduce the calculation for the mode decision of the intra 4 × 4 macroblock , wherein the pcc - sa algorithm comprises a condition - correlation search method , a probability - correlation search method and a non context - correlation search method . ( b ) then texture coding is processed to the best luma predicted modes and the best chroma predicted thus , novel h . 264 / avc intra coding algorithms for a quality scalability are obtained . in this way , the present invention provides h . 264 / avc intra coding algorithms for a quality scalability , where intra coding algorithms are selected for mode decisions to be processed with texture coding , and intra coding methods used in the algorithms reduce calculations with picture quality remained . please refer to fig3 to fig6 , which are views showing a condition - correlation search method , a half - full search method , a prediction of the half - full search method , a context - correlation search method , a prediction of the context - correlation search method and a cc - sa search table . as shown in the figures , originally , an intra 4 × 4 macroblock has 9 predicted modes ; then the predicted modes are reduced by referring to existences of the upper and left side blocks to reduce calculations . the search method for obtaining a mode decision according to the existences of the upper and left side blocks is a condition - correlation search method 31 . there are four conditions in the condition - correlation search method 31 for obtaining the mode decision ; and the modes include mode 0 of a vertical mode , mode 1 of a horizontal mode , mode 2 of a decoding ( dc ) mode , mode 3 of a diagonal down - left mode , mode 4 of a diagonal down - right mode , mode 5 of a vertical - right mode , mode 6 of a horizontal - down mode , mode 7 of a vertical - left mode and mode 8 of a horizontal - up mode . when there is a upper block but not an left block , only mode 0 , mode 2 , mode 3 and mode 7 when there is a left block but not an are calculated for a mode decision upper block , only mode 1 , mode 2 and mode 8 are calculated for a mode decision . when there are a left block and an upper block , two methods are used for a mode decision , which are a half - full search method 33 and a context - correlation search method 34 . in predicted modes for an intra 4 × 4 macroblock , the predicted modes have their directions except the dc mode and , so , the dc mode is singled out . and , in a natural picture , neighboring blocks have a very high similarity hence , by using these spatial correlations among blocks , only several possible predicted modes are selected so that calculations are reduced . no mater what predicted modes the neighboring blocks have , dc mode always has the possibility to become a best predicted mode . if there is a dc mode for any neighboring block , any predicted mode is possible to be selected as the best predicted mode and so all modes have to calculated . because the dc mode has no specific direction , it is not predicted with a spatial correlation . to simplify the correlation , full - search predicted modes are replaced with cross - direction predicted modes 33 . the smaller a picture block is , a better predicted mode is obtained by referring to the neighboring blocks owing to the similarity . hence , on obtaining the best predicted mode for the intra 4 × 4 macroblock , not only the original upper and left blocks are selected , but also the predicted modes at the neighboring directions . for example , the context - correlation search method 34 and the predicted mode 34 have mode 6 and mode 7 as the upper predicted mode and the left predicted mode respectively ; and , based on the above description , only mode 3 , mode 7 , mode 0 , mode 4 , mode 6 , mode 1 and mode 2 are selected to be calculated . accordingly , as shown in fig3 , a cc - sa search table is obtained with the condition - correlation search method 31 , the half - full search method 32 and the context - correlation search method 34 . please refer to fig7 to fig1 , which are views showing a condition - correlation search method of a pcc - sa algorithm , a probability - correlation search method , a first and a second predictions of the probability - correlation search method , a non context - correlation search method , a prediction of the non context - correlation search method and a pcc - sa search table . as shown in the figures , a cc - sa algorithm used for an intra 4 ×∝ macroblock requires 4 . 9 predicted modes . to minimize required time for a mode decision of the intra 4 × 4 macroblock , a pcc - sa algorithm is provided to improve efficiency . the pcc - sa algorithm is a refinement to the cc - sa algorithm , where a mode having a higher probability is selected to reduce predict modes to be calculated . therefore , the pcc - sa algorithm only calculates 3 . 84 predicted modes for each block . the condition - correlation search method 51 of the pcc - sa algorithm is basically the same as the condition - correlation search method 31 of the cc - sa algorithm . what differs is the refinement of the probability - correlation search method 52 . in the probability - correlation search method of pcc - sa algorithm , when the predicted modes of the neighboring blocks are dc modes , predicted modes at all directions have to be calculated since direction is unknown . yet , in the probability - correlation search method [ 52 ] of the pcc - sa algorithm , predicted modes are calculated to mode 0 , mode 1 , mode 2 , mode 3 and mode 4 only [ 53 ], which is the same as the half - full search method [ 31 ] ( as shown in fig4 a and fig4 b ). when a neighboring block only has dc mode at a direction , predicted modes are calculated with mode 0 , mode 1 , mode 2 and mode of the neighboring block [ 54 ] . mode 0 at vertical direction and mode 1 at horizontal direction are two major spatial directions and are two modes having the highest probabilities , which are thus included in the predicted modes to be calculated . mode 2 gas no direction and thus is included since no information can be obtained from neighboring blocks . in addition , on obtaining mode decisions for macroblocks , it is known from statistics that the predicted modes of the neighboring blocks have high possibilities to be selected as the best predicted modes . accordingly , the predicted modes of the neighboring blocks become modes to be calculated . when not one of the neighboring block has dc mode as predicted mode , only the predicted modes of the neighboring blocks and the dc mode are calculated for a mode decision . for example , the non context - correlation search method 55 and the predicted mode 56 have mode 6 and mode 7 as the predicted modes of the neighboring blocks at the left and the upper direction , and thus these two modes and dc mode are calculated . accordingly , a pcc - sa search table is obtained with the condition - correlation search method 51 , the probability - correlation search method 52 and the non context - correlation search method 55 . please refer to fig1 and fig1 , which are views showing a luma 16 × 16 macroblock and transformed residues of a 4 × 4 macroblock . as shown in the figures , and ndcb - sa algorithm is used for calculating a cost of a predicted mode for an intra 16 × 16 macroblock . at first , the 16 × 16 macroblock [ 71 ] is divided into 16 4 × 4 sub - macroblocks . a residue for each block in the 4 × 4 sub - macroblock is calculated . after a hadamard transformation , a sum of absolute transformed differences ( satd ) is obtained for each 4 × 4 sub - macroblock . then the satds of the 16 sub - macroblocks are summed to obtain a total satd for the 16 × 16 macroblock [ 71 ], which is also the cost of the 16 × 16 macroblock [ 71 ]. thus , a best predicted mode is obtained . the formulas for the ndcb - sa algorithm are as follows : therein , tr i is the transformed residues [ 72 ]; satd 4 × 4blk is the sum of tr 0 to tr 15 ; and cost i16mb is the sum of 16 satds for the intra 16 × 16 macroblock . please refer to fig1 and fig1 , which are views showing a first color element macroblock and a second color element macroblock . as shown in the figures , chroma macroblocks are divided into first color element macroblocks 81 and second color element macroblocks 82 . each color element macroblock has 4 4 × 4 blocks and 4 predicted modes . in the chroma macroblocks , spatial connections between blocks are not strong ; prediction values for blocks are very close ; and , human eyes are not sensitive to chroma changes . hence , in a qmb - sa algorithm , only the most upper - left blocks are calculated to obtain a mode decision for each color element . then costs for the first color element macroblock 81 and the second color element macroblocks 82 are summed to obtain cost for each predict mode of the chroma macroblocks [ 83 ]. in this way , 75 % of calculations can be reduced . the formulas for the qmb - sa algorithm are as follows : therein , satd 4 × 4blk0 is the sum of satds of the most upper - left block ; and , cost chroma is the sum of costs for the two color elements . thus , three different levels of intra coding are provided . a cc - sa algorithm calculates 4 . 9 modes in a mode decision of block for intra 4 × 4 macroblocks with spatial correlations . according to occurrence rates of predicted modes , a pcc - sa algorithm is obtained with 3 . 84 modes calculated for further simplifying the cc - sa algorithm , which reduces 21 % of calculation . besides intra 4 × 4 macroblock , the present invention also provides proper methods for intra 16 × 16 macroblocks and chroma macroblocks , which are an ndcb - sa algorithm and a qmb - sa algorithm respectively . the present invention provides intra coding algorithms for different applications . the intra coding algorithms in level 0 is used for coding high - quality pictures without any quality loss . for portable products , intra coding algorithms in level 1 and level 2 can be used to save power consumption , which save 38 % and 50 % of total calculations respectively and have only little losses to picture quality . thus , the present invention greatly reduces complexities in calculations and can be practiced in a hardware structure with a different reference table , which is simple and has no big hardware loading . consequently , the present invention is an excellent solution to a quality - scaleable hardware . to sum up , the present invention is h . 264 / avc intra coding algorithms for a quality scalability , where , with intra coding algorithms for different applications , complexities in calculations are greatly reduced and coding efficiencies are improved ; and thus a high efficiency , a high picture quality and a low power consumption are obtained suitable for practicing a low - cost hardware . the preferred embodiment herein disclosed is not intended to unnecessarily limit the scope of the invention . therefore , simple modifications or variations belonging to the equivalent of the scope of the claims and the instructions disclosed herein for a patent are all within the scope of the present invention .	7
in utilization of the above mentioned organic super foods for various food compositions , broken down by element and weight percentage thereof , to form the desired food product are discussed hereof . these organic super foods or nutraceutical compositions have been purposely designed to improve health , prevent chronic diseases , postpone the aging process , increase life expectancy and support functions and integrity of the body . in time , this nutraceutical intervention will control symptoms , treat , prevent and / or reverse different health issues . the various effects of the nutritional food included in the present invention have been grouped into separate health groups as under : hg # 1 : inflammatory ( inflammation , joints , neuropathic pain , respiratory ) hg # 2 : brain health ( general well - being , anxiety , depression , memory , insomnia , stress , alzheimer &# 39 ; s and dementia ) hg # 3 : circulation ( heart and circulatory health , high blood pressure , cholesterol and triglycerides ) hg # 4 : weight loss and stomach health hg # 5 : metabolic ( cancer protection , diabetes , blood sugar control ) hg # 6 : healthy skin , nails and hair , teeth and bones hg # 7 : anti - aging , eye health hg # 8 : hormone balance , menopause . hg # 9 : immune system ( infections , colds and flu ) the following are various food compositions , broken down by element and weight percentage thereof , to form the desired food product and their effects on human health based on their nutritional functions and grouped as above . in order to produce a food composition as herein described , the preparation of dough for pasta involves pulverizing the above ingredients and placing & amp ; mixing them in a conventional mixing device thereby , slowly adding 400gram water and adding 50 gram of crushed flaxseeds . after waiting for 5 minutes , the next step involves placing the well - blended mixture in the pasta machine for 10 minutes after which the pasta sheets of different lengths and thicknesses gets prepared , whereby the prepared pasta sheets are placed in different machines accordingly , to make the pastas of the desired forms like ravioli , cannelloni , lasagna , long and short pastas . the pasta is then dried for 12 hours . these pastas have no preservatives , therefore it will be packed and sold with expiration date of 12 months . the customer is encouraged to prepare it at home using the steam technique , as used for their fish / vegetables , or at low boiling point / simmer water for 5 - 6 minutes . ready to serve food has the same pasta formulas , and is served with raw foods , such as an avocado , papaya or other fresh food containing enzymes . effecting health group ; hg # 1 , hg # 2 , hg # 3 , hg # 4 , hg # 5 , hg # 6 , hg # 7 the mixture in this example can be prepared in the same manner as that used for formula 1 . the mixture in this example can be prepared in the same manner as that used for formula 1 . effecting health group : hg # 1 , hg # 2 , hg # 3 , hg # 4 , hg # 5 , hg # 6 , hg # 7 the mixture in this example can be prepared in the same manner as that used for formula 1 . food product for pizza , bread , tacos , tortillas , crackers , arepas and empanadas in order to produce a food composition as herein described , the preparation of dough for bread / pizza / tacos / tortillas / crackers / arepas / empanadas involves pulverizing the above ingredients and placing & amp ; mixing them in a conventional mixing device , thereby , slowly adding 90 gram water and adding 20 gram of sunflower oil . the next step involves placing the well - blended mixture in the mixing device for 10 minutes , which produces the required dough for making different pasta shapes for the different products , wherein filling those different products shapes with nutritionally balanced food fillings , thereby producing the final nutraceutical composition for the bread / pizza / tacos / tortillas / crackers / arepas / empanadas . the dough for crackers , is steam baked for 1 - 2 minutes and sold as such , whereas , the dough for bread / pizza / tacos / tortillas / arepas / empanadas , thus produced , are frozen and sold , and when ready to be consumed , they are steam baked for 15 minutes at a temperature of 200 degrees fahrenheit for pizza and bread and 1 - 2 minutes for tacos , tortillas , arepas and empanadas . effecting health group : hg # 1 , hg # 2 , hg # 3 , hg # 4 , hg # 5 , hg # 6 , hg # 7 the mixture in this example can be prepared in the same manner as that used for formula 1 . the mixture in this example can be prepared in the same manner as that used for formula 1 . in order to produce a food composition as herein described , the preparation of the granola for cold cereals and snack bar involves pulverizing the above ingredients , mixing and placing the mixture in a tray on the conveyer belt for wet steam baking at 150 degree fahrenheit for 1 minute , thence , adding 50 gram of honey and dry steam baking for another minute . whereas , for hot cereal , all the above ingredients are combined in a large container and stored in a cool dry condition . before consumption , water is added to the mixture and steamed in an oven for 3 to 5 minutes . then , served hot with milk or yogurt , fruits , nuts or seeds . effecting health group : hg # 1 , hg # 2 , hg # 3 , hg # 4 , hg # 5 , hg # 6 , hg # 7 the mixture in this example can be prepared in the same manner as that used for formula 1 . the mixture in this example can be prepared in the same manner as that used for formula 1 . the above nutraceutical compositions are representative of unique formulas designed as “ disease preventive food ”. in time , this nutraceutical intervention will control symptoms , treat , prevent and / or reverse different health issues . as stated , various combinations are possible , of the components herein described , in order to provide a food composition , which is capable of serving as a substitute for nutritionally imbalanced , chemically processed food , as an alternative to drugs . the food compositions , of the instant invention , can be used to provide balanced proper nutrition for all age groups ( developing and sustaining ) and can be readily adapted to meet any of several nutritional lifestyles , as well as , provide the following benefits to the human body . the separate beneficial properties of the various natural ingredients included in the various food compositions are enumerated below . seaweeds : seaweeds have unique mineral content like calcium , copper , and concentrated form of iodine ( for healthy metabolism ), bioavailable iron , magnesium , manganese , molybdenum , phosphorus , potassium , selenium , vanadium , as found in human blood . seaweeds also offer a variety of unique phytonutrients , including sulfated polysaccharides , antioxidants ( anti - inflammatory ), polyphenol antioxidants ( flavonoids ) along with substantial amounts of protein , niacin , vitamin b1 , vitamin b2 , vitamin b5 , vitamin b6 and b12 and a variety of enzymes ( that reduce blood sugar level ). moreover , on account of the sulfated polysaccharides compounds , seaweeds / sea vegetables possess unique anti - inflammatory ( especially osteoarthritis ), anti - cancer ( especially colon and breast cancers ), anticoagulant , antithrombotic , and antiviral properties ( herpes simplex virus ). seaweeds also acts as a “ blood purifier ” as well as neutralizing the over - acidic effect of diet by alkalizing blood . with their powerful chelating and detoxifying properties , seaweeds provide protection to environmental toxins and drawing out of body wastes . moringa : another natural sources of basic nutrients is moringa oleifera it contains more than 92 nutrients , 46 types of antioxidants and vitamins a - z , 36 anti - in ammatones , 18 amino acids and 9 essential amino acids . it cures and prevent over 300 illness including diabetes , high blood pressure , arthritis , stroke and cancers . it is also commonly used for energy , beautiful skin , sleep and strengthening teeth . besides , stimulating the body to feel good , fresh and energized , moringa has several thousand times more zeatin than any other known plant . it allows new skin cells to grow at a faster rate when old skin cells die . this results in a marked reduction of wrinkles on the face and other parts of the body , and a more youthful skin appearance . moringa have our times more chlorophyll than wheatgrass . sulfur is the key ingredient to substances which make up human skin collagen , and keratin . while not all antioxidart are created equal , monngaoleifera leaves contain over 30 antioxidants which are well suited for skin health . there are 23 amino acids of which eight are considered essential these are the basis for the construction of new muscle . scientists have identified pterygospermin as the active compound in moringa that causes its antibacterial action . moringa acts as a great natural sleeping aid because it contains the unique natural compound known as nebedaye moringa leaves possess anti - tumor and anti - cancel activities , due in part to a compound called niaziminin anti - viral activity in cases of herpes simplex 1 . the glucose - modifying , anti - diabetic effects of moringa may prove of great use amidst a virtual epidemic of type 2 diabetes and obesity . barley has a good source of molybdenum , manganese , dietary fiber , selenium , copper , vitamin b1 , chromium , phosphorus , magnesium , and niacin thataids in lowering blood cholesterol levels ( possibly with propionic acid obtained from the insoluble fiber of barley ), protects the intestine and colon ( vide its “ friendly bacteria ” in the large intestine ), besides , having anti - cancer , anti - diabetic properties . the propionic acid produced from barley &# 39 ; s insoluble fiber may also be partly responsible for the cholesterol - lowering properties of fiber as well as the regularity and intestinal protection . barley and other whole grains are rich sources of magnesium , a mineral that acts as a co - factor for more than 300 enzymes , including enzymes involved in the body &# 39 ; s use of glucose and insulin secretion . the fiber can also help to prevent blood sugar levels from rising too high in people with diabetes . chaga mushroom offer a complex balance of active compounds , delivery mineral structures , and co - agents , more effective to sustaining a healthy immune balance than synthesized isolated compounds that ultimately slows the aging process . it has the highest orac ( oxygen radical absorbance capacity ) score for natural foods or supplements that protect every cell in the entire body from free - radical damage . it also promote cellular respiration and proliferation , helps regenerate cells and regenerate damaged tissue , promotes the growth of healthy cells and assist in cellular repair , enhances the immune system , maintains optimum alkalinity and ph levels , oxygenates the blood and helps stabilize blood sugar , protects dna and anti - inflammatory benefits , improve neurological function , digestion and circulation of blood all over the body , alleviates stress and anxiety while increases energy and strength , fights chronic fatigue , reduces muscle and joint pain , supports normal kidney and vision health , balances hormones , manages weight and helps gain muscles , improves lymphocyte count , suppresses allergies , improves memory and concentration , helps optimize cardiovascular health , inhibits lipid peroxidation maintains healthy blood pressure and cholesterol levels , impedes tumor malignancy and boosts natural cancer - fighting ability , helps detoxification of all cells , skin , blood , liver , intestines , colon , kidney , bladder , lymphatic system , lung & amp ; respiratory , yeast & amp ; fungal , chemicals and heavy metals ( including lead and mercury ). brown rice : brown rice is a rich source of manganese which helps in the synthesis of fatty acids and produces energy from protein and carbohydrates which are helpful in keeping the nervous system strong . further , manganese is a critical component of superoxide dismutase which is responsible for providing protection against damage from free radicals produced during energy production and balancing the action of calcium in the blood vessels , thereby keeping the blood vessels relaxed and dilated , thus keeping pressure normal and preventing heart attack . it is also a rich source of selenium which helps in thyroid hormone metabolism , and strengthens the immune system . selenium helps in inducing dna repair , damaged cell synthesis and inhibits proliferation of cancer cells as well as being an important cofactor of glutathione peroxidase , an antioxidant enzyme , detoxifies the liver of harmful molecules and helps in preventing damage to the cellular dna and development of cancer cells . lowers ldl cholesterol and lower type - 2 diabetes . magnesium , another nutrient for which brown rice is a good source , has been shown in studies to be helpful for reducing the severity of asthma , lowering high blood pressure , reducing the frequency of migraine headaches , and reducing the risk of heart attack and stroke . quinoa : quinoa has significantly greater amounts of both lysine and isoleucine ( especially lysine ), which allows the protein in quinoa to serve as a complete protein source . besides , it is also rich in rda nutrients like folate , zinc , and phosphorus . the phytonutrient present in quinoa provides significant amounts of antioxidants like ferulic , coumaric , hydroxybenzoic , and vanillic acid . ouinoa also has anti - inflammatory properties due to the presence of phenolic acids like hydroxycinnamic and hydroxybenzoic acids , polysaccharides like arabinans and rhamnogalacturonans and vitamin e like gamma - tocopherol . the antioxidant and anti - inflammatory phytonutrients in quinoa also make it a likely candidate for cancer risk reduction in humans . oats contains a specific type of fiber known as beta - glucan which lowers the high cholesterol levels which significantly reduces the risk of cardiovascular disease and stroke . due to the high fiber content in oats , it reduces the cholesterol levels . the presence of antioxidant compound avenanthramides prevents free radicals from damaging ldl cholesterol , thus reducing the risk of cardiovascular disease . avenanthramides suppresses production of icam - 1 ( intracellular adhesion molecule - 1 ) and vcam - 1 ( vascular adhesion molecule - 1 ), e - selectin , and the secretion of pro - inflammatory cytokines kl - 6 , chemokines il - 8 and protein mcp - 1 ( monocyte chemoattractant protein ). soybean is a source of pepetides like defensins , glycinins , conglycinins and lunasin which helps in improving blood pressure regulation , controlling blood sugar levels , and improving immune function . it is a good source of geistein , an isoflavone which reduces the risk of cancer . it is also rich in phytonutrrients like caffeic , coumaric , ferulic , and sinapic acid . soybeans are also an important source of the minerals copper , manganese , molybdenum , phosphorus , and potassium ; the b vitamin , riboflavin ; and omega - 3 fatty acids ( in the form of alpha - linolenic acid ). the area of bone health benefits from soy has been the finding in many studies of improved markers of bone health following consumption of soy . flaxseeds is a high source of omega - 3 fatty acid especially alpha - linolenic acid , or ala which helps in preventing excessive inflammation of blood vessels , thereby benefitting the cardiovascular system . further , presence of ligans in flaxseeds imparts antioxidant properties to it . the mucilage content especially the presence of arabinoxylans and galactoxylansin flaxseeds benefits the digestive tract . decrease the ratio of ldl - to - hdl cholesterol and to increase the level of apolipoprotein a1 , and help reduce blood pressure . the antioxidant and anti - inflammatory benefits of flaxseeds aids on cancer prevention . sunflower seeds : are an excellent source of vitamin e , which is a fat soluble antioxidant and neutralizes free radicals which are harmful to the cell membrane and brain cells . being an antioxidant , vitamin e helps in preventing cardiovascular diseases , apart from preventing or reducing the occurrence of asthma , osteoarthritis and rheumatoid arthritis vide its anti inflammatory properties . sunflower seeds are also rich in manganese which helps in reducing the severity of asthma , lowering high blood pressure , preventing migraine headaches , and reducing the risk of heart attack and stroke . magnesium is also necessary for healthy bones and energy production . a trace element selenium present in sunflower seeds induces dna repair and synthesis in damaged cells , inhibits proliferation of cancer cells and induces their apoptosis , thereby protecting the cells from becoming cancerous . furthermore , selenium is instrumental in developing body &# 39 ; s most powerful antioxidant enzymes , glutathione peroxidase that is used in the liver to detoxify a wide range of potentially harmful molecules . walnuts are high sources of anti - inflammatory nutrients like omega - 3 fatty acids including alpha - linolenic acid , phyto nutrients like tannins , phenolic acids , and flavonoids and quinines like juglone . the presence of anti - inflammatory nutrients ( alpha - linolenic acid ) helps the cardiovascular system and regulates the blood composition as well as blood pressure . it reduces problems in metabolic syndrome and is beneficial in the treatment of type - 2 diabetes . the antioxidant properties of walnuts help lower risk of chronic oxidative stress . also , walnut helps to keep bones strong and prevents prostrate and breast cancer . black beans are also rich sources of phytonutrients and anthocyanin flavonoids like delphinidin , petunidin , malvidin , kaempferol and quercetin . these phytonutrients and flavonoids impart both antioxidant and anti - inflammatory properties to the black beans . black beans are also sources of hydroxycinnamic acids ferulic , sinapic , and chlorogenic acid , as well as numerous triterpenoids . antioxidant minerals like zinc and manganese are also plentiful in black beans . also , found in black beans is omega - 3 fatty acids that helps control blood pressure and cardio - vascular system . black beans are rich both in proteins as well as fibres . this combination is beneficial for smooth functioning of the digestive tract , in regulating the blood sugar system and the cardiovascular system . coconuts have anti - viral , anti - bacterial , anti - fungal , and anti - parasite properties . it improves digestion and absorption of nutrients , vitamins , and minerals in the body thereby providing a natural source of quick energy in the body . it stimulates insulin secretion thereby guards against diabetes . it protects the body from degeneration by removing the free radicals present in the system . goji berries are excellent source of antioxidants such as polyphenols , flavonoids , carotenoids , vitamins like a , c and e apart from having potassium , zinc , iron , copper and riboflavin in them . they are also rich in polysaccharides which are a primary source of dietary fiber . gogi berries , due to the presence of antioxidants , help neutralize the cell - damaging effects of free radicals and help guard us from degenerative diseases such as rheumatoid arthritis , alzheimer &# 39 ; s disease and most types of cancer . it also contain 8 polysaccharides , a primary source of dietary fiber . honey : honey is a real food that has been accessible to humans throughout evolutionary history and can still be obtained in its natural form . existence of fructose and omega - 6 fatty acids despite being linked to health issues when isolated , in “ real foods ” have a completely different effect . honey raises blood sugar less than dextrose ( glucose ) and sucrose ( glucose and fructose ). it reduces c - reactive protein ( crp )— a marker of inflammation , lowers ldl cholesterol , blood triglycerides and raises hdl cholesterol and also lowers homocysteine , another blood marker associated with disease . honey also contains an abundance of various antioxidants that are associated with improved health and lower risk of disease . two human studies revealed that consumption of buckwheat honey increases the antioxidant value of the blood black seeds black cumin used as a spice is considered a natural remedy for asthma , hypertension , diabetes , inflammation , cough , bronchitis , headache , eczema , fever , dizziness , and influenza . the seeds are known to be carminative , stimulant , and diuretic . similarly , seeds of herbaceous plant are used in the prevention of inflammation , antioxidant activities , antimicrobial activity , and anti - carcinogenic and antiulcer activity . food as medicine , how are food and the environment related ?, how does food impact health ? what should i eat for my specific condition ? http :// www . takingcharge . csh . umn . edu / our - experts / karen - lawson - md while there have been shown and described what are at present , the preferred embodiments of the invention , it will be obvious to those skilled in the art that various changes and modifications may be made therein without departing from the scope of the invention as defined by the appended claims . for a better understanding of the present invention , together with other and further objects , advantages and capabilities thereof , reference is made to the following disclosure and appended claims .	0
the present invention will now be explained in further detail while referring to examples , but the present invention is not limited to these examples . furthermore , tablet strength , the friability , and the disintegration time in the buccal cavity are evaluated in the following examples of the present invention , but because it appears that addition of drug has little effect on these evaluation items , the examples also include the results obtained from those tablets that do not contain drug . the methods for evaluating the quick disintegrating tablet in buccal cavity of the present invention are described below : [ hardness tests ] determinations were performed using a schleuniger tablet hardness tester ( schleuniger co ., ltd .). the tests are performed with 5 tablets and the mean value is shown . tablet hardness is represented by the force needed to crush the tablet ( units kp ). a larger number indicates a stronger tablet . [ friability ] determinations were performed using an abrasion tester ( model ptfr - a , pharma test co .) the friability is found using 6 g tablets . it is represented by the percentage weight loss of a tablet after 100 rounds at a turning speed of 25 rpm . a smaller value indicates a stronger tablet surface . [ disintegration in buccal cavity tests ] healthy adult males place the tablet of the present invention inside their buccal cavity without having any water inside their mouth and the time until the tablet is completely disintegrated and dissolved by saliva only is determined . [ porosity ] porosity of the tablets was calculated from the following formula ( i ) and is the mean of five tablets . porosity = v - ( w / ρ ) v × 100 formula   ( i ) ( v : tablet volume , w : tablet weight , p : specific gravity of powder making up tablet ) [ experiment1 ] confirmation of melting by heating of saccharide and changes in its crystal form . after thoroughly crushing trehalose ( hayashibara co ., ltd . ), maltose ( brand name sunmalt - s , hayashibara co ., ltd ), sorbitol , sucrose , mannitol ( towa kasei co ., ltd . ), erythritol ( hayashibara co ., ltd . ), xylitol ( towa kasei co ., ltd ) as the saccharides with a mortar and punch , they were transferred to a glass dish and heat treated for 5 minutes at 140 ° c . using a program oven ( model no . mov - 112p , sanyo ). melting of the saccharide was visually confirmed . after cooling the molten saccharide to room temperature , it was crushed again using a mortar and punch and determinations were performed with a differential scanning calorimeter ( dsc hereafter ) and crystal form was evaluated . the maltose was further humidified over night under conditions of 25 ° c . and 75 % rh using a thermostatic vessel at constant humidity ( tabaiespec co ., ltd ., pr - 35c ) and dsc determination was performed . a physical mixture of mannitol / maltose ( 9 / 1 ) and mannitol / trehalose ( 9 / 1 ) was further prepared and dsc determination was performed before heat treatment , after heat treatment and when humidification was performed after heat treatment to evaluate crystal form . melting of the trehalose , maltose , sorbitol , xylitol , and erythritol by heating was confirmed . on the other hand , melting of sucrose and mannitol was not confirmed . of the saccharides that had melted , the endothermic peak derived from crystals of trehalose and maltose disappeared , confinning conversion to amorphous . moreover , recrystallization of saccharide that had converted to amorphous as a result of humidification amorphous saccharide was also confirmed . in contrast to this , crystallization of xylitol and erythritol was confirmed because the same endothermnic peak as before heating was present . only the peak of the “ saccharide with a low melting point ” used in the present invention disappeared , confirming conversion to amorphous , with each physical mixture of mannitol / maltose and mannitol / trehalose . moreover , the peak of a “ saccharide with a low melting point ” used in the present invention appeared after humidification , confirming that recrystallization had occurred . meltability of the saccharides used in the present experiment when heated at 140 ° c . was evaluated . as a result , melting was observed with the “ saccharides with a low melting point ,” while there were no apparent changes with the “ saccharides with a high melting point .” moreover , because only the endothermic peak of the “ saccharides with a low melting point ” disappeared with heating of physical mixtures , it appears that only the “ saccharide with a low melting point ” melted . that is , it appears that it is possible for only the “ saccharide with a low melting point ” of these mixtures to melt and make the particles of “ saccharide with a high melting point ” adhere . moreover , it was made clear that when the saccharide converts to amorphous with melting , it is recrystallized by humidification . consequently , it was clarified that improvement of stability can be realized by crystallization when a saccharide with a low melting point converts to amorphous and there is a chance that hardness will decrease , and the like , due to absorption of moisture during storage , and the like . [ experiment 2 ] tests relating to raising hardness of model tablets ( mannitol / maltose ) model tablet a ( tablet a hereafter ) was prepared as follows : first , 450 g mannitol were sifted with a sieve ( 20 mesh ) and then granulated using a fluid bed granulator with 250 g aqueous maltose solution ( 20 w / w %) as the binder . then 0 . 5 % w / w magnesium stearate was added to this granulation product and mixed , and tablets of approximately 200 mg per 1 tablet were made using a rotary tableting machine . tableting pressure was adjusted as needed to obtain a tablet hardness of approximately 1 kp , and it was approximately 0 . 1 t / punch . tablet a was heated and / or humidified as described below ( group 1 : heat - treated only , group 2 : humidified after heat treatment , group 3 : heat - treated after humidification , and humidified once again ). the treatment conditions of each process were heat treatment for 5 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo ), and humidification treatment involved humidification for 18 hours under conditions of 25 ° c . and 75 % rh using a thermostatic chamber at constant humidity ( tabaiespec , pr - 35c ) and then drying for 3 hours under conditions of 30 ° c . and 40 % rh . moreover , crystal form was evaluated as needed for each process by performing dsc determinations . furthermore , tablet stability of group 1 was evaluated under conditions of 25 ° c . and 60 % rh . a rise in hardness of tablet a by approximately 4 - times was seen with heating only ( group 1 ), but a reduction in hardness was observed ( table 1 ) in the stability evaluations ( conditions of 25 ° c ., 60 % rh ) that followed . when dsc determinations of tablet a after heat treatment were performed , it was confirmed that the maltose had converted to amorphous and it was felt that moisture absorption by amorphous maltose was the cause of the reduction in hardness . dsc determinations were performed on tablets that had been humidified ( group 2 ) for the purpose of crystallization of the maltose that had converted to amorphous , but crystallization was not seen . in addition , crystallization of maltose was seen with the first humidification of group 3 . the peak derived from maltose crystals disappeared after this was heat treated , confirming that melting of the maltose had occurred in this tablet as well . furthermore , crystallization of maltose was not observed when this was humidified once again . a rise in hardness with heat treatment was observed with tablet a . it appeared that this rise in hardness apparently was due to firm adhesion of particles of “ saccharide with a high melting point ” as a result of the “ saccharide with a low melting point ” melting because the peak of the maltose crystals disappeared in the dsc determinations ( group 3 ). stability under conditions of 25 ° c . and 60 % rh was confirmed because maltose that has converted to amorphous has a low critical relative humidity and there is a chance that hardness will drop with absorption of moisture . as a result , a reduction in hardness of tablet a ( group 1 ) was observed . an attempt was made to humidify tablets that had been heat treated in order to increase the critical relative humidity and improve stability by crystallizing the maltose ( group 2 ). however , a peak derived from the maltose crystals was not seen and almost no crystallization occurred . as shown by experiment 1 , crystallization was seen with physical mixtures and it therefore appeared that crystallization was delayed by making the surface area of the tablet relatively small . consequently , it is possible to present a pharmaceutical preparation with which the rise in tablet strength can be retained when maltose is used as the saccharide of the present invention by , for instance , sealing in a non - moisture permeable packaging material . [ experiment 3 ] tests relating to a rise in hardness of model tablets ( mannitol / trehalose , mannitol / erythritol ) model tablets b and c were prepared as follows : first , 450 g mannitol were sifted with a sieve ( 20 mesh ) and then granulated using a fluid bed granulator with 250 g aqueous trehalose solution ( model tablet b , tablet b hereafter ) or aqueous erythritol solution ( model tablet c , tablet c hereafter ) ( 20 w / w %) as the binder . then 0 . 5 % w / w magnesium stearate was added to this granulation product and mixed , and tablets of approximately 200 mg per 1 tablet were made using a rotary tableting machine . tableting pressure was adjusted as needed to obtain a tablet hardness of approximately 1 kp , and it was approximately 0 . 1 t / punch for tablet b and approximately 0 . 25 t / punch for tablet c . the model tablets were heated and / or humidified as described below ( group 1 : heat - treated only , group 2 : humidified after heat treatment , group 3 : humidified ). the heat treatment conditions for tablet b were 9 minutes at 140 ° c . and the heat treatment conditions for tablet c were 5 minutes at 140 ° c ., and the humidification conditions were the same as in experiment 2 . stability of hardness , the friability , and the disintegration time in the buccal cavity of these tablets when set aside at 25 ° c . and 60 % rh was evaluated for up to 24 hours . moreover , dsc determinations were performed and crystal form was evaluated as needed for each process . a rise in hardness by 2 . 5 - times ˜ 8 - times was observed withn heat treatment of both tablets b and c ( tables 2 and 3 ). when crystal form was evaluated using dsc at this time , the trehalose of tablet b was amorphous and the erytluitol of tablet c was crystals . when the stability of tablet b under conditions of 25 ° c . and 60 % rh was evaluated , a temporary reduction in hardness that was thought to be due to absorption of moisture was observed with tablet b ( table 2 , group 1 ). however , there was almost complete recovery from this reduction in hardness in 24 hours . the fact that this was accompanied by crystallization of the trehalose was confirmed by dsc . there was almost no drop in hardness , indicating that there was stability , with group 2 that was humidified after heat treatment for the purpose of promoting crystallization . furthermore , almost the same crystallization of group 2 was true for group 3 , which was made by humidification only , which is the conventional production method . consequently , it was made clear that it is possible to obtain a tablet of superior properties by using that heat treatment / humidification treatment of tablet b when compared to humidification treatment only . since the erythritol of tablet c is crystals , there was almost no absorption of moisture and it was all but stable at 25 ° c . and 60 % rh ( table 3 ). consequently , humidification treatment after heating ( group 2 ) was not performed . erythritol is a crystalline saccharide and therefore , there was almost no rise in hardness with humidification only ( table 3 , group 3 ). [ 0102 ] table 3 properties of tablet of the present invention ( tablet c ) group 1 group 3 treatment hardness friability vivo hardness friability vivo group ( kp ) (%) ( s ) ( kp ) (%) ( s ) before 2 . 1 1 . 34 24 2 . 1 1 . 34 24 heating after heating 5 . 2 0 . 81 30 ↓ ↓ ↓ after ↓ ↓ ↓ 2 . 3 1 . 03 32 humidification 25 ° c . 60 % 1 hr 4 . 6 — — 3 . 4 — — 2 hr 5 . 7 — — 3 . 6 — — 4 hr 7 . 5 — — 2 . 6 — — 8 hr 4 . 0 — — 2 . 9 — — 24 hr 4 . 6 0 . 72 45 2 . 5 1 . 00 20 trehalose is a saccharide of high moldability that becomes amorphous . as a result of the present experiment , it was made clear that trehalose easily crystallizes under conditions of 25 ° c . and 60 % rh and under conventional humidification and drying conditions . moreover , once trehalose crystallized , it was stable under conditions of 25 ° c . and 60 % rh . consequently , trehalose is a useful saccharide in the preparation of quick - disintegrating tablets in the buccal cavity using heat treatment . erythritol is a crystalline saccharide of low moldability . it is a saccharide that does not function as a binder by conventional methods , but the present invention was successful in raising tablet strength as a result of melting because this saccharide has a low melting point . since its original nature is a crystalline sugar , crystallization by humidification , and the like , is not necessary and it is also useful in improving productivity . after sifting 450 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 250 g of an aqueous trehalose ( hayashibara co ., ltd .) solution ( 20 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 8 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 1 t / punch using a rotary tableting machine . next , these tablets were heated for 9 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature . disappearance of the endothermic peak derived from trehalose crystals was confirmed at this time using dsc , proving that the trehalose was amorphous . then these tablets were humidified at 25 ° c ./ 75 % rh and stored for 18 hours while moist using a thermostatic chamber at constant humidity ( tabaiespec co ., ltd ., pr - 35c ). next , they were dried for 3 hours at 30 ° c . ( humidity of 40 %) to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 6 . 4 kp ( n = 5 ), a friability of 0 . 66 % ( 100 rounds ), a disintegration time in the buccal cavity of 20 seconds ( n = 1 ), and a porosity of 30 . 6 %. moreover , as a result of dsc determinations of the tablets that were obtained , an endothermic peak derived from trehalose crystals was seen , indicating that the trehalose had crystallized . the tablets that were granulated and tableted as in example 1 were humidified at 25 ° c ./ 75 % rh and stored for 18 hours while moist using a thermostatic chamber at constant humidity ( tabaiespec co ., ltd ., pr - 35c ) without being heated . they then were dried for 3 hours at 30 ° c . ( humidity of 40 %). the tablets that were obtained showed a hardness of 3 . 2 kp ( n = 5 ), friability of 1 . 53 % ( 100 rounds ), a disintegration time in the buccal cavity of 17 seconds ( n = 1 ), and a porosity of 30 . 6 %. based on these results , it was clarified that the tablet of the present invention has excellent properties in terms of hardness and the friability while retaining a fast disintegration time in the buccal cavity when compared to tablets made by humidification and drying only . after sifting 450 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 250 g of an aqueous erythritol ( hayashibara co ., ltd .) solution ( 20 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( 4 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 1 . 0 kp ( n 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 25 t / punch using a rotary tableting machine . next , these tablets were heated for 2 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 5 . 2 kp ( n = 5 ), a friability of 0 . 81 % ( 100 rounds ), a disintegration time in the buccal cavity of 30 seconds ( n = 1 ), and a porosity of 25 . 5 %. the tablets that were granulated and tableted as in example 2 were humidified at 25 ° c ./ 75 % rh and stored for 18 hours while moist using a thermostatic chamber at constant humidity ( tabaiespec co ., ltd ., pr - 35c ) without being heated . they then were dried for 3 hours at 30 ° c . ( humidity of 40 %). the tablets that were obtained showed a hardness of 2 . 3 kp ( n = 5 ), friability of 1 . 03 % ( 100 rounds ), a disintegration time in the buccal cavity of 32 seconds ( n = 1 ), and a porosity of 25 . 5 %. based on these results , it was clarified that the tablet of the present invention has excellent properties in terms of hardness and the friability while retaining a fast disintegration time in the buccal cavity when compared to tablets made by humidification and drying only . a suspension was prepared by mixing 1 , 500 g famotidine , 2 , 000 g aquacoat ( brand name , asahi kasei ), 150 g triacetin , and 700 g purified water . this suspension was spray dried at a spraying rate of 30 g / min , inlet temperature of 120 ° c ., and disk rotating speed of 8 , 000 rpm using a spray dryer ( ohkawara kakoki co ., ltd ., l - 8 ) to obtain famotidine particles . mean particle diameter at this time was 91 μm . separately , 4 , 578 . 6 g mannitol ( towa kasei co ., ltd . ), 60 g aspartame ( ajinomoto co ., ltd . ), and 165 . 2 g peppermint flavor powder ( t . hasegwa co ., ltd .) were granulated with 15 % w / w aqueous solution containing 244 . 2 g maltose ( hayashibara co ., ltd ., brand name sunmalt - s ) in a fluid - bed granulator ( freund industry co ., ltd , flo - 5 ). after mixing 574 . 8 g famotidine particles that were obtained and 40 g calcium stearate with 3 , 385 . 2 g of this granulation product , 200 mg tablets containing 20 mg famotidine per 1 tablet were manufactured using a rotary tableting machine . next , these tablets were humidified at 25 ° c ./ 75 % rh and stored for 24 hours while moist using a thermostatic chamber at constant humidity ( tabaiespec co ., ltd ., pr - 35c ). then they were dried for 3 hours at 30 ° c . and 40 % rh . the tablets that were obtained were heated for 2 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo co ., ltd .) and set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained show a hardness of 5 . 9 kp ( n 5 ), friability of 0 . 14 % ( 100 rounds ), a disintegration time in the buccal cavity of 15 seconds ( n 1 ), and a porosity of 25 . 5 %. tablets were obtained by granulation , tableting , and humidification and drying as in example 3 . the tablets that were obtained without heating showed a hardness of 3 . 7 kp ( n = 5 ), friability of 0 . 38 % ( 100 rounds ), a disintegration time in the buccal cavity of 15 seconds ( n = 1 ), and a porosity of 25 . 5 %. based on these results , it was clarified that the tablet of the present invention has excellent properties in terms of hardness and the friability while retaining a fast disintegration time in the buccal cavity when compared to tablets made by humidification and drying only . after sifting 450 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 250 g of an aqueous maltose ( brand name surnmalt - s , hayashibara co ., ltd .) solution ( 20 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 1 . 2 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 15 t / punch using a rotary tableting machine . next , these tablets were heated for 5 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 6 . 9 kp ( n = 5 ), a friability of 0 . 39 % ( 100 rounds ), a disintegration time in the buccal cavity of 22 seconds ( n = 1 ), and a porosity of 35 . 6 %. after sifting 475 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 125 g of an aqueous maltose ( brand name sunmalt - s , hayashibara co ., ltd .) solution ( 20 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 1 . 0 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 1 t / punch using a rotary tableting machine . next , these tablets were heated for 5 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 7 . 8 kp ( n = 5 ), a friability of 0 . 67 % ( 100 rounds ), a disintegration time in the buccal cavity of 23 seconds ( n = 1 ), and a porosity of 33 . 2 %. after sifting 400 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 500 g of an aqueous maltose ( brand name sunmalt - s , hayashibara co ., ltd .) solution ( 20 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 9 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 03 t / punch using a rotary tableting machine . next , these tablets were heated for 5 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 4 . 4 kp ( n = 5 ), a disintegration time in the buccal cavity of 20 seconds ( n = 1 ), and a porosity of 42 . 7 %. after sifting 490 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 67 g of an aqueous maltose ( brand name sunmalt - s , hayashibara co ., ltd .) solution ( 15 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( 4 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 8 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 1 t / punch using a rotary tableting machine . next , these tablets were heated for 10 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 3 . 9 kp ( n = 5 ), a disintegration time in the buccal cavity of 20 seconds ( n = 1 ), and a porosity of 29 . 3 %. after sifting 450 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 333 g of an aqueous erythritol ( hayashibara co ., ltd .) and maltitol ( hayashibara co ., ltd .) solution ( 7 . 5 w / v % each , 15 w / v % as a whole ) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 9 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 04 t / punch using a rotary tableting machine . next , these tablets were heated for 10 minutes at 120 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 4 . 8 kp ( n = 5 ), a friability of 0 . 3 % or less ( 100 rounds ), a disintegration time in the buccal cavity of 20 seconds ( n = 1 ), and a porosity of 32 . 2 %. after sifting 450 g lactose ( freund industry co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 250 g of an aqueous maltitol ( hayashibara co ., ltd .) solution ( 20 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 9 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 03 t / punch using a rotary tableting machine . next , these tablets were heated for 2 . 5 minutes at 160 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 5 . 6 kp ( n = 5 ), a friability of 0 . 3 % or less ( 100 rounds ), a disintegration time in the buccal cavity of 27 seconds ( n = 1 ), and a porosity of 42 . 1 %. after sifting 900 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( olikawara seisakujo ) with 400 g of an aqueous erythritol ( hayashibara co ., ltd .) solution ( 20 w / v %) and 133 . 3 g of an aqueous maltitol ( hayashibara co ., ltd .) solution ( 15 w / v %) as the binder . then 1 % sucrose fatty acid ester ( mitsubishi - kagaku foods ) was mixed with this granulation product and tablets (( φ 8 . 5 mm , 9 . 0 mmr ), tablet hardness of 0 . 4 kp ( n = 5 )) of 200 mg per 1 tablet were made using a rotary tableting machine . next , these tablets were heated under the conditions shown in table 4 using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention ( porosity of 34 . 1 %). the property values of the tablets that were obtained are also shown in table 4 . after sifting 250 g acetaminophen ( yoshitomi fine chemicals ) and 200 g mannitol ( towa kasei co ., ltd .) with a sieve ( 24 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) by spraying 200 g of an aqueous erythritol ( hayashibara co ., ltd .) solution ( 20 w / v %) and 66 . 7 g of an aqueous maltitol ( hayashibara co ., ltd .) solution ( 15 w / v %) as the binder . then 1 % sucrose fatty acid ester ( mitsubishi - kagaku foods ) was mixed with this granulation product and tablets (( φ 8 . 5 mm , 9 mmr ), tablet hardness of 0 . 4 kp ( n = 5 )) of 200 mg per 1 tablet were made using a rotary tableting machine . next , these tablets were heated for 10 minutes at 120 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 6 . 9 kp ( n = 5 ), a friability of 0 . 23 % ( 100 rounds ), a disintegration time in the buccal cavity of 26 seconds ( n = 1 ), and a porosity of 29 . 6 %. after sifting 250 g calcium carbonate ( nitto funka kogyo ) and 200 g mannitol ( towa kasei co ., ltd .) with a sieve ( 24 mesh ), the product was introduced to a vertical mixer and 40 g water were added and mixed . after this was sifted with a sieve ( 16 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) by spraying 200 g of an aqueous erythritol ( hayashibara co ., ltd .) solution ( 20 w / v %) and 66 . 7 g of an aqueous maltitol ( hayashibara co ., ltd .) solution ( 15 w / v %) as the binder . then 1 % sucrose fatty acid ester ( mitsubishi - kagaku foods ) was mixed with this granulation product and tablets (( φ 9 . 5 mm , 11 . 4 mmr ), tablet hardness of 0 . 4 kp ( n = 5 )) of 400 mg per 1 tablet were made using a rotary tableting machine . next , these tablets were heated for 10 minutes at 130 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 4 . 6 kp ( n = 5 ), a friability of 0 . 48 % ( 100 rounds ), a disintegration time in the buccal cavity of 25 seconds ( n = 1 ), and a porosity of 44 . 9 %. after sifting 450 g mannitol ( towa kasei co ., ltd .) and 40 g erythritol ( hayashibara co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 200 g of an aqueous copolyvidone ( kollidon va64 , basf ) solution ( 5 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( 4 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 6 kp ( n = 5 )) of 200 mg per 1 tablet were made using a rotary tableting machine . next , these tablets were heated for 10 minutes at 120 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 7 . 3 kp ( n = 5 ), a friability of 0 . 20 % ( 100 rounds ), a disintegration time in the buccal cavity of 18 seconds ( n = 1 ), and a porosity of 36 . 9 %. after sifting 475 g mannitol ( towa kasei co ., ltd .) and 15 g erythritol ( hayashibara co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 200 g of an aqueous copolyvidone ( kollidon va64 , basf ) solution ( 5 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 7 kp ( n = 5 )) of 200 mg per 1 tablet were made using a rotary tableting machine . next , these tablets were heated for 10 minutes at 120 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 6 . 2 kp ( n = 5 ), a friability of 0 . 37 % ( 100 rounds ), a disintegration time in the buccal cavity of 15 seconds ( n = 1 ), and a porosity of 36 . 7 %. after sifting 350 g acetaminophen ( yoshitomi fine chemicals ), 100 g mannitol ( towa kasei co ., ltd . ), and 40 g erythritol ( hayashibara co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 200 g of an aqueous copolyvidone ( kollidon va64 , basf ) solution ( 5 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( 4 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 8 kp ( n = 5 )) of 200 mg per 1 tablet were made using a rotary tableting machine . next , these tablets were heated for 10 minutes at 120 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature to obtain the tablet of the present invention . the tablets that were obtained showed a hardness of 8 . 3 kp ( n = 5 ), a friability of 0 . 36 % ( 100 rounds ), a disintegration time in the buccal cavity of 31 seconds ( n = 1 ), and a porosity of 31 . 0 %. after sifting 360 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 200 g of an aqueous maltitol ( hayashibara co ., ltd .) solution ( 20 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 4 . 6 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 1 t / punch using a rotary tableting machine . next , these tablets were heated for 2 minutes at 140 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside to cool for 30 minutes at room temperature . the tablets that were obtained showed a hardness of 4 . 0 kp ( n = 5 ) and a porosity of 22 . 8 %. an increase in hardness was not seen by heat treatment at the melting point of maltitol ( 150 ° c .) or lower . granulation with a vertical granulator was performed using 50 g water to 800 g mannitol . after drying the granulation product , 15 g peg6000 and 0 . 3 g magnesium stearate were added to 284 . 7 g granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 4 kp ( n = 5 )) of 200 mg per 1 tablet were made under a tableting pressure of approximately 0 . 1 t / punch using a rotary tableting machine . next , these tablets were heated for 1 hour at 70 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature . the tablets that were obtained showed a hardness of 5 . 1 kp ( n = 5 ), a friability of 0 . 37 % ( 100 rounds ), a disintegration time in the buccal cavity of 60 seconds or longer ( n = 1 ), and a porosity of 22 . 8 %. based on these results , it was clarified that when tablets that have been manufactured by melting with peg6000 serving as the binder have the same hardness as the product of the present invention , the disintegration time in the buccal cavity is greatly prolonged and they do not have the properties of a quick - disintegrating tablet . after sifting 490 g mannitol ( towa kasei co ., ltd .) with a sieve ( 20 mesh ), granulation was performed using a fluid - bed granulator ( ohkawara seisakujo ) with 200 g of an aqueous copolyvidone ( kollidon va64 , basf ) solution ( 5 w / v %) as the binder . then 0 . 5 % magnesium stearate was mixed with this granulation product and tablets (( φ 8 . 5 mm , 10 . 2 mmr ), tablet hardness of 0 . 8 kp ( n = 5 )) of 200 mg per 1 tablet were made using a rotary tableting machine . next , these tablets were heated for 10 minutes at 120 ° c . using a program oven ( model mov - 112p , sanyo ) and then set aside for 30 minutes at room temperature . the tablets that were obtained showed a hardness of 1 . 1 kp ( n = 5 ) and a porosity of 36 . 5 %. a rise in hardness with heat treatment was not seen with tablets that did not contain erythritol . the quick - disintegrating tablet in the buccal cavity of the present invention has almost the same properties as conventional oral pharmaceutical tablets , with tablet strength being higher , the friability being kept low in particular , without prolonging disintegration time in the buccal cavity when compared to conventional quick - disintegrating tablets in the buccal cavity . therefore , it can be used with automatic unit dosing machines . the quick - disintegrating tablet in the buccal cavity can also be used with drugs that are given in large doses . furthermore , as with conventional oral pharmaceutical tablets , the quick - disintegrating tablet in the buccal cavity of the present invention can be taken without being disintegrated in the buccal cavity , or it can be taken together with water . in addition , the tablet of the present invention can be taken after being dissolved in water , and the like , in a cup , and the like . the quick - disintegrating tablet in the buccal cavity of the present invention , which is produced by conventional tableting machines , and manufacturing method thereof can be used for a variety of drugs and therefore , are a very popular pharmaceutical technology .	0
the improved mouthpiece according to the invention will now be described by referring to fig1 - 7 . the mouthpiece 10 has a circular connector piece 12 which engages the outlet of a nebulizer in the same way that the mouthpiece engages the nebulizer in fig . a . the opposite end of this mouthpiece device is the mouth shaped end piece 14 that , in use , is placed in the patient &# 39 ; s mouth . on top is a valve disc housing 16 that holds the exhaust valve for exhausting the exhalation from a patient . in the exploded view of fig1 , the valve housing 16 contains an inner ring 18 the base which serves as a support ring for the valve disc . in the embodiment illustrated there is a central hub 20 which is supported by three arms 22 . these arms are quite thin so that the open areas 24 between them represent a substantial portion of the cross - sectional area in the housing . other configurations and different numbers of arms can be used . above the housing in the exploded view is the valve disc 26 sized fit on top of the arms and the support ring 18 . the arms 22 and hub 20 prevent the valve disc 26 from opening inwardly during inhalation . above the valve disc in the exploded view is a retainer ring 28 having the outer wall shown and an inner wall ( not shown ) which is of slightly smaller diameter . the outer wall screw threads over threads 30 of the valve housing wall 16 to hold the outer peripheral area of the valve disc in place , by means of the inner wall , when the unit is assembled . the retaining ring 28 has a series of projections or ribs to facilitate gripping the ring and twisting it off the threads 30 for removal . fig2 is a cross - sectional side view of the mouthpiece device showing the elevational relationship of the parts and passageways . for greater clarity , the retaining ring 28 and the valve disc have been removed . the circular connector 12 will fit into the conventional circular outlet port of nebulizer . the mouth shaped end piece 14 at the other end is positioned above the center line of the circular connector 12 . the back wall 13 of the connector 12 joins the connector to the upper mouthpiece . the valve housing 16 is part of the mouth shaped end piece 14 . inside the housing the support ring 18 together with the hub 20 and support arms 22 are arranged to support the valve disc 26 . when the mouthpiece is used by a patient , inspiration mist enters the circular connector 12 through its opening 32 and passes through the device and out the opening 34 in the mouthpiece . in that flow path inside the circular connector 12 is a deflector 36 which extends out at an obtuse angle from the inside wall of the circular connector 12 toward opening 34 . the purpose of the deflector is two fold . first , with regard to the incoming inspiration mist , the deflector deflects that gas stream away from the valve disc in the valve housing so that the mist will not strike the valve disc and thus there is no possibility that some of the mist might leave through the valve disc . the second function is that in the respiration cycle when the patient is exhaling , the exhalation gas will be deflected so that exhalation gas is directed into the valve housing 16 where it can exhaust through the valve disc 26 . fig3 is a top view of the thin valve disc 26 . the radial cuts 40 and annular cuts 42 in the valve disc facilitate draining the accumulated moisture back into the mouthpiece on inhalation . there can be many possible - cut patterns in the disc to define various flaps which will open upwardly when the exhalation pressure is applied to permit the exhalation gas to leave the mouthpiece . seen here are three radial cuts 40 from the center and three annular cuts 42 which define six flaps 41 . as exhalation gas pressure is applied from below , these flaps will open along the cut lines to let gas escape from the mouthpiece . fig4 is an outside view of the device showing again the elevational relationship between the circular connector 12 , its back wall 13 connecting to the higher level mouth shaped end piece 14 . the valve housing is made a part of the mouth shaped end piece 16 above where it connects to the circular connector . fig5 is a top view of the device without the retaining ring 28 and valve disc 26 . the support structure for the valve disc 26 is made up of the ring surface 18 , the three grille arms 22 and the central hub 20 . the end of the mouth shaped piece that is placed in the patient &# 39 ; s mouth has a greater width than the opposite end where the valve housing is located . the mouth end has an oval opening to better anatomically fit in the patient &# 39 ; s mouth . fig6 a - d illustrate various cut patterns for the valve disc 26 . in 6 a , each of six radial cuts the center form a flap 41 on either side of the cut in conjunction with annular cuts so as to provide twelve flaps which can open up in response to the exhalation pressure . in 6 b there are three large flaps 41 which pivot adjacent the disc center and extend toward the periphery . in 6 c where each radial cut meets the annular cut it forms the apex for a flap . thus here are five flaps formed in fig6 c . in 6 d each radial cut defines two flaps and so as to form six flaps formed . fig7 a , 7 b are plan views of alternative support means integral with the hollow mouthpiece element positioned so as to prevent the opening of the exhaust valve element during patient or user inhalation . referring to fig8 , the valve body 16 is provided with interrupted threads 30 evenly spaced around the outer circumference of the valve body to engage protrusion receiving internal threads ( not shown ) in the retaining ring 28 . a filter body 44 is shown as being configured with a cylindrical base member 47 which is sized to be snugly fit into the interior of the retaining ring 28 . the cylindrical base 47 extends below the filter body a distance that is less than the distance from the top of the retaining ring 28 to the flexible valve . in this manner , the filter body will be sized to be snugly received in the retaining ring which will abut the surface 48 without the cylindrical base touching or otherwise interfering with the function of the one - way valve element ( valve disc 26 ). optionally , a positive expiratory pressure ( pep ) valve 50 having a body 51 configured with a base member 52 which is sized to be received in the retaining ring 28 with a snug fit is provided which will enable the mouthpiece to be used as described in u . s . pat . no . 5 , 584 , 285 as either a pep device or as a part of the breathing circuit described therein with a filter to reduce exposure to excess aerosol medication . this is an important use to reduce health care provider exposure to patient contaminating aerosol or highly toxic medicants . the pep valve 50 , which will be described more fully hereinafter , is provided with the feature of adjustable back pressure which can be used to aid in the deposition and prevent the loss of aerosol in the lungs by creating airflow conditions which are more controlled and thereby permit deeper deposits which are less susceptible to mucocillary removal . such devices also help improve patient compliance with proper breathing techniques and helps to strengthen the muscles of respiration . this can be accomplished by providing either inhalation resistance , exhalation resistance or both . further , the incorporation of the variable resistance valve combines maximum aerosol density and respiration of optimum particle size for many treatment options including antibiotics , antivirals , enzymes , bio - reactive substances and genetic therapies . the pep valve 50 has a variable cross - section semicircular slot 53 ( fig1 ) on a rotationally movable plate 54 can be adjusted to present the capability of providing for variable back pressure provided by an adjustably sized outlet for the opening 55 which communicates with the interior of the pep body 51 . the back pressure may be measured , if clinically desired , by a manometer fitted to the nipple 56 during treatment or exercise . a handle 57 is integral with the plate 54 which is rotatably captive in the pep body 51 by means of a rivet or pivot 58 . the components are sized to prevent significant leakage which could alter the value of the manometer readings . in operation the mouthpiece , the pep valve may be incorporated into a breathing circuit with or without the one way valve disc and filter 44 , or a pressurized external gas source can be used for various therapies and exercises . such a device , which can be called a positive airway pressure adjunct and can be used in modified circuits to mobilize secretions , treat atelectasis and provide continuous positive airway pressure ( cpap ), positive expiratory pressure ( pep ), and expiratory positive airway pressure ( epap ) therapies . during cpap therapy , the patient breathes from a pressurized circuit against a threshold resistor ( water - column , weighted , or spring loaded ) that maintains consistent preset airway pressures from 5 to 20 cm h 2 o during both inspiration and expiration . by strict definition , cpap is any level of above - atmospheric pressure . cpap requires a gas flow to the airway during inspiration that is sufficient to maintain the desired positive airway pressure . during pep therapy , the patient exhales against a fixed - orifice resistor , generating pressures during expiration that usually range from 10 to 20 cm h 2 o . pep does not require a pressurized external gas source . during epap therapy the patient exhales against a threshold resistor , generating preset pressures of 10 to 20 cm h 2 o . epap does not require a pressurized external gas source . the device described herein is suited for pep therapy in the configurations shown . the size of the device provides both convenience comfort and greater independence for the patient during treatment . referring now to fig1 , 12 , 13 , 14 , 15 and 16 , a filter housing 44 is provided which will fit into the retaining ring 28 as previously described . a filter element 60 is received in the housing 44 which is hinged at the back 61 and closed at the front with a suitable latch structure 62 . the interior of the filter housing 44 is provided with a peripheral apron 63 and locator pins 64 which , in combination with the structure of the rear of the housing locates the filter element 60 on the apron ( as shown in fig1 ). clamping protrusions 65 molded into the lid 66 of the filter housing 44 are sized to firmly squeeze the edge of the filter element 60 onto the apron 63 to seal and prevent lateral movement of the element during use . ribs 67 are provided as projections from the cylindrical base 47 to provide central support for the filter element to minimize sagging . the filter element itself is selected to provide a significant reduction in visible particles , a 3m product 0 . 3 micron filtrate filter being preferred . in the configuration shown the effective area of the filter exposed to patient exhalation is nominally a surface measuring about 5 cm by about 7 . 5 cm ( i . e . about 37 . 5 cm 2 ). in order to be most effective , the inlet and exhaust areas of the filter housing should be comparable in cross - sectional area . the textured outlet areas shown in fig1 on the top surfaces of the housing 44 are therefore sized to be substantially the same in effective exhaust area as the inlet cross - sectional area . in one arrangement the filter housing may be attached to the retaining ring by way of the pep valve . an alternative construction for the pep valve will now be described with reference to fig1 and 20 . a cylindrical body 70 has an integral annular flange 71 defining an annular array of three evenly spaced openings 72 defining a passageway through the valve under the control of a rotatable valve member 73 which defines an annular array of openings 74 of the same spacing as openings 72 and having a range of different sizes . the member 73 is rotatable by a handle 75 , integral therewith , relative to the openings 72 to adjust the size of the passageway . the valve member 73 is captively mounted to the body 70 by detents 76 formed on an exterior cylindrical surface of a hollow boss 77 integral with and forming a central opening in the flange 71 . the boss 77 defines a plurality of axially extending slots to provide for assembly as the detents are inserted in a bore of the valve member 73 for engagement with recesses 78 therein . valve member locating detents 84 resiliently retain the valve member 73 relative to body recesses 85 to retain desired alignment of openings 72 and 74 . a poppet valve member 79 is located in the central opening in the flange 71 and seats under the bias of a spring 80 against a valve seat 81 . the poppet valve member 79 includes a guide spider 82 about the spring 80 which is guided by a spider guide opening in the boss 77 to control alignment of the poppet valve member 79 with the valve seat 81 . in similar fashion to the pep valve described with reference to fig8 , 9 and 10 , the body 70 defines a base member 82 to be received in the retaining ring 28 and nipple 83 for attachment to a manometer to measure back pressure , if desired . in use , the passageway is adjusted to desired cross - sectional area by rotation of the valve member 73 . during exhalation , if the back pressure in the body 70 below the poppet valve exceeds the bias of spring 80 , the poppet valve member 79 lifts from the valve seat overcoming the spring bias to relieve the back pressure by allowing exhaled gas to bypass the passageway . the pep valve of this invention has a controllable exhalation resistance of from 5 - 20 cm . h 2 o ( water pressure ) at flow rates of 10 - 55 liters / minute . the pressure relief poppet valve is spring biased to insure that flow resistance values over 20 cm . h 2 o are actively vented .	0
a preferred embodiment of a first filtering device in the present invention , as shown in fig1 includes a water storing tank 1 , a filter 2 , an activated carbon filter 3 and a critical filter 4 as main components combined together . the water storing tank 1 is provided in a fishpond a ( or an aquarium ) or at its periphery for storing fish - raising water by blending underground water ( fresh water ) with seawater , and for storing dirty water of the fishpond a or the aquarium . the filter 2 is installed behind the water storing tank 1 for pumping out the fish - raising water stored in the water storing tank 1 and removing bad substances inside such as comparatively large grains of soiled mud , limestone , irony substance or other heavy metals so as to purify raising water by the filtering materials filled in it . the filtering materials of the filter 2 consist of rough sands , fine sands and charcoal dregs orderly filled inside for filtrating and eliminating rough , medium and fine bad substances layer by layer . the activated carbon filter 3 filled with activated carbon is provided behind the filter 2 for eliminating odor , flavor , color and poison to clean the raising water . the critical filter 4 is installed behind the activated carbon filter 3 for filtrating comparatively fine impurities and getting rid of harmful substances ( like nitrogen ) in raising water to heighten water quality and supply a fishpond a ( or an aquarium ) with the cleanest raising water . the critical filter 4 is provided with filtering membrane or special filtrating material for removing or reducing afloat nitride such as ammonium nitrogen ( n2 ) and nitrite nitrogen ( n3 ) easily causing fish , shrimps and the like to become ill or dead in raising water , once more effectively elevating the quality of raising water . when the raising water in a fishpond a ( or an aquarium ) deteriorates and becomes soiled ( i . e . raising water not matching with the proportion of ph value ), the soiled raising water will be stored together in the water storing tank 1 and then pumped into the filter 2 by a water pumping motor . subsequently , the filter 2 carries on filtering this soiled raising water layer by later to remove a great amount of comparatively large grains of impurities . next , the activated carbon filter 3 functions to get rid of the odor , flavor , color and poison of the raising water , and the critical filter 4 keeps on filtrating , and eliminating the harmful substances still remaining in raising water . lastly , ninety percent of completely filtrated raising water is sent back to the fishpond a ( or the aquarium ), and the rest can be filtrated again or pumped out of the fishpond , achieving effect of purifying raising water , which can be used in circulation . additionally , the fish - raising water of a fishpond a ( or an aquarium ) may unavoidably decrease in one period of raising fish and in the process of circulative filtration . in such case , original water 8 ( underground water ) blended with seawater in a proper proportion ) can directly be poured into the fishpond a ( or the aquarium ) to supply what is insufficient . another preferred embodiment of a second filtrating device in the present invention , as shown in fig2 includes a water storing tank 1 , a filter 2 , a critical filter 4 , a powerful oxidizing device 5 , a storing barrel 6 and an ozone sterilizing device 7 as main components combined together . the powerful oxidizing device 5 is deposited before the water storing tank 1 for turning comparatively large grains of organic substances into small ones by the ozone mixed inside to be filtered easily so as to lighten the filtrating burden of subsequent filtrating devices of good precision and high prices . in addition , after fish - raising water is managed in circulation for a period of time , its ph value and its amount of oxygen may gradually decrease , and in consequence it is liable to lower the fish - raising density . therefore , a store barrel 6 is additionally provided behind the critical filter 4 for checking and testing the ph value and the oxygen amount of the fish - raising water so as to properly add sea water to adjust the ph value and the oxygen amount to a proper density . furthermore , an ozone sterilizing device 7 is installed before the critical filter 4 for pouring a definite amount of ozone ( o 3 or o 2 ) into the fish - raising water to let the ozone dissolving into the fish - raising water maintain an amount over 7 . 5 ppm for incessantly carrying on sterilizing during the period when the fish - raising water in the store barrel 6 or in the fishpond a is delayed to be managed . thus , a definite amount of oxygen can be maintained in the fish - raising water , and the burden of the critical filter 4 can be lightened . furthermore , the filters used in the invention include a gravity - mode filter , a pressure - mode filter or a tube - mode filter . the gravity - mode filter 21 , as shown in fig3 consists of a filtering chamber 211 , a first water storing chamber 212 and a second water - storing chamber 213 . the filtering chamber 211 is installed inside with a low water - level sensor 2111 , a high water - level sensor 2112 and a water - pumping device 2113 . when fish raising water is pumped into the gravity - mode filter 21 , it is first filtered by the filtering material filled in the filtering chamber 211 to let soiled mud , limestone , iron or other heavy metals in the fish - raising water removed , and then stored in the first water - storing chamber 212 . and when the fish - raising water of the first water storing chamber 212 overflows to the second water - storing chamber 213 , it can timely flow out through a water guiding pipe into a next process . but , when the filtering material of the filtering chamber 211 contains too much impurities , the amount of the fish - raising water flowing through the filtering chamber 211 is certainly larger than that of the fish - raising water flowing from the filtering chamber 211 into the first water - storing chamber 212 , letting the water level in the filtering chamber 211 become higher and higher . in case - the water level in the filtering chamber 21 becomes high enough to reach the high water - level sensor 2112 , the water pumping device 2113 is started to pump out the fish - raising water of the filtering chamber 211 , and in the mean while this pumped water washes and cleanses the filtering material of the filtering chamber 211 , because the impurities of the filtering material together with the stirred fish - raising water are pumped out at the same time . on the contrary , when the water level in the filtering chamber 211 falls below the low water - level sensor 2111 , the water pumping device 2113 is turned off , and the gravity - mode filter 21 functions normally again . the pressure - mode filter 22 , as shown in fig4 consists of a filter 221 , a first switch 2212 , a second witch 2213 , a water - storing tank 222 , a high water - level gauge 2221 a low water - level gauge 2222 and a water - pumping device 223 combined together . the filter 221 is provided with a first switch 2212 at a water intake end having a water outlet installed with a second switch 2213 inside . the water - storing tank 222 is provided behind the filter 221 , having a high water - level gauge 2221 at an upper location and a low water - level gauge 2222 at a lower location . when fish - raising water is pumped into the pressure - mode filter 22 , it is first filtered to eliminate its soiled mud , limestone , iron or other heavy metals layer by layer . after that , this filtered fish - raising water is pumped into , the water - storing tank 222 by the water - pumping device 223 and then gets to a next process through a water - guiding pipe . but , when the water level in the water - storing tank 222 becomes high enough to reach the high water - level gauge 2221 , the first switch 2212 at the water intake end is turned off , and the second switch 2213 at the water outlet is turned on to activate the water - pumping device 223 to pump the fish - raising water in the water - storing tank 222 to flow back to the filter 221 and then flow out of the water outlet of the filter 221 . under such a condition , the impurities of the filtering material 2214 together with the fish - raising water can flow out at the same time , because the fish - raising water is stirred to wash and cleanse the filtering material 2214 during pumping - out process . on the contrary , when the water level in the water - storing tank 222 falls and reaches the low water - level gauge 2222 , the first switch 2212 at the water intake end can be turned on , and the second switch 2213 can be turned off , letting the water pumping device 223 recover to operate and make the pressure - mode filter 22 function normally again . the tube - mode filter 23 , as shown in fig5 is composed of a proper number of filtrating tubes 231 . in a filtering process , raising water is pumped into the interior of the tube - mod - e filter 23 and then flows into each filtering tube 231 to be filtered by the filtering material filled in the filtering tube 231 to eliminate solid mud , limestone , iron or other heavy metals layer by layer . subsequently , the filtered fish - raising water is gathered together by the filtrating tubes 231 and then flows to a next process through a water - guiding pipe . these filtering tubes 231 can be taken out to be cleaned , or replaced with new ones so as to let the tube - mode filter 23 operate normally as usual again . as can be , noted from the above description , the invention has the following advantages . 1 . fish - raising water of the best quality can incessantly be supplied to a fishpond or an aquarium in accordance with various requirements , greatly lowering the probability of changing fish - raising water , not restricting fish - raising locations , preventing geologic strata from sinking due to excessive pumping of underground water , and preventing seawater from invading land . 2 . soiled mud and impurities in the fish - raising water can fully be eliminated to prevent marsh gas and poison from generating . further , the purity value and the ph value as well as the oxygen amount of the fish - raising water can be checked , tested and adjusted , maintaining the quality of fish - raising able to satisfy the standard , and largely increasing raising density and growth rate . 3 . in a raising process , low probability of changing water , high fish - raising density and fast growth rate can not only save much cost dispensed in replacing raising water , but also increase volume of production of fish and shrimps or the like and elevate raising profit . 4 . when raising water deteriorates or becomes soiled , its water quality turns acidic , with its ph value being around 6 . 0 ± 0 . 5 and its oxygen amount around 4 . 5 ± 0 . 5 ppm . but , after the raising water is filtered , the ph value of its purified water is around 7 . 5 ± 0 . 5 and its amount of oxygen is around 7 . 5 ± 0 . 5 ppm . it is quite obvious that the quality of filtered raising water is far better than that of unfiltered dirty raising water . besides , the filtering materials in the filter , the activated carbon filter and the critical filter can timely be replaced . while the preferred embodiments of the invention have been described above , it will be recognized and understood that various modifications may be made therein and the appended claims are intended to cover all such modifications that may fall within the spirit and scope of the invention .	0
fig1 is a block diagram illustrating network 10 constructed having route server 100 providing routing information on router 101 and router 102 to looking glass web server 103 . as shown in fig1 , router 101 and 102 establish bgp sessions with route server 100 in order to send its routing information . looking glass web server 103 is then able to provide users access to the routing information collected and stored on route server 100 . therefore , in addition to the processing cycles that routers 101 and 102 use to perform routing between themselves and any other peering router , routers 101 and 102 expend additional processing cycles connecting and communicating with route server 100 , thus , decreasing their overall efficiency . fig2 is a block diagram illustrating network 20 with network monitor 200 configured according to one embodiment of the present invention . unlike the system in network 10 , network monitor 200 monitors the communication between routers 201 and 202 through tap 203 without requiring a separate bgp session / connection with either or both of routers 201 and 202 . similarly to network 10 , network 20 is configured with route server 205 providing access to the routing information via looking glass web server 206 . however , as tap 203 eavesdrops on the data packets being communicated between peering routers 201 and 202 , bgp proxy 204 reassembles the tcp connection information and the bgp session data and updates therein , and then emulates a bgp session with route server 205 using the bgp sessions information trapped from the communication between peering routers 201 and 202 . thus , route server 205 believes that it is physically in communication with both of routers 201 and 202 , without there being an actual drain on routers 201 and 202 &# 39 ; s processor resources . it should be noted that typical rs generally listen to one well - known port ( usually port 179 ). however , embodiments of the present invention may generally operate with rs that are capable of listening on multiple different ports . this allows the rs to maintain simultaneous connections with multiple bgp session streams emulated from a bgp proxy , such as bgp proxy 204 shown in fig2 . similarly , bgp proxies configured according to various embodiments of the present invention may use network interface cards ( nic ) that support multiple addresses or establishing multiple tcp connections on different ports . although fig2 illustrates an embodiment of the present invention monitoring a single peering session , additional embodiments of the present invention may monitor any desired number of peering sessions . fig3 is a block diagram illustrating an additional embodiment of the present invention monitoring routers 303 - 305 . integrated network monitor 300 includes bgp proxy 306 , route server 307 , and looking glass web interface 308 . such an integrated embodiment may provide a compact form . tap 301 taps into the peering communication session between routers 303 and 305 and transmits the captured routing information to integrated network monitor 300 . tap 302 taps into the peering communication session between routers 303 and 304 and also transmits the captured / copied routing information to integrated network monitor 300 . the various embodiments of the present allow wider deployment of router monitoring devices because they teach non - invasive information capturing and may not require router configuration changes . furthermore , because no extra bgp sessions are set up between the monitored routers and the monitoring system , no extra cpu cycles are used in the monitored routers . an additional by - product of the embodiments of the present invention is that it allows for detection of router attacks . current monitor methods typically do not show scans or attacks against routing protocols because routers typically discard such unexpected data packets with their routing protocol messages unless a complex , extremely cpu intensive debugging process is activated . however , because the embodiments of the present invention generally capture all of the data packets in the communication sessions between routers , the various embodiments of the network monitor may then be capable of logging routing information from such unexpected origination or destination addresses that would otherwise be discarded by the monitored router . fig4 is a block diagram detailing network monitor system 40 configured according to an embodiment of the present invention . tapping module 401 includes a physical interface tap , tap 404 , and tap interface ( ti ) module 405 . ti module 405 captures traffic using tap 404 , which may be a physical line tap or a built in means , such as a mirroring port , and filters out non - routing information . it should be noted here that mirroring ports of existing routers / switches typically copy all traffic and therefore may have problems keeping up with the received levels of traffic because aggregate traffic volume is generally higher than mirroring port capacity . today , capturing traffic at a speed of up to 100 mbit / sec could be problematic . it is important , therefore , that , in select embodiments of the present invention , tap 404 have real - time filtering and forwarding capabilities . bgp data directed to the monitored router &# 39 ; s ip address is forwarded to transport reconstruction ( tr ) module 406 of network monitor 400 for transport session data reconstruction . tr module 406 reconstructs tcp data streams and deals with packets that are out of order , packet retransmissions , and the like , in a timely fashion , i . e ., it cannot wait indefinitely when a packet is missing . tr module 406 should handle packets missed by the tap because the apparatus is non - intrusive and , therefore , cannot request retransmission of a missing packet . it should be noted here that bgp uses a maximum packet size of 4 kbytes while media such as ethernet generally allows payloads of less than 1 . 5 kbytes . in such cases , 4 kb bgp messages may be fragmented into smaller ip packets . ti module 405 should have the capability to filter data packets based on filter attributes , such as ip address , protocol ids , and destination ports . if the filter values of a captured packet matches a previously user - configured filters , the packet is forwarded to tr module 406 ; otherwise it is dropped . the ti module 405 reduces data traffic to the data needed for reconstructing tcp sessions associated with the exchange of routing information . this is to provide a scaleable solution for high - speed links . it should be noted here that some of the traffic destined to a particular router may not carry routing information , such as snmp or telnet . this data may be either dropped at ti module 405 or at tr module 406 depending on the sophistication of ti module 405 &# 39 ; s filtering capability . in such cases , ti module 405 may also filter based on a particular tcp port . in additional implementations , ti module 405 &# 39 ; s functionality may reside in a separate element that also houses tap 404 . tap 404 may also aggregate multiple physical tap &# 39 ; s serving each individual interface on the router &# 39 ; s line card as disclosed in commonly assigned , co - pending patent application ser . no . 10 / 407 , 719 , entitled , “ assisted port monitoring with distributed filtering .” as previously discussed , tr module 406 may also detect intrusions . if , for example , a router typically accepts only tcp connections from specifically configured routers ( peers ) and usually drops other competing tcp connection attempts that are directed to bgp port 179 without logging those attempts . unless the router &# 39 ; s configuration enables specific debugging / logging , such attempts will not be observed . tr module 406 could be configured to accept only traffic destined for the previously configured , monitored routers &# 39 ; ip addresses and log any other attempts to establish connection . screening and logging of tcp / ip traffic at this level could be even more detailed than when this is done by the router itself . it should be noted that the reconstruction of the transport protocol should take care of missing , and later retransmitted packets and out of order packets that may occur especially when dealing with multi - hop bgp , i . e ., when other routers separate the peering routers . tr module 406 , after reconstructing part of the tcp data stream , passes data to bgp message reconstruction ( bmr ) module 407 to assemble the bgp message and ensures that is complete . incomplete messages may be logged locally as missing or malformed bgp messages . depending on configuration of the apparatus , bmr 407 forwards the bgp message either to routing reconstruction ( rr ) module 408 or bgp session emulation ( bse ) module 410 . rr module 408 may be used when the apparatus provides an integrated solution and builds a routing information base ( rib ) according to rfc 1771 . the snapshots of the rib , as well as time stamped bgp update information , may be stored in local disk 412 . in this case , the invention may work as a rs that , via web interface ( wi ) module 408 , provides routing information to web users as looking glass applications do today . in the case where the invention provides a bgp proxy solution , bmr module 407 forwards the reconstructed bgp messages to bse module 410 . reconstructed bgp messages coming from a specific monitored router are then sent over a specific peering session that is established with external route server 411 or replicated into multiple peering sessions if more than one route server is interested in receiving the routing information of a specific router . bse module 410 may use either different ip addresses when talking to a specific rs or different tcp ports at the rs to distinguish between different peering sessions representing different monitored routers . the bgp session information includes time stamps that get recorded in addition to the bgp update information into local disk 412 . unlike zebra , which must break off the bgp session to save any bgp information is has , the reconstructed bgp updates with all of the time stamps accurately recorded thereon are stored into local disk 412 . therefore , two conflicting updates may be resolved by embodiments of the present invention by comparing time stamps and knowing that there were no interim updates that occurred when zebra would have been storing its data .	7
an embodiment in which the present invention is applied for a leaf type digital clock device shall be explained in detail with reference to fig2 to 4 . in fig2 and 3 , reference numeral 1 indicates a body frame provided with a through hole 1a in the bottom wall portion , 2 indicates a motor driving a clock mechanism and having a pinion 2a secured to its output shaft , 3 indicates a large gear meshing with the pinion 2a , 4 indicates a minute indicating leaf group including at least one leaf 4a provided with a lug 4a 1 , 5 indicates a minute indicating drum pivotally supporting the minute indicating leaf group 4 and connected with the large gear 3 through a clutch mechanism not illustrated so that the rotation of the motor 2 may be transmitted as reduced to one revolution per hour , 6 indicates an hour indicating leaf group , 7 indicates an hour indicating drum pivotally supporting the hour indicating leaf group 6 and having the rotation of the minute indicating drum 5 transmitted to it as reduced to 1 / 24 by a gear mechanism not illustrated , 8 and 9 indicate pressing springs for temporarily retaining in upright positions respectively the minute indicating leaf 4 and hour indicating leaf 6 appearing in an indicating window not illustrated , 10 indicates a main shaft supporting the minute and hour indicating drums 5 and 7 and 11 indicates a synchronizing piece made of a resilient material and having a side portion 11a engageable with a lug 4a 1 of a minute indicating leaf 4a , a bent portion 11b for temporarily locking the turning operation of the hour indicating leaf 6 , a cut portion 11c engaging with the main shaft 10 and an end portion 11d to be connected with the body frame 1 by being inserted in the through hole 1a and then twisted by about 90 degrees in the portion projected below the body frame . this synchronizing piece 11 is pushed in downward between the minute indicating drum 5 and hour indicating drum 6 while the cut portion 11c fits the main shaft 10 and the end portion 11d fits the through hole 1a and is then connected with the body frame 1 by twisting by about 90 degrees the end portion projected below the body frame 1 . that is to say , the synchronizing piece 11 is fitted so as to be held by the main shaft 10 and body frame 1 through the cut portion 11c and end portion 11d . the thus formed clock device operated as mentioned below . that is to say , the rotation of the motor 2 is transmitted to the minute indicating drum 5 through the pinion 2a , large gear 3 and clutch device not illustrated to rotate it clockwise in the position in fig3 at a rate of one revolution per hour . by such rotation of the minute indicating drum 5 , the minute indicating leaves 4 are unlocked one by one from the pressing spring 8 and are turned successively to indicate minutes . on the other hand , the rotation of the minute indicating drum 5 is transmitted to the hour indicating drum 7 through a reduction gear not illustrated to rotate it in the same direction as the minute indicating drum 4 at a rate of one revolution per 24 hours . by this rotation of the hour indicating drum 7 , the hour indicating leaves 6 are unlocked one by one from the pressing spring 9 and are turned to indicate hours . in such case , when the minute indicating leaf 4 indicates 59 minutes , that is , when the minute indicating leaf 4a having the lug 4a . sub . 1 comes to the indicating position , the lug 4a 1 will push in the side portion 11a of the synchronizing piece 11 leftward in fig3 and , as a result , the bent portion 11b will advance into the turning track of the hour indicating leaf 6 and , even if the hour indicating leaf 6 is unlocked from the pressing spring 9 , it will not operate to turn . thus , when the rotation of the minute indicating drum 5 advances and the minute indicating leaf 4a is unlocked from the pressing spring 8 and turns , the pressing of the side portion 11a of the synchronizing piece 11 by the lug 4a 1 will be released , therefore the synchronizing piece 11 will return to the original position due to its own habit and the bent portion 11b will retreat out of the turning track of the hour indicating leaf 6 . therefore , only in case the minute indication changes from &# 34 ; 59 &# 34 ; to &# 34 ; 00 &# 34 ;, the hour indicating leaf 6 and minute indicating leaf 4 will turn as synchronized with each other as a result . by the way , the main component parts of the clock device shown in fig2 are assembled as mentioned below . that is to say , first of all , the minute indicating drum 5 pivotally supporting the minute indicating leaves 4 and the hour indicating drum 7 pivotally supporting the hour indicating leaves 6 are passed on the main shaft 10 and are fitted between both side walls of the body frame 1 . further , the other component parts are assembled . then , the synchronizing piece 11 is inserted from above between the minute indicating drum 5 and hour indicating drum 7 to engage the cut portion 11c with the main shaft 10 . the end portion 11d is inserted into the through hole 1a and is twisted at the end by about 90 degrees to complete the assembling . as evident from this explanation , by the engagement of the end portion 11d with the through hole 1a , the rotation of the synchronizing piece 11 with the main shaft as a center is prevented . further , by twisting the end portion 11d , the synchronizing piece 11 is prevented from separation off the body frame 1 and is fitted so that the main shaft 10 and cut portion 11c may not be disengaged from each other . fig4 shows another embodiment of the present invention somewhat different from the above explained embodiment . according to this embodiment , the end portion 11d of the synchronizing piece 11 is inserted in the through hole 1a made in the rear wall of the body frame 1 and is then bent substantially at right angles to connect the synchronizing piece 11 with the body frame 1 . the assembly and operation of this device are the same as of the already explained embodiment . therefore , the same respective numerals are only attached to the substantially same component parts and portions as are shown in fig3 . any detailed explanation shall be omitted . fig5 shows still another embodiment of the present invention which is fundamentally the same as the embodiment in fig3 but is somewhat different in the structure of connecting the synchronizing piece 11 with the body frame 1 from the embodiments shown in fig3 and 4 . that is to say , according to this embodiment , a stepped portion 11e to be engaged with the front surface of the bottom wall of the body frame 1 when the end portion 11d is inserted in the through hole 1a and a tongue portion 11f to be engaged at the free end edge with the back surface of the bottom wall of the body frame 1 are formed in the end portion 11d of the synchronizing piece 11 so that , by holding the bottom wall of the body frame 1 between the stepped portion 11e and tongue portion 11f , the synchronizing piece 11 may be connected with the body frame 1 ( see fig6 .). as the tongue portion 11f is so formed as to expand upward at the free end , in case the end portion 11d is inserted into the through hole 1a , the tongue portion 11f will be once contracted by the peripheral edge of the through hole 1a but , the moment the tongue portion 11f passes out of the through hole 1a , it will again expand due to its habit . therefore , according to this connecting method , there are advantages that not only the synchronizing piece 11 can be incorporated into the device more simply and easily but also the position of the synchronizing piece 11 can be held very accurately and the bad influence of the cut portion 11c on the rotating motion of the main shaft 10 can be properly eliminated . further , according to this embodiment , a plurality of holes 11g are made in the synchronizing piece 11 so that the spring action of the synchronizing piece 11 may be made very softly . by the way , in this embodiment , too , the same respective numerals are attached to the same component parts and portions as in the already explained embodiments , the operation of the synchronizing piece is the same and therefore any further explanation shall be omitted . fig7 shows an embodiment in the case that the same structure as is explained with reference to fig5 and 6 is adopted for the method of connecting the synchronizing piece 11 with the body frame 1 . according to this embodiment , there are the same advantages as are explained with reference to fig5 and 6 but the operation of the synchronizing piece is the same as in the case of the other already described embodiments . therefore , the same respective numerals are only attached to the same component parts and portions . any detailed explanation shall be omitted . it is needless to say that the present invention is not limited to the avove described various embodiments , can be variously modified and changed within the range of the appended claims , is not limited to the time indicating device and can be applied to any other indicating devices wherein it is necessary to turn a plurality of leaf indicating means as synchronized .	6
reference will now be made in detail to the preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . in the drawings , like reference numerals designate identical or corresponding pads throughout several views and an additional letter designation is characteristic of a particular embodiment . referring to fig1 a thin film photovoltaic cell , supported on a metal - based foil is generally indicated by 10 . structure 10 has a width x - 10 and length y - 10 . width x - 10 defines a first photovoltaic cell terminal edge 45 and second photovoltaic cell terminal edge 46 . it is contemplated that length y - 10 is considerably greater than width x - 10 and length y - 10 can generally be described as &# 34 ; continuous &# 34 ; or being able to be processed in a roll - to - roll fashion . fig2 shows that structure 10 comprises a thin film photovoltaic structure 11 supported by metal - based foil 12 . foil 12 has first surface 65 , second surface 66 , and thickness &# 34 ; z &# 34 ;. metal - based foil 12 may be of uniform composition or may comprise a laminate of two or more metal - based layers . for example , foil 12 may comprise a base layer of inexpensive and processable metal 13 with an additional metal - based layer 14 disposed between base layer 13 and photovoltaic structure 11 . the additional metal - based layer may be chosen to ensure good ohmic contact between the top surface 65 of support 12 and photovoltaic structure 11 . bottom surface 66 of foil support 12 may comprise a material 75 chosen to achieve good electrical and mechanical joining characteristics to the substrate as will be shown . the thickness z of support layer 12 is generally contemplated to be between 0 . 001 cm . and 0 . 025 cm . this thickness would provide adequate handling strength while still allowing flexibility for roll - to - roll processing . photovoltaic structure 11 can be any of the thin film structures known in the art . in its simplest form , the photovoltaic cell combines an n - type semiconductor with a p - type semiconductor to form an n - p junction . most often an optically transparent window electrode such as a thin film of zinc or tin oxide is employed to minimize resistive losses involved in current collection . fig3 illustrates an example of a typical photovoltaic cell structure in section . in fig3 represents a thin film of a p - type semiconductor , 16 a thin film of n - type semiconductor and 17 the resulting photovoltaic junction . window electrode 18 completes the typical photovoltaic structure . the exact nature of the photovoltaic structure 11 does not form the subject matter of the present invention . fig4 refers to the method of manufacture of the foil supported photovoltaic structures generally illustrated in fig1 through 3 . the metal - based support foil 12 is moved in the direction of its length y through a deposition process , generally indicated as 19 . process 19 accomplishes deposition of the active photovoltaic structure onto support foil 12 . support foil 12 is unwound from supply roll 20a , passed through deposition process 19 and rewound onto takeup roll 2ob . process 19 can comprise any of the processes well - known in the and for depositing thin film photovoltaic structures . these processes include electroplating , vacuum sputtering , and chemical deposition . process 19 may also include treatments , such as heat treatments , intended to enhance photovoltaic cell performance . referring now to fig5 there are illustrated cells 10 as shown in fig2 . the cells have been positioned to achieve spacial positioning on the support substrate 21 . support structure 21 is by necessity non - conductive at least in that distance indicated by numeral 70 separating the adjacent cells 10 . this insulating space prevents shod circuiting from metal foil electrode 12 of one cell to foil electrode 12 of an adjacent cell . in order to achieve series connection , electrical communication must be made from the top surface of window electrode 18 to the foil electrode 12 of an adjacent cell . this communication is shown in the fig5 as a metal wire 41 . metal wire 41 is clearly impractical for inexpensive continuous production and is shown for illustration purposes only . it should be noted that foil electrode 12 is relatively thin , on the order of 0 . 001 cm to 0 . 025 cm . therefore connecting to its edge as indicated in fig5 would be impractical . referring now to fig6 and 7 , one embodiment of the substrate structures of the current invention is generally indicated by 22 . unit of substrate 22 comprises electrically conductive sheet 23 and electrically insulating joining portion 25 . 25 . electrically conductive sheet 23 has a top surface 26 , bottom surface 28 , width x - 23 , length y - 23 and thickness z - 23 . width x - 23 defines a first terminal edge 29 and a second terminal edge 30 of conductive sheet 23 . top surface 26 of conductive sheet 23 can be thought of as having top collector surface 47 and top contact surface 48 separated by imaginary insulating boundary 49 . the purpose for these definitions will become clear in the following . electrically conductive sheet 23 includes an electrically conductive polymer . typically , electrically conductive polymers exhibit bulk resistivity values of less than 1000 ohm - cm . resistivities less than 1000 ohm - cm can be readily achieved by compounding well - known conductive fillers into a polymer matrix binder . the substrate unit 22 may be fabricated in a number of different ways . electrically conductive sheet 23 can comprise an extruded film of electrically conductive polymer joined to a strip of compatible insulating polymer 25 at or near terminal edge 29 as illustrated in fig7 . alternatively , the conductive sheet may comprise a strip of electrically conductive polymer 23a laminated to an insulating support structure 31 as illustrated in section in fig8 . in fig8 electrically insulating joining portions 25a are simply those portions of insulating support structure 31 not overlaid by sheets 23a . it is contemplated that electrically conductive sheets 23 may comprise materials in addition to the electrically conductive polymer . for example , a metal may be electrodeposited onto the electrically conductive polymer for increased conductivity . in this regard , the use of a directly electroplateable resin ( der ) may be particularly advantageous . a further embodiment of fabrication of substrate unit 22 is illustrated in fig9 and 10 . in fig9 electrically conductive sheet 23b comprises electrically conductive polymer impregnated into a fabric or web 32 . a number of known techniques can be used to achieve such impregnation . insulating joining portion 25b in fig9 is simply an un - impregnated extension of the web 32 . fabric or web 32 can be selected from a number of woven or non - woven fabrics , including non - polymeric materials such as fiberglass . referring now to fig1 , an alternate embodiment for the substrate structures of the present invention is illustrated . in the fig1 , a support web or film 33 extends among and supports multiple individual cell units , generally designated by repeat structure 34 . electrically conductive sheets 35 are analogous to sheet 23 of fig6 through 10 . at the stage of overall manufacture illustrated in fig1 , electrically conductive sheets 35 need not comprise an electrically conductive polymer as do sheets 23 of fig6 through 10 . however , as will be shown , electrically conducting means , typically in the form of an electrically conductive polymer containing adhesive , must eventually be utilized to join photovoltaic laminate 10 to the top surface 50 of electrically conductive sheets 35 . in addition , the electrically conducting sheets 35 must be attached to the support carrier 33 with integrity required to maintain positioning and dimensional control . this is normally accomplished with an adhesive , indicated by layer 36 of fig1 . conductive sheets 35 are shown in fig1 and 12 as having length y - 35 , width x - 35 and thickness z - 35 . it is contemplated that length y - 35 is considerably greater than width x - 35 and length y - 35 can generally be described as &# 34 ; continuous &# 34 ; or being able to be processed in roll - to - roll fashion . width x - 35 defines a first terminal edge 53 and second terminal edge 54 of sheet 35 . it is important to note that the thickness of the conductive sheets 35 , z - 35 must be sufficient to allow for continuous lamination to the support web 33 . typically when using metal based foils for sheets 35 , thickness between 0 . 001 cm and 0 . 025 cm would be chosen . as with the substrate structures of fig6 through 10 , is helpful to characterize top surface 50 of conductive sheets 35 as having a top collector surface 51 and a top contact surface 52 separated by an imaginary insulating barrier 49 . referring now to fig1 a and 13b , a process is shown for laminating the metal - based foil supported thin film photovoltaic structure of fig1 through 3 to the substrate structures taught in fig6 through 12 . in fig1 a and 13b , photovoltaic cell structures as illustrated in fig1 through 3 are indicated by numeral 10 . substrate structures as taught in the fig6 through 12 are indicated by the numeral 22 . numeral 42 indicates a film of electrically conductive adhesive intended to join electrically conductive metal - based foil 12 of fig1 through 3 to electrically conductive sheet 23 of fig6 through 10 or electrically conductive sheets 35 of fig1 and 12 . it will be appreciated by those skilled in the art that the adhesive strip 42 shown in fig1 a and 13b is one of but a number of appropriate metal joining techniques which would maintain required ohmic communication . for example , it is contemplated that methods such as doctor blading a conductive resin prior to lamination , spot welding , soldering , joining with low melt temperature alloys , or crimped mechanical contacts would serve as equivalent methods to accomplish the ohmic joining illustrated as achieved in fig1 a and 13b with a strip of conductive adhesive . these equivalent methods can be generically referred to as conductive joining means . referring now to fig1 and 15 , there is shown the result of the lamination process of fig1 using the substrate structure of fig6 through 10 . fig1 a and 15a correspond to the substrate structures of fig6 and 7 . fig1 b and 15b correspond to the substrate structure of fig8 . fig1 c and 15c correspond to the substrate structures of fig9 and 10 . in the fig1 a , 15b , and 15c , electrically conductive adhesive layer 42 is shown as extending completely and contacting the entirety of the second surface 66 of metal - based foil supported photovoltaic cells 10 . this complete surface coverage is not a requirement however , in that foil 12 is highly conductive and able to distribute current over the expansive width x - 10 with minimal resistance losses . for example , the structure of fig2 shows an embodiment wherein electrical communication is achieved between conductive sheet 23 of fig6 and 7 and second surface 66 of foil 12 through a narrow bead of conductive joining means 61 . an additional bead of adhesive shown in fig2 by 44 , may be used to ensure spacial positioning and dimensional support for this form of structure . adhesive 44 need not be electrically conductive . in the fig1 a , 15b , and 15c , the conductive sheets 23 , 23a , and 23b are shown to be slightly greater in width x - 23 than the width of foil x - 10 . as is shown in fig2 , this is not a requirement for satisfactory completion of the series connected arrays . fig2 is a sectional view of a form of the substrate structures of fig6 and 7 laminated by the process of fig1 to the photovoltaic structures of fig1 - 3 . in fig2 , width x - 10 is greater than width x - 23 . electrical communication is achieved through conductive joining means 42 and additional joining means 44 to achieve dimensional stability may be employed . the only requirement of the current invention is that first conductive sheet terminal edge 29 be offset from first photovoltaic cell terminal edge 45 to expose a portion of top surface 26 of conductive sheet 23 . referring now to fig1 and 17 , there is shown an alternate structure resulting from the laminating process of fig1 as applied to the photovoltaic cells of fig1 - 3 and the substrate structure of fig1 and 12 . in a fashion similar to that of fig1 , 22 , and 23 , the first terminal edges 53 of conductive sheets 35 supported by insulating substrate 33 are slightly offset from the first terminal edge 45 of photovoltaic cells 10 . this offset exposes a portion of top surface 50 of conductive sheet 35 . electrical and mechanical joining of sheets 35 with second surface 66 of metal - based foil 12 is shown in fig1 as being achieved with conductive adhesive 42 as in previous embodiments . however , it is contemplated as in previous embodiments that this electrical and mechanical joining can be accomplished by alternate means such as soldering , joining with compatible low melting point alloys , spot welding , or mechanical crimping . comparing the sectional views of fig1 , 22 , 23 , and 17 , one observes many similarities . the most important common structural similarity is that the first terminal edges 29 of conductive sheets 23 be offset slightly from first terminal edge 45 of photovoltaic cells 10 ( fig1 , 22 , 23 ). similarly , first terminal edges 53 of conductive sheets 35 are slightly offset from first terminal edges 45 of photovoltaic cells 10 ( fig1 ). as will be shown , the resulting exposed top surface portions are used as contact surfaces for the final interconnected array . it should also be observed that the structures equivalent to those shown in fig1 and 17 can also be achieved by first joining photovoltaic cells 10 and conductive sheets 35 with suitable electrically conductive joining means 42 to give the structure shown in fig2 and laminating these strips to an insulating support web 33 . an example of such an equivalent structure is shown in fig2 , wherein the laminates of fig2 have been adhered to insulating web 33 in defined repeat positions with adhesive means 57 . as mentioned above and as shown in fig2 and 25 , conductive sheets 35 do not have to contact the whole of the bottom surface 66 of photovoltaic cell 10 . referring now to fig1 and 19 , beads 56 and 60 of insulating material having been applied to the first and second terminal edges 45 and 46 respectively of photovoltaic cells 10 . while these beads 56 and 60 are shown as applied to the structure of fig1 a , it is understood that appropriate beads of insulating material are also envisioned as a subsequent manufacturing step for the structures of 15b , 15c , 17 , 22 , 23 and 25 . the purpose of the insulating beads is to protect the edge of the photovoltaic cells from environmental and electrical deterioration . in addition , as will be shown the insulating bead allows for electrical interconnections to be made among adjacent cells without electrical shorting . it is noted that the application of insulating material 56 to first terminal edge 45 of photovoltaic cells 10 effectively divides the top surfaces 26 and 50 of conductive sheets 23 and 35 respectively into two regions . the first region ( region 48 of surface 26 or region 52 of surface 50 ) can be considered as a contact region for series interconnects among adjacent cells . the second region ( region 47 of surface 26 or region 51 of surface 50 ) can be considered as the contact region for interconnecting the substrate to the second surface 66 of photovoltaic cells 10 . referring now to fig2 and 21 , there is shown the method of forming the final interconnected array . grid fingers 58 of a highly electrically conductive material are deposited to achieve electrical communication between the top surface 59 of the photovoltaic cell 10 and the remaining exposed contact regions 48 or 52 of an adjacent cell . it is contemplated that these fingers can be deposited by any of a number of processes to deposit metal containing or metal - based foils or films , including masked vacuum deposition , printing of conductive inks , electrodeposition or combinations thereof . following deposition of the grid fingers , it would be normal to protect the integrated array with some form of encapsulant , but these latter processes do not form the subject matter of the present invention . it is important to recognize that the unique design and process taught by the present invention is accomplished in a fully additive fashion . no wasteful and costly material removal steps are needed to achieve the integrated series connected arrays taught . this is a significant advantage over the prior art . although the present invention has been described in conjunction with preferred embodiments , it is to be understood that modifications , alternatives and equivalents may be included without departing from the spirit and scope of the inventions , as those skilled in the art will readily understand . such modifications , alternatives and equivalents are considered to be within the purview and scope of the invention and appended claims .	7
the inventive apparatus shown in fig1 is made up of gas production chamber 20 , having refractory lining 22 for containing combustion gases in chamber 20 generated from partially decomposed cellulosic material 24 . incoming cellulosic material 26 is introduced through hopper 28 and conveyor 30 , which are designed to prevent substantial leakage of combustion gas from gas production chamber 20 . insulating layer 32 is supported by frame 34 , which is conventional structural angle iron . flame igniter 36 is provided as a pilot light to insure the limited combustion inside chamber 20 of the products of decomposition of cellulosic material 24 with the limited supply of air in chamber 20 . products of incomplete combustion , such as carbon monoxide , result from substances evolved from decomposing cellulosic material 24 . controlled amounts of gas and air are introduced through inlet lines 38 and 40 of flame igniter 36 to permit a permanent ignition flame to be present within gas production chamber 20 . support chute 42 is provided with through holes 44 and 46 for passage of air through the grate portion 48 thereof . through holes 44 are directed perpendicular to the plane of grate 48 , as is best seen in fig5 while through holes 46 are directed at an angle of 15 degrees downwardly from the normal , although through holes 46 can be provided at somewhat different angles instead . through holes 44 are oriented perpendicular to the plane of grate 48 in order to admit air to preheat cellulosic material 26 and 24 , and to lift partially decomposed cellulosic material 24 a short distance from the upper surface of grate 48 , leaving an air blanket 50 therebetween . through holes 46 in grate 48 are oriented downwardly at an angle from the perpendicular to the plane of grate 48 and , accordingly , impart a propelling force downwardly along the longitudinal extent of support chute 42 . the purpose of the disclosed arrangement of grate 48 with through holes 44 and 46 as described is to provide cooling for grate 48 , preheating of incoming air forming in air blanket 50 , propulsion of partially decomposed cellulosic material 24 downwardly , lifting of the partly decomposed cellulosic material 24 to reduce wear on the upper surface of grate 48 and thereby prolong the useful life of grate 48 , and to provide an accurately controllable flow of air into refractory gas production chamber 20 from blower 56 to support limited decomposition of cellulosic material 26 and 24 in a progressive manner as it moves downwardly in support chute 42 . it is contemplated that an apparatus described will be operated continuously for maximum eceonomic efficiency , with the products of decomposition of cellulosic material 26 in the form of charcoal and ash 52 . continuously operating conveyor 54 removes such non - destroyed material to an area which is separated from the interior of refractory gas production chamber 20 , conveyor 54 being constructed to prevent substantial escape of gases from chamber 20 therethrough . it is advantageous to remove non - destroyed material continuously in the manner described , since neither time nor temperature devices for removal of such material has been found satisfactory , since their use affects the production rate of the entire unit in a negative manner , leading to increased damage and maintenance due to a higher temperature in the interior of gas production chamber 20 . primary air blower 56 provides a controlled flow of air in the direction shown by arrows in duct 58 and in sheet metal wind box 60 , which is mounted and sealed parallel to the lower surface of grate 48 , and which provides a constant size air inlet means for forcing combustion , preheating of primary air and propelling of primary air through the through holes 44 and 46 of grate 48 . the thickness of grate 48 is predetermined to provide close control of the rate of flow of all incoming air . the pressure of air in wind box 60 is controlled to assist in proper destruction of cellulosic material 24 at a predetermined feed rate of incoming cellulosic material 26 . material entering gas production chamber 20 through hopper 28 is distributed more evenly over the entire surface of grate 48 thereby . inasmuch as the upper section of support chute 42 does not contain design slots or openings , the risk of unwanted gas combustion in incoming cellulosic material 26 is reduced , but conduction of heat from the lower section of grate 48 , combined with heating of air resulting from the pressure maintained in wind box 60 maintains grate surface temperature at about 500 degrees f ., resulting in preheating of incoming cellulosic material 26 . this speeds decomposition of incoming cellulosic material 26 as it passes downwardly toward the conveyor 54 in support chute 42 . this is particularly true prior to entry of cellulosic material 26 into the major area of gasification in gas production chamber 20 . through holes 44 and 46 are constructed a size which reduces the production of particulate matter in gas production chamber 20 during decomposition of cellulosic material 26 and 24 . gases produced , including a proportion of carbon monoxide , converge on the throat 62 of outlet duct 64 as indicated by the arrows in gas production chamber 20 as seen on fig1 . combustion gases in duct 64 then enter low velocity air canister 66 , which is of conventional construction , for removal of a substantial portion of particulate material , such as smoke or the like . hot combustion gases issuing from canister 66 then enter duct 68 , within which is located refractory nozzle 70 for introduction of secondary air forced therethrough by secondary air blower 72 . further blending and mixing of secondary air with hot combustion gas occurs in combustion chamber 74 , part of which is shown in fig1 and the end of which is shown in fig2 . electrode pair 76 is provided with a source of high voltage from high voltage feed line 78 to provide an ignition spark for completing the combustion of gases entering combustion chamber 74 from duct 68 . the product formed in combustion chamber 74 , which is now in a state of substantially complete combustion , is drawn from combustion chamber 74 by recirculation blower 80 for discharge through exit duct 82 . recirculation blower 80 is provided with a low velocity air box 84 to further remove particulate matter from the gas stream and thereby reduce such matters in the heated gas issuing from exit duct 82 . trapdoor 86 is used to remove accumulated solids as necessary , and valve 88 regulates the size of opening between blower 80 and air box 84 . if heated gases so purged of solid particulate matter are introduced into the interior of a lumber drying kiln , problems of undesirable residue deposits on the lumber are avoided . grate 48 is shown in fig4 as a perforated plate made of refractory material 88 interlaced with metallic needles 90 , grate 48 having through holes 44 at right angles to the plane of grate 48 , and through holes 46 angled downwardly at a predetermined angle with respect to a perpendicular . the angle of holes 46 is shown in fig5 as 15 degrees , which has been found to be an angle suitable for serving the purpose of assisting and propelling partially decomposed cellulosic material 24 downwardly through support chute 42 . preferably , refractory material 88 is a kaolin - based clay which has been baked into the sheet making up grate 48 . field experience with existing burner systems fitted with a metal grate of either a bar or slot configuration have a life of very short duration , even when the grate system is made of cast iron or stainless steel . such systems depend solely on the force of gravity to provide fuel flow , and day - to - day maintenance , as well as time in which such units are out of service , is high . grate 48 of the present invention is of hard castable refractory material in which stainless steel needles are interlaced . this construction eliminates a major source of difficulty with prior art arrangements utilizing a grate made entirely of metal , such metal grates being subject to expansion and contraction of the metal grate sections . these problems are minimized when special care is taken in preparation of the grate composition as herein described . the refractory material used is a kaolin - based material , such as that commonly sold under the trademark &# 34 ; plicast kl &# 34 ;, having a fusion point of about 3205 degrees f . and a service range of about 200 - 3000 degrees f . this process is exact , and must be adhered to closely if proper results are to be obtained . the procedure for manufacture of grate 48 is given in example 1 below . refractory nozzle 70 is shown in enlarged from in fig7 where it is located within aperture 92 in duct 68 , the nozzle 70 projecting into duct 68 from secondary air inlet pipe 94 . inlet pipe 94 is connected to secondary air blower 72 for transport of air in the direction indicated by the broken arrows in fig7 . flaps 96 are cut into the projecting portion of refractory nozzle 70 , and cap 98 in sealing the end of nozzle 70 forces upwardly traveling air to exit nozzle 70 through slits 100 formed by inwardly bent flaps 96 . with this arrangement , mixing of secondary air from refractory nozzle 70 with combustion gases passing horizontally along duct 68 is best seen in fig8 . the direction of air issuing from nozzle 70 is seen to be in a generally radial direction , but with a tangential component . fig9 shows spark igniter 76 held in place within combustion chamber 74 by support bar 104 . a mixture of combustion gas and secondary air enters combustion chamber 74 through duct 68 , and a pair of electrode tips 106 supports a spark resulting from application of high voltage carried by wire 108 through insulated support rods 110 . collars 112 adjustably positioned support rods 110 with respect to bar 104 . high voltage can be applied to tips 106 as needed to insure complete combustion of the gas mixture within combustion chamber 74 . alternatively , gaseous material introducted from duct 68 into chamber 74 can carry small tracers , which ignite the gaseous material as it is introduced to the secondary airstream . preferably , however , a continuous spark or natural gas pilot is used , in order to reduce the possibility of danger from unignited gases in combustion chamber 74 . example 2 presents results of a commercial test on a system of the present invention . combustion chamber 74 is preferably constructed of refractory board and is preferably rectangular in shape . recirculation blower 80 produces draft to remove the gaseous products of combustion from combustion chamber 74 , and the heated combustion products are then conveyed to the point of use , which is contemplated as the interior atmosphere of a lumber drying kiln . with the present invention , the support chute and grate is not adversely affected by heat generated by combustion in chamber 20 or by the chemical effects of gasification . the present invention avoids the necessity of time , temperature or electrical limiting devices or limited switches to control the introduction of fibrous material and withdrawal of ash and charcoal products . continuous operation , besides representing a more efficient use of invested capital , also tends to reduce damage and maintenance as well . with use of the support chute and grate of the present invention , necessity for mechanical devices to vibrate or dislodge cellulosic material in order to produce even fuel flow is avoided . in fact , no moving parts are required for forcing the flow of fuel . the continuous nature of the non - destroyed discharge , independent of time or temperature limiters , provides for equal removal of non - destroyed material throughout the full width of the removal system . with use of the particulate matter removal systems disclosed in the present invention , a problem commonly found with prior art systems is avoided , namely the deposition of residue or particulate matter on lumber dried in kilns furnished with the combustion gases of prior art devices . in addition , health and environmental hazards are successfully minimized with the present invention insofar as air pollution conventionally results from particulate matter removed in the canister , air box , and combustion chamber of the present invention . 100 pounds of the trademarked material &# 34 ; plicast kl &# 34 ; mix is added to precisely 5 quarts ( 10 . 4 pounds ) of water in a cement mixer . while the the mixing proceeds 11 / 2 pounds of stainless steel needles are gradually added to the mixture , the needles having the approximate dimensions 0 . 010 inches by × 0 . 022 inches × 1 inch , as illustrated in fig6 . the resulting material is mixed thoroughly in the cement mixer for 5 minutes , and then poured into prepared molds while vibrating for proper consistency . the mold is allowed to stand at room temperature for 15 hours . the cast section is then drilled to provide rows of 1 / 4 inch holes on 2 inch centers with alternate rows of these holes at a 15 degree diagonal . the sections are then cured in an oven at a temperature of 100 degrees f . the temperature of the oven is increased 50 degrees f . per hour until the oven temperature reaches 1000 degrees f ., at which level it is maintained for 8 hours . the temperature is then increased 100 degrees f . per hour until the oven reaches 2000 degrees f . the oven temperature is then decreased gradually until the sections are cooled to an ambient temperature . a commercial test was performed on a system shown in fig1 and 2 having a capacity of 10 , 500 , 000 btu &# 39 ; s , where grate 48 had a surface area of 35 square feet . the incoming cellulosic material 26 was southern pine planer shavings having a moisture content of about 15 %. the unit produced gas for a forced air heater , firing directly into the drying chamber of a high temperature lumber drying kiln held at about 240 degrees f . tests were run in 5 - to 24 - hour continuous cycles , starting with 68 , 000 pounds of material in a storage bin . the heat required to dry the lumber for each 24 - hour charge was 101 , 500 , 000 btu &# 39 ; s , or 507 , 500 , 000 btu &# 39 ; s for the 5 days of testing . at peak loading , the unit generated gas having a heat value of 10 , 480 , 000 btu &# 39 ; s from 1310 pounds of planar shavings per hour . to assure accuracy , the unit was attached to an existing propane fired furnace , with propane burner disconnected , and identical results were achieving using either propane or using the apparatus of the present invention . the test results show a production rate of 300 , 000 btu &# 39 ; s per square foot of grate surface area , at full firing temperature , with a turndown rate of 41 / 2 to 1 . throughout the specification and claims , parts and proportions have been given in weight percent unless otherwise specified , and temperatures are given in degrees f . unless otherwise specified . it should be particularly pointed out that with use of grate 48 of the present invention , gas combustion chamber 20 is enabled to run at a temperature of approximately 600 degrees lower than most alternative devices for burning of cellulosic materials such as wood chips . the interior of gas production chamber 20 never reaches a temperature greater than 1200 degrees f ., thereby avoiding slagging which occurs typically at temperatures of 1500 degrees f . or above . moreover , the structure of the gas production chamber avoids all horizontal shelf areas where material could collect and eliminate or hinder free flow thereof . the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .	8
in the following description , reference is made to the accompanying drawings which form a part hereof and which illustrate several embodiments of the invention . it is understood that other embodiments may be utilized and structural and operational changes may be made without departing from the scope of the invention . embodiments provide a latch mechanism coupled to an electronic component ( e . g ., hdd ) and a retention hole on a pcb . embodiments include an “ up and down ” latch mechanism on an electronic component ( e . g ., hdd ) and a retention hole ( i . e ., elongated slot ) made on a pcb ( printed circuit board ). fig3 a illustrates a top view of a hdd 300 with a latch mechanism 310 in accordance with certain embodiments . fig3 b illustrates a bottom view of a hdd 300 with a latch mechanism 310 in accordance with certain embodiments . fig4 a and 4b illustrate use of a latch mechanism on a hdd and a retention hole in a pcb in accordance with certain embodiments . fig4 a illustrates a hdd 400 with a latch mechanism 410 . also in fig4 a , the pcb 420 includes a retention hole 430 . it is to be noted that the retention hole 430 is on the opposite end of the pcb 420 from the connector 440 coupled to the pcb 420 . placement of the retention hole 430 in this manner enables precise placement and secure installation within a multi - drive tray and ensures secure electrical connection ( between the connector coupled to the hdd 400 and the connector 440 coupled to the pcb 420 . the connector coupled to the hdd 400 and the connector 440 coupled to the pcb 420 are capable of being connected together ( i . e ., may be said to mate ). in fig4 b , the hdd 400 is secured in the tray with the latch mechanism 410 . fig5 a illustrates and hdd and damping rubber bushings in accordance with certain embodiments . fig5 b illustrates a close - up of the rubber bushings in accordance with certain embodiments . in fig5 a and 5b , the hdd 500 includes two damping rubber bushings 510 , 520 that absorb vibrations as the drive in the hdd 500 rotates to store and retrieve data . fig6 and 7 illustrate a hdd with a latch mechanism having a specialized handle in accordance with certain embodiments . in fig6 , the hdd 600 includes latching mechanism 610 . it can be seen that the latching mechanism 610 includes a specialized handle with a touch point 612 ( e . g ., one that would fit a user &# 39 ; s thumb or finger ). fig7 illustrates a front view of a hdd with a latch mechanism having a specialized handle in accordance with certain embodiments . from the front view , it can be seen that the latch mechanism 610 coupled to the hdd 600 includes a touch point 612 and a latch tongue 700 ( i . e ., the portion of the latch mechanism 610 that is inserted into a retention hole ). the latch tongue 700 is able to act as a spring damper to absorb both shocks and vibrations . when the latch tongue 700 is in a lowered position , the latch tongue can be seen exiting the retention hole , which enables a user to easily recognize whether the latch mechanism is properly secured . fig8 a , 8 b , and 8 c illustrate push points 810 , 820 on a latch mechanism 800 in accordance with certain embodiments . fig8 a illustrates a side view of push points 810 , 820 on latch mechanism 800 . the push points 810 , 820 enable a user to more easily push the hdd into the tray . in certain embodiments , the push points 810 , 820 are curved indentations with grooves . fig8 b illustrates a top view of push points 810 , 820 on latch mechanism 800 . fig8 c illustrates a bottom view of push points 810 , 820 on latch mechanism 800 . fig9 a , 9 b , 9 c , and 9 d illustrate various views of a hdd 900 in accordance with certain embodiments . fig9 a illustrates a view of the latch mechanism 910 on the hdd 900 looking towards the latch mechanism 910 from the opposite end of the hdd 900 . fig9 b illustrates a top view of the latch mechanism 910 and damping rubber bushings 920 , 930 . fig9 c illustrates a side view of the latch mechanism 910 . fig9 d illustrates a front view of the latch mechanism . fig1 a , 10 b , and 10 c illustrated views of a latch mechanism 1010 in accordance with certain embodiments . fig1 a illustrates a top view of the hdd 1000 with latch mechanism 1010 being in a raised and unlocked position . fig1 b illustrates a front view of the hdd 1000 with the latch mechanism 1010 in a lowered and locked position . in fig1 b , the latch tongue 1020 of the latch mechanism 1010 is in a lowered and locked position . fig1 c illustrates a front view of the hdd 1000 with the latch tongue 1020 of the latch mechanism 1010 is in a raised and unlocked position . fig1 a and 11b illustrate views of a metal support 1100 in accordance with certain embodiments . a latch mechanism 1110 is coupled to the metal support 1100 , which holds an hdd ( not shown ). fig1 a illustrates a bottom view of the metal support 1100 with the latch mechanism 1110 . fig1 b illustrates a top view of the metal support 1100 . the electronic component is coupled to the metal support using four screws to retain the electronic component ( e . g ., drive assemble ) to the metal support . fig1 a and 12b illustrate exploded views of a latch mechanism coupled to a metal support 1200 in accordance with certain embodiments . in fig1 a and 12b , the latch mechanism includes a latch head 1220 , a latch front 1230 , and springs 1240 , 1242 screws 1250 , 1252 , 1254 are used to couple the metal support 1200 to the latch head 1220 and latch front 1230 . damping rubber bushings 1260 , 1262 are also coupled to the metal support 1200 . fig1 illustrates an hdd 1300 being installed into a tray in accordance with certain embodiments . fig1 illustrates the hdd 1300 after being installed into the tray in accordance with certain embodiments . fig1 a , 15 b , and 15 c illustrate views of a hdd 1500 and latch mechanism 1510 in accordance with certain embodiments . fig1 a illustrates a top view of the hdd 1500 and the latch mechanism 1510 , while fig1 b illustrates a bottom view of the hdd 1500 and the latch mechanism 1510 . fig1 c illustrates a sectional view of the hdd 1500 and the latch mechanism 1510 . the touch point 1520 ( i . e ., finger hold ), push points 1530 , 1532 , and pull back handles 1540 , 1542 enable a single hand operation for hdd installation by the domed shape ( i . e ., the curved top center portion forming the touch point of the latch mechanism is a domed shape ) and removal by the pull back handles . in particular , a user may use the touch point 1520 and push points 1530 , 1532 for installation . the user may then use the pull back handles 1540 , 1542 for removal of the hdd 1500 from the tray . in certain embodiments , the pull back handles are curved indentations of the head of the latch mechanism . the design of the latch mechanism is easy to use , intuitive ( i . e ., user friendly ), and tool - less ( e . g ., does not require a screw driver or other tools ). as an example , a user may hold the touch point of the latch mechanism to insert an hdd into a tray . the user may also use the push points to push the hdd into the tray to complete the insertion so that the latch tongue is inserted into the retention hole and the latch mechanism is in a locked position . the user may later use the pull back handles to raise the latch tongue so that the latch mechanism is in an unlocked position and remove the hdd from the tray . thus , embodiments provide a tool - less and small form factor design for electronic component ( e . g ., hdd ) mounting / retention . in certain embodiments , such a design is applicable to server and storage systems with multiple and dense hdd mounting . when mounting small form factor hdds in a tray , embodiments enable single hand operation for hdd installation and removal , with unique handle usability features ; anti - shock rubber feet and spring damper on the hdd for damage protection ; and hdd retention with a latch mechanism on the hdd and a retention hold on the pcb . the hdd includes a connector that connects to a connector on a pcb , and the latch mechanism is on the opposite side of the connector on the pcb . the foregoing description of embodiments of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the embodiments to the precise form disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the embodiments be limited not by this detailed description , but rather by the claims appended hereto . the above specification , examples and data provide a complete description of the manufacture and use of the composition of the embodiments . since many embodiments may be made without departing from the spirit and scope of the embodiments , the embodiments reside in the claims hereinafter appended or any subsequently - filed claims , and their equivalents .	6
the same parts are provided in both figures with the same reference characters . fig1 for example shows the high - pressure part of the waste heat steam generator 1 . the invention can naturally also be used in other pressures stages for regulation of the intermediate superheating . fig1 schematically represents a part of the flow path 2 of the flow medium m . of the heating surfaces of the economizer , evaporator and superheater usually disposed in the high - pressure part of the waste heat steam generator 1 only the last superheater heating surfaces 4 are shown . the spatial arrangement of the individual superheater heating surfaces 4 in the hot gas duct is not shown and can vary . the superheater heating surfaces 4 shown can each be representative of a plurality of serially connected heating surfaces which , for reasons of clarity , are not shown differentiated . before it enters the part shown in fig1 , the flow medium m is conveyed from a feed pump at the corresponding pressure into the high - pressure flow path 2 of the waste heat steam generator 1 . during this process the flow medium m initially passes through an economizer , which can comprise a plurality of heating surfaces . the economizer is typically disposed in the coldest part of the hot gas duct , in order to obtain a use of residual heat here to increase the efficiency . subsequently the flow medium m passes through the heating surfaces of the evaporator and a first superheater . in such cases a separation device can be disposed between the evaporator and superheater , which removes the residual moisture from the flow medium m so that only pure steam gets through to the superheater . disposed on the flow medium side downstream from a first superheating heating surface not shown in the figure is an intermediate injection valve 6 , a further final injection valve 8 is disposed after the last superheater surface 4 . here cooler and unevaporated flow medium m for regulating the outlet temperature at the outlet 10 of the high - pressure part of the waste heat generator 1 can be injected . the amount of flow medium m introduced into the intermediate injection valve 6 is regulated via the injection valve 12 . the flow medium m in this case is supplied via an overflow line 14 branching off beforehand in the flow path 2 . disposed in the flow path 2 for regulating the injection are a number of measurement devices , namely a temperature measurement device 16 upstream from the intermediate injection valve 6 , a temperature measurement device 18 and a pressure measurement device 20 downstream from the intermediate injection valve 6 and upstream from the superheater heating surfaces 4 , as well as a temperature measurement device 22 downstream from the superheater heating surfaces 4 . the other parts of fig1 show a regulation system 24 for the intermediate injection . first of all a temperature nominal value is set at a nominal value generator 26 . this temperature nominal value is switched together with the temperature measured at the temperature measurement device 22 downstream from the superheater heating surface 4 to a subtractor element 28 , where the discrepancy between the temperature at the outlet of the superheater heating surfaces 4 and the nominal value is thus formed . this discrepancy is corrected in an adder element 30 , wherein the correction models the time delay of a temperature change during passage through the superheater heating surfaces 4 . to this end the temperature at the inlet of the superheater heating surfaces 4 is switched from the temperature measurement device 18 to a time - delayed ptn element 32 . the signal produced is switched together with the value from the temperature measurement device 18 to a subtractor element 34 , the output of which is supplied to the adder element 13 . the subtractor element 34 consequently only supplies a value other than zero for a certain time after a change of the temperature at the temperature measurement device 18 , which corrects the discrepancy present at the adder element . the signal present at the adder element 30 is switched together with further signals to a minimum element 36 , which takes account of further parameters : on the one hand the temperature downstream from the intermediate injection must have a certain distance from the pressure - dependent boiling temperature . for this purpose the pressure measured at the pressure measurement device 20 is switched into a functional element 38 , which outputs the boiling temperature of the flow medium m corresponding to this pressure . in an adder element 40 a preset constant from a generator 42 is added , which can amount for example to 30 ° c . and guarantees a safety gap to the boiling line . the minimum temperature thus determined is switched together with the actual temperature determined at the temperature measurement device 18 to a subtractor element 44 and the discrepancy thus determined is given to the minimum element 36 . for reasons of clarity a few switching connections are not shown in fig1 but are indicated by appropriate connection symbols & lt ; a & gt ;, & lt ; b & gt ;, & lt ; c & gt ;. furthermore following injection , a certain enthalpy of the flow medium m must be guaranteed which must not fall below a certain level for operational reasons . to this end the signals of the pressure measurement device 20 as well as those of the temperature measurement devices 16 , 18 upstream and downstream from the intermediate injection are switched to the enthalpy module connected upstream from the minimum element 36 . the enthalpy module 46 for its part calculates an associated temperature difference on the basis of these parameters which will be connected as an input signal to the following minimum element 36 . the signal determined in the minimum element 36 is connected to a regulation element 48 for controlling the injection regulation valve 12 . to enable the injection system to be used not only for regulation of the outlet temperature , but also to provide an immediate power reserve , said system comprises corresponding means for executing the method for regulating a short - term power increase of the steam turbine . initially for this purpose the temperature nominal value is reduced at the nominal value generator 26 , which results in an increase in the intermediate injection amount . however so that this leads directly to a power increase the , a rapid regulator response of the pi regulator element 48 should be guaranteed . the discrepancy caused between the actual temperature and the temperature nominal value will however be ameliorated by the ptn element 32 shortly after the change . in order to prevent this in the event of a desired rapid power increase , the signal of the nominal value generator 26 for the temperature nominal value is to be switched to a first - order differentiation element ( dt1 ). for this a pt1 element 50 has the signal of the nominal value generator 26 applied to it on the input side and is switched together with the original signal of the nominal value generator 26 to a subtractor element 52 on the output side , the output of which is connected to a multiplier element 54 which amplifies the signal by a factor , e . g . 5 , from a generator 56 . this signal is in its turn added by a subtractor element 58 into the signal to the adder element 30 . in the event of a change in the nominal value , the circuit outputs a signal differing from one via the pt1 element 50 , which is amplified by the multiplier element 54 and artificially disproportionately amplifies the value characteristic for the discrepancy . the signal via the loop with the ptn element 32 is then relatively smaller and a faster regulator response of the pi regulator element 48 is forced . thus a steam amount increase is rapidly achieved and the power of the downstream steam turbine is increased . fig2 now shows the parts of the regulation system 24 relevant to the final injection . there is a further temperature measurement device 60 here in the flow path 2 downstream from the final injection valve 8 likewise the temperature nominal value of the nominal value generator 26 is used here as a regulation variable . its signal is sent to a ptn element 62 which , like the ptn element 32 , models the time delay through the superheater heating surfaces 4 . its output signal is sent together with the signal of the nominal value generator 26 to a maximum element 64 , of which the output signal together with the signal from the temperature measurement device 60 is sent into a subtractor element 66 . the discrepancy determined there is sent to a pi regulation element 68 which regulates the injection regulation valve 70 of the final injection . in the event of a change in the temperature nominal value via the nominal value generator 26 , the ptn element , in combination with the maximum element 64 , here delays the regulator response of the pi regulator element 68 . in order to prevent this for the case of a final injection desired quickly , the time delay , i . e . the ptn element 62 , is deactivated for a time in such a case . this speeds up the regulator response accordingly and a fast power release is possible . a waste heat steam generator 1 regulated in this way is now used in a combined cycle power plant . here the hot waste gases of one or more gas turbines are routed on the flue gas side through the waste heat steam generator 1 , which thus provides steam for a steam turbine . the steam turbine in this case comprises a number of pressure stages , i . e . the steam heated up by the high - pressure part of the waste heat steam generator 1 and expanded in the first stage ( high - pressure stage ) of the steam turbine is routed into a medium - pressure stage of the waste heat steam generator 1 and is superheated there once again , but to a lower pressure level however . as already mentioned , the exemplary embodiment shows the high - pressure part of the waste heat steam generator 1 to illustrate the invention by way of example , but this can also be used in other pressure stages . a combined cycle power plant equipped with such a waste heat steam generator is able not only to provide a short - term power increase of the gas turbine which is restricted by the allowed maximum load change speed , but also to rapidly provide a power increase via an immediate power release of the steam turbine , which serves to support the frequency of the electricity grid . the fact that this power reserve is achieved by a double use of the injection valves as well as the usual temperature regulation also enables a permanent throttling of the steam turbine valves in order to provide a reserve to be reduced or dispensed with entirely , whereby an especially high level of efficiency during normal operation is achieved .	8
with reference to fig2 , a first embodiment of a vacuum pump 100 suitable for evacuating at least the high vacuum chamber 10 and intermediate chamber 14 of the differentially pumped mass spectrometer system described above with reference to fig1 comprises a multi - component body 102 within which is mounted a shaft 104 . rotation of the shaft is effected by a motor ( not shown ), for example , a brushless dc motor , positioned about the shaft 104 . the shaft 104 is mounted on opposite bearings ( not shown ). for example , the drive shaft 104 may be supported by a hybrid permanent magnet bearing and oil lubricated bearing system . the pump includes at least four pumping sections 106 , 108 , 110 and 112 . the first pumping section 106 comprises a set of turbo - molecular stages . in the embodiment shown in fig2 , the set of turbo - molecular stages 106 comprises four rotor blades and three stator blades of known angled construction . a rotor blade is indicated at 107 a and a stator blade is indicated at 107 b . in this example , the rotor blades 107 a are mounted on the drive shaft 104 . the second pumping section 108 is similar to the first pumping section 106 , and also comprises a set of turbo - molecular stages . in the embodiment shown in fig2 , the set of turbo - molecular stages 108 also comprises four rotor blades and three stator blades of known angled construction . a rotor blade is indicated at 109 a and a stator blade is indicated at 109 b . in this example , the rotor blades 109 a are also mounted on the drive shaft 104 . the third pumping section 110 also comprises a set of turbo - molecular stages , with blade angles generally reversed in relation to those of the second pumping section 108 . in the embodiment shown in fig2 , the third pumping section 110 contains the same number of stages as the second pumping section 108 , that is , the set of turbo - molecular stages 110 also comprises four rotor blades and three stator blades of known angled construction . a rotor blade is indicated at 111 a and a stator blade is indicated at 111 b . in this example , the rotor blades 111 a are also mounted on the drive shaft 104 . as shown in fig2 , downstream of the first to third pumping sections is a fourth pumping section 112 in the form of a holweck or other type of drag mechanism . in this embodiment , the holweck mechanism comprises two rotating cylinders 113 a , 113 b and corresponding annular stators 114 a , 114 b having helical channels formed therein in a manner known per se . the rotating cylinders 113 a , 113 b are preferably formed from a carbon fibre material , and are mounted on a disc 115 that is located on the drive shaft 104 . in this example , the disc 115 is also mounted on the drive shaft 104 . downstream of the holweck mechanism 112 is a pump outlet 116 . as illustrated in fig2 , the pump 100 has two inlets ; although only two inlets are used in this embodiment , the pump may have three or more inlets , which can be selectively opened and closed and can , for example , make the use of internal baffles to guide different flow streams to particular portions of a mechanism . for example , an inlet may be located interstage the second pumping section 108 and the fourth pumping section 112 . in this embodiment , a first , low fluid pressure inlet 120 is located upstream of all of the pumping sections . a second , high fluid pressure inlet 122 is located interstage the second pumping section 108 and the third pumping section 110 . a conduit 126 has an inlet 128 located interstage the first pumping section 106 and the third pumping section 110 , and an outlet 130 located interstage the second pumping section 108 and the fourth pumping section 112 . in use , each inlet is connected to a respective chamber of the differentially pumped mass spectrometer system . fluid passing through the first inlet 120 from the low pressure chamber 10 passes through the pumping section 106 , enters the conduit 126 at conduit inlet 128 , passes out of the conduit 126 via conduit outlet 130 , passes through the fourth pumping section 112 and exits the pump 100 via pump outlet 116 . fluid passing through the second inlet 122 from the middle pressure chamber 14 enters the pump 100 and “ splits ” into two streams . one stream passes through the second pumping section 108 and fourth pumping section 112 and exits the pump via the pump outlet 116 . the other stream passes through the third pumping section 110 and enters the conduit 126 at conduit inlet 128 to combine with the fluid passed through the first pumping section 106 . this enables the fluid passing through the third pumping section 110 against the “ usual ” flow direction ( i . e . away from the outlet ) to be connected to a similar vacuum point as the fluid passing through the intermediate pumping section 20 in the pump illustrated in fig1 . fluid passing through a third inlet 124 from the high pressure chamber 12 may be pumped by a backing pump 150 which also backs the pump 100 via outlet 116 . a particular advantage of the embodiment described above is that , by providing two pumping sections ( namely the second and third pumping sections 108 , 110 ) on either side of the inlet to the middle chamber 14 of the differentially pumped mass spectrometer system , the mass flow rate of fluid entering the pump from the middle chamber 14 can be at least doubled in comparison to the known arrangement shown in fig1 , without varying the level of the vacuum in the middle chamber . thus , the flow rate of sample and carrier gas entering the high vacuum chamber 10 from the middle chamber can also be increased , increasing the performance of the differentially pumped mass spectrometer system . with reference to fig3 , a second embodiment of a vacuum pump 200 suitable for evacuating the high vacuum chamber 10 and intermediate chamber 14 of the differentially pumped mass spectrometer system is similar to the first embodiment , save that the conduit 126 is replaced by a first conduit 202 and a second conduit 208 . the first conduit 202 has an inlet 204 located interstage the first pumping section 106 and the third pumping section 110 , and an outlet 206 located interstage the second pumping section 108 and the third pumping section 110 . the second conduit 208 has an inlet 210 located interstage the first pumping section 106 and the third pumping section 110 , and an outlet 212 located interstage the second pumping section 108 and the fourth pumping section 112 . a baffle member 220 ensures that fluid passing through the first pumping section 106 enters the first conduit 202 and the fluid passing through the third pumping section 110 enters the second conduit 208 . this arrangement can enable both the fluid passing through the third pumping section against the usual flow direction to be connected to a similar vacuum point as the fluid passing through the intermediate pumping section 20 in the pump illustrated in fig1 , and the fluid passing through the first pumping section to be connected to a similar vacuum point as the fluid passing through the pumping section 18 in the fig1 pump . with reference to fig4 , a third embodiment of a vacuum pump 300 suitable for evacuating the high vacuum chamber 10 and intermediate chamber 14 of the differentially pumped mass spectrometer system is similar to the first embodiment , with the exception that the rotors of the various pumping sections are located on a common impeller 302 . in this embodiment , the rotor blades 107 a , 109 a and 111 a of the first , second and third pumping sections 106 , 108 and 110 are integral with the impeller 302 , and the disc 115 of the fourth pumping section 112 is also integral with the impeller 302 . however , only one or more of these rotor elements may be integral with the impeller 302 , with the remaining rotor elements being mounted on the drive shaft 204 , as in the first embodiment , or located on another impeller , as required . the right ( as shown ) end of the impeller 302 may be supported by a magnetic bearing , with permanent magnets of this bearing being located on the impeller , and the left ( as shown ) end of the drive shaft 104 may be supported by a lubricated bearing .	5
with reference to the drawings there is shown therein an illustration of the operational concept of the shoulder launched unmanned reconnaissance system ( hereinafter slurs ) of the present invention indicated generally at 10 and shown in fig1 . in an overview of the operational sequence , the slurs reconnaissance air vehicle ( hereinafter rav ), indicated generally at 20 is aimed upwardly by the operator 115 and ejected from the portable launcher 30 . in the alternative the ( rav ) may be fired from a portable groundbased launcher ( not shown ) of the type having multiple support legs either manually or by remote control . in the preferred embodiment , the launch mechanism for the portable launcher 30 is a pneumatic or hydraulic cylinder , but springs or pyrotechnic propulsion may also be utilized to launch the ( rav ). since such launching mechanisms are well known to those skilled in the art , further detailed discussion of the same is not deemed necessary . the ( rav ) 20 accelerates to flight speed , the wings unfold , and the ( rav ) flies away under the control of the operator 115 using the ground control system 45 ( hereinafter gcs ). the ( rav ) is flown to the target area , indicated generally at 40 , and the on - board wide angle video system transmits video images of the target area 40 by radio or fiberoptics link to the ( gcs ) 45 for video processing and display . the ( gcs ) 45 includes ( rav ) controls which permit the operator 115 to direct the ( rav ) to a recovery area after flight is complete . the operator 115 sends a signal which stops the ( rav &# 39 ; s ) motor 21 and the rav descends in a stall mode . thereafter the ( rav ) is recovered , the battery and / or fiberoptic reel is replaced , the wings of the ( rav ) are refolded , and the rav is reinserted into the launcher 30 for re - use . the major sub - systems of the ( slurs ) of the present invention will now be described in further detail . the reconnaissance air vehicle ( rav ) is capable of providing reconnaissance to a range of up to 10 kilometers . the fuselage 22 carries on board a video camera , electric motor , battery , global positioning system ( gps ) receiver , auto - pilot , flight controls , and a data link system . as more clearly shown in fig2 the ( rav ) 20 weighs only ten pounds having a six foot wing span . the prelaunch stowed volume is 42 inches by 5 inches . the speed ranges from 25 miles per hour ( stall ) to 60 miles per hour ( structural limit ). ( rav ) endurance on a rechargeable battery package 23 is thirty minutes with an additional one hour capacity possible on non - rechargeable batteries . the ( rav ) features a u - shaped fuselage 22 up to 50 inches in length with a flat top 22a to support the wing deployment mechanism , indicated generally at 35 , and to provide a smooth aerodynamic joint between the fuselage 22 and the lower surface of the wing 24 . the entire flat top 22a of the fuselage is removable for easy access to the components contained therein , which simplifies maintenance tasks and reduces down time for repairs . in the preferred embodiment the fuselage 22 includes a bay 39 as shown in fig8 a and 8b located at the center of gravity which is utilized to carry and / or deploy various items such as sensors , or other packages . the bay 39 is provided with a rotary mechanism to minimize structural problems associated with the construction of such a bay . a geared , brushless electric motor 21 drives the large folding propeller 26 for maximum efficiency . the ( rav ) motor 21 can be stopped in flight to permit the aircraft to glide and conserve battery power , which causes the propeller 26 to fold back to minimize drag . since the wing 24 , particularly the fabric covering , is the component most susceptible to damage , the wing assembly is designed to be easily replaced . the entire wing assembly including the wings 24 , the wing deployment mechanism 35 , and servo controls 31 , is attached so it can be easily and quickly removed from the fuselage 22 as a unit . a critical feature of the ( rav ) 20 is the wing deployment mechanism 35 as more clearly shown in fig3 . the folded front spars 27 are positioned inboard of the rear spars 28 on the top of the fuselage 22 in a folded condition as shown in fig3 . it can be seen that the outboard tips of front spars 27 are pivotally attached to wing tip plates as at 29 , which also connect to the outboard tips of the rear spars 28 . the front spars 27 are larger and deeper than the rear spars 28 allowing the rear spars to nest inside the front spars in a folded condition as shown in fig3 . the difference in depth between the rear spars 28 and the front spars 27 provides storage volume for the wing fabric in the folded condition . a plurality of servos 31 located in the wing roots drive the large , elongated elevons 32 mounted on the trailing edge of the rear spars 28 to provide both pitch and roll control of the ( rav ). this design feature eliminates mechanical linkages from the fuselage 22 to the wing 24 requiring only power and control wires ( not shown ) leading through the wing root to the servos 31 . to minimize the ( rav ) volume in a folded condition , the elevons 32 are folded against the sides of the fuselage 22 prior to launch as most clearly shown in fig5 b . after launching the elevons 32 rotate upwardly during wing deployment to align themselves with the trailing edge of the wing as shown in fig2 . during wing deployment the rear spars 28 are pivoted outwardly by a plurality of torsion springs 33 disposed in the wing roots as shown in fig3 and mechanically coupled to the rear spars 28 , which initiate the unfolding process . the rear spars 28 rotate outwardly about their respective pivot points as at 34 on the outboard edge of the fuselage 22 pulling the front spars 27 forward and outboard as described hereinafter in further detail . the centerpiece 36 connecting the front spars 27 slides on a center rod 37 allowing the front spars 27 to move forward while simultaneously rotating outwardly . as the wing deployment continues the centerpiece 36 is pulled forward by a spring ( not shown ), which draws the wing fabric taut . once the front spars 27 are drawn forward to their functional position shown in fig2 the spring tension prevents the front spars from sliding rearwardly under aerodynamic loads . during flight in order to achieve stability in an aircraft such as the ( rav ) without a tail or canard surface , reverse camber must be built into the wing to counteract the cordwise aerodynamic moments . thus , during flight the full span elevons 32 of the ( rav ) are trimmed a few degrees upwardly in order to achieve stability during flight without having to build reverse camber into the wing structure . the outboard portion of the elevons 32 function primarily as ailerons since their lateral moment arm is large , but their pitching moment arm is very small . it will be appreciated by those skilled in the art that the elevons can be modified to various other configurations ( not shown ) or can be deleted entirely if additional control surfaces such as control fins are provided . in addition , the necessary reverse camber can be built into the wing structure if desired . it will be noted that although fig2 shows the front spars 27 being perpendicular in relation to longitudinal axis of the fuselage 22 , the wing deployment mechanism 25 can be arranged so that front spars 27 are disposed at an acute angle to the fuselage 22 resulting in a forward swept wing configuration ( not shown ). this configuration may be preferable in order to change the center of gravity of the ( rav ) 20 or for other reasons . in yet another alternative embodiment the wing deployment mechanism 35 can be arranged such that the front spars 27 are attached at the outboard pivot points 34 with the hinge points positioned toward the front of the fuselage 22 . in this arrangement the rear spars 28 nest inboard of the front spars 27 in a folded condition such that the rear spars 28 are attached to the center rod 37 during wing deployment . this configuration of the ( rav ) 20 results in a so - called delta wing aircraft ( not illustrated ). the ( rav ) 20 is provided with at least one ventral fin 50 including an associated fin deployment mechanism , indicated generally at 55 , as shown in fig4 . in the preferred embodiment a pair of ventral fins 50 are pivotally mounted on either side of the fuselage 22 as more clearly shown in fig . 5a wherein fins 50 are shown deployed and in fig5 b wherein fins 50 are folded upwardly along the sides of the fuselage 22 in a prelaunch condition . after launch the fins 50 are rotated downwardly into their flight position by the fin deployment mechanism 55 . this mechanism includes a torsion spring 53 being mechanically coupled in functional relation to pivot pins 51 . the springs 53 function to rotate the fins 50 downwardly after launch to the position shown in fig4 . however , spring tension is designed to permit the fins 50 to deflect aft during landing and recovery to prevent the ( rav ) 20 from cartwheeling to a crash landing . of course various other spring mechanisms such as the inclusion of integral springs at the pivot point may be utilized to effect the downward rotation of fins 50 . in an alternative embodiment ( not shown ) the fins 50 may pivot relative to a vertical center plane of the fuselage to form an inverted or upright v in cross - section . this fin configuration is accomplished by locating the pivot pins 51 on the curved portion of the side of the fuselage 22 or by the use of a cam ( not shown ) at the pivot point to divert the fin 50 away from the fuselage 22 at an acute angle . in addition , the fins 50 may include control surfaces or may be &# 34 ; all - moving &# 34 ; control surfaces in addition to or in lieu of the elevons 32 as described hereinabove . still referring to fig4 it can be seen that spring 53 incorporates a loop connector 57 which is adapted to receive a retaining wire or cable 58 at one end thereof and being anchored at an opposite end thereof as at 59 to a structural member 60 of the fuselage 22 . wire 58 is of a predetermined length to control the downward rotation of fin 50 to a desired position to provide optimal flight characteristics . primary power for the ( rav ) is provided by a 2 kilogram ( 4 . 4 pound ) battery pack , indicated generally at 15 , configured in two parallel cylinders of a plurality of individual c or d cells 16 . the individual battery cells 16 are placed end - to - end in series with a cross connection 17 at the end of one cylinder to the other as shown in fig6 . the primary power take off is a 28 . 8 volt heavy duty connector ( not shown ) to support the large motor current loads at the forward or primary end . a connector ( not shown ) at the opposite or secondary end of the battery pack provides 14 . 4 volt power for other onboard equipment . the battery cells 16 are preferably a rechargeable nickel - cadmium or nickel - metal hydride type which are used for training and normal operational missions . in addition , non - rechargeable lithium - sodium dioxide batteries may be used for longer duration missions to provide an hour or more of operation . a fiberglass rib member 18 disposed between the two rows of battery cells 16 reinforces the battery pack 15 and supports the power connectors to provide a positive contact with the onboard ( rav ) wiring system when the battery pack 15 is inserted into the fuselage as shown in fig7 . a key way or slot on the rib 18 prevents installing the battery pack 15 with incorrect polarity . the assembled battery pack 15 slides into the fuselage 22 through a rear opening 25 therein to permit efficient replacement of a battery pack 15 between flights and does not require opening the fuselage 22 for access during inclement weather . during flight the ( rav &# 39 ; s ) low light video camera image is transmitted to the ground control system ( gcs ) and displayed to the operator . a key feature in making the ( slurs ) of the present invention feasible is the omniview wide angle video system that transforms any portion of the recorded image from a 180 ° fisheye lens into normal undistorted images produced by conventional cameras . the ( rav ) is capable of carrying muliple cameras including a mixture of color and black and white for increased low light capability . since such wide angle video systems are well known to those skilled in the art , further detailed discussion of the same is not deemed necessary . in addition to the video camera system , the ( rav ) is capable of carrying additional sensors 38 that require exposure to the external environment such as sensors to detect chemical and biological warfare agents and other contaminents . the fuselage bay 39 being provided with a rotary deployment mechanism can rotate to expose such sensors without releasing them to obtain chemical data and , thereafter , rotate the sensors 38 inwardly into the bay of the fuselage to preserve samples for later analysis as shown in fig8 a and 8b . further , the fuselage bay is capable of carrying dropable payloads including ground sensor packages , jamming equipment , and dye markers ( not shown ) for police marking of fleeing vehicles . using the ( gcs ), the ( rav &# 39 ; s ) auto - pilot can fly it in pre - programmed patterns without constant attention , permitting the operator to maintain radio silence except when passing new flight directions to the ( rav ). in practical use the operator does not have to &# 34 ; fly &# 34 ; the ( rav ) using a small &# 34 ; joy stick &# 34 ; on the ( gcs ) except during launch and recovery . for the remainder of the mission the operator can program in waypoints and altitude and the auto - pilot will use the ( gps ) information to fly the desired patterns . the ( gcs ) calculates the ( rav &# 39 ; s ) relative bearing , range , and altitude through comparison with the ( gps ) signal . the ( gcs ) includes interfaces to record the video for later intelligence view or to relay the video immediately to higher echelons . the ( gcs ) design for civilian users and for some military users such as rear area security forces will be approximately the same size , but slightly heavier , than a lap top computer . for infantry use an even smaller ( gcs ) consisting of a small hand held controller and a backpack radio transceiver / video processor is contemplated . multiple ( gcs ) units can receive the ( rav ) video / radio down link . so - called individual observer units ( iou &# 39 ; s ) are provided with only the video receiver , processor and display units of the full blown ( gcs ) described hereinabove . thus , soldiers in different locations can each look at any part of the total video transmission . for example , in a situation where a patrol is entering a village , one soldier might utilize an ( iou ) to determine whether an enemy was around a corner of a building while another soldier utilizing a separate ( iou ) could be looking for infiltraters on the other side of the village . the ( slurs ) of the present invention includes related auxiliary equipment to support its use in a particular application . for example , the ( slurs ) may be carried in a flexible pouch ( not shown ) to permit the system to be carried by military personnel in the field . in addition , the entire ( slurs ) can be contained in a waterproof , pressurized tube to permit underwater carriage by navy seal teams and other special operations personnel . since such carrying equipment is well known to those skilled in the art , further detailed discussion of the same is not deemed necessary . from the above , it can be seen that the ( slurs ) of the present invention provides a practical and cost effective reconnaissance system for front line infantry . the relatively simple video system combined with the folding wing and compact fuselage permits the ( rav ) to be light enough to be carried and operated by one individual . the launcher protects the ( rav ) prior to launch , eliminates carrying cases , and permits launch of the ( rav ) from confined spaces . further , interchangeable radio and fiberoptic control in the ( rav ) provide maximum versatility including flights with no radio transmission at all . in addition , the use of the ( rav ) auto - pilot and pre - programmed flight profiles reduces the operator &# 39 ; s work load . the terms &# 34 ; upper &# 34 ;, &# 34 ; lower &# 34 ;, &# 34 ; side &# 34 ;, and so forth have been used herein merely for convenience to describe the present invention and its parts as oriented in the drawings . it is to be understood , however , that these terms are in no way limiting to the invention since such invention may obviously be disposed in different orientations when in use . the present invention may , of course , be carried out in other specific ways than those herein set forth without departing from the spirit and essential characteristics of such invention . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive , and all changes coming within the meaning and equivalency range of the appended claims are intended to be embraced therein .	1
the half - sectional view in fig1 shows a filter element 10 that comprises a filter medium 11 which is folded in zigzag pleats and is arranged concentrically around the central axis 12 . the filter medium is bounded at its axial end faces by a first end disk 13 and a second end disk 14 . the end disks ensure a tight seal and are secured to the filter medium 11 by adhesive bonding or , if the end disks are thermoplastic end disks and the filter medium is a thermoplastic material , by a welding operation . the end disks each have an outer flange 15 , 16 for concentric positioning of the filter medium 11 . whereas the end disk 14 has an essentially flat construction and an opening 17 to accommodate a connection in its inner area , the first end disk 13 is designed as a functional part and serves at the same time as a carrier for a valve 18 . valve 18 comprises the following components : first the first end disk 13 is provided with a bulge 19 . this bulge 19 forms a valve seat 20 in its inner area . within the valve seat there is a valve opening 21 through which liquid or gas can flow into to filter as long as the valve is open . the valve 18 is also provided with guide webs 22 , only one of which can be seen in this figure . in the area of the guide web 22 a contact pin 23 is provided , as explained in greater detail below . inside of the first end disk 13 is a valve body part or sliding valve 24 which is held by the guide webs and is bordered axially at the top by the valve seat 20 . this sliding valve 24 has a valve body surface 25 which cooperates with the valve seat 20 and in the position shown here ensures a seal of the interior space 26 within the filter medium 11 . the valve body part 24 has a cylindrical surface 27 and can move axially downward . the axial movement of the valve body 24 is guided by the guide webs 22 along the surface 27 . the open position of the valve is shown in fig4 . furthermore in fig1 snap - in elements 28 , 29 are also provided on the first end disk 13 and may cooperate with a housing cover 111 , as cover shown in fig4 . fig2 shows a perspective view of the first end disk 13 without the filter medium 11 . corresponding parts are identified by the same reference numerals . the valve body part 24 is shown in the axially lower end position , so the valve is opened . it can be seen here that the guide webs 22 and 22 a are opposite one another and other guide webs are provided , offset by 90 . degree . in relation to the guide webs shown here , so the valve body part 24 is reliably guided . a supporting edge 30 is provided in the area of the valve body surface and also ensures that the valve body part 24 is supported . as shown in fig1 , the sliding valve or valve body part 24 has an axially extending outer cylindrical surface 27 . as shown in fig2 with further reference to fig1 , the axially extending outer cylindrical surface 27 of the valve body part 24 is without gaps or grooves , ( i . e . a circumferentially continuous cylindrical surface 27 , also see fig1 ). fig3 shows the guide webs 22 , 22 a and 32 , 32 a . furthermore , this drawing figure shows the contact pins 23 , 23 a , 33 , 33 a that are arranged in the area of the guide webs and whose mechanism of action is described in greater detail below . the end disk 13 and the valve body part 24 are both made of a thermoplastic synthetic resin material . the valve body part 24 is simply engaged in the end disk at the time of assembly . as shown in fig3 , the guide webs 22 , 22 a and 32 , 32 a are formed by a radially inwardly leg and the respective contact pins 23 , 23 a , 33 , 33 a are formed by a radially outwardly leg of the a plurality of v - shaped members ( for example v - shaped member having legs 22 a + 23 a ). as shown in fig3 , the v - shaped members are secured to said inner side of said first end disk ( 13 ) and spaced apart radially around the exterior of the axially extending outer cylindrical surface 27 of the sliding valve or valve body part 24 ( see also fig1 and 2 ). the fluid filter shown in fig4 contains a filter element like that shown in fig1 and is explained in greater detail below . first , a base 110 is provided as well as a screw - on cover 111 . in the area of the base there is an outlet 113 and an inlet 115 . the fluid to be filtered flows through the inlet 115 into a raw or unfiltered fluid side 116 of the filter , passing from there through the filter medium 117 of a filter insert 118 , and then going into an interior space 119 of the filter insert , which represents the clean side of the filter . the filtered fluid then flows out of the filter through the outlet 113 . when a certain pressure difference on the filter element is exceeded , a bypass valve , which comprises a valve body 120 and a valve seat 121 opens so that the fluid flows through the bypass openings 123 and thus passes directly from the raw fluid side 116 to the interior space 119 of the filter insert 118 . in the illustrated embodiment , the end of the valve body 120 which faces away from the valve seat 121 engages an axially moveable intermediate member 135 which is mounted on the support tube or support dome 124 ( which also serves as a support tube ) fixedly mounted in the base 110 . a spring 122 mounted in the support tube dome 124 urges the intermediate member axially upwardly and thus presses the valve body 120 against the valve seat 121 . retainers 38 with catches 37 on the intermediate member 135 limit the axial movement of the intermediate member 135 and prevent it from disengaging from the support tube dome 124 . the centrally disposed support tube 124 also serves to support the filter medium 117 . during installation , the filter insert 118 , into which the valve body 120 and the valve seat 121 are integrated , can be pushed onto this supporting dome . then the screw - on cover 111 is screwed into the base 110 . a seal is achieved by a molded gasket 126 between the base and the screw - on cover . the compression spring 122 exerts an axially directed closing force through the intermediate member 135 on the ribs 140 of the valve body 120 and normally holds the valve closed . in this figure , however , the valve body 120 is shown in the position in which its valve body surface 124 125 is spaced a distance from the valve seat 121 . thus , as depicted in fig2 , fluid can pass between the holding webs 22 from the raw fluid side to the clean fluid side . this open position of the valve body surface 124 125 is assumed only when the fluid pressure on the raw fluid side is significantly above the fluid pressure on the clean fluid side . the filter insert 118 is sealed at the end faces with end disks 139 a , 139 b . a radial gasket 142 that is provided on the end disk 139 a ensures a seal in this area between the raw fluid side and the clean fluid side . a snap - in connection 141 is provided on the end disk 139 b for securing the filter insert 118 in the screw - on cover 111 when the filter is screwed on . furthermore , contact pins 143 , 144 are arranged on the end disk 139 b and are engaged with the supporting dome 124 or functional elements on the supporting dome 124 . thus through these contact pins the supporting dome or parts of the supporting dome are held in a predefined axial position relative to the end disk 139b . furthermore these contact pins may actuate functional components on the supporting dome such as locking systems . the crucial function of these contact pins is that they achieve a functionally reliable cooperation between the supporting dome 124 , the filter insert 118 , the screw - on cover 111 and the base 110 . the foregoing description and examples have been set forth merely to illustrate the invention and are not intended to be limiting . since modifications of the described embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed broadly to include all variations within the scope of the appended claims and equivalents thereof .	1
referring first to fig1 there is shown a camera of an embodiment of the present invention on which a front converter is mounted . the front converter generally denoted at 2 is constructed such that it may be mounted on a body 4 of the camera as shown in solid lines and removed from the camera body 4 as shown in broken lines in fig1 . referring also to fig2 the front converter 2 has a front frame portion 2a which covers a lens barrel of the camera when it is mounted on the camera body 4 , a converter lens barrel 2b extending forwardly from the front frame portion 2a , and a view field frame forming portion 2c extending upwardly from the front frame portion 2a . the converter lens barrel 2b has a front converter lens system 2h supported therein , and when the front converter 2 is mounted on the camera , the front converter lens system 2h is positioned in front of a photographing lens 6 of the camera described hereinbelow . meanwhile , the view field frame forming portion 2c of the front converter 2 has an opening 2f perforated therein which serves as a view field frame indicating a range of photographing when trimming photographing is to be effected with the front converter 2 mounted on the camera body 4 . a coupling portion 2d extends rearwardly from the view field frame forming portion 2c , and an eyepiece frame forming portion 2e extends downwardly from a rear end of the coupling portion 2d . an opening 2g serving as an eyepiece frame is perforated in the eyepiece frame forming portion 2e . the opening 2g has a size sufficiently greater than an area of a light path of the view finder of the camera when the front converter 2 is mounted on the camera . referring back to fig1 the camera includes the photographing lens 6 and a view finder optical system 8 . when the front converter 2 is mounted onto the camera body 4 , an end of the eyepiece frame forming portion 2e thereof is introduced into a slit 4b formed in the rear cover 4a of the camera and presses against a detecting switch sw which will be hereinafter described to switch the same . thereupon , a light emitting diode ( led ) 10 incorporated in the view finder optical system 8 is lit to make an indication that a trimming photographing mode is designated . here , the view finder optical system 8 may be a view finder optical system of the albada type wherein frames of fields of view for a non - trimming mode and a trimming mode and focus frame marks indicative of ranges of fields of view may selectively be displayed within a field of view of the view finder . referring now to fig3 there is shown a front elevational view of the camera body 4 on which the front converter 2 is mounted . the camera body 4 has a pair of light measuring windows 12a , 12b for admitting light to be measured for automatic focusing , another light measuring window 14 for admitting light to be measured for automatic exposure control , a view finder window 16 , and a flash light projecting portion 18 . the camera body 4 further has a trimming mode selection button 20 for manually selecting whether trimming photographing is to be performed or not , and a shutter release button 22 . with the construction of the camera body 4 described just above , when the front converter 2 is mounted on the camera body 4 , a photographer will have a photographing range defined by the field of view of the view finder which is delineated by the view field frame 2f of the front converter 2 . in this instance , a lighting light path of the optical system of the albada type is interrupted by the view field frame forming portion 2c of the front converter 2 so that the view field frames for the non - trimming mode and the trimming mode will not be observed by the photographer , which will improve the visibility of the view finder of the camera . on the other hand , the focus frame marks indicated by the optical system of the albada type remain in clear visibility because lighting for the focus frame marks can be effected via the opening 2f of the view field frame forming portion 2c of the front converter 2 . meanwhile , when the front converter 2 is mounted onto the camera body 4 , the lower end of the eyepiece frame forming portion 2e thereof is introduced into the slit 4b in the rear cover 4a of the camera thereby to switch the detecting switch s2 within the rear cover 4a . as the switch sw is switched , when photographing is actually effected , the camera is put into the trimming mode without fail so that a trimming signal is encoded on a film whether the trimming mode or the non - trimming mode is selected on the camera body 4 side . such information of the detecting switch sw is transmitted to the camera body 4 side by way of a signal pin . referring now to fig4 there is shown a top plan view of the camera body 4 on which the front converter 2 is mounted . a liquid crystal display device 24 for displaying a photographing mode and the trimming mode selection button 20 mentioned above are located on the top of the camera body 4 . the trimming mode selection button 20 may be manually operated to select the trimming mode or the non - trimming mode . meanwhile , the shutter release button 22 is located at an upper portion of a grip 4c which is formed in an integral relationship on the camera body 4 . referring now to fig5 there is shown a rear elevational view of the camera body 4 on which the front converter 2 is mounted with the rear cover 4a opened . a trimming signal encoding device 26 is located adjacent a side of a picture frame 4d of the camera body 4 and encodes , where the trimming mode is designated , a trimming signal on a film upon photographing . fig6 to 8 show different display patterns of the liquid crystal display device 24 on the top of the camera as shown in fig4 . in particular , fig6 shows a display pattern in the non - trimming mode of the camera wherein characters &# 34 ; 35 mm &# 34 ; representing a focal length of the photographing lens of the camera by itself are displayed as a focal length of 35 mm for photographing . fig7 shows another display pattern of the liquid crystal display device 24 when the trimming mode is designated by manual operation of the trimming mode selecting button 20 but the front converter 2 is not mounted on the camera body 4 . in this instance , characters &# 34 ; 70 mm &# 34 ; are displayed on the liquid crystal display device 24 because the distance &# 34 ; 70 mm &# 34 ; which is obtained from an equation 35 ×( 1 /√ 1 / 4 ) makes a substantial focal length of the photographing lens to a user of the camera due to the fact that in this condition of the camera a trimming signal is encoded on a film upon photographing so that a central portion of a picture having an area of one fourth of the entire area of the picture will later be printed in an expanded scale . at the same time , a word &# 34 ; trimming &# 34 ; is also displayed in order to indicate that the camera is in the trimming mode . fig8 shows a further display pattern of the liquid crystal display device 24 when the front converter 2 is mounted on the camera body 4 . in the embodiment , the magnification of the front converter 2 itself is 2x , and consequently the substantial focal length of the photographing lens to a camera user is 70 × 2 = 140 mm . thus , a word &# 34 ; 140 mm &# 34 ; indicating the substantial focal length 140 mm is displayed on the liquid crystal display device 24 . further , when the front converter 2 is mounted on the camera body 4 , the camera is compulsorily put into the trimming mode whichever of the trimming mode and the non - trimming mode was selected before mounting of the front converter 2 . accordingly , the word &# 34 ; trimming &# 34 ; is also displayed on the liquid crystal display device 24 . in the display patterns of the liquid crystal display device 24 shown in fig6 to 8 , three pictures which always remain displayed indicate visually how the magnitude of an object relatively varies on a print as a result of change - over of a photographing mode and mounting or removal of the front converter . referring now to fig9 an electric circuit incorporated in the camera body 4 of the present embodiment is shown . the electric circuit shown includes a photometry switch s 1 which turns on when the shutter release button 22 is depressed to a first position or depth , a release switch s 2 which turns on when the shutter release button 22 is depressed to a second position or depth farther than the first position , a one frame switch fps which turns on when feeding of a film by one frame distance is completed , an overload detecting switch ols which turns on when an overload is applied to a film winding device because the film cannot be wound up any more due to , for example , arrival of a final end of the film during winding , and a counter switch cos . here , a film counter is reset to a position s when the rear cover 4a of the camera is opened and is then enabled to count a film frame when the rear cover 4a is closed again . when enabled , the film counter increments like s →.→.→ 1 → 2 . . . each time the film is wound by one frame distance . the counter switch cos remains off until the count value of the film counter reaches &# 34 ; 1 &# 34 ; from &# 34 ; s &# 34 ;, and then it turns on . here , the camera is constructed such that it may effect preliminary feeding of a film until the one frame switch fps turns on after the film has been wound up to the predetermined initial position after closing of the rear cover 4a . the electric circuit of the camera further includes a film detecting switch fis which is normally on but is turned off when a film is loaded into the camera . while a film is being rewound , the state of the film detecting switch fis is continuously checked , and when it is judged that the film detecting switch fis is turned on , the film rewinding operation is stopped . the electric circuit further includes a rear cover switch rcs which is connected to a terminal cl when the rear cover 4a is closed but is disconnected from the terminal cl and connected to another terminal op when the rear cover 4a is opened . when the switch rcs is switched from the terminal cl to the other terminal op or vice versa , a pulse is produced from a pulse generator pg 2 and transmitted via a negated and circuit an 0 to an interrupt terminal int 1 of a microcomputer mc which is provided for controlling various operations of the camera . another interrupt terminal int 0 is connected to the photometry switch s 1 described hereinabove . the electric circuit of the camera further includes a light source trm for the trimming signal encoder 26 , and a display device trd for displaying within the view finder that the trimming mode is designated . the display device trd includes the aforementioned led 10 . another display device lld is provide for making an indication of warning when shutter release is locked because the brightness of an object for photographing is lower than a predetermined level or else a capacitor for driving a flash device is not sufficiently charged upon photographing using the flash device . a trimming switch trs is operated in response to the trimming mode selection button 20 , and when the trimming switch trs is switched from an open to a closed position , a pulse is produced from a pulse generator pg 1 and is transmitted via the negated and circuit an 0 to the interrupt terminal int 1 of the microcomputer mc . a front converter detecting switch fcs is turned on when the front converter 2 is mounted on the camera body 4 and is turned off when the front converter 2 is removed from the camera body 4 . the front converter detecting switch fcs corresponds to the detecting switch sw of fig1 . when the front converter detecting switch fcs is switched from a closed to an open position or vice versa , a pulse is produced from the pulse generator pg 0 and transmitted to the interrupt terminal int 1 of the microcomputer mc via the negated and circuit an 0 . a further display device dsp corresponds to the liquid crystal display device 24 of fig4 and is located on the top of the camera for displaying a selected one of the display patterns of fig6 and 8 in accordance with data received from the microcomputer mc . a motor driving circuit md is provided for driving a film feeding motor mo . the motor mo is thus controlled by the motor driving circuit md such that when an output terminal wt of the microcomputer mc is changed from a &# 34 ; high &# 34 ; to a &# 34 ; low &# 34 ; level , it is rotated in a forward direction to wind a film , but when another output terminal rwt of the microcomputer mc is changed from the &# 34 ; high &# 34 ; to the &# 34 ; low &# 34 ; level , it is rotated in a reverse direction to rewind a film . when both of the output terminals wt , rwt are at the &# 34 ; low &# 34 ; level , the motor mo is short - circuited across opposite ends thereof for a predetermined interval of time so that rotation thereof may be braked . a flash circuit flc initiates a boosting operation for charging a flash capacitor therein when an output terminal fls of the microcomputer mc is changed from the &# 34 ; high &# 34 ; to the &# 34 ; low &# 34 ; level , and when another output terminal dts of the microcomputer mc is changed from the &# 34 ; high &# 34 ; to the &# 34 ; low &# 34 ; level , the flash circuit flc initiates an operation to detect a charged voltage of the flash capacitor . when the charged voltage of the flash capacitor exceeds a predetermined level , input to an input terminal chc of the microcomputer mc from the flash circuit flc is changed from the &# 34 ; low &# 34 ; to the &# 34 ; high &# 34 ; level . after then , the flash device flc will be caused to emit light in response to a pulse signal delivered thereto from an output terminal trg of a flashmatic timer fmt which will be hereinafter described . a release circuit rlc is provided for canceling an arresting condition of an arresting mechanism which is in turn provided for arresting the photographing lens 6 from movement for focusing . the release circuit rlc operates to allow the photographing lens 6 to start its movement when an output terminal rle of the microcomputer mc is changed over from the &# 34 ; high &# 34 ; to the &# 34 ; low &# 34 ; level . an automatic exposure controlling circuit aec starts a light measuring and calculating operation when an output terminal pwc of the microcomputer mc is changed over from the &# 34 ; high &# 34 ; to the &# 34 ; low &# 34 ; level to turn on a power supply transistor bt connected to a power source battery ba so that the power supply transistor bt starts supply of power over a power supply line + v . the automatic exposure controlling circuit aec thus calculates out an exposure value ev from information regarding a film sensitivity sv delivered from a digital to analog converter da which will be hereinafter described and also from information regarding a brightness bv of an object obtained as a result of a light measuring operation ( here , ev = bv + sv ). then , at a point of time when a further output terminal al of the microcomputer mc is changed over from the &# 34 ; high &# 34 ; to the &# 34 ; low &# 34 ; level , the exposure value ev is locked , and then when the exposure value ev is lower than a predetermined value , input to an input terminal ll of the microcomputer mc from the automatic exposure controlling circuit aec is changed over to the &# 34 ; low &# 34 ; level . then , when the movement of the photographing lens 6 for focusing is completed and the shutter is caused to start its opening movement via a mechanical connection therebetween , a switch ess is turned on , and a signal indicative of an exposure value ev corresponding to the opening of the shutter is produced from a slide rheostat not shown . after turning on of the switch ess , the exposure value ev locked for automatic exposure and the exposure value ev from the slide rheostat are compared with each other , and when they coincide with each other , a shutter closing operation starting magnet is turned off to start a shutter closing operation . in response to starting of such a shutter closing operation , a pulse of the &# 34 ; low &# 34 ; level is delivered from another output terminal aee of the automatic exposure controlling circuit aec to the microcomputer mc . in the present embodiment , the shutter is of the type which serves also as an aperture diaphragm , and combinations of aperture opening diameters and exposure times are fixed in accordance with a predetermined program . it is to be noted here that the shutter closing operation starting magnet is turned on when the output terminal rle of the microcomputer mc is changed over from the &# 34 ; high &# 34 ; to the &# 34 ; low &# 34 ; level . an automatic focusing circuit afc begins to receive supply of power when the aforementioned power supply transistor bt is turned on . then , the automatic focusing circuit afc first performs a distance measuring operation and stores therein distance data obtained as a result of such a distance measuring operation and indicative of a distance to an object . the distance data is also delivered from an output terminal afd of the automatic focusing circuit afc to the flashmatic timer fmt . consequently , the release circuit rlc is rendered operative so that the photographing lens 6 is released from its arrested condition and begins its movement . here , a lens movement stopping magnet for stopping the photographing lens 6 at a focused position was turned on when the output terminal rle of the microcomputer mc was changed over from the &# 34 ; high &# 34 ; to the &# 34 ; low &# 34 ; level . as the photographing lens 6 is moved for focusing , a pulse train is produced from an encoder not shown , and such pulses are counted within the automatic focusing circuit afc . then , when the count value comes to coincide with the distance data stored in the automatic focusing circuit afc , the lens movement stopping magnet is turned off so that the lens is arrested from movement at a position corresponding to the distance data . a film sensitivity data reading circuit isd reads data recorder on a code plate on a film container and indicative of a film sensitivity and delivers the data as information regarding the film sensitivity sv . it is to be noted that either where no film container is loaded in the camera or where a film container having no code plate thereon is loaded in the camera , predetermined fixed film sensitivity data ( for example , iso = 100 ) is delivered from the film sensitivity data reading circuit isd . the delivered data is transmitted to the microcomputer mc and the flashmatic timer fmt . the data is also transmitted to the automatic exposure controlling circuit aec as an analog signal via the digital to analog converter da . the flashmatic timer fmt decodes , in response to distance data received from the automatic focusing circuit afc and also to film sensitivity data received from the film sensitivity data reading circuit isd , timer data for indicating a timing at which the flash device is to emit light . the time to the timing corresponds to an interval of time from a point of time at which the opening operation of the shutter is started ( that is , turning on of the switch ess ) to another point of time at which the aperture opening diameter of the shutter reaches a value at which appropriate exposure is obtained by emission of flash light . it is to be noted that , in the present embodiment , in case an object is located remotely and accordingly an appropriate aperture value is not reached even when the aperture opening diameter reaches that of the fully open aperture , the shutter undergoes limitation for a long time of seconds and begins its closing movement when the fully open aperture is reached . then , when the flashmatic timer fmt receives the signal indicative of starting of such a shutter closing operation from the output terminal aee of the automatic exposure controlling circuit aec , it delivers from the output terminal trg thereof a light emitting pulse to compulsorily cause the flash device to emit light . it is to be noted that a light emitting pulse is delivered from the output terminal trg of the flashmatic timer fmt only when an output terminal fle of the microcomputer mc is at the &# 34 ; low &# 34 ; level . now , operation of the microcomputer mc in the present embodiment will be described with reference to flow charts of fig1 a , 10b , and 11 and 12 . in the flow charts , reference symbol trf represents a trimming flag which is set to &# 34 ; 1 &# 34 ; when the trimming mode is designated by way of the trimming switch trs but is reset to &# 34 ; 0 &# 34 ; when a normal mode in which no trimming photographing is effected is selected , and fcf represents a front converter mounting detection flag which is set to &# 34 ; 1 &# 34 ; when the front converter 2 is mounted on the camera body 4 but is reset to &# 34 ; 0 &# 34 ; when the front converter 2 is removed . fig1 a and 10b are flow charts illustrating operation of the microcomputer mc when the photometry switch s 1 is turned on while fig1 is a flow chart illustrating operation of the microcomputer mc when the rear cover switch rcs is switched from the terminal cl to the terminal op or vice versa or when the front converter detection switch fcs is switched from the open to the closed position or vice versa or otherwise when the trimming switch trs is changed from the open to the closed position . referring first to fig1 a , the routine of the flow chart shown is entered when the photometry switch s 1 is turned on . in the routine , at first at step # 1 , the microcomputer mc changes both of the output terminals fls , dts thereof to the &# 34 ; high &# 34 ; level to stop operation of the flash circuit flc so that if the turning on of the photometry switch s 1 occurs during boosting operation of the flash circuit flc , the flash circuit flc may not further continue its boosting operation . then at step # 2 , the output terminal pwc of the microcomputer mc is changed to the &# 34 ; low &# 34 ; level to turn the power supply transistor bt on to make supply of power available . then at step # 3 , it is judged whether or not the trimming flag trf is &# 34 ; 1 &# 34 ;, and at step # 4 , it is judged whether or not the front converter mounting detection flag fcf is &# 34 ; 1 &# 34 ;, and in case either one of the flags trf and fcf is &# 34 ; 1 &# 34 ;, then the display device trd is turned on at step # 5 to indicate that the trimming mode is designated . subsequently at step # 6 , the microcomputer mc waits for a predetermined interval of time sufficient for a photometry circuit included in the automatic exposure controlling circuit aec to become stabilized in operation and for the automatic focusing circuit afc to complete a distance measuring operation , and then changes the output terminal al thereof to the &# 34 ; low &# 34 ; level in order to lock an exposure value ev at the time . then at step # 8 , the microcomputer mc judges whether or not the output terminal ll of the automatic exposure controlling circuit aec is at the &# 34 ; low &# 34 ; level in order to determine whether or not the locked exposure value ev is lower than the predetermined level , and in case the output terminal ll is at the &# 34 ; low &# 34 ; level and accordingly the exposure value ev is lower than the predetermined level , then the program advances to step # 9 , or on the contrary in case the output terminal ll is at the &# 34 ; high &# 34 ; level and accordingly the exposure value ev is not lower than the predetermined level , the program advances to step # 15 . at step # 9 , the output terminal dts of the microcomputer mc is changed to the &# 34 ; low &# 34 ; level to cause the flash circuit flc to detect a current state of the flash capacitor being charged , and at subsequent step # 10 , it is judged whether or not the flash capacitor is in a sufficiently charged up state . thus , in case the flash capacitor has been sufficiently charged up and consequently the output terminal chc of the flash circuit flc presents the &# 34 ; high &# 34 ; level , the microcomputer mc changes at step # 11 the output terminal fle thereof to the &# 34 ; low &# 34 ; level to enable the flashmatic timer fmt to thereafter deliver a light emitting pulse from its output terminal trg and then changes at step # 12 the output terminal dts thereof to the &# 34 ; high &# 34 ; level to stop the charged condition detecting operation of the flash circuit flc , whereafter the microcomputer mc advances the program to step # 15 . on the other hand , in case the output terminal chc of the flash circuit flc is at the &# 34 ; low &# 34 ; level and accordingly the flash capacitor is not yet in the fully charged up state at step # 10 , then the microcomputer mc turns on the release lock warning display device lld at step # 13 and then waits at step # 14 until the photometry switch s 1 is turned off , whereafter the program advances to a stop routine which will be hereinafter described . at step # 15 , it is checked whether or not the release switch s 2 is on , and at step # 16 , it is checked whether or not the photometry switch s 1 is off . a loop including the steps # 15 and # 16 is repetitively followed either until the release switch s 2 is turned on or until the photometry switch s 1 is turned off . in the latter case , the microcomputer mc subsequently enters the stop routine . but in the former case , the program advances to step # 17 at which the microcomputer mc changes the output terminal rle thereof to the &# 34 ; low &# 34 ; level to activate the release circuit rlc to start movement of the lens of the camera . then , at the step # 18 , the trimming flag trf is checked , and at step # 19 , the front converter mounting detecting flag fcf is checked . thus , in case either one of the trimming flag trf and the front converter mounting detection flag fcf is &# 34 ; 1 &# 34 ;, the program advances to step # 20 in order to encode a trimming signal on a film . in particular , at first at step # 20 , a built - in timer of the microcomputer mc is set to a value corresponding to information of the film sensitivity sv , and then the trimming signal encoding light source trm is turned on at step # 21 whereafter the timer is started at step # 22 . then at step # 23 , the microcomputer mc waits until operation of the timer comes to an end , and then at step # 24 , the trimming signal encoding light source trm is turned off , thereby completing encoding of a trimming signal on a film . after then , the program advances to step # 25 . to the contrary , in case it is judged at steps # 18 and # 19 that both of the trimming flag trf and the front converter mounting detection flag fcf are &# 34 ; 0 &# 34 ;, the trimming signal encoding sequence including the steps # 20 to # 24 is by - passed , and the program immediately advances to step # 25 . at step # 25 , the microcomputer mc waits until the output terminal aee of the automatic exposure controlling circuit aec is changed to the &# 34 ; low &# 34 ; level and consequently the microcomputer mc receives a signal indicating that the shutter has been closed . upon reception of such a signal , the microcomputer mc advances the program to step # 26 . referring now to fig1 b , the microcomputer mc controls , at step # 26 , the power supply transistor bt and the trimming mode display device trd to turn off to stop their operation , and then changes , at step # 27 , the output terminals rle , al and fle thereof to the &# 34 ; high &# 34 ; level to stop operation of the automatic exposure controlling circuit aec and the flashmatic timer fmt . then at step # 28 , the microcomputer mc waits for a predetermined interval of time sufficient to complete the closing operation of the shutter , and thereafter changes , at step # 29 , the output terminal wt thereof to the &# 34 ; low &# 34 ; level in order to start a film winding operation . after starting of a film winding operation at step # 29 , the microcomputer mc waits for another predetermined interval of time sufficient for the one frame switch fps to be turned off and then waits until either the one frame switch fps or the overload detecting switch ols is turned on at step # 31 or # 32 , respectively . then , if the one frame switch fps is turned on , this means that the film winding operation has been completed regularly , and accordingly the microcomputer mc advances the program to step # 33 at which it changes the output terminal rwt thereof to the &# 34 ; low &# 34 ; level together with the output terminal wt in order to brake rotation of the motor mo . then at step # 34 , the microcomputer mc changes both of the output terminals rwt , wt thereof to the &# 34 ; high &# 34 ; level to stop operation of the motor driving circuit md , whereafter it enters the stop routine . on the other hand , in case the overload detecting switch ols is turned on at step # 32 , this means that an overload is applied due to excessive tension of a film because the film is at a final frame position and cannot be wound any more . thus , the microcomputer mc now executes a sequence of operations beginning with step # 35 . at step # 35 , the output terminal rwt of the microcomputer mc is changed to the &# 34 ; low &# 34 ; level together with the output terminal wt in order to brake rotation of the motor mo , and then at step # 36 , the output terminals rwt , wt are both changed to the &# 34 ; high &# 34 ; level to stop operation of the motor driving circuit md to stop the motor mo . subsequently at step # 37 , the microcomputer mc waits until the photometry switch s 1 is turned off , and then at step # 38 , the output terminal rwt of the microcomputer mc is changed to the &# 34 ; low &# 34 ; level in order to rotate the motor mo in the reverse direction to start rewinding of a film . then at step # 39 , the microcomputer mc waits until the film detecting switch fis is turned on . the film detecting switch fis turns on when the film disappears from a position adjacent which the film detecting switch fis is located . thus , after turning on of the switch fis , the microcomputer mc changes at step # 40 the output terminal wt thereof to the &# 34 ; low &# 34 ; level together with the output terminal rwt in order to brake the motor mo against rotation , and then at step # 41 , the output terminals rwt , wt are both changed to the &# 34 ; high &# 34 ; level in order to stop the motor mo to stop the film rewinding operation , whereafter the microcomputer mc enters the stop routine . now , the stop routine will be described with reference to a flow chart of fig1 . in the stop routine shown , at first at step # 60 , the output terminals al , fle of the microcomputer mc are both changed to the &# 34 ; high &# 34 ; level in order to cancel locking of the exposure value ev and inhibit delivery of a light emitting pulse from the output terminal trg of the flashmatic timer fmt . then at step # 61 , the power supply transistor bt , trimming mode display device trd , and release lock warning display device lld are turned off . subsequently at step # 62 , the microcomputer mc judges whether or not an interrupt signal is received at the interrupt terminal int 1 thereof , and in case an interrupt signal is received , the program advances to step # 70 , but on the contrary if no interrupt signal is received , the microcomputer mc enables such interrupt at step # 63 , and then at step # 64 , changes the output terminals fls , flc thereof to the &# 34 ; low &# 34 ; level to cause the flash circuit flc to perform a boosting operation and a charging completion detecting operation . subsequently at step # 65 , the microcomputer mc waits completion of charging up of the flash capacitor of the flash circuit flc , and when the output terminal chc of the flash circuit flc is changed to the &# 34 ; high &# 34 ; level and accordingly completion of charging up of the flash capacitor is detected , the output terminals fls , dts of the microcomputer mc are both changed to the &# 34 ; high &# 34 ; level at step # 66 in order to stop the boosting operation and the charging completion detecting operation of the flash circuit flc . after then , the microcomputer mc stops its operation . now , operation of the microcomputer mc when the rear cover switch rcs is switched from the terminal cl to the other terminal op or vice versa or when the front converter detecting switch fcs is switched from the open to the closed position or vice versa or otherwise when the trimming switch trs is changed from the open to the closed position , will be described with reference to fig1 . in any of the instances described just above , an interrupt signal is received at the interrupt terminal int 1 of the microcomputer mc . in the routine illustrated in fig1 , at first at step # 70 , the output terminals fls , dts of the microcomputer mc are both changed to the &# 34 ; high &# 34 ; level in order to stop a boosting operation and a charging up completion detecting operation of the flash circuit flc similarly as at step # 1 of fig1 a . then at step # 71 , it is judged whether or not the rear cover switch rcs is switched to the terminal cl . then , in case the rear cover switch rcs is connected to the terminal cl at step # 71 , then the microcomputer mc checks , at step # 72 , a rear cover flag rcf which is set to &# 34 ; 1 &# 34 ; when the rear cover is closed but is reset to &# 34 ; 0 &# 34 ; when the rear cover is opened . if the flag rcf is &# 34 ; 1 &# 34 ; at step # 72 , this means that the rear cover has been and still remains in the closed position , and the program thus advances directly to step # 90 . to the contrary , if , at step # 72 , the rear cover flag rcf is &# 34 ; 0 &# 34 ;, this means that the rear cover has been just brought into the closed position from the open position , and the program thus advances to step # 73 at which the rear cover flag rcf is set to &# 34 ; 1 &# 34 ; and then to step # 74 at which the output terminal wt of the microcomputer mc is changed to the &# 34 ; low &# 34 ; level in order to rotate the motor m in the forward direction to effect a preliminary film feeding operation . then at step # 75 , the microcomputer mc waits until the counter switch cos is turned on . then after turning on of the counter switch cos , the microcomputer mc waits , at step # 76 , now until the one frame switch fps is turned on . then after turning on of the one frame switch fps , the output terminal rwt of the microcomputer mc is changed at step # 77 to the &# 34 ; low &# 34 ; level in order to brake the motor mo , and then at step # 78 , the output terminals wt , rwt are both changed to the &# 34 ; high &# 34 ; level to stop operation of the motor driving circuit md thereby to complete the preliminary film feeding operation . after then , the microcomputer mc enters the stop routine shown in fig1 . on the other hand , if it is judged at step # 71 that the rear cover switch rcs is connected to the terminal op , then the microcomputer mc judges at step # 80 whether or not the rear cover flag rcf is &# 34 ; 1 &# 34 ;, and where the rear cover flag rcf is &# 34 ; 0 &# 34 ;, this means that the rear cover has been and still remains in the open position , and the program thus advances to step # 90 . on the contrary if the rear cover flag rcf is &# 34 ; 1 &# 34 ; at step # 80 , this indicates that the rear cover has been just brought into the open position from the closed position . in this case , the rear cover flag rcf is reset to &# 34 ; 0 &# 34 ; at step # 81 , and then it is judged at step # 82 whether or not the one frame switch fps is on . then , if the one frame switch fps is on at step # 82 , the microcomputer mc immediately enters the stop routine . on the contrary if the one frame switch fps is off at step # 82 , this means that winding of a film by one frame failed due to arrival of a final frame of the film and therefore rewinding of the film has been performed . accordingly , in this case , the output terminal wt of the microcomputer mc is changed to the &# 34 ; low &# 34 ; level in order to start a film winding operation at step # 83 . after then , the microcomputer mc advances the program to step # 76 at which it waits until the one frame switch fps turns on , and after turning on of the one frame switch fps , the motor mo is braked against rotation and stopped at steps # 77 and # 78 in such a manner as described hereinabove , and then the microcomputer mc enters the stop routine . meanwhile , at step # 90 , the microcomputer mc judges whether or not the front converter detecting switch fcs is on , and when the switch fcs is on , the program advances to step # 91 at which it is judged whether or not the front converter mounting detection flag fcf is &# 34 ; 1 &# 34 ;. in case the front converter mounting detection flag fcf is &# 34 ; 1 &# 34 ;, this indicates that the front converter has been and still remains mounted on the camera , and the program thus skips to step # 98 . to the contrary , in case the front converter mounting detection flag fcf is &# 34 ; 0 &# 34 ; at step # 91 , this means that the front converter has been newly mounted on the camera . in this case , the front converter mounting detection flag fcf is set to &# 34 ; 1 &# 34 ; at step # 92 , and then at step # 93 , the microcomputer mc instructs the liquid crystal display device 24 to display with the display pattern as shown in fig8 and then enters the stop routine . to the contrary , in case the front converter mounting switch fcs is off at step # 90 , the microcomputer mc judges at step # 94 whether or not the front converter mounting detection flag fcf is &# 34 ; 1 &# 34 ;, and if the flag fcf is &# 34 ; 0 &# 34 ;, this indicates that the front converter is not yet mounted on the camera , and the microcomputer mc thus advances to step # 98 . on the contrary if the front converter mounting detection flag fcf is &# 34 ; 1 &# 34 ; at step # 94 , this means that the front converter has been just removed , and accordingly the flag fcf is reset to &# 34 ; 0 &# 34 ; at step # 95 . after then , the trimming flag trf is also reset to &# 34 ; 0 &# 34 ; at step # 96 , whereafter the display pattern of fig6 is displayed on the liquid crystal display device 24 at step # 97 . the step # 98 is reached when the trimming switch trs has been switched from the open to the closed position . in this instance , it is first detected at step # 98 whether or not the front converter detecting switch trs is on . in case the switch fcs is on , the stop routine is immediately entered in order to maintain the trimming mode of the camera and the display pattern of fig8 on the liquid crystal display device 24 . on the contrary if the front converter detecting switch fcs is off at step # 98 , then it is determined at step # 99 whether or not the trimming flag trf is &# 34 ; 1 &# 34 ;. if the flag trf is &# 34 ; 1 &# 34 ; here , this indicates that the camera has been and still remains in the trimming mode and the display of the display pattern of fig7 has been and is maintained on the camera , and the trimming flag trf is thus reset to &# 34 ; 0 &# 34 ; at step # 96 whereafter the display pattern of fig6 for the normal mode is displayed on the liquid crystal display device 24 at step # 97 . on the other hand , if the trimming flag trf is &# 34 ; 0 &# 34 ; at step # 99 , this indicates that the camera has been and still remains in the normal mode with the display pattern of fig6 displayed on the liquid crystal display device 24 , and the trimming flag trf is thus set to &# 34 ; 1 &# 34 ; at step # 100 whereafter the display pattern of fig7 is now displayed on the liquid crystal display device 24 at displayed on the liquid crystal display device 24 at step # 101 . it will be appreciated that while in the present embodiment the switch for detecting mounting of a front converter is located within the rear cover , it may otherwise be located within the camera body . further , the present invention can be applied also to a camera of the type which allows only normal photographing using a photographing lens of a predetermined fixed focal length when a front converter is not mounted on the camera . having now fully described the invention , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit and scope of the invention as set forth herein .	6
this disclosure relates to a vehicle system and method for adjusting a deceleration rate of an electrified vehicle during specific driving events . a closing rate of the electrified vehicle to an oncoming object may be determined based on a distance and a closing velocity to the oncoming object . a negative torque demand , or regenerative torque , required to achieve a desired deceleration rate may be determined from the desired deceleration rate , which can be calculated using the closing rate . during various driving events , the negative torque demand associated with a predefined accelerator pedal position may be increased or decreased to achieve a smooth , linear deceleration to the oncoming object without the need to apply the brakes of the vehicle . these and other features are discussed in greater detail in the paragraphs that follow . fig1 schematically illustrates a powertrain 10 for an electrified vehicle 12 . although depicted as a hybrid electric vehicle ( hev ), it should be understood that the concepts described herein are not limited to hev &# 39 ; s and could extend to other electrified vehicles , including , but not limited to , plug - in hybrid electric vehicles ( phev &# 39 ; s ), battery electric vehicles ( bev &# 39 ; s ), and modular hybrid transmission vehicles ( mht &# 39 ; s ). in one embodiment , the powertrain 10 is a power - split powertrain system that employs a first drive system and a second drive system . the first drive system includes a combination of an engine 14 and a generator 18 ( i . e ., a first electric machine ). the second drive system includes at least a motor 22 ( i . e ., a second electric machine ), the generator 18 , and a battery assembly 24 . in this example , the second drive system is considered an electric drive system of the powertrain 10 . the first and second drive systems generate torque to drive one or more sets of vehicle drive wheels 28 of the electrified vehicle 12 . although a power - split configuration is shown , this disclosure extends to any hybrid or electric vehicle including full hybrids , parallel hybrids , series hybrids , mild hybrids or micro hybrids . the engine 14 , which could include an internal combustion engine , and the generator 18 may be connected through a power transfer unit 30 , such as a planetary gear set . of course , other types of power transfer units , including other gear sets and transmissions , may be used to connect the engine 14 to the generator 18 . in one non - limiting embodiment , the power transfer unit 30 is a planetary gear set that includes a ring gear 32 , a sun gear 34 , and a carrier assembly 36 . the generator 18 can be driven by the engine 14 through the power transfer unit 30 to convert kinetic energy to electrical energy . the generator 18 can alternatively function as a motor to convert electrical energy into kinetic energy , thereby outputting torque to a shaft 38 connected to the power transfer unit 30 . because the generator 18 is operatively connected to the engine 14 , the speed of the engine 14 can be controlled by the generator 18 . the ring gear 32 of the power transfer unit 30 may be connected to a shaft 40 , which is connected to vehicle drive wheels 28 through a second power transfer unit 44 . the second power transfer unit 44 may include a gear set having a plurality of gears 46 . other power transfer units may also be suitable . the gears 46 transfer torque from the engine 14 to a differential 48 to ultimately provide traction to the vehicle drive wheels 28 . the differential 48 may include a plurality of gears that enable the transfer of torque to the vehicle drive wheels 28 . in one embodiment , the second power transfer unit 44 is mechanically coupled to an axle 50 through the differential 48 to distribute torque to the vehicle drive wheels 28 . the motor 22 can also be employed to drive the vehicle drive wheels 28 by outputting torque to a shaft 52 that is also connected to the second power transfer unit 44 . in one embodiment , the motor 22 and the generator 18 cooperate as part of a regenerative braking system in which both the motor 22 and the generator 18 can be employed as motors to output torque . for example , the motor 22 and the generator 18 can each output electrical power to the battery assembly 24 . the battery assembly 24 is an exemplary type of electrified vehicle battery assembly . the battery assembly 24 may include a high voltage battery pack that includes a plurality of battery arrays capable of outputting electrical power to operate the motor 22 and the generator 18 . other types of energy storage devices and / or output devices can also be used to electrically power the electrified vehicle 12 . in one non - limiting embodiment , the electrified vehicle 12 has two basic operating modes . the electrified vehicle 12 may operate in an electric vehicle ( ev ) mode where the motor 22 is used ( generally without assistance from the engine 14 ) for vehicle propulsion , thereby depleting the battery assembly 24 state of charge up to its maximum allowable discharging rate under certain driving patterns / cycles . the ev mode is an example of a charge depleting mode of operation for the electrified vehicle 12 . during ev mode , the state of charge of the battery assembly 24 may increase in some circumstances , for example due to a period of regenerative braking . the engine 14 is generally off under a default ev mode but could be operated as necessary based on a vehicle system state or as permitted by the operator . the electrified vehicle 12 may additionally operate in a hybrid ( hev ) mode in which the engine 14 and the motor 22 are both used for vehicle propulsion . the hev mode is an example of a charge sustaining mode of operation for the electrified vehicle 12 . during the hev mode , the electrified vehicle 12 may reduce the motor 22 propulsion usage in order to maintain the state of charge of the battery assembly 24 at a constant or approximately constant level by increasing the engine 14 propulsion usage . the electrified vehicle 12 may be operated in other operating modes in addition to the ev and hev modes within the scope of this disclosure . fig2 illustrates a vehicle system 56 that may be incorporated into a vehicle , such as the electrified vehicle 12 of fig1 . the vehicle system 56 is adapted to adjust a deceleration rate of an electrified vehicle during various driving conditions , such as lift pedal conditions , as is further discussed below . in one non - limiting embodiment , the exemplary vehicle system 56 includes an accelerator pedal 54 , an object detection subsystem 58 , an electric machine 59 , and a control module 60 . the accelerator pedal 54 may be located within a passenger compartment 62 ( shown schematically ) onboard an electrified vehicle . the accelerator pedal 54 may be actuated by a driver to request a torque , power or drive command for propelling or decelerating the vehicle . the accelerator pedal 54 may be positioned at a plurality of accelerator pedal positions between fully tipped out ( shown as position t 1 , also called lift pedal ) and tip in ( shown as position t 2 ). for example , at a 0 % pedal position , the accelerator pedal 54 is completely tipped out ( i . e ., driver &# 39 ; s foot has been removed from the accelerator pedal 54 ), and at a 100 % pedal position the accelerator pedal 54 is completely tipped in ( i . e ., driver &# 39 ; s foot has depressed the accelerator pedal 54 down to a floor board 64 of the passenger compartment 62 ). the accelerator pedal 54 may an electronic device that includes a sensor 66 for indicating the accelerator pedal position during vehicle operation . in general , the sensor 66 may generate a pedal position signal s 1 that is communicated to the control module 60 as the accelerator pedal 54 is depressed and / or released . the object detection subsystem 58 may be equipped to detect an oncoming object 76 ( see fig3 ). in one non - limiting embodiment , the object detection subsystem 58 utilizes gps technology to detect the oncoming object 76 . the object detection subsystem 58 could alternatively or additionally utilize radar , ladar , cameras and / or vehicle - to - vehicle communication technologies to detect the oncoming object 76 . stated another way , the object detection subsystem 58 may utilize any known technology , or combinations of technologies , to detect the existence of the oncoming object 76 . referring to fig2 and 3 , the object detection subsystem 58 may determine a closing rate to the oncoming object 76 once the oncoming object 76 has been detected . the oncoming object 76 may include another vehicle , a stop sign , a stop light or any other object ahead of the electrified vehicle 12 . in one embodiment , the closing rate is based on at least a distance d from the electrified vehicle 12 to the oncoming object 76 , and a closing velocity of the electrified vehicle 12 to the oncoming object 76 . the closing velocity may be based on a velocity v 1 of the electrified vehicle 12 and a velocity v 2 , if any , of the oncoming object 76 . a closing rate signal s 2 indicative of the closing rate may be communicated to the control module 60 from the object detection subsystem 58 . the electric machine 59 may be configured as an electric motor , a generator or a combined electric motor / generator . based at least upon input from the accelerator pedal 54 via the pedal position signal s 1 , the control module 60 may command torque ( either positive torque or negative torque ) from the electric machine 59 . for example , the electric machine 59 may receive torque command signals s 3 from the control module 60 for propelling the electrified vehicle 12 or for decelerating the electrified vehicle 12 during periods of regenerative braking . while schematically illustrated as a single module in the illustrated embodiment , the control module 60 of the vehicle system 56 may be part of a larger control system and may be controlled by various other controllers throughout an electrified vehicle , such as a vehicle system controller ( vsc ) that includes a powertrain control unit , a transmission control unit , an engine control unit , a battery electronic control module ( becm ), etc . it should therefore be understood that the control module 60 and one or more other controllers can be collectively referred to as “ a control module ” that controls , such as through a plurality of integrated algorithms , various actuators in response to signals from various sensors to control functions associated with the electrified vehicle 12 , and in this case , with the vehicle system 56 . the various controllers that make up the vsc can communicate with one another using a common bus protocol ( e . g ., can ). in one embodiment , the control module 60 includes executable instructions for interfacing with and operating various components of the vehicle system 56 . the control module 60 may include inputs 68 and outputs 70 for interfacing with the components of the vehicle system 56 . the control module 60 may additionally include a central processing unit 72 and non - transitory memory 74 for executing the various control strategies and modes of the vehicle system 56 . in one embodiment , the control module 60 is configured to determine a deceleration rate for achieving a smooth , linear deceleration of the electrified vehicle 12 to the oncoming object 76 . a desired deceleration rate may be calculated during various driving conditions based at least on the pedal position signal s 1 and the closing rate signal s 2 . the control module 60 may communicate a torque command signal s 3 to the electric machine 59 to achieve a desired deceleration rate during specific driving events . fig4 , with continued reference to fig1 - 3 , schematically illustrates a vehicle control strategy 100 of an electrified vehicle 12 equipped with the vehicle system 56 described above . the exemplary vehicle control strategy 100 may be performed to adjust a deceleration rate of the electrified vehicle 12 during certain driving events . for example , the deceleration rate of the electrified vehicle 12 can be adjusted based on a closing rate of the electrified vehicle 12 to an oncoming object 76 . of course , the vehicle system 56 is capable of implementing and executing other control strategies within the scope of this disclosure . in one embodiment , the control module 60 of the vehicle system 56 may be programmed with one or more algorithms adapted to execute the vehicle control strategy 100 , or any other control strategy . in other words , in one non - limiting embodiment , the vehicle control strategy 100 may be stored as executable instructions in the non - transitory memory 74 of the control module 60 . as shown in fig4 , the vehicle control strategy 100 begins at block 102 . at block 104 , an oncoming object 76 , such as another vehicle , a stop sign or a stop light ahead of the electrified vehicle 12 , is detected by the object detection subsystem 58 of the vehicle system 56 . detection of the oncoming object 76 indicates that the electrified vehicle 12 must begin to decelerate . the closing rate signal s 2 may be communicated to the control module 60 if an oncoming object 76 is detected ( see fig2 ). if an oncoming object 76 has been detected , the vehicle control strategy 100 determines a closing rate of the electrified vehicle 12 to the oncoming object 76 at block 106 . the control module 60 of the vehicle system 56 may determine the closing rate based on a distance d to the oncoming object 76 and a closing velocity to the oncoming object 76 ( see fig3 ). the closing velocity may be calculated based on both a velocity v 1 of the electrified vehicle 12 as well as a velocity v 2 of the oncoming object 76 , if any . a desired deceleration rate of the electrified vehicle 12 can be calculated at block 108 . in one embodiment , the desired deceleration rate is based at least on the closing rate obtained at block 106 . for example , if the closing rate is calculated as 2 mph / second , then the desired deceleration rate is approximately 2 mph / second . once the desired deceleration rate is known , a negative torque demand necessary to achieve the desired deceleration rate can be determined at block 110 . the negative torque demand that is required to decelerate the electrified vehicle 12 may be correlated to the desired deceleration rate . for example , in one non - limiting embodiment , the negative torque demand can be obtained from a look - up table stored on the control module 60 that lists deceleration rates and negative torque demand rates required to achieve such deceleration rates . next , at block 112 , the deceleration rate of the electrified vehicle 12 may be adjusted to achieve a smooth , linear deceleration to the oncoming object 76 . in one embodiment , the deceleration rate of the electrified vehicle 12 is adjusted by modifying the negative torque demand that is associated with a predefined accelerator pedal position . in one embodiment , the predefined accelerator pedal position is set at a 5 % pedal position . in another embodiment , the predefined accelerator pedal position is set at a 0 % pedal position . in yet another embodiment , the predefined accelerator pedal position is set between a 0 % pedal position and a 5 % pedal position . in yet another embodiment , the predefined accelerator pedal position is between a 0 % pedal position and a pedal position that corresponds to zero torque demand ( i . e ., the point where the accelerator pedal map 78 of fig5 crosses from negative to positive ) or that corresponds to zero acceleration . the negative torque assigned to the predefined pedal position may be modified to be equal to the negative torque demand obtained at block 110 in order to achieve the desired deceleration rate to the detected oncoming object 76 . the deceleration rate adjustment that occurs at block 112 of fig4 may be illustrated and described with reference to an accelerator pedal map 78 of fig5 . the accelerator pedal map 78 plots torque demand ( in n - m or lb - ft ) versus accelerator pedal position ( in %). in one embodiment , the deceleration rate is adjusted by increasing or decreasing a negative torque demand 80 of the accelerator pedal map 78 at a predefined accelerator pedal position 82 . the negative torque demand 80 may be raised to position 84 if lower deceleration is needed to stop the electrified vehicle 12 by the time it reaches the oncoming object 76 , or may be lowered to position 86 if higher deceleration is needed to stop the electrified vehicle 12 by the time it reaches the oncoming object 76 . by way of a non - limiting example , if the oncoming object 76 is relatively “ far ,” and it is determined at block 108 that a 0 . 2 mph / second deceleration rate is need to achieve linear deceleration , then the negative torque demand 80 associated with the predefined accelerator pedal position 82 is adjusted so that the predefined accelerator pedal position 82 achieves the desired 0 . 2 mph / second deceleration rate . alternatively , if the oncoming object 76 is relatively “ close ,” and it is determined at block 108 that a 2 mph / second deceleration rate is needed to achieve linear deceleration , then the negative torque demand 80 is adjusted so that the predefined accelerator pedal position 82 achieves the desired 2 mph / second deceleration rate . finally , referring again to fig4 , the control module 60 can command the necessary negative torque demand ( via torque demand signal s 3 ) to the electric machine 59 to achieve the desired deceleration rate of the electrified vehicle 12 for any given driving event at block 114 . in other words , the negative torque demand may be applied to the electric machine 59 . the negative torque is transmitted to the vehicle drive wheels 28 to slow the electrified vehicle 12 using regenerative braking . the vehicle control strategy 100 may be performed to control vehicle deceleration based on a positioning of the accelerator pedal 54 and without the need to apply the brakes of the electrified vehicle 12 . although the different non - limiting embodiments are illustrated as having specific components or steps , the embodiments of this disclosure are not limited to those particular combinations . it is possible to use some of the components or features from any of the non - limiting embodiments in combination with features or components from any of the other non - limiting embodiments . it should be understood that like reference numerals identify corresponding or similar elements throughout the several drawings . it should be understood that although a particular component arrangement is disclosed and illustrated in these exemplary embodiments , other arrangements could also benefit from the teachings of this disclosure . the foregoing description shall be interpreted as illustrative and not in any limiting sense . a worker of ordinary skill in the art would understand that certain modifications could come within the scope of this disclosure . for these reasons , the following claims should be studied to determine the true scope and content of this disclosure .	1
referring now to the drawings and in particular to fig1 and 2 , a multi - function flashlight 10 according to the present arrangement is shown . the flashlight 10 includes a lamp head 200 pivotally mounted to a body 20 . a ring clip 70 connected to the body 20 allows the flashlight 10 to be clipped onto a pocket or a belt . in addition , a saddle 150 mounts onto the ring clip 70 so that the light can be worn on the users head , or mounted on a helmet . the lamp head 200 includes a dual - parabolic - surface reflector 300 . the general interconnection of the various components of the flashlight is shown more clearly in fig2 . the body 20 is a generally cylindrical shell having a threaded open end for receiving a battery pack 100 . the battery pack 100 includes one or more batteries disposed in a battery casing 102 . the embodiment shown in fig2 includes four serially interconnected batteries 120 . a locking collar 90 threads onto the open end of the body 20 to secure the battery pack 100 in the body . a mounting stem 30 on the end of the body 20 is formed for making a pivotable connection with and for mating engagement with a recess 237 formed in the lamp head 200 . a metallic pivot pin 180 extends through an opening in mounting stem 30 and a coaxial opening in the lamp head 200 to provide an electrical path between the body 20 and the lamp head 200 . a lamp socket 280 is mounted within the lamp head housing 205 for receiving two lamp elements 285 , 286 . although both lamp elements can be incandescent bulbs , preferably lamp element 286 is an incandescent bulb , and lamp element 285 is a light - emitting diode ( led ). preferably , the led lamp element 285 has a lower light intensity than the incandescent lamp element 286 so that the led lamp element is operable to provide low level light intensity when such is desired . in addition , preferably the led emits a non - white light such as red or green . a non - white led allows the flashlight to be used in certain situations without significantly impairing the night vision of the operator . the dual - parabolic - surface reflector 300 is mounted in the housing 205 so that the lamp elements 285 , 286 project through two openings found in the reflector . as is discussed further below , the reflector 300 has two parabolic reflecting surfaces : a minor concave reflective surface 306 nested within a major concave reflective surface 304 . in the embodiment shown , the incandescent lamp element 286 projects through the center of the major parabolic reflective surface , and the led lamp element 285 projects from the center of the minor parabolic reflective surface . a focusing ring 290 having internal threads 292 that engage with external threads 230 on the end of the lamp head housing 205 retains the reflector 300 within the housing . a coil spring 314 disposed between the lamp socket 280 and reflector 300 in coaxial relationship with the incandescent lamp element 286 biases the reflector away from the lamp socket so that the reflector is urged into contact with the focusing ring 290 . in this way , rotation of the focusing ring 290 displaces the reflector 300 relative to the lamp elements 285 , 286 . a gripping ring 295 is mounted in a circumferential groove 294 formed on the external surface of the focusing ring 290 . electrical energy is provided to the lamp elements 285 , 286 from the battery back 100 via a series of conductive contacts . referring now to fig9 and 10 , a positive battery conductor 145 connects a positive terminal of the battery pack 100 to the metallic pivot pin 180 . the pivot pin is connected to a lamp contact 160 against which one prong of each of the lamp elements 285 , 286 is maintained . a switch contact 170 is connected to a cylindrical conductive shell 185 that is coaxial with and located within the metallic pivot pin 180 . the conductive shell 185 is connected with a negative battery contact 146 of the battery pack 100 . referring back to fig2 , the circuit between the battery pack 100 and the lamp elements is controlled by the switch 250 , which has three operative positions . a switch contact 170 selectively contacts one or none of the second prongs of lamp elements 285 , 286 as switch 250 is moved to its various positions . in the first position , a switch contact 170 contacts the second prong of the first lamp element 285 to close the electrical circuit , so that the first lamp element is illuminated . in the second or off position , the switch contact 170 contacts neither of the lamp elements . in the third position , the switch contact 170 contacts the second prong of the second lamp element 286 , so that the second lamp element is illuminated . referring now to fig2 , 11 and 12 , the details of the flashlight body 20 are shown more clearly . the flashlight body 20 has a hollow interior . the flashlight body 20 has end cap 25 that is preferably formed integrally with the sidewall of the flashlight body . the distal or open end of the flashlight body 20 has external threads 28 formed thereon . a locking ring 90 has internal threads 92 formed therein for mating engagement with the external threads 28 . adjacent the end cap 25 , the flashlight body 20 has circumferential groove 26 formed thereon for receiving the clip ring 70 . the groove 26 includes at least one detent 27 extending across the width of the groove 26 which cooperates with ridges in the clip ring 70 as is discussed further below . the clip ring 70 includes a ring portion 72 that is dimensioned to fit within the groove 26 . a clip arm 74 extends from the ring portion 72 . the internal surface of ring 72 includes a plurality of parallel grooves 73 that engage with the detent 27 in the groove 26 . the engagement of a groove 73 with detent 27 prevents the ring portion 72 from easily rotating relative to the flashlight body 20 . when sufficient force is applied to disengage the groove 73 from detent 27 , the clip ring 70 can be rotated to a desired position . the clip arm 74 includes a pair of sockets 75 to facilitate the attachment of a mounting saddle 150 . the mounting saddle 150 is a removable device that allows the flashlight to be affixed upon a curved surface 159 such as a helmet or an operator &# 39 ; s head . as shown in fig1 and fig1 , the saddle 150 includes a pair of saddle clips 156 having curved gripping ends . the saddle 150 is attached to the clip arm 74 by inserting the saddle clips 156 into the sockets 75 so that the gripping ends of the saddle connectors 156 engage the inside surface of the clip arm 74 , e . g ., when displaced in a predetermined direction relative to body 20 , such as the direction towards lamp head 200 . the flashlight 10 is then mounted on a helmet . once mounted on a helmet , the operator can direct a beam of light in a desired direction by turning and / or tilting his head . the saddle 150 is attached to the operator &# 39 ; s head or helmet by one or more straps . as shown in fig2 , the saddle 150 includes a plurality of strap slots 154 for that purpose . straps are threaded through the strap slots 154 and then wrapped around the operator &# 39 ; s head or his helmet . the saddle 150 can also be affixed to a helmet with double - sided adhesive tape . saddle 150 has a curved concave surface 151 that is to be placed against a curved convex surface 159 , e . g ., of the operator &# 39 ; s head or helmet . preferably , the flashlight body 20 includes a grip sleeve 87 around the outer surface of the body below the ring clip 70 . in the preferred embodiment , the gripping sleeve 87 is made of an elastomeric material and has a plurality of parallel ridges to facilitate gripping the flashlight 10 . however , the gripping sleeve 87 can also have a smooth surface . referring now to fig1 , the end cap 25 of the flashlight body 20 includes an integral mounting stem 30 that is hollow . the mounting stem 30 has a stepped through - bore for receiving a hollow vent plug 40 . as seen in fig1 , the hollow vent plug 40 includes a trilobal bore 42 through an inner wall thereof . the trilobal bore 42 has a central bore 44 connecting three slots 42 extending through the inner wall of the hollow vent plug 40 and directed radially relative to the central bore 44 . vent plug 40 also has an external wall 47 that is contoured to maintain the curvature of the surface of stem 30 . a flapper valve 55 is disposed in the central bore 44 of the vent plug 40 and extends through the inner wall of vent plug 40 . the hollow vent plug 40 has an open side 46 to facilitate insertion of the flapper valve 55 . the vent plug 40 is press - fit into the stepped bore of the mounting stem 30 so that the vent plug 40 abuts a shoulder in the stepped bore . the flapper valve 55 includes an enlarged head 56 that engages the inner surface of the vent plug 40 to form a seal over the trilobal bore 42 . the flapper valve 55 includes a stem 59 connected to the enlarged head , which passes through the central bore of the vent plug 40 . an integral barb 58 on the stem 59 is formed on the outer surface of the stem 59 to fix the flapper valve 55 in place on the vent plug 40 . two passageways extend through the end cap 25 so that the inside of the flashlight body 20 communicates with the stepped bore of the mounting stem 30 . gases produced by use of the batteries pass through those passageways and then through the trilobal bore 42 in the vent plug 40 . when the gas pressure reaches a threshold level , the head 56 displaces and the gases are vented from the flashlight . in this manner , the flapper valve 55 functions as a one - way valve that allows the release of gases produced from use of the batteries , while preventing fluid from entering the flashlight . each of the passageways between the body and the mounting stem are configured to receive one of the two battery contacts 145 or 146 . as shown in fig1 , the battery contacts 145 and 146 are fixed in place in the passageway by barbs 148 and 149 on the respective contacts . prior to inserting the battery contacts 145 and 146 into the passageway , a deoxidizing pellet 38 is placed in a recess in end cap 25 . when inserted in its passageway , the negative battery contact 146 is positioned to maintain the deoxidizing pellet in the recess . referring again to fig2 , 9 , 11 and 12 , the battery pack 100 includes a case 102 having a closed end 105 and an open end for receiving one or more batteries 120 . when assembled , the open end is sealed by an o - ring 130 and an end cap 125 that is removably connected to the casing by two screws 135 , 136 that extend through the end cap and into the body of case 102 . the batteries 120 can be either disposable or rechargeable . in the preferred embodiment , the batteries 120 are rechargeable batteries that are serially connected to one another by a plurality of battery connector straps 118 . one of the battery straps is connected to a thermal fuse and a diode , which are not shown , and is engaged by the central screw 135 that attaches the end cap 125 to the housing 102 . a second battery connector strap is engaged by the side screw 136 that connects the end cap 125 to the casing 102 . the battery strap that engages the center screw 135 is separated from the battery strap that engages the side screw 136 by an insulator 142 . the center screw 135 and the side screw 136 are electrically connected to the batteries 120 and act as terminals for recharging the battery 100 . the closed end 105 of the case 102 has an annular flange that is slightly smaller than the inner diameter of the flashlight housing 20 . two holes 108 in the closed end 105 provide access ports for the battery contacts 145 and 146 to contact the respective positive and negative terminals of the battery pack . a recess 107 in the edge of the closed end 105 cooperates with an axially elongated alignment rib 85 projecting from the inner surface of the flashlight body 20 . the alignment rib 85 acts as a key to align the battery pack 100 to ensure that the battery pack is properly oriented within the flashlight housing . the casing 102 further includes an external rib 104 that cooperates with a latch in a recharger 400 used to recharge the battery pack as described below . the battery pack 100 is secured within the flashlight housing 20 by a locking ring 90 having internal threads that engage with the external threads 28 of the flashlight body . the locking ring urges the end cap 125 of the battery pack 100 against o - ring 130 that engages the end of the flashlight body to provide a fluid - tight seal . referring now to fig2 , 8 and 9 , the details of the lamp head 200 are seen more clearly . the lamp head includes a housing 205 that is pivotally connected to the mounting stem 30 of the flashlight body 20 . the housing 205 includes a pair of mounting posts 210 onto which the lamp socket 280 and the lamp contact 160 are mounted . the posts 210 project through holes formed in the lamp socket and the lamp contact respectively . the posts are flared by applying heat and pressure to the ends thereof to retain the lamp socket 280 and the lamp contact 160 in place . the lamp housing 205 further includes an aperture 242 through which the switch 250 projects . arcuately spaced pairs of parallel ribs 235 are disposed around the inner circumference of lamp housing 205 to serve as guides for mounting the reflector 300 and positioning relative to the lamp elements 285 and 286 . the electrical and mechanical interconnection between the flashlight body 20 and the lamp head 200 is shown more clearly in fig1 . the first mechanical and electrical connection between the lamp head 200 and the flashlight housing 20 is provided by a hollow metallic pin 180 . the hollow pin 180 has a flanged head at one end thereof . the hollow pin 180 extends through the stepped bore in the mounting step 30 of the body , through a hole in the positive battery contact 145 , through an aperture in the lamp head housing , and finally through an aperture in the lamp contact 160 . the flanged head of hollow pin 180 abuts the wall of stem 30 surrounding the stepped bore to prevent the hollow pin from sliding therethrough . the other end of the hollow steel pin 180 is crimped over onto the lamp contact 160 to fix the pin in place . in this way , the hollow pin 180 provides a pivotal connection between the lamp head 200 and the flashlight body 20 , as well as an electrical connection from the positive battery contact 145 to the lamp contact 160 . an o - ring 198 disposed between the lamp head 200 and the mounting stem 30 provides a fluid - tight seal between the lamp head and the flashlight body 20 . a spacer sleeve 190 , which may be formed of an electrically insulating material , is disposed coaxially through the hollow pin 180 . spacer sleeve 190 has a flange formed at one end thereof . a second hollow metallic pin 185 extends coaxially through the spacer 190 . the pin 185 extends through an aperture in the negative battery contact 146 and a spring washer 194 . the inner pin 185 has a flanged head that engages a conductive washer 192 which contacts the switch contact 170 . to fix the inner pin 185 in place , the non - flanged end thereof is crimped against the flanged head of the spacer 190 . the insulator spacer 190 supports the crimping forces that are applied to the inner pin 185 so that the crimping forces are not transferred to the outer pin 180 , which could adversely affect the interconnection between the lamp head 200 and the flashlight body 20 . the washer 192 provides an increased surface area to distribute the reaction forces associated with the crimping of the inner pin 185 against the flanged head of the insulator sleeve 190 . the inner hollow pin 185 provides an electrical connection between the switch contact 170 and the negative battery contact 146 . a sealing plug 50 is disposed in a recess in the side of the lamp housing 205 . the recess provides an access port for inserting and crimping the inner and outer hollow pins 180 and 185 . the lamp head 200 includes two lamp elements 285 and 286 that are mounted in the lamp socket 280 . referring now to fig1 and 16 , each lamp element 285 , 286 includes two prongs 288 a , 288 b , and 289 a , 289 b , respectively . the lower prongs 288 b , 289 b of the lamp elements contact the lamp contact 160 . the upper prongs 288 a , 289 a are normally spaced from two resilient arms 176 and 177 of the switch contact 170 . the arms 176 and 177 are resilient and cooperate with the switch 250 . the switch 250 includes a rotatable shaft having two eccentric lobes 262 and 264 . as noted previously , the switch 250 operates in three positions . as shown in fig1 , the second or off position is illustrated . in the off position , the eccentric lobes 262 , 264 do not urge either of the switch contact arms 176 , 177 into contact with the lamp element prongs . rotating the switch 250 in the direction of arrow a causes the eccentric lobe 262 to engage the second contact arm 177 and force it into contact with prong 288 a of lamp element 285 . at the same time , eccentric lobe 264 is rotated away from the second switch contact arm 176 so that the second contact arm does not contact prong 289 a of lamp element 286 . when switch 250 is rotated in the direction of arrow b , eccentric lobe 264 forces the first contact arm 176 into contact with the second prong 289 a of lamp element 286 . in this way , the switch operates to control the illumination of lamp elements 285 and 286 independently of one another . referring now to fig8 and 12 , the switch 250 is mounted in the aperture 242 in the base of the lamp housing 205 . a plurality of resilient switch - holding fingers 240 engage an annular groove in the switch to retain the switch in the lamp housing . in addition , an o - ring is disposed between the switch 250 and the lamp housing 205 to provide a fluid - tight seal between the switch and the lamp housing . referring to fig1 and 13 , the reflector 300 has a pair of apertures 308 and 309 formed therein for receiving the light elements 285 and 286 . the lamp elements 285 and 286 project through the apertures 308 and 309 as described hereinabove . the reflector includes two parabolic reflecting surfaces . the first is a major parabolic reflective surface generally symmetric about an axis through the central aperture 308 . nested within a sector of the major parabolic surface is a second minor parabolic reflecting surface 306 that is generally symmetric about an axis through the aperture 309 . in this way , the reflector 300 incorporates a smaller reflective surface 306 nested within a larger reflective surface 304 . the major parabolic reflective surface 304 provides a reflective surface for the central lamp element 286 and the minor parabolic reflective surface 306 provides a reflective surface for the second lamp element 285 . because of this unique configuration , the minor reflective surface 306 does not substantially interfere with the reflection of the light from lamp element 286 off of the major reflective surface 304 . an o - ring 299 is disposed between the lamp housing 205 and the focusing ring 290 to provide a fluid - tight seal between the focusing ring and the lamp housing . in addition , as shown in fig1 and 12 , the focusing ring 290 includes an integral lens 298 . referring now to fig1 - 21 , a battery charger 400 for recharging the battery back 100 in the flashlight 10 is shown . the battery charger 400 includes a housing 410 having a receptacle 415 extending from the top surface of the housing for receiving the contact - end of the flashlight . alternatively , the socket 415 can be configured so as to receive only the battery pack 100 instead of the entire flashlight 10 . a latch 430 is provided to retain the flashlight or battery pack in the socket 415 . in the embodiment shown , the latch 430 is configured to cooperate with an annular groove 96 found in the locking ring of the flashlight ( see fig2 ). if the socket 415 is configured to receive the battery pack 100 , the latch 430 is preferably designed to cooperate with the retaining rib 104 located on the external surface of the battery case 102 , also shown in fig2 . the latch mechanism includes a lever arm 434 pivotally mounted to the wall of receptacle 415 by a pivot pin 439 . a latching finger 437 projects from the distal end of the lever arm 434 to engage the annular groove 96 in the locking ring 90 or the locating rib 104 on the battery case 102 . a coil spring 432 biases the proximal end of the lever arm 434 , thereby urging the latching finger 437 about the pivot pin and into contact with the flashlight or the battery pack . to recharge the batteries , two terminals in the battery charger are positioned for contacting the heads of the screws 135 , 136 in the end of the battery pack . the first terminal is a coil spring 424 that contacts the side screw 136 . the second contact is a plunger 420 that contacts the center screw 135 . the plunger 420 is biased into contact with the center screw 135 by a spring 426 . power is supplied to the battery charger 400 via a jack 450 that is adapted for connection to a power source . the jack 450 includes two terminals 455 that are mounted to a circuit board 460 . the circuit board is mounted within the housing 410 by a plurality of screws or other fasteners , and a protective bottom cover 445 that is fastened to the base by a like plurality of screws or other fasteners . the contact spring 424 and the plunger 420 are also connected to the circuit board , which includes conductive paths interconnecting the spring contact and the plunger to the terminals 455 . to recharge a battery pack 100 , the battery pack or the flashlight is inserted into the socket 415 of the battery charger . a power source is then connected to the jack 450 to provide power to the battery charger . once the battery pack is recharged , the battery pack or flashlight is removed from the socket by pressing latch 430 to withdraw the latch finger 437 from engagement with the battery pack or flashlight . while particular embodiments of the arrangement have been herein illustrated and described , it is not intended to limit the invention to such disclosures , but changes and modifications may be made therein and thereto within the scope of the following claims .	5
the objectives of the invention may be obtained by the features set forth in the following description of the invention and / or in the appended claims . the invention is based on the discovery that the dual passivation layer disclosed in south - korean patent application no . 2002 - 0018204 may be given a substantially increased passivation effect by performing a gentle annealing after deposition of the layers . by gentle annealing , we mean an annealing at a temperature below the temperatures where the deposited passivation films are known to degrade . for example , the passivation effect is reported to be non - reversible degraded at 300 - 350 ° c . in the case of using silicon nitride films , at less than 400 ° c . for amorphous silicon films , and at & gt ; 500 ° c . for combined amorphous silicon and silicon nitride films . thus the present invention relates to a method for obtaining an efficient surface passivation in single crystalline or polycrystalline ( including multi - crystalline ) silicon wafer based solar cells where a first hydrogenated amorphous silicon or hydrogenated amorphous silicon carbide thin film of thickness in the range of 1 - 150 nm is deposited on the silicon wafer , followed by depositing a hydrogenated silicon nitride thin film of thickness in the range of 10 - 200 nm atop the amorphous silicon or amorphous silicon carbon layer . preferably , but not limited to , the amorphous silicon or silicon carbide and silicon nitride films are deposited by plasma enhanced chemical vapor deposition ( pecvd ). the two films are preferably deposited in a substantially single deposition process . examples of further preferred methods for deposition of the one or more passivation layer ( s ) include , but are not limited to ; plasma enhanced chemical vapour deposition , low temperature chemical vapour deposition , low pressure chemical vapour deposition , or sputtering . after deposition of the passivation films , the surface passivated wafer is annealed at a temperature in the range from about 300 to 600 ° c . further , the present invention also relates to solar panels made by wafers passivated according to the method described above . the increase of the passivation effect by the annealing at temperatures up to 600 ° c . is a surprising feature , since it is generally known that the passivation effect of amorphous silicon films severely degrades non - reversibly after being heated to temperatures above 300 - 350 ° c . ; see for instance [ 1 ]. thus it is generally assumed that use of amorphous silicon as surface passivation means that low temperature metallization steps ( below 300 - 350 ° c .) are required in the subsequent process steps in order to preserve the surface passivation . however , the present inventors have shown that this is not a general feature , and have thus made it possible to employ amorphous silicon films as surface passivation at higher temperatures . and have thus , due to the higher temperature stability of the dual surface passivation layer compared to e . g . solely an amorphous silicon layer , allowed using this film without loss of passivation effect for both back - contacted solar cell structures and more traditional solar cell structures . studies performed by the present inventors show that the increased passivation effect is probably due to diffusion of hydrogen atoms into the boundary region of the crystalline silicon substrate . without being bound by theory , it is believed that these hydrogen atoms satisfies dangling bonds in the crystalline silicon and thus passivates the surface region of the silicon wafer . these studies are presented in an article by the present inventors [ 2 ]. fig1 if [ 2 ] shows measurements of the effective recombination times using the quasi - steady - state photo - conductance technique . the figure shows that the passivation effect increases by increasing annealing temperature up to about 500 ° c ., and then decreases rapidly with increasing temperature . thus there is an optimum annealing temperature of about 500 ° c . fig2 of [ 2 ] shows measured distributions of hydrogen by use of nuclear reaction analyses of the dual passivation layer and the surface region of the silicon wafer at the different annealing temperatures . the figure shows that the measured hydrogen concentrations has a maximum at 500 ° c . annealing temperature of about 10 atom % h in the surface region of the wafer . annealing at higher or lower temperatures gives lesser hydrogen contents . a facsimile of fig1 and fig2 of [ 2 ] is given in this application as fig1 a ) and b ), respectively . thus the claimed invention also includes silicon based wafers passivated by methods resulting in an in - diffusion of hydrogen in the surface region of the wafer , and solar cells made from such wafers . the basis for this is found in the priority application u . s . 60 / 671 , 081 filed on 14 apr . 2005 , which discloses the inventive method of annealing the dual layer described above . the invention will be described in more detail in the form of preferred embodiments , which by no means should be considered a limitation of the inventive idea of employing passivation films that result in an in - diffusion of hydrogen atoms into the surface region of silicon wafers when subject to a gentle annealing . the preferred embodiments of the solar panels are based on silicon wafers which may be made from a mono - crystalline silicon , poly - silicon , or multi - crystalline silicon block . also , the principle of the invention relates equally well to any silicon based device which is dependent on efficient transport of minority carriers through portions of the device . the first preferred embodiment of the invention is a method for passivating a silicon wafer . the preferred method for depositing the dual passivation layer is as follows : the wafer ( 1 a , 1 b ) is cleaned by immersion in a h 2 so 4 : h 2 o 2 solution followed by an oxide removal in diluted hf . then the wafer is introduced into a plasma enhanced chemical vapour deposition chamber ( pecvd - chamber ), and an amorphous silicon film with thickness 1 - 150 nm , preferably about 10 - 100 nm is deposited by use of sih 4 as sole precursor gas . then a layer of silicon nitride is deposited by use of a mixture of sih 4 and nh 3 as precursor gases in the pecvd - chamber . the thickness of the silicon nitride film should be in the range of 10 - 200 nm , preferably about 70 - 100 nm . the deposition temperature in the pecvd - chamber is about 250 ° c . for both films . the passivation procedures is finalised by heating the wafers to a temperature in the range of 350 - 550 ° c ., preferably around 500 ° c . for a short period , preferably about four minutes . the precursor gases may comprise from 0 to about 50 mol % hydrogen gas . the investigations made by the inventors on monocrystalline silicon wafers is summarised in fig1 a ) and 1 b ). fig1 a ) is a summary of results of effective minority carrier recombination lifetime , as measured at an injection level of 1 × 10 15 cm − 3 using the quasi - steady - state photoconductance technique ( for a presentation of the measuring technique , see for example r . a . sinton et al ., applied physics letters 69 , ( 1996 ) pp . 2510 - 2512 ). the samples measured were p - type silicon samples manufactured by the czochralski process , which received surface passivation layers at both sides of the sample . the layers were deposited as given above . the need for deposition of layers at both surfaces of the samples for efficient measurements is apparent to all those skilled in the field , and should thus not be considered as a limitation of the invention . it is apparent from the data in fig1 a ) that independent layers of both a hydrogenated silicon nitride film ( thickness 80 nm ) and a hydrogenated amorphous silicon film ( thickness 100 nm ) individually exhibit some degree of surface passivation of the underlying silicon sample , with measured effective recombination lifetimes in the range of 50 - 100 μs . interestingly , though , the deposition a dual surface passivation layer consisting of a first hydrogenated amorphous silicon film ( thickness 100 nm ) followed by an overlying hydrogenated silicon nitride film ( thickness 80 nm ), both films deposited at a temperature of 250 ° c ., reveals a measured effective lifetime of about 220 μs , that is 2 - 3 times higher than the single films alone . however , the dual passivation film annealed at 500 ° c . shows an efficient recombination of about 780 μs , almost one order of magnitude higher than the individual layers alone and about 3 times as efficient as the dual layer with no annealing . as previously mentioned , the poor temperature stability of amorphous silicon films sets a strict restriction of possible conditions during the process steps following the surface passivation of silicon wafers . in the case of a combined amorphous silicon / silicon nitride structure , however , it is readily seen from fig1 a ) that the surface passivation is stable up to at least 500 ° c . in addition to the increased temperature stability , the figure shows the surprising result that the surface passivation even improves after subsequent annealing . further , upon annealing at temperatures above 500 ° c ., the surface passivation will degrade , thus there exists a temperature window for subsequent thermal treatments in order to retain the passivation properties of the structure . fig1 b ) shows hydrogen distributions in the dual passivation layers ( 2 , 3 ) and the surface region of the wafer ( 1 a ) measured by nuclear reaction analyses . the measurements are performed on the same samples presented in fig1 a ), and it may be seen that there is a correlation between the hydrogen concentration at the surface region of the silicon wafer ( 1 a ) and the obtained effective recombination times . that is , the effective recombination times is related to the hydrogen concentration in the surface region of the silicon wafer , and that the hydrogen concentration at the surface region of the silicon wafer in the sample with the best obtained recombination times ( the dual passivation layer annealed at 500 ° c .) is about 10 atom %. thus it is believed that the reason for the markedly increased passivation effect of the annealing according to the inventive method is due to diffusion of hydrogen atoms into the boundary region of the crystalline silicon substrate which satisfies dangling bonds in the crystalline silicon . it should be noted that annealing at higher or lower temperatures gives lesser hydrogen contents in the surface region of the silicon wafer , and corresponding lower effective recombination times . the measurements presented in fig1 a ) and 1 b ) is taken from an article presented after the priority date of this application . the claimed invention does nevertheless contain silicon wafers / solar panels where the surface region is passivated by a dual layer film which is annealed such that the surface region of the wafer is more or less saturated with hydrogen atoms . it should be noted that the priority document discloses all features of the inventive method of surface passivating silicon wafers , such that the hydrogen content is only a discovery explaining why the inventive method has an unexpected passivation effect . the investigations has indicated that the best mode of the invention is silicon wafers passivated with a first layer of about 10 - 100 nm thick amorphous silicon film ( 2 ) followed by a second layer of about 70 - 100 nm thick silicon nitride film ( 3 ), which is heated to about 500 ° c . for four minutes after deposition . even though the investigations are performed on a monocrystalline silicon wafer , the best mode includes wafers of polycrystalline and multicrystalline silicon passivated with the dual film defined above . the second preferred embodiment of the invention is a silicon wafer passivated at least on one side with the layers deposited by the method according to the first preferred embodiment . fig2 a ) is a cross sectional view from the side of a preferred embodiment of the invention , where a silicon sample ( 1 a ) of either n - or p - type conductivity receives a deposition of a layer 2 of intrinsic hydrogenated amorphous silicon or hydrogenated amorphous silicon carbide of thickness in the range 1 - 150 nm . atop layer ( 2 ) is deposited a hydrogenated silicon nitride thin film ( 3 ) of thickness 10 - 200 nm . the complete structure can then optionally be annealed to optimize the surface passivation at a suitable temperature preferably in the range 300 - 600 ° c . fig2 b ) is a cross sectional view from the side of the second preferred embodiment of the invention , where a silicon sample of one type conductivity ( n - or p - type ) ( 1 a ) has a layer of silicon with either the same or the opposite type conductivity ( 1 b ) of substantially higher conductivity compared to the silicon region ( 1 a ). typically , but not limited to , the concentration of dopant ( acceptor - or donor - type ) in silicon layer ( 1 b ) is 3 - 5 orders of magnitude higher than in the silicon region ( 1 a ). the higher conductivity layer ( 1 b ) can be fabricated by in - diffusion or ion implantation of a suitable dopant into layer ( 1 a ), or by deposition of a appropriately silicon layer by a large range of various deposition techniques . atop the higher conductivity silicon region ( 1 b ) is deposited an intrinsic hydrogenated amorphous silicon or hydrogenated amorphous silicon carbide film ( 2 ) of thickness 1 - 150 nm . atop layer ( 2 ) is deposited a hydrogenated silicon nitride thin film ( 3 ) of thickness 10 - 200 nm . the complete structure can then optionally be annealed to optimize the surface passivation at a suitable temperature preferably in the range 300 - 600 ° c . the best mode of the second preferred embodiment is either a mono - crystalline , poly - crystalline , or multi - crystalline silicon wafer ( 1 a ) of one type of conductivity ( n - or p - type ) with a dual passivation layer of one amorphous silicon film ( 2 ) and one silicon nitride film ( 3 ), and at least one diffused layer ( 1 b ) with the other type of conductivity ( p - or n - type ) of the wafer also with a dual passivation layer of one amorphous silicon film ( 2 ) and one silicon nitride film ( 3 ). the passivation layer should preferably be deposited on both sides , but may only be deposited only on one side of the wafer ( 1 a , 1 b ). the layers in the best mode of the invention is the same as given in the first preferred embodiment of the invention ; about 10 - 100 nm thick amorphous silicon film ( 2 ) followed by a second layer of about 70 - 100 nm thick silicon nitride film ( 3 ), which is heated to about 500 ° c . for four minutes after deposition . the third preferred embodiment of the invention is a solar cell passivated with the method according to the first preferred embodiment . fig3 a ) shows a cross - sectional view from the side of a preferred embodiment of a solar cell according to the invention . the figure shows a silicon wafer ( 1 a ) of monocrystalline or polycrystalline ( including multi - crystalline ) nature of one type conductivity ( n - or p - type ) including a silicon layer ( 1 b ) of the other type conductivity , processed by e . g . in - diffusion of a suitable dopant into the silicon wafer ( 1 a ). atop the silicon layer ( 1 b ) is deposited an intrinsic hydrogenated amorphous silicon or hydrogenated amorphous silicon carbide film ( 3 ) of thickness 1 - 150 nm . atop layer ( 2 ) is deposited a hydrogenated silicon nitride thin film ( 3 ) of thickness 10 - 200 nm . a current collection grid ( 4 ) for the one polarity carrier is then deposited on top of the silicon nitride film ( 3 ). on the back - side surface is deposited a current collection region ( 5 ) for the other polarity carrier , as well as soldering pads ( 6 ) for interconnection of individual solar cells in a module . methods for forming the contact regions ( 4 , 6 , and 6 ) include , but are not limited to , screen - printing metal containing pastes or evaporation of appropriate metals . the complete structure is then heated for combined contact firing and annealing of the surface passivation stack consisting of layers ( 2 and 3 ). the temperature for combined contact firing and passivation optimization is preferably in the range of 300 - 600 ° c . the best mode of the third preferred embodiment employs the same surface passivation as the best mode of the second preferred embodiment on both sides of the silicon wafer , which may be either a mono - crystalline , poly - crystalline , or multi - crystalline silicon wafer ( 1 a ) of one type of conductivity ( n - or p - type ) with at least one diffused layer ( 1 b ) with the other type of conductivity ( p - or n - type ), and where the passivation layers is a first layer of about 10 - 100 nm thick amorphous silicon film ( 2 ) followed by a second layer of about 70 - 100 nm thick silicon nitride film ( 3 ), which is heated to about 500 ° c . for four minutes after deposition . the fourth preferred embodiment is a second aspect of a preferred solar cell passivated with the method according to the first preferred embodiment . this preferred embodiment is an example where the passivation is only applied on the front side of the silicon wafer , and is illustrated in fig3 b ) which shows a cross - sectional view from the side . the figure shows a silicon based solar cell ( 1 ) having both polarity current collection terminals ( 7 ) and ( 8 ) on the same surface of the cell . such a back - contact solar cell may consist of , but not limited to , an emitter wrap through cell or a metal wrap through cell having a current collection regions on the light - receiving surface combined with a method for passing the collected carriers to the opposite surface , or a back - contacted cell in which no such carrier collection region is present at the light - receiving surface . atop the light - receiving surface of the silicon solar cell ( 1 ) is deposited an intrinsic hydrogenated amorphous silicon or hydrogenated amorphous silicon carbide film ( 2 ) of thickness 1 - 150 nm . atop layer ( 2 ) is deposited a hydrogenated silicon nitride thin film ( 3 ) of thickness 10 - 200 nm . the complete structure can then optionally be annealed to optimize the surface passivation at a suitable temperature preferably in the range 300 - 600 ° c . the best mode of the fourth preferred embodiment employs the same surface passivation as the best mode of the second preferred embodiment , but now only on the front side of the silicon wafer , which may be either a mono - crystalline , poly - crystalline , or multi - crystalline silicon wafer ( 1 a ) of one type of conductivity ( n - or p - type ) with at least one diffused layer ( 1 b ) with the other type of conductivity ( p - or n - type ), and where the passivation layers is a first layer of about 10 - 100 nm thick amorphous silicon film ( 2 ) followed by a second layer of about 70 - 100 nm thick silicon nitride film ( 3 ), which is heated to about 500 ° c . for four minutes after deposition . the diffused layer ( 1 b ) is not shown in the figure . while preferred embodiments of the invention have been described , it is understood that various modifications to the disclosed processes and methods may be made without departing from the underlying spirit of the invention or the scope of the subsequent claims . 1 . s . dauwe , j . schmidt , and r . hezel , proc . 29 th ieee pvsc , 2002 , 1246 - 1249 . 2 . andreas bentzen et al . “ surface passivation of silicon solar cells by amorphous silicon / silicon nitride dual layers ”, presented at 15 th international photovoltaic science & amp ; engineering conference ( pvsec - 15 ), shanghai , china , 19 th may 2005 .	8
[ 0062 ] fig1 shows a configuration of a digital television system to which a method of changing a graphical user interface according to embodiment 1 of the present invention is applied . in fig1 a digital television system 101 includes a signal receiver 103 for receiving from a signal transmitter 102 a broadcast wave ( including television picture signals ) broadcast by a program broadcasting side , system software ( computer program ) 105 including a gui controller 104 that serves to display a menu and data contents , a display 106 for displaying a picture and a gui , a user profile database 107 for recording and storing preference information of a user . [ 0064 ] fig2 is a diagram showing a flow of an operation for changing the graphical user interface according to this embodiment . in step s 201 , the signal transmitter 102 distributes an archive of software for adding a menu . in step s 202 , the digital television system 101 receives the archive at the signal receiver 103 . in step s 203 , a header is extracted from the received archive . in step s 204 , the user profile database 107 is searched through , and it is checked whether any of keywords included in the header belongs to ( is included in ) preference keywords included in the user profile database 107 or not . if included , the processing advances to step s 205 , and if not included , the processing advances to step s 207 . the software ( program ) for adding a menu is thus selected . in step s 205 , an inquiry ( fig8 ) is made to a user . if the user wishes to install an additional screen image , the processing advances to step s 206 , and if the user does not wish to , the processing advances to step s 207 . in step s 206 , it is determined to execute the installation of the program for adding a menu image , and the installation is executed . the digital television system 101 provides the system software 105 with a mechanism for having a user fill in a questionnaire form on his / her preference information at the time of purchasing a product , or a mechanism for learning the user &# 39 ; s preference information through a user &# 39 ; s operation . accordingly , the user profile database 107 is created . here , an example structure of the user profile database 107 is shown in fig3 . in the user profile database 107 , user identification information ( user id ) 301 and user &# 39 ; s preference keywords 302 are used to manage user information . the preference keywords 302 include words serving as keywords based on information of user &# 39 ; s “ favorites ”. the signal transmitter 102 distributes information ( a program ) for changing a gui to the digital television system 101 in each household by superposing the information on the broadcast wave used for a program or a commercial that is being broadcast . the information ( program ) for changing a gui is used to display additional screen images for a menu screen of the digital television system 101 for the purpose of providing advertisements and public relations for arbitrary products and planned programs , and an initial operation screen ( a portal screen ) for relating contents , and other such purposes . the distributed program has a header part as shown in fig4 . the header part includes a system compatibility information 401 and a preference keyword table 402 of archive . the system compatibility information 401 provided in the header part serves to judge an adaptability of the program with respect to the structure of the digital television system 101 , determine that the program can be applied to the system , and compare the information in the preference keyword table 402 with the user &# 39 ; s preference information . if these information coincide with each other , according to the user &# 39 ; s wish , a main part of data ( a program ) 403 for displaying the additional screen images is installed into the digital television system 101 . the preference keywords 302 included in the user profile database 107 of the digital television system 101 and the preference keyword table 402 included in the distributed information are respectively set by way of the questionnaire or by manual input . in addition , it is possible to ( semi ) automatically generate the preference keywords 302 by means of keyword extraction from program detail information with reference to a viewing history recorded in a usual state , and the preference keyword table 402 by means of keyword extraction from detail information included in the distributed information . for example , description will be made of a case where the structure of fig5 is adopted for the distributed program consisting of the elements 401 to 403 , and the structure of fig6 is adopted for the preference information of a given user included in the user profile database 107 of the digital television system 101 . [ 0080 ] fig5 shows a system compatibility information 502 , a preference keyword table 503 , and a main part of data 501 . the main part of data 501 , which serves as a substantial information part of the distributed program , is assumed to be a software updater for providing the user with a menu screen image incorporated with a movie commercial as shown in fig7 . the program of fig5 provides the additional menu screen image relating to the commercial of a new car action movie , and has keywords relating to the contents recorded into the preference keyword table 503 serving as a preference information part . from the comparison between the keywords in the preference keyword table 503 as the preference information part and a preference keywords 602 in the user profile database part 107 of the digital television system 101 , it is understood that there are matched keywords and the user may possibly be interested in the distributed program . subsequently , a screen is displayed as shown in fig8 to inquire the user &# 39 ; s judgment as to whether the user will use the distributed program or not . in the case where the user will use the distributed program , the screen image shown in fig7 is added to the menu screen , that is , the gui is changed . according to the above description , it is possible for the user to easily add a menu screen image for utilizing services by being notified of only the image that suits the user &# 39 ; s preference selected from among the distributed additional menu screen images . as to the use of user information , description is made in japanese patent application laid - open no . 2002 - 297657 . [ 0086 ] fig9 shows a configuration of a digital television system to which a method of changing a graphical user interface according to embodiment 2 of the present invention is applied . in fig9 a digital television system 901 includes a signal receiver 903 for receiving from a signal transmitter 902 a broadcast wave broadcast by a program broadcasting side , system software 905 including a gui controller 904 that serves to display a menu and data contents , a display 906 for displaying a picture and a gui , a user profile database 907 for recording and storing preference information of a user . [ 0088 ] fig1 is a diagram showing a flow of an operation for changing the graphical user interface according to this embodiment . in step s 1001 , the signal transmitter 902 distributes an archive of software for decorating a menu . in step s 1002 , the digital television system 901 receives the archive at the signal receiver 903 . in step s 1003 , a header is extracted from the received archive . in step s 1004 , the user profile database 907 is searched through , and it is checked whether any of keywords included in the header belongs to ( is included in ) preference keywords included in the user profile database 907 or not . if included , the processing advances to step s 1005 , and if not included , the processing advances to step s 1007 . in step s 1005 , an inquiry ( fig1 ) is made to a user . if the user wishes to install decoration data , the processing advances to step s 1006 , and if the user does not wish to , the processing advances to step s 1007 . accordingly , selective installation can be performed . in step s 1006 , the installation of the decoration data is performed as a program for changing the gui . the digital television system 901 provides the system software 905 with a mechanism for having a user fill in a questionnaire form on his / her preference information at the time of purchasing a product , or a mechanism for learning the user &# 39 ; s preference information through a user &# 39 ; s operation . accordingly , the user profile database 907 is created . here , an example structure of the user profile database 907 is shown in fig1 . in the user profile database 907 , user identification information ( user id ) 1101 and user &# 39 ; s preference keywords 1102 are used to manage user information . the preference keywords 1102 include words serving as keywords based on information of user &# 39 ; s “ favorites ”. the signal transmitter 902 distributes information ( a program ) to the digital television system 901 in each household by superposing the information on the broadcast wave used for a program or a commercial that is being broadcast . the information ( program ) is used to decorate components ( buttons and panels ) of a menu screen image of the digital television system 901 for the purpose of enhancing the user &# 39 ; s recognition of the services or increasing the user &# 39 ; s sense of attachment by use of advertisements and public relations for arbitrary products and planned programs , or characters etc . symbolizing the services used as in character goods . the distributed program has a header part as shown in fig1 . the header part includes a system compatibility information 1201 and a preference keyword table 1202 of archive . the system compatibility information 1201 provided in the header part serves to judge an adaptability of the program with respect to the structure of the digital television system 901 , determine that the program can be applied to the system , and then compare the information in the preference keyword table 1202 with the user &# 39 ; s preference information . if these information coincide with each other , according to the user &# 39 ; s wish , a main part of data ( a program ) 1203 for decorating the screen components is installed into the digital television system 901 . the preference keywords 1102 included in the user profile database 907 of the digital television system 901 and the preference keyword table 1202 included in the distributed program are respectively set by way of the questionnaire or by manual input . in addition , it is possible to ( semi ) automatically generate the preference keywords 1102 by means of keyword extraction from program detail information with reference to a viewing history recorded in a usual state , and the preference keyword table 1202 by means of keyword extraction from detail information included in the distributed information . [ 0103 ] fig1 shows system compatibility information 1302 , a preference keyword table 1303 , and a main part of data 1301 . for example , description will be made of a case where the structure of fig1 is adopted for the distributed program consisting of the elements 1201 to 1203 , and the structure of fig1 is adopted for the preference information of a given user included in the user profile database 907 of the digital television system 901 . the main part of data 1301 , which serves as a substantial information part of the distributed program , is assumed to provide data and program for changing components as of fig1 a into components as of fig1 b . the menu screen images of fig1 a and 15b are structured by sets of menu items 1501 a and 1501 b and menu focuses 1502 a and 1502 b , respectively . the menu screen image of fig1 b is added with a menu selection mascot . 1503 b that exhibits a visual effect when moving the menu focus 1502 b . the program of fig1 provides a screen decoration program relating to the soccer world cup , and the keywords relating to its contents are recorded in the preference keyword table 1303 . from the comparison between the keywords in the preference keyword table 1303 and preference keywords 1402 in the user profile database part 907 of the digital television system 901 , it is understood that there are matched keywords and the user may possibly be interested in the distributed program . subsequently , a screen is displayed as shown in fig1 to inquire the user &# 39 ; s judgment as to whether the user will use the distributed program or not . in the case where the user will use the distributed program , the screen image ( gui ) is changed as shown in fig1 b . according to the above description , it is possible to provide a user with a menu screen image suitable for his / her preference by notifying the user of only the function that suits the user &# 39 ; s preference selected from among the distributed additional functions . as to the use of keywords , description is made in japanese patent application laid - open no . 2002 - 300483 . [ 0111 ] fig1 shows a configuration of a digital television system to which a method of changing a graphical user interface according to embodiment 3 of the present invention is applied . in fig1 , a digital television system 1701 includes a signal receiver 1703 for receiving from a signal transmitter 1702 a broadcast wave broadcast by a program broadcasting side , system software 1707 including a gui controller 1704 that serves to display a menu and data contents , a remote control receiver 1706 for receiving signals from a remote control 1705 , a display 1708 for displaying a picture and a gui , a user profile database 1709 for recording and storing preference information and characteristics information of a user . [ 0113 ] fig1 is a diagram showing a flow of an operation for changing the graphical user interface according to this embodiment . in step s 1801 , the signal transmitter 1702 distributes a new remote control information . in step s 1802 , the digital television system 1701 receives the new remote control information at the signal receiver 1703 . in step s 1803 , a header is extracted from the received archive . in step s 1804 , it is checked whether a degree of recommendation for the remote control is equal to or higher than a value set arbitrarily or not . if equal to or higher than the set value , the processing advances to step s 1805 , and if lower than the set value , the processing advances to step s 1807 . accordingly , selective installation can be performed . in step s 1805 , if there is a user &# 39 ; s instruction of purchase and the user wishes to install a program for changing an operating and displaying manner , the processing advances to step s 1806 , and if the user does not wish to , the processing advances to step s 1807 . in step s 1806 , it is determined to execute the installation of the program for changing an operating and displaying manner , and the installation is executed . the remote control 1705 can be selected by the user from among a plurality of the remote controls 1705 that satisfy predetermined criteria ( such as a transmission method for signals and a type of button required minimally ). the remote control receiver 1706 of the digital television system 1701 is assumed to be capable of receiving signals from any remote control 1705 that satisfies the criteria . it is also assumed that the user can selectively use the remote control having an operation device that is his / her “ favorite ” one or “ suitable for his / her physical conditions ”. the digital television system 1701 provides the system software 1707 with a mechanism for having a user fill in a questionnaire form on his / her preference information and characteristics information at the time of purchasing a product , or a mechanism for learning the user &# 39 ; s preference information and characteristics information through a user &# 39 ; s operation . accordingly , the user profile database 1709 is created . here , an example structure of the user profile database 1709 is shown in fig1 . in the user profile database 1709 , user identification information ( user id ) 1901 , user &# 39 ; s preference keywords 1902 , and user &# 39 ; s characteristics information parameter part 1903 are used to manage user information . the preference keywords 1902 include words serving as keywords based on information of user &# 39 ; s “ favorites ”. the user &# 39 ; s natures are stored in the user &# 39 ; s characteristics information parameter part 1903 . for example , a user &# 39 ; s whip hand , the presence or absence of a physical disability , basic operation using a remote control ( whether to use a ten - key numeric pad or keys labeled as “+”, “.”, and “−”), the number of redos for an operation , etc . are recorded . the user &# 39 ; s characteristics information ( tendency information for a user &# 39 ; s operation ) 1903 includes at least one of a history of an operation for executing a given function , a type of misoperation caused before the execution , a hand holding a remote control , and information as to whether the remote control is laid or held in use . the signal transmitter 1702 is used by a manufacturer or the like manufacturing a remote control that can be used in the digital television system 1701 to distribute advertisement information of the manufactured remote control to the digital television system 1701 in each household by superposing the advertisement information on the broadcast wave . the distributed advertisement information has a header part and a main part of data as shown in the structure of fig2 . the header part includes system compatibility information 2002 and remote control characteristics information 2003 . the system compatibility information 2002 included in the header part is used to judge the adaptability of the remote control with respect to the digital television system 1701 , and check whether the remote control can be applied to the system . then , the degree of recommendation for the remote control to the user is determined based on the remote control characteristics information 2003 notified of in the distributed advertisement information and the user &# 39 ; s characteristics information parameter part 1903 stored in the user profile database 1709 of the digital television system 1701 . for example , fig2 a to 21 c shows a flow for obtaining the degree of recommendation . in the case of a user &# 39 ; s profile shown in fig2 a , common characteristics with respect to the transmitted characteristics information of the remote control of fig2 b are selected . as shown in fig2 c , weighting factors ( which have been assigned to the characteristics information of the remote control ) of the common characteristics are summed up to set the resultant value as the degree of recommendation for the remote control . the degree of recommendation for the remote control is thus calculated according to the flow of fig2 a to 21 c , and the user is notified of the remote control with the degree of recommendation exceeding a predetermined value as shown in fig2 . if the user notified of the information shown in fig2 purchases the remote control , driverware and information ( a program ) for changing a graphical user interface are distributed . the program for changing a graphical user interface which is distributed at this time indicates a program for , in the case where the purchased remote control is , for example , equipped with a bidirectional shuttle device shown in fig2 , changing a menu image shown in fig2 a into a menu image shown in fig2 b . when the reception of the distributed program finishes , such notification as shown in fig2 is made to have the user judge whether to adopt the change into a graphical user interface pattern ( layout or button assignment for the remote control ) suitable for the remote control in use . if the user wishes , the program for changing an operating and displaying manner is installed to the digital television system 1701 . according to the above description , the user can receive recommendation of a remote control suitable for the user , and the layout or the button assignment for the remote control can be variously set based on the forms of the remote controls . according to embodiment 4 of the present invention , as shown in fig2 , a network connected portion 2611 for connection with a network and a server 2610 existing in the network are added to the system of fig1 according to embodiment 3 . the server 2610 constantly accumulates programs for a graphical user interface ( layout or button assignment for the remote control ) which is transmitted from the signal transmitter 2602 . although the notification of another remote control may not be received in embodiment 3 , in the case where the number of misoperations for a given operation exceeds a predetermined number , or in the case of having the characteristics information based on which it is judged as being desirable to change the graphical user interface ( the judgment is performed by , for example , an agent function ), the following process is performed . that is , the digital television side searches through the server 2610 based on the characteristics information , and automatically downloads information ( a program ) for changing the graphical user interface . the server 2610 accumulates programs for changing the graphical user interface , and is accompanied with characteristics information indicating a compatibility with an arbitrary remote control . the digital television system 2601 transmits the information on a remote control 2605 currently in use to the server 2610 . the server 2610 that has received the information on the remote control 2605 compares the characteristics information accompanying graphical user interface patterns with the received information , and calculates the adaptability according to the procedure of fig2 a to 27 c . in the case where the characteristics information of a given remote control is structured as shown in fig2 a , the characteristics information is compared with the characteristics information of a graphical user interface pattern of fig2 b , which accompanies an archive of the programs for changing a graphical user interface pattern stored in the server , to select the common characteristics . as shown in fig2 c , the weighting factors ( which have been assigned to the characteristics information of the graphical user interface pattern ) of the common characteristics are summed up to set the resultant value as the adaptability . if the calculated adaptability exceeds a predetermined value , the program for changing for the graphical user interface with the adaptability is transmitted to the digital television system 2601 . in the digital television system 2601 that has been received the information for changing the graphical user interface , such notification as shown in fig2 is made to have the user judge whether to adopt the change into another graphical user interface pattern ( layout or button assignment for the remote control ) suitable for the remote control in use . if the user wishes to adopt the change , the digital television system 2601 selectively installs the received program . according to the above description , the user can set another operation form ( layout or button assignment for the remote control ) suitable for the remote control currently in use . as described above , the digital television system according to embodiment 1 includes the display means for organizing the menu screen of the digital television for display , the receiving means for receiving a program for adding an additional menu item and additional menu item group to the menu screen image , the accumulating means for accumulating the user &# 39 ; s preference information , the notifying means for notifying the user of only the program suitable for the user &# 39 ; s preference information based on the relating keywords accompanying the distributed program , and the executing means for executing the application of the program . thus , the digital television system provides the additional operation screen image . according to embodiment 1 , it is possible for a user to easily add a menu screen image for utilizing services by being notified of only the function that suits the user &# 39 ; s preference selected from among the distributed additional functions . the digital television system according to embodiment 2 includes the display means for organizing the menu screen of the digital television for display , the receiving means for receiving a program for decorating the menu screen according to a given theme , the accumulating means for accumulating the user &# 39 ; s preference information , the notifying means for notifying the user of only the program suitable for the user &# 39 ; s preference information based on the relating keywords accompanying the distributed program , and the executing means for executing the application of the program . thus , the digital television system decorates the operation screen for the user . according to embodiment 2 , it is possible to provide a user with a menu screen image suitable for his / her preference by notifying the user of only the function that suits the user &# 39 ; s preference selected from among the distributed additional functions . the digital television system according to embodiment 3 includes the display means for organizing the menu screen of the digital television for display , the remote control for operating the menu screen , the receiving means for receiving a command ( indicating which key is depressed or the like ) and information ( manufacturer id and equipment id ) unique to the remote control which are transmitted to the digital television by the operation of the remote control , the receiving means for receiving a program for changing the layout of the menu screen and the button assignment for the remote control for operation , and the accumulating means for accumulating the tendency information for the user &# 39 ; s operation ( such as the history of the operation for executing a given function , the type of misoperation caused before execution of the given function , the hand holding the remote control , and information as to whether the remote control is laid in use or held in use ). the digital television system according to embodiment 3 further includes the calculating means for calculating the characteristics information of the remote control included in the specification information of the distributed new remote control and the degree of recommendation for the remote control from the tendency information for the user &# 39 ; s operation , the notifying means for notifying the user of the remote control whose degree of recommendation exceeds a predetermined value , the receiving means for receiving the program for providing the layout of a menu screen and the button assignment for the remote control which are suitable for the operation using the remote control , and the executing means for executing the application of the program . thus , the layout of the menu screen and the button assignment for the remote control are changed for the user . according to embodiment 3 , the user can receive the recommendation of the remote control according to the user &# 39 ; s operation environment , and the operation forms can be variously set based on the forms of the remote controls . the digital television system according to embodiment 4 is structured by adding to the digital television system according to embodiment 3 the network connecting means for connection with a network and the accumulating means for accumulating the programs for changing the layout of the menu screen and the button assignment for the remote control . from among the programs for changing the layout of the menu screen and the button assignment for the remote control , the user is provided with the program with the adaptability exceeding a predetermined value . the adaptability is calculated from the characteristics information of the remote control currently in use and the characteristics information of the graphical user interface to be attained by the program which accompanies the program for changing the layout of the menu screen and the button assignment pattern for the remote control . according to embodiment 4 , the user can easily set another operation form suitable for the remote control currently in use . embodiment 4 can be realized by causing a computer ( digital television system etc .) to execute the program . further , as embodiment 4 , it is possible to adopt program providing means for providing a program to the computer , for example , a recording medium such as a cd - rom that records the program therein or a transmission medium such as the internet that transmits the program therethrough . the program , the recording medium , and the transmission medium are included in the scope of the present invention . as the recording medium , there can be used , for example , a flexible disk , a hard disk , an optical disk , a magneto - optical disk , a cd - rom , a magnetic tape , a nonvolatile memory card , and a rom . note that the above - mentioned embodiments have been respectively presented merely as specific examples for implementing the present invention , and the technical scope of the present invention should not be construed as being limited those embodiments . that is , the present invention can be implemented in various forms without departing from the technical spirit or essential characteristics thereof .	7
before describing the present invention of fig1 a brief description of the compressed image file is believed appropriate for a better understanding of the decoder and the process of decoding the image file . image data for large images may be compressed / decompressed by any of the well known formats e . g . gif , jpeg , etc . for use in the present invention . however , one image compression / decompression format which is especially suitable for the decoder of fig1 is djvu created by the assignee of the present invention . the djvu specification is available on the world wide web at ( http :// dejavu . research . att . com /) and also from . at & amp ; t shannon laboratory , 180 park avenue , p . o . box 971 , florham park , n . j . 07932 - 0971 . the djvu iw44 component deals with wavelet encoded images and facilitates progressive rendering and smooth scrolling of large color or gray level images with limited memory requirements . briefly , djvu is a non - bit - preserving ( lossy ) compression method and file format for coding color , gray scale and bi - level images . djvu is especially suitable for compound images consisting of foreground text and background photographic or graphic images . algorithms are designed for efficient storage , retrieval , and display of scanned documents on the world wide web . djvu provides high compression rates by handling text and images differently , each in an efficient way . djvu provides progressivity , allowing an application to find text , then to display the images using a progressive buildup . djvu is designed to be implemented using data structures appropriate for efficient navigation within an image . the section numbers of the specification which are relied upon to decode color and gray scale images will now be described , as follows a grayscale iw44 image consists of one color component . a color iw44 image consists of three - color components . the iw44bit stream is coded using the ea iff 85 format preceded by a four - octet preamble . the format consists of a file header and chunks . each chunk consists of a chunk header followed by chunk data . the chunk header consists of a four - octet type id followed by a four - octet integer specifying the number of octets of chunk data in the chunk . chunk data consists of a short header whose length is determined by the chunk type , followed by a stream of arithmetically coded data . the arithmetic coder used is the z ′- coder , a binary arithmetic coder . the z ′- coder is a variant of the z - coder . reference 1 [ bottou , howard and bengio1998 ]. when exactly two choices are possible for a given event , the z ′- coder is used without modification . the first four octets of an iw44 file are 0 × 41 0 × 54 0 × 26 0 × 54 . this preamble is not part of the eaiff85 format , but it is required in order to identify iw44 files . after the four - octet preamble , an iw44 file consists of a sub - file coded using the eaiff85 format ( hereinafter referred to as “ iff ” or “ the iff format ”). the parts of the iff format used with iw44 are described as needed in this document . an iff file consists of a number of chunks . each chunk has a header and data . the header of a chunk consists of a four - octet chunk - type field and a four - octet length field . the length is coded most significant octet first . the strings that identify the types of the chunks in an iff file are defined by the application . a chunk whose type is not recognized by the application is to be ignored . in the iff format , chunks may be nested : a chunk may contain other chunks as part of its data . in the iw44 format , there is only one chunk at the outermost nesting level , a form chunk . all other chunks appear within the form chunk , sequentially , with no nesting . each chunk , including those nested within another chunk , must begin on an even octet boundary ; that is , the number of octets in the file before the beginning of the chunk must be an even integer . if the length of a chunk other than the last chunk is odd , a single padding octet whose value is 0 × 00 is placed between the chunk and the following chunk . an iff header consists of a four - octet ascii string identifying the chunk type , a four - octet integer containing the length of the data , most significant octet first , and the data . the length of the data includes only the actual data in the chunk . it does not include the eight - octet iff header . it does not include the padding octet that may be present after the data . it does include data headers that may be present in the data . the length of a form chunk includes the padding octets that may be present at the end of the chunks nested within the form chunk . the iff chunk types used in iw44 are the following : form , pm44 , and bm44 . all files contain a form chunk , inside which all the other chunks are nested . the first four data octets of the form chunk are a secondary identifier . if this secondary identifier is bm44 , then the file describes a grayscale iw44 image . the chunk form then contains one or more chunks bm44 coding the grayscale image data . if this secondary identifier is pm44 , then the file describes a color iw44 image . the chunk form then contains one or more chunks pm44 coding the color image data chunks of types pm44 and bm44 have the same structure . the chunk consists of a chunk header followed by arithmetically coded wavelet coefficient updates . the coefficients are organized in a hierarchical fashion . color component . color iw44 images contain color image data . grayscale iw44 images contain grayscale image data . color image data is coded using three color components , called y , cb , and cr . these correspond to the usual ycbcr color space , adjusted to facilitate transformation to the rgb color space . grayscale image data is coded using one color component called y which corresponds to the grayscale intensity of the image . color chunk . a color chunk is a chunk of type pm44 , or bm44 . a color chunk contains wavelet coefficient update information for one or three color components . block . a block of pixels of size 32 × 32 or less . the blocks are numbered starting in the lower left corner of the image . all blocks are 32 × 32 except possibly those along the right edge or top edge ; those blocks may be smaller if the image dimensions are not divisible by 32 . block count . the number of blocks in the image , denoted by n b . wavelet block . the set of coefficients associated with one block of the image , in one color component . there are 1024 wavelet coefficients in a wavelet block , numbered 0 through 1023 . the coefficients in a wavelet block have effects on the reconstruction of other blocks in the image , but for coding purposes they are considered to be localized within the block in which they are coded . bucket . a particular set of 16 wavelet coefficients within a wavelet block . a wavelet block consists of 64 buckets , numbered 0 through 63 . band . a subset of wavelet coefficients for a given color component . there are 10 bands , the correspondence among band numbers , coefficient coefficients , and bucket coefficients being given by the following table : color band number . the current band number for a color component . each color component &# 39 ; s color band number starts at 0 , and increases by 1 until it reaches 9 as described below ; then it is reset to 0 . color band . a subset of the coefficients of one color component of the image , consisting of updates of all the coefficients in the image whose indices within their respective blocks are those corresponding to the current color band &# 39 ; s color band number . a slice is the highest level subdivision of a color chunk . a slice contains data for one color band for each of the color components in a color layer , that is , for three - color components for a color image , or for one color component for a grayscale image . block band . a subset of the coefficients of one color component of a wavelet block , consisting of updates of the coefficients in the block whose indices are those corresponding to a given band . chrominance delay counter . an integer counter that indicates how additional slices in a color layer contain a color band only for the y color component , and not for the cb and cr color components . the chrominance delay counter is initialized to the value specified in the first pm44 or bm44 chunk , and decremented by 1 after each slice in the color layer until it reaches 0 . there may be more than one pm44 or bm44 chunks in an iw44 file . if there is more than one such color chunk , the coefficient updating is continuous across the chunks , and the data is taken from the chunks in the order in which they appear in the file . nothing is reinitialized at the beginning of chunks after the first color chunk of these types , except for the low - level arithmetic coder . each color component is coded using a dubuc - deslauriers - lemire ( 4 , 4 ) interpolative wavelet transform . reference 3 [ sweldens1996 ]. the image is transformed into a set of wavelet coefficients , one wavelet coefficient for each pixel in the original image . this transform is especially effective for coding images at high compression ratios . the value of each coefficient is coded in a distributed fashion , through a number of cycles . within one cycle , each coefficient is updated once ( that is , in only one of the 10 bands ), and receives approximately one additional bit of information . specifically , from cycle to cycle the absolute value of a coefficient is first narrowed down by eliminating possible values for the most significant non - zero bit until the correct most significant non - zero bit is found . the sign is coded in the same cycle in which the most significant non - zero bit is found . then in each subsequent cycle , one additional bit of the value is coded . a color chunk begin with a data header consisting of 2 or 9 octets , as follows : serial number . a one - octet unsigned integer . the serial number of the first chunk of a given chunk type must be 0 . successive chunks are assigned consecutive serial numbers . number of slices . a one - octet unsigned integer . the number of slices coded in the chunk . major version number and color type . one octet containing two values , present only if the serial number is 0 . the least significant seven bits designate the major version number of the standard being implemented by the decoder . for this version of the standard , the major version number is 1 . the most significant bit is the color type bit . the color type bit is 0 if the chunk describes three color components . the color type bit is 1 if the chunk describes one color component . minor version number . a one - octet unsigned integer , present only if the serial number is 0 . this octet designates the minor version number of the standard being implemented by the decoder . for this version of the standard , the minor version number is 2 . image width . a two - octet unsigned integer , most significant octet first , present only if the serial number is 0 . this field indicates the number of pixels in each row of the image described by the current chunk . the image width will be less than the width of the original image if the chunk describes a layer coded at lower resolution than the original image . image height . a two - octet unsigned integer , most significant octet first , present only if the serial number is 0 . this field indicates the number of pixels in each column of the image described by the current chunk . the image height will be less than the height of the original image if the chunk describes a layer coded at lower resolution than the original image . initial value of chrominance delay counter . a one - octet unsigned integer , present only if the serial number is 0 . only the least significant seven bits are used . the most significant bit is ignored , but should be set to 1 by an encoder . this field specifies the initial value of the chrominance delay counter , used as described below . the data coded in a color chunk consists of information needed to reconstruct wavelet coefficients . there are one or three color components ; each color component has its own set of wavelet coefficients . within a color component , there are 1024 wavelet coefficients for each 32 × 32 block of the image . coding is divided into a series of slices . the slices may be coded in one chunk , or they may be separated into a number of chunks . the only difference it makes whether the slices are coded in one chunk or in several chunks is in the order of progressive rendering ; the final reconstructed image will be the same . the number of slices in each chunk is specified in the color chunk data header . one slice contains refinement data for one color band for each color component . within a color component , all coefficients in a slice are in the same band . a color chunk describes the full image at the spatial resolution implied by the image width and image height fields in the data header of the first chunk of the same type as the current color chunk . the sequence of color components within a slice is : first y , then cb , then cr , although the cb and cr components are not present in a slice if the chunk describes grayscale data or if the chrominance delay counter is not equal to 0 at the time the slice is coded . a color band is made up of coefficient updates for all blocks in the image , but only for coefficients that are in the currently active band for the color component . each block &# 39 ; s set of updates within a color band is called a block band . the block bands are coded block by block , by rows from bottom to top , and from left to right within each row . within a block band , there are 16 , 64 , or 256 coefficient updates . the coefficients being updated are divided into buckets , each bucket containing 16 coefficients . thus , a block band contains 1 , 4 , or 16 buckets . the buckets and coefficients being updated are determined by the color band number . the header of the first color chunk contains an initial value for the chrominance delay counter . it may be 0 or a positive integer . at the beginning of the first color chunk , the color band number for each of the three - color components is set to 0 . at the beginning of each slice , the chrominance delay counter is tested . if the chrominance delay counter is 0 and if the slice describes color image data , then all three - color components are present . if the chrominance delay counter is greater than 0 or if the chunk describes grayscale image data , only the y color component is present for the slice . at the end of a slice , the following actions take place : the color band number is increased by 1 for the y component . if the new color band number exceeds 9 , it is set to 0 . if the chrominance delay counter is 0 ; the color band numbers for the cb and cr components are increased by 1 . if the new color band numbers exceed 9 , they are set to 0 . ( note : the color band numbers for the cb and cr components are always equal to each other .) if the chrominance delay counter is greater than 0 , it is decreased by 1 . a color chunk ends when the number of slices specified in the color chunk header have been coded . at the beginning of each color chunk after the first , the chrominance delay counter and color band numbers retain the values they had at the end of the previous color chunk . all wavelet coefficients are quantized . the quantization is uniform ( i . e ., the quantization bin step size is the same for all steps ), except for the bin including the coefficient whose value is 0 . the number of coefficient values encompassed by that bin is twice the step size minus 1 . the initial values of the quantization bin step sizes are given in the following table . there is a separate table of step sizes for each color component . each color component &# 39 ; s table is given the same initial values . each slice contains one band of coefficient update information for each color component . at the end of a slice , the quantization bin step sizes are divided by 2 for the current band for each color component . the indices of the quantization bin step sizes to be reduced for each band are given in the following table . step sizes are always integer powers of 2 . when a step size of 1 is divided by 2 , the result is set to 0 . within a block band , each coefficient in the block band may be updated . a block band is decoded by a preliminary flag computation followed by four passes . one or more of the passes may be skipped or may not require any decoding , depending on conditions present at the beginning of the block band &# 39 ; s coding and on tests made during the decoding of previous block band passes . the 4 passes are : 2 . decoding the decode coefficients decision for buckets in the block band . 3 . decoding the activate coefficient decision for coefficients in the block band , and determining the sign of newly activated coefficients . during the coefficient updating process , a number of binary decisions are decoded . each decision is decoded using the z ′- coder . decoding a decision using the z ′- coder may be done with a conditioning context , or it may be done using the pass - through mode of the z ′- coder . for color chunk decoding , there are up to 584 conditioning contexts , up to 294 conditioning contexts for the background layer and up to 294 conditioning contexts for the foreground layer . within a layer , there are 98 conditioning contexts for each color component ; one or three color components may be present for each layer . if the image is a grayscale image the contexts are as follows : 1 context in each color component is for the decode buckets decision . 80 contexts in each color component are for the decode coefficients decision , 8 for each of the 10 bands . 16 contexts in each color component are for the activate coefficient decision . 1 context in each color component is for the increase coefficient decision . the coefficient sign is decoded using the pass - through mode of the z ′- coder . for all occurrences of the increase coefficient decision for any coefficient after the first such decision , the increase coefficient decision is coded using the pass - through mode of the z ′- coder . flags are computed for each coefficient in the block band , for each bucket in the block band , and for the block band as a whole . 1 . flag computation for coefficients . for each coefficient in a block band , there is a value of the quantization threshold . for each coefficient , there are two flag values , based on the value of the coefficient and the value of the coefficient &# 39 ; s quantization threshold . the flags are called active and potential . at most one of the flag values may be set for a coefficient in a given cycle . if the coefficient &# 39 ; s quantization threshold is either 0 or greater than or equal to 0 × 8000 , then both flag values are clear . the two flag values are : ( a ) active : the coefficient &# 39 ; s active flag value is set if the coefficient &# 39 ; s quantization threshold is greater than 0 and less than 0 × 8000 , and the coefficient &# 39 ; s value is not 0 . otherwise the coefficient &# 39 ; s active flag value is clear . the sign of the coefficient is known , and the most significant non - zero bit of its absolute value is known . ( b ) potential : the coefficient &# 39 ; s potential flag value is set if the coefficient &# 39 ; s quantization threshold is greater than 0 and less than 0 × 8000 , and the coefficient &# 39 ; s value is 0 . otherwise the coefficient &# 39 ; s potential flag value is clear . it is possible that the value of this coefficient will become non - zero during this cycle . 2 . flag computation for buckets . each bucket has two flag values associated with it depending on the flags of the 16 coefficients in the bucket . the bucket flags have the same names as the coefficient flags . both , one or neither of the bucket flags may be set for a bucket in a given cycle . ( a ) active : the bucket &# 39 ; s active flag is set if any of the coefficients in the bucket have active flags set . otherwise the bucket &# 39 ; s active flag value is clear . ( b ) potential : the bucket &# 39 ; s potential flag is set if any of the coefficients in the bucket have potential flags set . otherwise the bucket &# 39 ; s potential flag value is clear . 3 . flag computation for the block band . the block band has two flag values associated with it depending on the flags of the buckets in the block band . the block band flags have the same names as the bucket flags . both , one or neither of the block band flags may be set for a block band in a given cycle . the block band flag values are not needed if the number of buckets in the block band is less than 16 . ( a ) active : the block band &# 39 ; s active flag is set if any of the buckets in the block band have active flags set . otherwise the block band &# 39 ; s active flag value is clear . potential : the block band &# 39 ; s potential flag is set if any of the buckets in the block band have potential flags set . otherwise the block band &# 39 ; s potential flag value is clear . if the block band contains fewer than 16 buckets , the block - band - decoding pass is skipped . if the block band &# 39 ; s active flag is set , the block - band - decoding pass is skipped . if the block band contains 16 buckets , and if the block band &# 39 ; s active flag is clear , and if the block band &# 39 ; s potential flag is set , then the decode buckets decision is decoded . if the decode buckets decision is yes , the bucket - decoding pass is performed for the block band . if the decode buckets decision is no , the bucket - decoding pass and the newly - active - coefficient - decoding pass are skipped for the block band . for each color component , there is a single context for use in decoding the decode buckets decision . if the value returned by the z ′- coder for the decode buckets decision is 1 , then the value of the decode buckets decision is yes . if the value returned by the z ′- coder is 0 , then the value of the decode buckets decision is no . each bucket has a flag called the coefficient - decoding flag . if the bucket - decoding pass is not skipped , then for each bucket in the block band , if the bucket &# 39 ; s potential flag is set , then the decode coefficients decision for the bucket is decoded . if the decode coefficients decision is yes , then the bucket &# 39 ; s coefficient - decoding flag is set ; otherwise it is clear . for each color component , there are 80 contexts for use in decoding the decode coefficients decision . for each of the 10 bands , there are 8 contexts . there are four contexts that may be used if the block band &# 39 ; s active flag is set , and four contexts that may be used if the block band &# 39 ; s active flag is clear . if the band number is 0 , then n 0 = 0 . otherwise , the value of n 0 is computed as follows : 1 . the bucket number is multiplied by 4 , giving a result t . 2 . the coefficients numbered t , t + 1 , t + 2 , and t + 3 are examined , and the number n 0 of coefficients with value 0 among the four coefficients is counted . then the value of n 0 is used as the index to one of the four contexts , for the given color component , band , and block band active flag value . if the value returned by the z ′- coder for the decode coefficients decision is 1 , then the value of the decode coefficients decision is yes . if the value returned by the z ′- coder is 0 , then the value of the decode coefficients decision no . if the newly - active - coefficient - decoding pass is not skipped , then for each bucket in the block band , the coefficient - decoding flag is tested . for a given bucket , if the coefficient - decoding flag is set , then the following procedure is followed for each coefficient in the bucket : if the coefficient &# 39 ; s potential flag is set , then the activate coefficient decision is decoded . if the activate coefficient decision is yes , then the sign of the coefficient s ± , with value + 1 or − 1 , is decoded . then the coefficient is set equal to : for each color component , there are 16 contexts for use in decoding the activate coefficient decision . there are eight contexts that may be used if the block &# 39 ; s active flag is set , and eight contexts that may be used if the block &# 39 ; s active flag is clear . the index of the context to be used from among the 8 possible contexts is computed as follows : 1 . the coefficients in the bucket are examined , and the number n p of them whose potential flag is set is computed . ( b ) use i p as the index into the set of 8 possible contexts , given the color component and value of the block &# 39 ; s active flag . ( c ) decode the activate coefficient decision using the context ; if the activate coefficient decision is yes , decode the sign using the pass - through mode of the z ′- coder , and set n p = 0 . if the value returned by the z ′- coder for the activate coefficient decision is 1 , then the value of the activate coefficient decision is yes . if the value returned by the z ′- coder is 0 , then the value of the activate coefficient decision is no . the decoding of the sign s ± , of a newly activated coefficient uses the pass - through mode of the z ′- coder . if the value returned by the z ′- coder is 1 , then s ± =− 1 . if the value returned by the z ′- coder is 0 , then s ± =+ 1 . for all coefficients in the block band , the following procedure is followed : if the coefficient &# 39 ; s active flag is set , the increase coefficient decision is decoded . if the decision is no , the absolute value of the coefficient is reduced by half of the coefficient &# 39 ; s quantization threshold . if the decision is yes , the absolute value of the coefficient is increased by half of the coefficient &# 39 ; s quantization threshold . for each color component , there is a single context for use in decoding the increase coefficient decision . this context is used to decode the increase coefficient decision if the absolute value of the coefficient is less than or equal to 3 times the value of the quantization threshold for the coefficient . otherwise , the pass - through mode of the z ′- coder is used . whether the context or the pass - through mode is used , if the value returned by the z ′- coder for the increase coefficient decision is 1 , then the value of the increase coefficient decision is yes . if the value returned by the z ′- coder is 0 , then the value of the increase coefficient decision no . at any time during the decoding process , an image may be reconstructed from the wavelet coefficients already decoded . the wavelet coefficients are stored in three two - dimensional arrays one for each of the y , cb , and cr color components . each array has one entry for each image block . each entry itself is a 1024 - element one - dimensional array . the elements of each one - dimensional array are the wavelet coefficients . the wavelet coefficients are signed fixed - point numbers with six fractional bits . to reconstruct the image from the coefficients , the following steps must be performed : 1 . reordering coefficients . for each color component , each of the 1024 - element coefficient arrays is converted into a 32 × 32 coefficient array . these square coefficient arrays are embedded into a larger reconstruction array whose size is the size of the image . 2 . inverse wavelet transform . for each color component , the inverse wavelet transform is applied to the larger reconstruction array . the inverse transform is applied at progressively finer scales , and within each scale in each of the two directions , first vertically , then horizontally . 3 . precision reduction . for each color component , the data values in the reconstruction array are reduced to eight bits . 4 . conversion to rgb color space . for color images , the eight - bit values of each pixel in the ycbcr color space are converted to the corresponding eight - bit values in the rgb color space . for indexing the blocks within a color component , the origin ( 0 , 0 ) is at the lower left corner of the image . horizontal indices increase rightward , and vertical indices increase upward . for indexing the coefficients within a 32 × 32 block coefficient array , the origin ( 0 , 0 ) is at the lower left corner of the block . horizontal indices increase rightward , and vertical indices increase upward . for indexing the coefficients and color values within the image in the reconstruction array , the origin ( 0 , 0 ) is at the lower left corner of the image . horizontal indices increase rightward , and vertical indices increase upward . within each color component , the coefficients in each block are moved from a 1024 - element linear array into a 32 × 32 square array . the square array from each block is embedded in a reconstruction array the size of the full image . the mapping from indices in the linear array to indices in the square array is as follows : if the ten bits of the index in the linear array are b 9 b 8 b 7 b 6 b 5 b 4 b 3 b 2 b 1 b 0 , bit b 9 being the most significant bit of the index , then the bits of the row index of the square array are b 1 b 3 b 5 b 7 b 9 , bit b 1 being the most significant bit of the row index , and the bits of the column index of the square array are b 0 b 2 b 4 b 6 b 8 , bit b 0 being the most significant bit of the column index . if the number of rows in the image is not a multiple of 32 , then blocks along the top edge of the image have fewer than 32 rows . if the number of columns in the image is not a multiple of 32 , then blocks along the right edge of the image have fewer than 32 columns . for all such blocks , all coefficients are coded ; however , coefficients that fall outside the boundary of the image after the coefficient mapping described above are never used , regardless of their value . the inverse transformation from wavelet coefficients to color values is done independently for the three - color components . within a color component the transform is done for a decreasing sequence of scale parameters s . for a given scale parameter s , the transform is done first for columns , then for rows . within a column or row , the transform is done in two passes , a lifting pass and then a prediction pass . the scale parameter &# 39 ; s initial value is s = 16 . after the vertical and horizontal transformations have been done with a given value of s , the value of s is divided by 2 and the next pair of transformations is performed . after the vertical and horizontal transformations have been performed with s = 1 , the inverse wavelet transform for the color component is complete . the pair of transformations for a given value of s involve only rows and columns whose indices are multiples of s . the vertical transformation involves transforming the coefficients in column 0 whose row indices are multiples of s , then repeating the transformation for all other columns whose column indices are multiples of s . some of the coefficients transformed by the vertical transformation will already have been transformed during earlier iterations with larger values of the scale parameter s . the horizontal transformation involves transforming the coefficients in row 0 whose column indices are multiples of s , then repeating the transformation for all other rows whose row indices are multiples of s . the coefficients transformed by the horizontal transformation will have been transformed by the vertical transformation during the first pass for the current scale parameter s . some of the coefficients transformed by the horizontal transformation will already have been transformed during earlier iterations with larger values of the scale parameter s . 1 . if transforming a column , select the coefficients in the current column that come from rows whose indices are multiples of s . the coefficient from row ks is referred to as c k . the largest value of k is referred to as k max . if transforming a row , select the coefficients in the current row that come from columns whose indices are multiples of s . the coefficient from column ks is referred to as c k . the largest value of k is referred to as k max . 2 . lifting . for each even - numbered subscript k , 0 ≦ k ≦ k max , replace coefficient c k with c k - ⌊ 9   ( c k - 1 + c k + 1 ) - ( c k - 3 + c k + 3 ) + 16 32 ⌋ 3 . prediction . for each odd - numbered subscript k , 0 ≦ k ≦ k max , modify coefficient c k as follows : ( a ) if k − 3 ≧ 0 and k + 3 ≦ k max , replace c k with c k - ⌊ 9   ( c k - 1 + c k + 1 ) - ( c k - 3 + c k + 3 ) + 8 16 ⌋ ( b ) otherwise , if k + 1 ≦ k max , replace c k with c k + ⌊ c k - 1 + c k + 1 + 1 2 ⌋ after the inverse transformation , a color value in the reconstruction array for each color component is a signed fixed - point value with 6 fractional bits . this value is to be rounded to the nearest integer v . then if v & lt ;− 128 , v is set to − 128 , or if v ≧ 128 , v is set to 127 . finally , in the luminance ( y ) color component only , v is increased by 128 . after the inverse transformation , a grayscale value in the reconstruction array is a signed fixed - point value with 6 fractional bits . this value is to be rounded to the nearest integer v . then if v & lt ;− 128 , v is set to − 128 , or if v ≧ 128 , v is set to 127 . finally , v is replaced by 127 − v . for a color image , each pixel has a value in each of the color component reconstruction buffers . to convert a pixel &# 39 ; s ycbcr values to the corresponding rgb values , perform the following transformation : r = y + 3 2   cr g = y - 1 4   cb - 3 4   cr b = y + 7 4   cb this section presents how the iw44 format enables the construction of an efficient progressive decoder . as shown in fig1 a progressive decoder 10 can be viewed as composed of two units operating in parallel , namely a wavelet decoder 12 previously described in above sections 2 . 1 to 2 . 6 and an image renderer previously described in above section 2 . 7 responsive to image data 11 compressed in the djvu format , previously described in above sections 2 . 1 - 2 . 1 . 4 . the units 12 and 14 communicate via a shared array of wavelet coefficients 16 stored in a standard memory 18 . reducing the memory requirements for the shared array of wavelet coefficients ( section 3 . 3 ). the number of wavelet coefficients is equal to the number of pixels multiplied by the number of color components . each wavelet coefficient requires two octets in memory . a drastic reduction of these memory requirement can be achieved because most wavelet coefficients are zero . reducing the execution time of the image renderer ( sections 3 . 1 and 3 . 4 ). this is achieved by using more efficient wavelet transforms and by only reconstructing the part of the image which is actually needed . the techniques presented , either in isolation or in combination , are unique to the iw44 wavelet decoder . the inverse wavelet transform ( section 2 . 7 . 4 ) corresponds to a dubuc - deslauriers - lemire ( 4 , 4 ) interpolative wavelet transform . this transform is implemented using the lifting scheme . reference 3 — sweldens1996 which in that particular case can be implemented using integer arithmetic only . this approach eliminates the need for expensive floating point operations . furthermore , all the computations described in section 2 . 7 . 4 can be carried out using only bit shifts and integer additions or subtraction . no multiplications are needed . as described in sections 2 . 5 . 1 and 2 . 7 , the iw44 format organizes the wavelet coefficients using two - dimensional arrays ( one for each of the y , cb , and cr color components ). each array has one entry for each 32 × 32 blocks in the image . each entry itself is a linear array of 1024 coefficients ordered according to the rules specified in section 2 . 7 . 3 . fig2 shows how the ( y , x ) coefficients of a block 32 × 32 are reordered . fig2 a shows the traditional organization of the wavelet coefficients introduced in reference 1 —[ mallat1989 ]. dark areas 21 correspond to coefficients representing details of larger sizes . light areas 22 correspond to coefficients representing details of smaller sizes . fig2 b shows the organization of interleaved wavelet coefficients 21 required by a lifting transform . reference 2 —[ sweldens1996 ]. the coefficient coordinates are formed by inverting the bits of the coordinates in fig2 a . fig2 c shows the linearized array of coefficients 23 used by the iw44 wavelet decoder . the index in the linear array is computed by shuffling the bits of the coefficient coordinates in fig2 a . section 2 . 7 . 3 . explains how to reorder coefficients organization arranged as in fig2 c in order to obtain coefficients arranged as in fig2 b . this reordering has two interesting properties : if a particular wavelet coefficient is zero , then the neighboring wavelet coefficients in the linear array are more likely to be zero . the ordering rules tend to group the zeroes together and therefore enable the sparse array technique described in section 3 . 3 . coefficients located in the beginning of the linear array are likely to affect pixels located far away from the corresponding 32 × 32 block . coefficients located in the end of the linear array only affect pixels located in the current 32 × 32 block or in its immediate vicinity . this property is important for implementing the technique described in section 3 . 4 . in fig3 the memory requirements of the shared array 16 of wavelet coefficients can be drastically reduced by using a sparse array which takes advantage of the fact that a large number of coefficients are zero . a sparse array is a well known technique for efficiently representing arrays when a large number of elements are zero . our particular embodiment implements each array of 1024 coefficients corresponding to a 32 × 32 block using a two level indirection . four level - one pointers 32 represent each 256 coefficients . these level - one pointers either are zero — meaning that all 256 coefficients are zero — or reference an array of sixteen level - two pointers 34 addressing each set 36 of 16 coefficients . these level - two pointers either are zero - meaning that all 16 coefficients are zero — or reference an array containing the actual values of the 16 coefficients . null pointers are used when all corresponding coefficients are . then , there is no need to allocate memory for storing these coefficients equal to zero . this two level structure is convenient because it matches the structure of the wavelet encoding scheme : when the block - band - decoding pass ( section 2 . 6 . 2 ) reveals that the coefficient update will result into creating non - zero coefficients within a group of 256 coefficients ( 16 buckets ), the wavelet decoder tests the corresponding level - one pointer . if this pointer is zero , the wavelet decoder allocates an array of 16 level - two coefficients , initializes these pointers to zero , and causes the level - one pointer to reference this array . when the bucket - decoding pass ( section 2 . 6 . 3 ) reveals that the coefficient update will result into creating non zero coefficients within a bucket of 16 coefficients , the wavelet decoder tests the corresponding level - two pointer . if this pointer is zero , the wavelet decoder allocates an array of 16 coefficients , initializes them to zero , and causes the level - two pointer to reference this array . the implementation of fig3 ensures that memory 18 ( see fig1 ) is only allocated when a bucket of 16 coefficients contains one or more non - zero coefficient . this is efficient because the coefficient ordering rules ( section 3 . 2 ) tend to group the zero coefficients together . the amount memory required for storing these sparse arrays of coefficients is only a fraction of the amount of memory that would be required to store the uncompressed image . section 2 . 7 describes how to compute the values of all pixels in the image . it is preferable however to only compute the values of the pixels that are actually needed . in fig4 for instance , when the user of an image viewer program manipulates scrollbars 40 , 42 , for display 44 it is sufficient to compute the value of the few pixels uncovered along the edge of the image window . performing this much smaller computation is considerably faster than re - computing and redisplaying the whole image . the difficulty however consists of retrieving which coefficients are required to compute a predefined set of pixels . in the present embodiment , the inverse wavelet transform ( section 2 . 7 . 4 ) and the coefficient ordering rules ( section 2 . 7 . 3 ) ensures that the computation of the pixel values for a particular 32 × 32 block of the image depend on the following coefficients : all 1024 coefficients of the wavelet block ( cf . definition section 2 . 2 ) corresponding to this particular block . there is one such wavelet block for each of the y , cb , and cr color components . the first 256 coefficients of the wavelet blocks corresponding to the blocks immediately adjacent to the current block . there are at most eight such wavelet blocks for each of the y , cb , and cr color components . the first coefficient of the wavelet blocks corresponding to the blocks located on the right side and the top side of the eight blocks immediately adjacent to the current block . there are at most six such groups for each of the y , cb , and cr color components . fig5 represents an image 48 divided in 32 × 32 blocks . the partial rendering reconstructs a specified segment 50 of this image on the basis of the wavelet coefficients stored in an array 49 of wavelet blocks ( c . f . definition section 2 . 2 ). the partial rendering consists of 1 . determining the smallest set 52 of 32 × 32 blocks ( the required blocks ) containing the desired pixels . 2 . creating a reconstruction array 54 large enough to hold a sub - image large enough to encompass these required blocks , the blocks adjacent to the required blocks , the bottom row of the blocks located on the top side of the adjacent blocks , and the leftmost column of the blocks located on the right side of the adjacent blocks . 3 . for each color component , reordering the coefficients of these blocks as described in section 2 . 7 . 3 , and performing the inverse transform as described in 2 . 7 . 4 . the reconstruction array 54 contains the wavelet coefficient corresponding to the required blocks and the coefficients required for rendering the desired image segment . these operations are to be performed as if the sub - image mentioned above were the complete image . 4 . extracting the required pixel values and performing the remaining pixel level operations , precision reduction ( sections 2 . 7 . 5 and 2 . 7 . 6 ) and color conversion ( section 2 . 7 . 7 ) in order to reconstruct desired pixels 50 . the operation of the decoder 12 , renderer 14 and shared arrays 16 , as shown in fig1 is summarized , as follows : in fig6 the wavelet decoder process 600 waits to receive slices of incoming data . a test 601 is performed and a “ no ” condition continues the decoder in the waiting state . a “ yes ” condition initiates an operation 603 which reads the relevant coefficients from sparse arrays in the shared array 18 . the slices are decoded and the coefficients updated per section 2 . 6 in an operation 605 , followed by writing the updated coefficients into sparse arrays in an operation 607 , whereupon the decoder returns to the waiting state . the purpose of the test 601 is to determine whether there are more slices to come . the wavelet decoder process terminates when all slices have been received . otherwise , it processes the incoming slices 603 , 605 , 607 and goes back to 601 in order to process a possible new slice . in fig7 an updated coefficient c is written into the sparse array in a process 700 . in an operation 701 the decoder determines the sparse array p containing the coefficient c to be updated . a linear index l of the coefficient c is computed in the sparse array . the level 1 pointer described in fig3 is accessed in an operation 703 , where p 1 = p [ l / 256 ]. p 1 is compared to zero in a test 705 . a “ yes ” condition initiates test 707 to determine if c = 0 . if the c does equal 0 , the coefficient updating process ends . a “ no ” condition initiates an operation 709 in which an array p of 16 pointers is allocated . all 16 pointers are set to 0 and p 1 = p [ l / 256 ]= p . the operation 709 returns the process to an operation 711 in which the level 2 pointers are accessed . the level 2 pointers are also described in fig3 and p 2 = p 1 [( l mod 256 )/ 16 ]. a test 713 determines if p 2 is 0 . a “ yes ” condition initiates a test 715 to determine if c is 0 . a “ yes ” condition ends the process while a “ no ” condition allocates the array p of 16 coefficients and sets all 16 coefficients to 0 in an operation 717 . an operation 719 writes the coefficient c as p 2 [( l mod 16 )] and the process ends . fig8 describes reading the coefficient c from the sparse array in a process 800 . an operation 801 determines a sparse array p containing the coefficient c and a linear index l of the coefficient is computed in the sparse array . the level 1 pointers p 1 are accessed in an operation 803 where p 1 = p [ l / 256 ]. a test 805 is performed to determine if p 1 equals 0 . a “ yes ” condition initiates an operation 807 which sets the coefficient value of c to 0 , afterwhich the process ends . a “ no ” condition for the test 805 initiates an operation 809 which accesses the level 2 pointers where p 2 = p 1 [( l mod 256 )/ 16 ]. a test 809 is performed to determine if p 2 pointers are at 0 . a “ yes ” condition initiates the operation 807 . a “ no ” condition initiates an operation 813 which reads the coefficient value c as c = p 2 [( l mod 16 )] and the process ends after reading the coefficient value . in fig9 the image renderer 6 converts wavelet coefficients from the shared array into pixels in a process 900 . an operation 901 allocates an image reconstruction array r . the image components y for luminance ; chrominance cb , and chrominance cr are processed successively . the luminance component y is processed in an operation 903 . the y coefficients are copied from the sparse array into the reconstruction array in operation 905 . an inverse lifting wavelet transform is performed on the y and pixel values are saved . in an operation 907 . the chrominances component cb is processed in an operation 909 . the chrominance coefficients cb are copied from the sparse array into the reconstruction array in an operation 911 . an inverse lifting wavelet transform is performed for the chrominance coefficients cb and the pixel values are saved in an operation 913 . the chrominance components cr are processed in operation 915 . the chrominances coefficient cr are copied from the sparse arrays into the reconstruction array r in an operation 917 . an inverse lifting wavelet transform is performed on the coefficients cr and the pixel values are saved in an operation 919 . the pixel colors for the converted y , c v , cr are converted to red ( r ), green ( g ), and blue ( b ) for the display in an operation 921 , afterwhich the process ends . the references cited in the description of the preferred embodiment and elsewhere in the specification are , as follows : 1 ) bottou , l ., howard , p ., and bengio , y ., 1998 . the z - coder adaptive binary coder . in pro . ieee data compression conference 1998 , snowbird . ieee . 2 ) mallat , s ., 1989 . a theory for multiresolution digital signal decomposition : the wavelet representation . ieee transactions on pattern analysis and machine intelligence , 11 : 674 - 693 . 3 ) sweldens , w ., 1996 . the lifting scheme : a custom - design construction of biorthogonal wavelets . journal of applied computing and harmonic analysis , 3 : 186 - 200 . while the invention has been shown and described with respect to a specific embodiment , various changes can be made without departing from the spirit and scope of the invention as defined in the appended claims , in which :	7
an embodiment of the present invention is described below in detail . fig1 is a circuit block diagram illustrating a minimum configuration of a circuit that converts a pwm signal for a two - level power conversion device into a pwm signal for a three - level power conversion device , according to the embodiment of the present invention , and fig2 illustrates the configuration of a main circuit 25 of a two - level power conversion device in related art . in fig1 , a pwm signal ( illustrated in fig2 as a signal for a u - phase ) that is output from a two - level control circuit 23 ( see fig2 ) is input to an input unit 101 ( i . e ., an input terminal ). a high - frequency component is removed from the signal input to the input unit 101 by using a low pass filter 102 such that a signal including only a fundamental wave component is obtained , and the obtained signal is input to a frequency divider circuit ( a ½ frequency divider ) 103 on a post stage . the signal including only the fundamental wave component is binarized by using a threshold of an input terminal of the frequency divider circuit 103 in the frequency divider circuit 103 , the frequency of the signal is halved , and the signal is further converted into a signal for which a phase is shifted by a delay circuit 104 on the next stage . an output signal of the delay circuit 104 and the signal input to the input unit 101 are input to an and circuit 105 . one signal that is branched from an output of the and circuit 105 is output from an output unit 107 ( i . e ., an output terminal ) as a ( first ) output signal ( for example , a drive signal of a semiconductor switch t 1 of an upper arm of a u - phase ), and the other signal that is branched from the output of the and circuit 105 is output from an output unit 108 ( i . e ., an output terminal ) via a not circuit 106 as a ( second ) output signal ( for example , a drive signal of a semiconductor switch t 3 of a lower arm of the u - phase ). the and circuit 105 and the not circuit 106 configure ( i . e ., constitute ) a branching circuit , and the branching circuit configures an output unit of a pwm control device of a three - level power conversion device . semiconductor switches in a switching leg of each phase that configures a main circuit of the three - level power conversion device are usually referred to as t 1 to t 4 from the top in many cases . as illustrated in fig2 , in a two - level power conversion device , pwm signals that are output from a two - level control circuit 23 are input , for example , to gates of a semiconductor switch 21 and a semiconductor switch 22 that configure a switching leg 24 of a u - phase of the two - level power conversion device , via a switch drive circuit 26 . the switching leg above is also prepared for each of a v - phase and a w - phase such that a three - phase two - level power conversion device is configured . the signals that are input to the gates of the semiconductor switch 21 and the semiconductor switch 22 are mutually inverted in such a way that the two semiconductor switches are not in the on state simultaneously . as the signals are mutually inverted , a difference in a phase between both of the signals is 180 degrees . fig3 illustrates the configuration of a main circuit 38 of a three - level power conversion device in related prior art . in fig3 , semiconductor switches 31 to 34 configure a switching leg for a u - phase , and the switching leg is further prepared for a v - phase and a w - phase such that a three - phase three - level power conversion device is configured . pwm signals generated by a three - level control circuit 35 illustrated in fig3 are input , for example , to gates of the semiconductor switches 31 to 34 that configure the switching leg for the u - phase via switch drive circuits 36 that drive the semiconductor switches of the u - phase . a series circuit that is configured of two diodes is connected between a connection point of the semiconductor switches 31 and 32 and a connection point of the semiconductor switches 32 and 33 , and an intermediate voltage of three levels of voltages is connected to a connection point of the two diodes . in the configuration above , when the semiconductor switches 31 and 32 are in the on state and the semiconductor switches 33 and 34 are in the off state , a high voltage is output from the switching leg , and when the semiconductor switches 31 and 32 are in the off state and the semiconductor switches 33 and 34 are in the on state , a low voltage is output from the switching leg . when the semiconductor switches 31 and 34 are in the off state and the semiconductor switches 32 and 33 are in the on state , an intermediate voltage is output from the switching leg . fig4 is a first block diagram illustrating the configuration of a three - level power conversion device that includes a circuit that converts a pwm signal for a two - level power conversion device into a pwm signal for a three - level power conversion device , according to the embodiment of the present invention . a two - level control circuit 23 and pwm signal conversion circuits 200 and 210 configure a pwm control device of the three - level power conversion device ( the same hereinafter ). in fig4 , a signal for an upper arm of a two - level power conversion device that is output from the two - level control circuit 23 for the two - level power conversion device is input to the pwm signal conversion circuits 200 and 210 , an output signal 201 that is output from the pwm signal conversion circuit 200 is input to a gate of a semiconductor switch 31 that configures an upper arm of a u - phase , via a switch drive circuit , and an output signal 202 that is output from the pwm signal conversion circuit 200 is input to a gate of a semiconductor switch 33 that configures a lower arm of the u - phase , via a switch drive circuit . a difference of a half cycle of an output signal of a pwm signal conversion circuit ( one cycle of a fundamental wave that is output from a low pass filter 102 ) is set as delay amounts of both of delay circuits 104 that respectively configure the pwm signal conversion circuits 200 and 210 . in addition , an output signal 211 that is output from the pwm signal conversion circuit 210 is input to a gate of a semiconductor switch 34 that configures the lower arm of the u - phase , via a switch drive circuit , and an output signal 212 that is output from the pwm signal conversion circuit 210 is input to a gate of a semiconductor switch 32 that configures the upper arm of the u - phase , via a switch drive circuit . consequently , a main circuit 37 ( a switching leg ) for the u - phase of a three - phase three - level power conversion device is realized . the configuration above is also prepared for each of a v - phase and a w - phase of three phases such that a main circuit 38 of the three - phase three - level power conversion device is configured . fig5 is a second block diagram illustrating the configuration of a three - level power conversion device that includes a circuit that converts a pwm signal for a two - level power conversion device into a pwm signal for a three - level power conversion device , according to the embodiment of the present invention . namely , fig5 illustrates an example in which the main circuit ( the switching leg ) for the u - phase of the three - level power conversion device of fig4 is applied to a t - type circuit that is configured by semiconductor switches 41 to 44 , and this configuration is also prepared for each of a v - phase and a w - phase of three phases such that a main circuit 45 of a three - level power conversion device is realized . in fig5 , the configurations of a two - level control circuit 23 and pwm signal conversion circuits 200 and 210 in a two - level power conversion device are the same as those in fig4 . in this case , an output signal 201 that is output from the pwm signal conversion circuit 200 is input to the semiconductor switch 41 that configures an upper arm of the u - phase , via a switch drive circuit , and an output signal 202 that is output from the pwm signal conversion circuit 200 is input to the semiconductor switch 42 that connects an intermediate point of the upper and lower arms of the u - phase to an intermediate voltage , via a switch drive circuit . in addition , an output signal 211 that is output from the pwm signal conversion circuit 210 is input to the semiconductor switch 44 that configures the lower arm of the u - phase , via a switch drive circuit , and an output signal 212 that is output from the pwm signal conversion circuit 210 is input to the semiconductor switch 43 that connects the intermediate point of the upper and lower arms of the u - phase to the intermediate voltage , via a switch drive circuit . consequently , a main circuit 40 for the u - phase of a three - phase three - level power conversion device is realized . the semiconductor switches 42 and 43 configure a switch circuit that connects the intermediate point of the upper and lower arms ( this is also a connection point of the semiconductor switches 41 and 42 and an output unit ) to an intermediate voltage of three levels of voltages . when the semiconductor switches 41 and 42 are in the off state and the switch circuit above is in the on state , the intermediate voltage is output from the u - phase . the configuration above is also prepared for the v - phase and the w - phase of the three phases such that the three - phase three - level power conversion device is configured . fig6 is a third block diagram illustrating the configuration of a three - level power conversion device that includes a circuit that converts a pwm signal for a two - level power conversion device into a pwm signal for a three - level power conversion device , according to the embodiment of the present invention . namely , fig6 illustrates an example in which the main circuit for the u - phase of the three - level power conversion device of fig4 is applied to a t - type circuit that is configured by semiconductor switches 51 to 54 , and this configuration is also prepared for each of a v - phase and a w - phase of three phases such that a three - level power conversion device is realized . the semiconductor switches 52 and 53 are reverse blocking semiconductor switches . in fig6 , the configurations of a two - level control circuit 23 and pwm signal conversion circuits 200 and 210 in a two - level power conversion device are the same as those in fig4 . in this case , an output signal 201 that is output from the pwm signal conversion circuit 200 is input to the semiconductor switch 51 that configures an upper arm of the u - phase , via a switch drive circuit , and an output signal 202 that is output from the pwm signal conversion circuit 200 is input to the semiconductor switch 52 that connects an intermediate point of the upper and lower arms of the u - phase to an intermediate voltage , via a switch drive circuit . in addition , an output signal 211 that is output from the pwm signal conversion circuit 210 is input to the semiconductor switch 54 that configures the lower arm of the u - phase , via a switch drive circuit , and an output signal 212 that is output from the pwm signal conversion circuit 210 is input to the semiconductor switch 53 that connects the intermediate point of the upper and lower arms of the u - phase to the intermediate voltage , via a switch drive circuit . consequently , a main circuit ( a switching leg ) 50 for the u - phase of a three - phase three - level power conversion device is realized . the semiconductor switches 52 and 53 configure a switch circuit that connects the intermediate point of the upper and lower arms ( this is also a connection point of the semiconductor switches 51 and 52 and an output circuit ) to an intermediate voltage of three levels of voltages . when the semiconductor switches 51 and 52 are in the off state and the switch circuit above is in the on state , the intermediate voltage is output from the u - phase . the configuration above is also prepared for each of a v - phase and a w - phase of three phases such that a main circuit of a two - phase three - level power conversion device is configured . fig7 illustrates a variation of the circuit illustrated in fig4 that converts a pwm signal for a two - level power conversion device into a pwm signal for a three - level power conversion device , according to the embodiment of the present invention . namely , fig7 illustrates an exemplary configuration in which the pwm signal conversion circuits 200 and 210 illustrated in fig4 are transformed . in fig7 , a variation 220 of a pwm signal conversion circuit is configured by adding another pair of the and circuit and the not circuit in the pwm signal conversion circuit 200 illustrated in fig4 and adding a not circuit to one ( a side that is connected to an output of a delay circuit 104 ) of the input units of the added and circuit . the operation of the variation 200 is the same as the operation in fig4 , and could be easily understand by those skilled in the art . therefore , the description thereof is omitted . a two - level control circuit 23 and a pwm signal conversion circuit 220 configure a pwm control device of a three - level power conversion device . fig8 is a waveform chart that is obtained in circuit simulation performed to explain an effect of a pwm control device according to the embodiment of the present invention . the pwm signal conversion circuits 200 and 210 of fig4 to 6 are target circuits in this simulation . three waveforms of a group illustrated in the second portion from the top in fig8 indicate pwm signals for the upper arms of the u - phase , the v - phase , and the w - phase that are respectively obtained from the two - level control circuit 23 ( signals for the lower arms are obtained by inverting the signals illustrated in fig8 ). a waveform of an output signal of the low pass filter 102 in the u - phase is illustrated in the uppermost portion of fig8 , together with a straight line indicating a threshold of an input terminal of the delay circuit 104 . the output signal of the low pass filter 102 is binarized by using the threshold of the input terminal , and the frequency of the output signal is halved in the frequency divider circuit 103 , and the obtained signal is further delayed by a prescribed time in the delay circuit 104 on the next stage such that obtained signal is converted into a signal for which a phase is shifted . a group in the third portion of fig8 indicates output signals of the delay circuit 104 . three signals illustrated in the third portion of fig8 are obtained from pwm signals for the upper arms of the u - phase , the v - phase , and the w - phase that are respectively obtained from the two - level control circuit 23 . groups illustrated in the third , fourth , and fifth portions of fig8 indicate drive signals for four switch elements ( these correspond to the switch elements 31 to 34 of fig4 ) of each of the u - phase , the v - phase , and the w - phase . four signals indicated in each of the groups respectively correspond to the signals 201 , 211 , 202 , and 212 illustrated in fig4 to 6 in order from the top . it can be confirmed that the waveforms of pwm signals that are input to the main circuit 38 of the three - level power conversion device illustrated in fig4 , for example , were obtained . fig9 is a waveform chart illustrating a result of circuit simulation to demonstrate a pwm signal observed in fig8 by using a three - level power conversion device according to the embodiment of the present invention . as a circuit simulation result of fig9 shows , as an example , a sine wave output ( see the third from the top ) is obtained as an output current waveform of the u - phase , and it can be confirmed that a signal that is equivalent to the signal of the conventional three - level control circuit illustrated in fig3 was obtained , by referencing the circuit simulation result of fig9 . therefore , it can be confirmed that a pwm signal for a three - level power conversion device was obtained by adding a circuit that converts a pwm signal for a two - level power conversion device into a pwm signal for a three - level power conversion device according to the present invention . an operation for one of three phases , for example , the u - phase , has been described above , and description of the operations for the v - phase and the w - phase of the three phases has been omitted . however , those skilled in the art could easily understand that one two - level control circuit 23 can cope with the v - phase and the w - phase of the three phases . in addition , the delay circuit 104 of each of the phases generates a signal that is shifted from each other by an amount that corresponds to 120 degrees of an output signal cycle of a pwm signal conversion circuit ( it is assumed , for example , that phase delay amounts of the delay circuit 104 of the pwm signal conversion circuit 200 or 220 of fig4 to 7 for the u - phase , the v - phase , and the w - phase are respectively amounts that correspond to 0 degree , 120 degrees , and 240 degrees , and it is also assumed that phase delay amounts of the delay circuit 104 of the pwm signal conversion circuit 210 of fig4 to 6 for the u - phase , the v - phase , and the w - phase are respectively amounts that correspond to 180 degrees , 300 degrees , and 60 degrees ). the frequency or cycle of an output of each of the phases is a frequency obtained by halving the frequency of an output signal of the two - level control circuit 23 , or a cycle obtained by doubling the cycle of the output signal . accordingly , it can be understood that three levels of pwm signals are generated from two levels of pwm signals , as illustrated in the lower portion of fig8 . in a case in which the two - level control circuit 23 above is provided in each of the u - phase , the v - phase , and the w - phase ( namely , three two - level control circuits 23 in total are provided ), the delay circuit 104 can be omitted . as described above , according to an embodiment , an existing two - level control circuit that generates a pwm signal for a two - level power conversion device does not need to be changed , and a dedicated three - level control circuit that generates a pwm signal for a three - level power conversion device does not need to be generated additionally . a pwm control device for a three - level power conversion device can be realized by adding a circuit that converts an output of the existing two - level control circuit into a pwm signal for a three - level power conversion device , to the existing two - level control circuit . stated another way , a pwm signal for a two - level control circuit can be easily converted into a pwm signal for a three - level power conversion device only by adding a new circuit to the existing two - level control circuit . the present invention is not limited to the embodiment above , and various improvements or variations can be made without departing from the gist of the present invention .	7
fig1 and fig2 illustrate a hoist 100 according to one embodiment of the present invention . fig1 shows the hoist 100 without a pressurized tank attached to its cradle 102 . fig2 shows the hoist 100 with a pressurized tank attached to its cradle 102 and lifted for transport . the hoist 100 features a tank cradle 102 for securely attaching a pressurized cylindrical tank and supporting it during transport . the cradle 102 is attached to a linear actuator assembly 110 that provides vertical lifting motion to the cradle 102 . the electrical power for the linear actuator comes from a 24v battery 116 that features its own trickle battery charger 114 . the linear actuator assembly 110 is attached to a narrow base 120 that features heavy duty casters on its four corners . the front of the base 120 features fixed casters 124 while the rear features swivel casters 122 to allow for easy steering and maneuverability . the major structural components of the hoist 100 are constructed from steel . steel was chosen because it is inexpensive , easy to fabricate , structurally stable , and readily available . however , a person having ordinary skill in the art of fabrication would realize that other metals such as aluminum or even materials such as polymer composites may be used depending upon the structural load requirements . lighter materials may make the hoist 100 easier to maneuver due to the lighter weight . however , the tradeoff may be in increased cost and reduced stability of a fully - loaded device . steel provides a good balance of cost , stability , and maneuverability . with reference to fig1 and fig2 , the hoist 100 according to the present embodiment features a narrow base 120 with swivel casters 122 for increased maneuverability . the base 120 is fabricated such that there is a center opening between two outer rails . the center opening is just wide enough to allow for a pressurized cylinder to fit between the rails for attachment to the tank cradle 102 . the base 120 also features an attached handle 118 . the handle 118 allows an operator to maintain a comfortable grip on the hoist 100 while maintaining proper control under a full load . the forward edge of the outer rails of the base 120 feature fixed casters 124 while the rearward edge of the rails feature swivel casters 122 . the swivel casters 122 are located essentially beneath the operator &# 39 ; s handle 118 to allow the hoist 100 to be easily steered into position even with a load attached . in addition , the swivel casters 122 also feature locking mechanisms to allow a fully - loaded hoist 100 to be safely parked . while the current embodiment provides four casters for maximum stability , other configurations are possible and are within the scope of the present invention . for example , in another embodiment all four of the casters could swivel . in yet another embodiment , the base 120 could utilize only three casters ; two on the forward ends of the outer rails of the base 120 nearest the tank opening and one swivel caster on the opposite end of the base 120 , located in the center approximately beneath the linear actuator 110 . utilizing only three casters would improve the maneuverability of the hoist 100 but at the same time would sacrifice some of the vertical stability . with reference to fig1 and fig2 , the hoist 100 according to the present embodiment features a tank cradle 102 that is shaped to wrap partially around a pressurized tank for support . the radius of the curve of the cradle 102 approximates the radius of the body section of the pressurized tank . the cradle 102 also extends vertically to the approximate height of the body portion of a full - sized pressurized tank . thus , because its height is suitable for the tallest tank , the cradle 102 can support essentially any sized pressurized tank . with reference to fig1 and fig2 , the cradle 102 features a lip 108 near the bottom that engages the base of a pressurized tank that is to be attached to the cradle 102 . to attach a tank , the lip 108 is brought into contact with the base of the tank . the tank is then tipped slightly away from the lip 108 so that the lip 108 can slide beneath the tank . once the tank rests on the lip 108 , the primary and backup attachment means can be utilized to restrain the tank within the confines of the cradle 102 . with reference to fig1 and fig2 , the primary attachment means provided in the present embodiment is a strap 106 with an adjustable side release buckle . the strap 106 is wrapped around the body of the tank and the side release buckle is engaged and adjusted to put tension on the strap 106 to restrain the tank within the cradle 102 . while the present embodiment utilizes a strap 106 for the primary attachment means , other embodiments could utilize chain , rope , or cable . also , a strap with a ratchet tightening mechanism , a belt - type buckle , or a hook and loop fastener could be used in place of the adjustable side release buckle for maintaining proper tension on the strap 106 . with reference to fig1 and fig2 , the backup attachment means provided in the present embodiment is a safety ring 104 . the safety ring 104 is designed to provide backup retention of the tank in the cradle 102 should the strap 106 inadvertently release . in the present embodiment , the safety ring 104 is constructed of plastic coated steel cable . the steel cable provides tensile strength while the plastic coating prevents the cable from scratching or marring the finish of a tank . while the present embodiment utilizes plastic coated steel cable for the safety ring 104 , other embodiments could utilize uncoated steel cable , chain , rope , or even strap . the safety ring 104 is threaded through a piece of tubular steel that fits within the center piece of slightly larger diameter tubular steel that makes up the framework of the cradle 102 . thus , the safety ring 104 can be lifted by raising the attached piece of tubular steel to a height that allows the safety ring 104 to slip easily over the tank &# 39 ; s valve portion . when released , the tubular steel attached to the safety ring 104 slips down within the larger center piece of tubular steel that makes up the framework of the cradle 102 . this allows the safety ring 104 to be rapidly installed and removed . the hoist 100 according to the present embodiment features a linear actuator assembly 110 that is attached to both the cradle 102 and base 120 . the linear actuator 110 uses electrical power from the 24v battery 116 to operate . the height switch 112 allows the linear actuator to extend and raise the tank cradle 102 with attached tank up to 27 inches above the floor surface . this height is sufficient for insertion of a tank into typical ambulance stowage compartments . a second position of the height switch 112 allows the linear actuator 110 to retract and thus return the cradle 102 to the floor level . power for the linear actuator 110 comes from a rechargeable 24v battery 116 . the hoist 100 also features a built - in trickle charger 114 to allow the hoist 100 to be plugged into a standard wall socket and recharged when not in use . battery power is utilized to prevent the need for an electrical cord to provide power to operate the hoist 100 . this increases the devices portability and maneuverability . while the present embodiment utilizes a 24v power source , other voltages may be substituted as determined by the voltage requirements of the linear actuator 110 mechanism . fig3 shows a hoist 100 being used by an operator 300 to transport a pressurized tank 302 . the operator 300 maneuvers the hoist 100 by utilizing the handle 118 . once in position , the hoist 100 can be parked by locking the swivel casters 122 . the cradle 102 can then be raised or lowered by operation of the height switch 112 . in view of the foregoing , the hoist 100 serves special needs required by the ems community . in particular , the hoist 100 allows a single operator to safely and efficiently lift and transport a pressurized tank without the risk of back injury . the compact features of the hoist 100 lend to the device &# 39 ; s maneuverability and ease of operation . thus , a single operator can effectively remove a pressurized tank from an ambulance compartment and install a new one without assistance . although the invention hereof has been described by way of a preferred embodiment , it will be evident that other adaptations and modifications can be employed without departing from the spirit and scope thereof . the terms and expressions employed herein have been used as terms of description and not of limitation ; and thus , there is no intent of excluding equivalents , but on the contrary it is intended to cover any and all equivalents that may be employed without departing from the spirit and scope of the invention .	1
because atm and ip operate at different layers at the open systems interconnection ( osi ) protocol stack , any solution for supporting both tdm - and ip - based base sites must account for this difference . one technique for supporting tdm - and ip - based base sites is to provide a backhaul for the ip - based base sites which overlays the existing tdm - based backhaul . this technique provides separate switches and backhaul links for the tdm - and ip - based base sites . because the backhaul links are typically leased by the wireless network operator , this technique can effectively double the backhaul cost . another technique for supporting tdm - and ip - based base sites is to provide ip routing capability for current atm switches . specifically , this technique performs ip routing on the atm switches which interface with the ip - based base sites . ip routing would require costly upgrades to current atm switches , and therefore , is undesirable . additionally , ip routing can cause scalability issues because ip routing protocol can typically support several hundred nodes , while the backhaul network may require thousands of switches . fig2 a illustrates an exemplary system for connecting a wireless network operator &# 39 ; s base sites to the core network in accordance with one embodiment of the present invention . the system includes routers 210 and 220 , and atm switches 230 and 260 . routers 210 and 220 are respectively coupled to switches 230 and 260 via point - to - point / multi - link point - to - point ( ppp / mlppp ) communication sessions over tdm communication links . in accordance with exemplary embodiments of the present invention , router 210 is an ip - based radio router , which acts as a base transceiver station ( bts ) and is coupled to a base site . the router 210 can communicate with wireless stations using any type of air - interface protocol . information received by router 210 from the wireless stations is included in ip packets , which are sent over a communication link ( e . g ., a t1 , t3 , e1 , or the like ) to the wireless network operator &# 39 ; s core network . as used herein , wireless stations include cellular telephones , personal digital assistants ( pdas ), computers with wireless modems , or the like . these wireless stations can be stationary or mobile . router 220 can be an aggregation router located , for example , in an mso . similar to router 210 , router 220 is an ip - based router . atm switch 230 includes processor 235 a and memory 240 . processor 235 a can be a microprocessor , application specific integrated circuit ( asic ), field programmable gate array ( fgpa ), or the like . memory 240 includes tables 245 and 250 . atm switch 260 is similar to atm switch 230 , except for the contents of the memory . specifically , instead of including tables 245 and 250 , the memory 265 of atm switch 260 includes tables 270 and 275 . memories 240 and 265 can be solid state memory , flash memory , hard - disk drives , or the like . both atm and ip provide for different handling of different types of traffic . ip provides differentiated services for different types of ip packets using a type of service ( tos ) field in the ip packet header . the value in the type of service field is known in the art as the differentiated services code point ( dscp ) value . ip differentiated services provides expedited forwarding ( ef ), assured forwarding ( af ), best effort forwarding ( be ) and the like types of service . atm provides for different handling of different types of traffic using different virtual connections . atm connections can be constant bit rate ( cbr ), real - time variable bit rate ( rt - vbr ), non - real time variable bit rate ( nrt - vbr ), available bit rate ( abr ), and unspecified bit rate ( ubr ). accordingly , the present invention maps frames encapsulating ip packets received from ip - based radio routers to atm connections based on the value in the type of service field of the ip header . additionally , because the atm switches may support more than one ip - based radio router , the present invention also performs the mapping based upon the layer - 2 connection carrying the ip packets . tables 245 and 250 illustrate an exemplary mapping of ip differentiated services to atm connection types . specifically , ef frames associated with ppp session a are mapped into rt - vbr virtual connection 100 , af frames associated with ppp session a are mapped into nrt - vbr virtual connection 101 , and be frames associated with ppp / mlppp connection a are mapped into ubr connection 102 . switch 230 performs a similar mapping for frames received from switch 260 over the plurality of virtual connections . specifically , based upon the virtual connection on which the frame is received from switch 260 , switch 230 will set the type of service value of the ip packet and place the corresponding frame on a ppp / mlppp session based on the mapping tables . alternatively , instead of the switch 230 setting the type of service value , this value can be set by router 220 before the packet is sent to switch 260 . switch 260 performs similar mapping to that described above in connection with switch 230 . specifically , switch 260 maps frames received over one of the plurality of virtual connections onto a particular ppp / mlppp session . similarly , switch 260 maps frames received from aggregation router 220 onto one of the plurality of virtual connections based upon which ppp session carried the frame and the value in the type of service field in the ip header of the frame . because switches 230 and 260 are atm switches , these switches can switch tdm frames between the mso and the conventional base sites using conventional switching techniques . although fig2 illustrates the mapping being performed by the main processor and memory of the atm switch , the mapping can be performed by a separate processor and memory , an asic , fpga , or the like . as discussed above , atm switch 230 may support a number of ip - based radio routers . fig2 b illustrates an exemplary system for connecting a number of base sites to the core network in accordance with the present invention . the mapping performed for information received from radio router 210 will be similarly performed for other radio routers coupled to atm switch 230 . for example , another radio router 215 may have a ppp / mlppp session c with atm switch 230 . like ppp / mlppp session a , ppp session c can include dscp values ef , af and be . accordingly , memory 240 includes table 255 for mapping frames carried on ppp session c onto rt - vbr 103 , nrt - vbr 104 and ubr 105 connections between atm switches 230 and 260 . similarly , memory 265 , includes table 280 for mapping frames carried on connections rt - vbr 103 , nrt - vbr 104 and ubr 105 onto ppp / mlppp d . fig3 illustrates an exemplary system for connecting a wireless network operator &# 39 ; s base sites to the core network in accordance with another embodiment of the present invention . in accordance with this embodiment , the mapping is performed by a bridging module in the radio router . the radio router 310 includes a transceiver 320 , processor 325 , memory 330 and bridging module 345 . the transceiver 320 is coupled for bidirectional communication with one or more wireless stations ( not illustrated ) over communication link 305 . although fig3 illustrates only a single communication link 305 , more than one communication link can be used to couple the transceiver 320 with the one or more wireless stations . the one or more communication links can be 802 . 11 , cdma , tdma , iden , gsm , bluetooth , wimax , or the like . the processor 325 receives ip packets from one or more wireless stations and establishes a ppp / mlppp connection with bridging module 345 . the processor 325 , using the memory 330 , generates frames for transmission to the bridging module 345 . the bridging module 345 receives frames carried on a ppp / mlppp connection and maps the frames into one of a plurality of atm virtual connections . because there is a single ppp session , the mapping is based only on a value in the type of service field of the ip frame . the bridging module 345 can be implemented as a processor with associated memory , asic , fpga , or the like . moreover , the bridging module need not be a component of the radio router 310 , but instead can be located anywhere between the radio router 310 and an atm switch . fig4 illustrates an exemplary method for forwarding information from base sites to a backhaul transport network in accordance with the present invention . a switch , such as an atm switch , receives a frame encapsulating an ip packet ( step 410 ) and identifies a connection which carried the frame ( step 420 ). the switch then removes the ppp header of the frame in order to examine the ip packet ( step 430 ). the switch identifies a type of service associated with the ip packet by examining the type of service field of the ip packet ( step 440 ). the switch then encapsulates the ip packet in an atm header , breaks the resulting frame into atm cells , and transmits the atm cells over an atm connection based on the identified connection carrying the ip packet and a type of service associated with the ip packet ( step 450 ). fig5 illustrates an exemplary method for forwarding information from a backhaul transport network to a wireless network operator &# 39 ; s core network in accordance with the present invention . an atm switch receives an atm frame from another atm switch ( step 510 ) and identifies the atm connection carrying the atm frame ( step 520 ). the switch removes the atm overhead from the atm frame ( step 530 ). the switch then sets the type of service field based on the identified atm connection ( step 540 ). alternatively , the type of service field can be set . the switch encapsulates the packet into a ppp frame and transmits the ip frame over a particular connection based on the identified atm connection ( step 550 ). although exemplary embodiments have been described above in connection with a mapping between ppp / mlppp and atm connections , the present invention is applicable to any type of system where it is desired to bridge different types of layer 2 technologies while providing differentiated services . for example , instead of a ppp / mlppp connection between an atm switch and an aggregation router , an ethernet connection can be employed . additionally , other types of protocols and switches other than atm can be employed so long as the protocol supports some type of technique for providing different handling for different types of data . although exemplary embodiments have been described in connection with particular class of service types , the present invention is equally applicable to other class of service types . for example , instead of using the dscp value , the entire tos byte can be used . alternatively , the ip precedence bits , i . e ., the first three bits in the tos byte can be used . the foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed to include everything within the scope of the appended claims and equivalents thereof .	7
the basic components of the system of this invention are illustrated in the schematic diagram of fig1 . the control circuit 1 , for charging of a cellular phone , consists of a microprocessor controller 2 which is powered by a battery pack 3 . a charger 4 is connected to provide a charging current to the battery pack 3 when the energy of the battery is depleted . the charger 4 is controlled by an energy management module 5 including a start - up module 6 . a battery sensor module 7 is operatively associated with the battery pack 3 to sense the size , condition , and temperature of the battery pack 3 . controller 2 will control the charger function under normal conditions as long as its threshold voltage ( v r ) requirements are met by the battery pack 3 . the steps of the normal charging cycle is shown in the graph of fig2 . a two step cycle is desirable to speed up the start - up function . as shown in fig2 initially a 100 ma current is applied to the battery pack 3 by the start - up circuit of fig5 . after a short period a 300 ma current is applied once the start - up conditions are met . an application specific integrated circuit ( asic ) 5 is constructed as part of controller 2 to provide the energy management functions relating to the charging cycle . the asic 5 is constructed to take control of the charging cycle , when the voltage of the battery pack 3 falls below the threshold voltage needed to operate the controller 2 . to avoid excessive currents due to low battery levels , through the start - up module 6 , asic 5 limits the available charging current in two steps . the first step provides a constant current to the battery of 100 ma until the battery voltage ( v bat ) reaches a predetermined level ( v m ). at this point an increased charging current of 300 ma is provided . the 300 ma current is applied until a reset voltage ( v r ) is reached . at this point normal charging occurs as dictated by the microprocessor control unit 2 . the start - up module 6 provides the unique functions of this invention in conjunction with the battery sensor module 7 . module 7 employs a negative temperature coefficient resistor ( rntc ) to generate a signal relative to the operating temperature of the battery pack 3 . this signal is provided to a comparator in the start - up module 6 which compares the signal to a preset level relative to a predetermined temperature limit t max . in this manner an indication of the condition of the battery is obtained . a second resistor generates a signal relative to the presence of the battery . depending on the relative voltage of the second resistor , a second comparator can determine if the battery pack 3 is connected . the start - up charging circuit can be implemented in a variety of configurations . for illustration , a preferred embodiment of a suitable circuit is shown in fig4 . the start - up module 6 is powered by the voltage ( v c ) generated by the charger 4 . this is necessary , as this module is only used when v bat & lt ; v r . the sensor module consists of a negative temperature coefficient resistor ( rntc ) 8 and a conventional resistor 9 connected as a voltage divider across v bat . a pair of comparators 10 and 11 are connected to rntc 8 and resistor 9 respectively to analyze the signals from these components . the comparators , in this instance , should be a differential amplifier with hysteresis connected as shown . rntc 8 is operationally associated with the battery 3 to vary its resistance value in response to battery temperature . a voltage across rntc 8 will signal the comparator 10 which will compare this temperature signal to a value indicative of a temperature limit . typically this limit is set relative to approximately 40 ° c . as charging at temperatures above 40 ° c . may damage the battery . it is advantageous to determine if the battery pack is dysfunctional in a way that could create excessive currents in the charging circuit , for example , if the battery pack is an assembly of multiple cells and one or more of cells is dead . the malfunctioning condition will be reflected in an increased battery temperature and therefore , in the signal generated by rntc 8 . resistor 9 is shown connected in manner which will indicate the presence of battery pack 3 . by comparing the signal from resistor 9 , the operational presence of the battery can be sensed . controller 12 senses the initiation of a charging current and enables the comparators 10 and 11 . the comparators are connected within the start - up module to shut down the charging function in the event that either an excessive battery temperature or an unconnected battery is sensed . the first phase of the start - up charging cycle , 100 ma , as shown in the graph of fig2 is enabled , when a functional battery is sensed by comparator 11 , responsive to the signal from resistor 9 . start - up charging therefore , will be blocked without an appropriate indication at comparator 11 . the start up charging current is controlled by start amplifier 13 which in turn enables transistor switch 14 . the operation of the charging system of this invention is shown in fig3 and 4 and is divided into two phases . since the operation of this invention occurs only when the battery voltage is depleted below the threshold of operation of the mcu 2 , this is assumed in the following description . when the cellular phone is plugged into the charger , a charging current is initiated . the rising voltage of the charger is sensed and enables the start - up module 6 . a signal is generated by the temperature sensitive resistor 8 relative to the temperature of the battery . this signal is compared to a predetermined limit set in the comparator 10 . if the battery temperature exceeds the limit , then charging will be aborted . a signal indicative of the proper connection of battery pack 3 is generated at resistor 9 and if the signal complies with the predetermined criteria of comparator 11 , phase 1 of the start - up charging cycle is initiated . in phase 1 , the charger current is limited to 100 ma . providing a voltage is reached indicative of normal charging , the start - up module 6 , passes control to the energy management module 5 , and phase 2 of the start - up charging cycle will begin . in phase 2 , the charging current is limited to 300 ma . the charging cycle is monitored by a timer which is enabled at the start of phase 2 . after the expiration of a predetermined period , the battery voltage is checked . at this point the battery voltage should be sufficient to power the mcu 2 ( v r ). if has not charged to v r , then the charger is shut down . once v r is attained , during this period , the mcu will assume control of the charging in a conventional manner .	7
advantages and features of the invention and methods of accomplishing the same will be apparent by referring to embodiments described below in detail in connection with the accompanying drawings . however , the invention is not limited to the embodiments disclosed below and may be implemented in various different forms . the embodiments are provided only for completing the disclosure of the invention and for fully representing the scope of the invention to those skilled in the art . for simplicity and clarity of illustration , the drawing figures illustrate the general manner of construction , and descriptions and details of well - known features and techniques may be omitted to avoid unnecessarily obscuring the discussion of the described embodiments of the invention . additionally , elements in the drawing figures are not necessarily drawn to scale . according to at least one embodiment , the dimensions of some of the elements in the figures may be exaggerated relative to other elements to help improve understanding of embodiments of the invention . like reference numerals refer to like elements throughout the specification . in order to achieve the above object , embodiments of the invention are configured as follows . in order to induce change of the flow direction and speed of air ( gaseous component + particulate component + liquid component + thermal energy ) flowing into the smoker during smoking , a direct suction passage through which the smoker sucks ( inhales ) smoke via a cigarette filter is blocked . in addition , an indirect suction passage for bypassing is installed ( a bypass suction hole is provided in a side surface of the pipe ) to reduce inflow of harmful substances that have already passed through the cigarette filter . in the path of harmful substances of smoke caused to flow into the human body and move toward the lungs at a certain speed by suction force , the intake air is caused to flow along a circumference by suction force of a central axis in a section between the mouth and the larynx such that the harmful substances flow straight at a certain speed in the suction direction . according to at least one embodiment , an adsorption plate serving as a second filter is installed in order to block flow of air toward a central portion of a cylindrical cigarette by centripetal force of the cigarette . the adsorption plate is formed at a position opposite to the position of the cigarette filter part while being held at a predetermined distance ( corresponding to an indirect suction hole ) from the cigarette filter part . the adsorption plate is formed to have a circumference which is not larger than the circumference of the filter . the adsorption plate obstructs entry of harmful substances that have already passed through the cigarette filter . the pipe provided with the adsorption plate ( shielding membrane ) is connected to the filter part of the cigarette to induce adsorption of harmful substances in the adsorption plate and collision with the adsorption plate to generate repulsive force to change the path of airflow , such that the harmful substances are sent back into the mouth through one or more indirect suction holes and discharged from the mouth through a process of blowing out ( exhalation ). with the direction suction structure of a bypass tool with the adsorption plate ( shielding membrane ) for changing and distributing the positions of the harmful substances in the air flow by the time difference between inspiration and expiration , the amount of harmful substances entering the lungs of a human during smoking may be reduced . one or more bypass suction holes may be provided , and may have various sizes and shapes . multiple adsorption layers of adsorption fabric may be formed inside of the adsorption plate for blocking the air flow formed by the suction force generated during smoking . the adsorption fabric functions to primarily adsorb and collect harmful substances flowing into the human body using filters , degreasing cotton , korean paper , and the like and to secondarily change the direction of motion of the harmful substances by forming an air blocking membrane having a repulsive force such that the harmful substances are separated into small granular bodies , mixed with air and discharged back into the mouth through the suction holes . the bypass tool ( of a pipe type ) provided with the adsorption plate ( shielding membrane ) serving as the second filter is manufactured using non - toxic materials such as paper and plastic . bypass tools ( reduction pipes ) used by smokers for indirect suction are divided into an integrated type structure and a detachable type structure depending on how they are connected to the cigarette filter part . in the integrated type structure , the filter part of each cigarette extends so as to be directly connected to the indirect suction hole . this structure , which is manufactured in the production process of the cigarette , is disposable . the detachable type structure ( cigarette + pipe ), which is separable from the cigarette , is used by directly combining the cigarette filter part with the bypass tool ( reduction pipe ) when the smoker wants to smoke . after use of the structure is completed , the cigarette filter part can be removed . this structure is divided into a disposable type and semi - permanent ( reusable ) type . male and female thread parts detachably coupled with each other are provided on the back of the bypass tool ( reduction pipe ) to allow the smoker to check the condensate of high - concentration harmful substances during smoking and to replace the exhausted adsorption fabric with new adsorption fabric in the process of repeatedly smoking . thereby , the bypass tool can be semi - permanently used by replacing old adsorption fabric with new adsorption fabric . the bypass tool used for indirect smoking by the smoker includes the detachable type and the integrated type . fig1 illustrates a method of reducing the inflow of harmful substances into the human body through a basic smoking process of a cigarette to which an embodiment of the invention is applied , and a bypass tool of a harmful substance reduction pipe . according to at least one embodiment , there is provided a human body 101 , which includes a mouth 10 , a larynx 20 , a trachea 30 , a bronchus 40 , a diaphragm 50 and lungs 60 . the enlarged view of the configuration of a cigarette indicated in a dotted circle illustrates the processes of a smoker putting the filter part 90 into the mouth 10 , lighting a burning part 70 at the end of a tobacco part 80 of the cigarette and inhaling smoke . the basic path extends horizontally from the mouth 10 to the larynx 20 and vertically from the larynx 20 to the lungs 60 and forms one passage from the mouth 10 to the lungs 60 through which harmful substances are introduced . the harmful substances are generated from the burning part 70 at the end of the tobacco part 80 ( t 1 ), move towards the lungs 60 , which generate the suction force , at a certain speed and reach the lungs 60 ( t 2 ), thereby undergoing position change . reach point t 2 − generation point t 1 = distance ( from the mouth 10 to the lungs 60 )× momentum = the smoker &# 39 ; s ( suction force ). the distance is produced within the time difference in one cycle of inspiration ( inhaling ) and expiration ( exhaling ) when the smoker smokes . the change in the position of the hazardous substances from the generation point t 1 to the reach point t 2 occurs upon inspiration ( inhaling ) of the smoker during smoking . re - emission of the harmful substances having entered the lungs 60 is limited to a very small extent . when the smoker inhales cigarette smoke once by lighting a cigarette , about 50 ml of smoke enters his / her body through the mouth . at this time , a mixture of harmful substance particulates and gaseous components are inhaled . in this case , about 90 % of carbon monoxide and about 70 % of tar in the mixture remain in the body . harmful substances produced during smoking are combined with initial organic substances through pyrolysis , thermal synthesis , dehydration , etc ., generating more kinds of complex chemical substances . among the produced harmful substances , tar , nicotine , and carcinogenic substances , which are generated in the early stage of smoking , are sucked into the human body through the filter part 90 via the tobacco part 80 of the unburned cigarette in the progress of smoking ( 10 ). in this direct suction method , the harmful substances move from the mouth 10 to the lungs 60 without resistance and are thus directly sucked into the human body . in all conventional suction methods , smoke is inhaled while the filter part 90 of the cigarette is placed in the mouth 10 . according to the conventional direct suction methods , the inhaled air ( gas components + particulate components + liquid components + thermal energy ) flows straight toward the larynx 20 at a high speed , and thus harmful substances can enter the lungs through the back of the filter or the holes on the back of the pipe . accordingly , it difficult for the human body to control and protect the inflow of harmful substances due to anatomy . embodiments of the invention intend to implement a bypass ( indirect ) suction technique instead of a direct suction technique by blocking the holes in the back surface . to this end , embodiments of the invention provide a smoking and non - smoking aiding pipe 100 provided with a shielding adsorption plate part 102 in a straight path of inhaled harmful substances of a cigarette extending from the mouth 10 to the larynx 20 . the smoking and non - smoking aiding pipe 100 ( hereinafter referred to as “ aid pipe ”), which reduces harmful substances with a bypass ( indirect ) suction technique in order to control and prevent entry of the harmful substances into the body , is connected to cigarettes when in use . according to at least one embodiment , the circular hatched area on the rear surface of the aid pipe 100 represents a resistance element . the shielding adsorption plate part 102 functions to prevent air from passing therethrough . an adsorption layer is formed on the inner side of the rear end of the adsorption tube portion ( inside ) of the adsorption plate part 102 . adsorption fabric 106 for adsorbing harmful substances is adhered to the adsorption layer . a cigarette is inserted and coupled to the filter connector 104 provided at the front end of the absorption tube portion . one or more bypass ( indirect ) suction holes 105 are formed in the middle of the adsorption tube portion . according to at least one embodiment , the smokers 101 are moved to the moving path of the human body inflow process of the harmful substance which permeates the lungs by the suction force at the time of smoking at a predetermined distance from the tobacco filter part 90 . the aiding pipe 100 provided with the adsorption plate part 102 which interferes with entry of harmful substances is connected to the tobacco filter portion 90 . the adsorption plate part 102 for preventing entry of harmful substances is installed at a position opposite to the tobacco filter portion 90 and spaced a predetermined distance from the tobacco filter part 90 in the inflow path of the harmful substances of smoke , which permeates at a certain speed toward the lungs by the suction force when the smoker 101 smokes , and the aid pipe 100 provided with the adsorption plate part 102 is connected to the cigarette filter part 90 . fig2 is a configuration diagram illustrating distribution of force f in the process of smoking a cigarette . when the process of air flow in smoking is subdivided , a difference occurs depending on the suction force 107 of the smoker 101 . that is , when the direct suction portion of the filter part 90 is divided into concentric areas of different forces acting on the direct suction portion , include a center point area p 1 93 , a middle area p 2 92 and a circumferential area p 3 91 . the strongest airflow transfer effect occurs in the central point area p 1 93 . according to at least one embodiment , the suction force p produced when the smoker smokes extends from the mouth 10 to the tobacco part 80 via the filter part 90 and acts on the front portion of the burning part 70 as a suction force 107 . the pressure at points pa and pb 94 on the cigarette paper surrounding the tobacco part 80 acts on the central portion along the circumference so that the sucked air flows forward at a certain speed along the central axis . according to at least one embodiment , the suction force 107 depends on various breathing conditions such as the volume and pressure of the lungs , the thoracic pressure , and the alveolar pressure according to the body weight and body size of the smoker 101 . however , since the shape of the cigarette is circular , and the mouth 10 of the smoker 101 has a round shape , the force p applied to the tobacco part 80 acts as the centripetal force 95 of the force ( of areas p 1 and p 2 ) toward the center , forming a straight flow with faster speed and more energy than area p 3 91 . the harmful substances 96 generated from the burning part 70 of the cigarette move through the mouth 10 , the larynx 20 , the trachea 30 and the bronchus 40 via the tobacco part 80 and the filter part 90 according to the attraction force 107 and enter the lungs 60 . during smoking by the suction force 107 , the centripetal action of the force ( p 1 + p 2 ) applied to the cigarette 80 and directed toward the center causes airflow to be directed to the central axis along the circumference . the viscosity of the inhaled gas , the heat energy and chemicals generated at the time of burning ( 800 - 900 ° c .) of a cigarette , the liquidization of the tobacco part 80 and the humidity of the cigarette paper are mixed with the mucous materials of tar and nicotine and aerosolized , and harmful substances condense . that is , the harmful substances 96 ( gas component + particulate component + liquid component + thermal energy ) are aggregated . in the cross - sectional view of the filter part 90 , difference in force p acting on the center area p 1 93 , the intermediate area p 2 92 and the circumferential area p 3 91 produced by the suction force and the suction force of the aiding pipe 100 having four suction holes direct the force 95 of the center portion straightforward . thereby , the harmful substances 96 entering through the mouth 10 move straightly toward the larynx 20 in a horizontal direction . this movement is derived from the lungs , which is the main source of suction . fig3 is a comparison diagram illustrating movement of harmful substances according to smoking methods . according to at least one embodiment , the distribution of harmful substances through exchange of intake and exhalation momentum ( force exerted on the cigarette ) during smoking may be divided into upper and lower sections . in the figure , the conventional suction type in the projection and the suction type using the smoking and non - smoking aiding pipe of an embodiment of the invention shown in the lower section are compared and analyzed . also the figure shows the air flow during inhalation and the air flow during exhalation in detail . when a smoker lights a cigarette and an inhales cigarette smoke once , 50 ml of smoke usually enters the body through the mouth . at this time , 8 mg of particulate components and 32 mg of gas components are mixed and inhaled . the human airway has evolved for breathing and not for smoking . accordingly , airway resistance against inflow of harmful substances generated in smoking is very weak . smoking uses the airway intended for breathing . regarding change in the human body during one cycle in which the smoker inhales ( sucks ) and exhales ( blows out ), when the smoker inhales ( sucks the air ) to the maximum , the volume of the smoker increases from the basic level to the maximum level . when the smoker smokes , the smoker deeply inhales air twice as much as the volume of normal breathing as the thorax and the stomach expand the lungs . then , the smoker exhales ( breathes out ) to the maximum degree to restoring the original volume . in the conventional suction type shown in the upper section , the harmful substances 96 move toward the lungs 60 at a certain speed through the airway , which is formed by the mouth 10 , the larynx 20 , the trachea 30 , the bronchus 40 , the diaphragm 50 , without resistance . the pressure difference between the alveoli and the air needs to be large enough to sufficiently drive the amount of air entering the lungs 60 during inhalation , so that suction is performed . humans cannot simultaneously carry out inhalation and exhalation due to human anatomy . therefore , during a short period in which a smoker carries out inhalation ( sucking ) and exhalation ( blowing out breath ) during smoking , smoke is emitted from the mouth of the smoker through the expiration ( exhalation ) after the harmful substances 96 are already transferred to the lungs 60 . thus , the emitted smoke includes a very small part of the harmful components filtered from the lung . when the smoker inhales cigarette smoke once by lighting a cigarette , about 50 ml of smoke enters his / her body through the mouth . at this time , a mixture of harmful substance particulates and gaseous components are inhaled . in this case , about 90 % of carbon monoxide , about 70 % of tar , and 60 % of small particulates in the mixture enter the lungs and remain in the body . as the smoker 101 sets fire 70 on a cigarette and starts smoking , the air ( gas components + particulate components + liquid components + thermal energy ) containing the harmful substance 96 is sucked from the position t 1 , and is driven to flow toward the larynx 20 at a constant speed by the suction force f of the smoker 101 along the flow line leading to the position t 2 of the lungs 60 in one direction until the end of inhalation . in this process , the harmful substances 96 are combined into a small mass 97 , introduced into the body through the swallowing effect , and is then accumulated in the lungs 60 . the air discharged from the body according to blowing out breath ( exhalation ) contains only a fraction of the harmful substances 96 accumulated in the lungs 60 . according to the suction type using the aiding pipe 100 to which an embodiment of the invention is applied as shown in the lower section of the figure , while the harmful substances 96 move toward the position of the lungs 60 at certain speed through the mouth 10 , the larynx 20 , the trachea 30 , the bronchus 40 , and the diaphragm 50 , which form the airway , the centripetal force 95 acts on the force ( p 1 + p 2 ) passing through the center to change the flow direction of the harmful substance 96 going straight along the central point area p 1 , thereby implementing positional change . according to this approach , the aiding pipe 100 provided with an adsorption plate part 102 , which is a shielding film for preventing entry of the harmful substances 96 into an area with an circumference less than or equal to the circumference of the filter part and is positioned opposite to the cigarette filter part 70 in the path of movement of the harmful substances 96 into the body 101 while keeping a certain distance from the filter part 70 , is connected to the cigarette filter part 70 . thereby , the pipe cause the mass 97 of the harmful substances 96 moving at a certain speed to collide with the plate part to be decomposed into small particles 98 such that the harmful substances 96 are adsorbed and separated by the adsorption fabric 106 and dispersed through the bypass suction hole 105 by being repelled by the adsorption plate 102 , then discharged from the body through the process of blowing out breath ( exhalation ). in the process of blowing out ( exhalation ) of the harmful substances 96 shown in the upper section , compared to the process of blowing out ( exhalation ) of the harmful substances 96 using the aiding pipe 100 to which an embodiment of the invention is applied as shown in the lower section , most of the harmful substances 96 that have already been inhaled accumulate in the lungs 60 and cannot be returned , and thus the amount of discharged harmful substances is small . in the process of blowing out ( exhalation ) the harmful substances 96 using the aiding pipe 100 according to which an embodiment of the invention shown in the lower section obstructs normal entry of the harmful substances 96 through the adsorption plate part 102 which interferes with and resists against the inflow path of the harmful substances 96 shown in the upper section , and causes the harmful substances 96 to be adsorbed by the function of the adsorption fabric and discharged through the bypass suction hole by the repulsive force of the adsorption plate part . if the discharged harmful substances ever enter the larynx 20 in the throat again , they are discharged out of the mouth 10 immediately at the time of exhalation ( deep breathing out ). the amount of the harmful substances 96 discharged according to the indirect suction type using the aiding pipe 100 to which the invention is applied shown in the lower section is larger than the amount of harmful substances 96 discharged according to the conventional suction type . as a result , the inflow of the harmful substances 96 into the human body 101 is reduced . fig4 is a configuration diagram illustrating a tool and an embodiment to which the invention is applied . the figure shows the types of the indirect suction aiding pipe 100 to which an embodiment of the invention is applied , provides the detailed description of the adsorption fabric 106 of the adsorption plate part 102 and the configuration of connecting to the cigarette , and compares the rear surface of the typical direct suction filter part 70 with the rear surface of the filter part 70 of the indirect smoking type connected to the aiding pipe 100 . a filter connector 104 which is an inlet of an aiding tube having the same size as the circumferential size of the cigarette filter part 70 is formed at the front end of the adsorption tube portion 103 to connect the cigarette filter 70 during smoking . and one or more bypass suction holes may be formed in the middle portion of the adsorption tube portion . the suction tube portion accommodation space , which is an inner surface of the adsorption plate part 102 provided at the rear end of the adsorption tube portion 103 , is provided with an adsorption later by the adsorption fabric . according to an embodiment of the indirect suction type aiding pipe 100 to which an embodiment of the invention is applied may be formed as a detachable aiding pipe 201 in which the cigarette filter part 70 and the aiding pipe 100 is separate from each other . an integrated non - smoking aiding cigarette 202 which integrates the cigarette filter part 70 with the aiding pipe 100 may be formed in manufacture of cigarettes . an adsorption fabric replaceable aiding pipe 203 allowing the cigarette filter part 70 and the aiding pipe 100 to be detached from each other may be formed such that the adsorption fabric 106 of the adsorption plate unit 102 can be replaced with new adsorption fabric . in an embodiment of usage of the indirect suction type aiding pipe 100 to which an embodiment of the invention is applied , a filtration the effect of the rear surface of the cigarette filter part 70 is shown . in the filtration effect of the rear surface of the filter after the conventional direct suction , the effect is distributed throughout the filter . with the indirect suction type aiding pipe 100 to which an embodiment of the invention is applied , the filtration effect leaves a white circular periphery on the rear surface of the filter along with a darker center area after smoking , which is different from the result of direction suction . fig5 illustrates configuration of an embodiment of a tool and an experimental result . according to at least one embodiment , the smoker 101 may use the aiding pipe 100 in smoking by connecting a cigarette to the filter connector 104 at the front end of the adsorption tube portion . the smoker can directly check the adsorbing tube portion 101 on the inner side of the adsorption plate part 102 provided at the rear end of the adsorption tube portion 103 for the collection state of the harmful substances confirmed by the adsorption fabric 106 in the accommodation space . according to at least one embodiment , the subject was 170 cm tall and weighing 74 kg at the age of 62 . they smoke have had the smoking habit for 43 years and smoked one pack of cigarettes a day ( 20 cigarettes ). according to at least one embodiment , the upper part of fig5 shows detachable aiding pipes having two suction holes or three suction holes and a replacement type aiding pipe having two suction hole which can be continuously used by replacing the an assumption fabric , and three aiding pipes 206 as indirect suction type aiding pipes 100 . according to at least one embodiment , the lower part of fig5 shows the result of the experiment obtained by using a suction tool 206 which has two suction holes and can be continuously used by replacing the adsorption fabric . as a result of using five bypass tools 100 of the indirect suction type for 20 cigarettes ( one pack ), each indirect suction type bypass tool 100 was continuously used for four cigarettes and then the adsorption fabric 106 in the interior 103 of the adsorption plate 102 to check the collection state of harmful substances . a result 207 of using 5 indirect induction type korean paper adsorption fabric , a result 208 of using the filter type adsorption fabric , and a result 209 of using cotton type adsorption fabric are shown . embodiments of the non - smoking aiding pipe improve the smoking method , thereby attenuating introduction of harmful substances such as tar , nicotine , and carbon monoxide , which are toxic substances generated during smoking , into the human body and lowering nicotine dependence . thereby , the non - smoking aiding pipe provides long - term smoking cessation . terms used herein are provided to explain embodiments , not limiting the invention . throughout this specification , the singular form includes the plural form unless the context clearly indicates otherwise . when terms “ comprises ” and / or “ comprising ” used herein do not preclude existence and addition of another component , step , operation and / or device , in addition to the above - mentioned component , step , operation and / or device . embodiments of the invention may suitably comprise , consist or consist essentially of the elements disclosed and may be practiced in the absence of an element not disclosed . according to at least one embodiment , it can be recognized by those skilled in the art that certain steps can be combined into a single step . the terms and words used in the specification and claims should not be interpreted as being limited to typical meanings or dictionary definitions , but should be interpreted as having meanings and concepts relevant to the technical scope of the invention based on the rule according to which an inventor can appropriately define the concept of the term to describe the best method he or she knows for carrying out the invention . the terms “ first ,” “ second ,” “ third ,” “ fourth ,” and the like in the description and in the claims , if any , are used for distinguishing between similar elements and not necessarily for describing a particular sequential or chronological order . it is to be understood that the terms so used are interchangeable under appropriate circumstances such that the embodiments of the invention described herein are , for example , capable of operation in sequences other than those illustrated or otherwise described herein . similarly , if a method is described herein as comprising a series of steps , the order of such steps as presented herein is not necessarily the only order in which such steps may be performed , and certain of the stated steps may possibly be omitted and / or certain other steps not described herein may possibly be added to the method . the singular forms “ a ,” “ an ,” and “ the ” include plural referents , unless the context clearly dictates otherwise . as used herein and in the appended claims , the words “ comprise ,” “ has ,” and “ include ” and all grammatical variations thereof are each intended to have an open , non - limiting meaning that does not exclude additional elements or steps . as used herein , it will be understood that unless a term such as ‘ directly ’ is not used in a connection , coupling , or disposition relationship between one component and another component , one component may be ‘ directly connected to ’, ‘ directly coupled to ’ or ‘ directly disposed to ’ another element or be connected to , coupled to , or disposed to another element , having the other element intervening therebetween . as used herein , the terms “ left ,” “ right ,” “ front ,” “ back ,” “ top ,” “ bottom ,” “ over ,” “ under ,” and the like in the description and in the claims , if any , are used for descriptive purposes and not necessarily for describing permanent relative positions . it is to be understood that the terms so used are interchangeable under appropriate circumstances such that the embodiments of the invention described herein are , for example , capable of operation in other orientations than those illustrated or otherwise described herein . the term “ coupled ,” as used herein , is defined as directly or indirectly connected in an electrical or non - electrical manner . objects described herein as being “ adjacent to ” each other may be in physical contact with each other , in close proximity to each other , or in the same general region or area as each other , as appropriate for the context in which the phrase is used . occurrences of the phrase “ according to an embodiment ” herein do not necessarily all refer to the same embodiment . although the invention has been described in detail , it should be understood that various changes , substitutions , and alterations can be made hereupon without departing from the principle and scope of the invention . accordingly , the scope of the invention should be determined by the following claims and their appropriate legal equivalents .	0
the tertiary alcohol compounds of the present invention are represented by the general formula ( 1 ). r 1 and r 2 each independently represent a straight - chain , branched or cyclic alkyl group having 1 to 10 carbon atoms , in which some or all of the hydrogen atoms on the constituent carbon atoms may be replaced by a halogen atom or halogen atoms . specific examples thereof include methyl , ethyl , n - propyl , isopropyl , n - butyl , sec - butyl , tert - butyl , tert - amyl , n - pentyl , n - hexyl , cyclopentyl , cyclohexyl , bicyclo [ 2 . 2 . 1 ] heptyl , bicyclo [ 2 . 2 . 2 ] octyl , bicyclo [ 3 . 3 . 1 ] nonyl , bicyclo [ 4 . 4 . 0 ] decanyl , adamantyl , trifluoromethyl , 2 , 2 , 2 - trifluoroethyl , 2 , 2 , 2 - trichloroethyl , 3 , 3 , 3 - trifluoropropyl and 3 , 3 , 3 - trichloropropyl . alternatively , r 1 and r 2 may be joined together to form an aliphatic hydrocarbon ring . specific examples of the ring so formed include cyclobutane , cyclopentane , cyclohexane , bicyclo [ 2 . 2 . 1 ] heptane , bicyclo [ 2 . 2 . 2 ] octane , bicyclo [ 3 . 3 . 1 ] nonane , bicyclo [ 4 . 4 . 0 ] decane and adamantane . z represents a straight - chain , branched or cyclic divalent organic group having 2 to 10 carbon atoms . specific examples thereof include ethylene , propane - 1 , 1 - diyl , propane - 1 , 2 - diyl , propane - 1 , 3 - diyl , butane - 1 , 1 - diyl , butane - 1 , 2 - diyl , butane - 1 , 3 - diyl , butane - 1 , 4 - diyl , pentane - 1 , 1 - diyl , pentane - 1 , 2 - diyl , pentane - 1 , 3 - diyl , pentane - 1 , 4 - diyl , pentane - 1 , 5 - diyl , hexane - 1 , 1 - diyl , hexane - 1 , 2 - diyl , hexane - 1 , 3 - diyl , hexane - 1 , 4 - diyl , hexane - 1 , 5 - diyl , hexane - 1 , 6 - diyl , cyclopropane - 1 , 1 - diyl , cyclopropane - 1 , 2 - diyl , cyclobutane - 1 , 1 - diyl , cyclobutane - 1 , 2 - diyl , cyclobutane - 1 , 3 - diyl , cyclopentane - 1 , 1 - diyl , cyclopentane - 1 , 2 - diyl , cyclopentane - 1 , 3 - diyl , cyclohexane - 1 , 1 - diyl , cyclohexane - 1 , 2 - diyl , cyclohexane - 1 , 3 - diyl and cyclohexane - 1 , 4 - diyl . k is 0 or 1 . among the tertiary alcohol compounds represented by the general formula ( 1 ), tertiary alcohol compounds represented by the following general formula ( 2 ) are especially preferred . wherein r 3 and r 4 each independently represents a straight - chain , branched or cyclic alkyl group having 1 to 6 carbon atoms , or r 3 and r 4 may be joined together to form an aliphatic hydrocarbon ring ; and m is an integer satisfying the conditions defined by 3 ≦ m ≦ 6 . in this formula , r 3 and r 4 each independently represent a straight - chain , branched or cyclic alkyl group having 1 to 6 carbon atoms . specific examples thereof include methyl , ethyl , n - propyl , isopropyl , n - butyl , sec - butyl , tert - butyl , tert - amyl , n - pentyl , n - hexyl , cyclopentyl and cyclohexyl . specific examples of the tertiary alcohol compounds represented by the above general formulas ( 1 ) and ( 2 ) are as follows : it is believed that , in resist polymers formed by using these compounds as monomers , the tertiary alcoholic hydroxyl group which is considered to be a polar group for the development of adhesion can be located at a position remote from the main chain of the polymer through the intervention of a linker [ i . e ., — z — in formula ( 1 )], and this permits the polymer to exhibit good adhesion to the substrate . moreover , the lipophilicity of the polymer as a whole can be suitably regulated by choosing a compound having an appropriate number of carbon atoms with respect to k , r 1 , r 2 and z in the formula and using it as a raw material for the formation of the polymer . thus , it is believed that the dissolution characteristics of the polymer can also be controlled . the tertiary alcohol compounds of formula ( 1 ) in accordance with the present invention may be prepared , for example , according to any of the following four processes . however , it is to be understood that their preparation processes are not limited thereto . these preparation processes are specifically described below . ( a ) as a first process , a desired tertiary alcohol compound ( 1 ) can be synthesized by the nucleophilic addition reaction of an organometallic reagent ( 3 ) to a ketone compound ( 4 ). wherein r 1 , r 2 , z and k are as defined above , m represents li , na , k , mgp or znp , and p represents a halogen atom . it is desirable that the organometallic reagent ( 3 ) be used in an amount of 0 . 5 to 2 . 0 moles , preferably 0 . 9 to 1 . 2 moles , per mole of the ketone compound ( 4 ). preferred examples of the solvent include ethers such as tetrahydrofuran , diethyl ether , di - n - butyl ether and 1 , 4 - dioxane ; and hydrocarbons such as n - hexane , n - heptane , benzene , toluene , xylene and cumene . these solvents may be used alone or in admixture . the reaction temperature and the reaction time may vary widely according to the reaction conditions . for example , when a grignard reagent ( of formula ( 3 ) in which m is mgp ) is used as the organometallic reagent , the reaction temperature is in the range of − 20 to 80 ° c . and preferably 0 to 50 ° c . as to the reaction time , it is desirable from the viewpoint of yield to bring the reaction to completion while tracing it by gas chromatography ( gc ) or silica gel thin - layer chromatography ( tlc ). however , the reaction time usually ranges from about 0 . 5 to about 10 hours . the desired tertiary alcohol compound ( 1 ) can be isolated from the reaction mixture by an ordinary aqueous work - up . if necessary , the compound may further be purified according to common techniques such as distillation and chromatography . ( b ) as a second process , a desired tertiary alcohol compound ( 1 ) can be synthesized by the nucleophilic addition reaction of an organometallic reagent ( 5 ) to a ketone compound ( 6 ). wherein r 1 , r 2 , z , k and m are as defined above . it is desirable that the organometallic reagent ( 5 ) be used in an amount of 1 . 0 to 3 . 0 moles , preferably 1 . 1 to 1 . 5 moles , per mole of the ketone compound ( 6 ). preferred examples of the solvent include ethers such as tetrahydrofuran , diethyl ether , di - n - butyl ether and 1 , 4 - dioxane ; and hydrocarbons such as n - hexane , n - heptane , benzene , toluene , xylene and cumene . these solvents may be used alone or in admixture . the reaction temperature and the reaction time may vary widely according to the reaction conditions . for example , when a grignard reagent ( of formula ( 5 ) in which m is mgp ) is used as the organometallic reagent , the reaction temperature is in the range of − 20 to 80 ° c . and preferably 0 to 50 ° c . as to the reaction time , it is desirable from the viewpoint of yield to bring the reaction to completion while tracing it by gas chromatography ( gc ) or silica gel thin - layer chromatography ( tlc ). however , the reaction time usually ranges from about 0 . 5 to about 10 hours . the desired tertiary alcohol compound ( 1 ) can be isolated from the reaction mixture by an ordinary aqueous work - up . if necessary , the compound may further be purified according to common techniques such as distillation and chromatography . ( c ) as a third process , a desired tertiary alcohol compound ( 1 ) can be synthesized by the nucleophilic addition reaction of organometallic reagents ( 5 ) and ( 7 ) to an ester compound ( 8 ). wherein r 1 , r 2 , z , k and m are as defined above , and r 5 represents an alkyl group such as methyl or ethyl . it is desirable that the organometallic reagents ( 5 ) and ( 7 ) be used in an amount of 2 . 0 to 5 . 0 moles , preferably 2 . 0 to 3 . 0 moles , per mole of the ester compound ( 8 ). preferred examples of the solvent include ethers such as tetrahydrofuran , diethyl ether , di - n - butyl ether and 1 , 4 - dioxane ; and hydrocarbons such as n - hexane , n - heptane , benzene , toluene , xylene and cumene . these solvents may be used alone or in admixture . the reaction temperature and the reaction time may vary widely according to the reaction conditions . for example , when grignard reagents ( of formulas ( 5 ) and ( 7 ) in which m is mgp ) are used as the organometallic reagents , the reaction temperature is in the range of 0 to 100 ° c . and preferably 20 to 70 ° c . as to the reaction time , it is desirable from the viewpoint of yield to bring the reaction to completion while tracing it by gas chromatography ( gc ) or silica gel thin - layer chromatography ( tlc ). however , the reaction time usually ranges from about 0 . 5 to about 10 hours . the desired tertiary alcohol compound ( 1 ) can be isolated from the reaction mixture by an ordinary aqueous work - up . if necessary , the compound may further be purified according to common techniques such as distillation and chromatography . ( d ) as a fourth process , when the desired tertiary alcohol compound is represented by the general formula ( 1 ) in which r 1 and r 2 are joined together to form an aliphatic hydrocarbon ring ( i . e ., the partial structural formula wherein r 6 is a divalent hydrocarbon group produced when r 1 and r 2 are joined together to form an aliphatic hydrocarbon ring ), this tertiary alcohol compound ( 1 ) can be synthesized by the nucleophilic addition reaction of an organometallic reagent ( 9 ) to an ester compound ( 8 ). wherein r 1 , r 2 , r 5 , r 6 , z , k and m are as defined above . it is desirable that the organometallic reagent ( 9 ) be used in an amount of 1 . 0 to 3 . 0 moles , preferably 1 . 1 to 1 . 5 moles , per mole of the ester compound ( 8 ). preferred examples of the solvent include ethers such as tetrahydrofuran , diethyl ether , di - n - butyl ether and 1 , 4 - dioxane ; and hydrocarbons such as n - hexane , n - heptane , benzene , toluene , xylene and cumene . these solvents may be used alone or in admixture . the reaction temperature and the reaction time may vary widely according to the reaction conditions . for example , when a grignard reagent ( of formula ( 9 ) in which m is mgp ) is used as the organometallic reagent , the reaction temperature is in the range of 0 to 100 ° c . and preferably 20 to 70 ° c . as to the reaction time , it is desirable from the viewpoint of yield to bring the reaction to completion while tracing it by gas chromatography ( gc ) or silica gel thin - layer chromatography ( tlc ). however , the reaction time usually ranges from about 0 . 5 to about 10 hours . the desired tertiary alcohol compound ( 1 ) can be isolated from the reaction mixture by an ordinary aqueous work - up . if necessary , the compound may further be purified according to common techniques such as distillation and chromatography . when a polymer is formed by using a tertiary alcohol compound of the present invention as a monomer , it is common practice to mix the aforesaid monomer with a solvent , add a catalyst or a polymerization initiator , and subject the resulting mixture to a polymerization reaction while heating or cooling it as required . this polymerization may be carried out according to any conventional polymerization technique . examples of the aforesaid polymerization include ring - opening metathesis polymerization , addition polymerization , and alternating copolymerization with maleic anhydride or a maleimide . in some cases , the aforesaid monomer may be copolymerized with another norbornene type monomer , a ( meth ) acrylate type monomer or the like . resist materials may generally be prepared by using the polymer obtained in the above - described manner as a base polymer and adding an organic solvent and an acid generator thereto . if necessary , a crosslinking agent , a basic compound , a dissolution inhibitor and the like may also be added thereto . such resist materials may be prepared in the usual manner . the present invention is more specifically explained with reference to the following synthesis examples , reference example and comparative reference example . however , these examples are not to be construed to limit the scope of the invention . tertiary alcohol compounds in accordance with the present invention were synthesized according to the formulations described below . a grignard reagent was prepared from 95 . 5 g of 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane , 13 . 3 g of magnesium , and 200 ml of anhydrous tetrahydrofuran . then , under an atmosphere of nitrogen , 35 . 5 g of acetone was added thereto at 40 ° c . over a period of 1 hour . after this mixture was stirred for 1 hour , the reaction product was hydrolyzed by the addition of an aqueous solution of ammonium chloride , followed by separation into aqueous and organic phases . subsequently , the organic phase was washed with water and a saturated aqueous solution of sodium chloride , dried over anhydrous sodium sulfate , and concentrated under reduced pressure . the resulting residue was purified by vacuum distillation to obtain 90 . 5 g of 2 - methyl - 6 -( 5 - norbornen - 2 - yl ) hexan - 2 - ol ( boiling point : 93 - 98 ° c ./ 66 pa ; yield : 87 %). ir ( thin film ): v = 3371 , 3058 , 2966 , 2933 , 2863 , 1465 , 1380 , 1379 , 1377 , 1336 , 1253 , 1203 , 1186 , 1151 , 906 , 833 , 825 , 769 , 717 cm − 1 [ 0040 ] 1 h - nmr of major isomer ( 300 mhz in cdcl 3 ): δ = 0 . 44 - 0 . 50 ( 1h , m ), 1 . 03 - 1 . 12 ( 2h , m ), 1 . 16 ( 6h , s ), 1 . 22 - 1 . 46 ( 9h , m ), 1 . 77 - 1 . 85 ( 1h , m ), 1 . 91 - 2 . 01 ( 1h , m ), 2 . 70 - 2 . 76 ( 2h , m ), 5 . 86 - 5 . 93 ( 1h , m ), 6 . 06 - 6 . 11 ( 1h , m ) 3 - methyl - 7 -( 5 - norbornen - 2 - yl ) heptan - 3 - ol ( boiling point : 106 - 110 ° c ./ 53 pa ; yield : 88 %) was obtained in the same manner as in synthesis example 1 , except that 2 - butanone was used in place of acetone . ir ( thin film ): v = 3380 , 3058 , 2966 , 2935 , 2863 , 1461 , 1373 , 1336 , 1270 , 1253 , 1178 , 1149 , 993 , 929 , 904 , 879 , 833 , 775 , 717 cm − 1 [ 0044 ] 1 h - nmr of major isomer ( 300 mhz in cdcl 3 ): δ = 0 . 42 - 0 . 51 ( 1h , m ), 0 . 87 ( 3h , t ), 1 . 03 - 1 . 09 ( 2h , m ), 1 . 12 ( 3h , s ), 1 . 16 - 1 . 51 ( 11h , m ), 1 . 77 - 1 . 85 ( 1h , m ), 1 . 93 - 2 . 01 ( 1h , m ), 2 . 70 - 2 . 76 ( 2h , m ), 5 . 86 - 5 . 92 ( 1h , m ), 6 . 06 - 6 . 11 ( 1h , m ) 3 - ethyl - 7 -( 5 - norbornen - 2 - yl ) heptan - 3 - ol ( boiling point : 118 - 121 ° c ./ 53 pa ; yield : 89 %) was obtained in the same manner as in synthesis example 1 , except that 3 - pentanone was used in place of acetone . ir ( thin film ): v = 3403 , 3058 , 2964 , 2935 , 2863 , 1569 , 1459 , 1394 , 1376 , 1336 , 1253 , 1149 , 944 , 833 , 825 , 769 , 717 cm − 1 [ 0048 ] 1 h - nmr of major isomer ( 300 mhz in cdcl 3 ): δ = 0 . 42 - 0 . 51 ( 1h , m ), 0 . 84 ( 6h , t ), 1 . 01 - 1 . 48 ( 15h , m ), 1 . 77 - 1 . 85 ( 1h , m ), 1 . 93 - 2 . 02 ( 1h , m ), 2 . 70 - 2 . 76 ( 2h , m ), 5 . 87 - 5 . 92 ( 1h , m ), 6 . 07 - 6 . 11 ( 1h , m ) 2 - methyl - 7 -( 5 - norbornen - 2 - yl ) heptan - 2 - ol ( boiling point : 118 - 121 ° c ./ 66 pa ; yield : 91 %) was obtained in the same manner as in synthesis example 1 , except that 1 - chloro - 5 -( 5 - norbornen - 2 - yl ) pentane was used in place of 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane . ir ( thin film ): v = 3363 , 3058 , 2966 , 2931 , 2863 , 2852 , 1569 , 1465 , 1380 , 1336 , 1251 , 1199 , 1182 , 1151 , 904 , 835 , 769 , 717 cm − 1 [ 0052 ] 1 h - nmr of major isomer ( 300 mhz in cdcl 3 ): δ = 0 . 44 - 0 . 50 ( 1h , m ), 0 . 96 - 1 . 12 ( 2h , m ), 1 . 18 ( 6h , s ), 1 . 20 - 1 . 47 ( 11h , m ), 1 . 77 - 1 . 85 ( 1h , m ), 1 . 90 - 2 . 01 ( 1h , m ), 2 . 70 - 2 . 76 ( 2h , m ), 5 . 86 - 5 . 92 ( 1h , m ), 6 . 07 - 6 . 11 ( 1h , m ) 1 -{ 4 -( 5 - norbornen - 2 - yl )- 1 - butyl } cyclohexanol ( yield : 89 %) was obtained in the same manner as in synthesis example 1 , except that cyclohexanone was used in place of acetone . 2 - methyl - 6 -( 5 - norbornen - 2 - yl )- 6 , 6 - tetramethylenehexan - 2 - ol ( yield : 84 %) was obtained in the same manner as in synthesis example 1 , except that 1 - chloro - 4 -( 5 - norbornen - 2 - yl )- 4 , 4 - tetramethylenebutane was used in place of 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane . 2 - methyl - 4 -( 5 - norbornen - 2 - yl ) butan - 2 - ol ( yield : 89 %) was obtained in the same manner as in synthesis example 1 , except that 1 - chloro - 2 -( 5 - norbornen - 2 - yl ) ethane was used in place of 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane . 2 , 3 - dimethyl - 4 -( 5 - norbornen - 2 - yl ) butan - 2 - ol ( yield : 90 %) was obtained in the same manner as in synthesis example 1 , except that 2 - chloro - 1 -( 5 - norbornen - 2 - yl ) propane was used in place of 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane . 2 - methyl - 4 -( 8 - tetracyclo [ 4 . 4 . 0 . 1 2 , 5 . 1 7 , 10 ] dodecen - 3 - yl )- butan - 2 - ol ( yield : 83 %) was obtained in the same manner as in synthesis example 1 , except that 1 - chloro - 2 -( 8 - tetracyclo -[ 4 . 4 . 0 . 1 2 , 5 . 1 7 , 10 ] dodecen - 3 - yl ) ethane was used in place of 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane . 2 - methyl - 5 -( 5 - norbornen - 2 - yl ) pentan - 2 - ol ( yield : 89 %) was obtained in the same manner as in synthesis example 1 , except that 1 - chloro - 3 -( 5 - norbornen - 2 - yl ) propane was used in place of 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane . 1 -{ 3 -( 5 - norbornen - 2 - yl ) propyl } cyclopentanol ( yield : 86 %) was obtained in the same manner as in synthesis example 1 , except that cyclopentanone and 1 - chloro - 3 -( 5 - norbornen - 2 - yl ) propane were used in place of acetone and 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane , respectively . 2 - methyl - 6 -( 8 - tetracyclo [ 4 . 4 . 0 . 1 2 , 5 . 1 7 , 10 ] dodecen - 3 - yl ) hexan - 2 - ol ( yield : 82 %) was obtained in the same manner as in synthesis example 1 , except that 1 - chloro - 4 -( 8 - tetracyclo -[ 4 . 4 . 0 . 1 2 , 5 . 1 7 , 10 ] dodecen - 3 - yl ) butane was used in place of 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane . 1 , 1 - diisopropyl - 6 -( 5 - norbornen - 2 - yl ) hexanol ( yield : 85 %) was obtained in the same manner as in synthesis example 1 , except that diisopropyl ketone and 1 - chloro - 5 -( 5 - norbornen - 2 - yl ) pentane were used in place of acetone and 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane , respectively . 1 , 1 - dicyclopentyl - 6 -( 5 - norbornen - 2 - yl ) hexanol ( yield : 85 %) was obtained in the same manner as in synthesis example 1 , except that dicyclopentyl ketone and 1 - chloro - 5 -( 5 - norbornen - 2 - yl ) pentane were used in place of acetone and 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane , respectively . 1 -{ 5 -( 8 - tetracyclo [ 4 . 4 . 0 . 1 2 , 5 . 1 7 , 10 ] dodecen - 3 - yl ) pentyl }- cyclopentanol ( yield : 82 %) was obtained in the same manner as in synthesis example 1 , except that cyclopentanone and 1 - chloro - 5 -( 8 - tetracyclo [ 4 . 4 . 0 . 1 2 , 5 . 1 7 , 10 ] dodecen - 3 - yl ) pentane were used in place of acetone and 1 - chloro - 4 -( 5 - norbornen - 2 - yl ) butane , respectively . a polymer was synthesized by using one of the tertiary alcohol compounds obtained in the foregoing synthesis examples . then , a resist material was prepared by incorporating this polymer compound as a base resin , and its adhesion to the substrate was examined . using v60 , manufactured by wako pure chemical industries ltd .) as an initiator , tert - butyl 5 - norbornene - 2 - carboxylate , monomer 1 and maleic anhydride were polymerized to obtain an alternating copolymer of tert - butyl 5 - norbornene - 2 - carboxylate , 2 - methyl - 6 -( 5 - norbornen - 2 - yl ) hexan - 2 - ol and maleic anhydride ( in a copolymerization ratio of 4 : 1 : 5 ). using this polymer , a resist material was prepared so as to have the composition described below . after a silicon wafer was sprayed with hexamethyldisilazane at 90 ° c . for 40 seconds , the above resist material was spin - coated onto the silicon wafer and then heat - treated at 110 ° c . for 90 seconds to form a resist film having a thickness of 500 nm . this silicon wafer was exposed to light from a krf excimer laser , heat - treated at 110 ° c . for 90 seconds , and then developed by soaking it in a 2 . 38 % aqueous solution of tetramethylammonium hydroxide for 60 seconds . thus , 1 : 1 line - and - space patterns were formed . when the developed wafer was observed by top - down sem , it was confirmed that patterns having a size of down to 0 . 26 μm did not peel off but remained on the wafer . for purposes of comparison , an alternating copolymer of tert - butyl 5 - norbornene - 2 - carboxylate and maleic anhydride ( in a copolymerization ratio of 1 : 1 ) was used to prepare a resist material having the same composition as in the above - described reference example . this resist material was exposed under the same conditions as described above and its adhesion to the substrate was evaluated . as a result , it was found that no pattern having a size of 0 . 50 μm or less remained . it has been confirmed by the above - described results that polymers prepared by using the tertiary alcohol compounds of the present invention as raw materials have much better adhesion to the substrate , as compared with conventional polymers .	2
to prepare vulcanizable rubber composition of the invention , a masterbatch is prepared by conventional means , said composition comprising ( all parts by weight ) 100 parts of epdm rubber ( epsyn 70a ), 90 parts of carbon black ( n - 550 ), 50 parts of paraffinic extender oil and 2 parts of magnesium oxide . to 242 parts of the masterbatch there are incorporated by mastication in an internal mixer at about 100 ° c ., 3 parts of peroxide vulcanizing agent ( dicumyl peroxide dicup r ) and 4 parts of adhesion promoter . cured specimens are prepared by press - curing at 165 ° c . for 30 minutes . stress - strain properties are shown in table 1 . to illustrate reinforced articles of the invention , a reinforced article is formed by bonding two 5 mil . thick aluminum sheets ( 5 &# 34 ;× 5 &# 34 ; square ) together with about 1 gram of the vulcanizable compositions prepared as described above . an aluminum sandwich comprising the two aluminum sheets bonded by a vulcanized rubber interlayer is formed by press curing at 165 ° c . for 30 minutes and at a pressure sufficient to give a rubber interlayer about 5 mils . thick . the sandwich is cut into one inch strips . the peel force required to pull the two aluminum strips apart at 180 ° is measured with a tensile tester by using a jam separation speed of 10 inches per minute . the adhesion values are recorded in pounds per linear inch , pli . after pulling the sandwich apart , the amount of rubber covering the metal surface is visually estimated using a scale of 0 - 5 . zero indicates no coverage with all the rubber completely pulling away from the metal surface . a 5 rating means that the rubber completely covers the metal surface and that separation of the sandwich is due to tearing of the cured rubber . the adhesion results are shown in table 1 . table 1__________________________________________________________________________ aluminum adhesion ts , m . sub . 100 , stockadditive peel , pli coverage mpa mpa elong ., % __________________________________________________________________________1 none 4 . 5 0 . 0 10 . 3 1 . 34 5602 hva - 2 24 . 0 5 . 0 13 . 6 3 . 21 2603 n -( 4 - carboxyphenyl - 25 . 5 0 . 5 11 . 4 1 . 34 550maleamic acid4 n -( carboxymethyl )- 38 . 8 5 . 0 14 . 6 1 . 90 490maleamic acid5 n -( 3 - carboxypropyl )- 46 . 4 5 . 0 13 . 0 1 . 72 500maleamic acid6 n -( 5 - carboxypentyl )- 38 . 5 4 . 0 13 . 6 1 . 63 480maleamic acid7 n -( 1 , 3 - dicarboxypropyl )- 40 . 0 5 . 0 12 . 9 1 . 45 480maleamic acid__________________________________________________________________________ stock 1 is a control containing no adhesion promotor . stock 2 is a control containing m - phenylene bis - maleimide , hva - 2 , a commercially available rubber curative and adhesion promotor . stock 3 is a control containing n -( 4 - carboxyphenyl ) maleamic acid , an adhesion promotor described in u . s . pat . no . 3 , 502 , 542 . stocks 4 - 7 illustrate the invention ; the adhesion promotors are n -( carboxymethyl ) maleamic acid , n -( 3 - carboxypropyl ) maleamic acid , n -( 5 - carboxypentyl ) maleamic acid , and n -( 1 , 3 - dicarboxypropyl ) maleamic acid , respectively . the data show the n -( carboxyalkyl ) maleamic acid compounds give superior adhesion measured either by peel or surface coverage . stock 1 , without adhesion promotor , gives only 4 . 5 pli peel force and zero coverage , both values indicating no practicable adhesion . stock 2 , containing hva - 2 , gives a 24 pli peel value and complete coverage ; however , it caused an increase in 100 percent modulus and a descrease in ultimate elongation . stock 3 containing a known adhesion promotor gives 25 . 5 pli peel value but only 0 . 5 coverage . stocks 4 - 7 containing adhesion promotors of the invention give superior peel values of 38 . 5 to 46 . 4 pli . surface coverage values are 5 . 0 except for stock 6 which is 4 . 0 . thus , the adhesion promotors of the invention by either test method are superior to the promotors of stocks 2 and 3 . although the invention has been illustrated by typical examples , it is not limited thereto . changes and modifications of the examples of the invention herein chosen for purposes of disclosure can be made which do not constitute departure from the spirit and scope of the invention .	8
fig1 illustrates an operating table a , having side rails b , to which frame supports c are attached . various types of frames 10 , 11 are utilized on which are mounted a predetermined number of retractors to be hereinafter described . as shown in fig1 the frames 10 , 11 are of tubular construction . frame 10 is of an inverted l configuration and has the depending leg 10a thereof connected to one of the side rails b by a suitable clamp 13 . the other leg 10b of the frame is in an elevated position with respect to the patient lying on the table a . frame 11 , on the other hand , has a u - shape and is disposed in an elevated , horizontal position above the table - supported patient . the frame 11 is maintained in the desired elevated position by a pair of upright supports 14 , 15 , one disposed on each side of the table a and secured to the table frame , not shown , by suitable clamps or the like , of conventional design . to the upper end of each support is adjustably connected an extension arm 16 or 17 . the extension arm is normally formed of conventional flat bar stock . once the arm has been properly positioned , it is retained in place by a turnbolt 18 which extends through an opening in the arm and is threaded into the end of the upright support . both tubular frames 10 , 11 are provided with at least one exterior , longitudinally extending indentation such as a groove 20 . the groove is parallel to the axis of the tubular frame and the function of the groove will become apparent from the description to follow . secured to the frames 10 , 11 by various types of holders , to be hereinafter described , are various types of retractors . one retractor 21 , shown connected to the upper leg 10b of frame 10 , includes an elongated stem 22 which is provided with a hinge 23 at approximately mid - length thereof . the hinge 23 forms the stem 22 into an outer section 24 and an inner section 25 . both sections are provided with a plurality of exposed circumferential grooves g of like configuration arranged in axially spaced relation . the hinge 23 serves a dual function : ( 1 ) it permits the outer section 24 to assume a right angle position with the inner section and thus , not interfere with the movements of the surgeon and his or her assistants ; and ( 2 ) when in a right angle position , the outer section 24 provides a convenient handle to enable the retractor to be manually rotated about the axis of the inner section 25 thereby facilitating removal of the blade 26 from the inner end of section 25 without disturbing the patient . the shape and size of the blade 26 will depend upon the size and location of the incision and the physical dimensions of the patient . as shown in fig1 a second retractor of the same construction as retractor 21 is adjustably mounted on an extension arm 27 , the latter being secured by a turnbolt 28 to the upper end of an upright support 30 . support 30 is similar to supports 14 , 15 and is secured to a side rail b by a suitable clamp or attaching device 31 . attachment of the retractor 21 to the extension arm 27 is effected by a holder 32 which is shown more clearly in fig7 . the holder 32 as illustrated includes a bifurcated central body 33 , a clip segment 34 extending laterally in one direction from a lower segment 33a of the body 33 , a thumbscrew 35 mounted on an upper segment 33b of the body ; and a stop segment 36 extending laterally from the body lower segment 33a and in a direction opposite from that of the clip segment 34 . the clip segment includes a channel portion 37 which is sized to accommodate a portion of the extension arm 27 as will be described more fully hereinafter . overlying the body lower segment 33a , stop segment 36 and clip segment 34 is an elongated flat spring 38 . the portion 38a of the spring adjacent the stop segment is attached thereto by suitable pins or rivets 40 . the opposite end portion 38b of the spring is free and extends a short distance beyond clip segment 34 . when attaching the holder 32 on the arm 27 , the spring end portion 38b is brought into engagement with an edge of the extension arm and is distorted thereby , when manual pressure is applied , so as to allow the arm to slide between the spring end 38b and the clip segment 34 until it is aligned with the channel portion 37 whereupon a portion of the extension arm will be accommodated therein , see fig1 . the depth of the channel portion 37 is such that when the arm 27 is accommodated therein , the spring 38 will automatically return to its normal flat condition . the thumbscrew 35 and flat spring 38 coact with the bifurcated central body 33 to secure an adapter piece 41 to the central body . the adapter piece facilitates connecting the round stem section 25 of the retractor 21 to the holder 32 . as seen in fig7 adapter piece 41 includes a flat base 42 which is sized so as to readily slide between the upper and lower segments 33b , 33a , respectively , of the body when thumbscrew 35 has been loosened a predetermined amount . once the base 41 has been secured in place by the thumbscrew being drawn up tight against the base , the latter will overlie a substantial portion of the spring end portion 38b and press the latter into frictional engagement with the arm portion accommodated in the channel portion 37 and retain the holder in a fixed , selected position on the extension arm . an elongated depression 42a is provided in the upper surface of base 42 which is adapted to accommodate the concealed end of thumbscrew 35 . the base 42 has an exposed edge which is in the form of an elongated sleeve 43 . the interior dimension of the sleeve permits the stem section 25 of the retractor 21 to readily slide endwise therein . pivotally connected to the exterior of the sleeve and adjacent an end 43a of the sleeve furthest removed from the retractor blade 26 , is a spring - loaded latch or lever 44 . one end 44a of the latch is biased towards the sleeve axis so that it will automatically engage one of the external grooves g formed in the stem and restrain movement of the stem in a direction towards the patient &# 39 ; s incision . the opposite end 44b of the latch 44 is in an exposed , raised position and , when manually depressed will cause the latch to pivot about axis x thereby releasing the latch end 44a from the stem groove allowing the stem to be moved in either direction within the sleeve . the latch end 44b , when not depressed , will allow the stem the patients &# 39 ; incision and then be automatically locked in a desired position by the latch end 44a engaging a stem groove g . notwithstanding that the stem is locked in a selected position , the retractor 21 can still be rotated about the stem section axis by reason of latch end 44a being disposed in a circumferential groove , thereby facilitating replacement of the blade 26 without having to disengage the entire retractor from the holder 32 or adjusting the position of the patient on the table a . locking a retractor 45 having a conventional flat elongated stem 46 on a tubular frame 11 is accomplished by a modified form of holder 47 as seen in fig2 - 4 . the stem 46 normally is provided with an elongated longitudinally extending slot 46a . holder 47 is provided with a center body 48 , a clip segment 50 extending laterally in one direction from a lower segment 48a of the center body . a stop segment 51 projects laterally from the opposite side of the lower segment 48a . it will be noted in fig2 that the lower segment 48a and the clip segment 50 include parallel side walls v and w which are interconnected by a transverse base wall k . the portions of the side walls constituting the clip segment 50 are provided with semi - circular cutouts 50a . the shape of the cutouts corresponds substantially to the curved exterior of the tubular frame 11 . a flat spring 52 is secured at one end 52a by pins or rivets 53 to the stop segment 51 and the opposite end 52b is free and overlies in spaced relation the base wall k of the clip segment 50 . as seen in fig2 the flat spring 52 is sized so as to fit between the side walls v and w . spaced above the flat spring and extending in a cantilever relation from the side wall v of the center body is a flange 54 on which is mounted a thumbscrew 55 . the space between flange 54 and flat spring 52 is adapted to accommodate the flat stem 46 of the retractor 45 , see fig3 . upon the thumbscrew 55 being drawn up tight against the stem 46 , the latter will cause the free end 52b of the spring to be deflected downwardly thereby frictionally locking the holder 47 at selected position on the tubular frame 11 . the thumbscrew 55 also locks the retractor stem in a fixed , selected position relative to the holder 47 . rotation of holder 47 about tubular frame 11 is prevented by providing cutouts 50a of clip segment 50 with inwardly extending nubs 50b adapted to engage the external groove 20 formed in the tubular frame 11 . alternatively , the inward side of end 52b of spring 52 may be provided with an elongated protuberance adapted to engage the external groove of tubular frame 11 in order to prevent rotation of holder 47 about tubular frame 11 . holder 47 is possessed of a feature wherein it may be readily snapped onto the tubular frame at any selected location without any adjustment of other holders previously mounted on the frame . fig5 depicts another embodiment of a holder 56 which includes a body section 57 having a pair of spaced , substantially parallel flange segments 57a , 57b which are interconnected at one end by a bail segment 58 . each flange segment is provided with a substantially round opening 60 through which a portion of the tubular frame 11 is adapted to slidably extend . a corresponding peripheral portion of each opening is provided with an inwardly extending nub 60a . the nubs are adapted to engage the external groove 20 formed in the tubular frame and thus , prevent rotation of the holder relative to the frame . disposed between the bail segment 58 and the flange openings 60 and affixed to the flange segments 57a , 57b is a transversely extending anchor piece 61 . affixed to the anchor piece at approximately the mid - length thereof is an upwardly extending stud bolt 62 . the bolt terminates a substantial distance above the upper edges of the flange segments 57a , 57b , wee fig5 . the stud bolt is adapted to extend through the elongated slot 46a formed in the flat stem 46 of the retractor 45 shown in fig3 . the spacing between flange segments is slightly greater than the width of the flat stem 46 thus , enabling the flat stem to be disposed therebetween . it will be noted that the upper edge 58a of the bail segment 58 is recessed a slight amount from the upper edges of the flange segments the amount of the recess is approximately the same as the distance each opening 60 is from the upper edge of the respective flange segment . the upper end 62a of the stud bolt is threadably engaged by a wing nut 63 . when the nut 63 is drawn up tightly against the upper surface of the flat stem 46 , the latter , in turn , will clamp the portion of the tubular frame 11 disposed within the openings 60 between the underside of the flat stem and the lower perimetric portions of the openings . because of the serrated underside of the flat stem , as seen in fig3 a positive non - slipping contact is made between the stem and the tubular frame . as seen in fig1 the elongated slot 46a in the flat stem 46 of the retractor 45 is provided with one or more enlargements 46b which will allow the wing nut 63 and end 62a of the stud bolt to pass therethrough when the wings 63a of the wing nut are aligned with the slot . another embodiment of a holder 64 is shown in fig6 for securing the retractor 21 to the upper leg 10b of the tubular frame support 10 , see fig1 . holder 64 is fabricated of a deformable material , preferably aluminum , and includes a body section 65 having a cylindrical passage 65a formed therein and disposed adjacent one side thereof . the passage 65a is provided with a longitudinally extending key or protuberance 66 . the passage 65a is sized to slidably accommodate therein a portion of the tubular frame support 10 . the protuberance 66 is adapted to slidably engage the external groove 20 formed in the support 10 and thus , prevent relative rotation between the holder 64 and the frame support . a cut or open end slot 67 is formed in the body section 65 . the cut has three exposed open sides 67a and a concealed fourth side which terminates at the wall defining the passage 65a . disposed transversely of the plane of cut 67 is a stud bolt 68 . one end of the bolt is concealed within the body section 65 and is anchored to the portion 65b of the body section subtending the cut . the shank of the bolt spans the cut 67 and slidably extends through an opening formed in the portion 65c of the body section overlying the cut . the exposed end 68a of the bolt shank is threadably engaged by a wing nut 70 . when the nut 70 is drawn up tightly against the exposed surface of body portion 65c the latter will be distorted downwardly towards body portion 65b with the result that the frame support portion accommodated in passage 65a will be fixedly held in place within the passage . formed in body portion 65c and offset with respect to the bolt shank is a second cylindrical passage 71 . passage 71 is disposed above passage 65a and is substantially perpendicular thereto . passage 71 is sized so as to slidably accommodate the stem section 25 of the retractor 21 . pivotably connected to body portion 65c and adjacent the end of passage 71 furthest removed from the blade 26 of the retractor 21 is a spring biased latch 72 . the construction and function of latch 72 are the same as aforedescribed with respect to the latch 44 of the adapter piece 44 of holder 32 . in holders 32 and 47 , the thumbscrews thereof and in holders 56 and 64 , the wing nuts thereof cannot be disassembled from the remainder of the holder ; thus , eliminating the possibility of the thumbscrew or wing nut becoming lost or misplaced . from the above description , it is apparent that the objects of the present invention have been achieved . while only certain embodiments have been set forth , alternative embodiments and various modifications will be apparent from the above description to those skilled in the art . these and other alternatives are considered equivalents and within the spirit and scope of the present invention .	0
a description of exemplary embodiments of the invention will now be detailed . the same reference numbers will be used throughout the description as occasion allows . fig1 illustrates an exemplary work vehicle , a motor grader 1 , which could make use of the invention . the motor grader 1 of fig1 may include : a cab 10 having a steering device 11 and a seat 12 ; a front portion 20 having a front frame 20 a , a powered left front wheel 21 , a powered right front wheel 22 ; a rear portion 30 including a rear frame 30 a , tandem devices 31 ; rear wheels 32 , 33 ; and an articulation mechanism 40 including an articulation joint 41 and an articulation cylinder 42 for angular adjustments between the front and rear portions 20 , 30 . also included may be a tandem device 31 from which the rear wheels 32 receive motive power . the motor grader 1 may also include a work tool 50 for moving earth as the work vehicle 1 traverses the ground . fig2 represents a schematic of a first exemplary embodiment of the wheel drive control system 100 for the left and right front wheels 21 , 22 and the rear wheels 32 , 33 of the motor grader of fig1 . as illustrated , the drive system 100 may , among other things , include : tandem devices 31 through which the rear wheels 32 , 33 may receive motive power ; a transmission 34 ; a transmission controller 110 which may be in communication with , and operatively connected to : the transmission 34 ; a left hydrostatic transmission 120 ; and a right hydrostatic transmission 130 . the transmission controller 110 may also be in communication with : an engine controller unit ( ecu ) 36 ; a left front wheel speed sensor 126 ; a left front wheel angle sensor 127 ; a right front wheel speed sensor 136 ; a right front wheel angle sensor 137 ; and a rear speed sensor 34 a . an acceleration pedal 37 having a feature of detecting and communicating pedal positions may be in communication with the ecu 36 . as illustrated in fig2 , a vehicle speed sensor such as , for example , radar detector 160 may also be available and in communication with the transmission controller 110 . as illustrated , the left hydrostatic transmission 120 may include : a left hydraulic pump 121 with variable displacement ; a left pump solenoid 122 to position a left pump swash plate 121 a ; a left hydraulic motor 123 ; a left motor solenoid 124 for positioning a left motor swash plate 123 a ; and a left pressure sensor 125 for sensing a pressure difference between the left hydraulic pump 121 and the left hydraulic motor 123 . the transmission controller 110 is in communication with the left pressure sensor 125 and operably connected to the left pump solenoid 122 and the left motor solenoid 124 . as with the left hydrostatic transmission 120 , the right hydrostatic transmission 130 may include : a right hydraulic pump 131 with variable displacement ; a right pump solenoid 132 to position a right pump swash plate 131 a ; a right hydraulic motor 133 ; a right motor solenoid 134 for positioning a right motor swash plate 133 a ; and a right pressure sensor 135 for sensing a pressure difference between the right hydraulic pump 131 and the right hydraulic motor 133 . the transmission controller 110 is in communication with the right pressure sensor 135 and operably connected to the right pump solenoid 132 and the right motor solenoid 134 . as illustrated , the left and right hydrostatic transmissions 120 , 130 may be mechanically connected to the engine 35 . they may also be mechanically connected to left and right front wheels 20 , 30 respectively . fig3 illustrates a schematic of a second exemplary embodiment of the wheel drive control system 100 ′. the differences between the first and second exemplary embodiments of the invention 100 , 100 ′ may be attributed to rear transmission differences . the second exemplary embodiment of the wheel drive control system 100 ′ employs a rear hydrostatic transmission 60 in the stead of the geared transmission 34 of the first exemplary embodiment of the wheel drive control system 100 . as with the left and right hydrostatic transmissions 120 , 130 at the front of the work vehicle 1 , the transmission controller 110 may control the swash plates 61 a , 62 a of the respective pump and motor 61 , 62 via operable connections to the respective pump and motor solenoids 63 , 64 . swash plate displacement may determine the average speed of the rear wheels 32 , 33 . fig4 a , 4 b and 4 c illustrate an exemplary flowchart 200 for determining average and differential front wheel speed control efforts for the exemplary drive systems 100 , 100 ′ of fig2 and 3 and detailing the actions of the transmission controller 110 with respect to the transmissions 34 , 60 , the rear speed sensors 34 a , 66 , the left front wheel speed sensor 126 , the left front wheel angle sensor 127 , the right front wheel speed sensor 136 , the right front wheel angle sensor 137 , the articulation angle sensor 43 , the operator input device 140 and , possibly , a vehicle speed detector separate from the power train of the motor grader 1 such as , for example , the radar speed detector 160 . as illustrated in fig4 a , the average front wheel speed control effort ( asce ) may be viewed as a function of nominal and feedback efforts . as illustrated , the drive system 100 is activated when the ignition is on and front wheel assist is turned on at step 201 . at step 202 , the controller 110 may determine an average primary drive speed as a function of detected rear speed via a rotational speed detector ( such as , for example , rear speed detector 34 a , rear speed detector 66 or the like ); a detected vehicle ground speed via radar detector 160 ; or an anticipated speed via cross referencing rear speeds with displacements at the pump 61 and the motor 62 . the average front wheel speed target ( ats ) may then be calculated , at step 203 , based upon primary drive average speed and the vehicle model ( i . e ., for example , a detected articulation angle , a detected steering angle , a length between the articulation joint 41 and the front wheels 21 , 22 and a length between the articulation joint 41 and the rear wheels 32 , 33 ). at step 204 , the average front wheel speed target ( ats ) from step 203 may then be used to calculate a nominal ( or feed forward ) average front wheel speed control effort ( nae ). in exemplary embodiments , the front wheels 21 , 22 are driven by hydrostatic transmissions 120 , 130 respectively . in such a case effort may be considered as a function of displacement . thus , the nae may be determined via the use of a lookup table cross referencing front wheel speeds with displacements for swash plates 121 a and 131 a or via equivalent formulae . note that a displacement , especially a change in displacement , at hydrostatic transmission 60 may , under some circumstances , be considered to be an acceleration as the wheels 32 , 33 may require a finite time to respond to the displacement with a speed adjustment . as illustrated , at step 206 , the average front wheel speed ( ams ) may be determined from the speeds of the front wheels 21 , 22 which may be detected by the left and right speed sensors 126 , 136 at step 205 . the average front wheel speed error ( ase ) may then be calculated at step 207 as a function of average front wheel speed as calculated at step 206 and front wheel average speed target as calculated at step 205 ( e . g ., ats minus ams ). at step 208 , an average front wheel speed feedback effort ( afe ) may be calculated as a function of ase . at step 200 the average speed control effort may be calculated as the nominal feed forward front wheel speed effort plus the front wheel speed feedback effort ( e . g ., nae plus afe ). illustrated in fig4 b . is a similar pattern used by the controller 110 to determine the associated differential front wheel speed control effort ( dsce ). at step 210 , the controller 110 may determine differential front wheel speed ( dfs ) as detected right front wheel speed minus detected left front wheel speed . at step 211 , the controller 110 may calculate a target differential front wheel speed tds as a function of average primary drive speed , and a vehicle model which may include : positions of the rear wheels 32 , 33 with respect to the articulation joint 41 ; positions of the front wheels 21 , 22 with respect to the articulation joint 41 ; the diameters of the front wheels 21 , 22 ; the diameters of the rear wheels 32 , 33 ; the detected articulation angle aa ; and a turning angle ta of the front wheels 21 , 22 . the average primary drive speed may , among other things , be based upon a detected rotational speed via the rear speed sensor 34 a or the detected ground speed of the vehicle 1 via a speed detector independent of rotational speeds such as , for example , the radar speed detector 160 . if the vehicle has a hydrostatic transmission 60 , the average primary drive speed may be determined with detected displacements at the hydrostatic transmission 60 via a lookup table or formula effectively cross referencing displacements and average primary drive speeds . at step 212 , the controller 110 may calculate the front wheel differential speed error ( dse ) as a function of the detected differential front wheel speed ( dfs ) and the target differential front wheel speed ( tds ), i . e ., ( dse = tds − dfs , and dfe = f ( dse )). at step 213 , the dfe is determined by cross referencing the dse value with displacements in an appropriate lookup table or a suitable formula . at step 214 , the predicted or nominal front wheel differential speed feed forward effort ( nde ) may be determined by using the tds to find a corresponding displacement via a lookup table or formula cross referencing displacements and wheel speeds . finally , at step 215 , the differential speed control effort ( dsce ) may be calculated as the sum of the nominal differential speed feed forward effort and the differential speed feedback effort , i . e ., dsce = nde + dfe . as illustrated in fig4 c , at step 220 the controller 110 may determine right front wheel speed control effort ( rsce ) as a function of average front wheel speed control effort ( asce ) and dsce ( e . g ., rsce = asce + dsce ). at step 221 , the left front wheel speed control effort ( lsce ) may also be determined as a function of asce and dsce ( e . g ., lsce = asce − dsce ). the controller 110 may then send appropriate commands to control the speeds of the front wheels 21 , 22 , i . e ., signals controlling swash plate positions for the hydraulic pumps 121 , 131 and motors 123 , 133 of front wheels 21 , 22 , and return to step 201 . an operator input device 170 may be used to communicate aggressiveness settings , i . e ., settings of front wheel efforts and front wheel target speeds as a percentage or multiple of rear speeds detected via rear speed detector 34 a or vehicle speed via , for example , the radar speed detector 160 and , thus control of aggressiveness by the transmission controller 110 . the exemplary drive system 100 may also allow control over torque windup by monitoring torque values at the left and right front wheels 21 , 22 . in hydrostatic drives , hydrostatic or hydraulic pressure may be considered as proportional to torque . the transmission controller 110 may monitor torque values by monitoring the pressure signals from the left and right pressure sensors 125 , 135 and determining the respective torques via an appropriate equation or a lookup table . the transmission controller 110 may then control windup by controlling the left and right hydrostatic transmissions 120 , 130 such that the differences between the calculated left and right torques stay within a predetermined range . having described the exemplary embodiment , it will become apparent that various modifications can be made without departing from the scope of the invention as defined in the accompanying claims .	1
the embodiment shown in fig3 shows an sap r / 3 release 4 . 5 system landscape 300 with separate logical systems 301 that are here divided into a global part 302 , e . g . at a main development and production facility , and local parts 303 a , 303 b , 303 c , e . g . at other production facilities . the global part 302 comprising at least a development system 301 a for customizing and development work , a quality assurance system 301 b for testing functionality using representative test data , and a productive system 301 c for actual productive use . the local part 303 a comprises a development system 301 d for customizing and development work of local adaptations to sap , e . g . to meet different legal requirements if part 303 a is localized in a different country than the global part 302 . the local part 303 a further comprises a quality assurance system 301 e for testing functionality using representative test data , a training system 301 f for training new users , and a productive system 301 g for actual productive use . the local part 303 b comprises a development system 301 h , a quality assurance system 301 j and a productive system 301 k , but no training system . the local part 303 c is a two system landscape comprising a development system 301 l and a productive system 301 m only . the system landscape may be different according to the actual requirements . fewer or more , different or differently connected or grouped systems 301 may be defined as needed . the logical systems 301 are identical in large parts and function autonomously . the quality assurance system 301 j for example resembles the productive system 301 k in that it provides all the functionality , its present data and additionally special test data . new customization settings or adaptations may thus be thoroughly tested in the quality assurance system 301 j without jeopardizing the productive system 301 k . each system 301 comprises an import buffer 304 and a data supplier 305 . a transport management system connects the logical systems 301 and serves to effect software services across the system landscape via logical directional transport paths 306 . a service may for example relate to customization of a system 301 , e . g . a selection of predefined functionality in the system 301 , or an adaptation of a system 301 , e . g . an addition of or amendment to functionality , or to program and data updates or the like . a system path ( not shown ) is provided between each system 301 and a central system 307 having a data collector 308 . the systems 301 of each part 302 , 303 a , 303 b , 303 c and the central system 307 may be located and simultaneously executed in a single computer , or may be distributed across separate hardware . the global part 302 and the local parts 303 a , 303 b , 303 c each run on physically separate computer systems , which themselves may comprise different computers . an example implementation of the local part 303 a may comprise , cf . fig4 , a data base layer 401 for storing and retrieving business data like a factory inventory , employee data , sales figures etc . the data base layer 401 comprises one or more data base servers 402 and four data bases 403 , one for each of the systems 301 d , 301 e , 301 f and 301 g . connected to the data base layer 401 by a suitable network 404 , e . g . a lan , is an application layer 405 for execution of the software of the systems 301 d , 301 e , 301 f and 301 g . the application layer 405 comprises one or more application servers 406 . finally , connected to the application layer 405 by a suitable network 407 , e . g . a lan , is a presentation layer 408 for the graphical user interface ( gui ). the presentation layer 408 comprises dumb terminals 409 , personal computers 410 and / or wireless access devices 411 like pdas . the method according to an example embodiment of the invention is now described with reference to fig5 and fig3 . a software service is provided 501 using a transport request 309 . the transport request 309 is structured data comprising an identifier 310 , e . g . devk900251 , general information 311 regarding the service , e . g . indicating that the service is a program patch , and service data 312 , e . g . a piece of program code for a patch . the transport request 309 is fed 502 into the import buffer 304 of one of the systems 301 , e . g . the quality assurance system 301 b of the global part 302 . this initial feeding may occur from the development system 301 a through a transport path 306 , but may also be effected manually as shown by path 313 . at operation 503 , the data supplier 305 of system 301 b detects the transport request 309 , accesses at least a part of its data , in particular the identifier 310 and the general information 311 , and provides , at operation 504 , the accessed data together with further information in a predefined format as system supplier data 315 to the data collector 308 . the further information may comprise a system identifier and system status information , e . g . a list of the support packages and services installed on the system 301 b , project data , project status indicators etc . the data collector 308 updates , e . g . generates , deletes or changes , status data in a data file 314 that in this example is located within the central system 307 , operation 505 . the data file 314 may also be held in a different place or be a data base entry . the status data may contain a copy of the system supplier data 315 , or data based on an analysis of the system supplier data 315 . likewise stored in the data file 314 or other data files is system supplier data 315 provided by the data suppliers 305 of the other systems 301 . the data collector 308 maintains an up to date record of the state of all systems 301 of the system landscape 300 . for this purpose , the data collector 308 calls each data supplier 305 periodically for an update . alternatively or additionally , the data suppliers 305 may contact the data collector 308 if relevant data has changed . the central system 307 provides tracking services based on the data in data file 314 , operation 506 . these tracking services may comprise a request analysis , a status analysis , a sequence analysis , a project analysis , generation of reports , checking services etc . as explained in detail in the following . a request analysis allows the search through all transport requests pending in the system landscape 300 according to certain criteria . for example , all transport requests belonging to a particular project , originating from a particular developer , being older than a predeterminable period of time may be determined and provided in a results list using this tracking service . a status analysis allows the status of certain requests , e . g . the requests of the results list of the request analysis , to be analyzed . the analysis may state in which systems the requests have been approved , when they have been approved , in which systems they are pending to be approved , whether errors or system messages have been recorded during importation into a system etc . a sequence analysis allows to determine the import sequence of the transport requests into each system , the sequence of transport requests in the import buffers , and the automated centralized assessment whether the sequences are correct . a project analysis allows to determine the transport requests belonging to a particular project and its state . reports may be generated and automatically analyzed . such analysis may comprise comparing a report with a reference report to check for completeness , comparing the imports of transport requests in two different systems , comparing and analyzing import sequences in order to identify sequence errors , comparison of a request list with the contents of the import buffer of a system , determining the overall status of an object list , e . g . a list of objects belonging to a project , etc . based on the tracking service results , and with consideration of further information like project association and project status data , one or more transport requests may be imported automatically , operation 507 . a manual approval of the automated import by an operator may be required . although the foregoing has been a description of an example embodiment of the invention , it will be apparent to those skilled in the art upon review of this disclosure that numerous variations and modifications may be made in the invention . for example , instead of using sap r / 3 release 4 . 5 , other sap and non - sap systems may benefit from the invention .	6
the so - called “ constant - tension ” winch will allow a cable to be kept stretched between the vessel , for example a liquid natural gas tanker , and the loading / unloading arm throughout the phase comprising approach , connection and disconnection at the manifold of the vessel . this cable will allow , via the drive winch , the connection system for the loading arm to brought close to the manifold of the vessel . in order to guarantee a constant tension in the cable the winch winds on and unwinds according to the movements imposed between the vessel and the location on which the loading arm is installed . when the vessel approaches the arm , the winch winds on the cable , and when it moves away from it the winch allows the cable to unwind . a specific hydraulic control system applies a constant hydraulic pressure to the winch motor . the constant - tension winch is installed at the foot of the base of the loading arm . the guide pulley serves to orientate the cable between the constant - tension winch and the drive winch . it is orientatable along the three axes of rotation so as to best guide the cable , whatever the direction and the angle of engagement of the latter . the pulley is situated at the upper end of the base , just above the constant - tension winch . the orientatable alignment guide is fixed onto the drive winch and is situated just behind the latter . it moves along an axis perpendicular to the cable and orientates itself at an angle , for example ranging from − 30 ° to + 30 °. its principal functions are to correctly guide the cable before entering the winch , and to orientate the connection system in the vertical plane . this guide accompanied by the cable allows the avoidance of too - sudden vertical movements , and also the front and rear balancings of the connection system . the so - called “ drive ” winch is a mechanical assembly operated by a hydraulic motor . it is fixed at the connection system close to the alignment cone described below . it is located behind the coupling and moved off - centre relative to the axis of the latter . its functions are to permit the connection system to progressively follow the movements of the liquid natural gas tanker , and to guide the loading arm as far as the manifold of the vessel . for this , the winch winds and unwinds on the cable at constant tension . it is actually the adhesion of the cable on the drum of the winch that allows the arm to be brought close to and moved away from the manifold . during this approach phase , the arm is in “ free wheel ” mode . to drive the arm , the winch must overcome the forces induced by the cable , the intrinsic mass of the arm and all other outside agents ( wind , ice etc .). this hydraulic winch is controlled by the operator who works a control panel ; it is he who decides whether or not to bring the arm close , by working the drive winch . the hydraulic coupling is fitted with a female cone called “ alignment cone ” through which the cable passes at a constant tension . upstream from the alignment cone , the cable passes into the drive winch and downstream from the cone is found the end of the cable which is locked by the system located on the vessel . the role of this centering cone is to precisely guide the connection system and in particular the coupling . at the end of the approach , the male cone , called “ reception cone ”, which is located alongside the manifold of the vessel , fits inside the female cone . thus fitting allows the coupling to be brought close to the manifold while avoiding the violent impacts which could damage the joints and the coupling itself . the cone also serves to align the coupling with the flange on board the vessel ; it is situated alongside the coupling . in addition to the cone , it is possible to use an orientation device for the connection system , in order to best prepare the alignment between the two elements . this orientation device can comprise a device for rotating the connection system relative to the articulated arm . the whole of the connection system is in fact here fitted with a rotation device independent of the rest of the equipment , and permits angular orientation in the desired direction of the coupling and the system for connecting the arm ( cone , drive winch , orientatable guide ). this system allows the operator to centre the coupling with the manifold of the vessel during the final approach phase . it is composed of two hydraulic motors fitted with drive pinion , as well as a crown gear . this orientation system is installed at the upper - rotation level of the connection system generally called “ median rotation ” an equivalent system can for example be developed from a jack and connecting rods . the horizontal orientation ( the trim ) is obtained with the help of the orientatable guide and the guide rollers situated behind the female cone . a single cable stretched at a constant tension can thus serve as a link and guide between the manifold of the vessel and the system for connecting the loading arm . on the vessel , a guiding assembly is installed right alongside the manifold . this assembly is composed in particular of a male reception cone through which the cable passes equipped with a sleeve at its end , as well as a mechanical locking system allowing this cable under constant tension to be kept in place . this system is essentially composed of an indexable bolt fixed to an operating handle . the bolt is actually a piece having at its lower end a longitudinal rounded shape through which the cable passes . as the sleeve ( crimping ) has a diameter greater than that of the cable , this is “ trapped ” after having entered the guiding tube and after the bolt has been lowered . when at rest , the bolt is in fact in a position of flanging the sleeve of the cable . as the bolt is fitted with a return system , when the operator pulls on the rope hitched to the end of the sleeve , the latter acts on the bolt so that the latter closes as soon as the sleeve has passed completely behind it . the guiding / locking assembly is thus capable of withstanding very strong forces . in the event of a problem during the loading / unloading of the vessel , the connection assembly is fitted with an emergency disconnection system . this system is composed in particular of an ers ( assembly of two valves which close and separate ). as this equipment is well known , it will not be described in more detail here . the emergency disconnection system also comprises a means of releasing the cable in the case of an abnormal gap between the vessel and the arm . the cable release system is here installed at the constant - tension winch . the cable is wound onto the drum of the winch and its free end is kept engaged in a cubicle , by three mechanical spring thrusters ( not represented ). three additional thrusters , these being hydraulic , can also be used in parallel to the mechanical thrusters . in the event of a major unwinding of the cable , the three hydraulic thrusters are capable of unlocking themselves . at the end of unwinding , the cable is held only by the three mechanical thrusters , which can release the cable with the help of the tractive force engendered in the latter . the connection - assistance system is thus composed of a constant - tension winch and a drive winch , permitting movement of the loading arm , by friction , on a single cable kept stretched at a nominal tension . to connect the loading / unloading arm , the following stages can be envisaged , independently of one another : unlock the arm , then open the compass by a few degrees so as to position the arm in an intermediate position ; unwind the cable ; an operator a , who is located to the side of loading arm throws the rope , hitched to the sleeve of the constant - tension cable , to an operator b on the vessel ; operator b pulls the rope so as to haul the cable up onto the deck of the vessel , simultaneously with operator a who unwinds the cable ; operator b passes the rope through the male guide cone , then pulls the sleeve and the cable through the latter ; lock the sleeve of the cable with the help of the mechanical system located in the extension of the cone ; start the constant - tension winch , so as to pre - tension the cable ; open the inner and outer tubes ( the compass ) so as to place the arm in an intermediate position between a stored state and a connection state ; start a function permitting the cable to be stretched at its nominal tension . at the moment when this function is started , the loading arm passes into free wheel mode . with the cable hitched to the vessel and passing through the drive winch situated at the connection system , the arm then freely accompanies the vessel in its movements ; at the final approach , just before the cones engage in each other , it is possible to use the system for rotating the connection system , in order to best align the coupling with the manifold of the vessel ; start the drive winch so as to engage the two cones and permit the alignment of the coupling with the manifold ; close the coupling on the manifold ; apply a reduced constant tension in the cable , throughout the loading / unloading phase . to disconnect the loading / unloading arm , the following steps can be envisaged , independently of one another : with the loading arm connected to the manifold of the vessel and a reduced tension being applied in the cable , stretch the cable to its nominal tension ; open the coupling ; start the drive winch so as to remove the arm from the manifold and position the arm in an intermediate position between the connected state and the resting state ; pre - stress the cable to a reduced constant tension ; move the arm into its storage position ; remove any stress in the cable and unwind it slightly ; manually release the sleeve from the cable using the handle provided for this purpose ; unwind the cable using the constant - tension winch until the sleeve reaches the female cone ; lock the loading arm . although the cones or guiding elements are used for orientation and permit the coupling to be brought close to the manifold of the vessel without impacts , in the case described above these are not aligned relative to the axes of the coupling and of the manifold . the coupling and the manifold are orientated in one direction , whereas the connection - assistance assembly is orientated in another . the orientatable guide , the drive winch and the male and female guide cones are all orientated in the same direction . other cases can be developed , consideration being given for example to guiding tubes or frusta parallel to the axes of the coupling and of the manifold . the invention can comprise , in particular in view of the following elements , independent of one another : the connection of the loading / unloading arm to the manifold of the vessel is possible through a drive winch advancing by adhesion on a stretched cable or indeed by a device including an approach winch integral with the base and a return pulley on the vessel ; a single cable subjected to constant tension allows the loading arm to be guided as far as the manifold of the vessel ; the cable can be fitted at its free end with a crimped sleeve permitting a locking system to keep the cable on the vessel ; the system for locking the cable can be situated on the deck of the ship , right alongside the manifold ; the cable passes through all the guiding and operating elements ; the system according to the invention comprises a system for applying constant tension ( winch , jack , counterweight ); the system for applying constant tension , the winch in the case described previously , is fitted with an emergency disconnection system ; the system for emergency disconnection of the cable can be mechanical , hydraulic or other ; the vertical orientation ( the trim ) of the connection system is established in particular through the orientatable guide situated on the back of the drive winch ; the axial orientation of the coupling and of the manifold is possible thanks to the guiding elements ( cones or tubes etc .) and to the motorized system for orientation of the connection system . fig2 represents another embodiment of the invention according to which the cable , instead of being locked on the vessel , passes through a return pulley attached to the vessel so that two parallel strands of the cable join the jetty and the vessel . the end of the cable that has come from the return pulley is wound up by an “ approach ” winch integral with the base , thanks to another guide pulley . in addition , the connection system is joined in a fixed manner to the cable , for example by a system of hydraulic clips , and the movement of the connection system along the cable is then controlled by the approach winch . the reference signs used for the corresponding elements shown on the drawings are indicated below : 1 . articulated loading and unloading arm 2 . tube in which the product to be loaded or unloaded circulates , in compass form 3 . idem ( 2 .) 4 . base 5 . system for connecting the compass - style duct system to a coupling means 6 . coupling means of the vessel 7 . cable 8 . constant - tension winch 9 . drive winch 10 . approach winch 11 . system for locking the cable on the vessel 12 . reception cone 13 . alignment cone 14 . hydraulic coupling 15 . manifold 16 . orientatable alignment guide 17 . device for rotating the connection system relative to the compass - style duct system 18 . guide pulley to the constant - tension winch 19 . guide pulley to the approach winch 20 . return pulley attached to the vessel 21 . points of attachment of the connection system on the cable 22 . balance weights 23 . vessel 24 . jetty 25 . hydraulic motors of the rotation device 26 . drive pinions integral with the motors 25 27 . crown gear with the connection system 28 . guiding assembly installed on the vessel 29 . sleeve fitted to the end of the cable 30 . indexable bolt for the locking of the sleeve 29 31 . handle for operating the bolt 30 32 . emergency disconnection system 33 . rope hitched to the sleeve of the cable	1
the object locator system of the present invention is comprised of two units , a transmitter unit that emits an activation signal when a pushbutton is actuated , and a receiver unit that is attached to an object , such as by a chain or loop fastener , or incorporated directly into the object , which has a light pipe visual indicator that is illuminated in response to receipt of the activation signal . the light pipe provides a flash of illumination each time the user actuates the transmitter , and therefore provides direct visual feedback with each button press by the user . this direct feedback ensures that the user can pick out the light flash in a crowd without the need for a loud alarm or continuous annoying beeping or a triangulation locator device . preferably , the light pipe is provided with a length running at least partially around the perimeter of the receiver unit so that it is more visually prominent and can be seen at all angles from the user . the light pipe &# 39 ; s length and location may , of course , be altered to present a different market appearance or to allow for different engineering specifications . a digital oscillator circuit with dip switch settings may be used for setting a unique coded signal to be sent by the transmitter , and the receiver circuit may be set in similar fashion with dip switch settings to detect the encoded signal . alternatively , the transmitter and receiver may be pre - coded with unique signals during manufacture or , in the case where more than one receiver is to be used with each transmitter , the transmitter and receiver may be programmed by the user . in these manners , the receiver only responds to its associated transmitter , and each transmitter / receiver pair can be initialized for any one of a plurality of different objects to be located . each transmitter may also be programmed by the user to send a coded signal to more than one receiver . in fig1 a , 1 b , and 1 c , the receiver unit 10 is shown having a casing 11 with complementary halves 11 a , 11 b enclosing a circuit board 12 mounting the circuitry for the receiver functions , a battery 13 , battery connectors 13 a , a light emitting diode ( led ) 14 and head reflector 14 a , an antenna 15 , and a speaker 16 behind a grill 16 a . the two halves of the casing are attached by a latch or hold down 17 on one end , and a screw fastener 18 on its opposite end . the screw fastener 18 can be removed to allow access into the casing for setting dip switch settings therein , such as for setting the receiver to detect an encoded signal or to select a sound output type ( described further herein ). the casing can be made of a hard plastic material , such as lexan ( tm ), and molded with a clamshell or ovoid shape to provide a narrowed end by which it is attached to an object such as the handle of luggage . the casing is formed with an through - hole or aperture 19 at its narrowed end , through which a chain , plastic loop , or other type of secure fastener is inserted for attaching the receiver unit to a piece of luggage or other object . a light illumination element 20 is mounted to or on an external surface of the casing so that it is visible to the user . preferably , the element is a light pipe which has a length running at least partially around the perimeter of the receiver unit , and most preferably running along three sides of the receiver unit . the light pipe is fabricated as a tubular length of light transmissive plastic having an internal index of refraction which results in light rays at low angles of incidence being reflected down the pipe and light at high angles of incidence being transmitted through the pipe walls as external illumination . the light pipe may have tiny reflective particles or a dispersion of bubbles or other reflective elements embedded therein to promote the even dispersion of light along the length of the pipe . the light pipe 20 is retained in a recess 20 a formed by an indentation in the facing walls of the casing halves 11 a , 11 b . a head end 20 b of the light pipe 20 is fixed inside the casing 11 facing the led 14 and reflector 14 a , so that light from the led 14 is directed into and transmitted down the light pipe . preferred leds have a rated life expectancy of approximately 50 hours and a power rating of 3 . 6 - 4 . 0 vdc . to provide greater illumination , multiple leds may be used to direct light into the light pipe . in fig2 a and 2b , another version of the receiver unit has a casing 21 enclosing similar elements as described above for the first embodiment . in this version , the receiver is attached directly to a handle post 22 of a piece of luggage 23 by a threaded post 29 made of light transmissive plastic material as in the light pipe of the first embodiment . the plastic post 29 is insertable through a hole in one flange 24 a of the casing 21 and secured by threading into a fastener hole in another flange 24 b of the casing . in the secured position , the end of the post 29 is positioned adjacent an led inside the casing , as described above , for directing light into the post . thus , the illumination element and fastener to the object are combined in one element . in fig3 a , 3 b and 3 c , a further version of the receiver unit has a casing 40 enclosing similar elements as described above for the first embodiment . in this version , the receiver is incorporated directly into a side panel 42 of a piece of luggage 44 during manufacture of the luggage , preferably near the handle 45 of the luggage . the casing 40 is mounted between an inner supporting wall 46 and an outer covering 48 of the top side panel 42 and secured by inserting screws , rivets or the like through the outer covering and into the holes 47 provided in the casing . in this manner , the receiver unit may be incorporated into both hard and soft cover luggage . the casing 40 includes two flanges 52 a , 52 b which extend out of opposing sides of the casing and have portions 50 a , 50 b made of light transmissive plastic material as in the light pipe of the first embodiment . the flanges 52 a , 52 b are adjustable to extend the width of the luggage , such that each light pipe is visible on opposing sides of the luggage . alternatively , the light pipes 50 a , 50 b may be located on a top surface of each flange 52 a , 52 b and may extend through apertures cut into the outer covering 48 . each flange 52 a , 52 b is positioned adjacent an led inside the casing , as described above , for directing light into the flange and toward the light pipes 50 a , 50 b . thus , this embodiment may utilize two leds . a sound producing device is also mounted in the casing behind a grill 54 . as shown in fig4 the transmitter is a small hand held unit 30 about the size of a key ring which can be easily carried by the owner and / or unobtrusively attached to a variety of objects such as a key ring . the transmitter casing encloses transmitter circuitry , a battery power source , and an antenna , in a similar manner as described for the receiver unit . the casing can be opened to allow access for setting dip switch settings therein , such as for setting the transmitter to send a particular encoded signal ( described further herein ). an activation button 31 is mounted on an external side of the casing for convenient operation by the user . activation of the transmitter results in sending an encoded radio frequency ( rf ) signal . the rf signal for the indicated size and battery capacity of the transmitter typically would have an effective range of about 50 - 100 feet . the transmitter may also include an led which is illuminated upon activation of the transmitter , to confirm to the user that the transmitter is functioning properly . a further embodiment of the transmitter unit &# 39 ; s circuitry is shown in fig7 a and 7b . this is a digital circuit having two activation buttons 70 and 72 mounted on an external side of the casing for convenient operation by the user . activation of one of the activation buttons results in sending an encoded radio frequency ( rf ) signal . the other activation button is used for programming the transmitter to select a signal corresponding to a specified receiver unit and for programming the receiver to play one of several different response sounds , for example , melodies or songs . a unique aspect of the present invention is the activation of the receiver , upon receipt of a signal from the transmitter , to emit light through the light pipe in response to the user depressing the activation button on the transmitter . the user can thus activate a series of light flashes of arbitrary duration by depressing the transmitter button on and off at will . when the user scans an area where the object might be found , the visual perception of light flashes being emitted in direct response to the user &# 39 ; s button presses provides a direct visual feedback to the user that makes it easy to pick out the flashes in a crowded visual field , and thereby locate the object . this direct feedback makes it unnecessary to have the receiver emit a loud or distinctly audible sound that would annoy other persons . the embodiments described herein are also provided with a sound speaker or piezzo - electric sound element that is operated at lower audible levels that would be tolerable to passers - by , such as a warbling or chirping sound . the sound output can assist the user in the event the object is located nearby but out of the user &# 39 ; s visual field , such as behind the user or in a compartment or area shielded from the user &# 39 ; s sight . in a preferred embodiment of the invention , a user will be able to choose from one of eight melodies to be played upon activation by the transmitter . using the second transmitter activation button , a user can send a programming signal to the receiver unit for selecting a desired sound output . by activating the receiver to emit light only when the transmitter signal is sent , and with low speaker levels , the system of the present invention also conserves the receiver &# 39 ; s battery power without the need for complicated power shutoff or timer circuitry . the light pipe also provides an aesthetic element to the locator device that would make it more attractive to users . in fig5 an example of a circuit for the transmitter is shown having a battery input bat , a pushbutton switch s 2 , a driver transistor q 3 , a digital oscillator unit osc , an array of dip switch s 1 , and an rf output circuit including an inductor element l 1 . the array of dip switches s 1 has 8 bit positions for setting a unique binary number to be coded with the transmitted signal . in this manner , the transmitter is set to locate only the object that has a receiver set to detect the encoded signal . an array of 8 dip switches provides capability of setting up to 256 unique coded signals . the battery may be a 12 v battery with a service life of 2000 hours ( about 3 months ) in stand by mode or , in the digital circuit of fig7 a and 7b may be two button type batteries , which enables the units to be made smaller . the rf circuit generates an rf signal at 315 mhz and at a power level sufficient for a typical 50 - 100 foot range for locating an object . the digital oscillator can be a unit such as one manufactured under the part number ht12e by holtek corp . in fig6 a , an example of a circuit for the receiver is shown having an antenna circuit including an antenna element ant 1 , a signal passing circuit including transistor q 7 , an analog - to - digital conversion circuit including multivibrators u 2 a and u 2 b , a digital decoder unit dec , an array of dip switches s 1 , and a light emitting diode led . the array of dip switches s 1 has 8 bit positions for setting the unique binary number matched to that coded in the transmitter for detecting of the transmitted signal intended for that receiver . the battery power supply for the receiver can be a 9 v battery with a service life of 2000 hours ( about 3 months ) in stand by mode or may be two button type batteries . the digital decoder can be a unit such as one manufactured under the part number ht12f by holtek corp . in fig6 b , an example of a sound generator circuit for the receiver is shown having a buzzer input buzzer ( from an output of the digital decoder unit , a switch s 2 , a digital sound signal generator unit u 4 , and a piezoelectric sound element u 3 . the switch s 2 is set to select from up to four types of sound output signals . the digital sound signal generator can be a unit such as one manufactured under the part number ts3v555 by motorola corp . alternatively , a sound speaker unit may be used to provide a broader sound range . it will be recognized by those skilled in the art that the locator system of the invention has wide application for use in identifying and locating missing objects , and that numerous modifications are possible in light of the above disclosure . for example , the size , shape and color of the transmitter and receiver units , as well as the size , shape , color and location of the light pipe , may be modified in any number of ways to present a different marketing presentation or to accommodate different engineering specifications . further , other types of signal transmission may be used , such as infrared , sonic and ultrasonic , and any known electronic circuit designs may be used for generating , transmitting and receiving such signals . numerous other modifications and variations are possible within the disclosed principles of the invention . all such modifications and variations are considered to be within the spirit and scope of the invention , as defined in the following claims .	6
an embodiment of a stent delivery system 1 of the present invention will be described . fig1 is a plan view of the stent delivery system 1 of the present embodiment . fig2 is a bottom view of the stent delivery system 1 . fig3 is a cross - sectional view in line a - a of fig1 . fig4 is a cross - sectional view in line b - b of fig3 . fig5 is an explanatory view for illustrating the positional relationship between a first passage and a second passage in the stent delivery system . fig6 is a cross - sectional view showing a state after the release of a stent 2 in the stent delivery system 1 . fig7 is a cross - sectional view showing a state after the release of the stent 2 in the stent delivery system 1 and after the stent 2 comes off a connecting member 7 . in the stent delivery system 1 of the present embodiment shown in fig1 , a tubular stent 2 is arranged at a desired position within a living body . the stent 2 , which can be applied to the stent delivery system 1 of the present embodiment , is formed with a through - hole 2 a that allows the inside and outside of the stent 2 to communicate with each other and couples the stent delivery system 1 and the stent 2 . in the present embodiment , the through - hole 2 a is provided in the vicinity of an end portion of the stent 2 . when the stent 2 is inserted into the stent delivery system 1 , the stent 2 is connected to the stent delivery system 1 with the stent 2 being directed to the stent delivery system 1 so that the side of the stent where the through - hole 2 a is formed gets closer to a distal end of the stent delivery system 1 . additionally , the shape of the stent 2 may have flaps formed at both ends or may be a simple tubular shape with no flap . the material of the stent 2 is not particularly limited . for example , the stent 2 may be made of resin having flexibility . as shown in fig1 , the stent delivery system 1 includes a guide catheter 3 , a push catheter 4 , and a connecting member 7 . the guide catheter 3 is an elongated member that is inserted into the stent 2 and inserted into the living body together with the stent 2 . the guide catheter 3 may be solid or tubular . the guide catheter 3 has flexibility . the push catheter 4 is a tubular member provided in order to push the stent 2 along the guide catheter 3 . the push catheter 4 has an internal diameter such that the guide catheter 3 can be freely advanced and retracted within the push catheter . moreover , a gap that the guide catheter 3 can be advanced and retracted with respect to the push catheter 4 is provided between the guide catheter 3 and the push catheter 4 even in a state where both the guide catheter 3 and the connecting member 7 are disposed within the push catheter 4 . the push catheter 4 is inserted into the living body together with the guide catheter 3 after the guide catheter 3 is inserted into the push catheter . additionally , the push catheter 4 has a first passage 5 formed with a through - hole ( first through - hole ) that allows the inside and the outside of the push catheter 4 to communicate with each other , and a second passage 6 formed with a through - hole ( second through - hole ) that allows the inside and the outside of the push catheter 4 to communicate with each other at a position different from the first passage 5 . the first passage 5 and the second passage 6 are passages into which the connecting member 7 is inserted . additionally , the first passage 5 and the second passage 6 are arranged on a line that is parallel to a central axis o 1 of the push catheter 4 and open , in the external surface of the push catheter 4 . there is a space in between the first passage 5 and the second passage 6 . accordingly , compared to a case where the first passage 5 and the second passage 6 are located in parallel along the circumferential direction of the push catheter 4 , the distance of the first passage 5 and the second passage 6 is easily increased , and it is possible to prevent a situation where , when the connecting member 7 is caught in an endoscope or other devices and an external force acts on the push catheter 4 , the push catheter 4 is completely torn and the connecting member 7 comes off the push catheter 4 . additionally , in the present embodiment , a proximal end of the push catheter 4 and a proximal end of the guide catheter 3 are enabled to be coupled to each other . the push catheter 4 and the guide catheter 3 can be integrally advanced and retracted in a state where the proximal end of the push catheter 4 and the proximal end of the guide catheter 3 are coupled to each other . the connecting member 7 is a member for connecting the stent 2 to the push catheter 4 . the connecting member 7 is a flexible thread having a closed loop shape . in the present embodiment , the thread used as the connecting member 7 has a closed loop shape as both ends thereof are tied together by one knot 8 shown in fig2 . the materials of the thread used as the connecting member 7 are not particularly limited if materials that do not affect the living body are provided . for example , the connecting member 7 may be a thin wire made of resin or metal . additionally , the distances of the first passage 5 and the second passage 6 from a distal end of the push catheter 4 are set to optimal distances in correspondence with the structure of an endoscope to which the stent delivery system 1 is applied . for example , as shown in fig5 , when the stent delivery system 1 is applied to a side view type endoscope 100 , it is preferable that the first passage 5 and the second passage 6 be located closer to proximal end side than forceps raising base 102 in the side view type endoscope 100 , in a state where the distal end of the push catheter 4 is delivered from a distal end of a treatment tool channel 101 of the side view type endoscope . additionally , in a case where there is a step in the inner surface of the treatment tool channel 101 on the distal end side due to a connecting portion x 1 or the like between a rigid portion 103 of a distal end of the endoscope and a channel tube 104 , when the distal end of the push catheter 4 is delivered to a position suitable for the indwelling of the stent 2 , it is preferable that the first passage 5 and the second passage 6 be located closer to the proximal end side than this step ( a portion shown by symbol x 1 in fig5 ). more specifically , when the length from an opening portion of the distal end of the treatment tool channel 101 to a proximal end of the forceps raising base 102 is about 10 mm , and the length from the opening portion of the distal end of the treatment tool channel 101 to a proximal end of the stepped portion ( portion shown by symbol x 1 in fig5 ) of the treatment tool channel 101 is about 20 mm , the first passage 5 and the second passage 6 are provided at a position apart from the distal end of the push catheter 4 by about 55 mm . in this case , even if the distal end of the push catheter 4 is made to protrude by about 20 mm from the opening portion of the treatment tool channel when the stent 2 is arranged , the first passage 5 and the second passage 6 are located closer to the proximal end side than the forceps raising base 102 and the stepped portion ( portion shown by symbol x 1 in fig5 ) of the treatment tool channel 101 . by setting the positions of the first passage 5 and the second passage 6 as described above , the effect of preventing a phenomenon in which the connecting member 7 extending from the inside of the push catheter 4 through the first passage 5 and the second passage 6 to the outside is cut or the knot 8 is untied is exhibited . next , a state where the connecting member 7 is attached to the push catheter 4 will be described in detail with reference to fig3 and 4 . only one thread is inserted through the first passage 5 , and only one thread is inserted through the second passage 6 . accordingly , the thread used as the connecting member 7 is configured so as not to come off the push catheter 4 unless either the thread is cut or the push catheter 4 is torn . the connecting member 7 ( thread ) pulled out of the push catheter 4 from the first passage 5 and the second passage 6 is fixed to an external surface of the push catheter 4 . the thread pulled out from the inside of the push catheter 4 through the first passage 5 to the outside and the thread pulled out from the inside of the push catheter 4 through the second passage 6 to the outside extend in opposite directions along the circumferential direction of the push catheter 4 , in the circumferential direction of the push catheter 4 . in the present embodiment , the knot 8 of the connecting member 7 ( thread ) is disposed on the outside of the push catheter 4 , and the knot 8 is fixed by adhesion . additionally , the knot 8 may be adhered and fixed to the outer peripheral surface of the push catheter 4 . additionally , both the connecting member 7 pulled in from the outside of the push catheter 4 via the first passage 5 to the inside of the push catheter and the connecting member 7 pulled in from the outside of the push catheter 4 via the second passage 6 to the inside of the push catheter are able to extend from the distal end of the push catheter 4 through the inside of the push catheter 4 . the connecting member 7 extended from the distal end of the push catheter 4 has a u shape that is folded back in the vicinity of the distal end of the push catheter 4 . the extending length of the connecting member 7 from the distal end of the push catheter 4 is set according to the shape of the stent 2 . next , a state where the connecting member 7 is attached to the stent 2 and the guide catheter 3 will be described in detail . as shown in fig4 , in the use of the stent delivery system 1 , before the release of the stent 2 , the stent 2 is disposed parallel to the push catheter 4 so as to be capable of coming into contact with the distal end of the push catheter 4 , and the guide catheter 3 is inserted through the inside of the stent 2 and the inside of the push catheter 4 . moreover , before the release of the stent 2 , the connecting member 7 ( thread ) is fixed to the push catheter 4 , both the thread extending from the first passage 5 and the thread extending from the second passage 6 are delivered together with the guide catheter 3 from the distal end of the push catheter 4 , and extends to the inside of the stent 2 through the through - hole 2 a of the stent 2 along an external surface of the stent 2 . the connecting member 7 extending to the inside of the stent 2 has a loop shape surrounding the guide catheter 3 inside the stent 2 . in this state , the stent 2 is locked to the connecting member 7 built between the push catheter 4 and the guide catheter 3 , and the stent 2 is held by the thread so that the stent 2 does not fall off the stent delivery system 1 . as shown in fig4 and 6 , in the use of the stent delivery system 1 , when the stent 2 is released at a desired position within the living body , the guide catheter 3 is moved to the proximal end side after the stent 2 is arranged at the desired position . accordingly , the guide catheter 3 slips out from the connecting member 7 ( thread ) having the loop shape surrounding the guide catheter 3 inside the stent 2 . subsequently , the push catheter 4 and the guide catheter 3 are moved to the proximal end side . then , the connecting member 7 ( thread ) fixed to the push catheter 4 is pulled out of the stent 2 through the through - hole 2 a of the stent 2 . then , the thread comes off the stent 2 . the thread that has come off the stent 2 , as shown in fig7 , is pulled back to the proximal end side together with the push catheter 4 in a state where the thread is supported by an opening end portion in the distal end of the push catheter 4 . at this time , a distal end portion of the thread used as the connecting member 7 is in a state where the distal end portion extends in a distal end direction from the opening end portion of the distal end of the push catheter 4 . in the related art , in a stent delivery system that holds a stent using thread , the thread may be entangled in an endoscope or other devices if the thread , which is brought into a state where the thread is delivered from a distal end of a push catheter after the release of the stent , is long . for example , in the case of the thread having folding within the stent as in patent document 1 , the thread is long compared to the thread that is the connecting member of the present embodiment . thus , the thread becomes easily entangled . additionally , when the push catheter is provided with only one passage for allowing the thread to pass through the push catheter , and a closed loop - shaped thread is hung between the passage and a distal end opening of the push catheter , the thread may be deflected so as to spread in a radial direction of the push catheter after the release of the stent . even in this case , the thread becomes easily entangled . in the present embodiment , the thread is shortened by forming the loop surrounding the guide catheter 3 within the stent 2 , and is brought into a state where the thread is supported by the opening end portion in the distal end of the push catheter 4 after the release of the stent 2 . thus , as compared to the above related - art configuration , a probability that the thread may be entangled in the endoscope and other devices in the process of extracting the push catheter 4 from the endoscope after the release of the stent 2 can be lowered . although the embodiment of the present invention has been described above with reference to the drawings , specific configuration is not limited to the embodiment . additions , omissions , substitutions , and other modifications of components can be made as long as there is no departure from the concept of the present invention . accordingly , the present invention is not considered to be limiting from the foregoing description , and is only limited by the scope of the appended claims . for example , in the above - described embodiment , the stent 2 is provided with the through - hole 2 a for allowing the connecting member 7 to pass therethrough . however , if there is the through - hole that allows the inside and the outside of the stent 2 to communicate with each other irrespective of a purpose , the stent 2 can be suitably indwelled through the connecting member 7 similar to the above embodiment . additionally , the through - hole formed in the stent 2 may be machined so that resistance decreases when the thread is pulled out from the through - hole . additionally , in the above - described embodiment , the passages on the push catheter 4 formed in order to allow the connecting member 7 to pass through are two including the first passage 5 and the second passage 6 . however , only one passage may be provided . in that case , two connecting members can be connected outside the push catheter 4 by pulling out the connecting members through one passage similar to the above - described example . additionally , the thread used as the connecting member 7 may have elasticity . if the thread used as the connecting member 7 has elasticity , the thread delivered from the distal end of the push catheter 4 does not hang down easily , and is held in the loop shape that is directed to the distal end direction of the push catheter 4 . thus , the thread is not further easily entangled . although the preferred embodiments of the present invention have been described above , the present invention is not limited to these embodiments . additions , omissions , substitutions , and other modifications of components can be made without departing to the invention as long as there is no departure from the concept of the invention . the invention is not to be considered as being limited by the foregoing description , and is limited only by the scope of the appended claims .	0
provided here is a cover for a mobile phone or tablet computer that has a telecentric lens . telecentric lenses were discovered more than a century ago , and various patents relating to them have been in existence for decades . ( see for example , u . s . pat . no . 2 , 600 , 805 , which is incorporated herein by reference ). a telecentric lens by definition limits the angular acceptance ( from object plane ) or exitance ( to image plane ) or both ( double telecentric ). the smaller the chief ray acceptance - angle of the lens the better the telecentric performance . this limitation fo chief ray acceptance angle is accomplished by the strateig placement of an aperture stop exactly at one compounded focal distance behind the group of lenses in front of the group of lenses for image plane example . for the double telecentric ase , both front and rear lens groups are placed exactly one focal length ( compounded separately for each of the front and rear group ) from the aperture stop . in general , lenses with acceptance angles of 1 ° or less are considered to be operationally telecentric . the chief ray originating from any point along the object is geometrically limited to be perpendicular to the object plane , which results in an invariant magnification for all object distances ( for object side telecentricity ). the range of practical operational object distance is limited by defocus / blur as the object is moved away from the preferred conjugate position . one type of telecentric lens that is used in the invention is a double telecentric lens , placed over the fixed lens , rendering both the distance from the object to lens ( new - attachment ) and distance from attachment to internal fix lens ( mobile phone camera lens ) insensitive to distance of separation in terms of magnification error . in other words , the magnification of the pupil image projected tot eh sensor would depend neither on the distance of the pupil from the objective lense or the distance of the objective lens to the phone - camera lens . in addition , the use of an intensified array ( e . g ., night vision element ) with front - end telecentric optics where the output screen is reimaged to the camera lens is also contemplated herein . with the above in mind , one embodiment of a cover having a telecentric lens ( from object plane , image plane , or doubly telecentric ) is shown in fig1 - 3 . cover 10 has a rectangular shape that matches the shape of many mobile phones , or it can be adapted to match the shape of a particular mobile phone brand and model so that the housing 20 of the cover 10 mates with the mobile phone by receiving the mobile phone . fig3 shows a mobile phone 90 inserted into the housing 20 in the conventional manner . the housing is flexible enough to flex to allow the mobile phone to be inserted into the housing , while at the same time being rigid and strong enough to protect the mobile phone from minor shocks or jarring . the cover 10 is actually a pupilometry adapter , because it transforms a mobile phone 90 into a pupilometer . the cover 10 includes a telecentric lens 30 . the telecentric lens 30 can be an object plane lens , an image plane lens , or a doubly telecentric lens . the telecentric lens has an ir filter 40 , ir leds 50 , and visible leds 60 . it also includes electronics 70 that enables it to communicate with the phone , such as a electric circuit to power on and off the ir leds 50 and visible leds 60 , as well as the aperture of the lens 30 itself the cover 10 can also have a light meter to measure ambient light . the electronics of the cover can communicate with the phone through a hard wire connection , such as a usb connection or other hardwire connection , or through a wireless connection , such as bluetooth or rfid . the electronics 70 of the cover can include a power source , such as an internal batter , or it can be powered by the phone &# 39 ; s power source . conversely , if it has its own power source , it can be a source of backup power for the phone . the telecentric lens 30 , ir filter 40 , ir leds 50 and visible leds 60 are all on the back side of the housing 20 . the front side of the housing 20 forms a receptacle that receives the mobile phone 90 . the bottom edge of the cover 20 has a communication connector 80 that can be connected to the mobile phone 90 so that the mobile phone 90 and cover 10 are in electrical and digital communication with one another when the connector 80 is connected to the mobile phone 90 . for example , the connector 80 can be a usb connector connecting to the mobile phone device &# 39 ; s usb port . alternatively , the cover 10 can have an rfid tag that communicates with an rfid reader in the mobile phone 90 , or bluetooth technology that allows the cover 10 to communicate wirelessly with the mobile phone 90 . accordingly , the cover 10 communicates with the phone 90 so that the buttons and electronics on the phone can control the aperture and lens of the telecentric lens 30 as well as the activation of the ir leds 50 and visible leds 60 in an alternative embodiment , the lens 30 is not itself a telecentric lens , but when combined with the phone &# 39 ; s built - in camera lens , the lens 30 acts a telecentric lens . in other words , the combination of the lens 30 and the lens of the built - in camera phone acts acts as a telecentric lens , such that the lens 30 is designed to work with the lens of the built - in camera phone to become a telecentric lens . the cover 10 can be associated with a mobile phone pupilometry application that can be downloaded onto the mobile phone for operating the cover 10 . when the phone is inserted into the housing 20 , the application can be automatically launched . the mobile phone application can be designed to modify the operation of the mobile phone &# 39 ; s built - in camera . the telecentric lens 30 of the cover fits over the lens of the built - in camera of the mobile phone . using the pupilometry application , the mobile phone can be used to image a subject &# 39 ; s pupil . the telecentric lens 30 , visible leds 60 and ir leds 50 are controlled using the pupilometry application downloaded onto the mobile phone . the pupilometry application allows the buttons of the phone to be used to image a pupil using the camera &# 39 ; s built - in camera and the telecentric lens 30 of the cover 10 . for example , the built - in camera of the mobile phone can be activated to begin recording the a video of the pupil through the telecentric lens 30 . upon pressing a button on the mobile phone camera or pupilometry application graphical user interface displayed on the mobile phone display , the ir leds 50 are activated for a period of time ( e . g ., between 10 msec and 5 seconds ) followed by a flash of light , or sequence of flashes of light , delivered by the visible leds 60 , while the camera is recording the pupil through the telecentric lens 30 . there can be one , two , three , four or more visible leds 60 , and one , two , three , four or more ir leds 50 . the ir leds 50 illuminate the pupil so that the pupil can be imaged by the built - in camera of the mobile phone . the visible leds 60 are used to provide a flash of white or yellow visible light to stimulate the pupils and cause a pupillary reaction to the flash of light or sequence of flashes of light . the telecentric lens 30 is important to the operation of a pupilometer by a mobile phone or a tablet computer for the following reason . most lenses exhibit varying magnification for objects at different distances from the lens . this causes several problems for a pupilometry application used on a typical built - in camera of a mobile phone : the apparent size of objects changes with distance from the camera ; some features or portions of the pupil may be hidden by objects that are closer to the lens , such as eyelashes or eyelid ; the apparent shape of the pupil varies with distance from the center of the field of view ( fov ); and objects appearing close to the edges are viewed from an angle , while objects near the center of the fov are viewed frontally ( circles near the center of the fov become egg - shaped when moved towards the periphery ). most importantly , without a telecentric lens , a typical built - in camera doesn &# 39 ; t have the ability to control for the size of the pupil no matter what the distance of the camera lens from the pupil . moreover , without a headrest , mobile phones cannot be reliably kept at an exact distance without any movement while the pupil is being recorded . thus , with the typical built - in camera of a mobile phone or tablet computer , the pupillary data is imprecise and corrupted , because the actual size of the pupil is not known and can appear to change with the movement of the phone relative to the subject &# 39 ; s pupil . telecentric lenses , on the other hand , provide an orthographic projection , providing the same magnification at all distances . an object that is too close or too far from the lens may still be out of focus , but the resulting blurry image will be the same size as the correctly - focused image would be . because their images have constant magnification and geometry , telecentric lenses are used for metrology applications , when a machine vision system must determine the precise size of objects independently from their position within the fov and even when their distance is affected by some degree of unknown variations . thus , a telecentric lens fitted over the built - in camera of the phone or tablet computer provides a means for accurately measuring the actual size of the pupil and controlling for that size even as the mobile phone moves relative to the subject &# 39 ; s pupil . while the invention is susceptible to various modifications and alternative forms , specific examples thereof have been shown by way of example in the drawings and are herein described in detail . it should be understood , however , that the invention is not to be limited to the particular forms or methods disclosed , but to the contrary , the invention is to cover all modifications , equivalents , and alternatives falling within the spirit and scope of the appended claims .	7
various embodiments of the present invention relate to a liquid crystal display ( lcd ) that is capable of functioning in multi - mode , a monochrome reflective mode and a color transmissive mode . various modifications to the preferred embodiments and the generic principles and features described herein will be readily apparent to those skilled in the art . thus , the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features described herein . fig1 is a schematic of a cross section of a pixel 100 of a lcd . pixel 100 comprises a liquid crystal material 104 , a pixel electrode 106 , a common electrode 108 , a reflective part 110 , a transmissive part 112 , substrates 114 and 116 , spacers 118 a and 118 b , a first polarizer 120 , and a second polarizer 122 . in an embodiment , a light source 102 or an ambient light 124 illuminates pixel 100 . examples of light source 102 include , but are not limited to , light emitting diodes backlights ( leds ), cold - cathode fluorescent lamps backlights ( ccfls ), and the like . ambient light 124 can be sunlight or any external source of light . in an embodiment , liquid crystal material 104 , which is an optically active material , rotates the axis of the polarization of the light from light source 102 or ambient light 124 . liquid crystal 104 can be a twisted nematic ( tn ), an electrically controlled birefringence ( ecb ) and the like . in an embodiment , the rotation of the plane of the light is determined by the potential difference applied between pixel electrode 106 , and common electrode 108 . in an embodiment , pixel electrode 106 and common electrode 108 can be made of indium tin oxide ( ito ). further , each pixel is provided with a pixel electrode 106 , while common electrode 108 is common to all the pixels present in the lcd . in an embodiment , reflective part 110 is electrically conductive and reflects ambient light 124 to illuminate pixel 100 . reflective part 110 is made of metal and is electrically coupled to pixel electrode 106 thereby providing the potential difference between reflective part 110 and common electrode 108 . transmissive part 112 transmits light from light source 102 to illuminate pixel 100 . substrates 114 and 116 enclose liquid crystal material 104 , pixel electrode 106 and common electrode 108 . in an embodiment , pixel electrode 106 is located at substrate 114 , and common electrode 108 is located at substrate 116 . additionally , substrate 114 comprises switching elements ( not shown in fig1 ). in an embodiment , the switching elements can be thin film transistors ( tfts ). further , a driver circuit 130 sends signals related to pixel values to the switching elements . in an embodiment , driver circuit 130 uses low voltage differential signaling ( lvds ) drivers . in another embodiment , a transistor - transistor logic ( ttl ) interface that senses both increase and decrease in voltages is used in driver circuit 130 . additionally , a timing controller 140 encodes the signals related to pixel values into the signals needed by the diagonal transmissive parts of the pixels . furthermore , timing controller 140 has a memory to allow self - refresh of the lcd when the signals related to the pixels are removed from timing controller 140 . in an embodiment , spacers 118 a and 118 b are placed over reflective part 110 to maintain a uniform distance between substrates 114 and 116 . additionally , pixel 100 comprises first polarizer 120 and second polarizer 122 . in an embodiment , the axes of polarity of first polarizer 120 and second polarizer 122 are perpendicular to each other . in another embodiment , the axes of polarity of first polarizer 120 and second polarizer 122 are parallel to each other . pixel 100 is illuminated by light source 102 or ambient light 124 . the intensity of light passing through pixel 100 is determined by the potential difference between pixel electrode 106 , and common electrode 108 . in an embodiment , liquid crystal material 104 is in a disoriented state and the light passing through first polarizer 120 is blocked by second polarizer 122 when no potential difference is applied between pixel electrode 106 , and common electrode 108 . liquid crystal material 104 is oriented when the potential difference is applied between pixel electrode 106 , and common electrode 108 . the orientation of liquid crystal material 104 allows the light to pass through second polarizer 122 . fig2 illustrates the arrangement of nine pixels 100 of the lcd , in accordance with an embodiment of the present invention . pixel 100 comprises transmissive part 112 b and reflective part 110 . in an embodiment , transmissive parts 112 a - c impart green , blue and red color components respectively to form a color pixel , if the ( red - blue - green ) rbg color system is followed . additionally , transmissive parts 112 a - c can impart different colors such as red , green , blue and white or other color combinations , if other color systems are chosen . furthermore , transmissive part 113 a and 114 a impart green color , transmissive part 113 b and 114 b impart blue color , and transmissive part 113 a and 114 c impart red color to the color pixel . additionally , color filters of different thicknesses can be placed over transmissive parts 112 a - c to decrease or increase the saturation of the color imparted to the color pixel . saturation is defined as intensity of a specific gradation of color within the visible spectrum . further , a colorless filter 202 d can be placed over reflective part 110 . in various embodiments , the thickness of colorless filter 202 d can vary from zero to the thickness of other color filters placed over transmissive parts 112 a - c . in an embodiment , transmissive parts 112 a represent a diagonal strip of one of the three colors of the color pixel . similarly , transmissive parts 112 b and 112 c represent a diagonal strip of other two colors of the color pixel . the diagonal strips are used so that the resolution in the color transmissive mode can be close to the resolution in the monochrome ( black and white ) reflective mode . the resolution in color transmissive mode is high because the human visual system can detect horizontal and vertical lines while visualizing images . in another embodiment , vertical stripes of color can be used that change the resolution more in the horizontal direction and less in the vertical direction when compared to the use of diagonal stripes . the amount of light from light source 102 transmitting through each of the transmissive parts 112 a - c is determined by the switching elements ( not shown in fig2 ). the amount of light transmitting through each transmissive parts 112 a - c , in turn , determines the color of the color pixel . further , the shape of transmissive parts 112 a - c and the color filters can be hexagonal , rectangular , octagonal , circular or so forth . additionally , the shape of reflective part 110 can be rectangular , circular , octagonal , and the like . further , reflective part 110 blocks light delivered to diagonal stripes from transmitting to pixels of different colors , for example reflective part 110 blocks light along transmissive parts 112 c and 113 c from entering to transmissive parts 112 b or 112 a . alternatively , a black matrix mask 203 , a covering between pixels and light sensitive areas of pixels , can be used . in an embodiment , black matrix mask 203 is eliminated to improve the reflectivity of the pixels . fig3 illustrates the functioning of pixel 100 in the monochrome reflective mode . since the monochrome reflective embodiment is explained with reference to fig3 , only reflective part 110 is shown in the figure . pixel 100 can be used in the monochrome reflective mode in the presence of an external source of light . in an embodiment , ambient light 124 passes through colorless filter 202 d , and liquid crystal material 104 and is incident on reflective part 110 . colorless filter 202 d is used to maintain the attenuation and the path difference of ambient light 124 the same as the attenuation and the path difference of the light in the color transmissive mode . the colorless color filter 202 d can also be omitted by modifying the design . reflective part 110 of pixel 100 reflects ambient light 124 to substrate 116 . in an embodiment , a potential difference ( v ) is applied to pixel electrode 106 , which is electronically coupled to the reflective part 110 and common electrode 108 . liquid crystal material 104 is oriented , depending on the potential difference ( v ). consequently , the orientation of liquid crystal material 104 rotates the plane of ambient light 124 , allowing the light to pass through second polarizer 122 . the degree of orientation of liquid crystal material 104 therefore determines the brightness of pixel 100 and consequently , the luminance of pixel 100 . in an embodiment , a normally white liquid crystal embodiment can be employed in pixel 100 . in this embodiment , axes of first polarizer 120 and second polarizer 122 are parallel to each other . the maximum threshold voltage is applied across pixel electrode 106 , and common electrode 108 to block the light reflected by reflective part 110 . pixel 100 therefore appears black . alternatively , a normally black liquid crystal embodiment can be used . in this embodiment , axes of first polarizer 120 and second polarizer 122 are perpendicular to each other . the maximum threshold voltage is applied across pixel electrode 106 , and common electrode 108 to illuminate pixel 100 . fig4 illustrates the functioning of the lcd in the color transmissive mode by using a partial color filtered approach . since the color transmissive embodiment is being explained , only transmissive parts of the pixel : 112 a - c are shown in fig4 . on substrate 116 , color filters 404 a , 404 b and 404 c are respectively placed in transmissive pixel parts 112 a , 112 b and 112 c , as shown in fig4 . pixel parts 112 a , 112 b and 112 c refer to the pixel optical value . part 112 a has optical contributions from part 102 , 402 , 120 , 114 , 106 a , 104 , 404 a 108 , 116 and 122 . part 112 b has optical contributions from part 102 , 402 , 120 , 114 , 106 b , 104 , 404 b , 108 , 116 , and 122 . part 112 c has optical contributions from part 102 , 402 . 120 , 114 , 106 c , 104 , 404 c , 108 , 116 , and 122 . color filters 404 a , 404 b , and 404 c are also spread partially over the reflective area of the pixel . in various embodiments , the color filters cover any amount that is less than half the reflective area of the pixel ( e . g ., 1 % to 50 % of the area ) and in one particular embodiment the color filters cover about 14 % to 18 % of the area . light source 102 is a standard backlight source . light 402 from light source 102 can be collimated by using a collimating light guide or lens . in an embodiment , light 402 , coming from light source 102 , is passed through first polarizer 120 . this aligns the plane of light 402 in a particular plane . in an embodiment , the plane of light 402 is aligned in the horizontal direction . additionally , second polarizer 122 has an axis of polarization in the vertical direction . transmissive parts 112 a - c transmit light 402 . in an embodiment , each of transmissive parts 112 a - c has an individual switching element . the switching element controls the intensity of light 402 passing through the corresponding transmissive part . further , light 402 , after transmitting through transmissive parts 112 a - c , passes through liquid crystal material 104 . transmissive parts 112 a , 112 b , and 112 c are provided with pixel electrodes 106 a - c respectively . the potential differences applied between pixel electrode 106 a - c , and common electrode 108 determine the orientation of liquid crystal material 104 . the orientation of liquid crystal material 104 , in turn , determines the intensity of light 402 incident on each color filter 404 a - c . in an embodiment , a green color filter 404 a is placed mostly or completely over transmissive part 112 a and partially the reflective portion 110 ( shown in fig2 and 3 ), a blue color filter 404 b is placed mostly or completely over transmissive part 112 b and partially over the reflective portion 110 ( shown in fig2 and 3 ) and a red color filter 404 c is placed mostly or completely over transmissive part 112 c and partially over the reflective part 110 ( shown in fig2 and 3 ). each of color filters 404 a - c imparts the corresponding color to the color pixel . the colors imparted by color filters 404 a - c determine the chrominance value of the color pixel . chrominance contains the color information such as hue and saturation for a pixel . further , if there is ambient light 124 , the light reflected by reflective part 110 ( shown in fig2 and 3 ) provides luminance to the color pixel and imparts a monochrome adjustment to the white reflectance of the pixel which can compensate for the greenish look of the lc mode . this luminance therefore increases the resolution in the color transmissive mode . luminance is a measure of the brightness of a pixel . fig5 illustrates the functioning of the lcd in the color transmissive mode by using a hybrid field sequential approach , in accordance with various embodiments . since the color transmissive embodiment is being explained , only transmissive parts 112 a - c are shown in fig5 . in an embodiment , light source 102 comprises strips of leds such as led group 1 , led group 2 and so on ( not shown ). in an embodiment , the leds that are arranged horizontally are grouped together , one led group below the other , to illuminate the lcd . alternatively , the leds that are arranged vertically can be grouped . the leds groups are illuminated in a sequential manner . the frequency of illumination of an led group can be between 30 frames to 540 frames per second . in an embodiment , each led group comprises red leds 506 a , white leds 506 b and blue leds 506 c . further , red leds 506 a and white leds 506 b of led group 1 are on from time t = 0 to t = 5 and red leds 506 a and white leds 506 b of led group 2 are on from time t = 1 to t = 6 . similarly , all the red and white leds of other led groups function in a sequential manner . in an embodiment , each led group illuminates a horizontal row of pixels of the lcd , in case the led groups are arranged vertically . similarly blue leds 506 c and white leds 506 b of led group 1 are on from time t = 5 to t = 10 , and blue leds 506 c and white leds 506 b of led group 2 are on from time t = 6 to t = 11 . similarly , all the blue and white leds of other led groups are on in a sequential manner . red leds 506 a , white leds 506 b and blue leds 506 b are arranged so that red leds 506 a and blue leds 506 b illuminate transmissive parts 112 a and 112 c and white leds 506 b illuminate transmissive part 112 b . in another embodiment , the led groups may comprise red , green and blue leds . red , green and blue leds are so arranged that green leds illuminate transmissive part 112 b and red and blue leds illuminate transmissive parts 112 a and 112 c , respectively . in an embodiment , light 502 from light source 102 is passed through first polarizer 120 . first polarizer 120 aligns the plane of light 502 in a particular plane . in an embodiment , the plane of light 502 is aligned in a horizontal direction . additionally , second polarizer 122 has the axis of polarization in the vertical direction . transmissive parts 112 a - c transmit light 502 . in an embodiment , each of transmissive parts 112 a - c has an individual switching element . further , switching elements control the intensity of light passing through each of transmissive parts 112 a - c , thereby controlling the intensity of the color component . further , light 502 , after passing through transmissive parts 112 a - c , passes through liquid crystal material 104 . each of transmissive parts 112 a - c has its own pixel electrode 106 a - c respectively . the potential differences applied between pixel electrodes 106 a - c , and common electrode 108 determines the orientation of liquid crystal material 104 . in the embodiment in which red , white , and blue leds are used , the orientation of liquid crystal material 104 , in turn , determines the intensity of light 502 incident on a green color filter 504 , and transparent spacers 508 a and 508 b . the intensity of light 502 passing though green filter 504 , and transparent spacers 508 a and 508 b determines the chrominance value of the color pixel . in an embodiment , green color filter 504 , is placed corresponding to transmissive part 112 b . transmissive part 112 a and 112 c do not have a color filter . alternatively , transmissive parts 112 a and 112 c can use transparent spacers 508 a and 508 b respectively . green color filter 504 , transparent spacers 508 a and 508 b are located on substrate 116 . in another embodiment , magenta color filters can be placed over transparent spacers 508 a and 508 b . in an embodiment , during time t = 0 to t = 5 , when red led 506 a and white led 506 b are on , transmissive parts 112 a and 112 c are red and green filter 504 imparts a green color to transmissive part 112 b . similarly , during time t = 6 to t = 11 , when blue led 506 c and white leds 506 b are on , transmissive parts 112 a and 112 c are blue , and green filter 504 imparts a green color to transmissive part 112 b . the color imparted to the color pixel is formed by the combination of colors from transmissive parts 112 a - c . further , if ambient light 124 is available , the light reflected by reflective part 110 ( shown in fig2 and 3 ) provides luminance to the color pixel . this luminance therefore increases the resolution in the color transmissive mode . fig6 illustrates the functioning of the lcd in the color transmissive mode by using a diffractive approach . since the color transmissive embodiment is being explained , only transmissive parts 112 a - c are shown in fig6 . light source 102 can be a standard backlight source . in an embodiment , light 602 from light source 102 is split into a green component 602 a , a blue component 602 b and a red component 602 c by using a diffraction grating 604 . alternatively , light 602 can be split into a spectrum of colors with a different part of the spectrum going through each of transmissive parts 112 a - c using a micro - optical structure . in an embodiment , the micro - optical structure is a flat film optical structure with small lensets that can be stamped or imparted into the film . green component 602 a , blue component 602 b and red component 602 c are directed to transmissive parts 112 a , 112 b and 112 c , respectively , using diffraction grating 604 . further , the components of light 602 are passed through first polarizer 120 . this aligns the plane of light components 602 a - c in a particular plane . in an embodiment , the plane of light components 602 a - c is aligned in the horizontal direction . additionally , second polarizer 122 has its axis of polarization in the vertical direction . transmissive parts 112 a - c allow light components 602 a - c to be transmitted through them . in an embodiment , each of transmissive parts 112 a - c has an individual switching element . switching elements control the intensity of light passing through each of transmissive parts 112 a - c , thereby controlling the intensity of the color component . further , light components 602 a - c , after passing through transmissive parts 112 a - c , passes through liquid crystal material 104 . transmissive parts 112 a , 112 b and 112 c respectively have pixel electrodes 106 a , 106 b and 106 c . the potential differences applied between pixel electrodes 106 a - c , and common electrode 108 determines the orientation of liquid crystal material 104 . the orientation of liquid crystal material 104 , in turn , determines the intensity of light components 602 a - c passing through second polarizer 122 . the intensity of color components passing through second polarizer 122 in turn decides the chrominance of the color pixel . further , if ambient light is available , the light reflected by reflective part 110 ( shown in fig2 and 3 ) provides luminance to the color pixel . this luminance therefore increases the resolution in the color transmissive mode . as presented herein , transmissive part of the pixel is arranged diagonally rather than vertically or horizontally , as in the case of prior known lcds . the diagonal arrangement of the transmissive part increases the resolution , as compared to prior known lcds and therefore provides a better display . additionally , the presence of ambient light enhances the luminance of the color pixel in the color transmissive mode . therefore , each pixel has both luminance and chrominance . this increases the resolution of the lcd . consequently , the number of pixels required for a particular resolution is lower than in prior known lcds , thereby decreasing the power consumption of the lcd . further , a transistor - transistor logic ( ttl ) based interface can be used that lowers the power consumption of the lcd as compared to the power consumed by the interfaces used in prior known lcds . additionally , because the timing controller stores the signals related to pixel values , the lcd is optimized for using the self refresh property , thereby decreasing the power consumption . in various embodiments , thinner color filters which transmit less saturated color and more light can be used . hence , various embodiments facilitate the process of reducing the power consumption , as compared to prior known lcds . further , in an embodiment ( described in fig5 ), green or white color light is always visible on pixel 100 , and only the red and blue color lights are switched . therefore , a lower frame rate is required as compared to the frame rate of prior known field sequential displays . while the preferred embodiments of the invention have been illustrated and described , it will be clear that the invention is not limited to these embodiments only . numerous modifications , changes , variations , substitutions and equivalents will be apparent to those skilled in the art without departing from the spirit and scope of the invention , as described in the claims .	6
the conventional method of cutting a window in a well casing is to affix to the inner wall of a cemented casing a wedge - shaped whipstock made of hard metal , so as to force the milling bit , mounted at the end of a long tubular shaft ( typically a drill string ) and inserted inside the casing , to press against the inner wall surface of the casing and to cut the casing until the milling tool exits out of the casing . this operation is difficult to control in a well and even in a shop , because of vibrations , and the milling tool quickly wears out due to its friction against the hard whipstock surface . furthermore , the partially - windowed casing tends to swell out under the residual tensile stresses within the casing wall and the outwards force applied on the milling bit . any movable branch - well connectors , equipped with seals at their upper end , might get stuck during their extension through a deformed window and their seals might be damaged or made ineffective . unless large compressive restraining farces are permanently applied on the outer surface of the casing outside the area of the window , to maintain constant the tube diameter during and after the machining operation , the window &# 39 ; s shape will not meet this narrow specifications required for making a tight seal between the window &# 39 ; s edge and any slanted movable connector tube ( intermediate liner element or liner stub , as called in the referenced patent ). in fixed branch - well connectors of the referenced u . s . pat . no . 5 , 462 , 120 , curved channels or multi - channel whipstocks are internals which remain permanently within the casing element . they are welded at their lower end to the completed window &# 39 ; s edge , while their upper end , equipped with a thick welded plate , may slide within the casing element . each such curved channel or multi - channel whipstock , permanently installed within the casing element prior to the removal of the corset , thus acts as a stiffener providing permanent re - inforcement to the windowed casing during its handling by the drilling rig and during its installation in the well . the quality of the sealing weld between the lower end of a curved channel or multi - channel whipstock and the window &# 39 ; s edge is also greatly enhanced by accurate machining and positioning of at least one of the surfaces which are ultimately welded together in branch - well fixed connectors of the referenced patent . in accord with the present invention , cutting of an accurate and consistent window , or of a template thereof , is always done in a shop before the casing tubular element is placed in a well , either as a special casing joint , or as a casing patch , or as a casing insert . the cutting of the window is carefully checked to assure that alignment is accurate . when the window has been cut , pre - fabricated internal assemblies are accurately positioned within the windowed casing element and the connector assemblies and guides are securely fastened in place . they provide re - inforcement of the windowed tubular casing element , as permanent or temporary stiffeners , until said element is fully installed in a well . in movable branch - well connectors , the retrievable whipstock used for guiding the intermediate liner element through the milled - out window , or the guiding assembly with its liner stub in the retracted position , temporarily provide the same stiffener re - inforcing function until the slanted movable connector tube is extended out of the window , sealed in the casing and cemented in the formation existing cemented cased wells may be of diameter too small to allow the use of a pre - assembled casing insert or casing patch , including all its internals , but large enough for a fixed branch - well connector . a method of pre - fabricating such curved channel or multi - channel whipstock assemblies is described , together with its time - saving field installation method . said fixed branch - well connector later provides structural re - inforcement of the windowed casing , independent of the cement quality . in a first embodiment ( fig1 and fig1 a ), the said compressive forces are applied by a rigid steel corset 1 placed around the casing 2 , prior to the start of the window - cutting operation . the tubular corset presents a window 3 of dimensions slightly larger than those of the required casing window and adjustable contact devices 4 for transmitting the restraining forces from the corset to the outer surface of the casing element placed within it . excessive restraining forces are prevented by checking the drift diameter of the casing element with a known caliper tool . the wedge surface 5 of a whipstock in the casing and the window in the corset outside it must be located so as to face each other . this is accomplished by placing on both the whipstock 5 and corset 1 a suitable orientation device or bubble level 6 . for instance , with the casing element horizontally supported , the bubble - type level indicator 6 affixed to the whipstock may be used to determine that the wedge face is in a reference plane ( vertical or horizontal ) and a similar level indicator 7 affixed to the corset is used to determine that its window is in a parallel reference plane . the axial distances from one of the casing ends respectively to the whipstock and to the corset window are also measured by known methods to insure that both are in the required positions for window machining . the restraining force devices are then firmly applied to the casing &# 39 ; s outer surface . template holes 8 in the corset are then used to drill holes through the casing wall and to tap into the lateral surface of the whipstock , so that the corset and the whipstock may be solidly bolted together through the casing wall . the shop milling tool 12 , mounted on its long tubular shaft is inserted into the casing element and gradually pushed against the whipstock wedge while the milling bit is rotated . cooling of the milling bit is by a circulation of fluid through the shaft and return via the casing - shaft annulus . additional coolant may also be added on the outer surface of the casing through the corset window , if necessary . when the window has been cut in the casing element , the bolts affixing the corset to the whipstock through the un - tapped casing wall holes are removed , one by one and immediately replaced by screws 59 ( fig3 a ) made of drillable metal , which solidly fasten the casing wall to the lateral surface of the whipstock , but leave the corset disconnected from the casing wall . besides its normally known function of guide for the shop milling tool , during the window - cutting operation , the whipstock assembly also provides the function of re - inforcement , as a stiffener of the windowed casing , which is the main focus of the present invention , but it must also provide other functions required during the subsequent installation of the casing element and of its slanted tubular connector in a well . the whipstock also provides a channel to be used as by - pass flow path for a cement slurry later injected in the part of the casing string located below the window to reach the casing shoe . finally , the whipstock is used to guide and seal the slanted movable connector tube ( intermediate liner ) through the window and then to guide drill strings and branch well tubulars through the connector tube during the drilling and completion phases of the lateral well . the whipstock , as prescribed in u . s . pat . no . 5 , 462 , 120 , for such additional guiding functions downhole , is thus equipped with an orientation groove 9 in the middle of its wedge surface . the whipstock may be made of one piece of metal , of smaller diameter than the casing element inside diameter , with a machined or cast central groove , as in fig1 a . if so , it is preferably designed to be retrievable with a wash - over cutting tool , as indicated in the referenced patent . if , however , the hard wedge surface of a full - bore whipstock is limited to that of the wall of a thick tube 10 , as in fig1 for a permanent whipstock , the inner part of the whipstock is filled with an inner core 11 , made of drillable material , in which the specified central orientation groove 9 , or a guiding strip , has been machined or molded . its wedge surface , 5a , matches that of the tubular whipstock and its lateral surface is fastened or bonded to the inner surface of the tubular whipstock or connected to it through a known pin and groove rotation - preventer system . it will be apparent to those skilled in the art that , if the anti - rotation groove 58 is located in the inner surface of the tubular whipstock 10 , the matching pin 57 will be located on the outer surface of the inner core whipstock 11 . conversely , if the anti - rotation groove 58 is located in the core whipstock 11 , the matching pin 57 will be affixed to the inner surface of the tubular whipstock 10 . in that case , it will be made of drillable material , to be drilled out at the same time as the core whipstock . similarly , larger additional grooves 56 in the lateral surface of the inner core 11 , or a tubular channel in the interior of said core , may provide flow paths to the cement slurry through the whipstock assembly to a casing cementing shoe , below , if the core whipstock is installed within the tubular whipstock prior to , rather than after the casing cementation . all those various options , and their combinations are included the present invention . the intermediate liner element , 43 , shown in fig2 must easily be insertable through the window 3 , with sufficient clearance for its specified sealing element . if not , minor grinding adjustments are made along the window &# 39 ; s edge to achieve proper clearances . the upper end of the intermediate liner element is traced along the edge of the window . an &# 34 ; o &# 34 ; ring groove 13 is then machined on the outer surface 14 of the intermediate liner element at a short distance from its traced upper end . the milling tool used for this task is guided respectively by the edge of the corset window , by the casing outer surface and by its rotation around the axis of the intermediate liner element . this cutting tool is shown on fig4 . its axis is parallel to the axis of the intermediate liner element . a similar tool , equipped with a different milling bit is later used to cut the upper end - face of the intermediate liner element , along its trace . a guiding collar 15 made of drillable metal is fastened to the upper end of the intermediate liner and an elastomeric &# 34 ; o &# 34 ; ring type seal is placed around the upper end the steel liner , in the outer surface groove behind the drillable guiding collar . the lower part of the drillable guiding collar , which will slide into the whipstock groove , presents a guide pin , extrusion or indentation 16 of shape matching that of the profile of the whipstock groove or strip 9 . the lower end of the intermediate liner element is plugged - off with drillable material 17 . the corset is then removed , for re - use in the fabrication of additional windowed casing elements of same diameter and same kick - off angle . a drillable cover plate 30 is affixed to the window &# 39 ; s edge using drillable fasteners . the cover plate presents transversal parallel tie ribs 55 , which materialize the dual curvature , in space , of the window &# 39 ; s edge . in large - diameter casings , where fixed multi - channel whipstocks may be used as branch - well connectors , as taught in fig1 of the referenced patent , instead of the movable intermediate liner , 43 , the whipstock is permanently affixed inside the casing element , while the casing is held in the corset 1 . in that case , a window is cut by the shop milling tool opposite the bottom end of each channel in the multi - channel window , by the method of the first embodiment . the greatly weakened multi - windowed casing is then re - inforced by welding directly the bottom end of each channel in the whipstock to its corresponding window in the casing element , along their respective edges , using known welding methods , prior to the removal of the corset . the multi - channel whipstock also provides an additional vertical by - pass flow path to convey a cement slurry to the casing space below the lowest window . as in the first embodiment , a drillable plate 30 is then affixed to the edge of each window , without damaging the welds and each channel is plugged off with drillable material . the drillable cover plate is stiffened by transverse tie ribs 55 , which may be cast in place on the plate or separately machined and affixed to the bent plate covering and sealing surface . it will be apparent to those skilled in the art that the method of the first embodiment , combined with known welding techniques , is directly applicable to the shop fabrication of casing elements including fixed multi - channel whipstocks , which , in this case , are permanently installed and do not require drillable fasteners . in a second embodiment ( fig3 ), the windowed tubular corset 1 is equipped with rail guides 18 on a rigid steel &# 34 ; a &# 34 ; frame 19 , at the specified kick - off angle , corresponding to the window &# 39 ; s dimensions . the function of the rails is the same as that of the internal whipstock wedge surface in the fig1 embodiment , but , being located outside of the casing elememt they provide more direct control of the machining operation . for this purpose , the corset is affixed only to the casing wall by means of double - ended bolts ( fig3 a ) which have one end threaded into the casing wall and the other end inserted in the corset hole 8 and bolted against the outer surface of the corset 1 . these bolts , required only during the window - cutting operation , are later replaced , one by one , by drillable screws threaded , both through the casing wall and into the outer lateral surface of a retrievable whipstock assembly , used again in part for its important function of re - inforcement and stiffening of the windowed casing element , prior to its cementation into a well . the shop milling tool 12 , which no longer requires a long shaft , is guided by the rails 18 rather than by a whipstock . it starts cutting the window from the end of the window &# 39 ; s long axis opposite from that shown on the fig1 embodiment . it also advances inwards into the casing element rather than outwards . this new disposition improves the window machining accuracy and reduces wear of the milling bit , while providing a better control of the bit advance , lubrication and cooling . it also allows the use of a wider variety of cutting tools , both mechanical and thermal ( oxygen plasma , laser and electron beam ), which otherwise , could not be guided from the inside of the casing , by a whipstock . it will be apparent to those skilled in the art that these various cutting tools may be used in multi - pass and / or in combination to obtain an accurate , undistorted window &# 39 ; s edge , which may also be precisely beveled or grooved , despite its great length and narrow width . the whipstock assembly &# 39 ; s other functions , after the tubular element has been lowered into a well , are then only limited to : 1 ) conveying the cement slurry to the casing space below the window , via a by - pass fluid flow channel , 2 ) guiding the drill bit which will simultaneously cut into the drillable cover plate of the window and drill the lateral drainhole , 3 ) orienting , by means of the whipstock &# 39 ; s central groove , the guiding collar at the intermediate liner upper end , these tasks are less demanding than those of cutting a window the steel casing , so that the whipstock may be made , in part or in whole , of drillable material . to satisfy task no . 1 , the cement slurry may be conveyed either through a channel within the whipstock or through channels between it periphery and the inner wall of the casing element . to satisfy task no . 3 , a central groove 9 or strip is required in the whipstock for orienting the guiding collar during its extension through the window . for instance , the outer cylindrical surface of the re - inforcing whipstock assembly may be made of a drillable metal tube , with a co - axial hard metal whipstock fastened inside it . when the inner whipstock is of the tubular kind , it may then be removed from the well by drilling out the outer tube with a known coring bit after cementation of the casing element . this restores the casing element to its full inside bore diameter . if the drainhole is drilled in hard formations , however , the use of a hanger - supported solid whipstock of reduced diameter , made of a hard core , but retrievable with an overshot cutting tool , as describe in the referenced patent , may be more advantageous . in that case , the cement slurry may be conveyed through the annulus between the inner surface of the casing and the lateral surface of the reduced diameter solid whipstock . the temporary re - inforcing function of the whipstock is achieved by the drillable screws 59 fastening the whipstock to the casing wall , which are subsequently cut in the well by the overshot cutting tool . another alternative whipstock for that case is a full - diameter whipstock , affixed to the casing element by means of drillable fasteners and composed of a drillable outer tubular shell re - inforcing internal , affixed to an oriented retrievable central hard core . the cost of the whipstock support , a conventional oriented drillable hanger / packer , may thus be eliminated . these various types of whipstocks , performing the same multiple functions , are variants of the present invention , the second method of window - cutting thus allows the use of any type of whipstock , solid or tubular , in one or two pieces , permanent or retrievable . it is the preferred embodiment . in a third embodiment , the fabrication of casing elements equipped with telescopically - extensible liner stubs , the window machining operation is the same as that in the second ( fig3 ) embodiment . the same type of corset 1 , equipped with parallel rail surfaces 18 on a rigid &# 34 ; a &# 34 ; frame 19 , is used . no whipstock , however , is used in this device . it is replaced , as a windowed casing re - inforcement , by a pre - fabricated telescopic stub internal stiffener assembly . a pre - fabricated insert drillable guiding assembly containing all the elements specified in the referenced patent is separately assembled from pre - fabricated parts , ( fig5 ) including : 1 ) a solid cylindrical rod 20 of drillable material of diameter equal to the drift diameter of the casing element , in which five or more cavities 21 have been machined or cast . this part is an assembly designed to present sufficient stiffness and structural strength to transfer to the windowed casing element all the restraining forces previously applied by the outside corset 1 . the cylindrical rod assembly is made of two halves , solidly affixed together by drillable fastening means , across the transverse diametrical plane of its main cavity , slanted at the kick - off angle , as shown in fig5 and fig5 a . 2 ) a steel liner stub 22 equipped with a drillable guiding collar 15 and seal 23 at its upper end , but in which the lower end is left unplugged , located within the main cavity 21 of the rod , in the shape of a cylinder of diameter slightly larger than the short axis of the liner stub collar and slanted at the specified kick - off angle from the rod axis ; ( its pre - fabrication is made by the same methods and tools than that of intermediate liner elements , except that its lower end is also cut parallel to its upper end , as shown on fig5 ) 3 ) a combination of two drillable co - axial guide cages 24 , respectively sliding within the rod assembly ( fig6 ) and internally within the liner stub 22 to support it during its extension out of the casing . a transverse section of the double cage 24 is shown on fig6 a . the inner cage 25 has a cross - shaped beam section providing maximum stiffness to support the effective weight of the liner stub during its extension . the cavities in the fixed drillable rod sub - assembly , besides the main slanted cylindrical cavity 21 , include : a ) slanted cavities 26 parallel to the axis of the main cavity 21 , in the shape of lateral grooves machined or cast in the cylindrical rod , in two or more radial planes of the main cavity , in which the short bars of the outer guiding cage 24 will slide , b ) a vertical by - pass channel 27 in the rod , with a horizontal cross section in the shape of a portion of a circle of diameter equal to the inside diameter of the casing element , c ) a central cylindrical blind cavity 28 on the top surface of the upper half of the rod assembly , equipped with one or more lateral grooves matching the dogs of a known fishing tool . after the installation and cementing of the telescopic liner stub in a well , the drillable rod sub - assembly will be drilled - out in two stages , first with an overshot cutting tool of length sufficient for its cutting edge to reach slightly below the center of the casing window cutout . in this cutting operation , all the upper fasteners on the upper half of the lateral surface of the rod sub - assembly are milled out and all the fastening means connecting the two halves of the rod are also removed . this allows the easy removal of the upper half of the rod and of the guiding double cage attached to it , by inserting a fishing tool into the top cavity of the rod , thus fastening it to the wash - over tool or to its work string . pulling out the tool &# 39 ; s work string removes the upper half of the rod sub - assembly and both guide cages to clear the window &# 39 ; s opening , thus leaving only the lower half of the rod to later serve as a drillable wedge for guiding the drill string and liner string into the extended liner stub . the remaining lower part of the rod will only be drilled - out after the installation of all permanent tubulars in the lateral well . during this second drilling operation , any protrusion within the casing is also removed . the resulting full - bore casing element then allows the installation of additional laterals below the first one , at a later date , if required . returning to the method of pre - fabrication , in the shop , of a sealed branch connector of the type including a telescopic stub , the operations proceed as follows : when the casing window cutout 3 has been machined , adjusted and tested for conformance with specified dimensions , the prefabricated guiding assembly , including the rod assembly , with its twin guiding grooves and cavities , plus the sliding double cage guide and liner stub , is inserted into the casing element . the unplugged lower end of the liner stub 22 is lined - up against the casing window and pulled out through it to check that the liner stub is effectively free to extend out of the casing . the liner stub is then thrust back into the casing element and fastened to the guide cage 25 by means of calibrated shearable fasteners 29 , installed through the open bottom end of the stub . transverse tie ribs , made of drillable metal , are affixed by drillable fasteners to the edges of the stub &# 39 ; s lower end . a drillable end plug 30 is then fitted into the lower end of the stub and affixed to the tie ribs by drillable fastening means . the double - ended bolts of the corset are then removed and replaced , one by one , by drillable screws 59 tapped into the lateral surface of the rod assembly , thus transferring the restraining forces from the corset to the rod , which is substitued , for this purpose , to the whipstock used in the second embodiment . this is the last step of fabrication of a casing element with a single telescopic stub . if the length of the casing element is sufficient to accept two stubs and if their relative orientation is known , a second window is machined in the casing by the same method , in the area not filled by the previous guiding assembly . a second guiding assembly is assembled from additional prefabricated parts . it is then inserted into the casing element , tested and installed in the same way as the first one . this completes the fabrication of casing elements of the type shown on fig4 of the referenced patent . in a fourth embodiment , the fabrication of casing elements equipped with fixed connector tubes , such as curved channels , is shown on fig4 a . the window machining operation is also the same as that in the fig3 embodiment . the same type of corset 1 equipped with rail 18 on a rigid &# 34 ; a &# 34 ; frame 19 is used . the re - inforcement of the windowed casing is , in this case , provided by a curved channel of diameter slightly less than - that of the short axis of the window 3 and of radius of curvature equal to that of the future branch well , typically about 300 ft , starting about 5 ft from the upper end of the channel . the curved channel 41 is made by bending a steel pipe in a pipe - bending machine to the required specification . it is then inserted from the outside , through the casing window 3 , into the upper part of the casing element , still held within the corset . it is thrust until its straight end emerges from the upper end of the casing element . a thick steel end plate 42 of outside diameter slighly smaller than the drift diameter of the casing is then tangentially welded to the periphery of the straight end of the curved channel and thrust back into the casing . the machined end plate presents one or more holes , which provide access to fluids and tools within the casing , along the curved channel and below the window . the lower end of the curved channel is then traced along the casing window &# 39 ; s edge and bevel using the millimg tool of fig4 . the casing window &# 39 ; s edge and the beveled lower end of the curve channel are welded together by known methods , such as multi - pass electrical mig , tig or plasma welding . the weld bead , along the window &# 39 ; s edge is made up of short segments welded alternatively on one end of a radius of the window and then at the end of the opposite radius , so as to minimize thermal distortion and residual stresses in the sealing weld bead . the curved channel 41 , in tangential contact with the inside surface of the casing , with its lower end welded to the window &# 39 ; s edge and with is upper end guided by the end plate , provides the required stiffening to the windowed casing . the adjacent holes in the end plate provide the required access to the casing below the window for tools of diameter as large as one half of the casing inside diameter . typically , an 11 . 75 &# 34 ; od casing element , of same diameter as the api couplings in a 10 . 75 &# 34 ; od casing string , may provide space for two 5 &# 34 ; id curved channels , each one permanently welded to a window 3 , while still leaving enough by - pass space to convey a cement slurry to the casing shoe , below the twin curved channels . in a fifth embodiment , the method of fabrication of embodiment no . 3 is applied to the construction of casing inserts for the type of connector shown on fig1 of the referenced patent . the diameter of the casing insert does not exceed the drift diameter of the cemented casing in which it is to be installed , but the first steps of its fabrication are identical with those of the third embodiment for a casing element . the dimensions of the required corset , milling bit and guiding assembly may , however , be different . the completely fabricated insert is shown on fig7 . upon removal of the corset , a tubular rubber sleeve 31 is slipped over the central part of the insert , covering the window , the plugged lower end of the liner stub , and at least one port hole 32 drilled into the top end of the insert wall , to provide entry of the cement slurry into the annulus space between the outer surface of the insert and the inner surface of the elastomeric sleeve 31 . this entry port hole 32 is then placed in flow communication with a known valve - type device 33 made of drillable material and providing control of the flow of cement slurry from a work string into the annular space inside the rubber tube . a known hydraulically - controlled hanger device 34 is then fitted to the bottom end of the insert . the pistons extending the dogs in this known hanger device are operated by a drillable hydraulic line 35 threaded from the top of the insert through the cut - out channel 27 in the rod assembly 20 of the guiding assembly to the bottom hanger 34 . another known hydraulically - controlled hanger device 36 is affixed to the top end of the casing insert and both devices are hydraulically connected with the work string , so that the two hangers are both simultaneously operated by a pressure increase of the fluid in the work string . a drillable or retrievable plug 37 is also affixed to the bottom end of the casing insert , to fully enclose the space covered by the rubber sleeve , during its extension into the well &# 39 ; s reamed cavity . the top and bottom ends of the rubber sleeve are then bonded to the insert &# 39 ; s outer surface and closed with straps . in a sixth embodiment of the invention , the fabrication of a casing patch of the type shown on fig1 of the referenced patent proceeds through the steps of embodiments 1 or 2 using a whipstock presenting a vertical hole , so that fluid pressure from the work string , to which the top end of the patch will be connected , may be transmitted below the whipstock . known hydraulic hangers are then affixed to both ends of the patch . a drillable plug is affixed to the bottom end of the patch , thus enclosing the fluid in the work string , as in the previous embodiment . this last step completes the fabrication of the casing patch equipped with a movable connector assembly . the installation of a casing insert or of a casing patch in an existing cemented casing requires the prior removal of a casing segment of length equal to or greater than that of their respective windows . with conventional milling bits at the end of a rotary work string , this preparation may be time - consuming . a less costly alternative method consists in using a combination of known tube cutting methods with the use of a downhole tool derived from that of fig2 c of the referenced patent . in a first stage , two circular cuts of the main casing are made , at the top and bottom of the segment to be removed . known tools such as wireline - operated explosive casing cutters or tubing - conveyed chemical cutters may be used for this task . these cutting operations are preferably performed above a known retrievable plug , so as to protect the lower part of the cemented casing string and to catch any debris . for the quick removal of the cut casing segment , a downhole tool derived from that of fig2 c of the referenced patent is used for cutting the casing segment into vertical strips which are then pried loose from their underlying cement layer . the resulting long steel strips drop down on top of the retrievable casing plug . they are then picked up by known magnetized fishing tools mounted preferably at the end of a wireline , used in a subsequent run to retrieve the casing plug . the modified downhole tool is shown schematically on fig8 . it is run on a high - pressure work string , used to convey a hydraulic fluid ( such as water or compressed gas ) required for the tool &# 39 ; s operation . the cutting arms are hydraulically pressed into the inner casing surface , just above the lower circular cut , thus initiating a slot . the work string is then pulled up from the surface . multiple arms equipped with plows 38 instead of slot - cutting wheels , but located in the same axial plane and a short distance below the wheels are also in their extended position . they enter into the slots at their contact with the lower circular cut to lift the slot edges off the underlying cement sheath . each slot is terminated by closure of the cutting arms when the depth of the upper circular cut is reached . the lifted vertical strips drop on top of the plug , where they are later picked - up by known magnetized junk recovery tools . a transverse sectional view of the plow 38 is shown on fig8 a . in a variant of this combined slot - cutting and plowing tool , shown on fig8 b , the sides of the cutting wheels 39 are machined like radial expander turbine wheels . a slip stream of hydraulic fluid , preferably compressed gas , is conveyed through the fork 40 in each cutting arm to the turbine inlet , resulting in high speed rotation of the wheel , the outer edges of which are covered with abrasive particles 44 , such as tungsten carbide . in that case , the wheel operates as a grinder rather than a punch , which reduces the required hydraulic pressure , and yet results in high cutting speeds . the turbine exhaust is into the casing fluid , with return to the surface . a vertical sectional view of the turbine and grinding wheel is shown on fig8 c . in existing cemented cased wells of diameter too small to accept more than one branch lateral , typically with a 7 &# 34 ; od casing , but where the addition to the existing vertical well of a single 4 &# 34 ; od branch - well is desirable at minimum cost , a 4 . 5 &# 34 ; od fixed curved channel connector may be shop - fabricated by the method of the fourth embodiment , using a casing element of same inside diameter as that of the existing casing . the accurately cut lower end of this channel effectively serves as a template for the accurate explosive cutting , downhole , of a window in the existing casing and for achieving a sealed / welded connection of the branch well to the casing , while providing permanent re - inforcement to the windowed casing interval , as shown in fig9 aa , 9b and 9bb . the lower end of the curved channel 41 obtained by this method presents a curved surface which conforms exactly with that of the inside surface of the existing casing , when pressed against it by an eccentering device 45 . the thick end plate 42 will also guide the straight upper end of the channel tangentially against the inner wall of the casing when it is inserted into the existing well at the end of a work string . the thick end plate also presents a hole 46 of about 2 &# 34 ; id providing by - pass fluid and tool access to the existing vertical well below the branch - well connection . the curved channel end is affixed to drillable tie ribs and closed by a drillable bent plate 47 , so as to form a pressure - resistant enclosed air - filled space . along the elliptical edge of the plate and on its inner surface , is affixed a cordon of high explosive , a &# 34 ; shaped &# 34 ; charge ring 48 with a &# 34 ; v &# 34 ; shape metal liner 49 facing outward along the periphery of the plate and with a dense backing housing 50 made of drillable metal facing the interior of the curved channel . the orientation of the &# 34 ; v &# 34 ; liner is such as to aim the gaseous sheet of high - pressure and very hot explosion products toward the edge of the bent plate , at its junction with the lower end of the channel . a similar linear &# 34 ; shaped &# 34 ; charge 51 is also affixed to the vertical center line of the plate , on the inside ribbed face . this linear charge does not have any metal liner 48 on its &# 34 ; v &# 34 ; surface . known detonating cords 52 are affixed respectively to the backing housing of the elliptical charge and , through an additional time delay detonating cord 52 , to the linear charge 51 . a known detonator 53 and a firing system 54 of the type used in tubing - conveyed casing perforators complete the pre - fabricated curved channel assembly . the assembly is run - in the existing well to the kick - off depth , by an empty work string , and oriented by known methods in the direction specified for the branch well . it is firmly clamped against the casing wall inner surface and detonated . the results of the detonation are : 1 ) a continuous inch - wide groove cut in the casing wall and cement adjacent to the edge of the drillable plate , with complete destruction of the peripheral zone of the plate and casing behind it , opposite the outer shaped charge , 2 ) a bending and welding of the slightly enlarged lower end of the curved channel to the remaining casing wall , thus achieving a metal / metal seal , at their junction , 3 ) the remaining elliptical portions of the cut casing and of the cover plate 47 are folded together along their longitudinal axis , by the detonation of the linear charge 51 , making them easy to remove with a known magnetized fishing tool . debris from the charges casings are then drilled out by the drill string inserted into the curved channel to start drilling the lateral branch - well . after reaching the target depth , the branch - well is completed with a liner string hung and cemented within the fixed curved channel . a separate tubing string may later be installed by known methods to connect the branch - well to the surface . the eccentering device used to clamp the lower part of the fixed channel assembly against the casing wall may also be drilled out through the hole in the thick end plate to allow sufficient access to logging and cleaning tools in the vertical well below the branch well to enhance the quality of the explosively bonded metal / metal seal it is advantageous to remove any scale from the old casing wall prior to run - in of the fixed channel assembly , also cleaned of any surface oxides during its fabrication in the shop and coated with aluminum paint . this completes the low - cost and rapid installation of a single pre - fabricated fixed curved channel above the perforated zone of an existing cased well . it will be apparent to those skilled in the art that the same methods of pre - fabrication and field installation of a bent tubular connector in an existing casing are not limited to the case when the flow path to the casing space below said connector is realized by a parallel tubing element , outside said connector , or by an eccentered annulus , as described above . they are equally applicable to the case when such by - pass flow path across the intersection with the lateral well is provided by an inner tubing element penetrating the lower wall of the curved tubular connector through a small window and coming out into a packer set at some distance below the casing window . in that case , the small window cut in the lateral connector tube is covered and sealed by a drillable plate . this allows to maintain the lateral connector and it shaped charges at atmospheric pressure , prior to the firing . the end plate at the upper end of the lateral connector may also be replaced by a known hanger set in the casing , so as to conform with the usual configuration for that case . after firing of the charges to install the lateral connector and clean - up of debris , the lateral drainhole is drilled through the bent tubular connector by known methods . a liner string is run in the drainhole through the explosive - welded window , hung and cemented within the connector , up to a depth between the top of the casing window and the base of the connector hanger . a small window is cut through the cemented liner and through the drillable cover plate of the connector tube window . the inner tubing element is then threaded through that window and stabbed into the packer below the casing window to form a leak - proof connection . if a separate production tubing is required for each of the two producers , vertical cased well and branch well , a dual tubing hanger may be set in the casing above the branch connection , supporting respectively the tubing string in the branch well and the tubing string in the vertical well . while certain embodiments of the invention have been specifically disclosed , it should be understood that the invention is not limited thereto , as many variations will be readily apparent to those skilled in the art and the invention is to be given the broadest possible interpretation .	8
the present invention proposes a new brush holder for metal fiber and metal foil brushes . it is designed to guide the brush in axial direction as it wears even while a constant light brush pressure is exerted and a large current is conducted to or from the brush at very low electrical resistance . the invention is depicted in fig1 a to 1 e and is called the “ tubular brush holder .” in the version of fig1 a and 1b , fiber brush 27 is conductively fastened to metal baseplate 28 and is pushed forward in electrically conductive brush box 29 by constant force spring 37 so as to load brush 27 against rotor 2 with the desired brush force . at least one of the four long sides of the inside of brush box 29 is lined in an electrically conductive manner with resilient multi - contact metal material 47 , i . e ., in the form of metal velvet , metal felt , strands of fine metal fibers , metal fibers combined in the manner of textiles , e . g ., through weaving or knitting or any other . at least one metal guide 38 is rigidly , electrically conductive attached to base plate 28 in such a manner that it is parallel to at least one side of the brush box that is lined with resilient multi - contact metal material 47 and is disposed so that it guides fiber brush 27 along the inside of brush box 29 while the brush wears . low - resistance electrical contact is established between the at least one guide 38 and at least one multi - contact metal material by means of at least one compression spring 54 ( in this case depicted as helical springs 54 ( 1 ) and 54 ( 2 ) extending between guide 38 and a thin low - friction plate 39 that is flexibly hinged to baseplate 28 disposed so that it is parallel to the at least one metal guide 38 . teflon may be a particularly suitable material for hinged low - friction plate 39 . for further stabilization of the brush motion , the remaining inner surfaces of the brush box may be provided with low - friction liner or the edges of base plate 28 may be lined with a low - friction material such as teflon . such a liner is indicated by number 56 . the spring action between guide 38 and hinged low - friction plate may be provided by at least one conventional spring , e . g ., a helical spring , or by at least one constant force spring . the spring force is adjusted to compare with the brush force exerted on fiber brush 27 by means of constant force spring 37 . the friction force due to the described elastic compression of the multi - contact metal material 47 and metal guide 38 will reduce the brush force on fiber brush 27 by about 30 % of the force imposed by constant force spring 37 , for the reason that the coefficient of friction between multi - contact metal material and smooth metals is in the range of 0 . 2 to 0 . 3 . the contact resistance between brush box 29 and fiber brush 27 via the resilient multi - metal material 47 will be about one half of the electrical resistance between the brush and rotor 2 since static multi contacts have about one half of the resistance of similar sliding contacts under same pressure ( compare c . m . adkins iii and d . kuhlmann - wilsdorf , “ devleopment of high - performance metal fiber brushes ii — testing and properties ”, electrical contacts — 1979 ( proc . twenty - fifth holm conf . on electrical contacts , iii . inst . techn ., chicago , ill ., 1979 ), pp . 171 - 184 , the entire contents of which is incorporated by reference herein . ), provided that the surfaces are clean . this is a requirement that must be fulfilled , either by operating in a protective atmosphere such as humidified co 2 or making the contact surface between multi contact metal material and slider of noble metal or plating with a noble metal . in cases of high packing density of brush holders , e . g ., as may be the case in homopolar motors , the outside of the brush box should be coated with a nonconductive paint or lacquer , e . g ., red stop - off lacquer . for a particular application , the tubular brush holder designed in fig1 a and 1b may be too costly or requires too much space . in fact restricted space for bushes is a perennial problem for homopolar motors since their appeal derives from their potentially large power to weight ratio and , due to the typically low voltage per current turns , they require large numbers of brushes . fig1 c to 1 e therefore show simplifications of the concept of the tubular brush holder according to the present invention that are designed both to save space and cost . in fig1 c , the dual function of guiding the brush axially with minimal friction while it wears and conducting current of the brush at very low resistance , is performed by the releasable conductive clamping mechanism 42 a that comprises a flexible metal ring with spring action 58 that is lined with resilient multi - contact metal material . an optimum compromise between friction and electrical resistance can be achieved by adjusting the wing nut 24 , since tightening it will decrease resistance but increase friction and vice versa . however , this is just one example of how to construct a releasable clamping mechanism . for example , the clamping mechanism 42 a may apply to a stem extending from the base plate or some metal guide as in fig1 a and 1b . also a matter of choice will be the means whereby clamping mechanism 42 a may be releasably but rigidly mechanically fastened to the stator . one possibility would be to provide a screw thread at the upper end of 42 a such that it does not interfere with the spring action due to the wing nut acting on the flexible metal ring 58 and a matching threaded hole in the stator . another would be to similarly provide a dovetail at clamping device 42 a and a female receptacle for such a dovetail in the stator . still another version of the tubular brush holder is shown in fig1 d where the brush is guided by a cavity in the stator that is lined with resilient multi - contact metal material . here that guidance is optionally supplemented by a stem 59 stem extending in axial direction from the brush base plate 28 and guided in hole 60 in the stator that may be optionally lined with resilient multi - contact metal material . in this example the brush force is applied by two constant force springs . the advantage of this version of the tubular brush holder is its still greater simplicity , but it lacks the possibility of adjusting the pressure between the multi - contact material and the brush base plate . the simplest tubular brush holder is shown in fig1 e , wherein the brush is guided by stem 59 in hole 60 lined with resilient multi - contact metal material 47 and is subject to the brush pressure applied by constant force spring 37 . a common feature of all tubular brush holders , shown in fig1 a to 1 e and any other modifications , is that the current is transferred between stator and brush by means of low - friction , low resistance resilient multi - contact metal material that is electrically connected to the current supply or load and is mechanically rigidly attached to the stator .	7
an embodiment of the present invention is illustrated by way of example in fig1 - 4 . with specific reference to fig1 , 2 and 4 , a single pressure vessel 12 , a new or existing building 10 , that has a sealed attic 56 , or sealed roof cavity 60 , that is not ventilated / opened to outdoors 32 . according to one embodiment the present invention includes , in a building 10 , with single or multiple floors , floor surfaces 36 , floor cavities 38 , ceiling surfaces 50 , ceiling cavities 52 , exterior wall surfaces 40 , exterior wall cavities 42 , interior wall surfaces 44 , interior wall cavities 46 , sealed attic 56 , attic ceiling surfaces 54 . the sealed outer edge surface 22 is shown with a thick black line . this sealed outer edge surface 22 is used to establish the outer edge of the single pressure vessel 12 . therefore , all of the interior areas within a single , continuous sealed outer edge surface 22 , that are marked 12 , are interior areas of the same , single pressure vessel . various possible locations of transfer openings ( s ) 24 and automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , are shown for example only , and not by way of limitation , to allow pressure to easily , automatically and quickly equalize between all of the interior areas of the single pressure vessel 12 . such as but not limited to , through floor surfaces 36 , floor cavities 38 , through ceiling surfaces 50 , ceiling cavities 52 , exterior wall cavities 42 , through interior wall surfaces 44 , interior wall cavities 46 , sealed attic 56 , through attic ceiling surfaces 50 , and roof cavities 60 , of the home 10 . any location of transfer openings ( s ) 24 and automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 that is desired and / or appropriate , may be used . fig1 clearly illustrates the formation of a single pressure vessel 12 , in a new or existing building 10 , that has a sealed attic 56 , or sealed roof cavity 60 , that is not ventilated / opened to outdoors 32 , by establishing the outer edge surface of the single pressure vessel 12 with a thick black line , through the implementation of sealed outer edge surface 22 . this along with transfer openings ( s ) 24 and automatic , pressure operated , pressure relief dampers , vents , openings and valve ( s ) 26 , are done so that all of the interior areas to be protected , such as but not limited to , through floor surfaces 36 , floor cavities 38 , through ceiling surfaces 50 , ceiling surfaces 50 , ceiling cavities 52 , exterior wall cavities 42 , through interior wall surfaces 44 , interior wall cavities 46 , sealed attic 56 , through attic ceiling surfaces 54 , roof cavities 60 , of the building 10 , can easily communicate with each other and allow pressure to easily , automatically and quickly equalize between one another , and not outdoors 32 . the sealed outer edge 22 prevents the protected interior areas from uncontrollably communicating with outdoors 32 . according to one embodiment , fig2 includes the addition of two attached , enclosed structures 14 , that are to be included in the single pressure vessel 12 , of a new or existing building 10 , that has a sealed attic 56 , or sealed roof cavity 60 , that is not ventilated / opened to outdoors 32 . the sealed outer edge surface 22 is now extended to include structures 14 . therefore , all of the interior areas within a single , continuous outer edge 22 , that are marked 12 , are parts of the same single pressure vessel . for example only , and not by way of limitation this drawing includes a garage 18 , on the right side of the building 10 , and an enclosed swimming pool area 20 , on the left side of the building 10 . refer again now to fig2 , for a more complete description of the variety of possible locations for transfer openings 24 and automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 . these locations are shown for example only , and not by way of limitation , to allow pressure to easily , automatically and quickly equalize between all of the interior areas of the single pressure vessel 12 , of a new or existing building 10 , that has a sealed attic 56 , or sealed roof cavity 60 , that is not ventilated / opened to outdoors 32 . such as but not limited to , through floor surfaces 36 , floor cavities 38 , through ceiling surfaces 50 , ceiling cavities 52 , exterior wall cavities 42 , through interior wall surfaces 44 , interior wall cavities 46 , sealed attic 56 , through attic ceiling surfaces 54 , roof cavities 60 , of the building 10 . any location of transfer openings 24 and automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 that is desired and / or appropriate , may be used . please note that when a transfer openings 24 and / or automatic , pressure operated , pressure relief damper , vent , openings and valve 26 , is installed in an exterior wall cavity 42 , it is only installed on the interior wall surface 44 , of this cavity 42 that faces , opens up to , the single pressure vessel 12 . the exterior wall surface 40 , is the one that is closest to the outdoors 32 . neither this exterior wall surface 40 , nor its sealed outer edge 22 , are ever pierced by anything except windows and doors that are then sealed in place . in fact , under no circumstances is the sealed outer edge surface 22 ever pierced , except by windows and doors that are then sealed in place , as well as possible , or by the automatic , pressure operated , pressure relief damper , vent , openings and valve 26 , to outdoors 32 , that is installed on all roof surfaces 58 , in order to easily , automatically and quickly relieve pressure build ups in the building 10 , to outdoors 32 , at the outer edge of the building surface 22 . stairways ( not shown ) in a normal multiple floor , new , or existing building 10 , that has a sealed attic 56 , or sealed roof cavity 60 , that is not ventilated / opened to outdoors 32 , will serve as a perfect transfer openings 24 , between the various floors . when this is true , then the transfer opening ( s ) 24 , and / or automatic , pressure operated , pressure relief dampers , vents , openings and valve ( s ) 26 , that are mounted on ceiling surfaces 50 , of the various floors , will only pierce the ceiling surface 50 , and allow pressure to be automatically and easily released from the ceiling cavity 52 . if there is no stairway ( not shown ), or if for some reason , the stairway ( not shown ) is sealed , or has some other form of restriction , then some of the ceiling surface 50 mounted transfer opening ( s ) 24 and / or pressure relief dampers , vents , openings or valve ( s ) 26 , will need to be installed on both the ceiling surface 50 and the floor surface 36 above the ceiling cavity 52 , so that pressure can easily and automatically equalize between the multiple floors involved , and easily escape the ceiling cavity 52 . sometimes a floor cavity 38 from one floor and a ceiling cavity 52 from the floor below , can be the same cavity 38 or 52 , and can be called either or both . according to another embodiment of the invention , fig1 , 2 and 4 also illustrates how automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 to the outdoors 32 , that pierce the sealed outer edge 22 , at the roof surface 58 , may be added to relieve built up pressures from within the single pressure vessel 12 of a new or existing building 10 , that has a sealed attic 56 , or sealed roof cavity 60 , that is not ventilated / opened to outdoors 32 , that occur during any and all wind and pressure challenges . these roof mounted automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , to outdoors 32 , are the only time that the sealed outer edge surface 22 is pierced , other than for doors and windows , and these should then be sealed in place , as well as possible . due to the high winds involved , exterior wall surfaces 40 , are not a suitable location for these automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , as deployed by previous patents . wind blowing directly against a pressure relief damper , vent , openings and valve 26 , located on an exterior wall surface 40 , or on only one side of a sloped roof surface 58 , could easily prevent it from operating at the proper relief pressure , when needed . the same does not hold true for flat roof surfaces 58 , or sloped roof surfaces 58 that are not in the direct path of the wind , due to the well know pressure envelope , that develops over roof surfaces 58 . so , for proper operation and protection , the automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , that opens to outdoors 32 , must be located on roof surface 58 . so , if the roof surface 58 is sloped , then automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , should be installed on all of the sloped sides of the roof surface 58 . so , in other words , every slopped roof surface 58 should have at least one automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , installed on it . this will allow a pressure envelope to develop over at least one of the automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , during high winds . individual flat roof surfaces 58 and individual sloped roof surfaces 58 , can each have a few as one automatic , pressure operated , pressure relief damper , vent , openings and valve 26 , provided it is sized and located properly . more than one automatic , pressure operated , pressure relief damper , vent , openings and valve 26 , can be used on each of these roof surfaces 58 , if desired . the automatic , pressure operated , pressure relief damper , vent , openings and valve 26 , can be located anywhere on the roof surface 58 , that is desired , or appropriate , as long as it is sized properly and allowed to easily communicate with the single pressure vessel 12 . due to the way that some new or existing building 70 are constructed with attics 72 and / or roof cavities 74 , that cannot be sealed to outdoors 32 , applicant feels that it will be very expensive and difficult , but not impossible to create a sealed outer edge surface 22 and convert them to the above described single pressure vessel 12 . fig3 is another embodiment of the invention that illustrates how automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , can be added to the attic ceiling surface 54 , of a new or existing building 70 , that have attics 72 and / or roof cavities 74 , that cannot be sealed to outdoors 32 , so that pressure can be released from the interior working or living area of the building 70 , into the unsealed attic 72 , and / or roof cavity 74 before an uncontrolled explosive and catastrophic pressure release occurs . transfer opening ( s ) 24 , should not be used at these locations as they could allow humidity to to uncontrollably infiltrate into the living area 70 . any location of transfer openings 24 and automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , on the attic ceiling surface 54 , that is desired and / or appropriate , may be used . refer again to fig3 , for a more complete description of another embodiment of the invention , for a variety of possible locations for transfer openings 24 and / or pressure operated , pressure relief dampers , vents , openings and valves 26 , in new or existing building 70 , that have attics 72 and / or roof cavities 74 that cannot be sealed to outdoors 32 . openings 24 and damper , vent , openings and valve 26 locations are shown for example only , and not by way of limitation , to allow pressure to easily equalize between all of the interior areas of the new or existing buildings 70 , that have attics 72 and / or roof cavities 74 , that cannot be sealed to outdoors 32 , such as but not limited to , floors , through floor surfaces 36 , floor cavities 38 , through ceiling surfaces 50 , ceiling cavities 52 , exterior wall cavities 42 , through interior wall surfaces 44 , interior wall cavities 46 , unsealed attic areas 72 , through attic ceiling surfaces 54 , roof cavities 60 , before an uncontrolled catastrophic pressure release occurs . any location of transfer openings 24 and / or automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 that is desired and / or appropriate , many be used . again , automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 will prevent the uncontrolled infiltration of humidity into the interior working and / or living area of the building 70 , where transfer opening ( s ) 24 , could allow humidity to enter and move throughout the building 70 , uncontrollably , and cause considerable mold , mildew and rot problems . as mentioned above , it will be very expensive and difficult , but not impossible to convert new or existing building 70 , that have attics 72 and / or roof cavities 74 that cannot be sealed to outdoors 32 , to the above described single pressure vessel 12 . they could just be modified as best as possible with transfer opening ( s ) 24 and / or automatic , pressure operated , pressure relief dampers , vents , openings and valve ( s ) 26 . please note that when a transfer openings 24 and / or automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , are installed in an exterior wall cavity 42 , it is only installed on the interior wall surface 44 , of this cavity 42 that faces , opens up to , the single pressure vessel 12 , of a new or existing building 70 , that have attics 72 and / or roof cavities 74 , that cannot be sealed to outdoors 32 . the exterior wall surface 40 is the one that is closest to the outdoors 32 . neither this exterior wall surface 40 , nor its sealed outer edge surface 22 , if installed , are ever pierced by anything except windows and doors that are then sealed in place . in fact , if a sealed outer edge surface 22 is created on a new or existing building that has attics 72 and / or roof cavities 74 that cannot be sealed to outdoors 32 then under no circumstances is the sealed outer edge surface 22 ever pierced except by windows and doors that are then sealed in place , as well as possible , or by the automatic , pressure operated , pressure relief dampers , vents , openings and valves 26 , to outdoors 32 , that could be installed on a sealed roof surface 58 , and / or the sealed attic ceiling surface 76 , as applicable , in order to easily and quickly relieve pressure build ups in the building 70 , to outdoors 32 . stairways ( not shown ) in a normal multiple floor , new or existing building 70 , that have attics 72 and / or roof cavities 74 , that cannot be sealed to outdoors 32 , will serve as a perfect transfer openings 24 , between the various floors . when this is true , then the transfer opening ( s ) 24 and / or automatic , pressure operated , pressure relief dampers , vents , openings and valve ( s ) 26 , that are mounted on the ceiling surfaces 50 , will only pierce the ceiling surface 50 , and allow pressure to be easily and automatically released from the ceiling cavity 52 . if there is no stairway ( not shown ) or if for some reason , the stairway ( not shown ) is sealed or has some other form of restriction , then some of the ceiling surface 50 mounted transfer openings ( s ) 24 and / or pressure operated , pressure relief dampers , vents , openings and valves 26 , will need to be installed through the ceiling surface 50 and the floor surface 36 above the ceiling cavity 52 , so that pressure can easily escape the ceiling cavity 52 , and equalize between the floors involved . fig4 clearly illustrates a new or existing multiple floor 34 , high rise building 10 that can be of unlimited height and unlimited number of floors 34 . shown is the formation of a single pressure vessel 12 , that has a sealed attic ( not shown ), or sealed roof cavity 60 , that is not ventilated / opened to outdoors 32 , by establishing the outer edge of the single pressure vessel 12 with a thick black line , through the implementation of sealed outer edge surface 22 . therefore , all of the interior areas within a single , continuous surface 22 , that are marked 12 , are parts of the same single pressure vessel . this along with transfer openings ( s ) 24 and pressure relief dampers , vents , openings and valve ( s ) 26 , are done so that all of the areas to be protected , such as but not limited to , through floor surfaces 36 , floor cavities 38 , through ceiling surfaces 50 , ceiling surfaces 50 , ceiling cavities 52 , exterior wall cavities 42 , through interior wall surfaces 44 , interior wall cavities ( not shown ), sealed attic ( not shown ), through attic ceiling surfaces ( not shown ), roof cavities 60 , of the building 10 , can easily communicate with each other and allow pressure to easily , automatically and quickly equalize between one another , and not outdoors 32 . the sealed outer edge surface 22 prevents the protected areas from communicating with outdoors 32 . in fact , under no circumstances is the sealed outer edge surface 22 ever pierced , except by windows and doors that are then sealed in place , as well as possible , or by the automatic , pressure operated , pressure relief damper , vent , openings and valve 26 , to outdoors 32 , that is installed on all roof surfaces 58 , in order to easily , automatically and quickly relieve pressure build ups in the building 10 , to outdoors 32 . according to another embodiment of the invention , fig5 illustrates how to implement a dynamic pressure energy structure 90 of any shape , height , width and length that has no or minimal interior obstructions that could impede the dynamic pressure 110 from a vertical flow upwards , illustrating the installation of dampers , vents , openings and valves 26 on all sides that could possibly receive wind 100 . these dampers , vents , openings and valves 26 will open on the wind impact side and close on all of the other sides in order to capture dynamic pressure energy 110 . please note that the wind 100 is coming from the right hand , therefore all of the dampers , vents , openings and valves 26 on that side are open , while the dampers , vents , openings and valves 26 on all of the other sides are closed to capture the dynamic pressure 110 , that will built up within the structure 90 . it is understood that any type of dampers , vents , openings and valves 26 , even motorized ones , could be used in this structure , since their design is not critical to the implementation of applicant &# 39 ; s dynamic pressure energy structure and no previous patent has implemented a structure similar to this . stairways ( not shown ) can be used to generate dynamic pressure energy and for access to the building ( not shown ) they are attached to , as long as landings still allow an open pathway to exist from the bottom to the top of the structure 90 . further , existing stairways ( not shown ) can also be converted into dynamic pressure energy structures 90 as long as the landings still allow an open pathway to exist from the bottom to the top of the structure 90 and dampers , vents , openings and valves 26 are installed on all sides that could possibly receive wind 100 , as shown in fig5 , or as desired . it includes an illustration of the placement of a single center flow wind turbine 94 at the roof line , of unlimited type , form , size and number , may be employed . the only limitation here is the size of the dynamic pressure energy structure itself 90 , and it can be designed to any size or shape desired . it is understood that more dampers , vents , openings and valves 26 can be employed over the height of the structure as wind velocities increase over height . sometimes more dampers , vents , openings and valves 26 may be used on the lower floors than the upper floors . the term floor ( not shown ) is used to describe any increase in structure 90 height and is not limited to the normal description of a floor ( not shown ) of a standard building . this dynamic energy flow 110 can further be captured , channeled , concentrated and harnessed through one or possibly several stages ( not shown ) of wind turbine generators 94 , through the addition of more dampers , vents , openings and valves 26 . with modifications this pressure energy 110 can be captured , channeled , concentrated and harnessed through one or more vertical channels ( not shown ) through the addition of more dampers , vents , openings and valves 26 . with further modifications this energy can be captured , channeled , concentrated and harnessed through one or more horizontal channels ( not shown ) through the addition of dampers , vents , openings and valves 26 . air straightening vanes 96 can be added as desired to assure a smooth entrance flow into the wind turbine 94 intake , to maximize power generation . applicant &# 39 ; s research reveals that the parapet walls 92 should be a little higher than the top of the turbine 94 . any lift generated by air passing over these parapets 92 will actually make the turbine 94 more efficient , especially during high winds 100 , while preventing those same high winds 100 from directly impacting the turbine 94 blades , which will actually reduce the efficiency of a center flow turbine 94 . additionally , with the height of the parapet 92 walls extending above the top of the center flow turbine 94 , dynamic pressure 110 will actually be pulled up through the turbine 94 , producing the first push - pull wind power generation system ever conceived , with some of the highest efficiencies ever realized . this type of shielded , center flow , electrical turbine 94 could withstand 150 mph winds 100 , with the implementation of properly sized and located bypass openings 98 . no sealed surfaces are needed for this type of structure 90 to withstand hurricanes and it is strong enough to withstand even stronger winds 100 and continue to produce electrical power throughout any high wind event through the implementation of properly designed dynamic pressure energy structures 90 and high speed wind turbines 94 along with more bypass openings 98 . the description of the present embodiments of the invention has been presented for the purposes of illustration , but is not intended to be exhaustive or to limit the invention to the form disclosed . many modifications , adaptations and variations will be apparent to those or ordinary skill in the art . as such , the present invention has been disclosed in connection with the preferred embodiments which fall within the spirit and scope of the invention as defined by the following claims .	4
as shown in fig1 a discharge tube arrangement comprises a discharge tube 20 mounted in a launcher 22 . the discharge tube 20 is formed of a light - transmissive , dielectric material , such as glass , and contains a fill 24 . the launcher 22 is made of an electrically conductive material , such as brass , and formed as a coaxial structure comprising an inner tube 26 and an outer tube 28 . a first plate 30 , at one end of the outer tube , provides a first end wall for the launcher structure . at the other end of the outer tube 28 , a second plate 31 , integral with the outer tube 28 , provides a second end wall . the inner tube 26 is shorter than the outer tube 28 and so positioned within the outer tube 28 as to define a first annular gap 32 and a second annular gap 33 . each of the first plate 30 and second plate 31 has an aperture for receiving the discharge tube 20 . the outer tube 28 , the first plate 30 and the second plate 31 form an unbroken electrically conductive path around , but not in electrical contact with , the inner tube 26 to provide an r . f . screening structure therearound . suitable dimensions for the launcher of fig1 are as follows : ______________________________________launcher length 7 - 20 mmlauncher diameter ( outer 25 - 35 mm but depends on sizetube 28 diameter ) of discharge tube 20 . inner tube 26 length 3 - 18 mminner tube 26 diameter 13 mm but depends on size of discharge tube 20 . length of launching gap 0 . 5 - 3 mm ( first gap 32 ) length of second gap 33 1 - 10 mm______________________________________ the thickness of the electrically conductive material is of the order of millimeters , or less , depending on the construction method used . an r . f . power generator 34 ( shown schematically ) is electrically connected to the inner tube 26 of the launcher 22 via a coaxial cable 35 and an impedence matching network 36 ( shown schematically as comprising capacitor 37 and inductor 38 ). the r . f . power generator 34 , the impedance matching network 36 , the coaxial cable 35 and the launcher 22 constitute an r . f . powered excitation device to energise the fill to produce a discharge . a body 40 of dielectric material inside the launcher 22 is provided as a structural element , to keep the size of the gaps 32 , 33 constant and to hold the inner tube 26 in position . the body 40 also helps in shaping the electric field in the gaps 32 , 33 for ease of starting or other purposes . suitable dielectric materials which exhibit low loss at r . f . frequencies include glass , quartz and ptfe . alternatively , the launcher may be partially or completely air filled , provided that means to support the inner tube are provided . when the r . f . power supply 34 is switched on , an oscillating electric field , having a frequency typically in the range of from 1 mhz to 1 ghz , is set up inside the launcher 22 . at the first and second gaps 32 , 33 , this electric field is parallel to the longitudinal axis of the discharge tube 20 . if sufficient power is applied , the consequent electric field produced in the fill 24 is sufficient to create a discharge through which an electromagnetic surface wave may be propagated in a similar manner to the arrangement of ep 0225753a2 . accordingly , the launcher 22 powered by the r . f . power generator 34 creates and sustains a discharge in the fill -- the length and brightness of the discharge depending , inter alia , on the size of the discharge tube 20 and the power applied by the r . f . power generator 34 . such a discharge tube arrangement may therefore be used as a source of radiation . in the first embodiment , the fill 24 consisted of the hexacarbonyl chromium complex ( cr ( co ) 6 ) and argon . in a second embodiment , the fill 24 consisted of the hexacarbonyl tungsten complex ( w ( co ) 6 ) and argon . in both embodiments , a stable surface wave discharge was achieved with the generation of a mixture of infra - red and visible radiation . it is envisaged that these embodiments may have applications in the field of lighting . in each case , the fill typically contained 20 mg of the metal carbonyl . the inventors found that mercury could advantageously be added to the w ( co ) 6 fill to assist in starting . it is envisaged that fills containing other metal carbonyl complexes will be excited by surface waves with the emission of a mixture of visible and infra - red radiation . examples of such metal carbonyl complexes include the following : ______________________________________hexacarbonyl molybdenum mo ( co ). sub . 6nonacarbonyl di - iron fe . sub . 2 ( co ). sub . 9pentacarbonyl iron fe ( co ). sub . 5hexacarbonyl vanadium v ( co ). sub . 6hexacarbonyl osmium os ( co ). sub . 6tetracarbonyl nickel ni ( co ). sub . 4octocarbonyl dicobalt co . sub . 2 ( co ). sub . 8decacarbonyl dimanganese mn . sub . 2 ( co ). sub . 10______________________________________ it is also envisaged that the spectrum of radiation emitted can be modified by using halogen in the form of the metal carbonyl halide eg mn ( co ) 5 i .	7
the inspection screens made of plastic have gained broad application since recently . known from the prior art are many solutions disclosing dimensions , a frame profile as well as the method for fastening the screen cover to the frame . the u . s . pat . no . 4 , 890 , 418 , as of feb . 1 , 1990 discloses a solution which is similar to the said utility model . thus , the said patent discloses a double - sided inspection screen which can be installed following both the front side and rear side installation options as displayed on fig1 , 2 respectively . said features extend the scope of application allowing the screen to be installed either with the frame mounted outwards taking advantage of the ornamental feature of the device , or with the frame being arranged inwards for the cases when the concealed emplacement of the inspection screen is implied . the disadvantage of the said embodiment consists in applying a so - called articulated connection to fasten the cover to the frame as shown on fig3 . the said method requires additional tools , such as a blade screwdriver , a hard plate etc . to detach the cover from the frame . a minor amount of recurrent attachment / detachment operations results in mechanical damage both to the cover and / or the frame , an excessive resort to accessories may lead to collapse of separate elements of the articulated connection . applying additional tools prolongs the cover opening and shutting steps to up to 3 - 5 min . an additional disadvantage of such construction consists in that the screen is not provided with a permanent fastening detail for clamping the cover in the frame due to which the former often gets lost during the installation process . the objective of this utility model is to provide an inspection screen with the cover that could be easily opened / shut without recourse to additional tools , and fixed reliably to reduce time of the opening / shutting step , and hereby enhance the reliability and user - friendliness . the problem confronted is solved by means of the screen design . the screen comprises a cover , upper , lower , right and left profiles forming the frame . the upper and lower profiles have the orifices which are arranged symmetrically to the edge of the profile and on ½ of the profile width as shown on fig4 . the screen cover has l - shaped holders which are arranged symmetrically to the cover edges as shown on fig5 , and axially aligned one against another on the upper and lower parts of the cover . the holders are provided with engaging and clamping elements . as shown on fig5 , the l - shaped holder a has an engaging element in the form of a cylindrical rod , and the l - shaped holder on fig5 has a clamping element in the form of a spherical lug . in order to obviate an undesirable range of motion of the screen cover relative to the screen frame , the right profile of the screen frame is provided with a lug ( front side ) and a groove ( rear side ). similarly , the left profile of the screen frame has a groove ( front side ) and a lug ( rear side ). the screen cover is arranged in such a way that the groove is located on the side of the engaging holders ( a , fig5 ) whereas the lug is provided on the side of the clamping holders ( b , fig5 ). it is important to note that the sides on which engaging and clamping elements are arranged , are referred to as upper and lower parts respectively . those skilled in the art will understand that in the mirror view the markings “ right side ” and “ left side ” are likely to get reversed . in much the same way the marking “ upper ” can be changed to “ lower ” and vice versa . a more detailed explanation of how the screen cover is clamped in the screen frame can be found on the sketch on fig6 . upper and lower l - shaped holders with cylindrical rods ( engaging holders ) of the screen cover are engaged into the orifices in the upper and lower profiles of the screen frame . the newly obtained engagement allows the cover to be held fixed in the frame and provides revolution around the clamping axis . an additional embodiment of the said utility model are detachable cylindrical rods on the l - shaped holders implicating that the rods can be installed / dismantled by means of thread , interlock or any other way known from the prior art . a more detailed explanation of how the screen cover is clamped in the screen frame can be found on the sketch on fig7 . the upper and lower l - shaped holders with cylindrical rods ( engaging holders ) of the screen cover are engaged in the orifices in the upper and lower profiles of the screen frame . due to the spherical form of the lugs and resilience of the l - shaped holder , the screen cover is clamped in the orifices of the screen frame . a slight effort suffices to disengage the screen cover from the orifices of the screen frame thanks to the spherical form of the lugs and resilience of the l - shaped holder . a more detailed description of the confinement of an undesirable range of motion of the screen cover relative to the screen frame is shown on the sketch on fig8 - 13 . in accordance with the front side installation method the l - shaped engaging holder of the screen cover is engaged into the orifices of the screen frame in such a way that the groove on the screen cover matches the lug on the profile of the screen frame as shown on fig8 . accordingly , when the cover is shut , the lug on the screen cover matches the groove on the profile of the screen frame as shown on fig9 . thus , the confinement provided by the interengagement “ lug in frame — groove in cover ” and “ groove in frame — lug in cover ” provides for the movement of the screen cover within the screen frame for the front side installation type as shown on fig1 . in accordance with the rear side installation method , the l - shaped engaging holder of the screen cover is engaged into the orifices of the screen frame in such a way that the groove on the screen cover matches the lug on the profile of the screen frame as shown on fig1 . accordingly , when the cover is shut , the lug on the screen cover matches the groove on the profile of the screen frame as shown on fig1 . thus , the confinement provided by the interengagement “ lug in frame — groove in cover ” and “ groove in frame — lug in cover ” provides for the movement of the screen cover within the screen frame for the rear side installation type as shown on fig1 . an additional embodiment of the utility model is provision of the heterogeneous moiré surface of the cover and / or front side of the screen frame . the said embodiment allows painting directly on the screen cover . thus , the screen , as presented hereinbefore , without any limitations , reduces the time of the opening / shutting step of the screen cover , enhancing hereby the reliability and user - friendliness . the notion “ front side installation ” used in this application , signifies the model for installation of the screen cover in the screen frame as shown on fig1 . the notion “ rear side installation ” used in this application , signifies the model for installation of the screen cover in the screen frame as shown on fig1 . the notion “ engagement ” used in this application , signifies fastening of one element relative to the other element without the possibility of correlative dislocation when external action occurs . the notion “ clamping ” used in this application , signifies fastening of one element relative to the other element with the possibility of correlative dislocation when external action occurs . the notion “ resilience ” used in this application , signifies a property which is described by the theory of resilient and plastic strain for material used for the fabrication of the cover with the l - shaped holder . unless stated otherwise , the technical and scientific terms used in this application have meanings that can be understood by those skilled in the art . all the patents , applications , published applications and other publications as well as definitions from the databases are included in this application by means of reference . when there is any contradiction or difference between the definitions in this part and definitions which are included or cited in any other patents , applications , published applications and other publications as well as definitions from the databases , only the definitions mentioned in this part shall be deemed valid . rectangular screen made of abs plastic , − 336 mm high , 236 mm wide . width of the frame profile is 20 mm . the diameter of openings is 4 . 4 mm . the offset to openings is 47 mm . the distance between the centers of the l - shaped holders is 150 mm . the grooves on the frame profiles and the screen cover are 1 . 5 mm . the engaging element is installed into the l - shaped holder by means of thread . the moiré pattern is applied onto the surface of the front side of the frame and the cover . rectangular screen made of ps plastic , 197 mm high , 291 mm wide . width of the frame profile is 20 mm . the diameter of openings is 4 . 4 mm . the offset to openings is 81 mm . the distance between the centers of the l - shaped holders is 190 mm . the grooves on the frame profiles and screen cover are 5 mm . rectangular screen made of bs plastic , 291 mm high , 291 mm wide . width of the frame profile is 30 mm . the diameter of openings is 4 . 4 mm . the offset to openings is 81 mm . the distance between the centers of the l - shaped holders is 190 mm . the grooves on the frame profiles and screen cover are 3 mm . the engaging element is installed into the l - shaped holder by means of interlock . the moiré pattern is applied onto the surface of the front side of the frame and the cover . 1 . the screen cover is installed so as to direct the groove toward the lug on the screen frame on the front side . the screen is installed in the pocket where the production assemblies are located . a slight effort suffices to open the screen cover on the groove side ( fig8 ). doing same procedure on the lug side ( fig9 ) clamps the cover in place . 2 . the screen cover is installed so as to direct the groove toward the lug on the screen frame on the rear side . the screen is installed in the orifice where the production assembly is located in order to obtain one single “ area ” with the wall . a slight effort suffices to open the screen cover on the groove side ( fig1 ). doing same procedure on the lug side ( fig1 ) clamps the cover in place . the description above illustrates the technical essence of the said utility model with the examples provided herein . it should be understood that various changes and modifications may be made the rein without departing from the spirit or scope thereof . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims .	4
fig1 shows a hardware platform that may be used to implement a media system 100 . in fig1 , the media system 100 includes a central processor 102 that may be connected to an i / o controller hub 110 . the i / o controller hub 110 may be used to provide communication between the processor 102 and a variety of peripheral components . in fig1 , the peripheral components include a user interface 147 , a primary storage device 160 , a secondary storage device 165 and an audio i / o subsystem 145 . interface 147 provides a point of interaction or communication between a user and the system 100 . for example , interface 147 may include a display and a number of different push buttons or the like . the display may be used to prompt the user for data and / or control input while the buttons may be used to enter the data and / or control input . interface 147 additionally , or in the alternative , may include a video display and keyboard such as those used in personal computer systems . playback , track selection , fast - forward , fast - reverse , record , and playback volume , without limitation , are among the many control inputs that may be initiated through the buttons or other input devices of the user interface 147 . similarly , song / media selection lists , song / media names , song / media artists or other media information may be provided on the display of user interface 147 . the information and prompts displayed to the user as well as the media that is selected by the user for playback through the system 100 may be coordinated with one another through software executed by the processor 102 . the media system 100 includes a primary storage device 160 and a secondary storage device 165 . the primary storage device 160 may include a device where information is kept such as one or more hard disk drives that are used to store files containing media such as video and / or audio . the files of the primary storage device 160 may be stored in one or more predetermined data formats that , for example , may include lossy as well as lossless formats . for example , the primary storage device 160 may include audio files that have been encoded using mp3 , adpcm , flac , and / or vorbis codecs . additionally , wav and / or aiff audio files may be stored on device 160 . the secondary storage device 165 may be adapted to access media files , such as digital audio and / or digital video files , that are stored on a removable storage medium . the removable storage medium , for example , may be an optical medium . in such instances , the secondary storage device 165 may include one or more optical disk drives . the disk drives may be capable of reading and / or writing audio cd disks , audio dvd disks , super audio compact disks , video dvd disks , video cd disks , multimedia cd disks , and multimedia dvd disks . the formats used to store the media files on the optical medium may be selected from the same formats used to store media files on the primary storage device 160 . the secondary storage device 165 may be adapted to access , without limitation , cd audio disks formatted in accordance with the redbook specification . similarly , the secondary storage device 165 may be adapted to access dvd video disks that have been formatted in a standard manner used to commercially distribute movies . media files on the secondary storage device 165 may be recorded to the primary storage device 160 and played through the audio i / o subsystem 145 . in the following examples , it is assumed that audio files of an audio cd are to be recorded to the primary storage device 160 , and that each audio file stored on device 160 corresponds to a track of the audio cd . fig2 through 4 show processing operations that may be used to accomplish this function . the operations may be implemented through software that is executed on the hardware platform such as that shown in fig1 . however , other hardware / software combinations may also be used to implement the media system 100 and the preemptive digital data extraction operations . the exemplary process begins at operation 200 , where the media system 100 determines whether an audio cd ( or other media storage medium ) has been inserted into the secondary storage device 165 . upon insertion of an audio cd , the media system reads the table of contents of the audio cd at operation 205 . at operation 215 , the recorded status of the cd may be checked to determine whether one or more of the audio tracks of the cd have been previously recorded to the primary storage device 160 . to this end , the system 100 may query database 210 . the result of the database query may be used to set the appropriate case scenario for subsequent processes . the first case scenario , case # 1 , is shown at operation 220 . in this scenario , none of the tracks of the audio cd have been previously recorded . some other cases are indicated at link 225 , which continues on fig4 . at operation 230 , the system 100 calculates the starting point and ending point of each audio track . these calculations may be stored in a record or corresponding file on the primary storage device 160 for subsequent use in accessing the tracks at the proper location on the audio cd . the system 100 may compare the access time of the secondary storage device 165 to a predetermined threshold value at operation 235 . this comparison may be implemented in real - time , near real - time , or after a delay by measuring the access time to determine whether it is equal to or above the threshold value . in another implementation , operation 235 may be deemed unnecessary provided that the access time is known to be sufficiently low to proceed to operation 240 . in either instance , operation 240 may be skipped if the access time is below a particular threshold value . operation 240 involves recording a predetermined portion of each audio track ( or each audio tracks selected for recording by the user ) of the audio cd to the principal storage device 160 . for example , about the first 5 - 10 seconds of each audio track may be preemptively recorded to the principal storage device 160 to reduce subsequent playback latency . as each track is preemptively recorded , a corresponding entry of this fact may be provided in the media database 210 for use in subsequent processing operations . once the preemptive recording of the tracks at operation 240 is completed or almost completed , the system 100 may begin recording complete audio tracks at operation 245 . the sequence in which the audio tracks are completely recorded from the audio cd to the primary storage device 160 may vary . in a relatively simple form , the system 100 may begin complete recording in a sequential manner , for example , starting with the lowest number audio track and proceeding until the highest number audio track has been recorded . when an audio track has been completely recorded to the primary storage device 160 , the system 100 checks at operation 250 to determine whether all audio tracks of the cd have been transferred . if not , the recording process returns to operation 245 . after all audio tracks that are requested have been recorded , the process terminates at operation 255 . processing operations 245 through 255 are executed in the foregoing manner assuming that a track selection event does not occur . however , in some instances the user may wish to play back a track during the recording process . further , the user may wish to switch between tracks during the recording process . to this end , a track selection event 260 may occur such as the one shown in fig2 . fig2 represents , for example , a change in the track that is played back through the system 100 . the track change may be initiated by the user through the user interface 147 , which may include a point of connection to push buttons , switches , or the like , that allow the user to advance through the audio tracks in either the forward or reverse directions . another type of track selection event occurs when the audio from one track has been completely or almost completely played and the audio for a subsequent track has been queued for playback . fig3 illustrates how the media system 100 may respond to a track selection event . when a track selection event 260 occurs , the media system 100 may execute a track selection event process at operation 300 . at operation 305 , the system 100 checks the media database 210 to determine whether the newly selected track has been completely recorded or almost completely recorded to the primary storage device 160 . if it has not been fully recorded or almost completely recorded , the initial audio segment of the newly selected track stored at operation 240 is played back at operation 310 from the principal storage device 160 and the remaining portion of the newly selected track is completely transferred to principal storage device 160 at operation 315 . playback of the newly selected track beyond the initial audio segment may continue from the principal storage device 160 since the recording process has a head start on the playback process . additionally , the recording process and playback process may occur concurrently when the access time of the secondary storage device 165 is below the threshold that is checked at operation 235 . if the newly selected track has previously been fully recorded to the principal storage device 160 , the media system 100 may continue recording the previously selected track at operation 320 until the previously selected track has been completely transferred to the principal storage device 160 . the newly selected track is played as the previously selected track is concurrently recorded to the primary storage device 160 . alternatively , complete recording of requested tracks may proceed in accordance with another track sequence . in either instance , once the previously selected track is completely or almost completely recorded at operation 320 or the newly selected track is completely or almost completely recorded at operation 315 , the media system 100 checks to determine whether all audio tracks have been recorded to the principal storage device 160 at operation 325 . if not , the tracks that have not been recorded are transferred to the principal storage device 160 at operation 330 . if all tracks have been recorded , the process may terminate at operation 335 . fig4 illustrates other cases that may occur at link 225 of fig1 . in case # 2 , as shown at operation 400 , a check of the media database 210 indicates that only a subset of the total number of tracks of the cd have been previously recorded to the primary storage device 160 . it is assumed that the user has requested playback of a particular track when the cd was inserted into the secondary storage device 165 . accordingly , the media system 100 begins playing the requested track from the primary storage device 160 at operation 405 . a check is made at operation 410 to determine whether the remaining portion of the requested track has been recorded to the primary storage device 160 . the record for the requested track may be accessed from media database 210 to make this determination . to this end , the media database 210 may include one or more fields indicating whether a given audio track has been partially recorded or completely recorded . the course taken by the process of fig4 depends on whether the requested track has been completely recorded or only partially recorded to the primary storage device 160 . if the audio track only has been subject to partial recording , complete recording of the track as it is played back by the media system 100 takes place at operation 415 . at operation 420 , the media system 100 monitors the recording process for completion . when recording of the requested track has been completed , a check is made at operation 425 to determine whether all of the audio tracks of the cd have been recorded to the primary storage device 160 . if not , recording of the remaining audio tracks may continue at operation 430 until all requested tracks of the cd have been completely recorded , at which point the process is completed at operation 435 . if a determination is made at operation 410 that the requested audio track has been completely recorded to the primary storage device 160 , the media system 100 continues playing the requested track from the primary storage at operation 440 . while the requested track is playing , the media system proceeds to operation 425 to determine whether all of the audio tracks of the cd have been recorded to the primary storage device 160 . if not , recording of the remaining audio tracks continues at operation 430 until all tracks of the cd have been completely or almost completely recorded , at which point the process is completed at operation 435 . in case # 3 , as shown at operation 445 , it is assumed that all of the tracks of the cd have been recorded to the primary storage device 160 . the media system 100 may respond to the insertion of a cd that has been completely recorded as though the user requested playback of the audio files from the primary storage device 160 . this operation is illustrated at operation 450 . alternatively , the media system 100 may respond to the insertion of the cd as though the user has requested re - recording of one or more of the audio tracks to the primary storage device 160 . to this end , the user may be prompted through the user interface 147 to select which audio tracks , if any , are to be re - recorded . otherwise , prompting of the user may be skipped and re - recording of all tracks begun in the manner shown in fig1 . this latter option may be useful in those instances in which one or more of the audio files stored on the primary storage device 160 have become corrupted . the sequence in which audio files are preemptively recorded may be optimized in accordance with a track selection probability density function . this increases the likelihood that a track selected for playback by the user will have a corresponding initial audio segment on the primary storage device 160 when the user initiates or the system otherwise experiences a track selection event . as a result , the likelihood that a user will or may experience unacceptable latency between track selection and the start of track playback will be reduced as well . the sequence in which complete audio tracks are recorded from the cd to the primary storage device 160 may also be optimized in accordance with a track selection probability density function . the probability density function may be the same as the one used for preemptive recording or may be different and determined from other design criterion . one probability density function is shown in fig5 , which is a plot showing the probability that a particular track will be selected by the user versus the audio track number . in this exemplary profile , it has been assumed that the average cd includes fifteen audio tracks . the plot of fig5 illustrates a probability density function in which the probability of selection linearly declines with increasing audio track number . in such instances , preemptive recording may begin with the lowest number track and proceed incrementally , track by track , until the highest numbered track has been preemptively recorded , after which the media system 100 may proceed with complete recording of each audio track in either a calculated sequence or other predetermined sequence . it will be recognized , however , that other probability density functions may also be employed . a probability density function may also be derived from the operating habits of the user . for example , the media system 100 may monitor which audio track numbers are most frequently selected by the user . one manner in which this may be done is shown in fig6 . in this exemplary process , the system 100 monitors track selection inputs from the user at operation 600 . a record of the track selection inputs from the user may be maintained , for example , in a file table or the like on the primary storage device 160 . the media system 100 may wait until a predetermined number of track selection inputs have been detected before proceeding to operation 605 , at which point the media system 100 derives a probability distribution function from the track entry data . waiting until a predetermined number of selection inputs have been detected may assist in increasing the accuracy of the probability distribution function . the resulting probability density function may be stored at operation 610 for subsequent use during the preemptive recording operation 240 of fig2 . similarly , the recording of complete audio files at operation 245 of fig2 may access the resulting probability density function to determine the sequence in which the audio tracks are to be completely recorded to the primary storage device 160 . although this example illustrates the generation of a probability density function , other probability distribution methods may be used to determine the sequence of the preemptive recording and / or complete recording . the particular probability determination that is used may be dependent on design constraints imposed by the requirements of the system 100 . an exemplary probability density function derived by monitoring the track selection habits of the user is illustrated in fig7 . in this example , audio track 1 has the highest probability of selection . accordingly , the media system 100 may begin preemptive recording of a cd with audio track 1 . the audio track having the next highest probability of selection in this example is audio track 8 . consequently , the media system 100 may continue preemptive recording of a cd with audio track 8 once the preemptive recording of audio track 1 is completed . once audio track 8 has been preemptively recorded , the preemptive recording process continues with audio tracks having successively lower selection probabilities . audio tracks having lower selection probabilities are preemptively recorded after audio tracks having higher selection probabilities until all audio tracks have been preemptively recorded . a similar process sequence may be followed for complete recording of the audio tracks to the primary storage device 160 . the media on the primary storage device 160 may be stored using one or more lossless or lossy compression formats . lossy compression formats may be used in those instances in which the number of media files per storage unit on the primary storage device 160 ( i . e ., audio files / megabyte ) is to be maximized . in these instances , lossy compression formats , such as the mp3 format , may be used . encoding of the audio file to the appropriate format may be executed by , for example , processor 102 during the recording process as each audio track is transferred to the primary storage device 160 . alternatively , each audio track may be recorded to a corresponding media file in a lossless compression format and subsequently encoded to a lossy format to reduce the amount of storage space utilized by the file . the particular lossy and / or lossless compression format that is to be used by the media system 100 to record audio tracks from the secondary storage device 165 may be selected by the user through the user interface 147 . the audio subsystem 145 shown in fig1 also may include components that are suitable for playing back audio files that have been stored using one or more compression formats . in the exemplary audio subsystem 145 , audio may be played from the primary storage device 160 . it will be recognized , however , that other system designs may use the secondary storage device 165 as the principal playback device . while the foregoing processing sequences have included preemptive recording of audio track files , it will be recognized that such sequences may likewise be adapted to preemptively record and playback other media files , such as dvd video and its corresponding audio . when applied to dvd video , predetermined portions of various video chapters of the dvd may be preemptively recorded in the manner described above . while various embodiments of the invention have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible within the scope of the invention . accordingly , the invention is not to be restricted except in light of the attached claims and their equivalents .	6
the apparatus shown in fig1 includes a first scrubber 11 and a second scrubber 13 . in the first scrubber 11 the gas to be treated is reacted with h 2 so 3 and in the second scrubber 13 , the gas product of the reaction in the first scrubber is reacted with an alkaline solution , typically naoh , an aqueous solution , of 2 to 25 % by weight , preferably 4 - 10 % by weight . the gas to be treated is injected into the first scrubber at its gas input 15 . the first scrubber 11 includes a source 17 of h 2 so 3 which is supplied to a second input 19 . the h 2 so 3 reacts with the no x in scrubber 11 . the gaseous product of this reaction is predominately n 2 o 3 . this product is supplied to scrubber 13 through input 21 . at another input 23 to scrubber 13 , an alkaline solution from a source 25 is supplied . this solution is typically caustic soda , naoh , or potassium hydroxide . the treated gas free of no x is derived from output 27 of scrubber 13 . the liquid product of the reaction of the n 2 o 3 and the alkaline solution is derived from output 29 of scrubber 13 and is treated as waste . fig2 a and 2b together show apparatus 31 for treating gas containing no x . this apparatus includes an upstream water pre - scrubber 33 , an h 2 so 3 scrubber 35 and an alkaline - solution scrubber 37 . a blowdown stripper 39 is cooperatively connected to the h 2 so 3 scrubber 35 and a blowdown oxidizer 41 is cooperatively connected to the alkaline solution scrubber 37 . there is also a source of so 2 which may be one or more bottles or cylinders 43 . ancillary components including pumps , valves and indicators are associated with each of the scrubbers . the upstream water scrubber 33 includes a scrubbing tower 45 and a scrubber recycle tank 49 . the tower 45 has packing which may be of suitable type such as pall rings or the packing disclosed in u . s . pat . no . 4 , 238 , 386 to bernard j . lerner . the tower 45 is vertical and has a gas inlet 51 below the packing and an inlet or header or header 53 above the packing . the gas to be treated containing the no x flows through inlet 51 and water or recycle acid is supplied to a distributor 55 through inlet 53 . the liquor flows through the packing in countercurrent - flow relationship to the gas absorbing a fraction of the no x and any hcl from the gas to be treated . the resulting liquid flows into tank 49 . in its top , the tower 45 has an outlet 57 for the treated gas . this outlet is connected to duct 58 . water or recycle acid for the distributor 55 is derived from the tank 49 . the tank 49 has an outlet 59 in its base which is connected to inlet 53 through a line 61 which includes a valve 63 , a pump 65 , a temperature indicator 67 and a valve 69 . the pump 65 drives the liquor from tank 49 to the distributor 55 . the water or dilute hno 3 flowing from the distributor reacts with the gas in the packing 47 to produce nitric acid . the nitric acid may be removed batchwise or continuously through a branch line 73 including valve 74 when it reaches a predetermined concentration . pressure of the liquid discharged from the pump is measured in branch line 75 which includes indicator 77 and valve 82 . the liquor in tank 49 may be replenished through a makeup water line 79 which includes control valve 72 and 76 and check valve 78 . the valve 76 is controlled dependent upon the level of the liquid in tank 49 . the valves 63 , 69 , 71 and 74 may be manually operable by the attendant of the apparatus or all or some of these valves may be responsive automatically to conditions in the system such as the concentration of the hno 3 in the recycle liquor . the h 2 so 3 scrubber 35 , like the scrubber 33 , includes a vertical scrubbing tower 81 and a recycle tank 83 . the tower 81 has packing 85 similar to the packing in tower 45 , an inlet 87 for the gas from tower 45 , an inlet or header 89 for the recycle liquid h 2 so 3 solution and an outlet 91 for the treated gas . the outlet 91 is connected to duct 93 . through inlet 89 , the recycle h 2 so 3 solution is supplied to the distributor 95 . the h 2 so 3 solution is distributed over the packing 85 and flows in countercurrent relationship to the gas entering the tower from duct 58 through the gas inlet 87 , and drains into recycle tank 83 . the h 2 so 3 solution reacts with the no x content of the input gas exothermically . the duct 58 is connected to the tower gas inlet 87 through a junction 60 which may be a t - joint and inclues a branch 97 for supplying supplementary air to tower 81 if no oxygen is initially present in the gas in duct 58 . in addition , so 2 is supplied to inlet 87 from tank 43 through a valve 99 and a rotameter 101 which measures the flow rate of the so 2 into inlet 87 . the recycle tank 83 has an outlet 105 which is connected to the distributor 95 through a line 107 which includes valve 109 , pump 111 ( fig2 a ), temperature indicator 113 , valve 112 , heat exchanger 115 , temperature indicator 116 , and tower inlet header 89 . the pump 111 circulates the liquid from tank 83 to the distributor 95 . a branch line 117 including valve 119 is connected to line 107 for removing liquid from tank 83 under predetermined conditions . pump discharge pressure in line 107 is measured by a pressure indicator 123 ( fig2 a ). the recycle liquid passing through heat exchanger 115 is cooled by coolant which flows through the primary tubing ( not shown ) of the exchanger through inlet line 127 , including valves 129 and 131 and temperature indicator 133 and outlet line 135 including temperature indicator 137 and valves 139 and 141 . valves 129 and 131 may be controlled in accordance with the measurement of indicator 133 and valves 139 and 141 may be controlled in accordance with the indications of 137 . at the start of an no x removal operation tank 83 contains water . initially , the valve 99 responding to the oxygen - reduction - potential controller 103 is fully open so that substantial quantities of so 2 are fed into tower 81 . the so 2 reacts with the recycle water from tank 83 producing h 2 so 3 in increasing concentraton . as the concentration of h 2 so 3 increases , the controller 103 causes valve 99 to be throttled reducing the flow of so 2 appropriately . during operation , the liquid in tank 83 will contain hno 2 , hno 3 , h 2 so 4 and h 2 so 3 . when the concentrations of these acids reaches limited or predetermined magnitudes , the liquid in tank 83 is drawn off through valve 119 or through branch line 143 to the blowdown stripper 39 . line 143 includes valve 145 . the water in tank 83 is replenished through line 147 including control valve 149 and check valve 153 . valve 149 may be controlled in accordance with the level in tank 83 . instead of being fed directly into the scrubber tower 81 , the so 2 may be supplied to tank 83 or to the circulating liquid prior to the operation of scrubber 35 . if this procedure is adopted , half the quantity of so 2 necessary for saturation of the liquid in tank 83 may be supplied to the tank before operation . during operation , the so 2 may be admitted to the scrubber 81 at a reduced rate . the blowdown stripper 39 includes tank 213 . air is forced through this tank 213 by compressor 215 . the air strips the so 2 from the liquid which flows into the tank through line 143 and feeds it back into input 87 of h 2 so 3 tower 81 through duct 217 . the air supplied by compressor 215 also flows into tower 81 . the liquid from the tank 213 also flows to a waste treatement facility ( not shown ) through line 219 . this liquid includes h 2 so 4 and hno 3 and flows into a mixing tank 220 . the alkaline - solution scrubber 37 , like scrubbers 33 and 35 , includes a vertical scrubbing tower 155 and a recycle tank 157 into which the liquid from the tower drains . the tower 155 includes packing 159 similar to the towers 45 and 81 , an inlet 161 for the gas in duct 93 , an inlet or header 163 for alkaline solution and a top outlet 165 for the treated gas . the outlet 165 is connected to the blower 167 which exhausts the treated gas to the atmosphere and maintains a small negative pressure ( suction ) in the ducts 58 and 93 . the gas from duct 93 is supplied to the bottom of packing 159 and the treating alkaline liquid is supplied to a distributor 169 on top of the packing 159 . the tank 157 contains alkaline solution typically naoh or koh . the concentration of the alkali may be between 1 and 20 %, but is typically about 4 or 5 %. the alkaline solution absorbs and reacts with the reactive forms of no x derived from the first - stage 35 . tank 157 has an outlet 171 . liquor from this outlet is recycled to the distributor 169 through line 173 including valve 175 , pump 177 , temperature indicator 179 , valve 181 , heat exchanger 183 , temperature indicator 185 and inlet 163 . the alkaline solution from distributor 169 flows through the packing 159 in countercurrent flow to the gas from duct 93 . the alkaline solution absorbs and reacts with the reactive forms of no x derived from the first - stage 35 . the product of this reaction may include nitrites , sulfites , nitrates and sulfates . a branch line 187 including valve 189 is connected to line 173 for draining off the liquid in tank 157 as desired . this liquid is also discharged to blowdown oxidizer 41 through branch line 191 , which includes valve 193 in the pump discharge branch line . pressure in line 173 is measured by indicator 195 in branch line 197 which includes valve 199 . the water in tank 157 is replenished through line 201 which includes control valve 203 and check valve 207 . alkaline solution is supplied to tank 157 through line 209 which includes valve 211 . typically , the makeup alkaline solution supplied has a concentration of about 50 %. valve 203 is controlled in accordance with the level in tank 157 . the primary tubing ( not shown ) of heat exchanger 183 is supplied with coolant through inflow duct 200 and outflow duct 202 . inflow duct 200 includes valve 204 and temperature indicator 208 and outflow duct 202 includes valve 210 and temperature indicator 214 . the blowdown oxidizer includes tank 221 . tank 221 is supplied with air by compressor 223 . the air oxidizes the sulfites and nitrites which flow into tank 191 from tank 157 . where the alkaline solution is naoh , the nitrites and sulfites are predominately nano 2 and na 2 so 3 . these are reducing agents whih have a high chemical oxygen demand ( cod ) injurious to marine life . they are converted in the tank 221 to harmless or beneficial nano 3 and na 2 so 4 . the output of tank 221 flows into mixing tank 220 . the liquid from tank 157 includes alkaline solution , typically naoh . this solution reacts with the h 2 so 4 and hno 3 in mixing tank 220 . the output of tank 221 flows into mixing tank 220 which also receives the output of tank 213 . the outputs of tanks 213 and 220 react to neutralize each other partially or wholly . the output of mixing tank 220 flows into the waste treatment facility . tests to evaluate the efficacy of the invention were conducted with the apparatus shown in fig3 . this apparatus includes a plurality of bubbler flasks 241 , 243 and 245 . each flask is provided with a stopper 247 . a long inlet tube 249 , 251 , and 253 extends into each flask through its stopper 247 . each inlet tube terminates near the bottom of its flask . a short outlet tube 255 , 257 and 259 extends into each flask through its stopper . each outlet tube terminates near the top of its flask . the apparatus shown includes a compressed air line 261 , an no 2 cylinder 263 and an so 2 cylinder 265 . the compressed air line 261 , the no 2 cylinder 263 , and the no 2 cylinder 265 are connected in parallel to inlet tube 249 . the compressed air line is connected to inlet tube 249 through a valve 267 and a rotameter 269 ; the no 2 cylinder 263 is connected to the tube through a valve 271 , an infra - red heater 273 and a rotameter 275 ; the so 2 cylinder 265 is likewise connected through valve 277 , heater 279 and rotameter 281 . the heaters 273 and 279 serve to prevent the formation of so 2 or no 2 liquid when the valves 271 and 277 are opened . the short outlet tube 255 of flask 241 is connected to long tube 251 of flask 243 and the short outlet tube 257 of flask 243 is connected to long inlet tube 253 of flask 245 . the treated gas is emitted from short tube 259 in flask 245 and is observed against the background of a white paper 283 . the gas may also be observed in flask 245 . prior to a test , water is poured into flask 241 . the level of the water is near the top of the flask but below the end of outlet tube 255 . also , the alkaline solution to be investigated is poured into flask 243 to a level near the top of the flask , but below the end of outlet tube 257 . flask 245 is empty . the flow of compressed air is then started . if flask 241 is to contain h 2 so 3 , the appropriate quantity of so 2 is bled into flask 241 through inlet tube 249 under the action of the compressed air . during the test , no 2 is fed into flask 241 through inlet tube 249 under the action of the compressed air . the emission into and through flask 245 is then observed . when the no 2 breaks through , a reddish - brown color is seen against the white paper 283 . the time which elapses between the start of the injection of the no 2 and the appearance of the reddish - brown color is measured . a short interval indicates that the h 2 so 3 and / or the solution in flask 243 are ineffective in absorbing the no 2 ; a long interval indicates that the h 2 so 3 and the alkaline solution are effective in removing no 2 . the results of a series of tests are shown in the following table iii : table iii__________________________________________________________________________ flask 241 flask 243 air no . sub . 2 so . sub . 2run break thru 500 grms . 500 grams . cc cc ccno . time ( min ) solution solution min . min . min . comments__________________________________________________________________________ 93 33 . 8 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 2 white mist as usual 500 ppm colors as usual ppd 94 19 . 2 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 100 ppm ppd 95 23 . 1 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 200 ppm ppd 96 26 . 7 5 % naoh 500 300 air 1600 cc / min . 20 min . before 5 % na . sub . 2 so . sub . 3 200 ppm ppd 97 14 . 3 5 % naoh 500 300 air 1600 cc / min . 20 min . before 5 % na . sub . 2 so . sub . 3 98 18 . 3 5 % naoh 500 300 air 1600 cc / min . 20 min . before 5 % na . sub . 2 so . sub . 3 99 16 . 5 5 % naoh 500 300 air 1600 cc / min . 20 min . before 5 % na . sub . 2 so . sub . 3100 21 . 65 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 sol . beige before air 500 ppm sol . dark cream w / air tbhq no white smoke during run during run sol . gets lighter color - light yellow101 13 . 7 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 sol . yellow before air 500 ppm wine red after propyl gal . during run sol . color lightens102 6 . 1 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3103 15 . 25 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 sol . amber - deepens w / no . sub . 2 200 ppm much white smoke ppd104 16 . 33 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 much less amber color before run 200 ppm ppd105 17 . 45 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 white smoke - very heavy ( obscures end 400 ppm point ) ppd106 17 . 7 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 light white mist ( smoke ) ( acid ) 50 ppm ppd107 15 . 45 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 acid mist as before 50 ppm solution amber ppd108 14 . 75 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 sol . begins w / slight amber cast 50 ppm deep amber w / air - clears w / no . sub . 2 tbhq white acid mist w / 50 ppm ppd109 13 . 25 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 colors and mist same as # 108 50 ppm tbhq110 10 . 00 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3111 13 . 1 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 20 ppm ppd112 7 . 6 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3113 11 . 6 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 100 ppm tbhq114 12 . 9 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 100 ppm tbhq 5 ppm ppd115 10 . 9 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 small amount of white mist 200 ppm triethanol am . 116 8 . 3 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 small amount of white mist 200 ppm benzyl alchl . 117 6 . 25 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 moderate amount of mist colors 200 ppm immediately sugar118 9 . 0 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 moderate white mist colors within 200 ppm first 2 min . of run sugar119 12 . 7 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 much white mist 200 ppm mond - ethanol amine120 16 . 5 5 % naoh 500 300 air 1600 cc / min . 20 min . before 2 % na . sub . 2 so . sub . 3 100 ppm mixed inh . 1 : 10 : 100 ppd tbhq : mea121 0 . 6 h . sub . 2 o sat . 500 300 so . sub . 2 in am . run 2 pm w / so . sub . 2122 4 . 25 h . sub . 2 o sat . 500 300 run immediately w / so . sub . 2 lots of moisture123 2 . 30 h . sub . 2 o 500 300124 11 . 3 h . sub . 2 o sat . 500 300 a lot of moisture . sol . turns violet w / so . sub . 2 late in run . sol . gets very warm during run . gas evolves after run . 125 17 . 3 h . sub . 2 o sat . 500 300 sat . and allow to sit 1 hr . brown w / so . sub . 2 cloud immediately , disappears in few seconds . blue liquid forms in outlet line from flask . 126 48 . 5 h . sub . 2 o sat . 5 % naoh 500 300 brown cloud forms in 241 immediately , so . sub . 2 which disappears in few seconds . froth - ing blue liquor in line between # 1 and # 2 . sol . # 1 slightly warm . sol . # 2 very warm . 127 8 . 5 * h . sub . 2 o sat . 500 300 100 white solid forms in outlet line , in - * step 1 w / so . sub . 2 creasing so . sub . 2 rate reverses end - point . 128 66 . 3 h . sub . 2 o 5 % naoh 500 300 300 white solid forms in inlet 249 to flask 241 frothing blue liquor forms in line between 241 and 243 . brown gas in line between 241 and 243 . end point is very sharp . 241 sol . slight warm . 243 sol . very warm . white solids finally plug line . 129 50 . 3 h . sub . 2 o sat . 5 % naoh 500 300 trickle sat . w / so . sub . 2 before run . reintroduce so . sub . 2 w / so . sub . 2 5 min . into run . no white solids build up . solutions not so warm as before . at end , increase so . sub . 2 to 300 cc / min . 56 min . 243 sol . turned violet . 59 . 6 min . second breakthru . 130 50 . 4 h . sub . 2 o 5 % naoh 500 300 300 duplicate # 128131 77 . 8 h . sub . 2 o 5 % naoh 500 300 150 so . sub . 2 start first . some clogging from white solids near end of run . 243 sol . turned violet just before break thru . 132 60 . 7 h . sub . 2 o 5 % naoh 500 300 150 forced to terminate because of plug - ging with white solids . 133 see 5 % naoh 500 300 small amount brown gas immediately . comments 2 . 5 min . copious brown gas . 7 . 5 min . increase so . sub . 2 700 cc / min . for 1 min .- gas reduced . 9 . 5 min . copious brown gas as before . sol . very hot . 134 immed . 5 % naoh 500 300 so . sub . 2 700 cc / min . 2 min . before - brown gas immediately . solution__________________________________________________________________________ hot . in table iii , the numbers in the left - hand column identify the run or test , the no 2 breakthrough time in minutes is in the second column from the left , the content of alkaline solution in flask 241 is in the third column , the content of h 2 so 3 in flask 243 is in the fourth column , the flow of compressed air in cubic centimeters per minute is in the fifth column , the flow of no 2 in cc per minute in the sixth column , and the flow of additional so 2 in cc per minute is in the seventh column . the eighth column describes other parameters of the tests and unusual observations . the initial portion of the program , represented by runs 93 through 120 in table iii , was an investigation of the possibility of inhibiting the oxidation of single - stage sodium sulfite or caustic / sulfite solutions when used to absorb no x from air . for the usual case where no x is admixed with air or oxygen , the sulfite solution is rapidly oxidized to sulfate , rendering the solution ineffective . the uninhibited - solution runs 97 - 99 show an average of 16 . 3 minutes for no x color breakthrough time . the various oxidation inhibitors tried included paraphenylene diamine ( ppd ), tributylhydroquinone ( tbhq ), propyl gallol , triethanolamine , benzyl alcohol , and sugar , none of which significantly improved the breakthrough time , and most of which depressed the breakthrough time . experiments omitting the sulfite and caustic , and using a single - stage sulfurous acid scrubbing solution , runs 121 - 122 and 124 - 125 , showed some interesting solution color change behavior , but no improvement on no x breakthrough time . the &# 34 ; discovery &# 34 ; run , run 126 , used the two stages of scrubbing in series h 2 so 3 followed by 5 % naoh , and gave a breakthrough time of 48 . 5 minutes . the blue liquid observed in the line between the two bubbler flasks is suspected of being n 2 o 3 , which is a blue liquor , but no positive identification of this material could be obtained because of its unstable nature . the results of tests 126 and 128 through 132 demonstrate the efficacy of the invention in removing no 2 . while preferred embodiments of this invention have been disclosed herein , many modifications thereof are feasible . this invention is not to be restricted except insofar as is necessitated by the spirit of the prior art .	2
referring now to the figures of the drawing in which , unless otherwise indicated , same reference numerals denote same parts throughout , and first , particularly , to fig1 thereof , there is seen a semiconductor body in which a region a with self - aligning structure and a further region b are integrated . fig1 shows an early process step within the production process . the semiconductor body structure represented in fig1 may , for example , be attained by process steps as described in the above - mentioned commonly assigned de 44 34 108 a1 . the disclosure of the publication and the corresponding u . s . application is herewith incorporated by reference . the semiconductor body has a p - doped substrate 10 which extends laterally over the entire semiconductor body . in region a , a buried layer 12 is embedded in the substrate 10 . over the buried layer 12 , there is an n - doped epitaxy layer divided by a deep diffusion area 16 extending vertically to the upper main surface of the semiconductor body . a well 14 is formed by means of this in region a . the well 14 later ( cf . fig4 ) supports p - doped wells 18 , which do not extend as far as the buried layer 12 . an insulation layer 22 , here a fox layer , is applied over the entire semiconductor body . the insulation layer 22 is structured by means of a standard photographic technique and wet chemical etching . it is possible for the oxide angle of the insulation layer 22 to be set by low - dose preimplantation or produced by means of a locos process . after this , a gate oxide 37 is applied to the semiconductor body in predetermined regions . in the next step , a semiconductor layer 24 , for example a heavily doped polysilicon layer , is formed on the structured insulation layer 22 and the gate oxide layer 37 . the semiconductor layer 24 is doped to high conductivity with a furnace process . from this semiconductor layer 24 , future gate electrodes are produced in region a , and , for example , resistors , interconnections , magnetoresistors or further gate electrodes in region b . in the next step , a further insulation layer 26 is applied surface - wide to this semiconductor layer 24 . this insulation layer 26 may be a single layer or a multiple tier layer . fig1 shows the structure described so far . the insulator layer 26 may , for example , be a teos layer . in a preferred embodiment , the insulator layer 26 is a double layer of a doped oxide and an undoped oxide . as can be seen from fig2 the insulation layer 26 is structured in the next process step by means of a photographic technique and subsequent etching process , in such a way that it is fully removed in region b and at least still partially remains in region a , where the self - aligning contacts are intended to be . the etching process may , for example , be carried out by wet chemical etching . in the illustrative embodiment which is represented , the insulation layer 26 is present to the left of the deep diffusion area 16 , while it is etched off over the deep diffusion area 16 and to the right thereof . in this process step , it is absolutely necessary to ensure that the insulation layer 26 remains in the region of the self - aligning contacts to be produced later , that is to say where the p + - doped well 18 is present later in region a ( cf . fig4 ). in a process step which follows , the semiconductor layer 24 and , in sections where the insulation layer 26 still lies over the semiconductor layer 24 , the insulation layer 26 together with the semiconductor layer 24 , are structured in common . the semiconductor body resulting therefrom is represented in fig3 . the above - mentioned etching process serves in region a to etch through the insulation layer 26 and the underlying semiconductor layer 24 as far as the oxide layer 22 . the edges which result therefrom , to which so - called spacers 30 are later applied ( fig4 ), are denoted k in fig3 . in the further regions , where there is no insulator layer 26 on the semiconductor layer 24 , it is merely the semiconductor layer 24 that is structured . in region b , the structured semiconductor layer 24 may be used to produce , for example , interconnections and / or resistors . at the above - mentioned edges k ( fig3 ), a spacer 30 is formed ( fig4 ) in a subsequent process step by applying a further oxide layer 28 using a standard photographic technique together with subsequent etching . the above - mentioned oxide layer 28 , which is firstly applied or deposited surface - wide to the semiconductor body , encloses the semiconductor layer 24 in the region b as well . the semiconductor layer 24 is used in region b as an interconnection or resistor . the oxide layer 28 insulates the semiconductor layer 24 in region b from an overlying metallization layer 32 . in detail , the following further steps may , for example , be carried out after the process step represented in fig3 in order to form the semiconductor body shown in fig4 : forming a further insulation layer 28 surface - wide to the semiconductor body ; structuring the further insulation layer 28 with a photographic technique and etching down to the semiconductor surface ; etching the semiconductor body using the further insulation layer 28 as a mask ; implanting a p + - dopant of the second conductivity type using the further insulation layer 28 as a mask ; and depositing at least one metallization layer 32 , 34 on the semiconductor body . comparing fig4 and 7 shows that , in the process according to the invention ( fig4 ), the metallization layer 32 has to overcome a considerably smaller step , and can therefore be fabricated much more easily than in the prior art process ( fig7 ). in total , this effects a higher packing density in region b of the circuit integrated in the semiconductor body . in summary , according to the novel manufacturing process , the insulation layer 26 needed for the self - aligning technique is later removed in all parts of the semiconductor body where no self - aligning contacts are used . this does , however , require an additional mask plane and etching of the insulator layer . nevertheless these two additional process steps lead to only a slightly higher production cost for the semiconductor body . moreover , this slightly increased production cost permits a higher packing density for the integrated circuit as a whole .	7
note : statements of characteristics herein represent exemplary observations of the cultivar herein and will vary depending on time of year , location , annual weather , etc . ‘ pacific starlet ’ was first identified in a field with other seedlings in may 2010 at watsonville , calif . usa . ‘ pacific starlet ’ was first propagated asexually by crown division in august 2010 in watsonville , calif . usa . the crown on the original plant was dug and parted into basal cane pieces ( approximately 15 cm long ) with root attached and replanted into a selection plot elsewhere on the farm , resulting in a 3 - fold increase . in september 2011 , two actively growing primocanes were dug ( with root attached ) and shipped to lafayette , oreg . usa , where vegetative material was explanted and established in vitro for micropropagation . this propagation method has allowed extensive testing of ‘ pacific starlet ’ and aided in determining that this cultivar is genetically stable . age of plants used for this discussion : crown age of about 3 . 5 years and a cane age of about 8 and 16 months for primocanes and floricanes , respectively . age of plants used for the photographs in the figures : crown age of about 3 . 5 years and a cane age of about 8 and 16 months for primocanes and floricanes , respectively . type of greenhouse covering or growing structure , or field : high tunnel over a field planting . color terminology refers to the colour chart of the royal horticultural society , fifth edition , london , united kingdom ( 2007 ) (“ r . h . s .”). observations for floricanes herein were made in june 2013 . observations for primocanes herein were made in august 2013 . form / shape .— vase . growth habit .— erect . height .— 1 . 9 m as measured from cane base to cane apex . spread .— 40 . 8 cm as measured from lateral leaf tip to lateral leaf tip . propagation method .— division . time to initiate and develop roots .— 24 days . root description .— generally of thick diameter with a smooth , glossy texture . few feeder roots present . ‘ pacific starlet ’ generally produces spawn ( shoots ) from roots with moderate vigor . diameter .— base : 1 . 1 cm \| middle : 0 . 9 cm \| tip : 0 . 3 cm . length .— 1 . 5 - 1 . 9 m . number of nodes .— 37 - 42 . internode length .— base : 3 . 4 cm \| middle : 6 . 5 cm \| tip : 4 . 0 cm . number of canes / hill .— 4 - 6 . cane color .— rhs 144c . spines ( present or absent ).— present . density : base : 28 / cm 2 \| middle : 0 . 5 / cm 2 \| tip : 2 / cm 2 . shape : acute . length : 0 . 05 cm . width : 0 . 01 cm . apex descriptor : lanceolate . color : rhs 181a . vegetative bud shape .— rounded . length : 0 . 3 cm . diameter ( base ): 0 . 2 cm . diameter ( tip ): 0 . 08 cm . color : rhs n200b . texture : mildly pubescent . reproductive bud shape ( base / tip ).— truncate / acuminate . length : 1 . 3 cm . diameter ( base ): 0 . 98 cm . diameter ( tip ): 0 . 12 cm . color : rhs 146c . texture : pubescent . diameter .— base : 1 . 1 cm \| middle : 0 . 9 cm \| tip : 0 . 8 cm . length .— 1 . 9 m . number of nodes .— 14 . internode length .— base : 7 . 2 cm \| middle : 9 cm \| tip : 10 . 8 cm . cane color .— rhs 175a . spines .— present . spine density : base : 28 / cm 2 \| middle : 0 . 5 / cm 2 \| tip : 2 / cm 2 . spine shape : acute . spine length : 0 . 05 cm . spine width : 0 . 01 cm . spine apex descriptor : lanceolate . spine color : rhs 181a . vegetative bud shape .— rounded . length : 0 . 3 cm . diameter ( base ): 0 . 2 cm . diameter ( tip ): 0 . 08 cm . color : rhs n200b . texture : mildly pubescent . reproductive bud shape ( base / tip ).— truncate / acuminate . length : 1 . 3 cm . diameter ( base ): 0 . 98 cm . diameter ( tip ): 0 . 07 cm . color : rhs 146c . texture : pubescent . winter hardiness .— unknown for ‘ pacific starlet ’ outside of usda hardiness zone 9b ( watsonville , calif .). this cultivar is best adapted to the mild coastal conditions of california . drought / heat tolerance .— pollen viability and fruit quality of raspberry generally begins to decline above 30 ° c . this is consistent with observations of ‘ pacific starlet ’. raspberries are generally not drought tolerant , and ‘ pacific starlet ’ has not been tested in unirrigated plots . complete leaf .— length : 19 . 8 cm . width : 17 . 4 cm . number of leaflets : 5 . terminal leaflet .— size : length : 9 . 6 cm . width : 7 . 2 cm . length / width ratio : 1 . 33 . shape of leaf apex : acuminate . shape of leaf base : terminal leaf : cordate . shape of leaf base : basal lateral leaflets : sessile . margin : serrate . texture : mild interveinal puckering . number of serrations / leaf : 96 . shape of serrations : flexuous — concave . color : upper surface : rhs 137a . lower surface : rhs 188c . venation pattern : reticulate . venation color : upper surface : rhs n144d . lower surface : rhs 145b . leaf pubescence density : none , glabrous . color of leaf pubescence : n / a . number of leaflets / leaf : 3 on upper fruiting laterals . 5 on mid - to lower leaves . interveinal blistering : mild . glossiness : low . primocane leaves .— petiole length : 4 . 1 cm . petiole diameter : 2 . 0 cm . petiole color : upper : rhs 137d . lower : rhs 143d . rachis length : 2 . 0 cm . stipule length : 0 . 6 cm . stipules per leaf : 2 . stipule width : 0 . 01 cm . stipule color : rhs n144d . color : upper surface : rhs 137a . lower surface : rhs 188c . terminal leaflet : length : 9 . 6 cm . width : 7 . 2 cm . rachis length : 0 . 8 cm . basal lateral leaflet : length : 7 . 2 cm . width : 4 . 3 cm . petiolule length : 0 . 1 cm . floricane leaves .— petiole length : 4 . 8 cm . stipule length : 0 . 4 cm . stipules per leaf : 2 . stipule width : 0 . 01 cm . stipule color : rhs n144d . color : upper surface : rhs 137a . lower surface : rhs 188c . terminal leaflet .— length : 9 . 0 cm . width : 6 . 0 cm . rachis length : 1 . 7 cm . distal lateral leaflet : length : 8 . 4 cm . width : 6 . 0 cm . petiolule : length : 1 . 7 cm . diameter : 0 . 1 cm . color : upper surface : rhs 137d . lower surface : rhs 143d . basal lateral leaflet .— length : 7 . 2 cm . width : 4 . 2 cm . petiolule length : 0 . 1 cm . diameter : 0 . 1 cm . color : upper surface : rhs 137d . lower surface : rhs 143d . time of flowering ( 50 % of plants at first flower ).— august 5 on primocanes ; april 15 on floricanes . size .— length : 0 . 9 cm . diameter : 0 . 7 cm . fragrance .— none . peduncle .— length : 0 . 8 cm . diameter : 0 . 05 cm . color : rhs 143b . pubescence : present . texture : smooth with few undulations . perianth .— flowering trusses shape : truncate . petals .— color ( upper and lower ): rhs 149d . number per flower : 5 . shape : oblanceolate . length : 0 . 6 cm . width : 0 . 1 cm . apex descriptor : rounded . base descriptor : truncate . margin descriptor : entire . texture : smooth with visible striations . sepals .— quantity : 5 . length : 0 . 6 cm . width : base — 0 . 3 cm . mid — 0 . 1 cm . tip — 0 . 01 cm . color : rhs 145b . apex descriptor : acuminate . margin descriptor : entire . texture : mildly pubescent . pedicel .— color : rhs 145a . length : 0 . 9 cm . diameter : 0 . 01 cm . self - fertile .— yes . male .— stamen number : 90 . filament length : 0 . 3 cm . filament diameter : 0 . 01 cm . filament color : rhs 155c . anther length : 0 . 01 cm . anther diameter : 0 . 01 cm . anther color : rhs 161c . pollen color : rhs 161c . amount : sparse . female .— style length : 0 . 2 cm . style diameter : 0 . 01 cm . style color : rhs 154d . stigma length : 0 . 2 cm . stigma diameter : 0 . 01 cm . stigma color : rhs 154d . ovary color : rhs 145c . ovary length : 1 . 2 mm . ovary diameter : 0 . 45 mm . predominant shape .— broad conic . fruit weight .— 4 . 2 g . fruit length .— 2 . 1 cm . fruit width .— 1 . 75 cm . fruit length / width ratio .— 1 . 2 . receptacle length .— 1 . 8 cm . receptacle diameter .— base : 0 . 7 cm \| middle : 0 . 65 cm \| tip : 0 . 2 cm . receptacle color .— rhs 143b . drupelet length .— 0 . 6 cm . drupelet diameter .— 0 . 4 cm . drupelet number .— 80 . drupelet weight .— 0 . 3 g . fruit color external .— rhs 44a . fruit color internal .— rhs 46a . firmness of fruit skin .— very firm . firmness of fruit flesh .— very firm . hollow center .— present . number of fruit per node .— 4 - 6 . time of ripening ( 50 % of plants with first fruit ).— september 10 on primocanes . time of fruiting .— early summer and autumn . type of bearing .— remontant . fruit yield .— 15 , 750 lb / a / cycle . average brix °.— 8 . 2 . market use .— fresh . keeping quality .— excellent . shipping quality .— excellent . pest and disease resistance : ‘ pacific starlet ’ exhibits field tolerance to raspberry bushy dwarf virus ( rbdv ). susceptibility to yellow rust ( phragmidium rubi - idaei ) has been observed . this cultivar exhibits moderate field tolerance to phytopthora root rot .	0
with reference to fig1 there is generally shown a message transmitting ashtray 10 . a base 12 contains a visual display 14 and an ashtray 16 . a lid 18 is disposed on a surface 20 of base 12 . lid 18 is a hinged member which rotates around an edge 22 . lid 18 is of a rectangular form of predetermined size sufficient to cover a first cavity 24 which is disposed in base 12 proximate surface 20 . cavity 24 is of a predetermined size so as to encase display 14 . a second cavity 26 ( fig2 ) disposed in base 12 is of a predetermined size to accommodate ashtray 16 . a mounting block 28 is affixed to a bottom surface 30 of cavity 26 . an actuating lever 32 in the form of an l - shape having a first leg 34 and a second leg 36 wherein leg 36 is u - shaped and leg 34 is rotatively mounted through a hole 38 disposed in block 28 and a hole 40 disposed in a wall 42 of cavity 26 . hole 38 and hole 40 are of a predetermined size to allow leg 34 to rotate freely therein . a crank 44 is mounted in hole 46 disposed in wall 42 and hole 48 disposed in a second wall 50 . an eccentric portion 52 is longitudinally disposed on crank 44 essentially equidistant from walls 42 and 50 . extending through hole 46 in wall 42 is an l - shaped portion 54 which is affixed to visual display 14 by glueing , press fit or other conventional methods . a spring 56 is affixed to walls 42 and 50 parallel to bottom 30 . a stop 58 is positioned proximate the top and one end of first cavity 24 and secured between wall 42 and a wall 60 . ashtray 16 and base 12 may be made of plastic , ceramic or like material . crank 44 , lever 32 , spring 56 and stop 58 are constructed of steel rod or the like . when a cigarette 70 is pushed into ashtray 16 so as to extinquish cigarette 70 a bottom surface ( not shown ) of ashtray 16 coacts with portion 36 of lever 32 rotating in such a manner as to coact lever 32 and with eccentric 52 of crank 44 which rotates visual display 14 to a vertical position . rotation of visual display 14 lifts lid 18 . fig3 and 4 show alternative activating and display modes diagrammatically . instead of the mechanical sequence described an electrical contact is made when cigarette is extinquished . a switch 80 is electrically connected to a power supply 90 ; a voice synthesizer chip 100 , and a speaker 110 in a circuit which will produce an audible message . alternatively the switch 80 may be a heat sensor 82 activated by the heat of a burning cigarette 70 . another alternative would be the activation of an electromechanical display 120 or electronic visual display 130 , typical but not limited to such components as light emitting diodes , or liquid crystal diodes . while certain novel features of this invention have been shown and described and are pointed out in the annexed claims , it will be understood that various omissions , substitutions and changes in the forms and details of the device illustrated and in its operation can be made by those skilled in the art without departing from the spirit of the invention .	0
fig1 shows a diagrammatic view of an eddy pump for purposes of illustration , the invention has embodied a shaft sealing system or apparatus 10 for a pump 12 that comprises a pump housing or casing 14 having a pump inlet 16 and a pump outlet 18 . fig2 shows a cross - sectional view taken along the lines 2 - 2 of fig1 . within the pump housing or casing 14 is a chamber 20 containing a rotating impeller or rotor 22 . the rotor is affixed to a drive shaft 24 that extends through an opening 26 in the pump casing . the drive shaft is journaled for rotation within a bearing housing which is bolted to the pump casing at one end thereof . a drive means such as a motor 29 has a rotatable output shaft 27 coupled by a shaft coupling device to the drive shaft . within the bearing housing are radial and thrust bearings that locate and permit the drive shaft to rotate . it is desirable that liquid and foreign material , such as dirt or sand , be prevented from traveling along the shaft 24 from the pump casing opening 26 into the bearings to prevent contamination . the eddy pump vacuum pump apparatus 10 creates vacuum from the suction inlet side 16 of the pump 12 due to the physical characteristics of the eddy effect centered inside a liquid tornado feeding the eddy effect , located inside the pump volute and with the bgreen13 - vse attached to the suction inlet 16 of the pump 12 . this effect creates a tremendous liquid lift / draw to the volutes suction inlet . when the eddy pumps suction feed to the pump volute is properly manipulated by a special pump suction piping connector attached to the face of the pump called the bgreen13 - vse and the volute suction is flooded , vacuum pressure is efficiently and effectively created with without the need for any external hardware , chopping mechanisms and ejector nozzles . due to the vacuum being created at the suction of the eddy pump by the bgreen - vse , recirculation back to a tank 38 , as shown in fig3 , is not needed to create vacuum while discharging from the pump 12 and empting a tank 38 filled with liquid 44 . fig3 shows a pictorial schematic of the ejector - less vacuum creation pump using suction using an eddy pump and fig4 is a cross sectional view of the bgreen13 - vse showing the flow of media through the bgreen13 - vse . a 1200 rpm 10 horsepower motor 29 drives the 3 ″ eddy pump bgreen13 - vse 33 . while specific size , diameter , output and or dimension may be provided in this detailed description , the values are given for reference to a preferred embodiment . these values can be altered based upon the design installation or criteria . the valves provide a testing , calculation and experimentally achieved embodiment . some variation for these factors and ratios provide equivalent or superior functionality and are represented in the appended claims . a 3 ″× 4 ″ pipe expander 39 is connected between the output of the eddy pump 34 and a 4 ″ isolation valve 30 . the 3 ″× 4 ″ pipe expander causes a reduction in the pressure as media flows into 4 ″ discharge pipe 41 to discharge media 45 from the pump 34 to the vacuum collection , holding and transfer tank ( vcht ) 38 . the 4 ″ discharge pipe 41 is oriented above the eddy pimp 34 to create a head pressure within the eddy pump 34 to provide more stable flow through the eddy pump 34 . the length ( or height ) of the discharge pipe 41 establishes the back pressure on the discharge of the eddy pump 34 . in this figure , the discharge pipe 41 , is located above the fluid level 44 in the vcht tank 38 but the level 44 within the vcht tank 38 can vary and a vent / overflow 43 is shown to prevent pressure variation within the vcht tank 38 and prevent bursting from an overfill condition . media from within the vcht tank 38 is drawn into a 3 ″ pipe 31 that is in the existing ship that is connected to the vcht tank 38 . this 3 ″ pipe is connected to a 3 ″ isolation valve 32 . the isolation valve 32 is connected to a bgreen13 - vse 33 where fluid is drawn into 52 the bgreen13 - vse 33 . the bgreen13 - vse 33 is a 3 ″ pipe fabricated with a 2 ″ tee . the cross sectional area of the side tee to the through pipe is approximately 50 % but a range of between 25 % and 75 % will generally provide the desired result . the eddy pump 34 suction 51 velocity is increased by the bgreen13 - vse 33 , increasing the suction pull 51 of the eddy pump 34 which increases the velocity of the fluid passing 53 by a 2 ″ vacuum pipe connection . this draws the air in the area of the vacuum piping system attached to the 2 ″ vacuum pipe connection into the pump creating the negative pressure needed to maintain liquid fluid flow which is typically 14 to 18 ″ hg . using the bgreen13 - vse 33 attached to the eddy pump 34 can create a vacuum pressure of up to 29 ″ hg . the 3 ″ eddy pump 34 and bgreen13 - vse 33 can pump and pass - through the suction and discharge of the pump up to a 2 ″ solid spherical object while creating vacuum with a vacuum recovery efficient enough to operate in a vcht vacuum collection system . a 2 ″ connecting pipe 35 that connects between the bgreen13 - vse 33 to an output of the vacuum flapper check valve 36 . the vacuum flapper check valve 36 is connected to a vacuum distribution manifold 37 where it can be connected 42 to secondary vacuum pump ( s ). solid objects with a mass of up to 1 ″ less in suction feed pipe size can pass thru the eddy pump without any blockage or harm to the inside of the volute . vacuum is still created while pumping the solid objects . traditional , connecting a vacuum flapper check valve to the suction piping of the eddy pump allows for collection of the vacuum . due to the natural eddy pump effect created , vacuum can be produced in a continuous duty application . this preferred embodiment provides the ability to create vacuum pressure in waste and liquid collection systems without the use of an ejector and mechanical macerating type pump . instead by using the eddy pump 3 ″ pump with a 1200 rpm motor and the bgreen13 - vse 33 attached to the suction inlet 51 of the eddy pump 34 , vacuum pressure is created with an tremendous amount of vacuum recovery per flush while at the same time being able to pass solid objects thru the suction and discharge piping . the eddy pump vacuum pump is the creation of vacuum while discharging without needing to loop - back into a holding tank . this novel method of vacuum creation from the suction / feed inlet of the pump can be used for land - based systems and shipboard systems , while avoiding any clogging in the pump due to not using an ejector , allowing solids objects to pass thru while making vacuum . the eddy effect that is created by the eddy pump draws the fluid through the suction inlet 51 with such a tremendous amount of pull that vacuum is created while discharging the fluid at the same time . choking / reducing the size of the suction piping of the eddy pump in comparison with the pumps suction inlet size , and keeping a flooded suction increases the pulling effectiveness of the pump , creating a vacuum while maintaining discharge and flow specifications . connecting a flapper check valve from the suction of the pump to the vacuum manifold holds the vacuum created , so vacuum toilet flushing can occur , sustaining 7 - 9 flushes per minute at 2 cubic feet per flush . this embodiment is non - clogging , without an ejector , maintenance free , major increase in efficiency of vacuum creation , solid objects pass thru , creation of vacuum while discharging without the need of recirculation back to a holding tank , continuous duty operation with extremely low heat transfer to the fluid being pumped . the media that is being transported range from clear and clean water to heavy liquid slurries within a specific gravity of 1 . 0 or less and objects of 2 ″ spherical size and shape suspended in liquid , vacuum pressure is created by utilizing the suction pull and lift abilities of a fluid tornado physically feeding into an liquid eddy effect mechanical device without cavitations and manipulating the devices suction pull and lift abilities to increase tremendously the vacuum creation effect and recovery of vacuum loss while vacuum pressure is being created or within a holding chamber . a key to transporting this media is the ability to remove the air with a volume of space quick enough to not only create absolute vacuum at 29 hg , but recover lost vacuum that has been created within a certain amount of time in conjunction with the volume area , without creating mechanical cavitations by the air being removed while being able to keep creating vacuum while solid objects within 2 ″ size are being collected , passed forward or re - circulated and while creating a layer of air removal separate from the fluid in the liquid suction , only to be mixed together in the discharge . this allows for an increase in vacuum fluid or object collection and the removal of cavitations as air is introduced to the eddy effect device . using a fluid tornado feeding into an eddy effect mechanical device connection to a recirculation tank was not enough to create the vacuum recovery within a set area of volume space . a balance of liquid fed into the device along with the removal of air , eddy effect device liquid discharge pressure ( psi ) range , limitations in power requirements of the eddy effect device , flooded suction pipe diameter in relation to the devices suction diameter , the location with the flooded suction that the air must be removed from and the removal of greater than minor cavitations of the eddy effect device being used . bgreen13 - vse 33 was created to provide the desired result . the diameter of the suction pipe is reduced by ½ ″ of the eddy effect devices suction diameter while pulling the air directly above at a minimum of 1 ″ or greater and in front of the pipe diameter reduction with the suction piping . the location of the air removal device must be 0 ″- 12 ″ within connection of the eddy effect device suction connection . the suction piping distance after the air removal device is irrelevant if continuously flooded with liquid . thus , specific embodiments of an ejector - less vacuum creation pump using suction have been disclosed . it should be apparent , however , to those skilled in the art that many more modifications besides those described are possible without departing from the inventive concepts herein . the inventive subject matter , therefore , is not to be restricted except in the spirit of the appended claims .	5
fig5 is a continuous cooling transformation curve diagram for a class c wheel steel . it is adapted from a drawing appearing in : atlas of continuous cooling transformation diagrams for engineering steels . this particular steel contains 0 . 75 percent carbon , 0 . 33 percent silicon , 0 . 70 manganese , 0 . 017 percent phosphorous and 0 . 016 percent sulfur . the nose region n of the p s curve is well to the right of cooling curve t . hence , the cooling curve t descends in an uninterrupted manner to the steel &# 39 ; s martensite formation region . fig6 shows a continuous cooling transformation curve diagram for a steel made according to the teachings of this invention . among its other alloying ingredients , this steel should be regarded as having a 1 . 1 weight percent silicon concentration . as a result of this , a “ nose ” region n of the p s curve is shifted far enough to the left that it encounters a hot spot steel &# 39 ; s cooling curve t before said cooling curve t descends to those martensite - producing temperatures ( e . g ., at about 250 ° c . as depicted by the m s curve of fig6 . as was previously noted , in order to produce martensite , a steel must transform from a austenite crystalline material to a martensite crystalline material . transformations from pearlite to martensite do not normally occur . thus , applicants &# 39 ; shifting of the pearlite start curve p s to the left in fig6 to such an extent that it encounters cooling curve t implies that the steel will take on a pearlitic structure before the descending cooling curve t reaches the steel &# 39 ; s martensite forming conditions ( i . e ., before it reaches the martensite start curve m s and the regions under it ). thus , this steel will , to some degree , take on a pearlitic structure as a result of the cooling curve t encountering at least some portion ( e . g ., nose region n ) of the pearlite start curve p s , as the curve t descends toward the martensite starting curve m s . having taken on a pearlitic structure here , the steel will not transform to martensite as the temperature falls because , once again , martensite is only formed by a transformation from austenite . again , it will not be formed from a transformation from pearlite . this is even more true of a steel whose entire pearlite forming region p s - p f is shifted well to the left of the steels cooling curve t . thus , since martensite is formed only from austenite — and is not formed from pearlite — applicants &# 39 ; steels resist formation of a martensitic structure as the cooling curve t continues to descend as the steel returns to its normal , or pre - skid , temperature . in effect , the herein described martensite transformation resistant steels of this patent disclosure make these austenite to pearlite transformations in time periods that tend to be less than the heating and cooling time periods extant in railway skid situations ( e . g ., in time periods less than a second , and in many cases less than one tenth of a second ). applicants have found that such a shift of the pearlite forming region ( i . e ., the region between p s and p f ) far enough to the left that it encounters ( see fig6 ) or , better yet , penetrates ( see fig7 ) the cooling curve t , can be achieved by formulating steels having unusually high silicon concentrations . silicon concentrations of 1 . 1 to 3 . 0 percent by weight are preferred . such 1 . 1 to 3 . 0 percent silicon concentrations are especially preferred in steels having carbon concentrations of 0 . 60 to 0 . 77 weight percent carbon . for example , fig6 generally depicts the degree of shift of the p s - p f region by use of a 1 . 1 percent silicon concentration in a steel having 0 . 60 to 0 . 77 percent carbon . fig7 depicts the degree of shift produced by a 2 . 0 percent silicon concentration in a 0 . 60 to 0 . 77 percent carbon steel . fig7 illustrates a situation where the pearlite region between p s and p f is shifted well to the left of the cooling curve t . when compared , fig6 and 7 also show that applicants &# 39 ; use of these relatively high ( i . e ., 1 . 1 to 3 . 0 percent ) silicon concentrations will tend to shift the right end of the martensite region farther and farther to the right as the silicon concentration is raised within the 1 . 1 to 3 . 0 percent range . however , because applicants &# 39 ; p s curve encounters and / or penetrates the cooling curve t , any rightward shift of the m s curve is of no great concern . again , this follows from the fact that once the falling cooling curve t encounters the pearlite - forming conditions implicit in the p s curve , pearlite is formed . thereafter transitions from pearlite to martensite do not occur . fig8 generally illustrates an effect that results from adding 1 . 1 to 3 . 0 silicon to a steel formulation of this patent disclosure . fig8 also generally illustrates the effects of adding 0 . 5 to 1 . 0 weight percent chromium to a steel formulation of this patent disclosure . more specifically , fig8 shows that , as a steel is heated more rapidly , its transformation from pearlite to austenite occurs at ever increasing temperatures . for example , in fig8 the continuous heating transformation curve h for a 0 . 7 wt % carbon steel makes the pearlite — austenite transformation at about 756 ° c . ( i . e ., point 1 in fig8 ) when heated in 10 2 seconds ( 100 seconds ). when heated for 10 seconds it makes this transition at about 790 ° c . at one second the transition takes place at about 862 ° c . thus , as the heating time gets shorter , the pearlite - austenite transition temperature gets higher . applicants have found that the addition of 1 . 1 to 3 . 0 weight percent silicon to such a steel formulation shifts the transformation curve upward and to the left . this shift is generally depicted by the dashed line i in fig8 . thus in the relatively short time periods , e . g ., one second , with which this invention is concerned , the presence of the 1 . 1 to 3 . 0 silicon in the steel formulation tends to raise the transformation temperature to a higher temperature . thus , austenite is less likely to be formed from the pearlite form of the steel under many heating conditions produced by wheel skids . the presence of chromium in applicants &# 39 ; steel formulations shifts their transformation temperatures still higher and to the left . this additional shift is depicted by the dotted line j in fig8 . this effect is cumulative . thus , as both silicon and chromium shift the continuous transformation curve for the steel upward and to the left , in shorter and shorter time periods , a pearlite to austenite transformation is made less likely to occur . thus , the cumulative effects of the use of high silicon concentrations plus the use of 0 . 5 to 1 . 0 percent chromium is of even greater value in a railway wheel under the skid conditions previously described wherein heating and cooling occur very rapidly ( e . g ., in 1 second or less ). it also should be understood that various physical treatments of the steels having the formulations described in this patent disclosure may be employed during their manufacture to improve their metallurgical properties . such physical operations may include quenching , hot working , cold working and the like . it also should be understood that , while this invention has been described in detail and with reference to certain specific embodiments thereof , various changes and modifications can be made therein without departing from the spirit and scope thereof .	2
an apparatus and method with temperature control for optically probing and / or testing an active ( operating ) semiconductor device ( dut ) is described here . in the following description , numerous specific details are set forth such as material types , etc ., in order to provide a thorough understanding . however , it will be apparent to one of skill in the art that the invention may be practiced without these specific details . in other instances , well known elements and techniques have not been shown in particular detail in order to avoid unnecessarily obscuring the present invention . this discussion is mainly of controlling the temperature of flip - chip semiconductor devices ( e . g ., ics ) during optical ( laser or other ) probing and / or testing . it will be recognized , however , that such is for descriptive purposes only and that the present apparatus and methods are applicable to ics having other types of packaging . as explained above , optical - based testing and debugging techniques , such as laser based probing and photon emission detection , are particularly useful for evaluating ic parameters and defects through the backside surface of the ic substrate ( die ). since the ic substrate is typically of crystalline silicon which has a band gap energy of 1 . 1 ev , the energy of a photon used to probe the substrate should have an energy that is less than or equal to 1 . 1 ev ( since the substrate will merely be partially transmissive to such photons ). thus for optical probing the photons propagate to and from the active ( transistor ) regions located on the principal ( front - side ) region of the substrate . [ 0018 ] fig2 illustrates a side view ( not to scale ) of the present temperature control apparatus 100 in one embodiment . in fig2 a flip - chip mounted integrated circuit die dut 102 is mounted to its conventional flip - chip ic package 110 and conventionally electrically powered from and receives and transmits signals through its pins 115 . the portion of the ic package uppermost in the figure has earlier been cut away to expose the die &# 39 ; s backside . any backside heat sink inside the package is also removed . an , e . g ., infrared transmissive heat conductor film 120 is provided in thermal contact with the backside surface of die dut 102 . a heat spreader structure 130 is in thermal contact with the top surface outer edges of the film 120 . thermoelectric devices (“ ted ”) 140 a , 140 d are in thermal contact with the top surface of the heat sink structure 130 . an additional heat sink structure 150 a , 150 d is in thermal contact with respectively the top surface of each ted 140 a , 140 d in one embodiment . it is to be understood that the heat spreader and heat sink may be integrated or combined . heat conductor film 120 is of a material that is both a conductor of heat and transmissive to , e . g ., infrared light . in one embodiment , heat conductor film 120 is made of synthetically grown , optically clear diamond since diamond is both an excellent conductor of heat and is transmissive to infrared light . since diamond has a thermal conductivity that is approximately twelve times larger than that of silicon , it provides an excellent means for conducting heat away from die dut 102 . the diamond film 120 is placed in intimate contact with the ic , and clamped thereto by the heat spreader 130 . the diamond film is a part purchased from norton diamond films or harris diamond , and is , e . g ., 300 microns thick ; its other dimensions depend on those of the underlying dut die ; exemplary dimensions are 22 mm × 22 mm . sufficient pressure is exerted on the die by film 120 to obtain good thermal contact . in one embodiment heat spreader structure 130 is a machined , oxygen free copper plate concentric around a central window to allow passage of the probe beam . a suitable copper is uns c14200 . an alternative material is , e . g ., aluminum . in one embodiment , additional heat sink structures 150 a , 150 d are provided . each is an additional machined , oxygen free copper plate having a large thermal mass and a large heat transfer area and defining internal channels 155 a , 155 b , for carrying coolant ( e . g ., air or water ). such use of internal coolant channels in a heat sink structure is conventional . cooling fins may also be provided for heat sink structures 150 a , 150 d either with or without internal channels 155 a , 155 b . heat spreader structure 130 is shaped to allow maximum surface contact with heat conductor film 120 , and is a standard part purchased from melcor . it defines internal cooling channels to carry coolant and is connected to teds with screws . teds 140 a , 140 d are in thermal contact , being clamped with one screw respectively to heat sinks 150 a , 150 d and heat sink structure 130 . each ted 140 a , 140 d is of the type that , e . g ., operates on the peltier effect , capable of heating or cooling depending on the voltage bias applied to it . in one embodiment , each ted 140 is a standard part available also from melcor , of trenton , n . j . [ 0022 ] fig3 illustrates a plan view of the temperature control apparatus shown in fig2 . in the embodiment shown , four teds , teds 140 a , 140 b , 140 c , 140 d , are in thermal contact with heat sink structure 130 and with respectively associated heat sinks 150 a , . . . , 150 d , however , this configuration is not limiting . thus in this embodiment each ted 140 has its associated separate heat sink . as previously stated , it is advantageous to control the temperature of the active ( operating ) integrated circuit because we have found that fluctuations in temperature adversely affect the results obtained during the optical testing . while being tested , if dut 102 is operated at full electric power , teds 140 cool dut 102 to maintain dut 102 at a predetermined temperature in a range of , e . g ., 0 ° c .- 150 ° c . if electric power to dut 102 is reduced , the power to the teds 140 is adjusted so that dut 102 is cooled less , again , so that dut 102 is advantageously maintained at the predetermined temperature . if the power to dut 102 is reduced to the point where the predetermined temperature is not maintained by the internal exhaust heating of the operating dut 102 , the electrical current bias to ted 140 is reversed to provide heating to the operating dut 102 by teds 140 . each ted , e . g ., 140 c is powered via leads 185 a , 185 b by a suitably controlled power supply 180 . in one embodiment , the ted power supply 180 is controlled by a standard ted controller 170 from melcor coupled to a standard temperature sensor 160 from omega engineering , inc . of stanford , conn . located on heat sink structure 130 as shown in fig3 connected thereto by epoxy . in an alternate embodiment ( not shown ), temperature sensor 160 is located on dut 102 by use of a thermal sensor located on the die so that the signal must be transmitted out of the die through a pin ( terminal ). also shown are the coolant connections , e . g ., 187 , to the heat sinks . in another embodiment ( also shown in fig3 ), ted power supply 180 is instead controlled using a feedback loop 175 coupling ted power supply controller 170 and the conventional dut power supply 195 to dut 102 ( the electrical coupling of power supply 195 to dut 102 is not shown ). in this embodiment , rather than controlling teds 140 in response to changes in sensed temperature , teds 140 are controlled based upon changes in the electric power ( e . g ., current ) drawn by dut 102 . in such an embodiment , if power consumption is high , then teds 140 will operate to cool the operating dut 102 . alternatively , if dut 102 power draw is low , the electrical current bias of teds 140 is reversed to provide heating to dut 102 . the teds are coupled in parallel to their power supply 180 . [ 0025 ] fig4 illustrates in somewhat simplified form one embodiment of the conventional optical probing system ( optical probing microscope ) used in conjunction with the active dut temperature control apparatus 100 as described here . dut 102 is coupled to test apparatus 190 . test apparatus 190 conventionally operates ( exercises ) the dut 102 by applying thereto test signal patterns . test apparatus 190 also supplies power to the dut 102 via conventional dut power supply 195 , which , for simplicity , is not shown in fig4 . it is understood that dut 102 has a plurality of signal and power pins 115 connected via its package 110 to test apparatus 190 . although not illustrated , it is further understood that in the present system test apparatus 190 , and the elements of temperature control apparatus 100 as previously described , are configured and assembled to allow the dut to fit within the overall constraints of a typical commercially available optical probing microscope such as the schlumberger ids ™ 2500 , without interfering with the primary objective of obtaining optical signals from the dut . as described here , and illustrated in fig4 the dut is in one embodiment conventionally probed optically with laser beam 210 generated by laser source 200 . a suitable laser is a yag 1064 mode - locked laser . for detail on the laser and the microscope , see u . s . patent application ser . no . 09 / 500 , 757 filed feb . 8 , 2000 , k . wilsher , w . k . lo , incorporated herein by reference in its entirety . laser beam 210 is focused onto a location ( e . g ., one transistor ) on the dut through objective lens 230 . after the dut is probed by laser beam 210 , the resultant photons reflected from a particular transistor of the dut , pass back up through the lens 230 and are detected by the photon detector 240 and subsequently processed conventionally . conventional reference arm 230 is for calibration purposes . thus , what has been described is an apparatus and method for optically probing or otherwise testing an active ic while controlling the temperature of the ic device under test . in the foregoing detailed description , the methods and apparatus of the present invention have been described with reference to specific exemplary embodiments thereof . it will , however , be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the present invention . the present specification and figures are accordingly to be regarded as illustrative rather than restrictive .	6
we have developed a strategy for endosomal release of membrane impermeable molecules . this strategy involves the reversible inactivation of a membrane active or membrane lysing agent . the reversible inactivation of the membrane active agent is accomplished by attaching an inhibitor or plurality of inhibitors to the membrane active agent by a bond or plurality of bonds that cleave in the environment of an endosome . the inhibitor prevents the agent from lysing the cytoplasmic membrane and thereby causing cell death . the inhibitor is removed from the agent in the acidic environment of the endosome by cleavage of a labile bond , thereby allowing the membrane active agent to disrupt the endosomal membrane to effect release of endosomal contents into the cytoplasm . a key component to limiting membrane activity to the endosome is the labile bond , which must be stable under extracellular conditions , but very unstable in the endosomal vesicle . in particular , we have focused on the identification of bonds that are cleaved in an acidic environment . acidification is a characteristic of the endosome environment that is commonly exploited by viral and non - viral delivery vehicles . agents which rely on protonation to become membrane active , such as polypropylacrylic acid and peptide derivatives of the viral coat protein hemagluttinin , have a serious flaw . activation of the agent causes partial disruption of the endosome , thus destroying the ph gradient and leading to inactivation of the membrane active agent . this cycle can limit the effectiveness of the membrane active agent in delivery of macromolecules to the cell cytoplasm . in contrast , the invention as described herein , results in essentially irreversible reactivation on membrane active agents upon exposure to an acidic ph environment . an important consideration in selecting labile bonds for use in cellular delivery systems is the kinetics of bond cleavage upon exposure of the bond to acidic ph . the kinetics of endosome acidification and maturation of the endosome to a lysosome are very rapid compared to the rates of cleavage for most of the acid - labile bonds reported in the literature . once endocytosis occurs , the ph drops from the extracellular ph ( about 7 . 4 ) to ph about 5 in roughly 10 min . endosomal contents are quickly exposed to active lysosomal enzymes and degradation of the molecule to be delivered may occur . therefore , bonds that are cleaved in within minutes in the ph range 5 - 7 are preferred . a well - studied ph - labile bond is the maleamate bond , which is derived from the reaction of an amine and a maleic anhydride or maleic anhydride derivative ( fig1 ). the rate of maleamate cleavage is dependent upon the structure of the maleic anhydride used to form the maleamate . in general , disubstituted maleamates are more labile than monosubstituted maleamates , which are more labile than unsubstituted maleamates . the monosubstituted maleamates are the most studied members of this family , and have half - lives of hours at ph & lt ; 5 . according to literature , disubstitution of the maleamate results in about two orders of magnitude increase in the rate of cleavage . we have found that the disubstituted maleamate bond derived from dimethylmaleic anhydride ( r 1 and r 2 = ch 3 in fig1 ) has a half - life of about 2 min at ph 5 . this rate is on the same order as endosome maturation . in contrast , we have found that monosubstituted maleamate bonds derived from methylmaleic anhydride ( r 1or2 = h and r 2or1 = ch 3 in fig1 ) have a half - life of cleavage of about 300 min ( 5 hours ) at ph 5 . to increase charge and solubility , derivatives of dimethyl maleic anhydrides , such as 2 - propionic - 3 - methylmaleic anhydride (( naganawa et al . 1994 ; carboxylated dimethylmaleic anhydride or cdm ) may be used ( fig2 ). the ability of a disubstituted maleic anhydride to reversibly inhibit membrane activity of the peptide melittin until reaching the acidic environment of the endosome was reported by us ( rozema et al . 2003 ). we demonstrated the ability of the reversibly inhibited melittin to deliver the membrane impermeable molecules polyethyleneglycol and an oligonucleotide to the cell cytoplasm . in these examples of delivery , the delivery reagent ( cdm - modified melittin ) and compound were not connected or associated with each other , but independently delivered to common endocytic compartments in the cell . for delivery of membrane impermeable molecules to the cytoplasm of cells in vivo , there must be an association between the molecule and the delivery agent . we now provide membrane active agents that may be noncovalently associated with or covalently linked to the membrane impermeable molecule for delivery of the molecule to the cytoplasm of a cell . dna can be condensed with an excess of polycation in aqueous solutions to form nanoparticles with positive surface charge . this phenomenon is critical not only to chromatin and viral assembly , but also is important in the construction of gene delivery vehicles . the positive charge surplus contained in polycation - condensed dna complex can be used to deposit a layer of polyanions on the surface dna / polycation complex resulting in negatively charge particles ( or complexes ) in a process termed recharging ( u . s . patent application ser . no . 09 / 328 , 975 ). negatively charged particles may reduce nonspecific interactions that cationic particles have with serum proteins , cell surfaces , and the extracellular matrix . recharging is a two - step process . in step one , the dna or other polynucleotide is condensed by addition of an excess of polycation to form a positively - charged polynucleotide nanoparticle . typical polynucleotide delivery formulations stop at this point and add the nanoparticle to the cell . in the recharging process , a third polyion ( a polyanion ) is added to the positively - charged polycation / polynucleotide particle to make a ternary complex that has a neutral to negative surface charge . under proper formulation conditions , the particles are small (& lt ; 150 nm ), and are termed nanoparticles . negatively charged complexes should be better able to circulate and target specific cells in vivo by reducing non - specific interactions with negatively charged cells surfaces , serum proteins , and the extracellular matrix . in order for the reversibly - masked membrane active agent to facilitate the delivery polynucleotides or other membrane impermeable molecules to cells , the masked membrane active agent must be associated with the molecule . small membrane active agents with low overall charge , such as the membrane lytic peptide melittin , can form particles with polynucleotides . however , these particles are large (& gt ; 150 nm ) and unstable ( i . e ., they increase in size in the presence of physiological concentrations of salt ). larger membrane active polymers can be used to form small , stable particles with polynucleotides . we have previously synthesized membrane active polymers composed of amines and alkyl groups via copolymerization of various alkyl vinyl ethers with an amine - protected monomer ( amphiphilic polyvinylether polycations ; fig3 and u . s . patent application ser . no . 10 / 772 , 502 , incorporated herein by reference ). as an example , a 50 : 50 mixture of alkyl groups and amines yields polymers containing ethyl ( peave ), propyl ( ppave ), and butyl ( pbave ) groups using trifluoride etherate as an initiator . deprotection of the amine - protecting phthalimide groups results in water soluble polymers with molecular weight about 20 , 000 daltons . the butyl - containing polymer pbave was found to be about 60 % as hemolytic as melittin when assayed for red blood cell lytic activity . reversible inhibition of pbave can be accomplished by cdm modification . incubation of the modified polymer at ph 5 restored lytic ability with a half - life of about 10 min . therefore , the membrane activity of the polymer pbave can be controlled by modification of the polymer with cdm . under basic conditions the polymer is not membrane lytic . upon acidification , the cdm inhibitor is cleaved from the polymer and membrane activity of the polymer is restored ( fig4 ). the endosomolytic activity of cdm - pbave is demonstrated by its ability to deliver a polynucleotide to cells ( see example 5 below ). cdm and cdm derivatives can be used to modify any amine - containing membrane active polymer . in addition to masking the membrane activity of an amine - containing polymer , modification of a polymer with the cdm maleic anhydride derivative further reversibly converts positive charges on the polymer to negatively charged carboxyl groups . thus , a polycation can be converted to a polyanion . following condensation of a polynucleotide with a first polycation to form a small binary complex or particle , a polyanion may then be used to recharge the binary complex and form a ternary complex or particle which has a less positive or more negative surface charge than the binary complex . in recharging a polynucleotide - containing particle with a cdm - modified second polycation , the recharging layer is acid - labile . exposure of this recharged nanoparticle to acidic conditions results in cleavage of the cdm groups from the polyanion with concomitant loss of negative charge from the recharging polymer . reversion of the polyanion to a membrane active polycation ( second polycation ) can have several effects including : destabilization of the particle , release of membrane active agent in the endocytic vesicle , and increased interaction of the first polycation with the endocytic vesicle membrane . the first polycation can also be a membrane active polymer and may further be of the same species as the membrane active second polycation . disruption of the endosome by the membrane active polymer ( s ) results in cytoplasmic delivery of the polynucleotide or other molecule present originally present in the recharged particle . we have shown that endosomolysis can be achieved by reversibly modifying a membrane active peptide such as melittin with maleic anhydride derivatives ( rozema et al . 2003 ; u . s . patent application ser . no . 10 / 444 , 662 ). cdm - melittin &# 39 ; s ability to delivery macromolecules polyethylene glycol and an uncharged oligonucleotide analog has been shown . however , in order to incorporate masked membrane active agents into polynucleotide - delivery vectors we synthesized polymers of sufficient size and charge to be formulated into stable polynucleotide - containing nanoparticles . as an example , the polycation pbave was synthesized and demonstrated to have both membrane activity and the ability to form small , stable particles with dna . masking of pbave &# 39 ; s membrane activity by reaction with cdm resulted in a polyanion that can be used to recharge dna / polycation particles to make small , negatively - charged , acid - labile nanoparticles . nanoparticles composed of dna : pbave : cdm - pbave were formulated at a 10 : 20 : 80 weight ratio and applied to cultured mouse liver cells ( hepa - 1clc7 ) in tissue culture in the presence of dmem and 10 % serum . the dna used in the delivery formulations was pciluc , which contains a gene encoding luciferase . the transfection ability of the complexes was determined by measuring the relative light units of luciferase produced by cells that had been treated with pciluc - containing nanoparticles . as a control for the reversibly inhibited membrane active polymer ( cdm - pbave ), particles were also constructed using succinylated - pbave ( s - pbave ) and cis - aconitylated - pbave ( a - pbave ). cis - aconitic anhydride is a monosubstituted maleic anhydride derivative that has a carboxylate ( ch 2 co 2 h ) substituent on the maleic anhydride . succinylation is irreversible and cis - aconitylation cleaves with a half - life of about 300 min at ph 5 . there is a dependence of transfection on the liability of the group used to modify / inhibit the membrane active agent pbave . the reversibly - masked , membrane active polymers cdm - pbave and a - pbave were able to transfect cells while the irreversibly modified polymer ( s - pbave ) was inactive . in addition , the nanoparticles containing cdm - pbave ( disubstituted maleamate bonds ) had 30 - fold more transfection activity than nanoparticles formed with a - pbave ( monosubstituted maleamate bonds ). the increase in transfection ability of the cdm - pbave containing particles is most likely related to the greater lability of the cdm disubstituted maleic anhydride derivative relative to the cis - aconitic monosubstituted maleic anhydride derivative . similar results are expected for other amine - containing membrane active polymers . in addition to the stability of particles due to the electrostatic forces between polycation and polyanion , the stability of the particle may also be enhanced by the formation of the covalent bonds , i . e . crossslinking , between the polymers . however , irreversible crosslinking of the polycation and polyanion results in particles that are ineffective for delivery of biologically active nucleic acids . in order to give the particles the stability of crosslinking while still providing the particles with intracellular instability , the polycation and polyanion of a nanoparticle can covalently linked via a plurality of acid labile maleamate bonds . in order to couple a cdm - based polyanion with a polyamine , it is necessary to use a crosslinking group that can react with amines only after the anhydride has reacted to form the cdm - based maleamate group . this selectivity in reaction is required because both formation of the maleamate and crosslinking between polyanion and polycation involve reactions with amines . as a consequence , in order to selectively couple a cdm - based polyanion and polyamine , there must be selectivity of the amine reactions . a method to accomplish this selectivity is to provide , on a cdm derivative , a functional group for crosslinking that is less reactive than the anhydride group involved in maleamate formation . such a functional group is a thioester . a thioester is moderately amine - reactive relative to an anhydride . using a thioester derivative of cdm , it is possible to link two amines together via a ph - labile maleamate bond ( fig5 ). in addition to the maleamate bond , other ph labile bonds may be incorporated into crosslinking reagents including acetals , enol ethers , and hydrazones . in particular , acetals derived from benzaldehyde and benzaldehyde derivatives are very ph labile . in addition to increasing stability in the presence of salt , targeting of particles in vivo requires that nonspecific interactions , with serum component and non - targeted cells , be reduced . in order to reduce such interactions with delivery vehicles , many researchers have attached polyethylene glycol ( peg ) ( kircheis et al . 2001 ; woodle et al . 1992 ), an uncharged water - soluble polymer , to nucleic acid containing particles . however , peg also decreases the transfection competency of particles . in order to gain the benefits of pegylation while maintaining transfection ability , we have synthesized a variety of dimethylmaleic anhydride - derived pegylation reagents . attachment of a plurality of dimethylmaleic anhydride groups to a single peg group allows for the formation of a plurality of reversible covalent bonds with the particle thereby increasing the stability of a particle ( fig6 ). a plurality of peg groups can be covalently attached to a particle . membrane active — membrane active polymers or compounds are molecules that are able to alter membrane structure . this change in structure can be shown by the compound inducing one or more of the following effects upon a membrane : an alteration that allows small molecule permeability , pore formation in the membrane , a fusion and / or fission of membranes , an alteration that allows large molecule permeability , or a dissolving of the membrane . this alteration can be functionally defined by the compound &# 39 ; s activity in at least one the following assays : red blood cell lysis ( hemolysis ), liposome leakage , liposome fusion , cell fusion , cell lysis and endosomal release . polymer — a polymer is a molecule built up by repetitive bonding together of smaller units called monomers . a polymer can be linear , branched network , star , comb , or ladder types of polymer . a polymer can be a homopolymer in which a single monomer is used or can be copolymer in which two or more monomers are used . the main chain of a polymer is composed of the atoms whose bonds are required for propagation of polymer length . for example in poly - l - lysine , the carbonyl carbon , α - carbon , and α - amine groups are required for the length of the polymer and are therefore main chain atoms . the side chain of a polymer is composed of the atoms whose bonds are not required for propagation of polymer length . for example in poly - l - lysine , the β , γ , δ and ε - carbons , an ε - nitrogen are not required for the propagation of the polymer and are therefore side chain atoms . polycation — a polycation can be a polymer possessing net positive charge , for example poly - l - lysine hydrobromide or a histone . the polymeric polycation can contain monomer units that are charge positive , charge neutral , or charge negative , however , the net charge of the polymer must be positive . a polycation also can be a non - polymeric molecule that contains two or more positive charges . polyanion — a polyanion can be a polymer containing a net negative charge , for example polyglutamic acid . the polymeric polyanion can contain monomer units that are charge negative , charge neutral , or charge positive , however , the net charge on the polymer must be negative . a polyanion can also be a non - polymeric molecule that contains two or more negative charges . other components of the monomers and polymers : polymers may have functional groups that enhance their utility . these groups can be incorporated into monomers prior to polymer formation or attached to the polymer after its formation . functional groups may be selected from the list consisting of : targeting groups , interaction modifiers , steric stabilizers , and membrane active compounds , affinity groups and reactive groups . targeting groups — targeting groups , or ligands , are used for targeting the polymer or polymer complex to cells , to specific cells , to tissues or to specific locations in a cell . targeting groups enhance the association of molecules with a cell . examples of targeting groups include those that target to the asialoglycoprotein receptor by using asialoglycoproteins or galactose residues . other proteins such as insulin , egf , or transferrin can be used for targeting . other targeting groups include molecules that interact with membranes such as fatty acids , cholesterol , dansyl compounds , and amphotericin derivatives . a variety of ligands have been used to target drugs and genes to cells and to specific cellular receptors . the ligand may seek a target within the cell membrane , on the cell membrane or near a cell . binding of a ligand to a receptor may initiate endocytosis . steric stabilizer — a steric stabilizer is a long chain hydrophilic group that prevents aggregation of final polymer by sterically hindering particle to particle electrostatic interactions . examples include : alkyl groups , peg chains , polysaccharides , hydrogen molecules , alkyl amines . interaction modifier — an interaction modifier changes the way that a molecule interacts with itself or other molecules , relative to molecule containing no interaction modifier . the result of this modification is that self - interactions or interactions with other molecules are either increased or decreased . for example cell targeting signals are interaction modifiers with change the interaction between a molecule and a cell or cellular component . polyethylene glycol is an interaction modifier that decreases interactions between molecules and themselves and with other molecules . a labile linkage is a chemical compound that contains a labile bond and provides a link or spacer between two other groups . the groups that are linked may be chosen from compounds such as biologically active compounds , membrane active compounds , compounds that inhibit membrane activity , functional reactive groups , monomers , and cell targeting signals . the spacer group may contain chemical moieties chosen from a group that includes alkanes , alkenes , esters , ethers , glycerol , amide , saccharides , polysaccharides , and heteroatoms such as oxygen , sulfur , or nitrogen . the spacer may be electronically neutral , may bear a positive or negative charge , or may bear both positive and negative charges with an overall charge of neutral , positive or negative . ph - labile refers to the selective breakage of a covalent bond under acidic conditions ( ph & lt ; 7 ). that is , the ph - labile bond may be broken under acidic conditions in the presence of other covalent bonds without their breakage . the term ph - labile includes both linkages and bonds that are ph - labile , very ph - labile , and extremely ph - labile . ph - labile refers to the selective breakage of a covalent bond under acidic conditions ( ph & lt ; 7 ). a ph - labile bond may be broken under acidic conditions in the presence of other covalent bonds without their breakage . for the purposes of the present invention , a bond is considered very ph - labile if the half - life for cleavage at ph 5 is less than 45 minutes . for the purposes of the present invention , a bond is considered extremely ph - labile if the half - life for cleavage at ph 5 is less than 15 minutes . targeting groups — targeting groups , or ligands , are used for targeting the polymer or polymer complex to cells , to specific cells , to tissues or to specific locations in a cell . targeting groups enhance the association of molecules with a cell . examples of targeting groups include those that target to the asialoglycoprotein receptor by using asialoglycoproteins or galactose residues . other proteins such as insulin , egf , or transferrin can be used for targeting . other targeting groups include molecules that interact with membranes such as fatty acids , cholesterol , dansyl compounds , and amphotericin derivatives . a variety of ligands have been used to target drugs and genes to cells and to specific cellular receptors . the ligand may seek a target within the cell membrane , on the cell membrane or near a cell . binding of a ligand to a receptor may initiate endocytosis . polynucleotide — the term polynucleotide , or nucleic acid or polynucleic acid , is a term of art that refers to a polymer containing at least two nucleotides . nucleotides are the monomeric units of polynucleotide polymers . polynucleotides with less than 120 monomeric units are often called oligonucleotides . natural nucleic acids have a deoxyribose - or ribose - phosphate backbone . an artificial or synthetic polynucleotide is any polynucleotide that is polymerized in vitro or in a cell free system and contains the same or similar bases but may contain a backbone of a type other than the natural ribose - phosphate backbone . these backbones include : pnas ( peptide nucleic acids ), phosphorothioates , phosphorodiamidates , morpholinos , and other variants of the phosphate backbone of native nucleic acids . bases include purines and pyrimidines , which further include the natural compounds adenine , thymine , guanine , cytosine , uracil , inosine , and natural analogs . synthetic derivatives of purines and pyrimidines include , but are not limited to , modifications which place new reactive groups such as , but not limited to , amines , alcohols , thiols , carboxylates , and alkylhalides . the term base encompasses any of the known base analogs of dna and rna . the term polynucleotide includes deoxyribonucleic acid ( dna ) and ribonucleic acid ( rna ) and combinations of dna , rna and other natural and synthetic nucleotides . a polynucleotide can be delivered to a cell to express an exogenous nucleotide sequence , to inhibit , eliminate , augment , or alter expression of an endogenous nucleotide sequence , or to affect a specific physiological characteristic not naturally associated with the cell . a polynucleotide - based gene expression inhibitor comprises any polynucleotide containing a sequence whose presence or expression in a cell causes the degradation of or inhibits the function , transcription , or translation of a gene in a sequence - specific manner . polynucleotide - based expression inhibitors may be selected from the group comprising : sirna , microrna , interfering rna or rnai , dsrna , ribozymes , antisense polynucleotides , and dna expression cassettes encoding sirna , microrna , dsrna , ribozymes or antisense nucleic acids . sirna comprises a double stranded structure typically containing 15 - 50 base pairs and preferably 19 - 25 base pairs and having a nucleotide sequence identical or nearly identical to an expressed target gene or rna within the cell . an sirna may be composed of two annealed polynucleotides or a single polynucleotide that forms a hairpin structure . micrornas ( mrnas ) are small noncoding polynucleotides , about 22 nucleotides long , that direct destruction or translational repression of their mrna targets . antisense polynucleotides comprise sequence that is complimentary to an gene or mrna . antisense polynucleotides include , but are not limited to : morpholinos , 2 ′- o - methyl polynucleotides , dna , rna and the like . the polynucleotide - based expression inhibitor may be polymerized in vitro , recombinant , contain chimeric sequences , or derivatives of these groups . the polynucleotide - based expression inhibitor may contain ribonucleotides , deoxyribonucleotides , synthetic nucleotides , or any suitable combination such that the target rna and / or gene is inhibited . transfection — the process of delivering a polynucleotide to a cell has been commonly termed transfection or the process of transfecting and also it has been termed transformation . the term transfecting as used herein refers to the introduction of a polynucleotide or other biologically active compound into cells . the polynucleotide may be used for research purposes or to produce a change in a cell that can be therapeutic . the delivery of a polynucleotide can lead to modification of the genetic material present in the target cell . a transfection reagent or delivery vehicle is a compound or compounds that bind ( s ) to or complex ( es ) with oligonucleotides and polynucleotides , and mediates their entry into cells . application ser . nos . 10 / 619 , 778 and 10 / 816 , 081 are incorporated herein by reference . synthesis of 2 - propionic - 3 - methylmaleic anhydride ( carboxydimethylmaleic anhydride or cdm ). to a suspension of sodium hydride ( 0 . 58 g , 25 mmol ) in 50 ml anhydrous tetrahydrofuran was added triethyl - 2 - phosphonopropionate ( 7 . 1 g , 30 mmol ). after evolution of hydrogen gas had stopped , dimethyl - 2 - oxoglutarate ( 3 . 5 g , 20 mmol ) in 10 ml anhydrous tetrahydrofuran was added and stirred for 30 minutes . water , 10 ml , was then added and the tetrahydrofuran was removed by rotary evaporation . the resulting solid and water mixture was extracted with 3 × 50 ml ethyl ether . the ether extractions were combined , dried with magnesium sulfate , and concentrated to a light yellow oil . the oil was purified by silica gel chromatography elution with 2 : 1 ether : hexane to yield 4 g ( 82 % yield ) of pure triester . the 2 - propionic - 3 - methylmaleic anhydride was then formed by dissolving of this triester into 50 ml of a 50 / 50 mixture of water and ethanol containing 4 . 5 g ( 5 equivalents ) of potassium hydroxide . this solution was heated to reflux for 1 hour . the ethanol was then removed by rotary evaporation and the solution was acidified to ph 2 with hydrochloric acid . this aqueous solution was then extracted with 200 ml ethyl acetate , which was isolated , dried with magnesium sulfate , and concentrated to a white solid . this solid was then recrystallized from dichloromethane and hexane to yield 2 g ( 80 % yield ) of 2 - propionic - 3 - methylmaleic anhydride . synthesis of cdm thioester . to a solution of 2 - propionic - 3 - methylmaleic anhydride ( 30 mg , 0 . 16 mmol ) in 5 ml methylene chloride was added oxalyl chloride ( 200 mg , 10 eq ) and dimethylformamide ( 1 μl ). the reaction was allowed to proceed overnight at which time the excess oxalyl chloride and methylene chloride were removed by rotary evaporation to yield the acid chloride , a clear oil . the acid chloride was dissolved in 1 ml of methylene chloride . to this solution was added 2 equivalents thioglycolic acid , and pyridine ( 20 μl , 1 . 5 eq ) in 10 ml of methylene chloride . the solution was then stirred overnight . the solvent was then removed and the resulting solid was dissolved into 5 ml of water and purified using reverse - phase hplc using a 0 . 1 % tfa water / acetonitrile gradient . synthesis of polyvinylethers . 2 - vinyloxy ethyl phathalimide ( 1 g , 4 . 6 mmol ) was added to a oven dried round bottom flask under a blanket of nitrogen in anhydrous dichloromethane to this solution was added ethyl vinyl ether ( 0 . 332 g , 4 . 6 mmol ), propyl vinyl ether ( 0 . 396 g , 4 . 6 mmol ) or butyl vinyl ether ( 0 . 460 g , 4 . 6 mmol ). these solutions were then brought to − 78 ° c . and bf 3 — oet 2 ( 0 . 065 g , 0 . 46 mmol ) is added and the reaction is allowed to proceed for 2 hours at − 78 ° c . the polymerization is then stopped by the addition of 50 / 50 mixture of ammonium hydroxide in methanol . the solvents are then removed by rotary evaporation . the polymer is then dissolved in 30 ml of 1 , 4 - dioxane / methanol ( 2 / 1 ). to this solution was added hydrazine ( 0 . 147 g , 46 mmol ) and the mixture was heated to reflux for 3 hours . the solvents are then removed by rotary evaporation and the resulting solid was then brought up in 20 ml of 0 . 5m hcl and refluxed for 15 minutes , diluted with 20 ml distilled water , and refluxed for additional hour . this solution was then neutralized with naoh cooled to room temperature and transfer to 3 , 500 molecular cellulose tubing and dialyzed for 24 h ( 2 × 20 l ) against distilled water , and freeze dried . hemolysis by melittin , pea ve , ppave , pbave , and cdm - modified pbave . the membrane activity of the amphiphilic cation polymers was tested according to published procedure . 10 8 red blood cells were added to 500 μl of phosphate buffer . to this solution was added 20 μg of melittin , peave , ppave , pbave , or cdm - pbave , which was made by acylation of pbave with 2 eq . of cdm relative to amines . the samples were incubated for 15 min at 37 ° c ., then spun for 1 min at 15 , 000 rcf . lysis was be determined by measuring the absorbance of the supernatant at 541 nm . percent hemolysis was calculated assuming 100 % lysis to be the absorbance of hemoglobin released upon addition of deionized water . all of the polymers were determined to be hemolytic , with pbave and melittin being the most lytic . cdm - modified polymer pbave was not hemolytic until acidification . induction of luciferase upon delivery of oligonucleotide . hela luc / 705 cells ( gene tools , philomath oreg .) were grown under conditions used for hela cells . the cells were plated in 24 - well culture dishes at a density of 3 × 10 6 cells / well and incubated for 24 hours . media was replaced with 1 . 0 ml dmem containing 10 % fetal bovine serum and 2 . 5 nmol pmo ( cct ctt acc tca gtt aca att tat a , seq id 1 , gene tools , philomath , oreg .) either with or without 20 μg of cdm - modified pbave . the cells were then incubated for 48 hours in a humidified , 5 % co 2 incubator at 37 ° c . the cells were harvested and the lysates assayed for luciferase expression using a lumat lb 9507 ( eg & amp ; g berthold , bad - wildbad , germany ) luminometer . addition of cdm - modified pbave resulted in a 2 - 3 fold increase in luciferase activity . transfection with acid - labile dna particles : hepa cells ( a mouse hepatocyte cell line ) were cultured in 1 ml dulbecco &# 39 ; s modified eagle media containing 10 % fetal bovine serum using 12 - well plates . pbave nanoparticles were formulated according the reported ratios with plasmid dna pciiuc ( 10 μg / ml , pciiuc ; prepared according to published procedure in 0 . 5 ml of 5 mm hepes ph 7 . 5 . as controls for the ph - labile cdm modification , polyanions were generated from the polyamines using succinic anhydride , which irreversibly modifies the amine , and aconitic anhydride , which reversibly modifies the amine but is much slower to cleave than cdm , to form s - pbave and a - pbave respectively . the nanoparticles , 2 μg of dna , were then added ( 200 μl ) to the cells . the cells were incubated for 48 h . the cells were harvested and assayed for luciferase expression as previously reported . a lumat lb 9507 ( eg & amp ; g berthold , bad - wildbad , germany ) luminometer was used . the amount of transfection is average transfection for two separate wells of cells . amount of luciferase in picograms = 5 . 1 × 10 − 5 ( rlu )+ 3 . 683 . formulation relative light units dna : pbve : cdm - pbave 1 , 875 , 801 10 : 20 : 80 μg / ml dna : pbve : s - pbave 195 10 : 20 : 80 μg / ml dna : pbve : a - pbave 68 , 549 10 : 20 : 80 μg / ml naked dna 200 transfection with recharged acid - labile particles in vivo . pbave nanoparticles were formulated according the reported ratios with plasmid dna pciiuc ( 30 μg / ml , pciiuc ; prepared according to published procedure in 0 . 5 ml of 5 mm hepes ph 7 . 5 . the nanoparticles , 9 μg of dna , were then injected into the tail vein ( 300 μl ) of mice . 24 hours postinjection , the mice were sacrificed , their livers harvested and assayed for luciferase expression as previously reported . a lumat lb 9507 ( eg & amp ; g berthold , bad - wildbad , germany ) luminometer was used . the amount of transfection is average transfection for a group of three mice . amount of luciferase in picograms = 5 . 1 × 10 − 5 ( rlu )+ 3 . 683 . formulation relative light units dna : pbve : cdm - pbave 30 , 123 30 : 60 : 240 μg / ml naked dna 1 , 021 particle sizing in the absence and presence of salt and ζ - potential measurement . nanoparticles between dna and peave and cdm / cdm - thioester - modified peave were formulated in 20 mm hepes buffer ph 7 . 5 according to the weight ratios presented above at a dna concentration of 10 μg / ml . for the cdm / cdm - thioester modified polymers , cdm - thioester was mixed was cdm at a 9 : 1 weight ratio before mixing with the polymer . the size of the nanoparticles and the z - potential were determined by light scattering at 532 nm using a brookhaven instruments corporation , zetaplus particle sizer , i90 . the salt stability of the nanoparticles was assessed by addition of sodium chloride to 150 mm and measurement of size after 10 min . particles size ( nm ) in size ( nm ) in polymer wt . ratios ( μg / ml ) 20 mm hepes ph 7 . 5 150 mm nacl dna : peave : cdm - peave 10 : 20 : 100 90 - 110 & gt ; 1000 5 : 10 : 100 90 - 130 & gt ; 1000 dna : peave : cdm / cdmthioester - peave 10 : 20 : 100 90 - 110 114 5 : 10 : 100 90 - 130 118 transfection of cdm - thioester crosslinked dna particles . hepa cells ( a mouse hepatocyte cell line ) were cultured in 1 ml dulbecco &# 39 ; s modified eagle media containing 10 % fetal bovine serum using 12 - well plates . pbave nanoparticles were formulated according the reported ratios with plasmid dna pciiuc ( 10 μg / ml , pciiuc ; prepared according to published procedure in 0 . 5 ml of 5 mm hepes ph 7 . 5 . for the cdm / cdm - thioester modified polymers , cdm - thioester was mixed was cdm at a 9 : 1 weight ratio before mixing with the polymer . the nanoparticles , 2 μg of dna , were then added ( 200 μl ) to the cells . the cells were incubated for 48 h . the cells were harvested and assayed for luciferase expression as previously reported . a lumat lb 9507 ( eg & amp ; g berthold , bad - wildbad , germany ) luminometer was used . the amount of transfection is average transfection for two separate wells of cells . amount of luciferase in picograms = 5 . 1 × 10 − 5 ( rlu )+ 3 . 683 . formulation relative light units ( rlu ) dna : pbave : cdm - pbave 774 , 432 10 : 40 : 100 μg / ml dna : pbave : cdm - pbave 4 , 967 , 879 10 : 20 : 50 μg / ml dna : pbave : cdm / cdm - thioester - pbave 1 , 040 , 076 10 : 40 : 100 μg / ml dna : pbave : cdm / cdm - thioester - pbave 2 , 276 , 733 10 : 20 : 50 μg / ml synthesis of amino polyethylene glycol monomethyl ethers . to a 10 wt % solution of monomethyl ether peg of various molecular weights in methylene chloride is added 3 equivalents of mesyl chloride and triethylamine . after stirring overnight , the solution is washed with an equal volume of nahco 3 saturated water . the organic layer is then dried with sodium sulfate and the peg is precipitated out of solution by the addition of 9 volume equivalents of diethyl ether . the peg mesylate is allowed to precipitate out overnight at − 78 ° c . the peg mesylate is then dissolved to 15 wt % in water and 10 equivalents of amine ( ethylene diamine or tris ( 2 - aminoethyl ) amine ). the reaction is allowed to proceed for 48 hours and the amine - modified peg is purified using reverse - phase hplc using a 0 . 1 % tfa water / acetonitrile gradient . synthesis of cdm - peg derivatives . to a solution of 2 - propionic - 3 - methylmaleic anhydride ( 30 mg , 0 . 16 mmol ) in 5 ml methylene chloride was added oxalyl chloride ( 200 mg , 10 eq ) and dimethylformamide ( 1 μl ). the reaction was allowed to proceed overnight at which time the excess oxalyl chloride and methylene chloride were removed by rotary evaporation to yield the acid chloride , a clear oil . the acid chloride was dissolved in 1 ml of methylene chloride . to this solution was added 2 equivalents amino polyethylene glycol monomethyl ether of various molecular weights , and pyridine ( 20 μl , 1 . 5 eq ) in 10 ml of methylene chloride . the solution was then stirred overnight . the solvent was then removed and the resulting solid was dissolved into 5 ml of water and purified using reverse - phase hplc using a 0 . 1 % tfa water / acetonitrile gradient . particle size in the absence and presence of salt and ζ - potential measurement . nanoparticles between 10 μg / ml dna and 20 μg / ml pbave were formulated in 20 mm hepes buffer ph 7 . 5 . to this solution was added nothing or 100 μg cdm - peg 2 ( the molecular weight of the peg was 1100 ). the size of the nanoparticles and was determined by light scattering at 532 nm using a brookhaven instruments corporation , zetaplus particle sizer , i90 . the salt stability of the nanoparticles was assessed by addition of sodium chloride to 150 mm and measurement of size after 10 min . without addition of cdm - peg 2 the dna / polycation particles grew from 100 to & gt ; 1000 nm upon addition of sodium chloride . upon modification with cdm - peg2 , this increase in particle size did not occur in the presence of salt . condensation and decondensation of dna upon addition of salt and polyacrylic acid . dna was labeled with tetramethylrhodamine labelit dna labeling reagent ( mirus corporation ) at a 1 : 1 dna : labelit weight ratio according to manufacturer &# 39 ; s protocol . a solution of 1 μg / ml of tetramethylrhodamine - labeled dna was condensed by the addition of 10 μg / ml of pbave in the presence of taps buffer ph 9 . to this solution was added various amounts of cdm - peg 2 and cdm - peg 3 . to the solution was then added nacl bring the concentration to 150 mm . finally polyacrylic acid was added to 100 μg / ml . after the addition of each reagent , the fluorescence of the rhodamine was measured using a varian spectrofluorometer exciting at 555 nm and measure emission at 575 nm . a decrease in fluorescence is indicative of dna condensation , while an increase indicates a decondensation of dna . fluorescence sample relative dna alone 1 . 0 + pbave 0 . 2 + 40 μg peg ( 1100 )- cdm 2 0 . 3 + 150 mm nacl 0 . 3 + 100 μg / ml pacac 0 . 75 dna alone 1 . 0 + pbave 0 . 2 + 40 μg peg ( 1100 )- cdm 3 0 . 3 + 150 mm nacl 0 . 3 + 100 μg / ml pacac 0 . 79 dna alone 1 . 0 + pbave 0 . 2 + 150 μg peg ( 1100 )- cdm 3 0 . 3 + 150 mm nacl 0 . 3 + 100 μg / ml pacac 0 . 56 dna alone 1 . 0 + pbave 0 . 2 + 150 mm nacl 0 . 3 + 100 μg / ml pacac 0 . 95 the foregoing is considered as illustrative only of the principles of the invention . furthermore , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described . therefore , all suitable modifications and equivalents fall within the scope of the invention .	2
a system schematic of the present invention installed in a tankless water heating system is shown in fig3 . an element of this invention is a heat exchanger unit ( 20 ) as shown in fig4 b installed with its input coupled to the output of a tankless water heater ( 21 ), and its output connected to the hot water distribution line ( 22 ) supplying hot water to the various hot water faucets ( 23 ) in the building . a second element , also shown in fig3 , is one or more return lines ( 24 ) for the purpose of creating a loop for water to flow to all points of the hot water distribution system , and back to the unit through the return lines . the illustrated embodiment of the system is through the use of a convective circulation loop to keep hot water at remote faucets at all times . the electric circulation pump ( 25 ) shown in fig3 is optional for those installations where the physical arrangement of the building will not allow the necessary height to induce convective circulation . check valves ( 26 ) in the return loop will prevent reverse flow in the return lines . for purposes of describing the unit , one embodiment is shown to describe the operational concept , however other embodiments are also possible . the heat exchanger shown in fig4 a ( 27 ) is comprised of an outer housing ( 28 ), a water tank ( 29 ), a heat tube ( 30 ), and a heating element ( 31 ). a water jacket ( 32 ) is created in the space between the tank and the heat tube , to provide efficient heat transfer from heated water in the water jacket to water flowing through the heat tube . return line check valves ( 33 ) will be attached to the tank and fluidly couple the return lines to the interior of the tank . thermal insulation ( 34 ) in the space between the outer housing and the tank will minimize loss of water jacket heat . all operational components are capable of withstanding water at domestic water pressures without leakage or damage . the outer housing ( 28 ) of the heat exchanger will serve as a container to package all elements of the heat exchanger , including provisions for mounting , and will have access points for water inlet ( 35 ) and outlet fittings ( 36 ) and one or more return line check valves ( 33 ). access for an energy connection , either electric or gas , will be compatible with standard connections in use today . the housing will also serve to present an attractive external configuration in keeping with installation in a modern building , and to protect the unit from dust or damage . the water tank ( 29 ) is a water - tight , preferably made of stainless steel although other materials may be substituted , element that will have openings to accommodate sealably attaching each end of the heat tube , a check valve , a thermostat ( 37 ), and heater element fittings . the tank in the embodiment shown has a cylindrical shape , however any geometric configuration capable of containing the necessary internal parts and compatible with the outer housing design will suffice . one convenient embodiment of the tank may be formed with a rolled sheet metal cylindrical body with a bottom and top cap welded on during unit assembly , at the discretion of the designer . the required volume of the water in the tank surrounding the heat tube is determined by the heat capacity necessary to heat the cold sandwich considering the heat balance and efficiency of the heat transfer from the water in the tank to the water in the heat tube . the heat tube ( 30 ) is a second water - tight element , preferably made of stainless steel although other materials may be substituted , located internal to the tank ( 29 ), that will include a water inlet ( 35 ) and a water outlet ( 36 ) capable of connection to standard water pipes . a portion of the heat tube will have a larger cross section that will increase its surface area inside the tank to better expose water flowing through it to the hot water in the water jacket , and to slow the velocity of the water flowing through it to allow more time for heat transfer . in this embodiment , the heat tube is shown as a cylindrical tube , with the larger diameter portion of the heat tube will include serrations ( 37 ) as shown in fig4 b , as a further expansion of its surface area . the increase of heat transfer area may also be accomplished through the addition of fins to the outside and inside surfaces of the heat tube . a small hole ( 38 ) in the upper end of the heat tube will allow water from the heat tube to fill the water jacket , and allow a continuous flow of water to circulate from the water jacket to the remote faucets through the hot water distribution lines , and return to the water jacket through the return lines . the heat tube will be contained inside the tank and each end of the heat tube will be sealably attached to openings in the ends of the tank . since the heat tube is a heat exchanger , various other configurations may be used . one very effective alternative is a tube / fin device similar to an automobile radiator that will reside inside the water tank in the same fashion as the heat tube described above . it will be a water - tight unit with an inlet and an outlet and will transfer heat from the heated water in the tank to the ambient temperature water leaving the main heater element in the tankless heater immediately after a faucet is opened . another version of a fin / tube heat exchanger is a water tube having thermal conductors attached to its exterior so as to provide additional area exposed to the hot water in the tank , allowing heat to be conducted through the conductors to the tube , and the water therein . an electric heater element ( 31 ) is shown in one embodiment and is positioned internal to the tank in close relation to the heat tube . the heater element is controlled by a thermostat ( 37 ) exposed thermally to the water in the water jacket and will close the electrical heater circuit when water temperature in the jacket falls below a preset value . the thermostat set temperature will be such that it is sufficient for the specified mass of water to heat the mass of cold sandwich water to a temperature acceptable as hot water . the jacket temperature will be maintained within a given limit cycle by the thermostat controlling the electric heater . other heating concepts are possible in other embodiments . the water jacket ( 32 ) is a volume defined by the exterior of the heat tube and the interior walls of the tank . when filled with hot water it will serve as a heat sink to provide heat to the cold sandwich water as it passes through the heat tube following opening of a faucet in the hot water distribution system . a return line ( 24 ) will emanate from the hot water distribution line proximate the faucet farthest from the heat exchanger in each branch to be provided with instant hot water . this line will form a circulation loop from the heat exchanger to the remote faucets and back to the heat exchanger . some portion of the circulation loop is required to be above the heat exchanger for the convective embodiment to function . the unit will also contain a check valve , as described in fig5 , to prevent reverse flow in the convective circulation loop . the valve will utilize a neutral buoyancy poppet ( 39 ) to respond reliably to the low pressure differential in a convective system . insulation ( 34 ) in the space between the tank and the outer housing , to minimize heat loss of the water jacket to surroundings , can be any of several commercial products currently available . fiberglass pads or pour - in wool - type insulation will suffice . another embodiment may also evacuate air from this space to eliminate convective heat transfer . an alternative embodiment that incorporates an optional electric pump in the return line to support instant hot water circulation for installations where sufficient difference in elevation to induce a passive , convective circulation flow does not exist is shown in fig3 . all other elements of this alternative are similar to the preferred embodiment . an additional embodiment considers the use of other heat sources to keep the water in the water jacket at the required temperature . a gas burner , associated with the primary tankless burner could be designed into the system with little impact upon the total system complexity and cost . as fuel cell technology improves a small fuel cell may be employed to provide heat to the water in the jacket . catalytic heaters , similar to those used in hand warmers , could also function to provide the low level of heat necessary to keep the water jacket up to temperature . another heat source uses the electrical impedance of water as its resistive element may also be incorporated into this invention as a highly reliable and simple heating mechanism . still another alternative embodiment , as shown in fig6 , is the integral tankless heater concept that incorporates the instant hot water heat exchanger unit within the tankless heater housing . the heat exchanger unit is similar to the above unit shown in fig4 a , the storage container includes a water inlet , an outlet , and a circulation return line inlet . the return line inlet also contains a check valve to prevent reverse flow in the return line . heat for the heat exchanger is provided by a small unit ( 40 ) of the same general style as the main heating element for the tankless heater , using the same energy supply , and exhaust systems . a separate control system will maintain the water in the heat exchanger at a constant elevated temperature . the heat exchanger unit operates in conjunction with a return line to create a hot water circulation loop comprised of the normal hot water distribution pipe , the return line connected to the hot water pipe at a point near a remote faucet , and the instant hot water heat exchanger as shown in fig6 . the heat exchanger is used to provide a low - level hot water circulation flow to remote outlets for the purpose of providing instant hot water to remote faucets , and to eliminate the cold - water sandwich . all water exiting the main heating element shall pass through the circulation heat exchanger . circulation may be driven by convective forces or through the use of an electric circulation pump . the circulation heater shall contain a sufficient quantity of heated water and residual heat to warm the cold sandwich as it passes through the storage tank . in yet another embodiment , as the cold water sandwich moves down the distribution line toward the hot water outlets , it encounters a separate , secondary , high intensity , heating element that is spaced at an appropriate distance from the main tankless heater to allow it to reach its operating temperature and heat the cold sandwich as it passes through . the secondary heating element is initiated at the time the main heater is started , which occurs when a hot water outlet is opened . this allows the secondary heater element to be up to temperature when the cold - water sandwich arrives . in another version of this same embodiment , rather than using another heating element to heat the cold sandwich , the distribution line is rerouted back through a separate loop in the main heating element , such that the cold water has traveled an appropriate distance for its arrival back at the heating element to coincide with the element reaching operating temperature . in the standard tankless water heater , during periods of no water use , the water will normally be at ambient temperature since the heating element is powered only when water is flowing . water in the distribution lines and the heater itself will cool to ambient temperature in one hour or less . when a hot water faucet is opened the pressure in the distribution line will drop , and water will flow from the supply through the tankless heater , and through the hot water distribution line to the faucet . the drop in pressure also signals a control circuit in the tankless heater to heat the water flowing through it . this heating is implemented by igniting a combustion burner or providing power to an electric element . since the water in the distribution pipe is at ambient temperature , a delay in hot water arriving at the faucet will be experienced until all cool water in the distribution pipe is expended . since a delay of several seconds is experienced for the heating elements in the tankless heater to reach their operating temperature , a volume of ambient temperature water that was inside , and about to enter the heater , will proceed down the distribution line toward the faucet without being heated causing an additional delay for hot water to arrive at remote faucets . using the elements identified in this invention , the heating element in the tank will maintain the water in the water jacket at a temperature in the range of 130 degrees f . that will transmit heat into the water in the heat tube bringing it to essentially the same temperature . water will continually circulate from the heat exchanger through the hot water distribution lines to remote faucets and back through the check valve to the heat exchanger due to convective forces . heated water from the distribution lines , and the heat tube , is available immediately at the remote faucet . as the cold sandwich flows through the heat tube , it is heated by the hot water in the water jacket . the check valve in the return line will prevent hot water in the tank from flowing up the return line toward the faucet , which would deprive the water in the cold sandwich of the heat in the jacket . thus , with this invention hot water would be availability immediately to the remote faucets and the cold sandwich would be eliminated . it can be recognized from the previous descriptions that the principal difficulties with tankless water heaters can be overcome with the present invention . savings in water and heat , and the convenience of instant hot water will appeal to those who have or will purchase a tankless water heater . due to the simplicity of the invention that directly attacks the issues with a minimum of components , the present invention will yield a product that will solve a known problem , will prove to be extremely reliable , and mesh well into the conservation movement . test objective : determine the effectiveness of a heat exchanger to eliminate the cold sandwich encountered with a tankless water heater . this assumes the system is using a water heat sink to support a circulation flow to the remote faucets for instant hot water . approach : the approach to satisfy the objective of the test is to simulate a heat exchanger stabilized in a 125 - 130 deg f . water heat sink , in series downstream of a tankless water heater , and to inject a five second volume of ambient temp ( 72 deg f .) water into the exchanger . measure the temperature of water as it exits the exchanger . specifically , record the lowest temperature observed at the outlet immediately after the five second flow of ambient water into the exchanger . test article : finned transmission cooler , 0 . 75 × 5 × 10 inch , 0 . 525 inch round copper tube , aluminum fins . fin volume = 37 . 5 cubic in , area = 50 in sq . 15 fins / inch . test set - up : place the heat exchanger in the bottom of a fibre - glass utility sink . rubber hoses connect the exchanger inlet to the faucet . install thermocouples in the heat sink water and the exchanger outlet . pre - test flow rate measured at 1 . 1 gal / min . procedure : fill sink with water at heater outlet temp , ( 125 deg f .) to cover the exchanger by about two inches . fill the heat exchanger with hot water . set the hot and cold faucets to yield water at a temp of 72 deg f ., by running it into a bucket so that it does not cool the water in the sink . connect the hose from the faucet to the exchanger inlet for 5 seconds , observing the water temperature at the exchanger outlet . record the water temperature in the heat sink , and the temperature at the exchanger outlet . 1 . the cold sandwich temp dropped to ˜ 90 deg f . which may be ok since the entire pipe to the remote faucet will be at ˜ 125 deg f . and will continue to warm the sandwich . ideally , the temp would not drop by more than 5 deg f . 2 . additional heat exchanger area should and higher heat sink temp be tested . 5 . an electric immersion heater in the pipe , 5 seconds downstream , would solve the cold sandwich issue , but would not provide instant hot water .	5
the process of the invention involves two steps . the first step is to react metal pentahalide , mx 5 , with two - equivalents of primary amine ( h 2 nr 1 ) or the metal hexahalides , m ′ x 6 , with seven - equivalents of primary amine , h 2 nr 1 . the reaction is carried out in the presence of a donating ligand ( dl ) capable of complexing with the respective metal to form the complex represented by the respective formulas , r 1 n ═ mx 3 ( dl ) 2 or [( r 1 n ) 2 m ′ x 2 ( dl )] 2 . dimethyl hydrazine and tert - butyl hydrazine may be used as the functional equivalent of a primary amine . in a favored reaction the first step is carried out in the presence of a donating ligand ( dl ), e . g ., using an excess of pyridine ( py ) as the donating ligand in a hydrocarbon solvent to produce a solid comprised of the intermediate complexes r 1 n ═ mx 3 ( py ) 2 or [( r 1 n ) 2 m ′ x 2 ( py )] 2 mixed together with insoluble hydrohalide salts of pyridine py . hx along with hydrohalide salts of primary amine r 1 nh 2 . hx . this mixed solid can be isolated as a solid via centrifugation methods , filtration or stripping off the hydrocarbon solvents . the solid intermediate r 1 n ═ mx 3 ( py ) 2 or [( r 1 n ) 2 m ′ x 2 ( py )] 2 can then be separated by extracting the solid using a suitable solvent and filtering to remove the insoluble by - products r 1 nh 2 . hx and py . hx . the second step involves reacting the intermediate complex represented by the formulas r 1 n ═ mx 3 ( dl ) 2 or [( r 1 n ) 2 m ′ x 2 ( dl )] 2 with an excess of lithium amide having the formula of linr 2 r 3 to afford the desired complex , r 1 n ═ m ( nr 2 r 3 ) 3 or ( r 1 n ═) 2 m ′( nr 2 r 3 ) 2 . as will be set forth in greater detail below , the process invention of this disclosure eliminates the need to employ either me 3 sicl or na 2 sio 3 as halide removing reagents . in addition , the amount of solvent used and reaction time can be reduced significantly with introduction a mixed solvent . the first step is represented in equations 1 and 3 whereas the second step is revealed in equations 2 and 4 for penta - and hexavalent metals respectively : the first step of the process can be run in the temperature range of − 40 ° c . to the boiling point of the hydrocarbon solvent ( s ) employed typically ˜ 70 ° c . the exact temperature range of the reaction is dependent on the specific solvent or a combination of organic solvents used and is preferably − 40 ° c . or lower to slow down the initial reaction exotherm . then , the temperature is gently raised to room temperature . a variety of primary amines may be used to react with the metal halides as represented in equations 1 and 3 and these include : c 1 - 8 alkylamines such as monomethylamine , ethylamine , n - propylamine ; i - propylamine , n - butylamine and i and t - butylamine ; cycloalkyl amines , such as cyclohexyl amine ; and aryl amines such as phenyl amine . for reasons of economy the lower alkyl c 1 - 4 amines are preferred . if the primary amines are a gas at room temperature , a solution containing the amines can be employed instead . furthermore , alkyl derivatives of hydrazine , for example dimethylhydrazine and tert - butylhydrazine can be employed and are contemplated as primary amines . in forming the intermediate complex , a donating ligand is used to complex with the metal in an effort to facilitate the required coordination number for the metal center and removal of hydrogen halide byproduct as shown in equations 1 and 3 . although pyridine is a preferred donating ligand for coordination to the metal center plus the removal of hx by - product , other nitrogen containing ligands such as tertiary amines and phosphorus containing ligands such as trialkyl or triaryl phosphines may also be used . examples of tertiary amines include c 1 - 8 alkyl amines , e . g ., trimethylamine , triethylamine , and so forth . trialkyl phosphines include c 1 - 8 alkyl phosphines , e . g ., trimethylphosphine , triethylphosphine , and so forth . triarylphosphines include c 6 - 8 aryl phosphines , e . g ., triphenylphospine p ( c 6 h 5 ) 3 . regarding the first step , a mixed solvent in which the reactants are at least partially soluble and the product substantially insoluble is employed to facilitate the reaction . a mixture of toluene and hexane ( s ) solvents , for example , is employed in an effort to promote the reaction to completion in a short period of time . the reactant mx 5 or m ′ x 6 is at least partially soluble in toluene and the reaction product is insoluble in hexane . separation is accomplished by effecting precipitation of the product , e . g ., r 1 n ═ tax 3 ( py ) 2 in the solvent . the ratio of toluene : hexane ( s ) can vary from 1 : 1 to 10 : 1 , preferably 1 : 1 to 4 : 1 , and most preferably about 2 : 1 . the reaction time ranges from 30 minutes to 6 hours , preferably 30 minutes to 2 hours , most preferably is about 1 hour . other hydrocarbon solvents may be used but these are preferred . in the second step , the intermediate complex is reacted with a lithium amide of the formula linr 2 r 3 . per the second step , as represented in equations 2 and 4 , the lithium amide reactant may be generated as follows : a secondary amine hnr 2 r 3 is used to react with a solution of an alkyl lithium compounds to generate lithium amide in situ . the selection of the secondary amines is dependent upon the product desired . exemplary solvents include hexane ( s ) or other organic solvent . a solution of alkyl lithium can vary from 1 to 10 m in hexane ( s ), most preferably 2 - 3 m alkyl lithium , such as but not limited to , n - buli or hexyl lithium in hexane ( s ). depending upon the choice of solvents employed in the first step , the lithium amide may be formed in situ in the second step , although preformed lithium amide may be used . the reaction temperature will range from − 40 ° c . to a temperature which is at or below the boiling point of the hydrocarbon solvent ( s ) employed , typically ˜ 80 ° c . the optimal temperature of the reaction is dependent on the solvent or a combination of organic solvents , the preferable temperature at the beginning of the reaction is − 40 ° c . the reaction time can be varied from 2 to 24 hours , preferably from 8 to 12 hours . in the second step , it is preferred that the solvent be selected such that the intermediate reactant and reaction product are at least partially soluble . preferably the solvent is selected such that the reaction product is sufficiently soluble to form a solution . typically , the solvent is comprised of a mixture of organics and hydrocarbons with a preferred solvent being comprised of a mixture of tetrahydrofuran ( thf ) and an organic solvent are used . a ratio of the thf : hexane as the solvent employed in the reaction , for example , can vary , on a volume ratio , from 1 : 1 to 10 : 1 , preferably 1 : 1 to 4 : 1 , and most preferably about 2 : 1 . the advantage of using thf is to offer a better reaction medium as well as to reduce the amount of solvent needed . most importantly , a thf solution of r 1 n ═ tax 3 ( py ) 2 , for example , is much easier to transfer from one reaction vessel to another as compared to a slurry of r 1 n ═ tax 3 ( py ) 2 in a single solvent such as hexane . slurries tend to cause reactor and line plugging adding to processing difficulties . although , not intending to be bound by theory , a key advantage in the synthesis of r 1 n ═ m ( nr 2 r 3 ) 3 or ( r 1 n ═) 2 m ′( nr 2 r 3 ) 2 type compounds is to form the r 1 n ═ m or r 1 n ═) 2 m ′ unit by removal of the two halide ligands in mx 5 or four halides in m ′ x 6 . there are two ways to remove the halide ligands , i . e ., in the form of either a halide derivative or a hydrogen halide . as shown in the prior art , me 3 si - is an excellent halide removal group . on other hand , na 2 sio 3 or other bases are also shown as hydrogen halide acceptors . however , the preparation of r 1 nh ( me 3 si ), in situ , by the reaction of r 1 nh 2 with me 3 six leads to the formation of a large amount by - product , r 1 nh 2 . hx , thereby requiring a large amount of solvent to complete the reaction . this also allows for the potential to introduce high molecular weight siloxane impurities , most likely present as contaminants in the me 3 six reactant . these siloxanes are very difficult to remove during the following purification process and thereby can contaminate the final liquid product . on the other hand , the insoluble na 2 sio 3 solid represents an inefficient heterogeneous absorbent to neutralize hx generated in situ and is , therefore , required to be used in impractically large amounts . the following examples are provided to illustrate various and preferred embodiments of the invention and are not intended to restrict the scope thereof . tacl 5 ( 50 g , 0 . 14 mol ) was loaded in a 500 ml of schlenk flask . 200 ml of anhydrous toluene was added , resulting in an orange slurry . tert - butylamine ( bu t nh 2 ) ( 28 . 6 ml , 0 . 28mol ) in 100 ml of hexane was added slowly at low temperature , generating a yellow slurry . the reaction mixture was stirred at reaction temperature ( rt ) for 10 min . and pyridine ( 42 . 7 ml , 0 . 55 mol ) was added . after the mixture was stirred at rt for 1 hr , stripping of solvents was performed to afford a yellow solid . extraction with 200 ml of thf and filtration via celite to remove insoluble salts bu t nh 2 . hcl or py . hcl gave a yellow solution . the resulting yellow tetrahydrofuran ( thf ) solution was slowly added to a hexane solution of lithium diethylamine ( linet 2 ) previously freshly prepared in situ by reaction of diethylamine ( hnet 2 ) ( 46 . 4 ml , 442 mol ) with n - buli ( 2 . 5m , 176 ml , 442 mol ) at low temperature . the reaction mixture turned purple after stirring at room temperature over night . removal of all solvents gave a dark brown oil with black solid . extraction with 100 ml of hexane and filtration afford a dark brown solution and a black solid . stripping off hexane from the dark brown solution gave a dark brown oil . vacuum distillation at less than 100 ° c . was applied to give a brown liquid ( 41 g , yield ˜ 60 % based on ta ). redistillation of the brown liquid afforded a pale yellow liquid . tacl 5 ( 50 g , 0 . 14 mol ) was loaded in a 500 ml of schlenk flask . 200 ml of toluene was added which resulted in an orange slurry . isopropyl amine ( pr i nh 2 ) ( 47 . 7 ml , 0 . 56 mol ) in 100 ml of hexane was added slowly , generating a yellow slurry . the reaction mixture was stirred at rt for 10 min . pyridine ( 42 . 7 ml , 0 . 55 mol ) was added . after the mixture was stirred at rt for 30 min , stripping of solvents was performed to afford a yellow solid . extraction with 200 ml of thf and filtration via celite to remove the insoluble salts pr i nh 2 . hcl or py . hcl gave a yellow solution . the resulting yellow thf solution was added to a hexanes solution of linet 2 prepared in situ by reaction of hnet 2 ( 46 . 4 ml , 442 mol ) with n - buli ( 2 . 5m , 176 ml , 442 mol ) at low temperature . the mixture turned brown after stirring at room temperature overnight . removal of all solvents gave a dark brown oil which was extracted with 100 ml of hexanes . filtration and stripping off hexanes from the filtrate gave a brown oil . vacuum distillation at less than 100 ° c . afforded a yellow liquid ( 21 g , yield ˜ 33 % based on ta ). a yellow solution of bu t ntacl 3 ( py ) 2 ( 12 . 0 g , 23 mmol ) in hexanes was added to a hexanes solution of linetme prepared in situ by reaction of hnetme ( 10 . 0 ml , 115 mol ) with n - buli ( 2 . 5m , 46 ml , 115 mol ) at low temperature . the mixture turned reddish brown after stirring at room temperature over night . filtration and stripping off hexanes from the filtrate gave a brown oil . vacuum distillation at 80 ° c . afforded a yellow liquid ( 4 g , yield ˜ 45 % based on ta ). 1 h nmr data ( c 6 d 6 , ppm ) 3 . 44 ( q ); 3 . 16 ( s ); 1 . 38 ( s ); 1 . 11 ( t ). in summary , as can be noted from examples 1 , 2 , and 3 , the process described herein provides significant process improvements over many of the prior art procedures .	2
the arrangement of fig1 comprises : a central processor 1 hereinafter briefly called &# 34 ; the cpu &# 34 ;; a first memory zone 2 accessed exclusively by the central processor and hereinafter called &# 34 ; the private memory &# 34 ;; a second memory zone 3 with common access and hereinafter called &# 34 ; the dma memory &# 34 ;; three three - state logic circuits 4 , 5 and 6 hereinafter called &# 34 ; tristate circuits &# 34 ; which , according to the logical level of the command signal , behave as short circuits or as open circuits for the communication channels in which they are connected and therefore function as physical switches for the channels ; a storage device 7 , hereinafter called &# 34 ; latch &# 34 ;, which is enabled to receive input data by a logical signal , which data will be permanently present at the output until a fresh enabling signal arrives ; two logic circuits 8 and 9 for signalling the type and validity of the addressing ; an address channel consisting of a first part 11 called bc and a second part 12 called bt ; a bidirectional channel 13 , called mt , for the communication of data from or for the memory and connected at two monodirectional channels 24 and 25 called me and ecd , respectively ; a block 10 indicating a plurality of peripheral unit controllers called gops ; two logic circuits 14 and 20 adapted to allocate the cycles of access to the dma memory 3 to the cpu 1 or to the gops 10 , respectively ; a logic circuit 15 adapted to generate beginning - of - cycle timing signals ; a logic circuit 16 , called &# 34 ; the cpu logic switch &# 34 ;, which is adapted to enable selectively the connections of the channels me , ecd and bc with the channels bt and mt which concern the dma memory 3 ; two logic gates 17 and 18 ; a logic circuit 19 adapted to generate end - of - cycle timing signals ; and an oscillating and synchronizing circuit 21 . it is pointed out that in fig1 , 4 , 5 , 6 and 8 all the signals whose names end in a vowel are understood to be active at high logical level , while those ending with the letter &# 34 ; n &# 34 ; are active at low level . operation of the arrangement of fig1 takes place in the following manner . when the cpu makes a request for access to memory , it emits the signal wbco . this access by the central processor may concern the private memory 2 , in which case it will be called &# 34 ; alfa access &# 34 ; for short , or it may concern the dma memory 3 , in which case it will be called &# 34 ; beta access &# 34 ;. access by the cpu 1 to the private memory 2 , i . e . an alfa access , requires no particular enable signal and is never delayed ; a beta access by the cpu , on the other hand , requires suitable enabling or inhibiting operations at the tristate circuits 4 , 5 and 6 and at the latch 7 to be effected . the logic circuit 14 provides for the handling of a beta access . at the inputs of the circuit 14 there are the following signals : wbco indicates a general request for access ( writing or reading ) by the cpu 1 ; exmi specifies whether the request for access is of beta type ; prqo indicates that the dma memory is currently engaged by the gops 10 ; reqso indicates that there is a request by the gops 10 . at the outputs : prwbo indicates allocation of the cycle of access to the dma memory 3 to the cpu 1 ; stucn indicates the presence of a request for access to the dma memory 3 by the cpu 1 . when the four input signals wbco , exmi , prqo and reqso indicate that a request for access by the cpu 1 to the dma memory 3 and that the gops 10 are not , at present , accessing the same memory , the circuit 14 activates the output signals prwbo and stucn . the signal stucn has the function principally of enabling the timing circuit 15 to generate timing signals peoo and ckoo - 40 . the signal prwbo has three functions . the first is to generate the signal staro for enabling the dma memory : the signal staro is generated by the or gate 18 , which has as input the output of the and gate 17 and the signal prco ; the and gate 17 has the signals ckoo and prwbo as input . the second function of the signal prwbo is to enable the tristate circuit 5 . in this way the channel bt 12 is connected to the channel bc 11 and the cpu 1 can address the dma memory 3 . the third function is to command the logic circuit 16 . the logic circuit 16 organizes the transmission of the data in both directions between the cpu 1 and the dma memory 3 . in addition to the signal prwbo to which reference has just been made , we have the following signals as input to the circuit 16 : reuco specifies whether access by the cpu 1 is for reading or writing in memory ; redi signals that the data read in the dma memory 3 is ready on the channel mt 13 ; readn signals the end of a cycle of access to the dma memory 3 . as output we have the signals metsa , strobn and metsn , which enable the tristate circuit 6 , the latch 7 and the tristate circuit 4 , respectively . during a writing operation of the cpu 1 in the dma memory 3 , the tristate circuit 4 remains constantly enabled . during a reading operation , the tristate circuit 6 remains constantly enabled , while the latch 7 is enabled whenever the data in the dma memory 3 is ready to be read . when the access cycle is ended , the dma memory 3 generates the end - of - access signal readn . the end - of - access signal readn enables the logic circuit 19 to generate the successive end - of - cycle timing signals meoco - 4 and the signals meocn and donen . the signals meocn and donen indicate the end of the access cycle to the cpu 1 and the gops 10 , respectively . so far , the case of access by the cpu 1 to the dma memory 3 has been seen . it is desired in particular to bring into evidence how this access is always possible if requests for access by the gops 10 are not present , since requests of the gops 10 have priority over the requests made by the cpu 1 . let us suppose that one or more gops 10 simultaneously make a request for access to the dma memory 3 . the logical or of these requests for access is sent as input to the logic circuit 20 by means of the signal reqoo . the other inputs of the logic circuit 20 are constituted by the following details : ckoo - 40 and meoco - 4 are suitable beginning - of - cycle and end - of - cycle timing signals adapted to condition the logical operations of the circuit ; dorin is a signal indicating the beginning of an alfa access by the cpu 1 to the private memory 2 . as output we have the following signals : prqo indicates that the access cycle has been allocated to the request made by one of the gops 10 ; prco corresponds to the signal prqo synchronized with timing signals and principally has the function of enabling the dma memory 3 through the logical or gate 18 ; ackoa is the signal which enables the gops 10 to address the dma memory 3 in the event of acceptance of the request . the circuit 20 has the function of synchronizing access to the dma memory 3 by the gops 10 with an alfa access by the cpu 1 to the private memory 2 . this circuit suitably delays the beginning of the cycle of access by the gops 10 so as to superpose the two cycles . another feature of the logic circuit 20 is that it synchronizes only the first request requoo with the beginning of an access of alfa type , while following requests are accepted immediately , so that they are met without delays and in a sequential manner . in the most general case an access by the gops 10 to the memory 3 is therefore a group of several sequential accesses . the logic circuit 21 comprises a quartz oscillator which generates the synchronism signal osci . the signal osci is used by the above - described logic circuits 14 , 16 and 19 . the logic circuit 21 moreover generates the signal dorin whenever the signal alfao indicates the beginning of an access to the private memory 2 . explanation of the circuits 8 and 9 and explanation of those signals of fig1 which have not yet been described will be postponed to the detailed examination to follow . a brief synthesis of operation will now be given with reference to the flow diagram of fig2 . when no request coming from the gops 10 is present , a possible request of beta type by the cpu 1 is followed by access to the dma memory 3 ( blocks 30 , 36 , 35 ). on the other hand , when a request by the gops 10 ( block 30 ) occurs , it is delayed until the cpu 1 terminates a possible access of beta type to the dma memory 3 ( block 31 ). at this point the gop 10 can access the dma memory 3 in synchronism with an access of the cpu 1 to the private memory 2 ( blocks 32 and 33 ). access requested by a gop 10 has priority over a beta access requested by the cpu 1 . if , at the end of an alfa access by the cpu 1 to the private memory 2 , the memory 3 is free , an immediate beta access will follow . if , on the other hand , the dma memory 3 is engaged by the gops 10 , the request ( beta ) is stored and allowed only on exhaustion of the access cycles done by gops 10 ( blocks 34 , 37 , 38 and 35 ). fig3 shows in detail the circuit construction of the blocks 8 and 9 of fig1 . the circuit 8 serves to program the capacity and the location of the two zones , called the private memory 2 and the dma memory 3 , which we divided the memory into . the circuit 8 has as input the five most significant bits present on the address channel bc 11 of the cpu 1 ( see fig1 ). the output signal exmi indicates by a high logical level that the address presented on the channel bc 11 belongs to the private memory 2 , while a low logical level indicates that it belongs to the dma memory 3 . the circuit 8 comprises a comparison circuit 40 adapted to compare the configuration composed of the signals bc11 - 14 and bx15 with an equal number of signals c11 - 15 . the output amibo indicates by a high or low logical level , respectively , whether the configuration formed by the signals bc11 - 14 and bx15 represents a number smaller or greater than the comparison configuration c11 - 15 . the circuit 41 is simply constituted by eleven movable connectors p1 - 11 . these connectors give the option of connecting or not connecting each of the inputs to the corresponding output . this option is essential for programming the locations and capacities of the zones 2 and 3 of the memory . referring to the following table 1 and to fig4 three modes of programming are distinguished . table 1__________________________________________________________________________ mode a mode b mode c connections connections connections p6 - 11 p6 - 11 p6 - 11 6 7 8 9 10 11 6 7 8 9 10 11 6 7 8 9 10 11connections c n n c c n n c n c c n n c c n n cp1 - 5 addresses addresses addresses1 2 3 4 5 from to from to from to__________________________________________________________________________n c c c c 0000 07ff 0800 ffff 0800 8000c n c c c 0000 0fff 1000 ffff 1000 8000n n c c c 0000 17ff 1800 ffff 1800 8000c c n c c 0000 1fff 2000 ffff 2000 8000n c n c c 0000 27ff 2800 ffff 2800 8000c n n c c 0000 2fff 3000 ffff 3000 8000n n n c c 0000 37ff 3800 ffff 3800 8000c c c n c 0000 3fff 4000 ffff 4000 8000n c c n c 0000 47ff 4800 ffff 4800 8000c n c n c 0000 4fff 5000 ffff 5000 8000n n c n c 0000 57ff 5800 ffff 5800 8000c c n n c 0000 5fff 6000 ffff 6000 8000n c n n c 0000 67ff 6800 ffff 6800 8000c n n n c 0000 6fff 7000 ffff 7000 8000n n n n c 0000 77ff 7800 ffff 7800 8000c c c c n 0000 7fff 8000 ffffn c c c n 0000 87ff 8800 ffffc n c c n 0000 8fff 9000 ffffn n c c n 0000 97ff 9800 ffffc c n c n 0000 9fff a000 ffffn c n c n 0000 a7ff a800 ffffc n n c n 0000 afff b000 ffffn n n c n 0000 b7ff b800 ffffc c c n n 0000 bfff c000 ffffn c c n n 0000 c7ff c800 ffffc n c n n 0000 cfff d000 ffffn n c n n 0000 d7ff d800 ffffc c n n n 0000 dfff e000 ffffn c n n n 0000 e7ff e800 ffffc n n n n 0000 efff f000 ffffn n n n n 0000 f7ff f800 ffff__________________________________________________________________________ it is to be noted that in table 1 the connections to be made in positions p1 - 11 of the circuit 41 of fig3 are indicated by a &# 34 ; c &# 34 ;, while the connections not to be made are indicated by an &# 34 ; n &# 34 ;. for each arrangement of the configurations p1 - 11 there are given in correspondence therewith the various groups of addresses ( in hexadecimal notation ) belonging to the dma memory 3 . it can be observed in particular how the capacity of the dma memory 3 can be incremented by modules having 2048 ( 2k ) words . in the first mode , mode a , the connections p6 , p9 and p10 are made , while the connections p1 - 5 program the capacity of the dma memory 3 . the connection p6 puts exmi equal to the negated form of amibo . the connection p9 puts b × 15 = bc15 . the connection p10 is a connection with a constantly low logical level . the consequence is that the connections of the connectors p1 - 5 actually made bring the inputs c11 - 15 of the circuit 40 to low logical level , defining in this way the comparison configuration . those connections p1 - 5 not made ( n in table 1 ) define a corresponding signal c11 - 15 of high logical level . it is explained at this point that bc11 - 15 represents a number greater than c11 - 15 whenever the address present on the channel bc 11 is a number greater than the configuration c15 - c14 - c13 - c12 - c11 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 - 1 . in this case the signal exmi is at high logical level and thus indicates that the address relates to the private memory 2 . in the opposite case ( address lower than the foregoing configuration ), the signal exmi is at low logical level and indicates that the address relates to the dma memory 3 ( see fig4 a ). mode b differs from mode a only in the fact that the connection p7 is made instead of the connection p6 . the consequence is that , the other conditions being equal , the signal exmi always gives an opposite indication to that of mode a . the two memory locations are therefore inverted with respect to the previous case ( see fig4 b ). in mode c the connections p7 , p8 and p11 are permanently made . the result is that as long as the address presented on the channel bc 11 is less than 1000000000000000 it has the most significant bit bc15 at low logical level and the circuit 8 behaves as in case b . in fact , when the bit bc15 is at low logical level , the output signal exmi indicates that the address present on the channel bc 11 relates to the private memory 2 , in the case where the address is lower than the comparison address . on the other hand , in the case where the address is higher , the output signal exmi indicates that the address relates to the dma memory 3 . when the address presented on the channel bc 11 is equal to or greater than 1000000000000000 , the most significant bit bc15 is obviously at high logical level . this imposes a high logical level on the signal c15 ( connection p11 ), so that the comparison circuit 40 interprets the address present on the channel bc 11 as belonging to the private memory zone 2 ; the consequence is the configuration of fig4 c . table 1 specifies , also for mode c , the practical choice of the locations of the dma memory 3 with the respective addresses . the detailed description of the remaining blocks contained in fig1 is prefaced by the information that the letter &# 34 ; v &# 34 ; present at the asynchronous inputs of a number of flip - flops of j - k type represents a fixed voltage adapted to permit asynchronous operation of the arrangement in some cases . the logic circuit 9 has the function of allowing the signalling of a non - valid address to the cpu 1 . as input to the logic circuit 9 ( fig3 ) we have the following signals with their respective significances : meocn indicates the end of a cycle of access by the cpu 1 ; wbcso indicates a request for access of beta type coming from the cpu 1 ; invvi , if low , indicates that the address being sought is present in the dma memory 3 . the output invvo has the function of indicating that the address being sought is present in the dma memory 3 or in the private memory 2 , according to the type of access . when access by the cpu 1 is addressed to the private memory 2 , the signal exmi activates the flip - flop 45 , which is timed by the signal wbcso . the flip - flop 45 then presents a high logical level as output and the output invvo from the logical or gate 46 will also be at high logical level . on the other hand , when access by the cpu 1 is addressed to the dma memory 3 , the output of the flip - flop 45 is at low logical level , while the signal meocn enables the logical and gate 47 ; the output invvo therefore simply copies the logical level of the signal invvi . the utility of the signal invvo can be better understood by referring to fig5 which shows a connecting system for the various memory blocks ( making up the zones 2 and 3 ) which is useful for signalling to the cpu 1 or to the gops 10 that the address being sought is not contained in that zone of the memory . when the private memory 2 is concerned , the circuit 9 sends the conductor invvo to a high logical level . this is represented by the connection of the switch 74 to the supply voltage of + 5 volts ( block 9 ). as can be seen from the drawing , the presence of the address being sought in one of the blocks 75 , 76 of the private memory 2 can suitably command a transistor 70 or 71 and bring the conductor invvo to low logical level . only in the case in which the address being sought is not present in any block of the private memory 2 will the conductor invvo continue to remain at high logical level , signalling the error in this way to the cpu 1 . when the dma memory 3 is concerned , the circuit 9 acts so that on the conductor invvo there appears the same logical level present on the conductor invvi , effecting the closure of the switch 74 . similarly to the case of access to the private memory 2 , if the address is not present in either of the blocks 77 , 78 of the dma memory 3 , the transistor 72 or 73 does not lower the logical voltage of the conductor invvi and this signals &# 34 ; out of memory &# 34 ; to the cpu 1 by a high logical level . a description will now be given of other blocks of fig1 for which reference may be made to the timing diagrams of fig8 . as has already been said , the priority circuit 14 ( fig6 ) provides for storing requests for access of beta type and for determining allocation of the access cycles to the cpu 1 . a general request for access wbco by the cpu 1 is stored at the output of the flip - flop 52 by means of the delay flip - flops 50 and 51 only in the presence of the signal exmi . this means that only when the request is directed to the dma memory 3 ( beta access ) does the signal wbcso rise to high logical level . if there are neither requests by a gop 10 , nor cycles to be allocated ( signals req50 and prqo at low logical level ), and if the signal wbcso is at high logical level , the signal stucn issuing from the nand gate 53 goes to low logical level , signalling in this way the validity of the request by the cpu 1 . these same conditions set the output of the flip - flop 54 in asynchronous manner , that is the signal prwbo rises to high logical level and the cycle of access to the dma memory 3 is allocated to the cpu 1 . the signal wbcso has only the duration of a period of the signal osci , and thus also stucn ( fig8 ). after this interval , the signal stucn will be at high logical level , so that the flip - flop 54 will function in synchronous manner . because of this , the flip - flop 54 will reset itself and therefore the signal prwbo will go to low logical level only in corrspondence with the signal peoo and when reqso at high logical level will indicate an accepted request coming from the gops 10 . the timing circuit 15 generates a group of signals peoo and ckoo - 30 out of phase in time whenever the signal reqso or stucn indicates that a request for access to the dma memory 3 has been accepted . when a request for access by the gops 10 is accepted , both reqso and stucn are at high logical level and therefore the consequence is that the flip - flo 60 operates in synchronous manner and its output peoo is set . the signal peoo applied as input to the first stage of the shift register 61 , which is commanded by the synchronism pulses osci , activates in succession , at each synchronism pulse , the signals ck00 , ck10 , ck20 and ck30 ( fig8 ). when the signal ck10 goes to high logical level , the flip - flop 60 is obviously reset ( pe00 = 0 ). owing to this , the signals ck00 - 30 will also return to low logical level . when a request for access coming from the cpu 1 is accepted , both stucn and reqso are at low logical level , the flip - flop 60 operates in asynchronous manner and its output peoo is set . operation is therefore similar to the preceding case , that is the same waveforms are again generated . the logical switching circuit 16 generates the signals necessary for selectively enabling the cpu 1 to read or write in the dma memory 3 . it will be remembered that the signals strobn and metsa enable reading , while the signal metsn enables writing , and that if the input signal reuco is at high logical level it indicates a writing access and if at low level it indicates a reading access . the signal prwbo enables the nand gates 82 and 83 in the case of access by the cpu 1 . the signal reuco commands the flip - flops 80 and 81 to activate selectively the signals mesno and metsa . the signal strobn appears only in the case of reading , that is when the memory is ready to transmit the data ( signal redi ). at the end of the access , the flip - flop 80 is reset by the same signal reuco , while the flip - flop 81 is reset by the signal readn of end of access to the dma memory 3 . the timing circuit 19 is composed of five flip - flops 84 - 88 synchronized by the signal osci . the signal readn of end of access to the dma memory 3 is therefore shifted at each synchronism pulse to a following one of the flip - flops 84 - 88 and gives rise to the sequence of timings meoc1 - 4 ( see fig8 ) every time an access to the dma memory 3 is terminated . the nand gates 89 and 90 are enabled by the signals prqo and prwbo , respectively . the signal donen at the output of the nand gate 89 indicates to the gops 10 that the cycle of access to the dma memory 3 is terminated , while the output signal meocn of the nand gate 90 supplies the same indication to the cpu 1 . as has already been said , the priority circuit 20 ( fig7 ) provides for storing and suitably synchronizing requests for access coming from the gops 10 ( signal reqoo ). as output there are generated the signals reqso and prqo of known significance , and the signal ackoa which indicates acceptance of the request made to the gops 10 , and finally the signal prco which enables the dma memory 3 at the appropriate instant . when the gops 10 make a first request for access reqoo , the flip - flop 95 is not enabled by the nand gate 101 and the signal reqoo therefore only concerns the flip - flop 96 . as soon as a fresh access of alfa type by the cpu 1 begins , the signal dorin is enabled by abcon by means of the and gate 100 and generates through the or gate 99 the timing signal sinc for the flip - flop 96 . the signal reqso at the output of the flip - flop 96 is therefore set at high logical level only in correspondence with the beginning of an access of alfa type by the cpu 1 ( signal dorin ). if the signal reqso is set , the flip - flop 97 also sets the signal prqo ( which indicates a cycle allocated to the to the gops ) in correspondence with the beginning - of - cycle signal peoo . simultaneously , the signal pe00 and the signal prqo ( both at high logical level ) set the flip - flop 107 by means of the nand gate 106 . in this way there is also activated the signal ackoa enabling the gops to being the requested memory cycle . the signal prqo at high logical level is applied as input to the nand gate 101 together with the timing signal meoc 3 . the flip - flop 95 is obviously enabled and will set itself on presence of requests reqo following the first . owing to this , the signal sinc enabling the flip - flop 96 will be activated through the medium of the and gate 98 and the or gate 99 by the signal premn . the signal premn is generated by means of the or gate 108 as a combination of the end - of - cycle signals meoc 2 and meoc 1 and the signal prqo . the result of all this is that the first request by the gops 10 is enabled only at the beginning of an access of alfa type , while following requests are enabled by the end - of - cycle signals of the preceding request , so that they are accepted sequentially without delays . the and gates 102 , 103 , 104 and the nor gate 105 constitute a circuit adapted to enable or reset the flip - flop 96 . the signals prqo , abcon , ck30 , meoc1 , meoc3 and resn , to which the last - mentioned signal reference will be made hereinafter , define in fact , according to their logical level , the conditions under which the flip - flop 96 must be enabled by means of the signal maso to accept the input signals or must remain reset . this circuit meets the need to mask requests for access reqo under specific logico - temporal conditions . the end - of - cycle signals meoc5 and meoc4 and the signal abcon provide by means of the and gate 106 and the nand gate 107 for generating the end - of - cycle reset signal resn used by the flip - flop 97 and by the nor gate 105 . the circuit 21 comprises a quartz oscillator quarz which generates the synchronism signal osci withe a period of 50 nsec , and a circuit for generating the signal dorin of beginning of access of alfa type . the flip - flop 112 , synchronized by the signal oscio , is set when the signal alfao , indicating a request for access of alfa type , goes to high logical level . the output of the flip - flop 112 goes as input to the flip - flop 113 with crossed connections , so that it is clear that only when the signal alfao is activated the outputs of the and gates 114 and 115 go high for the duration of a synchronism pulse osci and the signal dorin is generated at the output of the nor gate 116 . let us see the characteristics of the arrangement of fig1 in terms of times . let ast be the time required by the gops 10 for carrying out an access or several sequential accesses to the dma memory 3 . let ts be the total time available for superposing the cycles , that is the interval of time between the beginning of the alfa access and the beginning of a beta access by the cpu 1 . in our embodiment the time ts = 1100 ns . the time ast depends on the number of sequential accesses effected by the gops 10 : in the case of a single access ast = 900 ns . it follows from this that if the gops 10 effect one access only at a time , the condition ast & lt ; ts takes place , which condition represents a complete superposition of the accesses . on the other hand , if the gops 10 effect several accesses in sequence , that is the condition ast & gt ; ts , the cycle of the cpu 1 in progress will , on the other hand , be delayed by the time r1 = ast = ts . logically , a high number of fast peripherals will increase the probability of sequential accesses by the gops 10 and will progressively delay execution of the programs of the cpu , the total saving of a time equal to ts for each access or group of accesses allocated to the gops 10 remaining fixed . those skilled in the art will , however , know exactly how to adjust the number of extensions and applications to particular peripherals in relation to their speed in order to obtain the maximum advantage from the saving of time allowed by the present arrangement .	6
referring now to the figures of the drawing in detail and first , particularly , to fig1 thereof , there is shown a perspective view of an inner container 1 of a refrigerator according to the invention . the inner container 1 is a unipartite hollow body that is formed by deep - drawing from flat plastic material . it is subdivided into a freezer compartment 2 and a normal refrigerating compartment 3 which are provided in order to be cooled in the finished refrigerator by a common evaporator or two evaporators series - connected in a refrigeration circuit . a planar face 4 on the rear side of the normal refrigerating compartment 3 is provided in order to fit the evaporator to its outer side . in the lower region of the normal refrigerating compartment 3 , an opening is punched into the rear wall of the inner container 1 , into which opening a heating subassembly , of which only a cover 5 facing the interior space can be seen in fig1 , is mounted . in the rear view of the inner container 1 shown in fig2 , a support 6 of the heating subassembly can be seen . as shown in fig3 , the cover 5 of the heating subassembly can be removed in the state mounted on the inner container 1 such that a foil heater 7 which is enclosed between the cover 5 and support 6 of the heating subassembly is accessible from the normal refrigerating compartment 3 . fig4 shows the heating subassembly separated from the inner container and in the assembled state . a circumferential frame 8 is integrally formed on the support 6 and in the mounted state engages in the punched opening of the inner container 1 with a form fit . a circumferential edge strip 9 of the support 6 surrounds the frame 8 and is provided in order to bear in the mounted state against the outer side of the inner container 1 . latching lugs 10 which can be elastically displaced into the interior of the frame are formed on the frame 8 at a distance from the edge strip 9 corresponding to the wall thickness of the inner container 1 , and , in the mounted state of the heating subassembly , hold the edge strip 9 pressed against the outer side of the inner container 1 . this and the form - fitting engagement of the frame 8 in the opening of the inner container 1 prevent expandable material , such as in particular polyurethane foam , from penetrating through the opening of the inner container 1 into the interior of the refrigerating compartment 3 when , after mounting of the heating subassembly , this material is injected into an intermediate space between the inner container 1 and a non - illustrated outer wall of the refrigerator . a tool can be inserted into a niche 14 of the frame 8 in order to feed the cover 5 to , and remove the cover 5 from , the frame 8 . an electrical supply line 11 of the heating subassembly runs through a duct 12 recessed in the edge strip 9 . the penetration of insulating material into the interior of the heating subassembly at the level of the duct 12 is also prevented by precisely matching the cross sections of supply line 11 and duct 12 to one another . the supply line 11 bears a plug - in connector 13 at its free end . the heating subassembly can be mounted in simple manner by being pressed into the opening of the inner container 1 from the outside and being latched therein , and by the plug - in connector being inserted into a non - illustrated complementary bushing which is disposed outside the inner container 1 . fig5 shows , in the same perspective as fig4 , the heating subassembly with the cover 5 removed . the electrical heating foil 7 connected to the supply line 11 occupies almost the entire face of the support 6 surrounded by the frame 8 . it bears loosely against the support 6 or is at best adhesively bonded to it at points . the position of the heating foil 7 on the support 6 is defined by a plurality of short , triangular webs 15 which each extend inward from the frame 8 and keep the heating foil 7 spaced apart from the frame 8 . a short section of the frame 8 is interrupted at the level of the duct 12 such that , during mounting of the refrigerator , the heating foil together with the connected supply line 11 and plug - in connector 13 can be conveniently put into place . fig6 shows a perspective view of the cover 5 of the heating subassembly , as seen from the inside . a plurality of parallel ribs 16 are formed on the inside of the cover 5 , each at a level which is dimensioned such that the heating foil 7 is held pressed against the support 6 when the cover is closed . the ribs 16 thus keep free between the heating foil 7 and the cover 5 an intermediate space in which air can circulate and thus effect thermal compensation between different regions of the heating foil . the circulation of this layer of air contributes , along with heat of radiation , to heating of the cover 5 and therefore of the normal refrigerating compartment 3 of the refrigerator . four latching arms 17 are integrally formed in the vicinity of the edge of the cover 5 . the length of these latching arms is greater than the height of the ribs 16 . in the mounted state of the heating subassembly , the latching arms 17 engage through the intermediate space , which can be seen in fig5 , between the frame 8 and the heating foil 7 secured by the webs 15 , into chambers 18 formed on the support 6 . the chambers 18 can be seen in the view of the support 6 shown in fig7 . the latching arms 17 and latching lugs 19 protruding laterally into the chambers 18 each have latching faces 20 which run at an obtuse angle to the insertion direction of the latching arms 17 and thus permit the cover 5 to be released from the support 6 by simply pulling at the cover 5 .	5
[ 0014 ] fig1 illustrates in perspective and fig2 in side view a palletizer 10 according to a preferred embodiment of the present invention . in fig1 and 2 , palletizer 10 includes a frame 12 of generally box - form configuration . frame 12 includes four vertical posts , individually posts 12 a - 12 d , supporting an upper structure comprising horizontal beams 12 e - 12 h . thus , the lower end of each of posts 12 a - 12 d rests on a floor and the upper ends of posts 12 a - 12 d support beams 12 e - 12 h . beams 12 e - 12 h provide a generally horizontal rectangular structure maintained at a given level above floor level . generally , frame 12 provides a relatively compact overall structure supporting therein elements of palletizer 10 as described more fully hereafter . adjacent frame 12 , palletizer 10 includes an infeed conveyor 14 . infeed conveyor 14 is a “ production level ” conveyor receiving , for example , output from a production or manufacturing operation or from a repackaging operation . infeed conveyor 14 includes along its length a series of live , i . e ., powered , rollers 14 a . infeed conveyor 14 also includes a case turner 16 . case turner 16 manipulates incoming items 18 , e . g ., cases of products , appropriately according to programmed layer building patterns . use of case turner 16 and layer building methods and patterns are well known in the art . generally , infeed conveyor 14 moves a series of items 18 therealong for presentation to the remaining portions of palletizer 10 as operating within frame 12 . as may be appreciated , infeed conveyor 14 and turner 16 operate cooperatively to appropriately orient a sequence of items 18 according to a programmed layer building pattern including contemplation of necessary sequential row patterns interfitting to form layer patterns and layer patterns interrelating to produce a stable stack of items on a pallet 40 . thus , it will be understood that items 18 are not necessarily symmetrical and may be oriented according to a specific predefined layer building pattern taking into account row - by - row variations within a layer and layer - to - layer variations for adjacent layers on a stack of item 18 layers resting on pallet 40 . within frame 12 , palletizer 10 includes a vertically reciprocating row conveyor 20 and a vertically reciprocating layer head 22 . a row conveyor lift motor 24 when actuated vertically reciprocates conveyor 20 as indicated at reference numeral 21 . a layer head motor 26 when actuated vertically reciprocates layer head 22 as indicated at reference numeral 23 . generally , each of row conveyor 20 and layer head 22 are independently suspended within frame 12 . more particularly , row conveyor 20 hangs from four suspension points 25 . layer head 22 hangs from four suspension points 27 . each of conveyor 20 and layer head 22 carry a pair of guides 29 . each of vertical posts 12 a - 12 d carry on their inner surface a corresponding guide track 31 . thus , guide tracks 31 on posts 12 a and 12 d interfit guides 25 of row conveyor 20 and maintain conveyor 20 along a vertical path within frame 12 . similarly , guide tracks 31 on vertical posts 12 b and 12 c interfit with guides 27 on layer head 22 to maintain layer head 22 along a vertical path within frame 12 . suspension chains and associated sprockets couple each of row conveyor 20 and layer head 20 to the respective motors 24 and 26 . more particularly , row conveyor 20 hangs within frame 20 from a first set of four suspension chains 32 routed through appropriate sprockets 34 and coupled to motor 24 . actuation of motor 24 in a first direction lowers row conveyor 20 and actuation in the opposite direction raises row conveyor 20 . specifically , the output shaft 24 a of drive motor 24 extends the length of horizontal beam 12 e ( shown only partially in fig1 ) and carries at each end a pair of sprockets 34 a . suspension chains 36 engage sprockets 34 a and move in response to rotation of sprockets 34 a . one end of each of chains 32 couples to a suspension point 25 and the other end of each of suspension chains 32 carries a counter weight ( not shown ) depending directly below each pair of sprockets 34 a . in this manner , chains 32 remain engaged relative to sprockets 34 a and , therefore , relative to drive motor 24 . similarly , a second set of four suspension chains 36 and sprockets 38 suspend layer head 22 within frame 12 and couple to motor 26 . actuation of motor 26 in a first direction moves layer head 22 upward and actuation in the opposite direction lowers layer head 22 . specifically , the output shaft 26 a of drive motor 26 extends the length of horizontal beam 12 g ( shown only partially in fig1 ) and carries at each end a pair of sprockets 38 a . suspension chains 36 engage sprockets 38 a and move in response to rotation of sprockets 38 a . one end of each of chains 36 couples to a suspension point 27 and the other end of each of suspension chains 36 carries a counter weight ( not shown ) depending directly below each pair of sprockets 38 a . in this manner , chains 36 remain engaged relative to sprockets 38 a and , therefore , relative to drive motor 26 . thus , row conveyor 20 and layer head 22 operate independently and may be vertically positioned by appropriately actuating and controlling motors 24 and 26 , respectively . row conveyor 20 moves to a lower position vertically coincident with the height of infeed conveyor 14 to receive from infeed conveyor 14 one row of items 18 . as discussed above , the row of items 18 presented to row conveyor 20 at the output of conveyor 14 correspond to an ongoing layer building pattern , i . e ., particular ones of the items 18 within a given row are suitably oriented according to and overall sequence of item 18 orientation pattern . as live rollers 14 a propel a sequence of items 18 onto row conveyor 20 , live rollers 20 a activate and collect the sequence of items 18 as a row onto conveyor 20 . as may be appreciated , live rollers 20 a are suitably operated in coordination with live rollers 14 a of conveyor 14 to pass serially a given set of items 18 from conveyor 14 onto conveyor 20 . in this manner , conveyor 20 receives one row of items 18 from conveyor 14 . conveyor 20 is then vertically positioned as necessary to vertically coincide with a current height of layer head 22 to pass the row of items 18 from conveyor 20 to layer head 22 . as may be appreciated , because both row conveyor 20 and layer head 22 independently vertically reciprocate a broad combination of relative movements may be accomplished by programmed control to transfer a row of items 18 from conveyor 20 to layer head 22 , i . e ., one of the two devices may be moved to match the height of the other or both moved to match some intermediate or predetermined height according to programmed control . generally , however , it is contemplated that the relatively higher speed conveyer 20 “ chase ’ layer head 22 , i . e ., seek out a current height for layer head 22 , when transferring a row of items 18 from conveyor 20 onto layer head 22 . in this particular embodiment , conveyor 20 includes a row pusher 30 of generally conventional design including a pneumatic cylinder 30 a for pushing a row of items 18 from conveyor 20 onto layer head 22 . thus , row conveyor 20 vertically aligns itself with a current vertical position of layer head 22 and passes laterally a row of items 18 from conveyor 20 to layer head 22 . generally , layer head 22 tracks the height of a stack of items 18 layer as positioned on a pallet 40 . pallet 40 rests at floor level and receives layer - by - layer items 18 from layer head 22 . once a complete layer of items 18 has been built row - by - row on layer head 22 , layer head 22 deposits the entire layer as a next layer on pallet 40 or on a stack of layers resting on pallet 40 . as will be described more fully hereafter , layer head 22 withdraws its support from below a layer of items 18 and drops the layer onto a pallet 40 below or onto a stack of item 18 layers resting on pallet 40 below . layer head 22 then repositions itself , i . e ., raises , to prepare to receive a next item 18 layer row - by - row from row conveyor 20 . [ 0024 ] fig3 and 4 detail layer head 22 as detached from frame 12 . fig5 illustrates a dead plate 108 of layer head 22 , but detached therefrom for purposes of illustration . in fig3 - 5 , layer head 22 includes a set of free rollers 100 carried on a pair of chains 102 a and 102 b . sprockets 103 a constrain chain 102 a to an l - shaped path . similarly , sprockets 103 b restrict chain 102 b to a corresponding l - shaped path . rollers 100 attach to a length segment of chain 102 a and thereby create a removable floor relative to layer head 22 . a drive shaft 105 couples to one of sprockets 103 a and one of sprockets 103 b and thereby ties together chains 102 a and 102 b . drive motor 104 turns shaft 105 to move chains 102 a and 102 b along their respective and coordinated l - shaped paths . a pair of vertical plates 110 , individually 10 a and 110 b , support shaft 105 and also carry thereacross a stop 111 , i . e ., a raised edge formation . stop 111 engages a leading lower edge of an item 18 layer while being dropped from layer head 22 . floor drive motor 104 operates to move chains 102 and thereby withdraw rollers 100 from a supporting or floor position relative to an item 18 layer to an open position allowing an item 18 layer to drop through layer head 22 onto a pallet 40 therebelow or onto a stack of item 18 layers therebelow . advancing rollers 100 rightward , in the view of fig3 and 4 , moves rollers 100 out of a floor position as illustrated in fig4 and into an open position occupying the vertical portion of the l - shaped path provided by sprockets 103 and chains 102 . once the leading edge of the item 18 layer engages stop 111 , the item 18 layer holds its position and rollers 100 continue to move out from thereunder to drop the item 18 layer therebelow . the first row of items 18 to fall from layer head 22 is the row most distant from stop 111 . thus , the first - to - arrive row of items 18 , i . e ., the row first placed on layer head 22 when constructing a layer , is the last row to fall from layer head 22 when releasing an item 18 layer . the last - to - arrive row is , therefore , the first row dropped from layer head 22 . in this manner , a complete item 18 layer drops through the opened floor of layer head 22 . layer head 22 includes conditioning mechanisms to better organize a given item 18 layer thereon prior to dropping the layer on a pallet 40 or a stack of layers therebelow . as discussed above , palletizer 10 accommodates an ongoing layer building pattern . items 18 of varying orientation must be organized into a layer . a relatively loose , i . e ., with space therebetween , initial organization of items 18 better facilitates layer building patterns . thus , as initially organized on layer head 22 , items 18 are loosely packed but possess the required relative orientations to form , when brought together , a desired and compact overall item 18 configuration within a given layer . generally , layer head 22 includes conditioning mechanisms to collapse together along orthogonal dimensions a loosely packed item 18 layer into a tightly packed item 18 layer . a pair of side clamps 106 , individually 106 a and 106 b , move laterally inward in a first dimension and compress together an item 18 layer in preparation for deposit on a stack of item 18 layers therebelow . a pneumatic cylinder 106 c couples by way of scissor mechanism 107 ( shown partially at reference numeral 107 a in fig4 ) to operate clamps 106 a and 106 b in parallel , i . e ., move laterally inward in parallel and coordinated orientation . a dead plate 108 ( shown separately in fig5 ) rotates about an axis 108 a , i . e . flips up into and past a vertical position , to compress a layer of items in a second dimension . thus , operating side clamps 106 and pivoting dead plate 108 compresses together , in first and second mutually orthogonal dimensions , a layer of items 18 prior to deposit on a surface therebelow . thus , the process of building a layer row - by - row on lift head 22 results in some disorganization or loose fitting layers requiring , for optimal stacking , that the layers be compressed together in two dimensions , i . e . squeezed inward by bars 106 and plate 108 , to make a compact organized layer ready for stacking on a surface therebelow . in fact , a palletizer which permits significant disorganization in an item 18 layer while constructing such layer row - by - row promotes rapid construction of the layer . for example , certain layer building patterns require an interfitting relationship between rows within a layer . when such interfitting is required , it is easier and faster to initially form the layer as a loose organization of items 18 to better facilitate rows having items 18 interfitting with other rows . palletizer 10 facilitates such loose organization of a layer of items 18 during construction thereof at upward - facing side plates 109 a and 109 b . generally , side plates 109 are upward facing , smooth surfaces adjacent the ends of rollers 100 on each side of layer head 22 . rollers 100 are of sufficient length to support a tightly - packed item 18 layer thereon . in accordance with the present invention , rollers 100 need not be any wider than necessary to support an item 18 layer thereon by virtue of support at side plates 109 a and 109 b . more particularly , a loosely fitting item 18 layer occupies more area , i . e ., requires a greater support surface , than a tight - fitting item 18 layer . side plates 109 a and 109 b support the outer edges of a loosely - fitting item 18 layer and thereby provide a greater area for supporting an item 18 layer during construction . in other words , layer head 22 tolerates significant disorganization among layers during layer formation and thereby facilitates rapid layer construction on layer head 22 . once the layer has been loosely organized on the upward facing surfaces of layer head 22 , i . e ., on rollers 100 and side plates 109 a and 109 b , dead plate 108 and side clamps 106 operate to drive together and compress the loosely organized item 18 layer into a tightly fitting item 18 layer resting entirely on rollers 100 . as best seen in fig4 the length of dead plate 108 corresponds to the length of rollers 100 . dead plate 108 includes , at each end , notches 108 b and 108 c , respectively . when plate 108 pivots upward , as indicated at reference numeral 108 d in fig5 notches 108 b and 108 c leave an open space therebelow to accommodate inward movement of clamps 106 , i . e ., inward and past the ends of dead plate 108 . with dead plate 108 moved to its “ clamping ” position , i . e ., pivoted inward to engage and compress and item 18 layer resting on layer head 22 , side clamps 106 move inward and if necessary reach beyond the ends of rollers 100 to thereby compress together in coordination with dead plate 108 an entire item 18 layer from a loosely organized item 18 layer into a tightly - fitting item 18 layer . as may be appreciated stop 111 operates in coordination with clamps 106 and dead plate 108 to compress together an item 18 layer resting upon layer head 22 . more particularly , stop 111 resists movement of an item 18 layer in response to dead plate 108 pivoting into its clamping position . in fig5 a pivot shaft 108 g mounts rotatably to layer head 22 and carries thereon dead plate 108 . a pair of pneumatic cylinders 108 e couple by way of corresponding levers 108 f to pivot shaft 108 g . thus , actuation of cylinders 108 e causes movement of dead plate 108 between a transition position as shown in fig4 and 5 and a clamping position , i . e ., pivoted inward as indicated at reference numeral 108 g . thus , dead plate 108 , rollers 100 , side plates 109 , stop 111 and side clamps 106 cooperatively tolerate significantly loose organization among items 18 when forming an item 18 layer and compress together items 18 in a tight fitting layer supported entirely on rollers 100 . dead plate 108 provides a transition surface filling a gap between row conveyor 20 and layer head 22 . conventional dead plates , i . e ., transition devices , are generally fixed in position . dead plate 100 goes beyond a transition function and provides a compression function . the horizontal position of dead plate 108 provides , therefore , a transition surface function when item 18 rows are pushed onto layer head 22 . after the last - to - arrive row of items 18 is located on layer head 22 , dead plate 108 pivots up to compress and provide a secondary backstop for proper layer construction . plate 108 thereby provides an ability to lower into a generally horizontal conventional dead plate position for a net fit between a reciprocating layer head 22 and whatever it mates with for receiving rows , e . g ., a row conveyor 20 . pivoting dead plate 108 provides also a layer compression device which operates in opposition to stop 111 as provided across plates 110 . in other words , dead plate 108 can push a layer against the stop 111 and thereby squeeze or compress the layer between plate 108 and stop 111 . dead plate 108 provides a particularly important advantage during layer release , i . e ., when rollers 100 are pulled from under an item 18 layer to drop the item 18 layer through layer head 22 . as discussed above , dead plate 108 pivots into clamping or compressing engagement relative to an item 18 layer to better organize and make compact the item 18 layer in preparation for stacking . leaving dead plate 108 in such engagement improves release of the first row of items dropped through layer head 22 . more particularly , and especially with respect to smaller dimensioned items 18 , dead plate 108 maintains a given and desired position for a row of items 18 when it remains in contact with the row of items 18 as they fall from of rollers 100 and onto a supporting surface therebelow . by guiding this first - to - drop row of items 18 , dead plate 108 serves an additional guiding function relative to items 18 when releasing a row of items 18 from layer head 22 . this first - to - drop row of items 18 then serves a similar guiding function relative to a next - to - drop row of items 18 . eventually , the last - to - drop row of items 18 , i . e ., those adjacent stop 111 , fall through layer head 22 and find their final resting position on pallet 40 or on a stack of item 18 layers resting on pallet 40 . prior art roller floors pulling support from under a layer of items suffer from a “ loose ” row which becomes more troublesome for narrower item 18 dimensions . in other words , the narrower item 18 is the greater its tendency to rock out of position when falling from rollers 100 . in accordance with the present invention , however , dead plate 108 guides the first - to - drop item 18 row into position and begins a cascading series of supporting elements , i . e ., each row is guided into position by the previous row and the first row is guided into position by dead plate 108 . in this manner , an item 18 layer compressed together on layer head 22 achieves a more stable and better compressed final position after dropping through layer head 22 as it finds its final resting place on pallet 40 or on a stack of item 18 layers resting on pallet 40 . compressive forces applied to an item 18 layer by virtue of the item 18 layer being captured and compressed between dead plate 108 and stop 111 also eliminate a dependence on conventional and undesirably variable compressive forces supplied by roller floors . in systems using only free rollers pulled from under an item 18 layer , the compressive force , i . e ., against a fixed stop , varies as the roller bearings become more free turning by the unweighting thereof as items 18 fall therefrom . for particularly heavy items 18 and particularly free turning rollers 100 , moving rollers 100 out of a supporting position does not generate significant compressive forces relative to a load , i . e ., the load does not bear heavily against a fixed stop under such conditions . under the present invention , however , dead plate 108 maintains static compression relative to an item 18 layer regardless of item 18 layer weight and degree of free - turning characteristic of rollers 100 . as a result , an item 18 layer dropped through layer head 22 enjoys a more compact and better organized final resting place on pallet 40 or on a stack of item 18 layers resting on pallet 40 . side plates 109 enhance use of rollers as a floor for a layer conveyor . the span occupied by rollers 100 , i . e ., as supported at each end thereof at chains 102 , is limited by the strength and deflection characteristics of rollers 100 . as may be appreciated , minimizing the length of rollers 100 to occupy just sufficient distance to support an entire item 18 layer minimizes the cost and structural requirements of rollers 100 . side plates 109 tolerate loose organization within an item 18 layer during construction thereof . in conventional practice , a forty inch wide finished width for a given item 18 layer requires a roller floor of over fifty inches wide to accommodate the layer during construction . under the present invention , however , rollers 100 need only be forty inches wide because side plates 109 support the outer edges of a layer during construction thereof . as the roller floor , i . e ., the support provided by rollers 100 , width increases , the strength of the rollers must increase to avoid unacceptable deflection caused by the longer roller length . increased strength requires increased weight and requires larger diameter rollers 100 as flooring for layer head 22 . both aspects negatively an inefficiently affect machine performance when roller length exceeds item 18 layer dimensions . in accordance with the present invention , however , rollers 100 are of minimal length just sufficient to support a tightly - organized item 18 layer thereon . thus , a synchronized palletizer has been shown and described . the synchronized palletizer of the present invention provides a compact overall size with high item throughput . most low infeed , i . e ., production level infeed , palletizers require a pallet position , a layer build position , and a row build conveyor . in accordance with the present invention , however , the layer build position is essentially eliminated by building layers row - by - row on the layer head 22 which also serves also as a layer placement mechanism , i . e ., placing item 18 layers on a pallet 40 or stack of item 18 layers . this feature of the present invention is believed to save approximately 25 % to 35 % of otherwise required floor space . the synchronized palletizer of the present invention utilizes a relatively high speed row conveyor to chase down a current position of the layer head 22 . generally , conventional layer building brings each row to a fixed and maximum height , i . e ., above any potential height for a stack of item 18 layers , for each and every row . in accordance with the present invention , however , each row need only be raised to the height of the current stack level , i . e ., to where layer head 22 is positioned just above pallet 40 or a stack of item 18 layers resting on pallet 40 . in this manner , the present invention reduces travel distance and travel time for rows conveyed to a layer building site . while illustrated as having two side plates 109 , one at each end of rollers 100 , the present invention may be practiced with only one side plate 109 . the important function being the presence of a support area beyond rollers 100 and adjacent thereto to facilitate loose packing of item 18 rows during construction of an item 18 layer on layer head 22 . it will be appreciated that the present invention is not restricted to the particular embodiment that has been described and illustrated , and that variations may be made therein without departing from the scope of the invention as found in the appended claims and equivalents thereof .	1
the following descriptions are of exemplary embodiments of the invention only , and are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the following description is intended to provide convenient illustrations for implementing different embodiments of the invention . as will become apparent , various changes may be made in the function and arrangement of the elements described in these embodiments without departing from the spirit and scope of the invention . for example , various changes may be made in the design and arrangement of the elements described in the preferred embodiments , without departing from the scope of the invention as set forth in the appended claims . in accordance with various aspects of the present invention , systems and methods for improved cleaning of workpieces and sponges are provided . in one embodiment of the invention , and with reference to fig1 a workpiece cleaning system 100 includes two cleaning stations 110 , each of which include a workpiece cleaning apparatus 102 , a sponge cleaning apparatus 108 and a support stand 106 . various other embodiments of the invention may include similar systems with different configurations or combinations of elements . for example , another embodiment of workpiece cleaning system 100 may include only one cleaning station 110 . in another embodiment , cleaning system 100 may include three or more cleaning stations 110 . in another embodiment , workpiece cleaning apparatus 102 and sponge cleaning apparatus 108 may be combined such that support stand 106 may be eliminated from the combination . for example , if two or more cylindrical sponges are used in workpiece cleaning apparatus 102 , it may be advantageous to clean the sponges by applying cleaning fluids to them in the same location in which they cleaned the workpieces — i . e ., without moving the sponges to a separate sponge cleaning apparatus 108 . ( such an embodiment is described in further detail below with reference to fig4 ). in yet another embodiment , sponge cleaning stations 108 may be a separate component of workpiece cleaning system 100 which may be used completely apart from cleaning stations 110 or which may be removably attachable to cleaning stations 110 . as mentioned above , for the purposes of this specification , “ sponge ” may be any sponge , brush , pad or other device suitable for cleaning a workpiece . a sponge may have a flat , cylindrical or any other suitable configuration and may be constructed from pva , a material similar to pva or any other suitable material . in general , any suitable configuration or combination of cleaning stations 110 , workpiece cleaning apparatus 102 , sponge cleaning apparatus 108 , support stands 106 and / or sponges may be included in cleaning system 100 , without departing from the scope of the invention . in accordance with one aspect of the invention , cleaning system 100 may also include one or more robots 112 . robot 112 may be configured to retrieve a workpiece ( not shown ) onto or within one or more cleaning stations 110 and / or to transfer a workpiece from one cleaning station 110 to another . in one embodiment , a workpiece may be placed in a first cleaning station 110 a by a human or a device ( not shown ) separate from cleaning system 100 and robot 112 may be configured to retrieve the workpiece from first cleaning station 110 a and transfer the workpiece to a second cleaning station 110 b . another separate device ( not shown ) may then retrieve the workpiece from second cleaning station 110 b and transfer it out of cleaning system 100 . in general , any configuration or combination of robots 112 or other suitable devices may be used to deliver and transfer workpieces to and from one or more cleaning stations 110 . in one exemplary embodiment , for example , workpieces may be moved from one cleaning station 110 to another via a track using pressurized aqueous media for propulsion . such a device for transporting workpieces is described in u . s . pat . no . 5 , 108 , 513 , the entire contents of which is hereby incorporated by reference . alternatively , workpieces and sponges may be transferred in any other suitable manner , such as by one or more robots 112 . [ 0022 ] fig2 illustrates , in perspective view , one exemplary embodiment of cleaning station 110 . as described above , cleaning station 110 may include workpiece cleaning apparatus 102 , sponge cleaning apparatus 108 and support stand 106 . workpiece cleaning apparatus 102 and sponge cleaning apparatus 108 may be located on or recessed into a surface . support stand 106 may hold and control the motion of an upper sponge 202 . support stand 106 may be configured to pivot about an axis 204 to position upper sponge 202 over workpiece cleaning apparatus 102 or sponge cleaning apparatus 108 . support stand may also be configured to position upper sponge 202 in contact with the upper surface of a workpiece ( not shown ) and to spin or otherwise move upper sponge 202 to mechanically scrub the workpiece . support stand 106 may then position upper sponge 202 within sponge cleaning apparatus 108 for cleaning . cleaning stations 110 or similar apparatus , such as depicted in fig2 and described above , are well known to those skilled in the art . any other apparatus for cleaning workpieces and / or sponges , either currently available or developed in the future , may be incorporated into workpiece cleaning system 100 without changing the scope of the present invention . in one embodiment of the present invention , and with reference to fig3 workpiece cleaning apparatus 102 may include upper sponge 202 , a lower sponge 304 and spray cleaning nozzles 306 and 308 . ( fig3 also illustrates a workpiece 310 in position for cleaning ). as mentioned above , sponges 202 and 304 may have any configuration suitable for cleaning workpiece 310 . thus , although fig3 shows a workpiece cleaning apparatus 102 with two , flat , disk - shaped sponges 202 and 304 , other workpiece cleaning apparatus 102 may include more than two sponges , cylindrical sponges , or any other combination or configuration of sponges for cleaning a workpiece 310 . apparatus for cleaning workpieces are well known in the art . for example , semiconductor wafer cleaning devices are described in u . s . pat . nos . 5 , 624 , 501 , 5 , 675 , 856 and 5 , 875 , 507 , the entire contents of which are hereby incorporated by reference . any suitable apparatus for cleaning workpieces , such as illustrated in fig3 and described above , including currently available apparatus and any apparatus discovered in the future , may be incorporated into workpiece cleaning system 100 without changing the scope of the invention . in the embodiment of workpiece cleaning apparatus 102 depicted in fig3 cleaning fluid may be deposited , sprayed or otherwise delivered on workpiece 310 and sponges 202 and 304 by nozzles 306 and 308 . upper sponge 202 and lower sponge 304 may be made to spin on their axes or otherwise move about workpiece 310 , thus cleaning workpiece . in accordance with another embodiment of the present invention , and with reference to fig4 workpiece cleaning apparatus 102 may comprise one or more cylindrical sponges 402 . in such an embodiment , workpieces 410 may be cleaned while traveling between two sets of adjacent sponges 402 . one or more fluid delivery systems 406 and 408 , such as nozzles or sprayers , may deliver workpiece cleaning fluid and / or sponge cleaning fluid to workpiece cleaning apparatus 102 . in accordance with another aspect of the present invention , sponges 402 may remain in the same location during cleaning of workpieces 410 and cleaning of sponges 410 . in an alternative embodiment , as described above with reference to fig2 sponges 202 may be moved from workpiece cleaning apparatus 102 to sponge cleaning apparatus 108 . in accordance with one aspect of the present invention , sponges 202 , 304 and / or 402 may be configured to possess particular surface charges within particular ph environments . fig5 illustrates surface charges ( or “ zeta potentials ”), at various ph levels , of several exemplary sponges and of several particles ( e . g ., sio2 516 and al2o3 518 ) which may be found on workpieces such as semiconductor wafers ( e . g ., tox wafers 520 ). for example , sponges such as conventional pva sponges typically have slightly negative surface charges at most ph levels used for cleaning semiconductor wafers . thus , conventional sponges may be referred to as “ anionic ” sponges 510 . as illustrated in fig5 anionic sponges 510 may have surface charges of approximately − 7 mv at ph 3 and approximately − 25 mv at ph 8 . alternatively , sponges 202 , 304 and 402 may be configured to have positive surface charges (“ cationic sponges ” 512 ) or neutral surface charges (“ neutral sponges ” 514 ) over various ph ranges . for example , cationic sponges 512 may be configured to have surface charges of + 200 mv at ph 2 , slightly less positive surface charges from ph 2 through ph 9 , neutral charge at ph 10 and negative surface charges at ph greater than 10 . in one embodiment of the present invention , the ph environment of one or more sponges 202 , 304 and 402 may be controlled and / or modified by a workpiece cleaning fluid , a sponge cleaning fluid or both . examples of cleaning fluids often used to clean workpieces and / or sponges include , but are not limited to , di water , dilute ammonium hydroxide , dilute hydrofluoric acid , buffered hydrofluoric acid , solvents , surfactants , detergents and the like . for example , a solution of approximately 2 % ammonium hydroxide will have a ph of approximately 11 . cleaning fluid may be applied to sponges 202 , 304 and 402 during cleaning of a workpiece in workpiece cleaning apparatus 102 and / or during cleaning of sponges 202 , 304 and 402 in sponge cleaning apparatus 108 . in one embodiment , cleaning fluid used in workpiece cleaning apparatus 102 may be the same as cleaning fluid used in sponge cleaning apparatus 108 . in another embodiment , cleaning fluids may be different the two apparatus 102 and 108 . sponges with surface charges will attract particles with opposite surface charges or repel particles with similar surface charges , via electrostatic forces , from surfaces being cleaned . for example , negatively charged sponges may attract various positively charged particles and repel various negatively charged particles , positively charged sponges may attract various negatively charged particles and repel various positively charged particles , and the like . thus , sponges may accumulate various oppositely - charged particles on their surfaces . if those sponges are then exposed to cleaning fluid which changes the ph environment and , thus , reverses the surface charge of sponges , particles on the surface of sponges may no longer adhere to the surface and may fall off , rendering clean sponges . for example , and with reference again to fig5 if cationic sponge 512 accumulates negatively charged particles on its surface while cleaning semiconductor wafers , the surface charge of cationic sponge 512 may be changed to a negative charge in sponge cleaning apparatus by exposing cationic sponge to approximately 2 % ammonium hydroxide solution at ph 11 . when cationic sponge 512 acquires a negative charge at ph 11 , many negatively charged particles will no longer be attracted to its surface and will fall off or be easily washed off in sponge cleaning apparatus 108 . in another embodiment of the present invention , one or more cleaning fluids may include a sponge charge modifying agent which is configured to modify the surface charge of one or more sponges . for example , a sponge charge modifying agent may be added to a workpiece cleaning fluid , a sponge cleaning fluid or both . examples of sponge charge modifying agents include , but are not limited to , aliphatic amines or an aromatic amines . sponge cleaning apparatus 108 may comprise any suitable device for cleaning one or more sponges used in workpiece cleaning . sponge cleaning apparatus 108 may include a bath - like apparatus , in which sponges may soak . sponge cleaning apparatus 108 may also include a mechanism for oscillating or otherwise moving or shaking sponges to remove particles and other debris . in another embodiment of the invention , sponge cleaning apparatus 108 may be physically separate from workpiece cleaning system 100 . for example , sponge cleaning apparatus 108 may be a separate bath - like apparatus , basin or the like which is freestanding , removably attachable or otherwise separate from workpiece cleaning system . in another embodiment , support stand 106 may be configured to turn a sponge circularly or in another pattern within sponge cleaning apparatus 108 such that the sponge will brush against or over a protrusion in sponge cleaning apparatus 108 , effectively acting as a “ beating bar ” to remove particles from the sponge . any suitable configuration for sponge cleaning apparatus 108 may be incorporated into workpiece cleaning system 100 without departing from the scope of the present invention . just as any suitable combination and configuration of workpiece cleaning apparatus , sponge cleaning apparatus 108 , support stand 106 and / or robots 112 may be included in workpiece cleaning system 100 , so to can any combination of sponges and cleaning fluids be included in workpiece cleaning system 100 . thus , a combination of sponges and cleaning fluid may be configured to give sponges a particular surface charge at one workpiece cleaning station 102 a , to remove particles with a particular charge . the surface charge of those sponges may then be reversed in sponge cleaning apparatus 108 a to more effectively clean sponges . a different combination of sponges ( not shown ) and cleaning fluid may be used in another workpiece cleaning station 102 b , to remove particles with different charges . the surface charges of those sponges may then be reversed in sponge cleaning station 108 b to more effectively remove the charged particles . any suitable combination of sponges and cleaning fluid may be used , without departing from the scope of the present invention . with reference again to fig1 according to one embodiment of the present invention , a method for cleaning a workpiece includes introducing the workpiece into workpiece cleaning system 100 . the workpiece may arrive at a first workpiece cleaning apparatus 102 a , where it may be cleaned by one or more sponges having a particular surface charge . after being cleaned at first workpiece cleaning apparatus 102 a , the workpiece may be transferred , by robot 112 , aqueous track or other methods , to second workpiece cleaning apparatus 102 b , for further cleaning . second workpiece cleaning apparatus 102 b may include one or more sponges with a particular surface charge . after being cleaned at second workpiece cleaning apparatus 102 b , workpiece may be transferred out of workpiece cleaning system 100 . when sponges are not cleaning workpieces , they may be cleaned in sponge cleaning apparatus 108 . one or more workpiece cleaning fluids may change the surface charges of one or more sponges , enabling more efficient cleaning of workpieces . one or more cleaning fluids may change the surface charges of one or more sponges , causing particles which were formerly attracted to the surfaces of the sponges by electrostatic forces to more easily fall off or be washed off in sponge cleaning apparatus . for example , and for exemplary purposes only , first workpiece cleaning apparatus 102 a may use anionic sponges ( not shown ) and workpiece cleaning fluid of approximately 2 % ammonium hydroxide solution ( ph about 11 ) to clean a semiconductor wafer after cmp . anionic sponges may then be cleaned in first sponge cleaning station 108 a , with a sponge cleaning fluid of approximately 2 % ammonium hydroxide solution . after this initial cleaning , the workpiece may be transferred via robot 112 to second workpiece cleaning apparatus 102 b . second workpiece cleaning apparatus 102 b may use cationic sponges ( also not shown ) with a workpiece cleaning fluid containing a sponge charge modifying agent such as polyethylamine ( an aliphatic amine ). such a fluid may have a ph of approximately 8 . at ph 8 , cationic brushes may have a positive charge and , thus , attract negatively charged particles and repel positively charged particles from the surface of the workpiece . cationic sponges may then be cleaned in second sponge cleaning apparatus , with approximately 2 % ammonium hydroxide solution as the sponge cleaning fluid . at ph approximately 11 , caused by the ammonium hydroxide solution , the cationic brushes may acquire a negative charge and , thus , negatively charged particles formerly adhering to the surface of the sponges may no longer be attracted to their surfaces and may easily fall off or be easily washed off . the above described systems and methods for cleaning workpiece and for cleaning sponges , using variations in sponge surface charges and cleaning fluids , achieve the desired results of more effectively cleaning workpieces and more effectively cleaning sponges . the overall result is a higher yield on workpieces such as semiconductor wafers and sponges that have longer longevity and work more effectively . lastly , as mentioned above , various principles of the invention have been described only as illustrative embodiments , and many combinations and modifications of the above - described structures , arrangements , proportions , elements , materials and components may be used in the practice of the invention . for example , methods and apparatuses not specifically described may be varied and particularly adapted for a specific environment and operating requirement without departing from those principles .	7
certain exemplary but non - limiting embodiments of the present invention are now described with reference to the attached drawings . referring now to fig1 , there is shown a schematic representation of an apparatus 100 according to the present invention , including microcontroller module 102 , sensor module 104 , and wireless module 106 . microcontroller module 102 comprises a microcontroller 108 and non - volatile memory 110 in electronic communication . microcontroller 108 is further in electronic communication with one or more actuators 112 , such as for example high current relays , for controlling operation of the prime mover of the pump , and with a plurality of ports 114 for collecting sensor inputs and for communicating with wireless module 106 . preferably , microcontroller input and output ports are optically isolated . as used herein , the term “ microcontroller ” refers without limitation to any microprocessor design that preferably emphasizes high integration , low power consumption , self - sufficiency and cost - effectiveness . exemplary microcontrollers include intel 8742 , the sx line from parallax , inc ., and the 8051 architecture from atmel . it will be understood that the term encompasses the use of microprocessors such as are found within personal computers and the like within the scope of the apparatus and system of the present invention . non - volatile memory 110 can be , for example , flash ram , a hard drive , eprom , or any other memory device now known or later developed for the storage of programs or data that are not lost when the microcontroller module is powered down . sensor module 104 comprises position sensor 118 and load sensor 116 and associated electronics to amplify and condition the sensor signals . sensor module 104 is mountable to the walking beam of the pump , preferably at a midpoint , to sense the inclination and load of the walking beam . preferably , the sensor module 104 is mounted by bolts or a pair of c - clamps . the sensor module 104 is mounted to the walking beam in a manner that permits the load sensor to convert deformation of the walking beam into electrical signals proportional to the well load . position sensor 118 is preferably an inclinometer that generates electrical signals proportional to the inclination of the walking beam , or can any other sensor capable of detecting the position of the walking beam throughout the pump cycle . wireless module 106 comprises electronics and antennae for long - range wireless communication , short - range wireless communication , or both . examples of short range wireless protocols include bluetooth and 802 . 11 series communication protocols . examples of long - range wireless protocols include scada protocols . the wireless communication permits the downloading of historical and real - time data from the apparatus , and optionally control of the pump from the remote device . for example , a handheld computer can retrieve the operating record of the pump over an extended period of time , or can retrieve a real - time graphical display of the surface card . it should be understood that , although microcontroller module 102 , sensor module 104 , and wireless module 106 are shown as separate boxes in fig1 , any two or all three can be combined into one physical unit . likewise , the components of any one module can be separated into two or more physical units . referring now to fig2 , an apparatus according to the present invention is shown mounted to a sucker rod pump 200 . in this embodiment , sensor module 202 is mounted to walking beam 204 , and the conditioned sensor signals are carried by signal wires 206 to microcontroller module 208 . actuator signals are carried by actuator wires 210 from microcontroller module 208 to power box 212 for controlling prime mover 214 . the present invention encompasses a method for the operation of the apparatus 100 , which can be embodied as software within the non - volatile memory 110 for running the microcontroller 108 . referring now to fig3 , a method for compensating for offset and amplitude drift in position data is illustrated 300 . the position of the walking beam during the pump cycle describes a sinusoidal curve moving between a maximum and a minimum position , but position sensor data may be noisy due to , for example , vibration of the walking beam because of friction , or because of mechanical instability at the maximum and a minimum positions of the walking beam . in addition , the sensor reading may drift with respect to its amplitude or it &# 39 ; s offset due to temperature fluctuations or due to long term changes in the mounting of the sensor module to the walking beam . in order to accurately identify the maximum and minimum points of the walking beam motion without the need for calibration or operator attention , a novel , self - adapting method is used . in the method , consecutive maximum 302 and minimum 304 positions are identified . a position horizon is calculated as the midpoint of the maximum and minimum position values . when the walking beam next crosses the position horizon 306 , a timer is started and the time interval 308 to the next horizon crossing 310 in the opposite direction is recorded . the time of the maximum or minimum points ( peak time ) is calculated as the midpoint between horizon crossings . the process is repeated for each cycle , whereby the horizon 312 and peak times 314 are continuously updated , thereby self - correcting for offset and amplitude and permitting recording of the peak times without calibration or operator intervention . it will be readily appreciated that the method can be used to determine both maxima and minima in position data . the present invention further provides a method for identifying a pump off condition in a sucker rod pump , as illustrated in fig4 . for each pump cycle , the minimum load 402 , the maximum load 404 , the start - up load 406 measured at the position minimum time , and the start - down load 408 measured at the position maximum time , are recorded . the start of the next downstroke is then identified , and a reference load boundary 410 is calculated by adding to the minimum load a predetermined fraction of the difference between the minimum and start - down loads . the time for the load to decrease to below the reference load boundary is recorded 412 . if the load has not decreased below the reference load boundary within a predetermined time , a pump off condition is indicated . the predetermined fraction used to calculate the reference load boundary is preferably about one - half but it could also be set to one - quarter or up to three - quarters . the present invention further provides a method for optimizing the hold down time for clearing a pump off condition in a sucker rod pump , as illustrated in fig5 . the pump off condition indicates that the fluid in the well has been depleted and the capacity of the well to naturally refill is lower than the pump capacity of the well . thus , a hold down period is required to permit the well to refill . the refill time is determined by geological and electromechanical characteristics of the well . however , it is know that an optimum hold down time provides the most efficient production rate . referring now to fig5 , the hold down time is incrementally increased within predetermined limits and by predetermined step size for each subsequent pump off condition . the pumping span , which is the length of time to the next pump off condition , is recorded . as the hold down time increases , the percentage of time spent pumping increases to a maximum and then decreases 504 . the level of fluid achieved in the well after each hold down period is inferred as a percentage from the subsequent pumping span 502 . the hold down period providing optimum percentage of time spent pumping is identified by interpolation 506 , and the pump is operated with this hold down period for optimum or near - optimal operation . referring now to fig6 , a flowchart for operation of a system according to the present invention , integrating the previous methods , is shown . in use , the apparatus of the system is started 602 and software flags initialized 604 . the prime mover of the well is started 606 and the horizon is calculated as previously described 608 . steps 608 , 610 and 612 comprise a cycle that operates until a predetermined number of pump - up strokes have been performed for pump conditions to stabilize prior to calibration . the next high point is determined 614 , and if not in a calibration cycle at point a a new reference load boundary and a new pump - off time - out are calculated 616 , 618 as previously described . if the load fails to drop below the load threshold within the time threshold , a pump off condition is detected 620 , the well is stopped for the hold down time 624 , and then control is returned to point c . if a pump off condition is not detected 626 , control returns to point b for another pump cycle . the present apparatus and system has a number of advantages and benefits compared to certain devices of the prior art . after the sensor module is mounted to the walking beam , the apparatus of the present invention can operate the pump and calibrate its operation with the minimum of operator intervention , and in particular without the operator having to calibrate the sensors or periodically adjust the operating parameters to account for aging or drift in sensor response . further , the apparatus , system , and method of the present invention can automatically detect pump off condition and can shut down the pump for a hold down period to permit the pump to refill . yet further , without user intervention the optimum hold down period can be determined , and the pump efficiently run thereafter . yet further , the apparatus provides for remote collection of historical and real time data through wireless communication , and for remote programming of the apparatus if desired . while the invention has been described in connection with its preferred embodiments , it should be recognized that changes and modifications can be made therein without departing from the scope of the appended claims .	5
fig1 shows a force limiting device according to the invention for a safety belt system of a motor vehicle . the force limiting device can be coupled by means of minor constructive adaptations to the shaft of a belt retractor , the anchor of a belt lock , or also an end stop of a safety belt system . regardless of the location of attachment to the safety belt system , the force limiting device allows a force - limited extension of the safety belt to reduce the stress acting on the passengers . the use of the force limiting device is furthermore also possible within the structure of the vehicle itself or on another part of the vehicle when a defined force limiting deformation is to be made possible . the force limiting device is composed of three parts 1 , 2 and 3 in this embodiment , wherein the parts 1 and 2 are of a fixed design , and also can be considered to be the housing of the force limiting device . the part 3 is designed as a disk plate with two lateral gearing 12 formed by teeth , of which only the part 1 facing the gearing 12 is shown . the disk plate 13 is furthermore equipped with a radially inwardly directed gearing 7 and an outwardly directed gearing 10 . a drive wheel 5 is provided with a gearing 6 , which is complementary to the gearing 7 and can be connected , for example , in a torque - coupling manner to a belt shaft in order to activate the force limiting device . the fixed parts 1 and 2 are likewise equipped with lateral , axially directed gearings 13 formed by teeth , wherein only the gearing 13 on the part 2 is visible based on the illustration . the gearing 13 and the axially directed ( not illustrated ) gearing located on the part 1 are shaped in such a way that they engage in the lateral gearing 12 and the gearing , which is not visible , engages in the part 3 , that is , the tooth spacing and the tooth depth of the gearing 12 and 13 and / or of the gearing , which is not illustrated , are selected such that a continuously alternating engagement motion of the gearings is possible . the parts 1 and 2 are dimensioned in such a way that the gearing 13 of part 2 and the not illustrated axially directed gearing on the part 1 have a spacing with respect to each other which enables a lateral oscillating movement of the part 3 located between them after the assembly of the force limiting device . as a result of the free play in the axial direction , which is intentionally adjusted as a result of the design , the part 3 is always engaged with the gearing 12 of the part 2 or with the gearing on the part 1 , which is not illustrated . upon driving the part 3 in circumferential direction by means of the drive wheel 5 , the part 3 carries out the wave - like forward motion caused according to the invention due to engaging in the gearing 12 and in the not illustrated gearing , whereas the part 3 is alternately decelerated and accelerated laterally . the wave - like forward movement of the part 3 is formed by a rotational movement defined by the rotational movement of the drive wheel 5 and a wave - like axial movement directed transversely to the rotational direction of the rotational motion , which is defined by the alternating engagement of the axially directed gearing 13 . the motion sequence corresponds insofar to that of the force limiting device of wo 2010 / 037460 a2 which is incorporated by reference . in accordance with the proposed further development , and as is also evident in fig2 , a radially outwardly directed gearing 10 formed by teeth is additionally provided transversely with respect to the rotational movement on the part 3 . a plurality of individual masses 4 , 4 a and 4 b having a radial groove 8 facing the part 3 are furthermore provided , in which a gearing 11 formed by teeth is likewise provided , whose geometry is selected in such a way that the gearing 11 can engage in the gearing 10 . after an activation of the force limiting device , the individual masses 4 , 4 a and 4 b are taken along by means of the mutually engaged gearing 10 and 11 and laterally by means of the part 3 engaged in the groove 8 , so that the individual masses 4 , 4 a and 4 b in the position coupled to the part 3 likewise carry out the wave - like advancing movement . due to the selection of the number and mass of the individual masses 4 , 4 a and 4 b , the force limiting characteristic can be individually changed without having to make a design change to the force limiting device per se . a force limiting device is accordingly created , whose force limiting characteristic can be changed as desired with a very small design effort , without the design of the basic elements themselves having to be changed . the force limiting device is moreover equipped with a device 14 in the form of a ramp - shaped control contour , which is arranged on the part 2 in a section , which is radially outwardly arranged with respect to the gearing 13 . the control contour runs in a circumferential direction and increases radially outward . the control contour is equipped with an axially protruding lug 14 a , which features an essentially constant thickness and engages in a groove 9 located to the side of the individual masses 4 , 4 a and 4 b . the lug 14 a extends laterally from the control contour and has a spiral - shaped profile with a distance to the rotational axis of part 3 that increases in the rotational direction of arrow a . with a rotation of part 3 in the direction of arrow a , the individual masses 4 , 4 a and 4 b are additionally guided and carry out a controlled movement by means of which they become disengaged from the part 2 upon reaching a predetermined rotational position . as is evident in fig2 , one individual mass 4 a is already in a position in which it no longer engages in the gearing 10 with its gearing 11 ; the individual mass 4 a is consequently no longer engaged in the part 3 . the individual mass 4 b , however , is still located in a position in which the gearing 11 and 10 engage with each other , so that the individual mass 4 b can be considered to be engaged with the part 3 . after an additional rotation of the part 3 with respect to part 2 , the individual masses 4 , 4 a and 4 b are disengaged one after the other by means of a movement of part 3 defined by the control contour and / or the laterally protruding lug 14 a , so that the entire mass of the part carrying out the advancing movement , which is formed by the sum of the masses of part 3 and of the engaged individual masses 4 , 4 a and 4 b , can be considered as decreasing . a free space 15 arranged radially outward to the moved part 3 is provided to accommodate the disengaged individual masses 4 , 4 a and 4 b . the free space 15 should be dimensioned in such a way that it allows a movement of the individual masses 4 , 4 a and 4 a radially outward by at least the depth of the gearings 10 and 11 , so that the gearings 10 and 11 are no longer engaged in the disengaged position . the force limiting characteristic of the force limiting device diminishes as a result of the decreasing total mass , that is , the amount of force limiting decreases if the speed of the part 3 remains constant . an opposite effect can be realized by means of a coupling of the individual masses 4 , 4 a and 4 b during the rotational movement and a consequent increase of the total mass . while the above description constitutes the preferred embodiment of the present invention , it will be appreciated that the invention is susceptible to modification , variation and change without departing from the proper scope and fair meaning of the accompanying claims .	1
this invention now will be described more fully hereinafter with reference to the accompanying drawings , in which exemplary embodiments are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those of ordinary skill in the art . moreover , all statements herein reciting embodiments of the invention , as well as specific examples thereof , are intended to encompass both structural and functional equivalents thereof . additionally , it is intended that such equivalents include both currently known equivalents as well as equivalents developed in the future ( i . e ., any elements developed that perform the same function , regardless of structure ). thus , for example , it will be appreciated by those of ordinary skill in the art that the diagrams , schematics , illustrations , and the like represent conceptual views or processes illustrating systems and methods embodying this invention . the functions of the various elements shown in the figures may be provided through the use of dedicated hardware as well as hardware capable of executing associated software . similarly , any switches shown in the figures are conceptual only . their function may be carried out through the operation of program logic , through dedicated logic , through the interaction of program control and dedicated logic , or even manually , the particular technique being selectable by the entity implementing this invention . those of ordinary skill in the art further understand that the exemplary hardware , software , processes , methods , and / or operating systems described herein are for illustrative purposes and , thus , are not intended to be limited to any particular named manufacturer . the aforementioned problems and others are solved by a dynamic computer telephony integration ( cti ) complete customer contact center (“ dynamic contact center ”). the dynamic contact center comprises systems and methods that leverage the assets of a business &# 39 ; communications systems including internal telecommunications networks , information systems , data networks , and applications , of public telecommunications networks ( e . g ., public switched telephone network ( pstn ) or mobile telecommunications switching office ( mtso )), of public data networks ( e . g ., internet ), and / or of various communications devices of a designated party affiliated with the business in order to facilitate improved access , sharing , notification , and / or management of incoming communications and associated data of the business &# 39 ; call center . as is apparent to one of ordinary skill in the art , the subject - specific group of the business may be tailored to any industry that seeks to leverage the assets of a dynamic contact center . some advantages of the dynamic contact center include faster access to staff and data ( remote and on - site ), ability to communicate incoming calls and data to staff over a variety of communications devices , less operator / agent intervention , and increased emergency recovery capabilities . as used herein , the term “ data ” includes electronic information , such as information and / or files stored in a database , electronic messages such as email , notifications , replies , and / or other means of communicating electronic information between or among the business &# 39 ; communications system ( including the agent station ), the public telecommunications networks , the public data networks , and / or of various communications devices of a designated party . referring now to the figures , fig1 is a block diagram showing a dynamic contact center ( dcc ) application 110 residing in an agent station 100 . the dcc application 110 operates within a system memory device . the dcc application 110 , for example , is shown residing in a memory subsystem 12 . the dcc application 110 , however , could also reside in flash memory 14 and / or in a peripheral storage device , such as storage device 40 associated with a dcc dataserver 42 . the agent station 100 also has one or more central processors 20 executing an operating system . the operating system , as is well known , has a set of instructions that control the internal functions of the agent station 100 . a system bus 22 communicates signals , such as data signals , control signals , and address signals , between the central processors 20 and a system controller 24 ( typically called a “ northbridge ”). the system controller 24 provides a bridging function between the one or more central processors 20 , a graphics subsystem 26 , the memory subsystem 12 , and a pci ( peripheral controller interface ) bus 28 . the pci bus 28 is controlled by a peripheral bus controller 30 . the peripheral bus controller 30 ( typically called a “ southbridge ”) is an integrated circuit that serves as an input / output hub for various peripheral ports . these peripheral ports could include , for example , a keyboard port 32 , a mouse port 34 , a serial port 36 and / or a parallel port 38 . additionally , these peripheral ports would allow the agent station to communicate with a variety of communications devices through ports 54 ( such as scsi or ethernet ), wireless transceiver 52 ( using the ieee wireless standard 802 . 11 and infrared ), and wired comm device port 50 ( such as modem v90 + and compact flash slots ). the peripheral bus controller 30 could also include an audio subsystem 35 . additionally , the agent station may include a network server 44 operating with a network browser 46 . the dcc dataserver 42 , the network server 44 , and the network browser 46 may be stand alone or integrated components . still further , the agent station 100 may include a power source 60 , such as a rechargeable battery to provide power and allow the agent station 100 to be portable . the power source 60 may additionally or alternatively include an alternating current ( ac ) power source or power converter . the processor 20 is typically a microprocessor . advanced micro devices , inc ., for example , manufactures a full line of microprocessors , such as the athlon ™ ( athlon ™ is a trademark of advanced micro devices , inc ., one amd place , p . o . box 3453 , sunnyvale , calif . 94088 - 3453 , 408 . 732 . 2400 , 800 . 538 . 8450 , www . amd . com ). sun microsystems also designs and manufactures microprocessors ( sun microsystems , inc ., 901 san antonio road , palo alto calif . 94303 , www . sun . com ). the intel corporation manufactures microprocessors ( intel corporation , 2200 mission college blvd ., santa clara , calif . 95052 - 8119 , 408 . 765 . 8080 , www . intel . com ). other manufacturers also offer microprocessors . such other manufacturers include motorola , inc . ( 1303 east algonquin road , p . o . box a3309 schaumburg , ill . 60196 , www . motorola . com ), international business machines corp . ( new orchard road , armonk , n . y . 10504 , ( 914 ) 499 - 1900 , www . ibm . com ), and transmeta corp . ( 3940 freedom circle , santa clara , calif . 95054 , www . transmeta . com ). the preferred operating system is a linux ® or a red hat ® linux - based system ( linux ® is a registered trademark of linus torvalds and red hat ® is a registered trademark of red hat , inc ., research triangle park , n . c ., 1 - 888 - 733 - 4281 , www . redhat . com ). other operating systems , however , may be suitable . such other operating systems would include a unix ®- based system ( unix ® is a registered trademark of the open group , 44 montgomery street , suite 960 , san francisco , calif . 94104 , 415 . 374 . 8280 , www . opengroup . org ). and mac ® os ( mac ® is a registered trademark of apple computer , inc ., 1 infinite loop , cupertino , calif . 95014 , 408 . 996 . 1010 , www . apple . com ). another operating system would include dos - based systems . windows ® and windows nt ® are common examples of dos - based systems ( windows ® and windows nt ® are registered trademarks of microsoft corporation , one microsoft way , redmond wash . 98052 - 6399 , 425 . 882 . 8080 , www . microsoft . com ). the system memory device ( shown as memory subsystem 12 , flash memory 14 , or peripheral storage device 40 ) may also contain one or more application programs . for example , an application program may cooperate with the operating system and with a video display unit ( via the serial port 36 and / or the parallel port 38 ) to provide a graphical user interface ( gui ) display for the dcc application 110 ( e . g ., gui displays for a staff directory , a work profile of a designated party , a messaging screen for inputting a message and / or associated data , and a communications profile associated with the work profile , status , and / or business requirements ). the gui typically includes a combination of signals communicated along the keyboard port 32 and the mouse port 34 . the gui provides a convenient visual and / or audible interface with the user of the agent station 100 . as is apparent to those of ordinary skill in the art , the selection and arrangement of the dcc application 110 may be programmed over a variety of alternate mediums , such as , for example , a voice - activated menu prompt . typically , the dcc application 110 is running on the workstation 100 when the incoming communication is detected at the pbx ( or other similar system ) by an automated call management and / or call routing system . the incoming communication is associated with initial customer data that triggers the dcc dataserver 42 to provide a communications profile of associated data along with the incoming communication to the workstation 100 ( similar to decoding an iclid signal for telecommunication special service features offered by telecommunication service providers ). the dcc application 110 allows an agent ( or other staff or customers ) of a call center to manage services provided by the dynamic contact center , such as : ( 1 ) accessing a staff directory including work profiles that provide up - to - date detailed information about a designated party , such as looking up the name of the designated party , a status of the designated party , and other information of the designated party ( e . g ., job title , job description , business department , business address , office hours , business associates such as secretaries , communications devices including personally owned / operated and employer affiliated , and routing addresses of the communications devices such as radio frequency identifiers , service node addresses , ip addresses , email addresses , and / or other electronic address information ); ( 2 ) messaging options , such as taking , saving ( e . g ., email , voicemail , journal , etc . ), retrieving , distributing ( e . g ., routing to one or more designated parties , delivery options including dates , times , priorities , etc . ), and modifying a message ; ( 3 ) issuing a query to determine the status of the designated party ; ( 4 ) customizing the communications profile associated with dcc dataserver 42 including an access agent , a messaging agent , and a business requirements agent ; ( 5 ) customizing presentation , features , and / or management of the incoming communication and / or associated data ; and ( 6 ) controlling communications outside of the business &# 39 ; communications system , such as communications with a telecommunications network and / or a data network . for example , the agent ( or the automatic call distributor using response rules received from an interactive response system ) may interact with the access agent to control up - to - date staff directories , search for the designated party , use the work profile and / or the communications profile to launch a query to determine the status , receive the status , and communicate the status to a messaging agent to manage communications with the designated party . in an embodiment , the dcc dataserver 42 has the ability to communicate with various networks , including internal and external telecommunications and / or data networks using appropriate protocols , such as standard transmission control protocol and internet protocol ( tcp / ip ). the communications profiles stored by the dcc dataserver 42 provide increased security by allowing the business to internally control electronic data , utilize existing databases to add , delete , or otherwise change electronic data , and control how the business &# 39 ; communications system interacts with non - proprietary networks and communications devices , such as controlling routing instructions . thus , dcc dataserver 42 functions as a computer server , database , and processor and is dedicated to managing dcc activity over the business &# 39 ; proprietary and non - proprietary networks . the dcc application 110 also allows the agent ( or another authorized staff member ) to control access , sharing , notification , routing , security , management , and / or additional processing of incoming communications and associated data . for example , dcc application 110 allows the agent to control how the associated data is processed into the communications system of the business including ( i ) sending the data to a local storage device ( such as local file server 216 shown in fig1 ), or alternatively , to a remote storage device ( such as a file server associated a the telecommunications service provider ), ( ii ) archiving the data , ( iii ) encrypting the data , ( iv ) copying the data , and ( v ) associating the data with the communications profile . the dcc application 110 may be downloaded from telecommunications network 204 , data network 230 , or provided on a storage media ( e . g ., diskette , cd - rom , or installed by the computer system manufacturer ) to install on the agent workstation 100 to enable , disable , and further control a variety of dcc services . still further , the dcc application 110 allows the agent ( or other staff ) to customize presentation features , such as splitting a workstation screen into two viewing areas and presenting a video display of the incoming communication in one portion and presenting information associated with the access agent ( e . g ., staff directory ) in the second portion . fig2 is a schematic showing an exemplary operating environment for a dynamic contact center ( dcc ) 200 . the dcc 200 includes a mobile telephone 202 , a telecommunications network 204 , a switch 206 , a private branch exchange ( pbx ) 208 , at least one telephone / voice workstation 210 , at least one modem 212 , at least one agent workstation 100 , a dynamic contact center application 110 , a wide area network 214 , at least one file server 216 , a firewall 218 , a local area network 220 , a remote pbx 228 , a data network 230 , a remote personal computer 235 , a communications interface 240 , a transceiver 245 , a business facility 250 , an intercom workstation 260 , a designated party 262 , an affiliated telephone 264 , and a personal identification transmitter 266 . the intercom workstation 260 is similar to traditional intercom systems ; however , intercom workstation 260 may further include an audio subsystem ( not shown ) for broadcasting and receiving audio messages , a video subsystem ( not shown ), typically a liquid crystal display ( lcd ), for displaying images , a keyboard and / or mouse for inputting and / or otherwise selecting commands and / or data , and an internal transceiver ( not shown ) for receiving signals from personal identification transmitter 266 and for sending signals to either the transceiver 245 or to the communications interface 240 so that the designated party 262 can be located within the business facility 250 . typically , a customer uses mobile phone 202 to place a call routed through telecommunication network 204 and switch 206 to the pbx 208 ( to the called telephone number of the call center ). alternatively , the customer may use the personal computer 235 to gain access to the dcc 200 through data network 230 . if so , firewall 218 screens and routes the incoming communication over the wan 214 . the incoming communication ( e . g ., incoming call ) is usually detected by an automated answering system ( or similar system for communications initiated by personal computer 235 ) that provides intelligent routing of the call . for example , the customer may hear a prerecorded message prompting the customer to make an initial routing selection , such as , for example “ press 1 to place an order ,” “ press 2 to speak with a customer service representative ,” “ press 3 for directions ,” “ if you know the extension of the party ( i . e ., the designated party ), please press * and the party &# 39 ; s four digit extension ,” and so on . thus , the incoming communication may be initially routed to an appropriate agent ( including agents connected with remote pbx 228 ) or to the extension of the designated party 262 ( as described later , this extension may also be associated with a status of the designated party and the incoming communication may be further routed based on the status to the communications device ). if the incoming communication is routed to the agent , then the call may be sent to the telephone / voice workstation 210 and / or through modem 212 to agent workstation 100 . further , the incoming communication and initial routing instructions provide information about the call to the telephone / voice workstation 210 and / or the agent workstation 100 . for example , if the calling telephone number of the customer is decoded and / or if the customer provides an account number in response to an inquiry from the automated answering system ( or if the account number is associated with other information like the iclid signal of the calling number ), then when the agent workstation 100 receives the incoming communication , the dcc application 110 may automatically associate , retrieve , and pull up associated customer information ( typically stored on file server 216 ). after the agent answers the incoming call , the agent may gather additional information from the customer , associate other customer data , identify the designated party 262 who can further handle the customer &# 39 ; s needs , determine a status of the designated party 262 , and based upon an available status , transfer the incoming communication and associated data to an appropriate communications device , such as the workstation intercom 260 or the work telephone 264 . if the status is unavailable , then the agent may alternatively route the incoming communication and / or associated data to a messaging system , such as voicemail or pager number messaging . the agent and / or the automated answering system determines the status of the designated party 262 by associating availability data of the designated party 262 , location data of the designated party 262 , availability data of the communications device , location data of the communications device , messaging delivery capability data of the communications device , and / or messaging delivery confirmation data with the communications device . typically , the designated party 262 programs in protocols or rules related to his / her availability , location , and communications device . for example , the designated party 262 may input his / her work schedule including meetings , breaks , office hours and so on . similarly , the designated party 262 may input specific times of unavailability ( e . g ., do not disturb ), such as , for example , when a surgeon is operating on a patient during a scheduled surgery . the location data of the designated party 262 and / or the communications device may also be used to determine a status of the designated party 262 . in an embodiment , the designated party 262 wears a radio frequency ( rf ) transmitter 264 ( or other means for identifying a location , such as , for example , a gps transceiver or alternate location means ) that transmits co - ordinates to nearby intercom workstation 260 in communication with transceiver 245 or that transmits co - ordinates directly to transceiver 245 . the dcc application 110 maps the co - ordinates to associate a location with the business facility 250 ( e . g ., 3 rd floor hawthorn building , hallway section 4b ). the location data may be further associated with the availability data of the designated party 262 to determine the status , such as whether the designated party 262 is available to receive the incoming communication . for example , if the designated party is located in a restroom , then the status of the designated party 262 is unavailable . the availability data of the communications device may also be used to determine the status . for example , if the telephone 264 is off - hook , then the telephone 264 may be unavailable to receive the incoming communication and / or associated data . the telephone 264 may represent the extension of designated party 262 or , alternatively , telephone 264 may be associated with the designated party 262 through the communications profile and / or through determining the location of the designated party 262 and nearby facility communications devices ( e . g ., designated party is on 3 rd floor hawthorn building , section 4b and proximate communications devices to area 4b include the intercom 260 in section 4b and the telephone 264 in section 4c ). in addition , the location of the communications device may be used to determine the status . for example , telephone 264 may be located in a conference room with an ongoing meeting , and therefore , the telephone 264 would be unavailable . still further , the messaging delivery capability of the communications device may be used to determine the status . for example , if the intercom workstation 260 has the means to display video images and text files , then the intercom workstation 260 would be available to receive associated video and files with the incoming communication . finally , messaging delivery confirmation capabilities of the communications device may be used to determine the status . for example , if the telephone 260 is capable of providing a dual tone multi frequency signal , then the telephone 260 would be available to transmit a confirmation signal from the designated party 262 indicating that the incoming communications and / or associated data ( including messages ) has been delivered and received by the designated party . the incoming communication and / or associated data may include voice , video , text , and / or other electronic data that is routed over the wide area network 214 through the communications interface 240 ( or alternate communications means as shown in fig8 - 11 ) to the available communications device ( e . g ., the intercom workstation 260 and / or telephone 264 ). the communications interface 240 not only communicates the incoming communication and / or associated data , but also formats and / or otherwise configures the incoming communication and / or associated data ( including messages transcribed by an agent from the customer ) for the communications device . for example , the data stored on file server 216 may need to be converted from a data format compatible with the agent station 100 ( and / or for storage on the file server 216 ) to another data format compatible with the communications device . the data formats may include printed text formats , a voice data formats , a video data formats , a dual tone multi - frequency data formats , and a digital data format ( e . g ., ascii ). in addition , the communications interface 240 may further include message delivery means that provide confirmation , such as a symbol or short message , that the communications device of the designated party 262 has received the incoming communication and / or associated data . thus , the communications interface 240 advises an agent when there is a problem or error communicating the incoming communication ( including associated data ) with the communications device . if there is a problem or error , then the agent may select an alternate communications device ( if the status is available ) to communicate the incoming communication . fig3 illustrates a dynamic contact center ( dcc ) 300 similar to the dcc 200 disclosed in fig2 . fig3 further includes an affiliated computer workstation 302 coupled with the proprietary network of the communications system through communications interface 240 . according to this embodiment , the agent ( or a router of the automated answering system ) receives the incoming communication and any associated data at his / her workstation 100 , interacts with the customer , determines the status of the designated party 262 , associates the status with the communications profile to select the nearby affiliated computer workstation 302 , and provides the incoming communication and / or associated data to the workstation 302 for the designated party 262 to access . as discussed above , the communications interface 240 ensures that the incoming communication and / or associated data are formatted and / or otherwise configured for the workstation 302 . further , the incoming communication and / or associated data routed to workstation 302 may be encrypted or otherwise secured so that only the designated party 262 has access . for example , workstation 302 may include a biometrics sensor 304 , such as , for example , a fingerprint id device . the biometrics sensor 304 may provide security features that prevent unauthorized parties from exploiting the incoming communication and / or associated data . the biometrics sensor 304 could also comprise retina recognition device and software , dna / rna recognition device and software , facial recognition device and software , speech recognition device and software , and / or scent recognition device and software . fig4 illustrates a dynamic contact center ( dcc ) 400 similar to the dcc 300 disclosed in fig3 . fig4 further includes a pots phone 402 and a personal digital assistant 404 to illustrate that the customer may use other wired and wireless communications devices to gain access to the pbx 208 through telecommunications network 204 . fig5 illustrates a dynamic contact center ( dcc ) 500 similar to the dcc 300 disclosed in fig3 . however , fig5 further includes a plurality of intercom workstations 260 and a plurality of designated parties 262 . according to this embodiment , the agent ( or a router of the automated answering system ) receives the incoming communication and any associated data at his / her workstation 100 , interacts with the customer to identify multiple designated parties 262 , determines the status of each of the designated parties 262 , associates each status with one or more communications profiles to select a nearby intercom workstation 260 for each designated party 262 , and provides the incoming communication and / or associated data to each intercom workstation 260 for each designated party 262 to access . the intercom workstations 260 are connected and associated so that the incoming communication and responses to the incoming communication are shared with the group of designated parties 262 . accordingly , this conference feature determines the status of each designated party 262 in a group and simultaneously provides the incoming communications and responses from each available communications device to the group . while not shown , each designated party 262 of the group could be accessed through alternate available communications devices ( such as telephone 260 shown in fig2 , personal computer 302 shown in fig3 , pager 810 , personal digital assistant ( pda ) 812 , interactive pager 814 , and mobile phone 816 shown in fig8 , mp3 1002 , digital signal processor 1004 , modem 1006 , and gps 1008 shown in fig1 , and interactive television 1108 shown in fig1 ). as discussed above , the communications interface ensures that the incoming communication and / or associated data are formatted and / or otherwise configured for each communications device . fig6 illustrates a dynamic contact center 600 similar to the dcc 500 of fig5 . however , according to the embodiment in fig6 , a staff member 602 initiates the incoming communication to the call center through intercom workstation 260 . the agent ( or automated answering system ) receives the incoming communication and any associated data at his / her workstation 100 , interacts with the staff member 602 to identify designated party 262 , determines the status of the designated party 262 , associates the status with the communications profile to select a nearby intercom workstation 260 , and provides the incoming communication and / or associated data to the intercom workstation 260 for communications with the designated party 262 . this embodiment illustrates the advantage of being able to internally use the dcc 600 for staff to more easily locate and communicate with highly mobile on - site staff ( e . g ., network administrators , doctors , car salesman , etc .). fig7 illustrates a dynamic contact center ( dcc ) 700 similar to the dcc 500 disclosed in fig5 . however , fig7 includes interactive , on - site messaging pagers 702 assigned to each designated party ( not shown ). according to this embodiment , the agent receives the incoming communication and any associated data at his / her workstation 100 , interacts with the customer , determines the status of each designated party , associates the status with the communications profile to select the pager 702 , and provides the incoming communication and / or associated data to the pager 702 for each designated party 262 to access . since the interactive pagers 702 allow the designated party to respond to the incoming communication and / or data , this response can be shared with the other pagers 702 in the group . fig8 illustrates a dynamic contact center ( dcc ) 800 similar to the dcc 200 disclosed in fig2 . however , dcc 800 further includes a gateway 802 , a pager 810 , a pda 812 , an on - site , interactive pager 814 , and a mobile phone 816 . according to this embodiment , the agent receives the incoming communication and any associated data at his / her workstation 100 , interacts with the customer to identify the designated party 262 , determines the status of the designated party 262 , associates the status with the communications profile to select one or more of the communications devices ( including the intercom workstation 260 , the pager 810 , the pda 812 , the on - site , interactive pager 814 , and the mobile phone 816 ) to communicate with , and provides the incoming communication and / or associated data to selected communications devices . as discussed above , the communications interface 240 ensures that the incoming communication , associated data , and / or responses are formatted and / or otherwise configured for each of the selected communications devices . alternatively , the incoming communication and / or associated data may be routed through firewall 218 to the data network 230 and the gateway 802 to each of the selected communications devices . an advantage of using the gateway 802 is that the gateway 802 may be provided by a manufacturer of the selected communications device for specialized formatting and / or other configuration of the incoming communication and / or associated data for presentation by the selected communications device , such as formatting a picture for display by the liquid crystal display ( lcd ) screen of the pda 812 . still further , as shown in fig9 , the incoming communication , associated data , and / or responses of a dynamic contact center 900 are routed through the telecommunications network 204 ( including the public switched telephone network ( pstn ) and mobile switched telephone network ( mtso )). an advantage of using the telecommunications network 204 is to leverage the assets of other affiliated data , up - to - date formatting and configuration programs ( including sharing the costs of these systems with other customers of the telecommunications network ), and increased range of accessing off - site staff ( e . g ., when a staff member is not located at the business facility 250 , the transmitter 266 and / or alternate communications devices , such as the mobile phone 818 , could provide the means to determine the location , and consequently the status , of the designated party ). fig1 illustrates a dynamic contact center ( dcc ) 1000 similar to the dcc 200 disclosed in fig2 . however , dcc 1000 further includes a mp3 1002 , a digital signal processor 1004 , a modem 1006 , and a global positioning system ( gps ) 1008 . according to this embodiment , the agent receives the incoming communication and any associated data at his / her workstation 100 , interacts with the customer to identify the designated party 262 , determines the status of the designated party 262 , associates the status with the communications profile to select one or more of the communications devices ( including the intercom workstation 260 , the mp3 1002 , the digital signal processor 1004 , the modem 1006 , and the gps 1008 ) to communicate with , and provides the incoming communication and / or associated data to selected communications devices . as discussed above , the communications interface 240 and / or the telecommunications network 204 ensures that the incoming communication , associated data , and / or responses are formatted and / or otherwise configured for each of the selected communications devices . alternatively , the incoming communication , associated data , and / or responses of a dynamic contact center 1000 may be routed through firewall 218 to the data network 230 and a gateway ( not shown ) to each of the selected communications devices . still further , according to the embodiment depicted in fig1 , a dynamic contact center 1100 includes an interactive television 1108 for communicating the incoming communication , associated data , and / or responses . regardless of the communications device used to communicate the incoming communication , associated data , and / or responses , this information may need to be formatted accordingly for the receiving communications device ( including audio , text ( e . g ., ascii ), video , other digital formats , and combination thereof ). accordingly , the dcc dataserver 42 ( via the communications profile ) has the intelligence to associate the presentation capabilities of each of the receiving communications devices described in fig2 - 11 and to communicate the incoming communication ( and associated data and response ) to a communications interface ( such as communications interface 240 or the gateway 802 ) for appropriate formatting . for example , if the alternate communications device uses the wireless application protocol ( wap ) technique , then the incoming communication and / or associated data are formatted using the wireless mark - up language ( wml ). the wireless mark - up language ( wml ) and the wap technique are known and will not be further described . this is a description of a solution for a specific wireless protocol , such as wap . this solution may be clearly extended to other wireless protocol , such as i - mode , voicexml ( voice extensible markup language ), dual tone multi - frequency ( dtmf ), and other signaling means . referring now to fig1 , a dynamic contact center ( dcc ) 1205 leverages the assets of a telecommunications network provided by pstn 1225 and a wide area network 1230 to interconnect with remote business affiliated sites 1210 , a remote authorized user 1215 ( e . g ., a staff member working remotely from home ), and a customer and / or other third party 1220 . similar to the embodiments described above , the means of coupling the dcc 1205 , the affiliated business sites 1210 , the remote authorized user 1215 , the customer / third party , the pstn 1225 and the wan 1230 include a variety of means , including optical transmission of electronic data , wireless transmission of electronic data , and / or fixed - wire transmission of electronic data ( e . g ., via a local loop of a telecommunications network to communicate electronic data ). fiber optic technologies , spectrum multiplexing ( such as dense wave division multiplexing ), ethernet and gigabit ethernet services , and digital subscriber lines ( dsl ) are just some examples of the coupling means . for example , the dcc 1200 may utilize smartring , avvid & amp ; frame relay , and ss7 vc interconnections . accordingly , the telecommunications network 204 may include advanced intelligent network ( ain ) componentry that may be programmed to control features of the dcc 1200 , such as locating a designated party off - site and adding the off - site designated party to a group conference of the incoming communication , associated data , and / or responses ( e . g ., a mobile phone of the designated party could be located using fingerprinting or other techniques in the art , this location could be associated with a status , and the agent could process the incoming communication according to the status ). the signaling between the dcc 1205 , the affiliated business sites 1210 , the remote authorized user 1215 , the customer / third party , the pstn 1225 including ain componentry , and the wan 1230 are well understood in by those of ordinary skill the art and will not be further described . further , those of ordinary skill in the art will be able to apply the principles of this invention to their own communications systems including their network configurations which may differ substantially from the leveraging the telecommunications network ( shown as reference numeral 1225 in fig1 , and alternatively , as reference numeral 204 in fig2 - 11 ), the wan ( shown as reference numeral 1230 in fig1 , and alternatively , as reference numeral 214 in fig2 - 11 ), and the data network ( shown as reference numeral 230 in fig2 - 11 ). while several exemplary implementations of embodiments of this invention are described herein , various modifications and alternate embodiments will occur to those of ordinary skill in the art . for example , the dcc 200 may include wired , optical , and / or wireless components and / or other components ( not shown ). the dcc 200 may use any means of coupling each of the electronic components for communicating the incoming communication and / or associated data , but the coupling means is preferably high - capacity , high - bandwidth optical transport services , gigabit ethernet services , and / or the like . as those of ordinary skill in the art of computer telephony integration understand , the electronic components could also be coupled using other appropriate means , such as , for example a synchronous optical network ( sonet ) structure with redundant , multiple rings . copper conductors may also be used . accordingly , this invention is intended to include those other variations , modifications , and alternate embodiments that adhere to the spirit and scope of this invention .	7
in a chemical plant , a large number of class 1 pressure vessels for handling a substance under the high - temperature / high - pressure conditions are employed , examples of such pressure vessels including a heating vessel , a reactor , an evaporator , accumulator , etc . the interior of this class 1 pressure vessel is subject to enormous accumulation of energy , so that if an accident such as explosion or bursting is caused to occur , a great magnitude of casualties will be resulted . because of this , this class 1 pressure vessel is regulated by various kinds of rules and laws , resulting in increase of the cost for safety equipments . in recent years , many attentions have been paid to a reaction apparatus called a microreactor which is constructed such that it comprises a structure with a fine channel having a width and a length both ranging from several micrometers to several hundreds micrometers , wherein two or more kinds of fluid reactants , which are reactive with each other , are designed to be introduced into the fine channel and allowed to contact with each other to bring about a chemical reaction . since this microreactor is featured in that the surface area per unit volume is relatively large , that the width ( height ) of the channel is small , and that the volume of the channel is relatively small , it is expected possible to obtain various advantages that the mixing time can be shortened , that the heat exchange can be accelerated , and that the reaction would become higher in efficiency . further , since the volume of the channel is small , a reaction under high - temperature / high - pressure conditions can be performed without being bound by the various regulations specified for the class 1 pressure vessel . therefore , it is now possible to apply the microreactor to a chemical reaction apparatus which is adapted to be used under the high - temperature / high - pressure conditions . for example , it is possible to widen the applicability of the microreactor to various chemical reactions wherein a supercritical fluid , a dissolved gas , a less - dissolvable substance or a substance which is low in reaction rate is employed for example . fig1 is a schematic diagram illustrating a reaction apparatus representing one embodiment of the present invention , wherein the reaction apparatus is constituted by a reactor 1 , a raw material tank 2 , a high - pressure pump 3 , a condenser 4 , an injecting liquid tank 5 , an injection pump 6 , a product tank 7 , a returning pump 8 , a heating bath 11 , a cooling bath 12 and channels 21 , 22 , 23 , 24 , 25 , 26 , 27 and 28 . an injecting liquid is designed to be delivered , by means of the injection pump 6 , from the injecting liquid tank 5 to the product tank 7 through the channels 27 , 25 and 26 . on this occasion , the pressure of the start point of the channel 26 , i . e . the pressure of the confluent portion consisting of the terminals of the channels 24 and 25 is determined by the pressure loss of the liquid flowing through the channel 26 . assuming that the cross - sectional configuration of channel 26 is circular and the representative size of this cross - sectional configuration is the same all along the entire length of the channel 26 , when a fluid is permitted to flow through a fine channel , the flow would become a laminar flow in general . more specifically , when reynolds number or a dimensionless number represented by the following equation is less than 2100 , the flow would become a laminar flow . wherein re is reynolds number ; d is an inner diameter ( m ) of the channel 26 ; u is a cross - sectional average flow rate ( m / s ) of fluid ; ρ is a density ( kg / m 3 ) of fluid ; and μ is a viscosity ( pa · s ) of fluid . in the case of laminar flow , when a fluid is permitted to flow through the channel of circular tube , a pressure loss represented by the following hagen - poiseuille equation would be caused to occur . wherein δp is a pressure loss ( pa ); and l is a length ( m ) of the channel 26 . assuming that the flow rate of fluid at the channel 26 is q ( m 3 / s ), the following equation would be established between a cross - sectional average flowing velocity u of fluid and the inner diameter d of the channel 26 . therefore , the equation ( 2 ) illustrating the pressure loss can be represented by the following equation . namely , under the conditions where the flow rate is constant , the pressure loss varies as the length l of the circular tube and varies inversely as the fourth power of the inner diameter d of the circular tube . the pressure of the confluent portion is regulated such that the lower limit thereof is determined by the flow rate flowing through the channel 25 , i . e . the flow rate of injecting liquid . as long as there is no counter - flow at the high - pressure pump 3 , there is no possibility that the pressure at the channels 22 , 23 and 24 , the reactor 1 and the condenser 4 would become lower than the value to be determined by the aforementioned equation ( 4 ). by means of the high - pressure pump 3 , the raw material is fed from the raw material tank 2 via the channel 21 to the reactor 1 . the product obtained through heating at the heating bath 11 and the reaction is delivered through the channel 23 to the condenser 4 and cooled by means of the cooling bath 12 . thereafter , the product is delivered to pass through the channel 24 and joined with a fluid from the channel 25 and then permitted to flow through the channel 26 , thus enabling the product to be recovered at the product tank 7 . assuming that the pressure inside the reactor 1 is approximately the same as the atmospheric pressure , if the temperature of the reactor 1 is set to the boiling point or more , the liquid delivered thereto is caused to boil , thus making it difficult to control the reaction conditions such as flow rate . however , since the inner pressure of a route from the channel 23 to the channel 24 including the reactor 1 that has been heated up to high temperatures is made higher exceeding the pressure loss of the channel 26 that can be determined by the aforementioned equation ( 4 ), it is possible to deliver a liquid raw material as it is as long as the conditions are satisfied . the relationship between the temperature and the pressure of the reactor for preventing the generation of boiling can be secured by setting the temperature so as to make all of the vapor pressure of the substances to be introduced into the reactor 1 become lower than the pressure to be determined by the aforementioned equation ( 4 ). for example , when toluene is employed as a solvent to be delivered into the reactor and the reaction temperature is set to 150 ° c ., the vapor pressure of toluene would become about 0 . 26 mpa . therefore , in the case where the injecting liquid is water , the injecting liquid is delivered with the specification of the channel 26 being set to 500 ( diameter )× 1 . 5 m and the flowing velocity thereof being set to 1 . 4 m / s ( flow rate : 275 μl / s ), thus rendering the pressure loss to become 0 . 27 mpa , which is higher than the vapor pressure of toluene at a temperature of 150 ° c . as a result , toluene can be delivered without generating the boiling of toluene . by the way , since the boiling point of toluene at atmospheric pressure is about 111 ° c ., it is possible to prevent the boiling of toluene by cooling the toluene down to not higher than 111 ° c . by making use of the condenser 4 or water employed as an injecting liquid and then by reducing the pressure thereof to atmospheric pressure . once the delivering of a raw material is initiated , the flow rate of the injecting liquid for generating pressure is reduced . namely , since the pressure loss is caused to increase as the raw material flows into the channel 26 , the flow rate of injecting liquid can be reduced by a magnitude of unnecessary pressure loss exceeding a target pressure . therefore , by reducing the liquid - delivering quantity of the injection pump 6 while monitoring the liquid - delivering quantity of the high - pressure pump 3 , the driving energy as well as the quantity of the injecting liquid to be used can be saved . under certain circumstances , the supply of injecting liquid may be completely suspended . further , it is possible to omit the condenser 4 and the cooling bath 12 , thereby allowing the liquid discharged from the reactor 1 to be naturally cooled down to the boiling temperature thereof during time when the liquid passes through the channel 23 or the channel 24 before the liquid reaches the confluent point . further , the liquid discharged from the reactor 1 may be cooled down by making use of the injecting liquid . namely , the temperature of the liquid at the confluent point may not necessarily be lower than the boiling point . it is only required that the pressure at a certain point in the channel is set and controlled so as to exceed the vapor pressure of the liquid at that point . since the injecting liquid can be repeatedly utilized , the product tank 7 can be connected with the injecting liquid tank 5 by making use of the channel 28 , wherein the flow rate of the injecting liquid can be controlled by making use of a return pump 8 or by making use of the head ( fall ), a valve , etc . the control of the injecting flow rate can be easily performed , if the product to be obtained consists of a single phase . however , if the product is formed of a two - phase stream consisting of liquid - liquid such as water and oil , or formed of a two - phase stream consisting of solid - liquid , the control of the injecting flow rate would become more difficult . therefore , it is advisable that the liquid phase to be employed as the injecting liquid is limited to only one kind . for example , if the specific gravity of the injecting liquid desired to be employed is relatively heavy , the injecting liquid can be drawn from a lower portion of the product tank . on the other hand , if the specific gravity of the injecting liquid is relatively light , the injecting liquid can be drawn from an upper portion of the product tank . in this case , it is possible to omit the injecting liquid tank 5 and to install the starting point of the channel 27 at a region inside the product tank 7 . further , an oil separator may be mounted at an intermediate portion between the product tank 7 and the injecting liquid tank 5 , thereby making it possible to take out a liquid phase as desired and to precisely control the injecting flow rate , i . e . the reduction of pressure even when the product is not formed of a single phase . further , it is also possible to perform new unit processing in the channel 26 and at a temperature lower than the boiling point of a substance . in this case , the processing can be performed accurately by additionally installing a new reactor in the route of channel 26 . for example , a new reagent may be injected from the channel 25 into the substance produced in the reactor 1 to perform a chemical reaction in the channel 26 . by formulating the reaction system such that the raw material and the injecting liquid are formed of an oily phase and an aqueous phase , respectively or , on the contrary , formed of an aqueous phase and an oily phase , respectively , it would become possible to perform extraction processing . more specifically , when a substance which is readily dissolvable in water is to be produced in a chemical reaction of an organic material , the injecting liquid should be selected from water and an aqueous solution , thereby making it possible to extract the product by making use of the aqueous phase in the channel 26 . since the heating bath 11 and the cooling bath 12 are employed simply for the purpose of giving and receiving heat relative to the reactor 1 and the condenser 4 , respectively , they may be constructed such that a heater or a cooler is wound respectively around the reactor 1 or the condenser 4 or such that a piping may be installed inside the reactor 1 and the condenser 4 . it is more preferable , in order to accurately perform the temperature control , to utilize peltier device . in the employment of a high - pressure reaction apparatus , the starting operation and the stopping operation should be carefully performed . namely , on the occasion of starting the reaction apparatus , the injection pump 6 is required to be started prior to the starting of the high - pressure pump 3 . for example , under the conditions when the temperature of reactor 1 has already raised up to a predetermined temperature , if the delivery of raw material is started before the pressure of the confluent portion is increased , the raw material may be caused to boil inside a hot reactor 1 , thereby increasing the possibilities that steam is caused to eject out of the channel 26 . therefore , since it is imperative that the injection pump is actuated to deliver an injecting liquid on the occasion when the reactor 1 is heated after the delivery of liquid by means of the high - pressure pump 3 or on the occasion when the delivery of liquid by means of the high - pressure pump 3 is started after the heating of the reactor 1 , the high - pressure reaction apparatus should preferably be constructed such that it is provided with an interlock so that unless the aforementioned conditions are satisfied , it is impossible to operate the high - pressure reaction apparatus ( in order to prevent the accidents that may be caused to occur due to erroneous operation or due to malfunctioning of machine , the interlock may be provided so as to make it impossible , when the operator of the reaction apparatus is doing erroneous operation or unless the procedures are not properly followed , to proceed to the next step ). on the occasion of stopping the operation of the reaction apparatus , if the operation of injection pump 6 is stopped prior to or concurrent with the suspension of the high - pressure pump 3 , the interior of the reaction apparatus 1 is decreased in pressure , thereby permitting the raw material to boil in the hot reactor 1 , thereby increasing the possibilities that steam is caused to eject out of the channel 26 . therefore , the injection pump is required to be continuously actuated until the temperature of the reactor 1 is decreased below the boiling point of raw material . accordingly , in order to satisfy this requirement , the interlock should be regulated so as not to permit the injection pump to stop . further , in order to keep the pressure of starting time and stopping time of the reaction apparatus , a stopper valve having no constricted channel such as a ball valve which is free from any reduction of channel size may be installed in the channel 24 or in the channel 26 , thereby suppressing the generation of clogging of channel . on the occasion of changing the temperature of the reactor 1 to a target temperature , since it is not required , basically , to deliver a raw material thereto , it is only required to keep the pressure inside the reactor 1 . this can be achieved by retaining the pressure between the stopper valve which is additionally installed and the high - pressure pump 3 . at the moments of power failure of emergency shutdown during the operation of the reaction apparatus , it is necessary to operate the reaction apparatus while suppressing the boiling of raw material . on the occasion of power failure , it is possible to overcome such an emergency by making use of a normally close - type stopper valve ( generally , which can be brought into a closed state without power source ). in the case where the injection of liquid is performed by means of pump , it can be overcome by making use of an uninterruptive power source . likewise , in the case of emergency shutdown , the stopper valve should be closed and all of power sources should be cut off or , alternatively , only the injection pump may be kept actuated and the power sources of other instruments should be cut off . fig2 shows another embodiment of the present invention . namely , the high - pressure reaction apparatus shown in fig2 differs from the high - pressure reaction apparatus shown in fig1 with regard to the chemical reaction to be handled therein . namely , in the apparatus shown in fig1 , only one kind of substance is permitted to exist in the raw material tank or even if a plurality of substances are permitted to exist therein , the raw material to be employed in the apparatus shown in fig1 is limited to those which cannot be reacted with each other unless they are heated . whereas , in the case of the apparatus shown in fig2 , the raw material to be treated therein consists of two or more kinds of liquid which are enabled to initiate the reaction as they are simply contacted with each other . in the case of this reaction system , since the kinds and ratio of substances to be produced differ depending on the temperature to be employed , they are mixed together after they are heated up to a prescribed temperature . the high - pressure reaction apparatus shown in fig2 is constituted by a reactor 1 , raw material tanks 2 a and 2 b , high - pressure pumps 3 a and 3 b , pre - heaters 9 a and 9 b , a heating bath 11 , channels 21 a , 21 b , 22 a , 22 b , 29 a and 29 b , and other devices which are the substantially the same as those of the high - pressure reaction apparatus shown in fig1 . the raw materials to be subjected a chemical reaction are delivered , by means of the high - pressure pumps 3 a and 3 b , from the raw material tanks 2 a and 2 b , via the channels 21 a , 21 b , 22 a and 22 b , to the pre - heaters 9 a and 9 b , respectively . then , these raw materials are respectively heated up to a predetermined temperature in the pre - heaters 9 a and 9 b and then fed , through the channels 29 a and 29 b , to the reactor 1 and mixed together to initiate the chemical reaction . the construction and functions of devices in the high - pressure reaction apparatus to be employed for treating the products discharged from the reactor 1 are the same as those of fig1 . further , even when three or more kinds of raw materials are to be employed herein , it is simply required to increase the number of devices to be employed in the route starting from the raw material tank to the pre - heater in conformity with the increase in kind of raw materials , this increased number of devices being also arranged parallel with each others . fig3 shows a further embodiment of the present invention . this high - pressure reaction apparatus shown in fig3 differs from that shown in fig1 with respect to the construction of devices located on the downstream side of the channel 22 . in the case of the reactor called microreactor which has a fine channel , when it is desired to increase the throughput , it is achieved by the tandem arrangement of the equivalent devices instead of executing the scale - up of the reactor , i . e . by increasing the size of reactor . in this case , when a high - pressure pump 3 is installed for each of the reactors , the control of the reaction conditions can be facilitated . this leads however to an increase in number of parts , resulting in a reaction apparatus of large size , thus increasing the manufacturing cost of the apparatus . therefore , in order to reduce the manufacturing cost of the apparatus and to enhance the reliability of the apparatus , the number of the high - pressure pump is limited to only one and the channel is diverged after the pressure of raw material is increased by the pump , thereby allowing the raw material to flow into each of the reactors . in the embodiment shown in fig3 , it is assumed to employ five reactors 1 . the raw material is delivered , by means of the high - pressure pump 3 , from the raw material tank 2 via the channel 21 to the channel 22 which is ultimately diverged into channels 22 a , 22 b , 22 c , 22 d and 22 e , through which the raw material is transported into each of the reactors 1 . the raw material is then heated in the heating bath 11 and reacted to create a product . the product thus obtained in each of the channels is permitted pass through each of the channels 23 and then joined with an injecting liquid from each of the channels 25 , the resultant joined liquid being subsequently recovered , via the channel 26 , in the product tank 7 . the injecting liquid is delivered from the injecting liquid tank 5 into the channel 27 . subsequently , by means of the injection pump 6 , the injecting liquid is delivered to pass through the channel 25 which is ultimately diverged into channels 25 a , 25 b , 25 c , 25 d and 25 e which are respectively joined with the terminals of channels 23 . therefore , due to the pressure loss to be generated as the joined liquid passes through the channels 26 , it is possible to keep the pressure of each of the reactors 1 . in the case where the channels 25 a , 25 b , 25 c , 25 d and 25 e thus diverged are respectively sufficiently thick relative to the channel 26 , the pressure of the confluent portion would become constant . therefore , the flow rate in each of the reactors 1 is determined by the pressure loss in the route between the diverged point of the channel 22 and the confluent points . the parts are respectively accompanied with a difference in dimension due to the manufacturing error . because of this difference , a difference in pressure loss is caused to generate , resulting in the generation of differences in flow rate among the reactors . however , due to the provision of flow rate - adjusting valves 10 a , 10 b , 10 c , 10 d and 10 e in the channels 25 , the flow rate of the injecting liquid passing through each of the channels 25 can be variably adjusted . therefore , since the flow rate of injecting liquid flowing into each of the confluent portions can be adjusted in this manner , the difference in flow rate that may be caused to generate among the reactors can be minimized . since the flow rate - adjusting valve is constructed to have a channel structure which is made narrower than the channels to be connected with the fore and rear ends of the flow rate - adjusting valve , the probability of generating the clogging at this flow rate - adjusting valve may be increased . however , since the flow rate of the injecting liquid can be adjusted as described above , it is possible to adjust the flow rate in the channel where the product is permitted to pass through , thereby making it possible to minimize the probability of generating the clogging at this flow rate - adjusting valve . if the injecting liquid is desired to be derived through the recycling of product , the injection of the injecting liquid can be conducted after finishing the filtering process thereof . further , when the product is formed of two phases , i . e . an aqueous phase and an oily phase , it is preferable to select the phase which is smaller in quantity of impurities . although a condenser is not shown in fig3 , if the condenser is installed as shown in fig1 , it is possible to stabilize the reaction in each of the microreactors . in the case where it is impossible to mix the raw material in advance , a series of devices starting from the raw material tank 2 to the preheater 9 may be juxtaposed as shown in fig2 . as described above , the reaction apparatus of the present invention is formed of a continuous liquid - delivering type chemical reaction apparatus , the internal pressure at the time of reaction can be accurately controlled irrespective of the flow rate to be employed . further , it is possible to set the internal pressure higher than the vapor pressure of injecting liquid and to set the reaction temperature higher than the boiling point of the injecting liquid . as a result , it is possible to increase the solubility of solid , to enhance the productivity , and to remarkably promote the chemical reaction of reactants which are low in reaction velocity . further , since the quantity of dissolved gas can be increased by increasing the pressure , it is possible to enhance the efficiency of even the reaction employing a dissolved gas . moreover , on account of the synergistic effects to be derived from the conditions of high - temperature / high - pressure and the conditions to reduce the mixing time as well as due to the utilization of supercritical fluid , the possibility of bringing about novel chemical reactions would be increased . because of these reasons , the present invention would contribute to the synthesis of novel substances and to the discovery of novel synthesizing methods .	1
in accordance with the invention the drive strength of a finfet transistor can be selectively modified , and in particular can be selectively reduced , by omitting the ldd extension region formation in the source and / or in the drain of the finfet . one application of this approach is to enable differentiation of the drive strengths of transistors in an integrated circuit by applying the technique to some , but not all , of the transistors in the integrated circuit . in particular in a sram cell formed from finfet transistors the application of the technique to the pass - gate transistors , which leads to a reduction of the drive strength of the pass - gate transistors relative to the drive strength of the pull - up and pull - down transistors , results in improved sram cell performance . the invention will now be explained with reference to fig7 , which shows a plan view of a finfet structure in accordance with one embodiment of the invention , and fig8 , which is a longitudinal cross - section through the line a - a in fig7 . corresponding reference numerals have been used for features corresponding to fig3 and 4 . in this embodiment of the invention adjacent each end of the fin are formed two high density doped ( hdd ) regions forming a source hdd region 140 and a drain hdd region 144 of the finfet . the source ldd extension regions 132 have been formed in the channel , extending from the source hdd region 140 towards the gate electrode ( s ) 136 but drain ldd extension regions have not been formed . as indicated above , in embodiments of the invention the drain ldd extension regions or the source ldd extension regions or both may be omitted , depending upon the desired extent of the reduction in the drive strength of the transistor required . typical reductions in the drive strength that may be obtained in an nmos finfet by omitting the drain ldd extension region , the source ldd extension region and both the source ldd extension region and the drain ldd extension region are shown in fig9 a to 9 c respectively . fig9 a to 9 c show a plot of the drive strength of a single fin finfet , i . e . the current flowing through the fin of the finfet , against the gate 36 voltage applied to the finfet for a drain to source voltage equal to 1 volt . in each of fig9 a to 9 c the line 50 shows the drive strength of a first finfet having both a source ldd extension region and a drain ldd extension , for example the finfet 30 shown in fig3 . therefore line 50 shows the maximum drive strength that can be obtained without changing the dimensions of the fin . in fig9 a the line 52 shows the drive strength of a finfet in accordance with an exemplary embodiment having a source ldd extension region formed therein but no drain ldd extension region formed therein , for example the finfet 130 according to the exemplary embodiment shown in fig7 and 8 . as can be seen , the drive current of the finfet in this embodiment shown by line 52 is reduced with respect to the maximum drive strength shown by line 50 by up to 27 %. in fig9 b the line 54 shows the drive strength of a finfet in accordance with an exemplary embodiment having a drain ldd extension region formed therein but no source ldd extension region formed therein ( not shown ). as can be seen , the drive current of the finfet in this embodiment shown by line 54 is reduced with respect to the maximum drive strength shown by line 50 by up to 47 %. in fig9 c the line 56 shows the drive strength of a finfet in accordance with an exemplary embodiment having no source ldd extension region or drain ldd extension region formed therein ( not shown ). as can be seen , the drive current of the finfet in this embodiment shown by line 56 is reduced with respect to the maximum drive strength shown by line 50 by up to 63 %. line 56 shows the minimum drive strength that can be obtained without changing the dimensions of the fin . as will be appreciated by a skilled person , the invention may be applied to any situation in which it is desired to selectively modify the drive current of a finfet transistor . thus it can be determined during a design process whether a finfet should have a maximum drive strength or should have a relatively lower drive strength . the finfet can then be designed , and then fabricated , with or without an ldd extension region for the source and / or the drain , according to the determined relative drive strength . the invention is particularly suitable where a differentiation between the drive currents of two or more finfet transistors within a circuit is required . in this case , the drive strength of a first finfet of a circuit can be selected to be higher that a second finfet of the circuit , and the second finfet can be formed having fewer ldd extension regions than the first finfet , and thus having a lower drive strength . one situation in which the invention can be applied is in a sram cell , and therefore embodiments of the invention will now be described with reference to a sram cell . however a skilled person will appreciate that the invention is not limited to application in a sram cell . in the exemplary embodiment of the invention applied to a sram cell , the drive strength of the pass - gate transistors are modified by omitting source ldd extension regions or drain ldd extension regions , in order to reduce the drive strength of the pass - gate transistor . it should be noted that in the pass - gate transistor of an sram , the source and drain change role depending on the state of the cell ( read / write / standby ), therefore we will refer to the bit line side ldd extension regions or the internal node side ldd extension regions for the pass - gate transistors instead of source and drain ldd extension regions . however , the skilled person will understand that the principles of omitting one or both of the ldd extension regions on the finfet may be applied equally to this situation . the static noise margin is given by the drive strength ratio of the pass - gate and the pull - down transistors . in the exemplary embodiment of the invention applied to a sram cell , the modification of the drive strength of the pass - gate transistors by omitting the bit line side ldd extension regions or the internal node side ldd extension regions as described above and as shown in fig9 a ) to 9 c ) will improve the static noise margin of the cell . the static noise margin can be illustrated by means of a sram cell butterfly curve . fig1 shows simulated butterfly curves of a first cell with internal node ldd extension regions in the pass - gate transistors ( line 62 ) and a second cell without internal node ldd extension regions in the pass - gate transistors ( line 64 ). each cell has the same pull - up , pull - down and pass - gate transistor dimensions ( l gate 50 nm ; w fin = 10 nm , h fin = 60 nm ). v dd is equal to 1 . the static noise margin can be represented visually by the size of the biggest square that can be inserted in the “ eyes ” of the butterfly curve . as is clear from fig1 , the static noise margin of the second cell , represented by square 66 , is larger than the static noise margin of the first cell , represented by square 68 . thus it will be apparent to a skilled person that if the drive strength of the pass - gate transistor is designed to be weaker than the drive strength of the pull - down transistor by application of the principles of the invention , the read operation of a sram cell will be easier and the static noise margin will increase . a skilled person can select whether or not bit line side ldd extension regions and / or the internal node side ldd extension regions for the pass - gate transistors are implanted in order to achieve the desired drive strength decrease required for the pass gate transistor . in this context it should be noted that the drive strength of the pass - gate transistor should not be made too weak . in particular , a weak pass - gate finfet drive strength will also result firstly in a degraded write margin , since the write margin is reduced if the pass gate transistor drive strength decreases with respect to the pull - up transistor , and secondly in reduced read current i read , since the read current i read is improved if the drive strength of both pass - gate transistor and pull - down transistor is increased . as indicated above , the present invention is not limited to use in finfet sram cells , and may be applied to a wide variety of circuits using finfets . an exemplary finfet cmos process flow will now be described with reference to fig1 and 12 . fig1 shows masks showing doping layer areas up to the first metal layer ( m1 ) overlaid on a typical 6 - t sram layout as shown in fig6 , and fig1 illustrates the essential steps in a typical finfet cmos process flow using the masks shown in fig1 . the person skilled in the art will appreciate that additional or alternative steps can also be used to effect fabrication of a cmos circuit and such additional or alternative steps have accordingly not been discussed in detail . in particular , well and halo ( pocket ) implantation steps are not present in the illustrated process flow , nor are intermediate thermal anneal steps and epitaxial growth steps after spacer formation to form a raised source or drain . typically fins are undoped so that well implantations are not necessary : however they can be added as additional mask layers . fig1 shows the mask layers used in the cmos process flow shown in fig1 . mask layer active 70 , defines the fins ; mask layer poly 72 , defines the gate stack ; mask layer nplus 74 defines the areas to be n - doped ; mask layer pplus 76 defines the areas to be p - doped ; mask layer metal 78 defines areas of metal interconnect ; and mask layer contact 80 defines contact areas . it should be noted that the mask layers active 70 , poly 72 , metal 78 and contact 80 shown in fig1 are positive masks , i . e . the features remain where the mask is drawn . in contrast the nplus 74 and pplus 76 masks are negative , i . e . photo resist is removed where the mask is drawn such that underlying areas are open for the formation of doped layers , for example by ion implantation . in the exemplary finfet cmos process flow 1000 shown in fig1 , firstly a soi silicon substrate is taken 1002 , and the fins are formed 1004 using the active mask 70 . the fins are typically formed from silicon . thereafter the associated gate stacks are formed 1006 on the substrate using the poly mask 72 , and a final gate etch step carried out 1008 . then the ldd extensions are formed . firstly the nplus mask , as shown in fig1 , is used in step 1010 to apply photo resist patterned to form the n - doped ldd extension regions , and then the n - ldd implant step 1012 is carried out . the n - ldd implant step 1012 may use , for example , phosphorous ( p ) or arsenic ( a ) dopants . the photo resist is removed 1014 . next the pplus mask , as shown in fig1 , is used in step 1016 to apply photo resist patterned to form the p - doped ldd extension regions , and then p - ldd implant step is carried out 1018 . the p - ldd implant step may use , for example , boron ( b ) or boron fluorine ( bf 2 ). then again the photo resist is removed 1020 . after formation of a spacer 1022 , the hdd extension regions are formed . firstly the nplus mask , as shown in fig1 , is used in step 1024 to apply photo resist patterned to form the n - doped hdd regions . then the n - hdd implant step 1026 , which may be for example use phosphorous ( p ) or arsenic ( a ), is carried out . the photo resist is removed , in step 1028 . then the pplus mask , as shown in fig1 , is used to apply photo resist patterned to form the p - doped hdd regions in step 1030 . then the p - hdd implant step 1032 is carried out . the n - hdd implant step 1032 may use , for example , boron ( b ) or boron fluorine ( bf 2 ). once again the photo resist is removed in step 1034 . a thermal anneal process in step 1036 completes the step of forming the ldd and hdd areas . finally a salicidation step 1038 is carried out before the end of the process . modifications of the finfet process flow and / or process masks to fabricate a sram cell in accordance with exemplary embodiments of the invention will now be described with reference to fig1 - 16 . in a first embodiment illustrated with reference to fig1 and 14 a finfet transistor having asymmetric ldd extension regions , as described above with reference to fig7 and 8 is formed as a pass - gate transistor in a sram cell . as illustrated , the pass - gate transistors only have a ldd extension region on one side of the gate , in this case only the internal node side ldd extension regions are present and the bit line side ldd extension regions are omitted . fig1 shows masks showing doping layer areas up to the first metal layer ( m1 ) overlaid on a typical 6 - t sram layout . reference numerals corresponding to reference numerals in fig7 and 8 have been added to fig1 . fig1 illustrates the essential steps in a finfet cmos process flow 2000 using the masks shown in fig1 . again , the person skilled in the art will appreciate that additional or alternative steps can also be used to effect fabrication of a cmos circuit and such additional or alternative steps have accordingly not been discussed in detail . in particular , well and halo ( pocket ) implantation steps are not present in the illustrated process flow , nor are intermediate thermal anneal steps and epitaxial growth steps after spacer formation to form a raised source or drain . typically fins are undoped so that well implantations are not necessary : however they can be added as additional mask layers . the ldd extension regions are typically formed by ion implantation of impurities , either vertically or under a tilt angle . alternatively doping techniques such as plasma doping ( plad ) can also be applied . also co - implantations with non - dopant impurities , e . g . germanium ( ge ) or fluorine ( f ) or hydrogen ( h ) or helium ( he ), may be made . fig1 shows the mask layers used in the cmos process flow shown in fig1 . mask layer active 70 , defines the fins ; mask layer poly 72 , defines the gate stack ; mask layer metal 78 defines areas of metal interconnect ; and mask layer contact 80 defines contact areas correspond with the same mask layers described above with reference to fig1 , and have therefore been given the same reference numerals . new mask layer nldd 82 defines the areas to be n - doped ; and new mask layer pldd 84 defines the areas to be p - doped . again it should be noted that the mask layers active 70 , poly 72 , metal 78 and contact 80 shown in fig1 are positive masks , i . e . the features remain where the mask is drawn . in contrast the nldd 82 and pldd 84 masks are negative , i . e . photo resist is removed where the mask is drawn such that underlying areas are open for the formation of doped layers , for example by ion implantation . in the finfet cmos process flow 2000 in accordance with the embodiment of the invention shown in fig1 , firstly a soi silicon substrate is taken 2002 , and the fins are formed 2004 using the active mask 70 . the fins are typically formed from silicon . thereafter the associated gate stacks are formed 2006 on the substrate using the poly mask 72 , and a final gate etch step carried out 2008 . then the ldd extension regions are formed . firstly the nldd mask 82 , as shown in fig1 , is used in step 2010 to apply photo resist patterned to form the n - doped ldd extension regions , and then the n - ldd implant step 2012 is carried out . the n - ldd implant step 2012 may use , for example , phosphorous ( p ) or arsenic ( a ) dopants . the photo resist is removed in step 2014 . next the pldd mask 84 , as shown in fig1 , is used in step 2016 to apply photo resist patterned to form the p - doped ldd extension regions , and then p - ldd implant step is carried out 2018 . the p - ldd implant step may use , for example , boron ( b ) or boron fluorine ( bf 2 ). then again the photo resist is removed 2020 . after formation of a spacer 2022 , the hdd regions are formed . firstly the nplus mask 74 , as shown in fig1 , is used in step 2024 to apply photo resist patterned to form the n - doped hdd regions . then the n - hdd implant step 2026 , which may be for example use phosphorous ( p ) or arsenic ( a ), is carried out . the photo resist is removed , in step 2028 . then the pplus mask 76 , as shown in fig1 , is used to apply photo resist patterned to form the p - doped hdd regions in step 2030 . then the p - hdd implant step 2032 is carried out . the n - hdd implant step 2032 may use , for example , boron ( b ) or boron fluorine ( bf 2 ). once again the photo resist is removed in step 2034 . a thermal anneal process in step 2036 completes the step of forming the ldd and hdd areas . finally a salicidation step 2038 is carried out before the end of the process . as will be apparent from the above description , in the embodiment of the invention described with reference to fig1 and 14 two additional masks nldd 82 and pldd 84 are needed in addition to the masks shown in fig1 , but no additional process steps are required . the new masks nldd 82 and pldd 84 do not contain small features , and are therefore relatively inexpensive . in a second embodiment illustrated with reference to fig1 and 16 a finfet transistor having asymmetric ldd extension regions , as described above with reference to fig7 and 8 , is formed as a pass - gate transistor in a sram cell . as illustrated the pass - gate transistors only have a ldd extension on one side of the gate , in this case only the internal node side ldd extensions are present and the bit line side ldd extensions are omitted . fig1 shows a hard mask to be used in addition to the masks shown in fig1 in the finfet cmos process flow 3000 shown in fig1 . reference numerals corresponding to reference numerals in fig7 and 8 have been added to fig1 . again , the person skilled in the art will appreciate that additional or alternative steps can also be used to effect fabrication of a cmos circuit and such additional or alternative steps have accordingly not been discussed in detail . in particular , well and halo ( pocket ) implantation steps are not present in the illustrated process flow , nor are intermediate thermal anneal steps and epitaxial growth steps after spacer formation to form a raised source or drain . typically fins are undoped so that well implantations are not necessary : however they can be added as additional mask layers . the ldd extension regions are typically formed by ion implantation of impurities , either vertically or under a tilt angle . alternatively doping techniques such as plasma doping ( plad ) can also be applied . also co - implantations with non - dopant impurities , e . g . germanium ( ge ) or fluorine ( f ) or hydrogen ( h ) or helium ( he ), may be made . fig1 shows a blocking hard mask ldd 86 . the ldd mask 86 is a negative mask , so that where the mask is drawn the hard mask will be removed and the ldd extension regions formed . in addition masks shown in fig1 are also used in the cmos process flow shown in fig1 . process steps corresponding to the cmos process described above with reference to fig1 or 14 will be given corresponding reference numerals . in the finfet cmos process flow 3000 in accordance with the embodiment of the invention shown in fig1 , firstly a soi silicon substrate is taken 3002 , and the fins are formed 3004 using the active mask 70 . the fins are typically formed from silicon . thereafter the associated gate stacks are formed 3006 on the substrate using the poly mask 72 , and a final gate etch step carried out 3008 . in this cmos process flow , firstly a hard mask layer is applied in step 3050 . the hard mask may be , for example , silicon nitride si 3 n 4 or a teos layer or stack of layers . next the ldd mask 86 is used in step 3052 to apply photo resist , and then the hard mask layer is etched in step 3054 . thereafter the photo resist is removed in step 3056 . these steps result in a covering of hard mask preventing formation of ldd extension regions on the bit line side of the pass - gate transistors . then the ldd extension regions are formed . firstly the nplus mask 74 is used in step 3010 to apply photo resist patterned to form the n - doped ldd extension regions , and then the n - ldd implant step 3012 is carried out . the n - ldd implant step 3012 may use , for example , phosphorous ( p ) or arsenic ( a ) dopants . the photo resist is removed in step 3014 . next the pplus mask 76 is used in step 3016 to apply photo resist patterned to form the p - doped ldd extension regions , and then p - ldd implant step is carried out 3018 . the p - ldd implant step may use , for example , boron ( b ) or boron fluorine ( bf 2 ). then again the photo resist is removed in step 3020 , and the hard mask removed in step 3058 . after formation of a spacer 3022 , the hdd regions are formed . firstly the nplus mask 74 , as shown in fig1 , is used in step 3024 to apply photo resist patterned to form the n - doped hdd regions . then the n - hdd implant step 3026 , which may be for example use phosphorous ( p ) or arsenic ( a ), is carried out . the photo resist is removed , in step 3028 . then the pplus mask 76 , as shown in fig1 , is used to apply photo resist patterned to form the p - doped hdd regions in step 3030 . then the p - hdd implant step 3032 is carried out . the n - hdd implant step 3032 may use , for example , boron ( b ) or boron fluorine ( bf 2 ). once again the photo resist is removed in step 3034 . a thermal anneal process in step 3036 completes the step of forming the ldd and hdd areas . finally a salicidation step 3038 is carried out before the end of the process . as will be apparent from the above description , in the embodiment of the invention described with reference to fig1 and 16 only one additional mask namely the ldd mask 86 is needed in addition to the masks shown in fig1 , but additional process steps 3050 - 3058 are required . the new ldd mask 86 does not contain small features , and is therefore relatively inexpensive . thus in the embodiments of the invention described with reference to fig1 - 16 the ldd extension region is formed in the pass gate transistors only on the side in contact with the internal node . clearly , in a first alternative the ldd extension region of the pass gate transistors on the side in contact with the bit line may be formed and the ldd extension region on the side in contact with the internal node may be omitted or in a second alternative both the ldd extension regions of the pass gate transistors on the side in contact with the bit line and on the side in contact with the internal node , may be omitted using suitable masks , depending on the required reduction in the drive strength of the transistor . the skilled person will appreciate that the process flows described herein and the illustrated masks are illustrative only and changes may be made thereto without departing from the scope of the invention . in addition other methods of forming a finfet transistor without one or more ldd extensions are intended to be included within the scope of the invention . thus there is provided a method for the selective modification of the drive strength of a finfet transistor , and in particular a method in which the drive strength of a finfet transistor can be selectively reduced , by omitting an ldd extension region formation in the source and / or in the drain of the finfet . one application of this method is to enable differentiation of the drive strengths of transistors in an integrated circuit by applying the technique to some , but not all , of the transistors in the integrated circuit . in particular in a sram cell formed from finfet transistors the application of the technique to the pass - gate transistors , which leads to a reduction of the drive strength of the pass - gate transistors relative to the drive strength of the pull - up and pull - down transistors , results in improved sram cell performance .	7
the materials employed for the preparation of the insulative sheet of this invention have been described by sawko in u . s . pat . no . 3 , 663 , 464 and that document is therefore incorporated by reference into this specification . these materials consist generally of mixtures of epoxy resins with polysulfides having a molecular weight ranging from about 600 to 8000 which contain , for intumescence purposes , a significant quantity of the ammonium salt of 4 - nitroaniline - 2 - sulfonic acid . a typical mixture will be described more specifically in the examples . in order that the intumescent compositions of sawko be used successfully as covering for small diameter missiles , critical size tolerances have had to be observed in the selection of the particulate substances employed , namely the powdered intumescent agent and the inorganic fibers . thus , it has been discovered that the particle size of the ammonium salt cannot be higher than about 10 microns in average diameter , about 5 to 8 microns being preferred , in order that a critical sheet material density of 1 . 46 to 1 . 50 g / cc be achieved . similarly , the inorganic fibers required must be limited to between about 1 / 64 to 1 / 128 inch in length and about 3 to 5 microns in diameter , the shorter fibers being preferred . the effectiveness of the insulating material of this invention in terms of density is illustrated in table 1 in terms of the time , in seconds per mil of insulation thickness , that the back surface of a 0 . 060 inch center isolated steel substrate exposed to fire will take to reach the temperature of 204 ° c . this particular temperature is critical with respect to detonation of several types of ordnance and to incipient degradation and fatigue of many alloys . table 1 . ______________________________________effect of density , ρ on thermal performanceρ g / cc time to reach 204 ° c .,* sec / mil______________________________________1 . 25 2 . 0 sec / mil1 . 30 2 . 0 sec / mil1 . 35 1 . 8 sec / mil1 . 41 2 . 6 sec / mil1 . 49 3 . 3 sec / mil______________________________________ * 204 ° c . is potential reaction temperature of ordnance . as can be readily calculated from the data in the table , a preferred 60 mil coating with a density of 1 . 49 g / cc will protect a substrate for about 200 seconds , as opposed to about 110 seconds for a 1 . 35 g / cc coating of the same thickness . when a 60 mil insulation sheet of 1 . 49 g / cc density is applied to a small diameter missile , the metal structure has a heat capacity such that it does not reach 204 ° c . before 5 minutes of exposure to fire , i . e ., well within the military specifications for this type of assembly . it should be noted here that both the density and the thickness of the coatings must be extremely uniform in order that any benefit be obtained from their presence . heretofore , this uniformity could not be achieved by available materials and spraying techniques and , for that reason , small diameter missiles were generally not protected since the coatings produced not only would fail as insulation but also would interfere with their ballistic and aerodynamic performance . the process for preparing the compositions from which the sheet insulation is fabricated can be visualized by referring to fig1 which shows a sigma mixer 10 into which the binder and intumescent components are added and thoroughly mixed together in vacuo . the purpose of this operation is to produce a uniform mix that does not contain any entrapped air . air pockets , localized reductions in density , and voids act as thermal breaks in the coating and furthermore , serve as loci for environmental corrosion . the fibers , preferably quartz fibers , are then mixed in , again under vacuum , and the resulting uncatalyzed paste may be stored until needed for sheet production , for example , for a period of about 7 days at - 10 ° c . or up to about 30 days at dry ice temperature . preferably , however , the catalyst 12 is immediately added and thoroughly dispersed in the paste by mixing under vacuum in tube mixer 13 . catalyzed paste 15 then passes to extruder 14 for placement between calendering rolls 20 and 21 . as can be seen in fig2 the paste is then extruded onto a continuous sheet of release paper 19 supplied from stock reel 17 . an example of a satisfactory release paper is a 70 lb . bleached kraft paper coated on both surfaces with 1 mil ( 0 . 0254 mm ) polyethylene and a silicone resin at the rate of 0 . 2 - 0 . 4 lb . per ream . as fig2 shows , a chemically inert and weather resistant film 18 made , for example , of polyvinyl fluoride , can be applied upon the upper surface of the extruded paste in the form of a continuous sheet supplied from stock reel 16 . the resulting sandwich is then passed consecutively between rolls 20 and 21 and between rolls 21 and 22 which are so positioned that a sheet thickness within the range of about 0 . 010 to about 0 . 100 inch is imparted to the finished product . it should be noted here that the release paper surface may be embossed with any desired pattern , said pattern being transferred in due course to the surface of the cured sheet composition . after having been formed by calendering rolls 20 , 21 and 22 , the sheet insulation is cut at station 23 in lengths suitable for wrapping individual missiles or other articles . the lengths are then cured in oven 24 under conditions that shall be presently desribed , and they are stacked in storage cabinet 25 . a critical point in the sheet - forming process is that any delay between calendering and curing the intumescent composition after the catalyst has been added should not exceed 20 minutes at ambient temperature . however , it is possible , when necessary , to store the uncured material at low temperatures , e . g ., at - 80 ° c ., but not for periods longer than two days . under such conditions , premature polymerization of the binder is minimized . one of the most critical aspects of the preparation of insulation material for small diameter missiles is the curing process , i . e ., the time and temperature selected for the cure . this criticality is illustrated in table 2 where it can be seen that a 60 mil coating preheated in an oven at 90 ° c . for five minutes achieves the required flexural properties after a total time of 10 minutes at that temperature . in contrast , both shorter and longer cure times are ineffective . table 2 . ______________________________________effect of cure time andtemperature on flexural properties observed componentcure temp ., ° c . time , min . elongation , % property state______________________________________90 5 5 . 6 cheesy90 10 7 . 9 elastic90 15 6 . 8 brittle______________________________________ note : all samples were placed in preheated oven at 90 ° c . a period of 5 min . was required for the 60 mil samples to reach temperature in the particular tests conducted . evidently , coatings with thicknesses greater or smaller than 60 mils will take more or less time than 5 minutes to reach 90 ° c ., i . e ., some period within the range of about 1 to 6 minutes , but in any case , the actual residence time at 90 ° c . must be limited to 5 minutes + 30 seconds - 0 seconds if useful properties are to be achieved . a typical time - temperature cure schedule for a 60 mil sheet is shown in the following table . table 3______________________________________typical time - temperature cure schedulefor thermal protection sheet stock temperaturetime , min . of sample , ° c . oven temperature , ° c . ______________________________________1 24 932 84 903 88 904 89 93 * 5 90 936 92 937 92 938 92 939 92 9310 92 93______________________________________ * cure time start ( temperature reaches quasi steady state ) an alternative method for applying the protective polyvinyl fluoride film to the surface of the insulation sheet of this invention is to do so after the sheet has been made . in such a case , a thin layer of conventional flexible epoxy adhesive , e . g ., scotweld 22 - 16 , is applied to the surface of the sheet , the film is vacuum bagged into place to avoid trapped air and insure intimate interfacing , and the assembly is then left under reduced pressure , e . g ., 30 mm hg for about 16 hours at ambient temperature (˜ 20 ° c .). a cross - sectional elevation of a film - covered insulation sheet such as that just described is shown in fig3 in which can be seen a layer of intumescent coating ( 30 ), covered by a layer of adhesive ( 31 ) and a polyvinyl fluoride film ( 32 ). proportions have not been respected in order to show the two top layers in sufficient detail . the preferred overall thickness for the layers of this assembly is 0 . 060 ± 0 . 002 inch , including between about 0 . 002 to 0 . 004 inch for the adhesive , and about 0 . 002 inch for the top film . it should be recalled that when the top film is applied directly to the uncured intumescent paste at the calendering stage , no adhesive need be employed since bonding takes place upon curing said intumescent paste . the attachment of the intumescent thermal protection sheet to a missile surface is also achieved by means of a flexible epoxy adhesive which acts as a strain isolator . an assembly of this type is shown in fig4 composed of a top protective film layer ( 32 ), an epoxy glue layer ( 31 ), an intumescent layer ( 30 ), a second epoxy glue layer ( 33 ), and the metal substrate from the missile ( 34 ). to construct this assembly , the release paper is first removed from the sheet surface and that bared surface is lightly scuffed to remove any sheen or release agent present . the surface is then dusted by vacuum to remove all loose particles . the adhesive is applied by mechanical means to a thickness no greater than about 0 . 010 inch nor thinner than 0 . 004 inch . the sheet is then heated at 50 ° c . for 5 minutes to cause it to soften and it is wrapped around the small diameter ( 10 inch or less ) missile . the adhesive is then cured in place by means of a vacuum bag for 16 hours at ambient temperature . after the adhesive has been cured , the missile is removed from the vacuum bag and inspected . the seams and joints , if any , are filled with a grout material having the same formulation as the calendered material , and this grout is allowed to cure for 24 hours at ambient temperature . a polyvinyl fluoride film strip is then placed on the grouted surface to close the gap between the edges of the polyvinyl fluoride film forming the outer covering of the missile . an alternative procedure involves the use of a polyvinyl fluoride sheet which extends beyond the area of the base thermal protection sheet during and after calendering . this extension or flap can then serve to cover the joint area formed on wrapping the insulation around the missile , thus greatly simplifying the process . as disclosed earlier , the materials used in the present compositions and their proportions are generally listed in u . s . pat . no . 3 , 633 , 464 . however , in addition to the preferences and criticalities already recited in the present disclosure , the following parameters have also been found relevant to the success of the present fire protection system . thus it has been found that the proper mechanical properties are achieved when the polymeric components of the composition constitute from about 19 . 5 to 22 . 5 % for the epoxy resin and about 16 . 0 to 19 . 0 % for the polysulfide , of the final calendering mix , excluding catalyst and solvents . as to the non - polymeric ingredients , the composition should contain between about 61 and 63 % of such materials , namely the intumescent agent and the fiber , with the balance , i . e ., about 37 to 39 %, being accounted for by polymers . however , as little as 20 % and as much as 95 % intumescent agent , based on the weight of the polymers used , can be employed depending on the particular polymeric components and proportions selected . the microfibers , which may be either of organic or inorganic nature , should preferably constitute between 2 and 10 % of the composition , while the amine curing agent , when employed , can be present at a level of up to about 12 % of the epoxy resin weight . the invention will now be illustrated in greater detail by means of the following non - limiting example which describes a most preferred embodiment . an intumescent formulation is first prepared from the following ingredients according to the teachings of u . s . pat . no . 3 , 663 , 464 : ______________________________________ parts by weight______________________________________epoxy resin ( epon 828 ) 21 . 4polysulfide ( lp - 3 ) 17 . 11 , 4 - nitroaniline - 2 - sulfonicacid , ammonium salt 56 . 5silica microfibers 5 . 0tris -( dimethylaminomethyl ) phenol 2 . 5______________________________________ the epoxy resin employed was of the epichlorohydrin - bisphenol a type and had an average molecular weight of 380 , an epoxide equivalent within the range of 185 to 192 and a viscosity of about 130 poises . the polysulfide was a mercaptan - terminated polymer of the formula with an average molecular weight of 1000 , an average viscosity of 10 poises at 25 ° c . and a mercaptan content of 6 percent with 2 percent cross - linking . the ammonium salt was used in the form of fine particles , i . e ., having an average diameter of about 5 to 8 microns . the silica microfibers had an average length of about 1 / 128 inch and an average diameter of about 3 - 5 microns . the first four ingredients were mixed in a sigma mixer under vacuum in the manner described earlier and , after incorporation of the curing agent , i . e ., the tertiary amine , by continued mixing under vacuum for 5 minutes , the paste was calendered into a sheet having a thickness of 0 . 060 ± 0 . 002 inch . a silicone coated paper and a 0 . 002 inch thick polyvinyl fluoride ( tedlar ) sheet were applied to the intumescent mixture during calendering , as shown in fig2 . in this manner , the need for an adhesive layer was obviated . when the resulting insulation sheet was applied to a small diameter missile as previously described , and the resulting assembly tested by placing it in a pool fire of 5000 gallons jp - 5 fuel , a period of 409 seconds elapsed before ordnance reaction , as opposed to a period of 45 to 60 seconds for uncoated missiles of the same caliber . these results are illustrated in the following table . table 4______________________________________thermal performance on missile warheadsenvironment : missile placed in pool fire ( 5000 gallons of jp - 5 fuel ) missile ( thermal protection system ) time to reaction , seconds______________________________________no coating 45 to 6060 mils coating 409______________________________________ while the thermal insulation material of the present invention , its preparation , and its principal use have been described in sufficient detail to enable those skilled in the art to practice these various aspects of said invention , it is contemplated that changes can be made in these processes , materials and uses without department from the spirit and the scope of the following claims .	5
in the following detailed description , numerous specific details are set forth in order to provide a thorough understanding of the invention . however , it will be understood by those skilled in the art that the present invention may be practiced without these specific details . in other instances , well - known methods , procedures , components and circuits have not been described in detail so as not to obscure the present invention . in the following detailed description , numerous specific details are set forth in order to provide a thorough understanding of the invention . however , it will be understood by those of ordinary skill in the art that the invention may be practiced without these specific details . in other instances , well - known methods , procedures , components , units and / or circuits have not been described in detail so as not to obscure the invention . embodiments of the invention may be used in a variety of applications . some embodiments of the invention may be used in conjunction with various devices and systems , for example , a transmitter , a receiver , a transceiver , a transmitter - receiver , a wireless communication station , a wireless communication device , a wireless access point ( ap ), a modem , a wireless modem , a personal computer ( pc ), a desktop computer , a mobile computer , a laptop computer , a notebook computer , a tablet computer , a server computer , a handheld computer , a handheld device , a personal digital assistant ( pda ) device , a handheld pda device , a network , a wireless network , a local area network ( lan ), a wireless lan ( wlan ), a metropolitan area network ( man ), a wireless man ( wman ), a wide area network ( wan ), a wireless wan ( wwan ), devices and / or networks operating in accordance with existing ieee 802 . 11 , 802 . 11a , 802 . 11b , 802 . 11e , 802 . 11g , 802 . 11h , 802 . 11i , 802 . 11n , 802 . 16 , 802 . 16d , 802 . 16e standards and / or future versions and / or derivatives and / or long term evolution ( lte ) of the above standards , a personal area network ( pan ), a wireless pan ( wpan ), units and / or devices which are part of the above wlan and / or pan and / or wpan networks , one way and / or two - way radio communication systems , cellular radio - telephone communication systems , a cellular telephone , a wireless telephone , a personal communication systems ( pcs ) device , a pda device which incorporates a wireless communication device , a multiple input multiple output ( mimo ) transceiver or device , a single input multiple output ( simo ) transceiver or device , a multiple input single output ( miso ) transceiver or device , a multi receiver chain ( mrc ) transceiver or device , a transceiver or device having “ smart antenna ” technology or multiple antenna technology , or the like . some embodiments of the invention may be used in conjunction with one or more types of wireless communication signals and / or systems , for example , radio frequency ( rf ), infra red ( ir ), frequency - division multiplexing ( fdm ), orthogonal fdm ( ofdm ), time - division multiplexing ( tdm ), time - division multiple access ( tdma ), extended tdma ( e - tdma ), general packet radio service ( gprs ), extended gprs , code - division multiple access ( cdma ), wideband cdma ( wcdma ), cdma 2000 , multi - carrier modulation ( mdm ), discrete multi - tone ( dmt ), bluetooth ®, zigbee ™, or the like . embodiments of the invention may be used in various other apparatuses , devices , systems and / or networks . although embodiments of the invention are not limited in this regard , discussions utilizing terms such as , for example , “ processing ,” “ computing ,” “ calculating ,” “ determining ,” “ establishing ”, “ analyzing ”, “ checking ”, or the like , may refer to operation ( s ) and / or process ( es ) of a computer , a computing platform , a computing system , or other electronic computing device , that manipulate and / or transform data represented as physical ( e . g ., electronic ) quantities within the computer &# 39 ; s registers and / or memories into other data similarly represented as physical quantities within the computer &# 39 ; s registers and / or memories or other information storage medium that may store instructions to perform operations and / or processes . although embodiments of the invention are not limited in this regard , the terms “ plurality ” and “ a plurality ” as used herein may include , for example , “ multiple ” or “ two or more ”. the terms “ plurality ” or “ a plurality ” may be used throughout the specification to describe two or more components , devices , elements , units , parameters , or the like . for example , “ a plurality of stations ” may include two or more stations . there are two general models which are generally known to provide integration between sps and iasps including : ( i ) the old cellular or “ walled garden ” model in which content is provided entirely through sp &# 39 ; s control environments ; and ( ii ) the open model in which content is provided by iasp transparently via the sp . the walled garden model had advantages for the sp in that it had full control on content accessed by the user . however the limited content typically provided by the sps was incomparable with those of internet , and thus failed to attract widespread user interest . the open model is attractive to users because it may provide nearly unlimited content . however , because the sp is transparent to transactions in this model , there is no revenue opportunity for the sp beyond access usage . furthermore , because mobile station location is not known by the iasps , without some input from sps , there are limits on enhanced services which may be provided . a recent model of content solutions for wireless broadband networks is defined in which improved content may be provided by iasps with the sp &# 39 ; s assistance . this model is referred to herein as the universal services interface ( usi ) model or internet + model . the usi model proposed herein is beneficial to users , iasps and sps in that users may obtain a wider variety of content than previously available , sps can benefit from additional revenue sharing , and iasps can offer better , more convenient , and / or smarter services to users . turning to fig1 , an example network architecture 100 for implementing the usi model is shown . according to one exemplary implementation , a mobile station ( ms ) 105 , for example subscriber stations using protocols compatible with the ieee 802 . 16 standards ( e . g ., ieee 802 . 16 - 2005 amendment ), may communicate via an over - the - air ( ota ) interface with a base station ( bs ) 110 to connect with a connectivity service network ( csn ) 115 operated by a service provider . in certain example implementations , communications between subscribers via bs 110 to csn 115 may be facilitated via one or more access service network gateways ( asngw ) 120 although the inventive embodiments are not limited to this specific type of network implementation . asngw 120 ( or other similar type of network node ) acts as an interface between core network 115 and a plurality of base stations 110 and may function as a type of bs controller and / or mobile switching center ( msc ) to facilitate handover control and other functions for a radio access network ( ran ), although the embodiments are not so limited . connectivity service network ( csn ) 115 , in certain example embodiments , may include a home agent ( ha ) 117 ( or similar type of network node ) and a new type of network node referred to herein as a usi server 118 which acts as a gateway for the interaction with the application service provider ( iasp ) 130 such as google ®, etc . home agent 117 may serve as a seamless internet protocol ( ip ) traffic hub to connect mobile stations ( e . g ., ms 105 ) with other non - service provider networks or entities such as a public internet network 140 , a public switched telephone network ( pstn ) 150 and / or iasp 130 . in actuality , iasp 130 may be part of internet network 140 but is shown separately in fig1 to highlight various interactions with the service provider &# 39 ; s csn 115 . if desired , a media gateway ( mgw ) node 151 may be used to convert circuit - switched communications to ip communications or vice versa between home agent 117 and pstn 150 although the inventive embodiments are not limited in this respect . according to certain embodiments , an accounting server 160 and / or subscriber depository database 170 may also be included in network 100 . accounting server 160 may be coupled with service provider &# 39 ; s csn 115 to authenticate / track user subscriptions ( e . g ., to track user charges ) while database 170 may be used to store customer profiles and / or personal data and preferences of subscribers ( e . g ., to identify users and authorized services ). in certain embodiments , server 160 and database 170 may be combine in a single node . to this end , the description and illustration of network 100 represents logical entities and thus arrangements of certain entities could be combined with others or separated from one another according to network design preference and / or physical constraints . according to the example network architecture in fig1 , the key logical interfaces for network 100 are as follows : u2 interface : between the iasp 130 and the usi server 118 ; u3 interface ; between the asn 120 and the usi server 118 ; and u4 interface ; an optional interface between ha 117 and the usi server 118 . usi server 118 may also have interfaces u6 to accounting server 160 and u5 to subscriber depository db 170 for content charging records and / or service authorization and user privilege . according to certain inventive embodiments the u2 interface between iasp 130 and usi server 118 may be used primarily for user identification ( e . g ., user of mobile station 105 ) as well as any other interaction described herein between the service provider network and the iasp 130 . the u3 interface between usi server 118 and asngw 120 is a signaling and hotlining interface which in certain embodiments may support functions for location services , presence , provisioning , etc . location services : upon the association of ms 105 with a new serving gateway ( sgw ) ( e . g ., anchor paging controller ( apc ) or asn - gw 120 ), either via inter - asn handover or anchor pc relocation , the new sgw handshakes with usi server 118 via u3 to inform the change in the sgw for ms 105 . when accurate location of ms 105 is requested by a content provider ( e . g ., iasp 130 ), usi 118 may contact the sgw to begin location measurements . presence : when ms 105 performs network entry / exit or idle mode entry / exit , in a particular asn - gw , the gw handshakes with usi server 118 via u3 to convey presence ( or lack thereof ) information . provisioning : if usi server 118 also functions as a provisioning server , u3 can be used for signaling of provisioning operations ( e . g ., provisioning start , provisioning complete , etc .). additionally , ms 105 can be hot - lined to usi server 118 via u3 until provisioning is complete . in certain embodiments , an optional u4 interface may be used for quality - of - service ( qos ) signaling between home agent 117 and usi 118 for managed qos services like ip television ( iptv ). in other embodiments , u4 is omitted and the foregoing signaling may be conveyed directly to asn - gw 120 via the u3 interface . in some embodiments of the present invention , when the user is on a vpn there are two ip addresses for the user , the inner ip address ( assigned by the vpn termination point ) and the outer ip address ( assigned by the operator ). in usi , the iasp typically uses the outer ip address to determine which operator the user is coming from , but this fails in the case of vpn , because , the asp can only see the inner ip address now and based on the inner ip address , it can no longer figure out which operator the user is coming from . in order to generically handle the vpn issue , an embodiment of the present invention provides the installation of a usi client on the user device , which basically may : a ) monitor the ip addresses on the user device . in the event that the user enters a vpn , it caches the external ip address of the vpn tunnel . b ) store some or all of the usi context as required by the asp . for example the device could store its current location information , qos context etc . when the user device accesses an asp through vpn , the usi client could include the following information as part of the “ asp request ” message in an embodiment of the present invention , this information may be bundled into the “ asp request ” by using xml . when the asp receives the “ asp request ” message from the user device , the asp now has the external ip address ( using which it can determine the wimax network and access the usi context for this user from the usi server ) and / or the usi context itself . using these parameters , the asp can now provide the same value add service for the vpn user as compared to a non vpn user . turning now to fig2 at 200 is an illustration of usi operation with 230 and without 255 vpn in accordance with an embodiment of the invention . for the normal operation without vpn , at 225 an asp request is sent to asp 220 from ms / usi client 205 . at 240 perform network identification based on ms ip . at 235 send usi context request from asp 220 to usi server in a wimax network 210 . at 245 usi context response sent from 210 to asp 220 and at 250 usi enhanced asp response sent from asp 220 to ms / usi client 205 . looking now at ms with vpn in accordance with an embodiment of the present invention , at 255 ms now opens a vpn tunnel and at 260 asp request is sent from ms / usi client 205 to vpn termination 215 . from vpn termination 215 an asp request 265 is sent to asp 220 . at 270 usi context is requested from usi server 210 with usi server 21 sending a usi context response at 275 . asp 220 at 285 sends usi enhanced asp response 285 to vpn 215 which then sends usi enhanced asp response 280 to ms / usi client 205 . some embodiments of the invention may be implemented by software , by hardware , or by any combination of software and / or hardware as may be suitable for specific applications or in accordance with specific design requirements . embodiments of the invention may include units and / or sub - units , which may be separate of each other or combined together , in whole or in part , and may be implemented using specific , multi - purpose or general processors or controllers , or devices as are known in the art . some embodiments of the invention may include buffers , registers , stacks , storage units and / or memory units , for temporary or long - term storage of data or in order to facilitate the operation of a specific embodiment . some embodiments of the invention may be implemented , for example , using a machine - readable medium or article which may store an instruction or a set of instructions that , if executed by a machine , for example , by system 300 of fig3 , by mobile station 305 of fig3 which may include a processor ( not shown ) and antenna 315 , or by other suitable machines , cause the machine to perform a method and / or operations in accordance with embodiments of the invention . mobile station 305 may be in communication with base station 310 . such machine may include , for example , any suitable processing platform , computing platform , computing device , processing device , computing system , processing system , computer , processor , or the like , and may be implemented using any suitable combination of hardware and / or software . the machine - readable medium or article may include , for example , any suitable type of memory unit , memory device , memory article , memory medium , storage device , storage article , storage medium and / or storage unit , for example , memory , removable or non - removable media , erasable or non - erasable media , writeable or re - writeable media , digital or analog media , hard disk , floppy disk , compact disk read only memory ( cd - rom ), compact disk recordable ( cd - r ), compact disk re - writeable ( cd - rw ), optical disk , magnetic media , various types of digital versatile disks ( dvds ), a tape , a cassette , or the like . the instructions may include any suitable type of code , for example , source code , compiled code , interpreted code , executable code , static code , dynamic code , or the like , and may be implemented using any suitable high - level , low - level , object - oriented , visual , compiled and / or interpreted programming language , e . g ., c , c ++, java , basic , pascal , fortran , cobol , assembly language , machine code , or the like . while certain features of the invention have been illustrated and described herein , many modifications , substitutions , changes , and equivalents may occur to those skilled in the art . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention .	7
in communications networks a plurality of communications channels is normally provided . for controlling such a network , channel identification technology is required so that the individual channels can be selectively addressed and controlled . specifying an identification technology is difficult , as no uniform standard has yet emerged . all in all , because of the distributedness of the system and the large number of different functionalities , system components and requirements , translating the described architecture into specific solutions is a highly complex technical problem . the object of the invention is to identify at least one of the existing problems and to solve same by specifying at least one teaching for technical action . because of the progressive integration of electrical and optical components , the number of communications channels encompassed by individual network elements is ever - increasing . at the same time , modern display technologies are characterized by ever larger and higher - resolution screens and faster image processing processors , so that the amount of displayable and displayed information is increasing . the combined effect of this is that more and more channels are displayed simultaneously in the workstation functions of the network management systems . this creates the new need , as recognized by the invention , for an identification technology for the communications channels which still remains clear even when a very large number of channels are displayed simultaneously . the known identification technologies are geared to controlled communications technology and not to the question of their clarity in the case of large numbers of units . rethinking and breaking away from this paradigm is unknown . however , this is precisely what is required here . simple identification of the channels is therefore becoming a complex and difficult task particularly for larger networks and screens . the known techniques do not solve the recognized problems or at the very least have undesirable side effects : in systems such as pcm30 ( pulse code modulation with 30 user channels and two signaling channels ) in which the channels are implemented using time slots which depend on their relative position within a frame , identification by position number is known , the absolute number of the positions being used for identifying the channels , i . e . the 30 user channels have the numbers 1 - 15 and 17 - 32 because the channels with positions 0 and 16 are used for signaling . wdm systems operate for technological and / or configurational reasons in different frequency ranges / bands ( e . g . red or blue , c or l band ), with different frequency grids ( e . g . 33 , 50 , 100 , 200 ghz grid ), with different numbers of channels ( e . g . 8 , 16 , 40 , 80 ), and / or with different frequency groups and gaps between frequency groups . in optical systems of this kind or generally in systems which are heavily frequency and wavelength dependent , identification via channel frequencies ( e . g . 195400 ghz / 195450 ghz / etc .) or via wavelengths ( e . g . 1541 . 35 nm / 1541 . 74 nm / etc .) is the rule . in the case of control operations across network elements , such as routing of optical paths or setting up services , compatibility and unambiguousness between the different systems is ensured using these values . although the identification of a channel via the frequency or wavelength is unambiguous across the systems , it is difficult for the operator to handle when working with the system on a daily basis , especially when six - digit complex numerical values are involved which are hard to memorize and with which it is difficult to communicate . a solution for the inventively identified problem situation and advantageous embodiments of this solution are set forth in the claims which likewise serve to describe the invention and are therefore part of the description . the invention will now be described using exemplary embodiments . it must be emphasized that these embodiments of the invention are merely exemplary in nature and are not to be taken in a limiting sense even when an embodiment of the invention is described in a highly detailed manner . products for carrying out the invention can be implemented as computer program products . to simplify the description of the invention it will be assumed that each computer program product corresponds unambiguously to a particular file . however , it will be clear to the average person skilled in the art that this limitation is not necessarily the case and a computer program product can at any time also include a plurality of files . according to one embodiment of the invention it is proposed , in place of or in addition to a first , technology - dependent identification scheme for channel identification , e . g . via frequency or wavelength , to provide a second , technology - independent scheme for channel identification , e . g . channel numbering and / or naming . this is preferably perfomed in the network management system . operator - specific requirements in respect of the numbering and / or naming scheme as well as the conditions described at the outset are taken into account . according to one embodiment , a plurality of possible / conceivable numbering or naming schemes with which numbers and / or names can be assigned to the channel frequencies or wavelengths are stored . according to another embodiment , the scheme or schemes are stored in the network element . the stored schemes are made available via a data interface to a management system for managing the network element . the scheme which is to apply to each network element can be selected and stored in the network element via the management interface . in addition , it is possible , via the management interface , to edit the stored schemes and to add further individual schemes . a network management system can retrieve from the network element or store in the network element the scheme which is to be used for that network element . the network management system uses the scheme defined for channel identification either in addition to frequency / wavelength or instead of same . channel frequency / ghz channel wavelength / nm number 192350 1558 . 57 76 192300 1558 . 98 77 192250 1559 . 39 78 192200 1559 . 79 79 192150 1560 . 20 80 192100 1560 . 60 81 192050 1561 . 01 82 192000 1561 . 42 83 channel channel frequency / ghz wavelength / nm name 192350 1558 . 57 tulip 192300 1558 . 98 rose 192250 1559 . 39 jasmine 192200 1559 . 79 lavender 192150 1560 . 20 lily 192100 1560 . 60 narcissus 192050 1561 . 01 coneflower 192000 1561 . 42 violet the invention describes the definition and selection of schemes to be used for a network element as a whole . implementation in finer granularity is also possible , by which is meant the definition and selection of schemes analogously for each network element sub - unit , e . g . for each rack , subrack , shelf , card , etc . the invention is not limited to wdm technology , but can also be applied to network elements of any technology necessitating identification of a frequency or wavelength . a large number of further advantages are associated with the invention : the identification of the channels has a high degree of flexibility , as the following can be optionally selected : a ) non - use of additional / alternative channel identification for all / individual network elements ( or their sub - units ); b ) use of different additional / alternative channel identifications for network elements or for groups of network elements ( or their sub - units ); c ) uniform network - wide additional / alternative channel identification . existing manual operations are shortened and operating errors are reduced or avoided altogether by the improved , ergonomic channel identification . implementation in network management that is free of network - element - dependent peculiarities such as frequency ranges , bands , grids , number of channels , frequency groups and / or gaps , configuration and / or technology . implementation of the invention requires no essential change to the prior art , but can basically be inserted subsequently as a module — in particular as a modified or additional computer program product .. the time of implementation is independent of the time of implementation of other functions . the invention ensures that the individual components of the overall system are only minimally loaded , thereby increasing the stability of the overall system . in conclusion , it should be pointed out that the description of the system components relevant to the invention are basically not to be taken in a limiting sense in respect of a particular physical implementation or assignment . to the average person skilled in the art it will be particularly obvious that the invention can be realized partially or completely in software and distributed over a plurality of physical products and , in particular , computer program products .	7
the vehicle 1 comprises a boot 2 provided with a lid 3 . the lid 3 has two opening positions . in fact , the lid 3 can be opened at will from front to back to store the retractable roof 4 or from back to front to access the luggage compartment . for this reason , the lid 3 of the boot comprises release hinges 5 , 6 situated to the front and rear of the lid . the retractable roof 4 consists of roof elements that can move between an unfurled position in which they cover the passenger compartment 7 of the vehicle 1 and a retracted position in which they are stored in the boot 2 of the vehicle 1 . in the embodiment of the invention shown in fig1 , the roof 4 consists of a front roof element 8 and a rear roof element 9 . the roof elements are linked to each other and to the chassis . the opening and closing movements of the retractable roof 4 and of the lid 3 of the boot 2 are activated by driving means 30 . the driving means are controlled by a control unit 28 . in the embodiment of the invention described in detail in fig1 and 2 , the edges 10 that entail a risk of pinching are shown by the dotted lines . to solve this problem , pressure - sensitive tape 11 is applied on the inner surface 12 of the openings 3 , 4 next to the edges 10 of the openings . the inner surface 12 of these openings 3 , 4 is the surface that is turned towards the part 2 , 7 of the vehicle to be covered . the inner surface 12 of the roof elements 8 , 9 is therefore the surface of the roof elements 8 , 9 that is turned towards the passenger compartment 7 of the vehicle 1 . likewise , the inner surface 12 of the boot 2 lid 3 is the inner surface 12 that is turned towards the boot 2 of the vehicle 1 . the sensors 11 are presented in the form of a thin tape with a thickness of several tenths of a millimetre . the tape 11 is made up of several superimposed layers . a layer of pressure - sensitive material , such as a semi - conductor material , is inserted between two layers of a conductor material , which form the electrodes . a pressure exerted on the tape 11 changes its electrical resistance . the variation in the electrical resistance can be easily detected and measured . thus , the pressure - sensitive tape 11 employs means for generating a pressure signal 26 according to the pressure exerted . the vehicle 1 is also equipped with a control unit . this control unit 28 comprises a device for analysing and comparing the detected pressure signal , a computer and a device for controlling the driving means . thus , the control unit 28 is arranged so as to modify the kinematics of the movement according to the pressure signal measured during the movement of the opening 3 , 4 . the modification of the kinematics of the movement of the opening 3 , 4 consists of slowing , stopping or reversing the movement . it should be noted that the range of pressures detected is very broad , extending from several grams per square centimetre to several kilograms per square centimetre . this enables , mainly , the setting of detection thresholds and , particularly , the setting of rising levels . in an embodiment of the invention , it is planned to set three detection thresholds . these detection thresholds enable modifications to be made to the kinematics of the movement that vary according to the pressure exerted . the operation of the control unit 28 is as follows : the control unit analyses the signal emitted by the pressure - sensitive sheet . the control unit then compares the emitted signal with the rising detection thresholds . finally , according to the comparison of the signal emitted by the pressure - sensitive sheet , the control unit 28 controls the driving means 30 so as to modify the kinematics of the movement of the opening 3 , 4 . the first threshold is the lowest detection threshold . detection signals that are lower than this threshold do not cause any modification of the kinematics of the movement of the opening 3 , 4 . thus , the sensitivity to external events is limited . on the other hand , all detection signals above this threshold cause a slowing of the movement of the opening 3 , 4 . surpassing the second threshold causes the movement of the opening 3 , 4 to stop . finally , surpassing the last threshold or the upper detection threshold causes a reversal of the movement of the opening 3 , 4 . in an embodiment of the invention , it is also possible to contemplate monitoring the changes in pressure over time and / or the rate at which these changes speed up . these parameters can also be compared with the thresholds in order to modify the movement of the opening 3 , 4 in a different fashion . according to an embodiment of the invention , the detection thresholds change according to the areas to be protected . in particular , very risky areas such as the front 13 or rear 14 edges of the lid 3 or the front and rear edges 15 of the roof elements 8 , 9 need to be protected with lower pressure thresholds . the implementation and integration of a pressure - sensitive tape 11 in a vehicle is extremely straightforward . in fact , it is sufficient to fix the tape 11 , for example by gluing or by adhesion directly on an inner surface 11 immediately next to the edge 10 of the lid 3 or of the roof 4 that is likely to meet a body or an object . as an alternative , the pressure - sensitive tape 11 can be fixed to a strip 16 of an elastic material . according to the embodiment of the invention described in detail in fig3 , the pressure - sensitive tape 11 is fixed to the inner face 12 of the lid 3 of the boot 2 , next to the edge 10 . in particular , the tape 11 is therefore separated from the seal 50 . according to the embodiment of the invention described in detail in fig4 , the pressure - sensitive tape 11 is situated in a continuous fashion around the entire periphery of the lid 3 . according to another embodiment of the invention , the pressure - sensitive tapes 11 are only placed on certain sections of the periphery of the lid 3 . more particularly , the pressure - sensitive tape 11 can be situated only in the most dangerous areas , such as the areas situated next to the front 5 and rear 6 hinges of the lid 3 . according to the embodiment of the invention described in detail in fig5 to 9 , the edges 10 of the openings 3 , 4 are formed by the end of a crimping . the skin 17 of the openings 3 , 4 , in other words , the part of the body that is turned towards the outside , is turned over so as to sandwich the edge of the lining 18 of the opening 3 , 4 . the part of the skin 17 that is turned over to form the crimping is called folded edge of the crimping . the part of the opening 3 , 4 situated in the continuity of the crimping opposite the edge 10 comprises a shoulder . in an embodiment of the invention , the pressure - sensitive tape 11 is placed on the folded edge of the crimping . the pressure - sensitive tape 11 is associated with a strip 16 that supports the pressure - sensitive tape and / or transmits pressure to it . the strip 16 is made from an elastic material . the elastic material is preferably a synthetic material such as a foam . the synthetic material used can , for example , be polyurethane . the hardness of the elastic material used is comprised between 15 and 70 shores , preferably between 30 and 60 shores . thus the material enables both the transmission of the pressure and to limit the pinching effect , particularly when involving a finger or a hand . according to the embodiment of the invention of fig5 a , the pressure - sensitive tape 11 is fixed to the strip 16 of elastic material . the pressure - sensitive tape 11 juts out slightly , by a height h , from the edge 10 which can pinch and is located facing a fixed part of the body . the pressure - sensitive tape forms a non - zero angle in relation to the folded edge of the crimping . the strip 16 rests on a shoulder 19 formed on the lining 18 , and on the crimped edge of the inner surface 12 of the boot lid . in this embodiment of the invention , the pressure - sensitive tape 11 directly detects any contact with a foreign body or object . according to the embodiment of the invention shown in fig5 b , the pressure - sensitive tape 11 is also supported by a strip 16 of elastic material and is placed facing a part of the body . the pressure - sensitive tape 11 is inserted in the strip 16 so as to protect it from external aggressions . these external aggressions can be , for example , mechanical or weather - related aggressions . according to the embodiments of the invention shown in fig6 a , 6 b and 7 , the pressure - sensitive tape 11 is fixed directly to the folded edge of the crimping , the strip 16 of elastic material covering the pressure - sensitive tape 11 completely . thus , the tape 11 is particularly well protected from external aggressions . the pressure applied to the edge 20 of the strip 16 facing the body element is transmitted by the strip 16 to the pressure - sensitive tape 11 . according to the embodiment of the invention shown in fig6 b , to improve the transmission of pressure , a cornice 21 providing an additional support surface is fixed to the lining 18 of the boot lid . with the aim of obtaining a maximum transmission of pressure , the curve of the strip 20 is preferably turned towards the body part . the embodiment of the invention described in detail above describes a strip 16 that has a support surface on all its sides , with the exception of the surface 20 that is turned towards the body of the vehicle . this is why it is possible to use a very soft material , such as a foam ; the use of a very soft material provides improved detection sensitivity . according to the embodiment of the invention described in detail in fig7 , the strip 16 can also have a lip 24 turned towards the part of the body . a pinch on the lip 24 results in a deformation of the strip 16 which is detected by the pressure - sensitive tape 11 . as an alternative , the lip 24 can be connected to the bottom part of the strip 16 . fig8 shows the area situated between the rear edge 15 of the front roof element 8 and the front edge of the rear roof element 9 . the edges 10 of the front edge and the rear edge 15 of the front roof element 8 also consist of a crimping such as described previously . likewise , the strip 16 rests against the turned - over edge of the crimping and against a shoulder 19 formed on the lining 18 . a seal 22 is fixed to the rear roof element 9 or to the crosspiece 23 of the windscreen in order to provide a watertight seal . according to the embodiment of the invention shown in fig9 a , the pressure - sensitive tape 11 is fixed to the strip 16 . the pressure - sensitive tape 11 juts out slightly from the edge 10 that can pinch and is situated facing the rear roof element 9 or the crosspiece 23 of the windscreen . although this embodiment of the invention is not shown , it is also possible to fix the pressure - sensitive tape 11 directly to the inner face 12 of the roof element 8 . however , in this case , the pressure - sensitive tape 11 is fixed to the shoulder 19 of the lining 18 and not to the turned - over part of the crimping . it should be noted that all the embodiments of the strip 16 described in fig5 to 7 can also be applied to the roof elements 8 , 9 . in another embodiment of the invention , not shown , the inner surface 12 of the opening 3 , 4 can also be partially or completely covered with a pressure - sensitive sheet that can emit a signal according to said pressure . thus , the inner surface 12 of the opening 3 , 4 is also secured . it will be understood that this disclosure , in many respects , is only illustrative . changes may be made in details , particularly in matters of shape , size , material , and arrangement of parts without exceeding the scope of the invention . accordingly , the scope of the invention is as defined in the language of the appended claims .	1
referring to fig1 of the drawings , a swing incorporating my invention includes a flexible swing seat 10 which is suspended by chains 12 from an overhead support such as the crossbar 14 of the gym set ( not shown ). extending along the length of seat 10 adjacent to the front and rear edges thereof is a pair of flexible inextensible connector members 16 . the connector members may be metal straps as described , for example , in u . s . pat . no . 3 , 897 , 056 . alternatively and more preferably , they are short lengths of chain which extend through tubes 10a formed integrally in seat 10 , as shown in fig2 and 3 and described in u . s . pat . no . 4 , 478 , 410 . for purposes of this description , we will assume that the connector members 16 are chains whose end links 16a ( fig2 ) project slightly from the opposite ends of seat 10 and are connected to hangers 22 at the ends of the seat . preferably , hangers 22 are inverted generally v - shaped wire members whose arms 22a terminate in hooks 22b which are hooked through the end links 16a of the associated chain 16 as shown in fig2 and 3 . the upper ends of the suspension chains 12 are connected by standard s - hooks 24 to a pair of hanger bolts 26 whose shanks extend through appropriate openings in the crossbar 14 and are secured there by nuts 28 screwed onto the upper ends of the hanger bolts . thus , the swing is free to swing about pivot points at the hanger bolts . if desired , bearings ( not shown ) may be provided in the upper loops of the s - hooks to minimize wear on those connections due to the motion of the swing . preferably also , the suspension chains 12 are covered along their entire lengths by plastic sleeves 12a to provide good gripping surfaces for the occupant of the swing . surrounding each of the hanger hooks 22b and its connection to the associated chain 16 is a relating stiff connection guard 32 . the guards are shown as being spherical . however , they could just as well be some other shape . similar connection guards 32 &# 39 ; surround the lower loops of the s - hooks 24 supporting the upper ends of the suspension chains 12 . as shown in fig2 and 3 , each illustrated connection guard 32 comprises a pair of more or less mirror image , generally hemispherical shells 32a and 32b . actually , as best seen in fig2 shell 32b constitutes a slightly larger section of the sphere made up by the two shells 32a and 32b . the shells are preferably molded of a relating stiff rugged , weather - resistant plastic material such as rubber , polyethylene or styrene . however , they could just as well be formed out of metal or wood . formed at the inside each shell 32a is a hollow , and radially extending pedestal 34 which extends from the bottom of the shell more or less to the diametric plane defined by the edge of the shell . a hole 36 in the outer wall of the shell extends to the interior of the pedestal and a colinear hole 38 present in the top wall of the pedestal is sized to receive the shank of a threaded fastener 42 inserted into the pedestal through opening 36 . shell 32b of each guard 32 is similar to shell 32a in that it has an interior , radially extending , hollow pedestal 44 . however , pedestal 44 is somewhat smaller in diameter than pedestal 34 and it does not extend all the way to the plane defined by the edge of shell 32b . a hole 46 in shell 32b extends through the outer wall of that shell into pedestal 44 and a small colinear hole 48 is present at the top of that pedestal . as shown in fig2 and 3 , at least two slots 52 and 54 extend into the sides of shell 32b from the edge of that shell . these slots are spaced around the circumference of the shell so that when that shell is positioned adjacent to the hanger hook 22a , the slot 52 is in position to receive the adjacent arm 22a of hanger 22 and slot 54 is in position to provide clearance for the chain link 16a connected to that hook 22a . as shown in the drawing figures , when unoccupied , the swing seat 10 ends hang down from the hanger arms 22a at an angle of about 135 °; therefore , the slots 52 and 54 are spaced around the axis of shell 32b at that same angle . it should be understood , however , that that angle may vary , depending upon the amount of sag in seat 10 , from 90 ° to 180 °. with these slots , the shell 32b can be positioned snugly against the side of hook 22b so that the shell pedestal 44 projects through the eye of that hook as shown in fig3 and at the right hand side of fig2 . then , the other shell 32a can be positioned against the opposite side of that hook 22b so that its edge engages the edge of shell 32b . preferably , the engaging edges or rims of the two shells are notched so as to interfit to maintain the alignment of the shells . thus , in the illustrated embodiment of the invention , the edge of shell 32a has an exterior circumferential notch 56a and shell 32b has an interior circumferential notch 56b . also , it may be necessary to provide a slot 58 in the wall of shell 32a directly opposite the slot 54 in shell 32b to provide additional clearance for the chain link 16a when the two shells are brought together as shown at the right hand side of fig2 . when the shells are mated as shown , the threaded fastener 42 may be inserted through opening 36 in shell 32a and through the smaller opening 38 in that shell &# 39 ; s pedestal 34 so that the fastener projects through the hanger hook 22b and extends into the hole 48 in pedestal 44 of shell 32b . when the fastener is turned down into that last hole , it taps threads into the wall of that hole and fastens the two shells tightly together , as depicted at the right hand side of fig2 . when the two shells 32a and 32b are secured together , they completely enclose the associated hanger hook 22b and the end of chain link 16a connected to that hook . therefore , it is impossible for a child using the swing to insert his or her fingers into that connection and possibly being injured because of that action . it is also an important feature of the invention that the guard 32 at each hanger hook 22b prevents the chain link 16a connected to that hook from becoming disconnected because that hook was not closed completely during assembly of the swing . instead of using a fastener to secure these two shells together , one of the pedestals , e . g ., pedestal 44 may be formed with a male snap fastener member or barb at its free end as shown in phantom 44a at the left side of fig2 . when the two shells are brought together , barb 44a is arranged to plug into hole 38 in pedestal 34 . this connection , as opposed to fastener 42 , tends to be permanent . more particularly , and as best seen in fig3 the relative angular position of each hook arm 22a and the chain link 16a connected to that arm is substantially fixed at about 135 ° by the slots 52 and 54 , 58 formed in the guard 32 engaged to that hook arm . moreover , any appreciable lengthwise motion of that link is prevented by the pedestals 34 , 44 forming the axle that extends through the eye of the hook . accordingly , there is little or no likelihood of the chain link 16a finding its way to the mouth of hook 22b even during the most violent movements of the swing . resultantly , even if a gap g should be present at the mouth of hook 22b as shown in fig3 which is large enough to permit the escape of chain link 16a , that link will be unable to slide along the hook far enough to reach that gap . it should be mentioned that while the connection guard 32 more or less fixes the relative position of the hanger arm 22a and the chain link 16a hooked to that arm , the guard does permit some tilting and rotation of the chain link 16a about the longitudinal axis of chain 16 because the slots 54 , 58 are somewhat oversize and the guard shells 32a and 32b are free to rotate relative to one another about the common axis of the pedestals 34 and 44 , i . e ., about fastener 42 . in addition to providing protection from pinch points and preventing accidental release of chains 16 from their hangers 22 as described above , the guards , by virtue of their shape and placement , also add decoration to the swing . while the illustrated guards are spherical , they could just as well be square , elliptical , heart - shaped or given some other shape that would make them particularly pleasing to the eye . also , the guards may be brightly colored or provided with a decorative surface coating as indicated by stippling 62 on the right hand guard 32 in fig2 . if desired , these colors may be coordinated with the colors of strap 10 and the chain sleeves 12a to enhance the overall ornamental appearance of the swing , which is desirable from a marketing standpoint . the guards 32 &# 39 ; at the tops of the suspension chains 12 are more or less the same as the guards 32 . that is , each guard 32 &# 39 ; comprises a pair of more or less mirror image hemispherical shells which engage opposite sides of the lower loop of the associated s - hook 24 and the chain link attached to that hook . in the case of guards 32 &# 39 ;, however , the notches 52 and 54 , 58 in the guard shells are located diametrically opposite one another because the suspension chain 12 hangs down vertically from the s - hook 24 . thus , each guard 32 &# 39 ; maintains a 180 ° angular alignment of the associated s - hook 24 and the claim link connected to that hook . each guard 32 &# 39 ;, being located directly opposite the upper loop of an s - hook 24 also closes any gap present in the upper loop of that s - hook so that that loop cannot detach accidentally from the associated hanger bolt 26 when the swing is in motion . it will be appreciated from the foregoing that the guards 32 and 32 &# 39 ; greatly increase the marketability of a children &# 39 ; s swing because they make the swing safer to use and improve the ornamental appearance of the swing . yet , being composed primarily of inexpensive molded parts , the guards are relatively inexpensive to make in quantity so they do not add appreciably to the overall cost of the swing . furthermore , since only threaded fasteners are needed to attach the guards to the swing , they can be installed easily by a customer when the swing is purchased ; they can even be retrofitted to existing swings . it will thus be seen that the objects set forth above , among those made apparent from the preceding description , are efficiently attained . also , certain changes may be made in the above construction without departing from the scope of the invention . for example , similar guards can be applied to the ring bolts used to connect wooden swing seats to their suspension chains and to the connections of the swing described in the above - mentioned u . s . pat . no . 4 , 478 , 410 . in the latter case , the guard may be sized and slotted to enclose the entire s - hook and its two connections to the two chains . therefore , it is intended that all matter contained in the above description or shown in the accompanying drawings be interpreted as illustrative and not in a limiting sense . it will also be understood that the following claims are intended to cover all of the generic and specific features of the invention described herein .	8
fig1 a and 1b are cross - sections of a setting tool 1 , a liner assembly 100 , and a wiper assembly 150 , according to one embodiment of the present invention . the setting tool 1 , liner assembly 100 , and wiper assembly 150 may be run into a wellbore using a run - in string 685 ( see fig6 ). the run - in string 685 may include a string of tubulars , such as drill pipe , longitudinally and rotationally coupled by threaded connections . the liner assembly 100 may include an expandable liner hanger 105 , a polished bore receptacle ( pbr ) 110 , one or more adapters 115 , and a liner string 125 . the setting tool 1 may be operable to radially and plastically expand the liner hanger 105 into engagement with a casing or liner string 305 ( see fig3 a ) previously installed in the wellbore . non - sealing members of the setting tool 1 and liner assembly 100 may be made from a metal or alloy , such as steel or stainless steel . alternatively , the pbr 110 may be disposed between the liner hanger and the run - in string . the setting tool 1 may include a connector sub 2 , a mandrel 3 , one or more piston assemblies 10 a , b , an expander assembly 25 , a latch assembly 50 , an isolation valve 200 , and a seal assembly 75 . the connector sub 2 may be a tubular member including a threaded coupling for connecting to the run - in string and a longitudinal bore therethrough . the connector sub 2 may also include a second threaded coupling engaged with a threaded coupling of the mandrel 3 . one or more fasteners , such as set screws may secure the threaded connection between the connector sub 2 and the mandrel 3 . the mandrel 3 may be a tubular member having a longitudinal bore therethrough and may include one or more segments connected by threaded couplings . the piston assemblies 10 a , b may include pistons 11 a , b , sleeves 12 - 14 , caps 15 a , b , inlets 16 a , b , outlets 17 a , b , and ratchet assembly 18 . the pistons 11 a , b may each be t - shaped annular members . an inner surface of each piston 11 a , b may engage an outer surface of the mandrel 3 and may include a recess having a seal , such as an o - ring disposed therein . the inlets 16 a , b may be formed radially through a wall of the mandrel 3 and provide fluid communication between a bore of the mandrel 3 and first sides of the pistons 11 a , b . the sleeves 12 , 13 may be longitudinally coupled to the pistons 11 a , b by threaded connections . seals , such as o - rings , may be disposed between the pistons 11 a , b and the sleeves 12 , 13 . each of the sleeves 12 - 14 may be a tubular member having a longitudinal bore formed therethrough and may be disposed around the mandrel , thereby forming an annulus therebetween . the caps 15 a , b may be annular members , disposed around the mandrel , and longitudinally coupled thereto by a threaded connection . the caps 15 a , b may also be disposed about a shoulder formed in or disposed on an outer surface of the mandrel 3 . seals , such as o - rings , may be disposed between the caps 15 a , b and the mandrel 3 and between the caps 15 a , b and the sleeves 12 , 13 . an end 12 a of the sleeve 12 may be exposed to an exterior of the setting tool 1 . the end 12 a of the sleeve 12 may further include a profile formed therein or fastened thereto by a threaded connection . the profile may mate with a corresponding profile formed on an outer surface of the ratchet assembly 18 , thereby longitudinally coupling the ratchet 18 and the sleeve 12 when the pistons are actuated . the sleeve profile may engage the ratchet profile by compressing a spring , such as a c - ring . the c - ring may then expand to lock in a groove of the sleeve profile . teeth formed on inner and outer surfaces of a lock ring of the ratchet assembly 18 respectively engage corresponding teeth formed on an outer surface of the mandrel 3 and an inner surface of a ring housing , thereby longitudinally locking the sleeve 12 and thus the expander assembly 25 once the sleeve 12 engages the ratchet assembly 18 . the outlet 17 a may be formed through an outer surface of the piston 11 a and may provide fluid communication between a second side of the piston 11 a and the exterior of the setting tool 1 . the sleeves 13 , 14 may be longitudinally coupled to the piston 11 b by a threaded connection . the outlet 17 b may be formed through a wall of the sleeve 14 and may provide fluid communication between a second side of the piston 11 b and the exterior of the setting tool 1 . an end 14 a of the sleeve 14 may be longitudinally coupled to an expander assembly 25 by a threaded connection and one or more set screws . the sleeve 14 may also be temporarily longitudinally coupled to the mandrel at 14 b by one or more frangible members , such as shear screws . the expander assembly 25 may include a body 26 , upper cone retainer 27 , a plurality of cones 28 a , b , cone base 29 , lower cone retainer 30 , sleeve 31 , and shoe 32 , pusher 33 , and one or more frangible members , such as shear screws 34 . the expander assembly 25 may be operable to radially and plastically expand the hanger 105 into engagement with a previously installed liner or casing . the expander assembly 25 may be driven through the expandable hanger 105 by the pistons 11 a , b . the pusher 33 may longitudinally coupled to the sleeve 14 by a threaded connection and one or more fasteners , such as set screws . the pusher 33 may be longitudinally coupled to the body 26 by the shear screws 34 . the cones 28 a , b may each include a lip at each end thereof in engagement with respective lips formed at a bottom of the upper retainer 27 and a top of the lower retainer 30 , thereby radially coupling the cones to the retainers . an inner surface of each cone may be inclined for mating with an inclined outer surface of the cone base 29 , thereby holding each cone radially outward into engagement with the retainers . the body 26 may be tubular , disposed along the mandrel 3 , and longitudinally movable relative to the mandrel . the upper retainer 27 may be longitudinally coupled to the body 26 by a threaded connection and one or more fasteners , such as set screws . the retainers , sleeve , and shoe may be disposed along the body . the upper retainer 27 may abut the cone base 29 and the cones 28 a , b . the cones may abut the lower retainer 30 . the lower retainer 30 may abut the sleeve 31 and the sleeve 31 may abut the shoe 32 . the shoe 32 may be longitudinally coupled to the body 26 by a threaded connection and one or more fasteners , such as set screws . in operation ( see fig3 c ), movement of the sleeve 14 longitudinally toward the upper retainer 27 may fracture the shear screws 34 since the body 26 may be retained by engagement of the cones 28 a , b with a top of the liner hanger 105 . failure of the shear screws 34 may free the pusher 33 for relative longitudinal movement toward the upper retainer until a bottom of the pusher abuts a top of the upper retainer . continued movement of the sleeve 14 may then push the cones 28 a , b through the liner hanger 105 , thereby expanding the liner hanger 105 into engagement with the previously installed casing / liner 305 . when removing the setting tool 1 ( fig3 d ), a top of the override 59 may engage a bottom of the body 26 , thereby carrying the expander assembly 25 with the mandrel 3 . the expandable liner hanger 105 may include a tubular body made from a ductile material , such as a metal or alloy , such as steel or stainless steel . the hanger may include one or more seals 105 a disposed around an outer surface of the body . the seals 105 a may be made from a soft material , such as lead or a polymer , such as an elastomer . the hanger may have teeth 105 b embedded in the one or more of the seals 105 a for engaging an inner surface of the previously installed casing / liner and / or supporting the seals 105 a . alternatively , a hard material 705 b ( see fig7 ) may be disposed along an outer surface of the hanger and / or the seals 105 a to penetrate an inner surface of the previously installed casing or liner , thereby securing the hanger 105 to the casing or liner . the hard material may be a ceramic , such as a carbide , such as tungsten carbide and disposed on the seals as dust and / or disposed on the hanger as teeth or blades . the liner assembly 100 may be longitudinally and rotationally coupled to the mandrel 3 by the latch assembly 50 . the latch assembly 50 may include a piston 51 , a stop 52 , a release 53 , a collet 54 , a cap 55 , a retainer 56 , a biasing member , such as a spring 57 , one or more frangible members , such as shear screws 58 , an override 59 , a body 60 , one or more fasteners 61 a , b , and a catch 62 . alternatively , the latch assembly 50 may include dogs ( see dogs 77 ) instead of a collet . the override 59 and the body 60 may each be tubular , have a bore therethrough , and include a threaded coupling at each end . the override 59 may be longitudinally and rotationally coupled to the mandrel 3 by one of the threaded couplings at a top thereof and one or more fasteners , such as set screws , and longitudinally and rotationally coupled to the body 60 by one of the threaded couplings and one or more fasteners , such as set screws 61 a . the body 60 may be longitudinally coupled to a seat 95 by one of the threaded couplings at a bottom thereof . seals , such as o - rings , may be disposed between the override 59 and the mandrel 3 , between the override and the body 60 , and between the body and the seat 95 . the release 53 may be longitudinally and rotationally coupled to the override 59 by a threaded connection and one or more frangible members ( not shown ), such as shear screws . the threaded connection may be oppositely oriented ( i . e . left - hand ) relative to other threaded connections of the setting tool 1 . the release 53 may be longitudinally biased away from the override 59 by engagement of the spring 57 with fasteners 61 b . the collet 54 may have a plurality of fingers each having a profile formed at a bottom thereof . the fingers 54 f may engage a corresponding profile formed in an inner surface of the adapter 115 . the collet 54 , case 56 , and cap 55 may be longitudinally movable relative to the body 60 between the stop 52 and a top of the piston 51 . when weight of the liner assembly 100 is applied to the collet 54 , the collet may move downward along the body 60 until the fingers seat against a profile 95 a formed in a top of the seat 95 , thereby longitudinally coupling the liner assembly 100 to the setting tool 1 . keys 53 k and keyways may be formed in an outer surface of the release 53 . the keys 53 k and keyways may engage respective keyways and keys 115 k formed in a top of the adapter 115 , thereby rotationally coupling the liner assembly 100 and the setting tool 1 . the piston 51 may be fluidly operable to release the fingers 54 f when actuated by a predetermined pressure . the piston 51 may be longitudinally coupled to the body 60 by the shear screws 58 . once the liner hanger 105 has been expanded into engagement with the casing / liner 305 ( see fig3 c ) and weight of the liner assembly is supported by the liner hanger 105 and / or setting the liner 125 onto a bottom of the wellbore 300 , fluid pressure may be increased . the fluid pressure may push the piston 51 and fracture the shear screws 58 , thereby releasing the piston 51 . the piston 51 may then move upward toward the collet 51 until the piston 51 abuts a bottom of the collet 54 . the piston 51 may continue upward movement while carrying the collet 54 ( and fingers 54 f ), case 56 , and cap 55 upward until a bottom of the release abuts the fingers 54 f , thereby pushing the fingers 54 f radially inward . the catch 62 may be a split ring biased radially inward and disposed between the collet 54 and the case 56 . the body 60 may include a recess formed in an outer surface thereof . during upward movement of the piston 51 and members 54 - 56 , the catch 62 may align and enter the recess , thereby forming a downward stop preventing reengagement of the fingers 54 f . movement of the piston and members 54 - 56 may continue until the cap 55 abuts the stop 52 , thereby ensuring complete disengagement of the fingers 54 f . in the event that the liner assembly 100 becomes stuck in the wellbore 300 during run - in , the override 59 may be operated to release the fingers 54 f from the liner assembly 100 . the override 59 may be operated by setting down weight of the run - in string 685 onto the liner assembly 100 , thereby moving the collet 54 upward along the body 60 and the fingers 54 f from engagement with the profile 95 a . the run - in string may then be rotated , thereby rotating the override , fracturing the shear screws , and freeing the release from the override . the spring 57 may then move the release 53 toward the fingers 54 f until the release 53 disengages the fingers 54 f from the adapter . the seal assembly 75 may include a lock 76 , a plurality of dogs 77 , dog retainer 78 , a cap 79 , fasteners , such as screws 80 , a catch 81 , a body 82 and one or more seal stacks 83 a , b . each of the seal stacks 83 a , b may include first and second end adapters ( not shown ), one or more first seals ( not shown ), a center adapter ( not shown ), and one or more second seals ( not shown ). the first seals may be directional ( i . e ., chevron rings ), and may be disposed between the first end adapter and the center adapter . the second seals may be directional and disposed between the center adapter and the second end adapter with an orientation opposing the first seals . the body 82 may be tubular , have a bore therethrough , and include a threaded coupling at each end . the body 82 may be longitudinally coupled to the housing 214 by one of the threaded couplings at a top thereof and longitudinally coupled to the catch 81 by one of the threaded couplings and one or more fasteners , such as set screws . a seal , such as an o - ring , may be disposed between the body 82 and the catch 81 . the dogs 77 may be radially movable between an extended position and a retracted position . the dogs 77 may be disposed in respective recesses formed in the dog retainer 78 and a lip of each dog may engage a respective lip of the retainer 78 in the extended position , thereby keeping the dogs 77 disposed in the recesses . the dogs 77 may be held in the extended position by abutment of protrusions of a profile formed in an inner surface of the dog with respective protrusions of a profile formed in an outer surface of the lock 76 . the dogs 77 may engage a groove formed in an inner surface of the adapter 115 in the extended position , thereby longitudinally coupling the dogs and the adapter . each screw 80 may be received by a threaded opening formed through the retainer 78 . an end of each screw 80 may extend into a respective slot formed through the lock 76 , thereby coupling the lock and the retainer while allowing limited longitudinal movement therebetween . the cap 79 may be longitudinally coupled to the block retainer 78 by a threaded connection . inner seal stack 83 a may be disposed radially between the dog retainer and the body and longitudinally between a lower surface of the cap and a shoulder formed in the dog retainer . outer seal stack 83 b may be disposed radially between the dog retainer and the adapter 115 and longitudinally between a bottom of the cap and a shoulder formed in the dog retainer . the seal stacks 83 a , b may fluidly isolate a bore of the liner 125 from an annulus formed between the setting tool 1 and the rest of the liner assembly 100 . to release the lock 76 ( see fig3 d ), the body 82 may be moved upward carrying the catch 81 toward the lock 76 until a top of the catch 81 abuts a bottom of the lock and pushes the lock 76 upward toward the dog retainer 78 until recesses in the lock profile align with protrusions in the dog profile . a lower portion of the body 82 may include one or more grooves formed in an outer surface thereof for pressure equalization as the catch moves toward the lock . alignment of the profiles allows the dogs to move from the extended position to the retracted position , thereby freeing the dogs from the adapter 115 . the setting tool 1 may further include the seat 95 . the seat 95 may have a tapered inner surface 95 s for receiving a ball or plug ( not shown ) and one or more ports 95 p formed radially therethrough . the ports 95 p may be isolated from the setting tool - adapter annulus by seals , such as o - rings , disposed between the seat and the adapter 115 and longitudinally straddling the ports 95 p . the ball or plug may be deployed as a safeguard or in response to failure of the isolation valve 200 . the ball may be released from the surface a predetermined distance behind the top plug ( se fig3 a ) so that the ball may be substantially pumped to the seat 95 by the displacement fluid ( the ball may have to free fall a small depth once the top plug has seated against the wiper ). alternatively , should the isolation valve 200 fail , a plug may be delivered to the seat via wireline ( not shown ) or the ball may be deployed after the top plug has seated by free - falling to the seat 95 . as with the isolation valve 200 , landing of the ball or plug may fluidly isolate the mandrel bore from the liner bore . when the setting tool is being removed from the liner assembly 100 and the seat is removed from the liner assembly , the port seals may no longer engage a sealing surface due to the larger inside diameter of the previously installed casing or liner , thereby opening the ports 95 p . the ports 95 p may then provide fluid communication between the setting tool bore and the wellbore , allowing drainage of the displacement fluid from the setting tool 1 and the run - in string 685 as the setting tool 1 travels to the surface . a bottom of the seat 95 may be longitudinally coupled to the housing 201 by a threaded connection . the wiper assembly 150 may include a body 151 , a wiper 152 , and one or more frangible members , such as shear screws 153 . the body 151 may be longitudinally coupled to the catch 81 by the shear screws 153 . the body 151 may be tubular and have a profile 151 p formed along an inner surface thereof for receiving a top plug 320 ( see fig3 a ). the top plug 320 may include a latch for engaging the profile 151 p . additionally , the wiper assembly 150 may be a top wiper assembly and the setting tool may further include a bottom wiper assembly ( not shown ). the bottom wiper assembly may be longitudinally coupled to the body 151 by shear screws and have an inner diameter less than an inner diameter of the top wiper assembly 150 . in this manner a bottom plug ( not shown ) may be deployed before the cement is pumped for isolating the cement from circulation fluid and may be pumped through the body 151 and seat in the bottom wiper assembly . the bottom plug may include a diaphragm or valve . fig2 is a cross - section of the isolation valve 200 . the isolation valve may be longitudinally coupled to the mandrel 3 by a threaded connection . the isolation valve may include one or more housings 201 , 208 , 211 , 214 , one or more seals , such as o - rings 202 , 204 , 207 , 212 , one or more frangible members , such as shear screws 203 and rupture disk 216 , a piston 205 , a retaining rod 206 , one or more nuts 209 , one or more locator rings 210 , a valve member such as a flapper 213 , and one or more biasing members , such as springs 215 , 218 , and one or pins 217 , 219 . alternatively , the valve member may be a ball ( not shown ). the piston 205 may be longitudinally coupled to the flapper 213 via the retaining rod 206 . the piston 205 may be longitudinally coupled to the retaining rod 206 via the pins 217 . the piston 205 may be biased away from the flapper 213 by spring 215 and longitudinally and rotationally coupled to the housing 208 by shear screws 213 . the retaining rod 206 may hold the flapper 213 in the open position . the flapper 213 may be biased towards the closed position by the spring 218 disposed on a mount , such as the pin 219 . a chamber housing the piston 205 and the spring 215 may be sealed at the surface with air at atmospheric pressure . in operation , when it is desired to close the flapper 213 , pressure may be increased in bores of the housings 201 , 208 , 211 , 214 until a predetermined pressure is reached . the rupture disk 216 may then fracture , thereby providing fluid communication between the housing bores and a bottom of the piston 205 . the resulting fluid force may fracture the shear screws 203 and ( along with the spring 215 ) move the piston 205 away from the flapper 213 , thereby allowing the flapper 213 to close . fig3 a - d illustrate installation of the liner assembly 100 . in operation , the setting tool 1 , liner assembly 100 , and wiper assembly 150 may be run into the wellbore 300 until the liner hanger 105 overlaps an end of the previously installed casing or liner 305 distal from the surface . a bottom of the liner 125 may or may not rest on a bottom of the wellbore . prior to run - in , fluid , such as drilling mud , may be circulated to ensure that all of the cuttings have been removed from the wellbore . a surge reduction valve ( not shown ), if used , may be closed . circulation may then be established by pumping fluid , such as drilling mud , down the run - in string and up the liner annulus . the liner assembly 100 may be reciprocated and / or rotated during circulation . if auto - fill equipment ( not shown ) is used , it may be released . if a bottom wiper assembly ( not shown ) is used , then the bottom plug may be launched . cement slurry 315 may then be pumped from the surface into the run - in string . the liner assembly 100 may be reciprocated and / or rotated during injection of the cement . a spacer fluid ( not shown ) may be pumped in ahead of the cement 315 . once a predetermined quantity of cement 315 has been pumped , a top plug 320 may be pumped down the run - in string using a displacement fluid 310 , such as drilling mud . the bottom plug may seat in the bottom wiper assembly , free the bottom wiper assembly from the setting tool , and land in the float collar / shoe . the diaphragm may then rupture or the valve may open due to a density differential between the cement and the circulation fluid and / or increased pressure from the surface . pumping of the displacement fluid 310 may continue and the top plug 320 may seat in the wiper body 151 , thereby closing the bore through the wiper body 151 ( fig3 a ). the displacement fluid 310 may have a density substantially less than the density of the cement , thereby placing the liner 125 in compression . a latch of the plug 320 may engage the profile 151 p and hydraulic pressure may fracture the shear screws 153 , thereby freeing the wiper assembly 150 and the plug 320 . the wiper / plug 150 , 320 may then be pumped down the liner 125 , thereby forcing the cement 315 through the liner and out into the liner annulus . pumping may continue until the wiper / plug 150 , 320 seat against a landing or float collar ( not shown ), thereby indicating that the cement 315 is in place in the liner annulus . the pressure may then be increased until the rupture disk 216 in the isolation valve 200 fractures , thereby moving the piston 205 and allowing the flapper 213 to close ( fig3 b ). the flapper 213 may isolate the mandrel bore from the liner bore . pressure may then be increased to fracture the shear screws 14 b and operate the pistons 11 a , b , thereby pushing the expander assembly 25 through the expandable liner hanger 105 ( fig3 c ). once the hanger 105 is expanded into engagement with the previously installed casing or liner 305 , the latch assembly 50 may be released from the liner assembly 105 and the setting tool 1 removed ( fig3 d ). before retrieval to the surface , the setting tool 1 may be raised and fluid , such as drilling mud , may be reverse circulated ( not shown ) to remove excess cement above the hanger before the cement sets . fig4 is a cross - section of an isolation valve 400 , according to another embodiment of the present invention . the isolation valve 400 may be used instead of the isolation valve 200 . the isolation valve 400 may include one or more housings 401 , 409 , 412 , 416 , 419 , 422 , one or more seals , such as o - rings 402 , 403 , 405 , 408 , 420 , one or more plugs 404 , one or more frangible members , such as shear screws 413 , one or more pistons 406 , 410 , an actuator 414 , a retaining rod 415 , a choke 407 , one or more nuts 417 , one or more locator rings 418 , a valve member , such as a flapper 421 , and one or more biasing members , such as springs 411 , 424 , and 218 ( see fig2 b ), one or more check valves 423 , and one or pins 217 , 219 ( see fig2 a and 2b ). a top of the piston 405 may be in fluid communication with a bore of the housings 401 , 416 via fluid path 430 defined between the housings 401 , 416 . a chamber housing spring 411 may be in fluid communication with the liner annulus via vent 432 . a hydraulic fluid , such as oil , may be disposed between a shoulder 406 s of the piston 406 and a top of the piston 410 . the housing 409 may include fluid ports 409 a , b longitudinally formed therethrough . the fluid ports 409 a , b may provide limited fluid communication between an upper hydraulic chamber formed between the shoulder 406 s and a top of the housing 409 and a lower hydraulic chamber formed between a bottom of the housing 409 and the top of the piston 410 . the check valve 423 may be disposed in the path 409 b and operable to prevent flow of the hydraulic fluid from the upper hydraulic chamber to the lower hydraulic chamber and allow flow from the lower hydraulic chamber to the upper hydraulic chamber . the choke 407 may be disposed in the path 409 a and operable to restrict hydraulic flow from the upper hydraulic chamber to the lower hydraulic chamber . the choke 407 may also restrict flow from the lower hydraulic chamber to the upper hydraulic chamber but this restriction may be negated by the open check valve 423 . the piston 410 may be longitudinally coupled to the piston 406 by incompressibility of the hydraulic fluid . a bottom of the piston 410 may be in fluid communication with the liner annulus via the vent 432 . the piston 410 may be biased toward the housing 409 by the spring 411 . the actuator 414 may be longitudinally coupled to the flapper 421 via the retaining rod 415 . the actuator 414 may be longitudinally coupled to the retaining rod 415 via the pins 217 . the retaining rod 415 may hold the flapper 421 in the open position . the flapper 421 may be biased towards the closed position by the spring 218 disposed on a mount , such as the pin 219 . the actuator 414 may be longitudinally coupled to the housing 416 by the shear screws 413 . fig4 a - c illustrate operation of the isolation valve 400 . once pressure in the bore of the housings 401 , 416 exceeds pressure in the liner annulus by an amount sufficient to overcome the bias of the spring 411 ( threshold pressure ), the piston 406 begins to move longitudinally downward toward the housing 409 ( fig4 a ). since movement of the piston is dampened by the choke 407 , the increased pressure must be sustained for a predetermined period of time , else once the pressure is reduced , the biasing member will return the piston 406 to the position of fig4 a . once sustained threshold pressure has been applied to the top of the piston 406 , a bottom of the piston 406 abuts a top of the actuator 414 and fractures the shear screws 413 ( fig4 b ). pressure may be then reduced to the annulus pressure or relieved at the surface , thereby allowing the spring 411 to return the piston 406 to the position of fig4 a . the spring 424 may then longitudinally move the actuator 414 and retaining rod 420 longitudinally upward away from the flapper 421 , thereby releasing the flapper and allowing the spring 218 to close the flapper ( fig4 c ). the choke 407 may time the movement of the piston 406 so that threshold pressure must be sustained for the piston to reach the actuator 414 . for example , when running the liner assembly 100 into the wellbore , a surge pressure may exceed the threshold pressure but may not be sustained to fully move the piston 406 . however , once the top plug 320 seats against the wiper 315 , then the threshold pressure may be applied for the sustained period . if pressure is relieved from the run - in string at the surface , the flapper 421 may allow annulus pressure to also be relieved . however , once pressure is reapplied to set the liner hanger 105 , the flapper 421 will close and isolate the liner 125 from setting pressure applied to the setting tool 1 . fig4 d illustrates an alternative embodiment of the isolation valve 400 . in this alternative , the piston 406 is initially longitudinally restrained by one or more frangible members , such as shear pins 455 . the shear pins 455 may keep the piston 406 from moving until a predetermined pressure has been reached . the shear pins 455 may avoid unintentional operation of the piston 406 during circulation and cementing operations . fig5 is a cross - section of an isolation valve 500 , according to another embodiment of the present invention . the isolation valve 500 may be used instead of the isolation valve 200 . the isolation valve may include one or more housings 501 , 510 , 512 , 513 , 518 , 521 , 524 one or more seals , such as o - rings 503 , 504 , 506 , 509 , 522 one or more plugs 505 , one or more frangible members , such as shear screws 514 , one or more pistons 507 , 511 , an actuator 515 , 516 , a retaining rod 517 , a choke 508 , one or more nuts 519 , one or more locator rings 520 , a valve member such as a flapper 523 , and one or more biasing members , such as springs 502 , 526 , and 218 ( see fig2 b ), one or more check valves 525 , and one or pins 217 , 219 of ( see fig2 a and 2b ). in operation , the spring 502 is used to slowly engage a release mechanism so the running of the liner and cementing of the liner can be completed before the valve closes . the actuator may include a head 516 and a ring 515 . the head 516 and the ring 515 may be longitudinally and rotationally coupled to the housing 518 by the shear screws 514 . the head 516 may be longitudinally coupled to the flapper 523 via the retaining rod 517 . the head 516 may be biased away from the flapper 523 by the spring 526 . the head 516 may be longitudinally coupled to the retaining rod 517 via the pins 217 . the retaining rod 517 may hold the flapper 523 in the open position . the flapper 523 may be biased towards the closed position by the spring 218 disposed on a mount , such as the pin 219 . a top of the piston 507 may be in fluid communication with a bore of the housings 501 , 518 via fluid path 530 defined between the housings 501 , 518 . a hydraulic fluid , such as oil , may be disposed between a shoulder 507 s of the piston 507 and a top of the piston 511 . the housing 510 may include fluid ports 510 a , b longitudinally formed therethrough . the fluid ports 510 a , b may provide limited fluid communication between an upper hydraulic chamber formed between the shoulder 507 s and a top of the housing 510 and a lower hydraulic chamber formed between a bottom of the housing 510 and the top of the piston 511 . the check valve 525 may be disposed in the path 510 b and operable to prevent flow of the hydraulic fluid from the upper hydraulic chamber to the lower hydraulic chamber and allow flow from the lower hydraulic chamber to the upper hydraulic chamber . the choke 508 may be disposed in the path 510 a and operable to restrict hydraulic flow from the upper hydraulic chamber to the lower hydraulic chamber . the choke 510 a may also restrict flow from the lower hydraulic chamber to the upper hydraulic chamber but this restriction may be negated by the open check valve 525 . the piston 511 may be longitudinally coupled to the piston 507 by incompressibility of the hydraulic fluid . the piston 507 may be biased longitudinally downward toward the housing 510 by the spring 502 . a chamber 535 between the housing 518 and the head 516 , a chamber 537 between the housings 513 , 518 , and a chamber 539 between the housing 512 and the piston 507 may be sealed at the surface with air at atmospheric pressure . in operation , once the isolation valve 500 is assembled , the spring 502 may begin to move the piston 507 longitudinally downward toward the flapper 523 . since movement of the piston 507 is dampened by the choke 508 , the piston 507 may require a predetermined period of time before a bottom of the piston 507 abuts a top of the ring 515 and fractures the shear screws 514 . the predetermined period may be selected so the liner assembly 100 may be run into the wellbore and cemented before the flapper 523 closes . alternatively , the spring 502 may be omitted and fluid pressure exerted on a top of the piston via flow path 530 may be used to operate the piston 507 . fig6 is a cross - section of an isolation valve 600 , according to another embodiment of the present invention . the isolation valve 600 may be used instead of the isolation valve 200 . the isolation valve 600 may include one or more housings 601 , 607 , 610 , 612 , 617 , 620 , 623 , 630 , a pick 602 , one or more seals , such as o - rings 604 , 605 , 608 , 611 , 621 , one or more plugs 606 , one or more frangible members , such as shear screws 613 and rupture disk 603 , one or more pistons 609 , an actuator 614 , 615 , a retaining rod 616 , one or more nuts 618 , one or more locator rings 619 , a valve member such as a flapper 622 , one or more biasing members , such as springs 624 , 218 ( see fig2 b ), one or pins 217 , 219 ( see fig2 a and 2b ), and an electronics package 650 . the actuator may include a head 615 and a ring 614 . the head 615 and the ring 614 may be longitudinally and rotationally coupled to the housing 617 by the shear screws 613 . the head 615 may be longitudinally coupled to the flapper 622 via the retaining rod 616 . the head 615 may be biased away from the flapper 622 by the spring 624 . the head 615 may be longitudinally coupled to the retaining rod 616 via the pins 217 . the retaining rod 616 may hold the flapper 622 in the open position . the flapper 622 may be biased towards the closed position by the spring 218 disposed on a mount , such as the pin 219 . an upper chamber between housings 601 and 630 , an intermediate chamber between a bottom of the housing 606 and a top of the piston 609 , and a lower chamber between a shoulder 609 s of the piston 609 and a top of the housing 612 may be sealed at the surface with air at atmospheric pressure . the housing 606 may have a first fluid port 606 a extending radially and longitudinally between a bore therethrough to the upper chamber . the rupture disk 603 may seal the first fluid port 606 a . the housing 606 may further have a second fluid port 606 b longitudinally extending therethrough between the upper and intermediate chambers . the housing 617 may have a vent 632 formed radially therethrough providing fluid communication between a bore formed therethrough and a chamber 635 between the housing 617 and the head 615 . the chamber 635 may be in fluid communication with a chamber 637 between the housings 612 , 617 via flow path 634 formed between ring 614 and housing 617 . fig6 a illustrates the electronics package 650 . the electronics package 650 may include a pressure sensor 652 , a signal amplifier 654 , a noise filter 656 , a signal detector 658 , a microprocessor 660 , a battery pack 662 , and a solenoid 664 . pressure pulses transmitted from the surface to the isolation valve 600 via the run - in string may be transformed by the pressure sensor 652 into an electrical signal . the electrical signal may then be amplified by the signal amplifier 654 and filtered by the noise filter 656 . the filtered signal may then be demodulated by the signal detector 658 into a format usable by the microprocessor 660 . the demodulated signal may be analyzed by the microprocessor 660 to determine if the signal matches a predetermined instruction signal for closing the flapper 622 . if so , then the microprocessor may energize the solenoid , thereby longitudinally moving the pick 602 to fracture the rupture disk 603 . the pick 602 may then be retracted from the fractured rupture disk 603 by a spring ( not shown ) or reversing polarity to the solenoid . once the rupture disk 603 has been fractured , circulation fluid from the bore of the isolation valve 600 may flow through the port 607 a into the upper chamber . fluid may then flow from the upper chamber through the port 607 b into the intermediate chamber , thereby moving the piston 609 longitudinally downward toward the flapper 622 . since lower chamber was sealed at the surface , minimal pressure may be exerted on the shoulder 609 s . the piston 609 may move until a bottom of the piston 609 abuts the ring 614 and fractures the shear screws 613 , thereby releasing the head 615 . the spring 624 may then move the head 615 ( and the rod 616 ) longitudinally upward away from the flapper 622 , thereby releasing the flapper . the spring 218 may then close the flapper 622 , thereby fluidly isolating the liner 125 from the setting tool 1 . the setting tool 1 may then be operated and the liner hanger 105 expanded . fig6 b illustrates surface equipment for generating pressure pulses . the pressure pulses may be generated at the surface using the displacement fluid 310 . the displacement fluid 310 may be stored in a surge tank 677 . the surge tank 677 may include a fluid barrier , such as a diaphragm 678 , separating a chamber of the tank 677 into a displacement fluid chamber and a gas chamber . a fluid line 684 may be in communication with a mud pump of the rig to fill the displacement fluid chamber . a gas line 682 may be in fluid communication with a gas source , such as a portable cylinder , and include a pressure regulator for filling and maintaining the gas chamber at a predetermined pressure . the gas 679 may be nitrogen . the pressure pulses may be applied and released from a bore of the run - in string 685 after the top plug 320 and the wiper 325 have landed in the float or landing collar . the pressure pulses may be generated by opening an inlet control valve , such as a solenoid operated ball valve 680 i , thereby providing fluid communication between the displacement fluid chamber of the surge tank 677 and the run - in string 685 . the valve 680 i may be electrically , pneumatically , or hydraulically operated . after a predetermined period of time , the valve 680 i may be closed while opening an outlet control valve 680 o , thereby relieving fluid pressure from the run - in string to a mud pit or tank ( not shown ) of the rig . control of the valves 680 i , o may be performed by a computer or programmable logic controller ( plc ) 690 located at the surface to generate the predetermined instruction signal to close the isolation valve 600 . fig6 c illustrates the computer / plc 690 . the computer / plc may be disposed in an operator interface ( not shown ), such as a console . the interface may include indicator lights r , g to provide visual feedback to the operator . a first light , such as a green light g , may indicate that the computer / plc is ready to transmit the instruction signal . the console may further include a pushbutton operable to signal the computer to begin transmission of the instruction signal . a second light , such as a red light r , may indicate that the computer is transmitting the instruction signal . the computer / plc 690 may be in electrical communication with solenoids of the valves 680 i , o . alternatively , instead of mud pulse , the electronics package 650 may include an electromagnetic ( em ) receiver or transceiver ( not shown ) or any other wireless telemetry system . an em telemetry system is discussed in u . s . pat . no . 6 , 736 , 210 , which is hereby incorporated by reference in its entirety . fig7 is a cross - section of a portion of a setting tool 700 and a liner assembly , according to another embodiment of the present invention . the remaining portion of the setting tool 700 and liner assembly may be similar to the setting tool 1 and liner assembly 100 except that the pbr 710 may be moved to between the expandable liner hanger and the run - in string and the isolation valve 200 may be omitted . the setting tool 700 may include a mandrel 703 , a piston 711 , a damping chamber 714 , a choke 716 , an atmospheric chamber 718 , a piston actuator , and an expander assembly 725 . the mandrel 703 may be a tubular member including a threaded coupling for connecting to the run - in string 685 and a longitudinal bore therethrough . although shown as one piece , the mandrel 703 may include a plurality of pieces connected by threaded connections and seals to facilitate manufacture and assembly thereof . the piston 711 may be a tubular member having a longitudinal bore therethrough . although shown as one piece , the piston 711 may include a plurality of pieces connected by threaded connections to facilitate manufacture and assembly thereof . the piston 711 may be disposed between inner and outer walls of the mandrel 703 . the piston 711 may include a head formed at a top thereof . one or more seals , such as o - rings , may be disposed between an inner surface of the head and the inner wall and between an outer surface of the head and the outer wall . the chambers 714 , 718 may be formed between the piston 711 and the outer wall of the mandrel 703 . the mandrel may include a partition dividing the chambers 714 , 718 . a seal , such as an o - ring may be disposed between the piston 711 and the partition . one or more chokes 716 may be disposed in the partition . the chokes 716 may provide limited fluid communication between the chambers 714 , 718 , thereby damping longitudinal movement of the piston . the chambers 714 , 718 may be sealed at the surface under atmospheric pressure . the damping chamber 714 may be filled with a hydraulic fluid , such as oil . the atmospheric chamber 718 may be filled with a gas , such as air . the expander assembly 725 may include an actuator 726 , one or more frangible members , such as shear screws 727 , a pusher 728 , a mandrel 729 , a collet 730 , a biasing member , such as a spring 731 , one or more retainers 732 , and a spacer 733 . the expander mandrel 729 may be tubular and disposed along an outer surface of the setting mandrel 703 so that the expander mandrel is longitudinally movable relative to the setting mandrel 703 . the expander mandrel may include a shoulder formed at a bottom thereof . the collet 730 may be disposed along an outer surface of the expander mandrel and include a base ring formed at a bottom thereof . the spring may be disposed between the base ring and the expander mandrel shoulder , thereby biasing the collet 730 longitudinally away from the expander mandrel shoulder . the collet 730 may include a plurality of radially split cones 730 c each extending longitudinally from the base ring . the cones 730 c may be radially split so that the cones may be radially movable between an expanded position ( shown ) and a retracted position . an inner surface of the cones 730 c may be held in the expanded position by abutment with the spacer 733 . an outer surface of the cones may abut the liner hanger 705 . a top of the cones 730 c may abut a bottom of the pusher 728 . the spacer 733 may be longitudinally coupled to the actuator 726 by one or more fasteners , such as screws . the pusher 728 may be longitudinally coupled to the actuator 726 by the shear screws 727 . the actuator 726 may be tubular and have a head formed at a top thereof . the actuator may further have one or more windows formed through a wall thereof . one of the retainers 732 may be disposed through each window . each retainer may be received by a groove formed in an outer surface of the expander mandrel and fastened to the expander mandrel . each retainer may also be disposed through a respective opening formed through a wall of the pusher . the retainers may be blocks and longitudinally couple the pusher to the mandrel . the windows may be sized to allow relative longitudinal movement of the actuator relative to the blocks should the shear screws fail . the collet 730 may have a recessed inner surface formed between the base ring and the cones 730 c for receiving a lower portion of the actuator and the spacer 733 should the shear screws fail . the bottom shoulder of the piston may also include a recessed inner surface for receiving an upper portion of the expander mandrel should the shear screws fail . the actuator head may abut the bottom shoulder of the piston 711 . in operation , longitudinal movement of the piston 711 may push the expander assembly 725 downward along the hanger 705 , thereby expanding the hanger into engagement with the previously set liner / casing . if the annulus between the hanger 705 and the liner / casing is sufficient , the hanger 705 may expand as forced by the expanded cones 730 c . however , if the annulus is insufficient , the reaction force may increase to fracture the shear screws 727 . as shown in fig7 b , the actuator 726 and the spacer 733 may then be free to move longitudinally relative to the rest of the expander assembly , thereby moving the spacer 733 from the inner surface of the cones and replacing the spacer 733 with the outer surface of the actuator 726 which may have a reduced outer diameter . the reduced outer diameter may allow the cones to move radially inward to the retracted position . movement of the actuator 726 may continue until a lower surface of the actuator head abuts a top of the pusher 728 , thereby resuming movement of the expander assembly 725 downward through the hanger 705 . the reduced outer diameter of the cones 730 c may reduce the expanded outer diameter of the hanger 705 which may suitable for the smaller annulus . as illustrated in fig7 c , after expansion of the liner hanger 705 into engagement with an existing casing 735 or at some other point during operation of the setting tool 700 , when the expander assembly 725 is removed from the liner assembly the cones 730 c are operable to collapse into an even further reduced outer diameter configuration . the spacer 733 may be releasably coupled to the actuator 726 by one or more frangible members , such as shear screws 734 . the cones 730 c , which are seated on the outer surface of the actuator 726 , may be forced against the end of the spacer 733 to shear the shear screws 734 and allow the cones 730 c to move relative to the actuator 726 . the cones 730 c may then be moved off of the actuator 726 outer surface until the cones 730 and the spacer 733 are seated on the outer surface of the mandrel 729 , thereby further reducing the outer diameter of the cones 730 c . in one embodiment , during retrieval of the expansion assembly 725 , a restriction , such as an inner diameter shoulder of a component of the liner assembly or a narrowed inner diameter portion of the existing casing 735 may engage the cones 730 c and obstruct passage theretherough . an upward or pull force applied to the run - in string and / or the mandrel 703 may cause a reaction force to be applied to the cones 730 c against the restriction . the reaction force may be transferred through the cones 730 c and applied to the spacer 733 until the shear screws 734 release engagement with the actuator 726 . the reaction force may then move the cones 730 c and the spacer 733 relative to the actuator 726 onto the outer surface of the mandrel 729 , thereby reducing the outer diameter of the cones 730 c and allowing the expander assembly 725 to be moved past the restriction . fig7 a is an enlarged view of the piston actuator . the piston actuator may include the electronics package 650 , one or more heating coils 706 , one or more ports 708 , one or more retainers , such as fusible rods 715 , and a plug 712 . the ports may provide fluid communication between the wellbore and a first chamber formed in the mandrel 703 . the plug may be disposed in a passage between the first chamber and a second chamber in communication with a top of the piston head . the second chamber may be sealed at the surface under atmospheric pressure and be filled with a gas , such as air . one or more seals , such as o - rings , may be disposed between each plug and the passage . each plug may be longitudinally restrained in the passage by a respective rod . in operation , when the electronics package detects an instruction signal from the surface , the microprocessor may supply electricity to the heating coil , thereby heating the rod . the increased temperature of the rod may weaken the rod until hydrostatic pressure exerted on a top of the plug fractures the rod , thereby freeing the plug . the plug may be pushed into the second chamber by wellbore fluid , thereby opening the passage . wellbore fluid may enter the second chamber through the open passage and exert hydrostatic pressure on the top of the piston head , thereby longitudinally moving the piston downward toward the expander assembly . the piston head may push the oil through the choke 716 and into the atmospheric chamber 718 , thereby controlling a rate of movement of the piston . as discussed above , movement of the piston may operate the expander assembly 725 , thereby setting the hanger 705 . cementing may occur as discussed above in relation to fig3 a - 3d . since the mud pulse signal can be varied , several difference devices can be operated down hole each with a unique signal , e . g . a surge reduction valve ( see u . s . pat . no . 6 , 834 , 726 , which is hereby incorporated by reference in its entirety ) that allows for faster run in of the liner before cementing can be closed prior to cementing ; setting the liner hanger with a vacuum operated jack system — note several vacuum chambers can be operated in series if the hydrostatic pressure is too low for a single vacuum chamber jack to set the liner hanger ; releasing the running tool from the liner hanger after the liner hanger is set ; etc . fig8 a illustrates a radio - frequency identification ( rfid ) electronics package 800 , according to another embodiment of the present invention . fig8 b illustrates an active rfid tag 850 a . fig8 c illustrates a passive rfid tag 850 p . the rfid electronics package 800 may be used instead of the electronics package 650 in the isolation valve 600 and / or the electronics package 750 in the setting tool 700 . the electronics package 800 may communicate with a passive rfid tag 850 p or an active rfid tag 850 a . either of the rfid tags 850 a , p may be embedded in the top plug 320 so that the electronics package 800 may detect passage of the top plug 320 thereby . alternatively , either of the rfid tags may be embedded in a ball , plug , bar or some other device used to initiate the release of a downhole valve . the rfid electronics package 800 may include a receiver 802 , an amplifier 804 , a filter and detector 806 , a transceiver 808 , a microprocessor 810 , a pressure sensor 812 , battery pack 814 , a transmitter 816 , an rf switch 818 , a pressure switch 820 , and an rf field generator 822 . if the active rfid tag 850 a is used , the components 816 - 822 may be omitted . if a passive tag 850 p is used , once the isolation valve 600 or setting tool 700 is deployed to a sufficient depth in the wellbore , the pressure switch 820 may close . the pressure switch may remain open at the surface to prevent the electronics package 800 from becoming an ignition source . the microprocessor may also detect deployment in the wellbore using pressure sensor 812 . the microprocessor 810 may delay activation of the transmitter for a predetermined period of time to conserve the battery pack 814 . the microprocessor may then begin transmitting a signal and listening for a response . once the top plug is pumped into proximity of the transmitter 816 , the passive tag 850 p may receive the signal , convert the signal to electricity , and transmit a response signal . the electronics package 800 may receive the response signal , amplify , filter , demodulate , and analyze the signal . if the signal matches a predetermined instruction signal , then the microprocessor 810 may monitor pressure for a predetermined threshold indicative that the top plug 320 has seated against the wiper and / or wait a predetermined period for the top plug to seat . once the predetermined threshold is detected and / or the time period has passed , the microprocessor may close the isolation valve or operate the setting tool . if the active tag 850 a is used , then the tag 850 a may include its own battery , pressure switch , and timer so that the tag 850 a may perform the function of the components 816 - 822 . since the tags send out unique signals , multiple receivers may be used . for example one receiver may be used to close a surge reduction valve ; another receiver may start a sequence leading to the operation of the setting tool 700 to set the liner hanger and release the running tool . fig9 a is a sectional view of an expandable liner system 900 disposed in a wellbore 910 proximate a lower end of a string of casing 920 , according to another embodiment of the present invention . the system 900 may include a liner assembly 925 and an expander assembly 950 . the expandable liner system 900 may be run - into the wellbore 910 using the run - in string 685 . the wellbore section below the casing 920 may be drilled without an underreamer . the liner assembly 925 may be set in the casing 920 by positioning an upper portion of the liner assembly 925 in an overlapping relationship with a lower portion of the casing 920 . thereafter , the expansion assembly 950 may be employed to expand the liner assembly 925 into engagement with the casing 920 and the surrounding wellbore 910 . the liner assembly 925 may include a tubular section 930 at an upper end thereof and a shaped or a corrugated liner section 935 disposed at the lower end thereof . it must be noted that the shape or corrugation of the liner section 935 is optional such that the liner section 935 is substantially cylindrical . alternatively , the corrugated liner section 935 may be located at any position along the liner assembly 925 . a cross section of a suitable corrugated liner section may be found at fig2 g of u . s . pat . no . 7 , 121 , 351 , which is herein incorporated by reference in its entirety . the corrugated liner section 935 and the substantially cylindrical liner section 930 may be connected by a threaded connection or may be one continuous tubular body . the corrugated liner section 935 may be fabricated from a drillable material , such as aluminum or a pliable composite . the corrugated liner section 935 may have a folded wall having an initial inner diameter which may be reformed to define a larger second folded inner diameter and subsequently may be expanded to an even larger unfolded diameter . the corrugated liner section 935 may be folded or deformed prior to insertion into the wellbore 910 , to a non - tubular - shape , such as a hypocycloid , so that grooves are formed along the length of the corrugated liner section 935 . the grooves may be symmetric or asymmetric . the liner assembly 925 may further include a shoe 940 at the lower end thereof . the shoe 940 may be longitudinally coupled to the corrugated portion , such as by a threaded connection . the shoe 940 may be a tapered or bullet - shaped and may guide the liner assembly 925 toward the center of the wellbore 910 . the shoe 940 may minimize problems associated with hitting rock ledges or washouts in the wellbore 910 as the liner assembly 925 is lowered into the wellbore . an outer portion of the shoe 940 may be made from steel . an inner portion of the shoe 940 may be made of a drillable material , such as cement , aluminum or thermoplastic , so that the inner portion may be drilled through if the wellbore is to be further drilled . a bore may be partially formed longitudinally through the shoe 940 and in fluid communication with one or more ports radially formed through the shoe . a sleeve 970 may be disposed in the bore and longitudinally movable between an open position exposing the ports and a closed position covering the ports , thereby fluidly isolating the ports from the bore . the sleeve 970 may be restrained in the open position by one or more frangible members 972 , such as shear screws . alternatively , the sleeve may have one or more ports formed radially therethrough and aligned with the shoe ports in the open position . the sleeve may be restrained in the open position by the threaded coupling between the valve 1000 and the shoe 940 and biased toward the closed position by a spring . unthreading of the valve 1000 from the shoe 940 may release the sleeve , thereby allowing the spring to move the sleeve so that a solid portion of the sleeve covers the ports , thereby fluidly isolating the ports from the bore . the expander assembly 950 may be disposed in the liner assembly 925 . the expander assembly 950 may include a tubular mandrel 955 . an upper end of the mandrel 955 may be connected to the work string 685 by a threaded connection and a lower end of the mandrel 955 may be releasably connected to the shoe 940 , such as by a threaded connection . the mandrel 955 may have a bore 990 formed therethrough in fluid communication with the surface of the wellbore 910 via a bore of the run - in string 685 . the mandrel 955 may support the liner assembly 925 during run - in . the expander assembly 950 may further include a seal 960 longitudinally coupled to the mandrel 955 and engaged with an inner surface of the tubular portion 930 . the seal 960 may be fabricated from a pliable material , such as an elastomer . the seal 960 may act as a piston to move the expansion assembly 950 through the tubular section 930 upon introduction of fluid pressure below the seal 960 . additionally or alternatively , tension from the run - in string may 685 be used to move the expansion assembly 950 through the tubular section 930 . the expander assembly 950 may further include a two - position expander 975 . detailed views of a suitable two - position expander may be found at fig3 a and 3b of u . s . pat . no . 7 , 121 , 351 . the two - position expander may include a first assembly and a second assembly . the first assembly may include a first end plate and a plurality of first cone segments and the second assembly may include a second end plate and a plurality of second cone segments . each end plate may be substantially round and have a plurality of t - shaped grooves formed therein . each groove may match a t - shaped profile formed at an end of each cone segment . an outer surface of each cone segment may include a first taper and an adjacent second taper . the first taper may have a gradual slope to form the leading shaped profile of the two - position expander 975 . the second taper may have a relatively steep slope to form the trailing profile of the two - position expander 975 . the inner surface of each cone segment may have a substantially semi - circular shape to allow the cone segments to slide along an outer surface of the mandrel 955 . a track portion may be formed on each first cone segment . the track portion may be used with a mating track portion formed on each second cone segment to align and interconnect the cone segments . the track portions may be a tongue and groove arrangement . the first assembly and the second assembly may be urged longitudinally toward each other along the mandrel . as the first assembly and the second assembly approach each other , the first and second cone segments may be urged radially outward . as the first and second segments travel longitudinally along respective track portions , a front end of each second cone segment wedges the first cone segments apart , thereby causing the first shaped profiles to travel radially outward along the first shaped grooves of the first end plate . simultaneously , a front end of each first cone segment wedges the second cone segments apart , thereby causing the second shaped profiles to travel radially outward along the second shaped grooves of the second end plate . the radial and longitudinal movement of the cone segments continues until each front end contacts a stop surface on each end plate , respectively . in this manner , the two - position expander 975 is moved from a retracted position having a first diameter to an expanded position having a second diameter that is larger than the first diameter . fig1 is a cross section of an electric valve 1000 . the expander assembly may further include the valve 1000 . the valve 1000 may include a body 1005 having a bore 1010 therethrough . the body 1005 may include an upper sub 1021 , a lower sub 1022 , and a sliding sleeve 1025 disposed therebetween . the upper and lower subs 1021 , 1022 may include threaded couplings for connection to the mandrel 955 and shoe 940 , respectively . a series of ports 1015 may be formed through a wall of the body 1005 for fluid communication between the interior and the exterior of the valve 1000 . one or more seals 1030 may be provided to prevent leakage between the sleeve 1025 and the subs 1021 , 1022 . the sliding sleeve 1025 may be longitudinally movable relative to the body 1005 for selectively opening and closing the ports 1015 . the valve 1000 may further include an actuator 1045 for moving the sliding sleeve 1025 . the actuator 1045 may be a linear actuator . the valve may further include the rfid electronics package 800 for operating the actuator in response to instruction from a ball 995 having one of the rfid tags 850 p , a embedded therein . alternatively , the electronics package 650 may be used instead . the sub 1022 may include a ball seat 1040 disposed therein and longitudinally movable relative thereto for receiving the rfid ball 995 , thereby closing the bore 1010 and longitudinally moving a longitudinal end of the ball seat 1040 into engagement with the sleeve 970 . the expandable liner system 900 may be lowered into the wellbore 910 while receiving displaced wellbore fluid through the shoe 940 . alternatively or additionally , fluid may be circulated to remove debris from the wellbore . after the system 900 is positioned within the wellbore 910 , the rfid ball 995 may be pumped from the surface through the run - in string 685 and the bores 990 , 1005 to the seat 1040 . once the ball 995 has seated , fluid pressure may increase and cause the seat 1040 to push the sleeve 970 , thereby fracturing the shear screws 972 and closing the shoe ports . the rfid ball 995 may include instructions for the electronics package 850 to open the ports 1015 after a predetermined time sufficient to sufficient for the sleeve 970 to close the shoe ports and / or after detecting a pressure sufficient to close the sleeve 970 . fig9 b is a sectional view illustrating the reforming or unfolding of the corrugated liner 935 to form a launcher . the launcher may be formed to house the unactuated two - position - expander 975 prior to expanding the liner assembly 925 into contact with the wellbore 910 . the mandrel 955 may be released from the shoe 940 , such as by rotation of the mandrel from the surface . fluid may then be pumped from the surface through the bore 990 and into the liner assembly 925 via the open ports 1015 . as fluid pressure increases in the liner assembly 925 , the corrugated liner section 935 may start to reform or unfold from the folded diameter to the larger folded diameter due to the fluid pressure . in this manner , the launcher is formed in the liner assembly 925 . fig9 c is a sectional view of the expansion system 900 after positioning the two - position expander 975 in the launcher . after the launcher is formed , the fluid pressure below the seal 960 may be released by allowing fluid to exit through the tubular member 955 . the expander 975 may then be lowered into the launcher . the electronics package 850 may close the ports 1015 after a predetermined time sufficient to sufficient for the launcher to be formed and pressure to be relieved and / or after detecting the pressure sequence for forming the launcher and relieving pressure from the liner assembly . fig9 d is a sectional view of the expandable liner system 900 illustrating the expansion of the corrugated liner section 935 . once the ports 1015 have been closed , pressure in the bore 990 may be increased to activate a hydraulic actuator ( not shown ). the hydraulic actuator may move the expander 975 from the retracted position to the expanded position . the hydraulic actuator may be similar to any of the hydraulic actuators used in any of the isolation valves or setting tools discussed herein . the electronics package 850 may open the ports 1015 after a predetermined time sufficient for actuation of the expander 975 to the expanded position and / or after detecting pressure sufficient for actuation of the expander 975 to the expanded position . once the expander 975 has been moved to the expanded position and the ports 1015 have opened , additional fluid pressure may be introduced through the bore 990 and the ports 1015 and into the liner assembly 925 ( below the seal 960 ) to move the expander assembly 950 relative to the liner assembly 925 . the two - position expander 975 may expand the corrugated liner section 935 from the folded diameter to the unfolded diameter . during expansion , the two - position expander 975 may “ iron out ” the crinkles in the corrugated liner section 935 so that the corrugated liner section 935 is substantially reformed into its initial , substantially tubular shape . reforming and subsequently expanding allows further overall expansion of the corrugated liner section 935 than would be possible with a tubular shape . fig9 e is a sectional view of the expandable liner system 900 illustrating the expansion of the upper liner section 930 . additional fluid may be introduced through the bore 990 and the ports 1015 and into the liner assembly 925 ( below the seal 960 ) to continue the movement of the expansion assembly 950 relative to the liner assembly 925 until substantially the entire length of liner sections 930 , 935 are expanded into contact with the surrounding wellbore 910 and the casing 920 . fig9 f is a sectional view of the completed wellbore 910 . once the expander 975 has reached the bottom of the casing and expanded the overlapping liner into engagement with the bottom of the casing , the expander assembly 950 may be removed from the wellbore . a drill string ( not shown ) having a drill bit disposed on a lower end thereof may be deployed into the wellbore 910 and a lower portion of the liner 935 and the shoe 940 may be drilled through . drilling of the wellbore 910 may then be continued . cementing of the expanded liner assembly 935 may not be required . alternatively , cement may be employed ( before unfolding the corrugated portion and expanding the liner ) to seal an annulus formed between the liner sections 930 , 935 and the surrounding wellbore 910 . fig1 illustrates an alternative expansion assembly 1150 , according to another embodiment of the present invention . instead of the hydraulic actuator and valve 1000 used in the expansion assembly 950 , the expansion assembly may include an electric motor 1102 operated by the rfid electronics package 800 . the sleeve 970 may be replaced by a ball seat . the rfid ball 995 may then be pumped to the ball seat in the shoe . the electronics package 800 may then wait for the launcher to be formed and the expander 1175 to be moved into the launcher . the electronics package may then operate the motor 1102 . a portion of the expander 1175 may be longitudinally coupled to a gear ( not shown ), such as a worm gear , rotationally coupled to the motor 1102 such that rotation of the motor may move the portion of the expander longitudinally relative to another portion of the expander , thereby moving the expander between the retracted and expanded positions . alternatively , the corrugated portion 935 may be formed into the launcher using a lower cone ( not shown ) instead of or in addition to fluid pressure . such an expansion system is illustrated in fig5 a - d of the &# 39 ; 351 patent . the alternative expansion system may utilize a hydraulic actuator to drive the lower cone into the corrugate portion 935 similar to fig9 a - 9f or the electric motor 1102 . alternatively , the expansion system 550 illustrated in fig5 a - d of the &# 39 ; 351 patent may be used instead of the expansion systems 950 , 1150 and modified by replacing the hydraulic valve 555 with the electric valve 1000 in order to selectively open and close hydraulic ports 520 , 565 . a second actuator may be added to the electric valve and the ball seat 1040 may be replaced by the sleeve that closes port 565 in fig5 a - d of the &# 39 ; 351 patent . the second actuator may then move the sleeve to close the port . the first actuator 1045 and the ports 1015 may replace the ports 520 of the hydraulic valve 555 . the shoe 590 may be modified to include a ball seat for catching the rfid ball 995 . the rest of the operation of the modified expansion system may be similar to that of the expansion system 555 discussed and illustrated in the &# 39 ; 351 patent . fig1 is a half section of a portion of a setting tool 1200 , according to another embodiment of the present invention . the remainder of the setting tool 1200 may be similar to the setting tool 1 or the setting tool 700 except that the isolation valve 200 may be omitted . the setting tool 1200 may include a connector sub 1202 , a mandrel 1203 , a piston assembly 1210 a , a pump 1205 , and the electronics package 800 . the connector sub 1202 may be a tubular member including a threaded coupling for connecting to the run - in string 685 and a longitudinal bore therethrough . the connector sub 1202 may also include a second threaded coupling engaged with a threaded coupling of the mandrel 1203 . one or more fasteners , such as set screws may secure the threaded connection between the connector sub 1202 and the mandrel 1203 . the mandrel 1203 may be a tubular member having a longitudinal bore therethrough and may include one or more segments connected by threaded couplings . the piston assembly 1210 may include piston 1211 , sleeves 1212 , 1214 , housing 1215 , inlets 1216 , flow path 1209 , and ratchet assembly 1218 . the piston 1211 may be an annular member . an inner surface of the piston 1211 may engage an outer surface of the mandrel 1203 and may include a recess having a seal , such as an o - ring disposed therein . the inlet 1216 may be formed radially through a wall of the mandrel 1203 and provide fluid communication between a bore of the mandrel 1203 and an inlet of the pump 1205 . the sleeves 1212 , 1214 may be longitudinally coupled to the piston 1211 by threaded connections . a seal , such as an o - ring , may be disposed between the piston 1211 and the sleeves 1212 . each of the sleeves 1212 , 1214 may be a tubular member having a longitudinal bore formed therethrough and may be disposed around the mandrel 1203 , thereby forming an annulus therebetween . the housing 1215 may be a tubular member , disposed around the mandrel 1203 , and longitudinally coupled thereto by a threaded connection . the housing 1215 may also be disposed about a shoulder formed in or disposed on an outer surface of the mandrel 1203 . seals , such as o - rings , may be disposed between the housing 1215 and the mandrel 1203 and between the housing 1215 and the sleeve 1212 . an end of the sleeve 1212 may be exposed to an exterior of the setting tool 1200 . the end of the sleeve 1212 may further include a profile formed therein or fastened thereto by a threaded connection . the profile may mate with a corresponding profile formed on an outer surface of the ratchet assembly 1218 , thereby longitudinally coupling the ratchet 1218 and the sleeve 1212 when the piston 1211 is actuated . the sleeve profile may engage the ratchet profile by compressing a spring , such as a c - ring . the c - ring may then expand to lock in a groove of the sleeve profile . teeth formed on inner and outer surfaces of a lock ring of the ratchet assembly 1218 respectively engage corresponding teeth formed on an outer surface of the mandrel 1203 and an inner surface of a ring housing , thereby longitudinally locking the sleeve 1212 and thus the expander assembly 25 once the sleeve 1212 engages the ratchet assembly 1218 . the pump 1205 and the electronics package may be disposed in the housing 1215 . the housing 1215 may include an inlet providing fluid communication between an inlet of the pump and the mandrel inlet . the housing may include an outlet providing fluid communication between an outlet of the pump and the flow path 1209 . the flow path 1209 may be formed between a recessed outer surface of the housing 1215 and an inner surface of the sleeve 1212 . the flow path 1209 may provide fluid communication between an outlet of the pump 1205 and a top of the piston 1211 . in operation , one of the rfid tags 850 a , p may be embedded in the top plug 320 . when the top plug passes the electronics package 800 , the microprocessor may receive an instruction signal from the tag 850 a , p . the microprocessor 810 may then wait a predetermined period of time and / or detect a pressure indicative of seating of the top plug against the float collar / shoe . the microprocessor may then supply electricity from the battery pack 814 to an electric motor of the pump 1205 . the pump may intake the displacement fluid from the mandrel bore via inlet 1216 , pressurize the displacement fluid , and discharge the pressurized displacement fluid into the flow path 1209 , thereby longitudinally moving the piston 1211 and setting the hanger 105 . additionally , the microprocessor 810 may detect setting of the hanger 105 , such as by including a switch ( not shown ) in the ratchet assembly that is closed when the sleeve 1212 engages the ratchet assembly or a flow meter or stroke counter in the pump 1205 . once the microprocessor 810 detects setting of the hanger 105 , the microprocessor may cease the electricity supply to the pump 1205 and then intermittently supply and cease electricity to the pump 1205 , thereby creating pressure pulses that may be detected at the surface . alternatively , the microprocessor may intermittently supply and cease reversed polarity electricity to the pump , thereby reversing flow through the pump . if the latch 50 does not release upon application of pressure in the mandrel bore , then a ball may be dropped through the run - in string and the mandrel bore to the ball seat , thereby isolating the liner from the mandrel bore . pressure may then be further increased to release the latch . alternatively , the latch 50 may include an actuator , such as any of the actuators discussed above for the isolation valves , setting tools , or expanders , and the electronics package 650 . the microprocessor 660 may detect the pressure pulses and operate the actuator , thereby releasing the latch 50 and allowing the setting tool 1200 to be removed from the wellbore . instead of the electronics package 650 , the latch actuator may be in electrical communication with the microprocessor 850 via a wire ( not shown ) extending through a wall of the mandrel 1203 . fig1 a - d illustrate a cross - section of an isolation valve 1300 , according to one embodiment of the invention . the isolation valve 1300 may be used instead of the isolation valve 200 described above . the isolation valve 1300 may include an upper adapter 1305 , a lower adapter 1395 , one or more couplers 1335 , one or more housings 1310 , 1340 , 1360 , one or more seals , such as o - rings 1301 , 1302 , 1303 , 1306 , 1307 , 1308 , 1309 , 1311 , 1312 , 1313 , 1314 , an upper piston member 1345 , a lower piston member 1347 , one or more sleeves 1315 , one or more pins 1317 , 1319 , an upper retaining member 1320 , a lower retaining member 1325 , an upper seat 1321 , a lower seat 1327 , one or more valve members , such as a ball 1330 , and one or more biasing members , such as a spring 1350 , and one or more lug rings 1365 . fig1 a illustrates an open position of the isolation valve 1300 . the upper and lower adapters 1305 , 1395 may include cylindrical members having flow bores therethrough to provide fluid communication to the isolation valve 1300 . in one embodiment , the upper and lower adapters 1305 , 1395 include threaded ends configured to couple the isolation valve 1300 to the setting tool 1 and the wiper assembly 150 , respectively , as described above . in one embodiment , the isolation valve 1300 may be located in the setting tool 1 below the seal assembly 75 . the housing 1310 is coupled to the exterior surface of the upper adapter 1305 and the upper retaining member 1320 is coupled to the interior surface of the upper adapter 1305 , such that the sleeves 1315 are movably disposed between the housing 1310 and the upper retaining member 1320 . the sleeves 1315 may include cylindrically shaped bodies that are spaced apart and / or include grooves on their outer surfaces to provide fluid passages between the sleeves 1315 and the housing 1310 for fluid communication with one or more chambers 1329 disposed above the upper piston member 1345 . the upper and lower retaining members 1320 , 1325 are configured to retain the ball 1330 within the housing 1310 , as well as retain the upper and lower seats 1321 , 1327 into a sealed engagement with the outer surface of the ball 1330 , using one or more retainers 1323 ( shown in fig1 a - 2 ). the ball 1330 includes a spherical shape having a cylindrical bore disposed therethrough . the one or more pins 1317 may be connected to the ball 1330 and may extend into a slot in the sleeve 1315 . the one or more pins 1319 may be connected to the sleeve 1315 and may extend into an opening in the ball 1330 ( shown in fig1 b - 2 ). the sleeve 1315 , ball 1330 , and one or more pins 1317 , 1319 are configured to provide rotational movement of the ball 1330 upon relative axial movement of the sleeve 1315 , thereby opening and closing fluid communication through the bore of the isolation valve 1300 . as the sleeve 1315 moves relative to the ball 1330 , the pin 1319 moves the ball 1330 and uses the pin 1317 located in the slot of the sleeve 1315 as a pivot point to rotate the ball 1330 . the bore of the ball 1330 is rotated into and out of alignment with the bore of the isolation valve 1300 to open and close fluid communication therethrough . the lower end of the sleeve 1315 is coupled to the upper end of the upper piston member 1345 to allow limited relative movement therebetween and further permit the piston member 1345 to move the sleeve 1315 relative to the ball 1330 . the upper piston member 1345 is disposed within the housings 1310 , 1340 , which are connected together using the coupler 1335 , such as with threaded connections . the upper piston member 1345 is coupled to the lower piston member 1347 , such as with a threaded connection . the lower piston member 1347 includes an upper shoulder that engages the spring 1350 , which is retained at its opposite end by the housing 1360 , which is coupled to the lower end of the housing 1340 . the spring 1350 is surrounded by the housing 1340 and is located within a chamber 1353 that is in fluid communication with the bore of the isolation valve 1300 via an opening 1349 in the wall of the lower piston member 1347 . the lower piston member 1347 extends through the housing 1360 and is coupled to the lower adapter 1395 . a nozzle 1343 may be disposed in the bore of the isolation valve 1300 above the opening 1349 to restrict the flow fluid therethrough prior to communicating with the opening 1349 and to create a pressure differential across the upper and lower ends of the isolation valve 1300 . the upper piston member 1345 , the lower piston member 1347 , and the lower adapter 1395 are movable relative to the housings 1310 , 1340 , 1360 , and may be controlled using a j - slot arrangement that is provided between the housing 1360 and the lower piston member 1347 . the j - slot arrangement includes a channel 1363 machined in the inner wall of the housing 1360 . the channel 1363 is shown in fig1 a - 1 in a “ rolled - out ,” flattened orientation . this pattern is preferably formed three times in the wall of housing 1360 so that each complete j - slot cycle covers 120 degrees of arc of the inner surface of housing 1360 . the lower piston member 1347 includes a recessed shoulder that carries one or more rotatable lug rings 1365 . the lug rings 1365 include an annular ring base which carries a projecting lug portion thereon . fig1 a illustrates a first operational position of the isolation valve 1300 having both fluid pressure and flow through the bore of the isolation valve 1300 . as the isolation valve 1300 is pressurized , fluid pressure is communicated to the chambers 1329 , which generates a force ( greater than the spring 1350 force ) on the upper end of the upper piston member 1345 , thereby moving the upper piston member 1345 , the lower piston member 1347 , and the lug rings 1365 relative to the housing 1360 until a shoulder on the upper piston member 1345 abuts the coupler 1335 . the spring 1350 is compressed between the lower piston member 1347 and the housing 1360 , and the lug rings 1365 are moved in an extended portion of the channel 1363 to the position shown in fig1 a - 1 . a shoulder on the upper end of the upper piston member 1345 engages a shoulder on the lower end of the sleeves 1315 and moves the sleeves 1315 and thus the pins 1317 , 1319 to rotate the ball 1330 so that the bore of the ball 1330 permits fluid flow through the bore of the isolation valve 1300 . as illustrated in fig1 b , when the pressure in the isolation valve 1300 is reduced , the spring 1350 returns the lower piston member 1347 , the upper piston member 1345 , and the sleeves 1315 , so that the ball 1330 is rotated using the pins 1317 , 1319 into a closed position to prevent fluid flow through the bore of the isolation valve 1300 . the lower piston member 1347 moves the lug rings 1356 relative to the housing 1360 , and the lug rings 1356 are rotated and directed by the channel 1363 into the position shown in fig1 b - 1 , which may also stop the retraction of the spring 1350 . as illustrated in fig1 c , pressure may then be applied above and to the isolation valve 1300 to conduct another operation , such as actuation of the expander assembly 25 described above , without opening fluid communication through the bore of the isolation valve 1300 . the upper piston member 1345 is moved within a recess of the sleeve 1315 a limited distance relative to the sleeve 1315 until the lug rings 1365 are moved by the lower piston member 1347 and are rotated and directed by the channel 1363 into the position shown in fig1 c - 1 , which may prevent the upper piston member 1345 from moving the sleeves 1315 and potentially re - opening fluid communication through the isolation valve 1300 . as illustrated in fig1 d , when the pressure in the isolation valve 1300 is reduced or removed , the spring 1350 returns the upper piston member 1345 back to the position shown in fig1 b . however , the lower piston member 1347 moves the lug rings 1356 into the channel 1363 to the position shown in fig1 d - 1 . from the position illustrated in fig1 d - 1 , when the isolation valve 1300 is pressurized again , the lug rings 1365 will be directed into an extended portion of the channel 1363 ( similar to the position shown in fig1 a - 1 ) to permit movement of the sleeve 1315 via the upper and lower piston members 1345 , 1347 , thereby moving the ball 1330 and opening fluid communication through the bore of the isolation valve 1300 . the isolation valve 1300 can be opened and closed indefinitely by following this procedure . fig1 a - c illustrate a cross - section of an isolation valve 1400 , according to one embodiment of the invention . the isolation valve 1400 may be used instead of the isolation valve 200 described above . the isolation valve 1400 may include an upper housing 1410 , a lower housing 1420 , an upper mandrel 1430 , a lower mandrel 1440 , a retainer 1417 , one or more seals , such as o - rings 1403 , 1405 , 1407 , 1409 , 1411 , 1413 , one or more biasing members , such as a spring 1450 , a flapper valve insert 1460 , a flapper valve 1465 , an adapter 1470 , and one or more frangible members , such as shear screws 1475 . the upper mandrel 1430 may include a cylindrical body having a bore disposed therethrough and one or more check valves 1435 located through the body of the upper mandrel 1430 . the check valve 1435 may optionally include a removable plug 1437 to prevent fluid from escaping through the top end of the upper mandrel 1430 . the upper mandrel 1430 may be coupled to the upper end of the upper housing 1410 , which may also include a cylindrical body having a bore disposed therethrough . the retainer 1417 may include a snap ring disposed within the inner surface of the upper housing 1410 and may be operable to retain the upper mandrel 1430 within the upper housing 1410 . the lower mandrel 1440 is disposed in the upper housing 1410 and extends through the lower housing 1420 , and further includes a cylindrical body having a bore disposed therethrough that sealingly engages the upper mandrel 1430 . the lower mandrel 1440 includes a shoulder that sealingly engages the upper housing 1410 and has one or more check valves 1445 disposed through the wall of the shoulder . a chamber 1480 is formed between the bottom end of the upper mandrel 1430 , the inner surface of the upper housing 1410 , the outer surface of the lower mandrel 1440 , and the top end of the shoulder of the lower mandrel 1440 . the chamber 1480 is filled with a hydraulic fluid , such as silicon oil . the upper housing 1410 includes a shoulder at its lower end that sealingly engages the lower mandrel 1440 and the lower housing 1420 and has one or more check valves 1415 disposed through the wall of the shoulder . a chamber 1455 is formed between the bottom end of the shoulder of the lower mandrel 1440 , the inner surface of the upper housing 1410 , top end of the shoulder of the upper housing 1410 , and the outer surface of the lower mandrel 1440 . the chamber 1455 is filled with a hydraulic fluid , such as silicon oil . the check valve 1415 may be configured to allow some of the fluid to escape from the chamber 1455 as an increase in temperature may cause expansion of the fluid . the check valve 1445 may be configured to direct the fluid from the chamber 1455 into the chamber 1480 and prevent fluid flow in the reverse direction . the spring 1450 is housed in the chamber 1455 and is operable to telescope apart the lower mandrel 1440 and the upper housing 1410 . the lower housing 1420 is coupled to the upper housing 1410 , such as through a threaded connection , and includes a cylindrical body having a bore disposed therethrough . a recess in the inner surface of the lower housing 1420 is configured to retain the flapper valve insert 1460 , which supports the flapper valve 1465 and abuts the bottom end of the upper housing 1410 . the flapper valve insert 1460 and the flapper valve 1465 are further retained by the outer surface of the lower mandrel 1440 . the lower end of the lower mandrel 1440 is positioned to maintain the flapper valve 1465 in an open position , which includes a spring member configured to bias the flapper valve 1465 into a closed position when unrestrained . the lower mandrel 1440 is releaseably coupled to the adapter 1470 via the one or more shear screws 1475 below the lower housing 1420 . the adapter 1470 includes a solid cylindrical member that provides a closed end of the isolation valve 1400 and is operable to couple the isolation valve 1400 to a device , such as a dart 1490 ( shown in fig1 c ) or a cement plug . in operation , the isolation valve 1400 is coupled to the dart 1490 via the adapter 1470 . the dart 1490 and the isolation valve 1400 may then be dropped from the surface of a wellbore into the setting tool 1 , the liner assembly 100 , or the wiper assembly 150 located in the wellbore . the dart 1490 may guide the isolation valve 1400 into the setting tool 1 , the liner assembly 100 , or the wiper assembly 150 until a shoulder 1425 of the lower housing 1420 engages and seals on a seat , such as a shoulder disposed in the bore of the seat 95 , the seal assembly 75 , the wiper assembly 150 , or other similar component . in an optional embodiment , the isolation valve 1400 may also include a c - ring coupled to the outer surface of the lower housing 1420 that is operable to engage a corresponding shoulder or recess to secure the isolation valve 1400 within the setting tool 1 , the liner assembly 100 , or the wiper assembly 150 . in one embodiment , the upper end of the upper housing 1410 may include a tapered shoulder configured to engage and seal on a seat , such as a shoulder disposed in the bore of the seat 95 , the seal assembly 75 , the wiper assembly 150 , or other similar component . after the isolation valve 1400 is secured , pressure above the isolation valve 1400 may be applied against the top of the adapter 1470 to shear the shear screws 1475 and release the adapter 1470 and the dart 1490 from the lower mandrel 1440 and open fluid communication through the isolation valve 1400 . the release of the adapter 1470 and the dart 1490 from the lower mandrel 1440 allows the spring 1455 to move the lower mandrel 1440 to remove its lower end from preventing the flapper valve 1465 to bias into a closed position , as illustrated in fig1 b . the fluid in the chamber 1480 and the check valves 1435 , 1445 provide a configuration operable to delay the closure of the flapper valve 1465 after the adapter 1470 is released from the lower mandrel 1440 . as the chamber 1480 is collapsed between the upper mandrel 1430 and the lower mandrel 1440 , the fluid in the chamber 1480 is prevented from flowing into the chamber 1455 by the check valve 1445 but is allowed to be slowly dissipated through the check valve 1435 into the bore of the isolation valve 1400 . the pressure developed in the chamber 1480 after release of the lower mandrel 1440 may first release the plug 1437 from the flow path of the check valve 1435 to open fluid communication therethrough . as the fluid is ejected from the chamber 1480 , the portion of the fluid remaining in the chamber 1480 provides a resistance to the force of the spring 1450 and slows the movement of the lower mandrel 1440 . the sizing of the check valve 1435 may determine the rate at which the fluid is removed from the chamber 1480 and the sizing of the chamber 1480 may determine the amount of fluid which can be filled in the chamber 1480 . these two factors may be used to provide a predetermined timed resistance against the force of the spring 1450 to delay the movement of the lower mandrel 1440 away from the flapper valve 1465 and thus the closure of the flapper valve 1465 . during the time delayed closing of the flapper valve 1465 , the released adapter 1470 and dart 1490 may be directed through the remaining assembly , such as the liner assembly 100 , to facilitate removal of any remaining fluids , such as cement , from the assembly . as illustrated in fig1 c , the dart 1490 may include a c - ring 1493 and a seal 1495 , such as an o - ring , configured to engage and seal with the body 151 of the wiper assembly 150 , the operation of which may then begin as described above after engagement with the dart 1490 and during the time delayed closing of the flapper valve 1465 . after the flapper valve 1465 closes fluid communication through the isolation valve 1400 , pressure may then be applied above and to the isolation valve 1400 to conduct another operation , such as actuation of the expander assembly 25 described above , without opening fluid communication through the bore of the isolation valve 1400 . fig1 a is a sectional view of an expandable liner system 1500 disposed in a wellbore 1510 according to one embodiment of the invention . the expandable liner system 1500 may be run - into the wellbore 1510 using the run - in string 685 . the system 1500 may include a liner assembly 1525 and an expander assembly 1550 . in one embodiment , the expandable liner system 1500 may be located proximate a lower end of a string of casing and the liner assembly 1525 may be set in the casing by positioning an upper portion of the liner assembly 1525 in an overlapping relationship with a lower portion of the casing . thereafter , the expansion assembly 1550 may be employed to expand the liner assembly 1525 into engagement with the casing and / or the surrounding wellbore 1510 . the liner assembly 1525 may include a tubular section 1530 at an upper end thereof and a shaped or a corrugated liner section 1535 disposed at the lower end thereof . it must be noted that the shape or corrugation of the liner section 1535 is optional such that the liner section 1535 is substantially cylindrical . alternatively , the corrugated liner section 1535 may be located at any position along the liner assembly 1525 . a cross section of a suitable corrugated liner section may be found at fig2 g of u . s . pat . no . 7 , 121 , 351 , which is herein incorporated by reference in its entirety . the corrugated liner section 1535 and the substantially cylindrical liner section 1530 may be connected by a threaded connection or may be one continuous tubular body . the corrugated liner section 1535 may be fabricated from a drillable material , such as aluminum or a pliable composite . the corrugated liner section 1535 may have a folded wall having an initial inner diameter which may be reformed to define a larger second folded inner diameter and subsequently may be expanded to an even larger unfolded diameter . the corrugated liner section 1535 may be folded or deformed prior to insertion into the wellbore 1510 , to a non - tubular - shape , such as a hypocycloid , so that grooves are formed along the length of the corrugated liner section 1535 . the grooves may be symmetric or asymmetric . the liner assembly 1525 may further include a shoe 1540 at the lower end thereof . the shoe 1540 may be longitudinally coupled to the corrugated portion , such as by a threaded connection . the shoe 1540 may be a tapered or bullet - shaped and may guide the liner assembly 1525 toward the center of the wellbore 1510 . the shoe 1540 may minimize problems associated with hitting rock ledges or washouts in the wellbore 1510 as the liner assembly 1525 is lowered into the wellbore . an outer portion of the shoe 1540 may be made from steel . an inner portion of the shoe 1540 may be made of a drillable material , such as cement , aluminum or thermoplastic , so that the inner portion may be drilled through if the wellbore is to be further drilled . a bore may be partially formed longitudinally through the shoe 1540 and in fluid communication with the wellbore 1510 . the expander assembly 1550 may be disposed in the liner assembly 1525 . the expander assembly 1550 may include a tubular mandrel 1555 . an upper end of the mandrel 1555 may be connected to the run - in string 685 by a threaded connection and a lower end of the mandrel 1555 may be releasably connected to the shoe 1540 , such as by a threaded connection . the mandrel 1555 may have a bore formed therethrough in fluid communication with the surface of the wellbore 1510 via a bore of the run - in string 685 . the mandrel 1555 may support the liner assembly 1525 during run - in . the expander assembly 1550 may further include one or more seals 1560 longitudinally coupled to the mandrel 1555 and engaged with an inner surface of the tubular portion 1530 . the seals 1560 may be fabricated from a pliable material , such as an elastomer . the seals 1560 may act as a piston to move the expansion assembly 1550 through the tubular section 1530 upon introduction of fluid pressure below the seals 1560 . additionally or alternatively , tension from the run - in string may 685 be used to move the expansion assembly 1550 through the tubular section 1530 . the expander assembly 1550 may further include a piston member 1570 disposed between the tubular section 1530 and the mandrel 1555 and movable relative to the tubular section and the mandrel . as illustrated in fig1 a - 1 , the piston member 1570 may form one or more vacuum chambers 1513 and one or more piston chambers 1515 with the mandrel 1555 . one or more seals , such as o - rings 1511 , 1512 , and 1514 may be used to seal the chambers 1513 and 1515 . the mandrel 1555 may include a shoulder disposed on its outer surface having a flow path 1557 providing fluid communication between the bore of the mandrel 1555 and the piston chamber 1515 . a valve 1559 , such as a rupture disk , may be located in the flow path 1557 to control fluid communication to the piston chamber 1515 . the expander assembly 1550 may further include a valve 1600 having a member 1610 , such as a pick , configured to actuate the valve 1559 to open fluid communication between the mandrel 1555 bore and the piston chamber 1515 for actuation of the piston member 1570 . in one embodiment , the valve 1600 may include the electronics package 650 or the rfid electronic package 800 described above . the valve 1600 may be actuated using an active or passive rfid tag embedded in a device , such as a dart 1580 , shown in fig1 b , or using mud pulses received from the surface . in one embodiment , alternative means of operating the valve 1600 may include a spring force , a gas spring , or an electric motor . in one embodiment , actuation of the valve 1600 may cause the member 1610 , such as a pick , to fracture the valve 1590 , such as a rupture disk , thereby opening fluid communication between the bore of the mandrel 1555 and the piston chamber 1515 . the expansion assembly 1550 further includes a two - position expander 1575 and a cone 1577 . the cone 1577 is a tapered member that is operatively attached to the piston member 1570 , whereby movement of the piston member 1570 in relation to the liner assembly 1525 will also move the cone 1577 . adjacent to the cone 1577 is the two - position expander 1575 . during run - in , both the two - position expander 1575 and the cone 1577 are disposed adjacent an end of the corrugated liner section 1535 . detailed views of a suitable two - position expander may be found at fig3 a and 3b of u . s . pat . no . 7 , 121 , 351 . the two - position expander 1575 may include a first assembly and a second assembly . the first assembly may include a first end plate and a plurality of first cone segments and the second assembly may include a second end plate and a plurality of second cone segments . each end plate may be substantially round and have a plurality of t - shaped grooves formed therein . each groove may match a t - shaped profile formed at an end of each cone segment . an outer surface of each cone segment may include a first taper and an adjacent second taper . the first taper may have a gradual slope to form the leading shaped profile of the two - position expander 1575 . the second taper may have a relatively steep slope to form the trailing profile of the two - position expander 1575 . the inner surface of each cone segment may have a substantially semi - circular shape to allow the cone segments to slide along an outer surface of the mandrel 1555 . a track portion may be formed on each first cone segment . the track portion may be used with a mating track portion formed on each second cone segment to align and interconnect the cone segments . the track portions may be a tongue and groove arrangement . the first assembly and the second assembly may be urged longitudinally toward each other along the mandrel . as the first assembly and the second assembly approach each other , the first and second cone segments may be urged radially outward . as the first and second segments travel longitudinally along respective track portions , a front end of each second cone segment wedges the first cone segments apart , thereby causing the first shaped profiles to travel radially outward along the first shaped grooves of the first end plate . simultaneously , a front end of each first cone segment wedges the second cone segments apart , thereby causing the second shaped profiles to travel radially outward along the second shaped grooves of the second end plate . the radial and longitudinal movement of the cone segments continues until each front end contacts a stop surface on each end plate , respectively . in this manner , the two - position expander 1575 is moved from a retracted position having a first diameter to an expanded position having a second diameter that is larger than the first diameter . in operation , the expandable liner system 1500 may be lowered into the wellbore 1510 adjacent an area of interest , such as an end of an existing casing section . wellbore fluids may flow up through the bore of the mandrel 1555 and the run - in string 685 as the system 1500 is run into the wellbore 1510 . a dart 1580 may be dropped from the surface of the wellbore 1510 , directed through the expandable liner system 1500 , and seated in the shoe 1540 , thereby closing fluid communication between the wellbore 1510 and the bore of the mandrel 1555 . the dart 1580 may include an embedded rfid tag used to communicate with the valve 1600 . a radio frequency communication may be directed between the dart 1580 and the valve 1600 to actuate the valve 1600 and move the member 1610 to open the valve 1559 . the pressure in the bore of the mandrel 1555 may be increased and communicated to the piston chamber 1513 via the flow path 1557 to move the piston member 1570 . the piston member 1570 causes the two - position expander 1575 and the cone 1577 to move relative to the mandrel 1555 and the liner assembly 1525 , thereby allowing the cone 1577 to reform the corrugated liner section 1535 . the cone 1577 reforms the corrugated liner section 1535 and may engage a shoulder disposed on the outer surface of the mandrel 1555 or the end of the shoe 1540 , which prevents further movement of the cone 1577 . fluid pressure continues to be introduced into the piston chamber 1515 , thereby causing the two - position expander 1575 to move closer to the cone 1577 to begin the activating process . as the fluid pressure continues to urge the two - position expander 1575 against the cone 1577 , the first and second cone segments of the two - position expander 1575 move radially outward into contact with the surrounding liner 1535 ( actuation of the two - position expander 1575 was described above ). fig1 c illustrates the two - position expander 1575 expanding the corrugated liner section 1535 and the liner section 1530 . as shown , the two - position expander 1575 has expanded a portion of the liner section 1535 from the folded diameter to the unfolded diameter . in other words , during the expansion process , the two - position expander 1575 basically “ irons out ” the crinkles in the corrugated liner section 1535 so that the liner section 1535 is substantially reformed into its initial tubular shape . reforming and subsequently expanding allows further expansion of the liner section 1535 than was previously possible because the reformation process may not use up the 25 % limit on expansion past the elastic limit . subsequently , the expansion assembly 1550 is rotated in one direction to release the connection between the mandrel 1555 and the shoe 1540 and / or dart 1580 . at this point , the expansion assembly 1550 and the liner assembly 1525 are disconnected , thereby unlocking the one or more seals 1560 . as additional fluid pressure is introduced through the bore of the mandrel 1555 , the entire expansion assembly 1550 is moved relative to the liner assembly 1525 as fluid pressure acts upon seals 1560 . in this manner , substantially the entire length of liner sections 1530 and 1535 are expanded into contact with the surrounding wellbore 1510 . fig1 d illustrates the removal of the expander assembly 1550 from the liner assembly 1525 . as illustrated , a device 1590 , such as a ball , may be dropped from the surface of the wellbore 1510 and landed into a seat of the mandrel 1555 , thereby closing fluid communication between the bore of the mandrel 1555 and the surrounding annulus of the wellbore 1510 . pressure may then be increased in the expander assembly 1550 and used to collapse the two - position expander 1575 into an unexpanded ( reduced outer diameter ) position to facilitate removal of the expander assembly 1550 . the cone segments of the two - position expander 1575 may be retracted to provide a reduced outer diameter of the expansion assembly 1550 to allow the assembly to be removed from the liner assembly 1525 and / or the wellbore 1510 . fig1 c - 1 , 15 d - 1 , and 15 d - 2 illustrate an embodiment of the expander assembly 1550 having a release mechanism 1700 used to retract the two - position expander 1575 into an unexpanded position as stated above . the release mechanism 1700 is configured to retract the two - position expander 1575 into an unexpanded position using fluid pressure and / or mechanical rotation of the expander assembly 1550 . the release mechanism 1700 may be disposed between the two - position expander 1575 and the cone 1577 of the expansion assembly 1550 . the release mechanism 1700 may include an adapter 1710 coupled to the two - position expander 1575 at an upper end and rotatively coupled to a first inner mandrel 1715 via one or more screws 1719 . the screws 1719 may reside in a slot in the body of the adapter 1710 to allow relative axial movement between the adapter 1710 and the first inner mandrel 1715 . the adapter 1710 and the first inner mandrel 1715 may include cylindrical members having bores disposed through the bodies of the members . the first inner mandrel 1715 may similarly be coupled at its upper end to a mandrel 1717 , which is disposed between the two - position expander 1575 and the mandrel 1555 and is operable to facilitate make - up of the expander assembly 1500 and the release mechanism 1700 . the release mechanism 1700 may include an upper sleeve 1720 , a middle sleeve 1725 , and a lower sleeve 1730 , each comprising cylindrical members having bores located through the bodies of the members . the upper sleeve 1720 may abut a shoulder disposed on the outer surface of the adapter 1710 and may be releaseably coupled to the middle sleeve 1725 via one or more frangible members , such as shear screws 1721 . an opening 1731 is disposed through the body of the upper sleeve 1720 , which is in communication with a chamber formed between the upper sleeve 1720 and the middle sleeve 1725 . the chamber is sealed using one or more seals , such as o - rings 1754 , 1753 , 1756 , and 1752 . the chamber is also in communication with an opening 1733 disposed through the body of the first inner mandrel 1715 , which is further in communication with an opening 1734 disposed through the body of the mandrel 1555 and thus the inner bore of the expander assembly 1550 . when the inner bore of the expander assembly 1550 is pressurized , the fluid pressure is directed to the chamber via the openings 1734 , 1733 , 1731 , which then telescopes apart the upper sleeve 1720 and the middle sleeve 1725 to shear the shear screws 1721 and allow relative movement between the upper and middle sleeves . the pressure also telescopes apart the adapter 1720 and the upper and middle sleeves 1720 , 1725 relative to the first inner mandrel 1715 . as illustrated in fig1 c - 1 , a set of dogs 1735 may be located in a slot of the upper sleeve 1720 and may extend into recesses disposed on the outer surface of the first inner mandrel 1715 . the dogs 1735 may include a cylindrical member having one or more shoulder portions extending from the inner diameter and one or more recesses disposed on the outer diameter of the member . the dogs 1735 may be surrounded by the lower sleeve 1730 , which is coupled to the upper end of a lower housing 1760 . the lower sleeve 1730 engages the outer surface of the dogs 1735 adjacent the recesses disposed on the outer diameter of the dogs 1735 to prevent the dogs 1735 from releasing engagement with the first inner mandrel 1715 . the dogs 1735 are engaged with the first inner mandrel 1715 to prevent relative movement between the adapter 1710 ( via the upper sleeve 1720 ) and the first inner mandrel 1715 , thereby preventing retraction of the two - position expander 1575 . a guide member 1740 is coupled to the lower end of the upper sleeve 1720 to facilitate translation of the upper sleeve 1720 relative to the lower housing 1760 . the housing 1760 may be releasably coupled to a second inner mandrel 1750 via one or more frangible members , such as shear screws 1722 . the second inner mandrel 1750 may also be coupled to the first inner mandrel 1715 at one end and the cone 1577 at the opposite end . a seal , such as a packing element 1751 , may be disposed between the first inner mandrel 1715 , the second inner mandrel 1750 , and the mandrel 1555 . as illustrated in fig1 d - 1 , the device 1590 ( shown in fig1 d ) may close fluid communication through the expander assembly 1550 and allow the bore of the mandrel 1555 to be pressurized , which may be communicated to the chamber between the upper sleeve 1720 and the middle sleeve 1725 . the shear screws 1721 between the upper sleeve 1720 and the middle sleeve 1725 ( and the shear screws 1722 between the lower housing 1760 and the second inner mandrel 1750 ) have been sheared ( as described above ) and the middle sleeve 1725 is used to direct a shoulder portion on the inner diameter of the lower sleeve 1730 into the recesses on the outer diameter the dogs 1735 . this engagement allows the dogs 1735 to move radially outward away from the first inner mandrel 1715 . the upper sleeve 1720 directs the dogs 1735 axially relative to the first inner mandrel 1715 to allow the dogs to disengage from the recesses in the first inner mandrel 1715 and retract into the middle sleeve 1725 . when the dogs 1735 are disengaged from the first inner mandrel 1715 , the adapter 1710 may move downward relative to the first inner mandrel 1715 to retract and pull apart the two - position expander 1575 . the movement relative to the first inner mandrel 1715 may be stopped when the guide member 1740 abuts the upper end of the second inner mandrel 1750 . the expander assembly 1550 may then be removed from the wellbore with the two - position expander 1775 in the retracted position . as illustrated in fig1 d - 2 , the two - position expander 1575 may be retracted into an unexpanded position by rotation of the mandrel 1555 . rotation of the mandrel 1555 may be used to induce relative movement between the second inner mandrel 1570 and the lower housing 1760 and thus shear the shear screws 1722 therebetween . release of the shear screws 1722 allows the middle sleeve 1730 to move relative to the dogs 1735 , which may then retract into the middle sleeve 1730 and radially outward relative to the first inner mandrel 1715 as described above . relative movement between the upper sleeve 1720 and the first inner mandrel 1715 may allow the lower end of the upper sleeve 1720 to move the dogs 1735 out of the recesses in the first inner mandrel 1715 and release the engagement therebetween to allow retraction of the two - position expander 1775 into the unexpanded position . any of the above discussed setting tools and / or liner assemblies may be installed in a pre - drilled wellbore or drilled in using a drilling with liner operation . further , any of the above discussed setting tools may be used with a conventional liner hanger , discussed in the background section . further , any of the setting tool actuators may be used for the isolation valves and vice versa . while the foregoing is directed to embodiments of the present invention , other and further embodiments of the invention may be devised without departing from the basic scope thereof , and the scope thereof is determined by the claims that follow .	4
the following detailed description is exemplary in nature and is not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the following description provides a practical illustration for implementing exemplary embodiments of the invention . fig1 is a plan view with a partial section of a lead 10 including means for retention 15 according to one embodiment of the present invention . fig1 illustrates lead 10 including a lead body 12 , a connector 16 coupled to a proximal end 121 of the lead body 12 and an electrode 14 coupled to a distal end 122 of the lead body 12 ; a conductor 13 , extending within an outer sheath 11 , couples electrode 14 to connector 16 , in order to deliver electrical stimulation , and forms a lumen for slideably engaging a stylet 18 . means and materials for constructing such a lead are well known to those skilled in the art . fig1 further illustrates retention means 15 formed along an outer surface of lead body 12 in proximity to distal end 122 . according to embodiments of the present invention , retention means 15 allows insertion of lead body 12 through a vessel , for example a vessel 607 as illustrated in fig6 , while preventing retraction of lead body 12 within the vessel due to an interference of retention means 15 along a wall of the vessel that contacts lead body 12 . retention means according to some embodiments of the present invention extends along a length greater than or equal to approximately 1 mm and may be implemented along any portion of a lead body alone or in conjunction with other retention means ; further , retention means 15 may be an integral part of outer sheath 11 or may be formed on a separate collar fitted about lead body 12 , either in - line with or about outer sheath 11 . suitable materials for outer sheath 11 and retention means 15 include those that are biocompatible , examples of which include , but are not limited to , silicone and polyurethane . various embodiments of retention means include projections formed along retaining segments as illustrated in fig2 a – d and 4 a – 5 b . it should be noted that alternate embodiments include , but are not limited to , retaining segments extending around an entire circumference of a lead body and segments extending only about a portion of the circumference of the lead body . for example , a plurality of projections may lie in a line , single file , along a length of a retaining segment , as illustrated in fig2 a , or each individual projection may extend circumferentially about all or a portion of a retaining segment , as illustrated in fig2 c , or a plurality of projections may lie approximately side - by - side about all or a portion of a circumference , as illustrated in fig2 d . in some embodiments , retaining segments as a whole or just the projections may be formed of a bioadsorbable material , examples of which include those taught in lines 10 – 24 of u . s . pat . no . 6 , 173 , 206 . according to these embodiments , if a lead body is chronically implanted , the retaining segment or projections would remain intact long enough to hold the body in place for a period of time up to tissue encapsulation of the body ; this may facilitate extraction of a chronically implanted lead . one example of an appropriate bioadsorbable material , polydioxanone is described along with means for molding the material in u . s . pat . no . 4 , 490 , 326 , the teachings of which are incorporated by reference herein . fig2 a is an enlarged plan view of means for retention according to one embodiment of the present invention . fig2 a illustrates a retaining segment 380 including a plurality of barb - like projections 385 positioned in a single - file line along a length of the segment 380 ; each of the plurality of projections 385 include a length l and extend laterally from a lead body 312 toward a proximal end 321 at an angle 33 , which , according to some embodiments , is less than approximately 45 degrees . according to this embodiment of the present invention and various other embodiments illustrated herein length l is greater than approximately 100 microns . fig2 a further illustrates projections 385 as portions of a wall 387 forming retaining segment , having been lifted out of wall 387 according to one embodiment of the present invention . fig2 b illustrates an alternate retaining segment 30 extending along a length of lead body 312 and including tread - like projections 31 extending laterally from lead body 312 to form a textured surface adapted to engage a vessel wall , similar to , for example , a sole of a shoe designed to facilitate traction . according to some embodiments of the present invention , projections , i . e . 385 , 31 , are directly formed in outer surfaces , being integral with a bulk material underlying the surfaces , but , according to alternate embodiments , the projections are formed of separate materials either embedded in or adhered to these surfaces . alternative methods of forming examples of these embodiments will be described herein below . fig2 b further illustrates retaining segment 30 including a coating 36 , which is soluble in body fluids ; according to this embodiment , coating 36 fills in around projections 31 and remains intact temporarily , during positioning of lead body 312 , so that lead body 312 may be moved back and forth through a vessel if repositioning is necessary . suitable materials forming coating 36 are soluble in body fluids ( within a temperature range encompassing normal body temperature ), non - toxic , biocompatible and non - pyrogenic ; examples of such a material include sugar derivatives , such as mannitol and dextrose , salts , such as sodium chloride and potassium chloride , and polyvinylpyrrolidone ( pvp ). portions of u . s . pat . no . 4 , 827 , 940 teaching methods for forming and applying a mannitol solution are incorporated by reference herein . according to an alternate embodiment , a covering in the form of a thin wall tube may be deployed over retaining segment 30 in place of coating 36 . it should be noted that any of the embodiments described herein may include such a coating or a covering facilitating positioning of lead bodies . fig2 c is an enlarged plan view of means for retention according to another embodiment . fig2 c illustrates a retaining segment 300 coupled to a portion of lead body 312 and including a proximal end 3210 and a plurality of projections 310 , each of which extend around all or a portion of a circumference of lead body 312 and extend laterally from lead body 312 at angle 33 with terminal ends 311 of projections 310 directed toward proximal end 3210 . fig2 d is an enlarged partial section view of means for retention according to yet another embodiment of the present invention . fig2 d illustrates a retaining segment 350 including a plurality of fish scale - like projections 355 positioned side - by - side about a circumference of lead body 312 and along a length of segment 350 and including terminal ends 351 directed toward a proximal end 3215 . fig2 d further illustrates projections 355 as discrete elements embedded in an underlying surface 375 of segment 350 according to one embodiment of the present invention . fig2 d also illustrates , by way of a dashed line connecting projections 355 around a circumference , another embodiment in which embedded elements forming projections may be rings or portions of a coil circling a portion of or the entire circumference of segment 350 creating projections similar to projections 310 illustrated in fig2 c . according to further alternate embodiments , some or all projections of a retaining segment , for example projections 385 , 31 , 310 and 355 ( fig2 a – d ), each include micro - features further enhancing engagement of the projections with the vessel wall . in fig2 a such a feature is illustrated on one of projections 385 as a hole or indentation 25 ; in fig2 b such a feature is illustrated as a modified surface 26 on one of projections 31 wherein surface 26 includes texture , adhesive spots , or some material promoting thrombotic adhesion to vessel wall . methods for forming various embodiments of retaining segments , for example those depicted in fig2 a – d , include , but are not limited to , molding , extrusion , cutting , laser ablation , and coating . these methods may form projections directly in outer surfaces , such that they are integral with a bulk material underlying the surfaces , or may integrate the projections with the surface by embedding or adhering . according to some embodiments of the present invention , transfer or injection molding , using methods known to those skilled in the art , are used to form a retaining segment including projections , examples of which include those depicted in fig2 b – c . according to other embodiments , a cutting process may be used to create projections on a retaining segment , for example segment 380 illustrated in fig2 a ; a blade may be used to nick the surface or to cut all the way through a wall of the retaining segment . alternatively , laser ablation may be used to create projections from a bulk material of a retaining segment , i . e . fig2 b – c , or by exposing , at a surface of the segment , portions of materials which have been embedded within the bulk material underlying the surface during , for example , a molding or extrusion process , i . e . fig2 d . u . s . pat . no . 5 , 580 , 699 describes a suitable laser ablation process , which may be used to form retaining segments and the pertinent teachings of the &# 39 ; 699 patent are incorporated by reference herein . u . s . pat . no . 4 , 272 , 577 describes an extrusion process for forming ski bases having direction - dependent friction coefficients wherein harder particles , within a plastic matrix flowing through a slit nozzle , become obliquely oriented relative to the surface of the base ; in one case , by means of a temperature gradient across the nozzle . we contemplate that similar methods may be developed by those skilled in the art , according to the teachings of the &# 39 ; 577 patent , in order to extrude retaining segments according to the present invention , and incorporate by reference the pertinent teachings of the &# 39 ; 577 patent herein . some composite materials suitable for embodiments of the present invention include but are not limited to polyamide and polyimide particles , polyester fibers , carbon fibers or particles and any combination thereof blended with silicone . according to further alternate embodiments a coating applied to a surface of a retaining segment may form projections and or micro - features on projections , for example similar to those illustrated in fig2 b – c . stewart et al . describe an example of a suitable coating process via plasma deposition in commonly assigned u . s . pat . no . 6 , 549 , 811 , which is incorporated by reference in its entirety herein . furthermore coatings including particles blended within , for example a silicone medical adhesive including biocompatible metal particles or hard plastic particles may form an embodiment of the present invention for example similar to those illustrated in fig2 b and 2d . fig3 is a plan view of a lead 40 , which may incorporate retention means according to embodiments of the present invention . fig3 illustrates lead 40 including a proximal portion 43 , a first preformed bend 41 extending from proximal portion 43 to an intermediate segment 45 and a second preformed bend 42 extending from intermediate segment 45 to distal segment 46 , which is terminated by a tip 44 . such a lead is fully described in commonly assigned u . s . pat . no . 5 , 999 , 858 , which is herein incorporated by reference in its entirety . according to embodiments of the present invention , first and second bends 41 and 42 acting as means for retention of lead body in a coronary vessel , for example a coronary sinus 605 or a branch vessel 607 thereof illustrated in fig6 , are supplemented by any of the retaining segments described herein , which may be formed along the lead body surface at first bend 41 , intermediate segment 45 , second bend 42 , distal segment 46 , or any combination thereof . any other combination of bends within a lead body is within the scope of the present invention . fig4 a – b are partial plan views of one embodiment of lead 40 showing only a portion at first bend 41 , which includes a retaining segment formed by projections 51 . according to some embodiments of the present invention a retaining segment may be activated by a bending of a lead body as illustrated in fig4 a – b . if a stylet , for example stylet 18 shown in fig1 , is inserted into lead 40 to straighten preformed bend 41 , projections 51 become approximately parallel with an outer surface of lead 40 , as illustrated in fig4 a . once the stylet is removed preformed bend 41 reforms such that projections 51 protrude laterally and are thus activated to prevent rearward motion of lead 40 within a vessel . if it becomes necessary to reposition lead 40 , the stylet may be reinserted to straighten bend 41 thus bringing projections into approximate alignment with the surface of lead 40 . it should be noted that the embodiment illustrated in fig2 d may be of the type illustrated in fig4 a – b . fig3 further illustrates lead 40 including an anchoring sleeve 48 positioned about proximal portion 43 thereof . according to an additional embodiment of the present invention , means for retention as illustrated herein , may be formed along an outer surface of proximal portion to provide frictional forces complementing anchoring sleeve 48 at a venous entry point . the means for retention may either engage an inner surface of anchoring sleeve 48 or engage a vein wall in proximity to the entry point . fig5 a – b schematic views of a portion of a lead body including retention means according to yet another embodiment . fig5 a – b illustrate a lead body 20 including a plurality of hair - like projections or fibers 205 each attached at one end to lead body 20 and directed by their attachment points 23 to extend out from and along a length of body 20 toward a proximal end 221 of body 20 . according to the illustrated embodiment , as lead body 20 is advanced distally in a vessel 207 per arrow a , as in fig5 a , projections 205 are suspended proximally ; when lead body 20 is retracted proximally per arrow b , as in fig5 b , projections 205 are forced toward a distal end 222 of body 20 to become bunched up and wedged between body 20 and a wall of vessel 207 , thereby providing retention means for lead body 20 . projections may be formed from a bioadsorbable polymer , for example polyglyocolic acid or polylactic acid . alternately projections 205 may be formed from polyester fibers or some other material promoting thrombotic adhesion with the vessel wall to enhance retention within vessel 207 ; such thrombotic projections may include a non - thrombogenic coating adapted to dissolve after the lead is positioned per fig5 b , examples of which include a benzalkonium chloride - heparin solution and polyvinylpyrrolidone . projections 205 may be attached at attachment points 23 by embedment within lead body 20 or by adhesive attachment , for example by means of silicone medical adhesive . fig6 is a schematic view of an exemplary medical device , which may incorporate retention means according to embodiments of the present invention . fig6 illustrates the medical device including a therapy generator 600 coupled to a lead 60 implanted within branch vessel 607 emanating from coronary sinus 605 . lead 60 including a connector terminating a proximal portion 62 , an electrode in proximity to a distal end 66 and a conductor extending through an outer insulative sheath ( similar to lead 10 illustrated in fig1 ) may deliver electrical therapy , or may deliver infusions of therapeutic fluids from generator 600 through a central lumen . fig6 further illustrates potential retention segment sites 65 , 61 , and 63 along lead 60 where projections of retention segments according to embodiments of the present invention would engage a wall of vessels 605 and 607 to prevent rearward dislodgment of lead 60 from vessel 607 . although embodiments of the present invention are described in the context of therapy delivery , diagnostic devices adapted for insertion within a blood vessel may also incorporate retention means described herein and thus fall within the scope of the present invention . in the foregoing detailed description , the invention has been described with reference to specific embodiments . however , it may be appreciated that various modifications and changes can be made without departing from the scope of the invention as set forth in the appended claims .	0
the present invention is more readily understood through the following preferred embodiments : two types of nanochannel glass arrays developed at the naval research laboratory are used as high surface area nanoporous support structures to tether dna targets or probes for hybridization . ncg materials are unique glass structures containing a regular geometric array of parallel holes or channels as small as 33 nm in diameter or as large as several micrometers in diameter . see tonucci , r . j ., justus , b . l ., campillo , a . j . and ford , c . e . 1992 . science 258 : 783 - 785 . these nanochannel glass structures can possess packing densities in excess of 3 × 10 10 channels per square centimeter , fabricated in various array configurations . a variety of materials can be immobolized or fixed to the glass surfaces within the channels of the ncg array , to yield a high surface area to volume ratio . nanochannel glass arrays are fabricated by arranging dissimilar glasses in a predetermined configuration , where at least one glass type is usually acid etchable . construction of a two - dimensional hexagonal close packing array begins by insertion of a cylindrical acid etchable glass rod ( referred to as the channel glass ) into an inert glass tube ( referred to as the matrix glass ) whose inner dimensions match that of the rod . the pair is then drawn under vacuum to reduce the overall cross - section to that of a fine filament . the filaments are then stacked , re - fused and redrawn . this process is continued until appropriate channel diameters and the desired number of array elements are achieved . by adjusting the ratio of the diameter of the etchable glass rod to that of the outside dimension of the inert glass tubing , the center - to - center spacing of the rods and their diameters in the finished product become independently adjustable parameters . once the fabrication process is complete , the ncg material is wafered perpendicular to the direction of the channels with a diamond saw and then polished to produce 0 . 1 - 1 . 0 mm sections of material . the channel glass of the array structure is then etched away with an acid solution . a hexagonal close packing arrangement of channel glasses , after acid etching , contains typically 10 7 channels and is uniform throughout . the channel diameter is typically 450 nm and the center - to - center spacing is approximately 750 nm . the type of array structure described above is useful in the ncg array hybridization assembly in accordance with the present invention . in this configuration , the tapered sample well structure defines each group of channels serving as a specific hybridization test site . a second type of hexagonal array structure , in which separated clusters of channels are formed during the fabrication process , exhibits an open array structure with typical channel diameters of 300 nm . the overall glass structure consists of an array of 18 μm diameter subarrays , each serving to contain a specific dna probe or target , and spaced typically 25 μm apart from neighboring arrays . the ncg hybridization arrays described in example 1 are bonded on the upper side to a polymeric layer containing an array of orifices which align with the array of nanochannel bundles and serve as sample wells for placement of a substantially homogeneous sample of a biomolecule ( e . g ., a single dna species ) within each hybridization site . this polymeric sample well array also provides physical support to the fragile ncg wafer . the polymeric array of orifices are fabricated using methods known in the art . for example , this polymeric layer suitable for use herein can be obtained from microfab technologies , inc . the orifices are fabricated using excimer laser machining . this method is preferred because existing technology is employed allowing for low cost / high volume manufacturing , as is currently being done in the microelectronics industry . development of the polymeric array comprises four task : ( 1 ) materials selection ; ( 2 ) ablation tooling and process development ; ( 3 ) lamination tooling and process development ; and ( 4 ) production of high density and ultra - high density polymeric arrays . these tasks are undertaken as follows : the materials useful in the polymeric array are filled polymers , epoxy resins and related composite ( e . g ., “ circuit - board ”- type ) materials . because it is a standard process in the microelectronics industry , the present invention most advantageously employs polymeric materials with the adhesive applied by the commercial vendor of the material for example , a polyamide with a 12 μm thick layer of a b - stage ( heat curing ) adhesive the primary requirements for the polymeric array material to be used are : i . high absorption in uv ( e . g ., & gt ; 4 × 10 5 / cm at 193 nm ), ii . high laser etch rate ( e . g ., 0 . 5 μm / pulse ) and low hole taper ( reduction in hole diameter with depth into material , e . g ., & lt ; 3 °); 3 . obtainable with b - stage adhesive on one side which is both laser ablatable and suitable for bonding to the nanoporous wafer ; 4 . high rigidity and thermal stability ( to maintain accurate alignment of samplewell and ncg wafer features during lamination ); contact mask excimer laser machining is a preferred processing technique because it is a lower cost technique than projection mask excimer laser machining . a projection mask is , however , employed when the feature size less than 50 μm . one or more masks with a variety of pattern sizes and shapes are fabricated , along with fixtures to hold the mask and material to be ablated . these masks are employed to determine the optimal material for laser machining and the optimal machining conditions ( i . e ., mask hole size , energy density , input rate , etc .). scanning electron microscopy and optical microscopy are used to inspect the excimer laser machined parts , and to quantify the dimensions obtained , including the variation in the dimensions . in addition to ablating the sample wells into the polymeric material , the adhesive material is also ablated . this second ablation is undertaken so that the diameter of the hole in the adhesive is made larger than diameter of the sample well on the adhesive side of the polymeric material . this prevents the adhesive from spreading into the sample well and / or the nanoporous glass during lamination . initial lamination process development is carried out using unablated polymeric material ( or alternatively , using glass slides and / or silicon wafers ). cure temperature , pressure , and fixturing are optimized during this process development . thereafter , the optimized processing parameters are employed to laminate both nanoporous wafers and polymeric arrays . the final lamination is done such that the alignment of the two layers creates functional wells . the optimal mask patterns and excimer laser parameters are determined and thereafter employed in the manufacture of contact masks and material holding fixtures . typically , fabrication is done so as to produce a large number (& gt ; 100 ) of parts as the masks wear out with use ). two general types of porous silicon devices are prepared according to the process described herein . first , known microfabrication methods are used to fabricate wafers , bounded by integral sample wells . second , uniformity porous wafer structures are bonded to the same orifice sample well arrays that were described previously ( example 2 ) for ncg glass arrays . porous silicon designs are advantageously employed herein because of their adaptability to low cost mass production processes and their ability to incorporate in the fabrication process structural elements that function in fluidic entry and exit from the hybridization site and structures ( e . g ., electrodes ) that may function in hybridization detection . stable , open - cell porous materials are used to accomplish enhancements and to introduce qualitatively new features in these devices , whereby the surface area of discrete and isolated binding regions is increased by a factor of 100 to 1000 in hybridization - based electronic , fluorescence and radiation - based dna detectors . in accomplishing this objective , controlled introduction of high - surface - area supports at the surface detection site is employed . thin - film processing technology is used to deposit chemically inert and thermally stable microporous materials . materials and processing methods are selected to achieve low - cost semiconductor batch fabrication of integrated semiconductor detectors . the microchip device provides in situ multisite analysis of binding strength as ambient conditions are varied . porous silicon materials are fabricated in oriented , pore arrays or random interconnected networks and with pore diameters selected over the range from 2 nm to several micrometers . porous silicon is produced most easily through electrochemical etching . it can be processed into two important pore structures , interconnected networks and oriented arrays . the pore diameter is tailored from approximately 2 nm to micrometer dimensions by selection of doping and electrochemical conditions . for n - type material , etching is thought to proceed through a tunneling mechanism in which electrons are injected into the pore surface through field concentration effects . in the case of p - type material the mechanism seems to be through moderation of carrier supply at the electrolyte / silicon interface . in practice , the following structures can be fabricated : i ) a dense interconnected network layer with porosity of 40 - 60 % and silicon filament size in the nanometer size regime . this is most easily obtained in lightly doped (& lt ; 1 ω - cm resistivity ) p - type silicon . ii ) a interconnected branched network of pores of typically 10 - nm diameter , axis preferentially oriented along & lt ; 100 & gt ; direction , and porosity of 30 - 80 % depending on etching conditions . this is obtained in p - type material of 10 − 1 to 10 − 2 ω - cm resistivity . iii ) dense oriented arrays of pores oriented with axis along & lt ; 100 & gt ; direction and with pore diameters in the range of 10 to 100 nm . obtained in p - type material with resistivity less than 10 − 2 ω - cm . iv ) dense oriented arrays of pores oriented along & lt ; 100 & gt ; direction and with pore diameters in the range less than 10 nm . obtained in n - type material with resistivity between 10 − 1 and 10 − 2 ω - cm . v ) dense oriented arrays of rectangular pores oriented with axis along & lt ; 100 & gt ; direction , rectangle side defined by { 001 } planes , and with pore diameters in the range less than 100 nm . obtained in p - type material with resistivity between 10 − 1 and 10 − 2 ω - cm . vi ) low density interconnected networks of large ( 1 - μm - diameter ) pores . this occurs in lightly doped n - type material . characterization can be undertaken by scanning electron microscopy . the surface wetting properties are varied using vapor treatment with silylation materials and chlorocarbons . high - porosity dielectrics which function as molecular sieves are produced by nuclear track etching . while nuclear track etching is used to produce these molecular sieves in a wide range of inorganic materials , it is most often used with dielectrics such as mica and sapphire . in this method , described in u . s . pat . no . 3 , 303 , 085 ( price , et al . ), a substrate is first bombarded with nuclear particles ( typically several mev alpha particles ) to produce disturbances or “ tracks ” within the normal lattice structure of the material and then wet - etched to produce pores which follow the tracks caused by the nuclear particles . more specifically , price et al . disclose that the exposure of a mica substrate to heavy , energetic charged particles will result in the formation of a plurality of substantially straight tracks in its lattice structure and that these tracks can be converted into pores by wet etching the substrate . pore sizes and overall porosity are variably controllable with pores typically 0 . 2 μm in diameter and densities on the order of 10 9 / cm 2 . particle track depths are energy dependent on the incident particle beam , but resulting pores can be extended through an entire 500 - μm - thick substrate . incorporation of these materials on the device structures shown above is readily accomplished . in addition , the use of implantation - etched dielectrics as the sensor element has advantages versus the porous silicon approach since the material is hydrophilic . a preferred device is the porous silicon array wafer with integral sample wells illustrated in fig3 . this may be constructed as follows : a four inch diameter , 100 μm thick wafer of crystalline silicon ( n - type , doped with 10 15 p / cm 3 ) with axis oriented along & lt ; 100 & gt ; direction is coated with photoresist and exposed to light through a mask to define a 50 × 50 array of 200 μm square areas having 200 μm space between them across the 2 cm × 2cm central area of the wafer . the process described by v . lehmann ( j . electrochem . soc . 140 ( 100 ): 2836 - 2843 ( 1993 )) is then used to create patches of closely spaced pores of diameter 2 - 5 μm , oriented perpendicular to the wafer surface , within each square area defined in the photolithographic step . a 300 μm thick wafer of silicon dioxide is coated with photoresist and exposed to light through the same mask used to define 200 μm square porous regions in the silicon wafer , and acid etching is conducted to create 200 μm square holes in the silicon dioxide wafer . the silicon dioxide wafer is then aligned with and laminated to the porous silicon wafer using a standard wafer bonding process to form the integral structure shown in the figure . during the high temperature annealing step , the silicon surface of each pore is oxidized to form a layer of silicon dioxide . the epoxysilane - amine linkage procedure described in example 4 is then carried out to covalently attach amine - containing biopolymer species to the walls of the pores . a stock solution of epoxysilane is freshly prepared with the following proportions : 4 ml 3 - glycidoxypropyl - trimethoxysilane , 12 ml xylene , 0 . 5 ml n , n - diisopropylethylamine ( hunig &# 39 ; s base ). this solution is flowed into the pores of the wafer , then the wafer is soaked for 5 hours in the solution at 80 ° c ., then flushed with tetrahydrofuran , dried at 80 ° c ., and placed in a vacuum desiccator over drierrite or stored in a desiccator under dry argon . oligonucleotide , bearing 5 ′- or 3 ′- alkylamine ( introduced during the chemical synthesis ) is dissolved at 10 μm - 50 μm in water and flowed into the porous silica wafer . after reaction at 65 ° c . overnight the surface is briefly flushed with water at 65 ° c ., then with 10 mm triethylamine to cap off the unreacted epoxy groups on the surface , then flushed again with water at 65 ° c . and air dried . as an alternative to attachment in water , amine - derivatized oligonucleotides can be attached to epoxysilane - derivatized glass in dilute ( eg ., 10 mm - 50 mm ) koh at 37 ° c . for several hours , although a higher background of nonspecific binding of target sample dna to the surface ( independent of base pairing ) may occur during hybridization reaction . a hamilton microlab 2200 robotic fluid delivery system , equipped with special low volume syringes and 8 - position fluid heads , capable of delivering volumes of 10 - 100 nl at 500 μm xyz stepping and a few percent precision . using this equipment 40 - nl samples of biomolecules ( e . g ., dna , olgionucleotides and the like ) are placed into the wells of the high density ncg wafer . a piezoelectrically controlled substage custom fitted for the microlab 2200 permits xy positioning down to submicron resolution . for 1 - nl samples , custom fabricated needles are employed . the eight - needle linear fluid head is operated in staggered repetitive steps to generate the desired close spacing across the wafer . the system has a large stage area and rapid motion control , providing the capacity to produce hundreds of replicate hybridization wafers . methods are known in the art ( microfab technologies , inc .) for delivering sub - nanoliter microdroplets of fluids to a surface at submicron precision . a microjet system capable of delivering subnanoliter dna solutions to the wafer surface is employed as follows : for placement of dna into individual hybridization sites within ultra - high density wafers , with volumes of one nl ( corresponding to a 130 μm sphere or 100 μm cube ) commercially available dispensing equipment using ink - jet technology as the microdispensing method for fluid volume below is employed . the droplets produced using ink - jet technology are highly reproducible and can be controlled so that a droplet may be placed on a specific location at a specific time according to digitally stored image data . typical droplet diameters for demand mode ink - jet devices are 30 - 100 μm , which translates to droplet volumes of 14 - 520 pl . droplet creation rates for demand mode ink - jet devices are typically 2000 - 5000 droplets per second . thus , both the resolution and throughput of demand mode inkjet microdispensing are in the ranges required for the ultrahigh density hybridization wafer . the microdispensing system is modified from a microfab drop - on - demand ink - jet type device , hereafter called a microjet device such that this type of device can produce 50 μm diameter droplets at a rate of 2000 per second . the operating principles of this type of device are known ( d . b . wallace , “ a method of characteristics model of a drop - on - demand ink - jet device using an integral drop formation method ,” asme publication 89 - wa / fe4 , december 1989 ) and used to effect the modification . to increase throughput , eight of these devices are integrated into a line array less than 1 inch ( 25 mm ) long . the eight devices are loaded with reagent simultaneously , dispense sequentially , and flush simultaneously . this protocol is repeated until all of the reagents are dispensed . most of the cycle time is associated with loading and flushing reagents , limiting the advantages of a complex of parallel dispensing capability . typical cycle time required is as on the following order : 1 minute for flush and load of 8 reagents ; 30 seconds to calibrate the landing location of each reagent ; 15 seconds to dispense each reagent on one location of each of the 16 genosensors , or 2 minutes to dispense all 8 reagents . total time to load and dispense 8 reagents onto 16 sensors is thus 3 . 5 minutes . total time for 64 reagents onto 16 sensors would be 28 minutes . the microdispensing system will consist of the subsystems listed below : a . microjet dispense head — an assembly of 8 microjet devices and the required drive electronics . the system cost and complexity are minimized by using a single channel of drive electronics to multiplex the 8 dispensing devices . drive waveform requirements for each individual device are downloaded from the system controller . the drive electronics are constructed using conventional methods . b . fluid delivery system — a beckman biomec is modified to act as the multiple reagent input system . between it and the microjet dispense head are a system of solenoid valves , controlled by the system controller . they provide pressurized flushing fluid ( deionized water or saline ) and air to purge reagent from the system and vacuum to load reagent into the system . c . x - y positioning system — a commercially available precision x - y positioning system , with controller , is used . resolution of 0 . 2 μm and accuracy of 2 μm are readily obtainable . the positioning system is sized to accommodate 16 sensors , but microjet dispense head size , purge station , and the calibration station represent the main factors in determining overall size requirements . d . vision system — a vision system is used to calibrate the “ landing zone ” of each microjet device relative to the positioning system . calibration occurs after each reagent loading cycle . also , the vision system locates each dispensing site on each sensor when the 16 sensor tray is first loaded via fiducial marks on the sensors . for economy , a software based system is used , although a hardware based vision system can be advantageously employed . e . system controller — a standard pc is used as the overall system controller . the vision system image capture and processing also reside on the system controller . in order to bind dna probes or targets within the pores of the microfabricated hybridization support , carry out the hybridization and washing steps , process the material for re - use , and potentially recover bound materials for further analysis , a means is provided for flow of liquids through the wafer . to enable flow of liquid through the hybridization wafer , it is packaged within a 2 mm × 4 mm polypropylene frame , which serves as an upper reservoir and structure for handling . a polypropylene vacuum chamber with a deltin o - ring around its upper edge to permit clamping of the wafer onto the vacuum manifold to form a seal is employed . the vacuum assembly is illustrated in fig4 . for control of fluid flow through the wafer a screw - drive device with feedback control is provided . oligonucleotides to be used in the present invention are synthesized by the phosphoramidite chemistry ( beaucage , s . l . and caruthers , m . h . 1981 . tet . lett . 22 : 1859 - 1862 ) using the segmented synthesis strategy that is capable of producing over a hundred oligonucleotides simultaneously ( beattie , k . l ., logsdon , n . j ., anderson , r . s ., espinosa - lara , j . m ., maldonado - rodriguez , r . and frost , j . d . iii . 1988 . biotechnol . appl . biochem . 10 : 510 - 521 ; beattie , k . l . and fowler , r . f . 1991 . nature 352 : 548 - 54926 , 27 ). the oligonucleotides can be derivatized with the alkylamino function during the chemical synthesis , either at the 5 ′- end or the 3 ′- end . optimal procedures for attachment of dna to silicon dioxide surfaces are based on well - established silicon chemistry ( parkam , m . e . and loudon , g . m . ( 1978 ) biochem . biophys . res . commun ., 1 : 1 - 6 ; lund , v ., schmid , r ., rickwood , d . and hornes , e . ( 1988 ) nucl . acids res . 16 : 10861 - 10880 ). this chemistry is used to introduce a linker group onto the glass which bears a terminal epoxide moiety that specifically reacts with a terminal primary amine group on the oligonucleotides . this versatile approach ( using epoxy silane ) is inexpensive and provides a dense array of monolayers that can be readily coupled to terminally modified ( amino - or thiol - derivatized ) oligonucleotides . the density of probe attachment is controlled over a wide range by mixing long chain amino alcohols with the amine - derivatized oligonucleotides during attachment to epoxysilanized glass . this strategy essentially produces a monolayer of tethered dna , interspersed with shorter chain alcohols , resulting in attachment of oligonucleotides down to 50 å apart on the surface . variable length spacers are optionally introduced onto the ends of the oligonucleotides , by incorporation of triethylene glycol phosphoryl units during the chemical synthesis . these variable linker arms are useful for determining how far from the surface oligonucleotide probes should be separated to be readily accessible for pairing with the target dna strands . thiol chemistry , adapted from the method of whitesides and coworkers on the generation of monolayers on gold surfaces ( randall lee , t ., laibinis , p . e ., folkers , j . p . and whitesides , g . m . ( 1991 ) pure & amp ; appl . chem . 63 : 821 - 828 and references cited therein . ), is used for attachment of dna to gold and platinum surfaces . dithiols ( e . g ., 1 , 10 - decanedithiol ) provide a terminal , reactive thiol moiety for reaction with bromoacetylated oligonucleotides . the density of attachment of dna to gold or platinium surfaces is controlled at the surface - activation stage , by use of defined mixtures of mono - and dithiols . part b : surface immobilization of recombinant vector dna , cdna and pcr fragments the chemical procedures described above are used most advantageously for covalent attachment of synthetic oligonucleotides to surfaces . for attachment of longer chain nucleic acid strands to epoxysilanized glass surfaces , the relatively slow reaction of surface epoxy groups with ring nitrogens and exocylic amino groups along the long dna strands is employed to achieve immobilization . through routine experimentation , optimal conditions for immobilization of unmodified nucleic acid molecules at a few sites per target are defined , such that the bulk of the immobilized sequence remains available for hybridization . in the case of immobilization tonanochannels coated with platinum or gold , hexylamine groups are first incorporated into the target dna using polymerization ( pcr or random priming ) in the presence of 5 - hexylamine - dutp , then a bromoacetylation step is carried out to activate the dna for attachment to thiolated metal surfaces . again , routine experimentation is employed ( varying the dttp / 5 - hexylamine - dutp ratio and the attachment time ) to define conditions that give reproducible hybridization results . the foregoing procedure ( omitting the bromoacetylation step ) can also serve as an alternative method for immobilization of target dna to glass surfaces . based upon quantitative measurements of the attachment of labeled oligonucleotides to flat glass and gold surfaces , the end attachment places the probes 50 - 100 å apart on the surface , corresponding to up to 10 8 probes in a 50 μm × 50 μm area . approximately 10 10 - 10 11 oligonucleotide probes can be tethered within a 50 μm cube of porous silicon in the nanofabricated wafer . the density of bound oligonucleotides per cross sectional area is estimated by end - labeling prior to the attachment reaction , then quantitating the radioactivity using the phosphorimager . known quantities of labeled oligonucleotides dried onto the surface are used to calibrate the measurements of binding density . from data on the covalent binding of hexylamine - bearing plasmid dna to epoxysilanized flat glass surfaces in mild base , it is known that at least 10 7 pbr322 molecules can be attached per mm 2 of glass surface . based on this density within the pores of the nanofabricated wafer , immobilization of 10 9 - 10 10 molecules of denatured plasmid dna per mm 2 of wafer cross section are achieved . the target dna ( analyte ) is prepared by the polymerase chain reaction , incorporating [ 32 p ] nucleotides into the product during the amplification or by using gamma - 32 p [ atp ]+ polynucleotide kinase to 5 ′- label the amplification product . unincorporated label is removed by centricon filtration . preferably , one of the pcr fragments is 5 ′- biotin - labeled to enable preparation of single strands by streptavidin affinity chromatography . the target dna is dissolved in hybridization buffer ( 50 mm tris - hcl , ph 8 , 2 mm edta , 3 . 3m tetramethylammonium chloride ) at a concentration of at least 5 nm ( 5 fmol / μl ) and specific activity of at least 5 , 000 cpm / fmol . pcr fragments of a few hundred bases in length are suitable for hybridization with surface - tethered oligonucleotides of at least octamer length . the target dna sample is flowed into the porous regions of the chip and incubated at 6 ° c . for 5 - 15 minutes , then washed by flowing hybridization solution through the porous chip at 18 ° c . for a similar time . alternatively , hybridization can be carried out in buffer containing 1m kcl or nacl or 5 . 2m betaine , in place of tetramethylammonium chloride . part c : optimization of hybridization selectivity ( discrimination against mismatch - containing hybrids although the experimental conditions described above generally yield acceptable discrimination between perfect hybrids and mismatch - containing hybrids , some optimization of conditions may be desirable for certain analyses . for example , the temperature of hybridization and washing can be varied over the range 5 ° c . to 30 ° c . for hybridization with short oligonucleotides . higher temperatures may be desired for hybridization using longer probes . the detection and quantitation of hybridization intensities is carried out using methods that are widely available : phosphorimager and film . the biorad phosphorimager has a sample resolution of about 100 μm and is capable of registering both beta emission and light emission from chemiluminescent tags . reagent kits for chemiluminescence detection available from millipore and new england nuclear , which produce light of 477 and 428 nm , respectively , are advantageously used with the biorad instrument . chemiluminescent tags are introduced into the target dna samples ( random - primed vector dna or pcr fragments ) using the procedures recommended by the supplier . thereafter , the dna is hybridized to the nanoporous wafers bearing oligonucleotide probes . radioactive tags ( 32 p and 33 p , incorporated by random priming and pcr reaction ) are also used in these experiments . film exposure is used for comparison . in the case of hybridization of labeled oligonucleotides with surface - immobilized target dnas , most preferably the radioactive tags ( incorporated using polynucleotide kinase ) are used , since optimal chemiluminescent tagging procedures for oligonucleotides are generally not available . ccd genosensor devices are capable of maximum resolution and sensitivity and are used with chemiluminescent , fluorescent and radioactive tags ( lamture , j . l ., varma , r ., fowler , r ., smith , s ., hogan , m ., beattie , k . l ., eggers , m ., ehrlick , d ., hollis , m . and kosicki , b . 1993 . nature , submitted ). genosensor experiment ; mutation detection in exon 7 / 8 region of hamster hprt gene the hprt gene is used extensively as a model system for studies of mutation . the gene has been cloned and sequenced from several mammals . a variety of mutations in this gene are known and were characterized by dna sequencing , in the hamster ( induced by chemicals and radiation in chinese hamster ovary cell lines ) and from humans ( associated with lesch nyhan syndrome ). a significant fraction of hprt mutations are found in a short region of the gene encoded by exons 7 and 8 . the nucleotide sequence of the normal and mutant genes are found in the following references : edwards , a ., voss , h ., rice , p ., civitello , a ., stegemann , j ., schwager , c ., zinimermann , j ., erfle , h ., caskey , c . t . and ansorge , w . ( 1990 ), automated dna sequencing of the human hprt locus , genomics , 6 : 593 - 608 ; gibbs , r ., nguyen , p .- n ., edwards , a ., civitello , a . and caskey , c . t . ( 1990 ), multiplex dna deletion detection and exon sequencing of the hypoxanthine phosphoribosyltransferase gene in lesch - nyhan families , genomics , 7 : 235 - 244 ; yu , y ., xu , z , gibbs , r . and hsie , a . ( 1992 ), polymerase chain reaction - based comprehensive procedure for the analysis of the mutation spectrum at the hypoxanthine - guanine phosphoribosyltransferase locus in chinese hamster cells , environ . mol . mutagen ., 19 : 267 - 273 ; and xu , z ., yu , y ., gibbs , r ., caskey , c . t . and hsie , a . ( 1993 ), multiplex dna amplification and solid - phase direct sequencing at the hprt locus in chinese hamster cells , mutat . res ., 282 : 237 - 248 . the nucleotide sequence of the cdna of hamster hprt exon 7 / 8 region is listed as follows : ( seq id no : 1 ) 500 520 540 gcaagcttgc tggtgaaaag gacctctcga agtgttggat ataggccaga ctttgttgga 560 580 600 tttgaaattc cagacaagtt tgttgttgga tatgcccttg actataatga gtacttcagg gatttgaatc the following represents the nucleotide sequence of hamster hprt genomic dna in the exon 7 / 8 region where the cho mutations are depicted above ( l ) and the human ( h ) and mouse ( m ) sequence differences below ( l ). the dna sequence which begins with “ 5 ′- aacagcttg ” and which ends with “ 5 ′- gactgtaag ” is designated as seq id no : 2 for sequences of hamster , human and mouse and seq id no : 3 for the sequence of cho cells . the remaining dna , beginning with “ 5 ′- tacagttgt ” and ending with “ gaatgtaat ” is designated as seq id no : 4 for sequences of hamster , human and mouse and seq id no : 5 the sequence of cho cells . ---------- ↑ - aacagcttgctggtgaaaaggacctctc gaagtgttgg atataggccag ↓ ↓ ↓ ↓ c a c a h h m h g - ↑ ↑ actgtaag ---- tacagttgttggatttg a aattccag a caagtttgttg + a c ↑ ↑ ttggatatgcccttgactat aa tgagtacttcag g atttgaatgt aat - ↓ ↓ ↓ a a a h h h the small letters in the beginning of the sequence represent intron sequence on the 5 ′- side of exon 7 . some flanking intron sequence between exons 7 and 8 is shown ( in small letters ) on the second line , and at the end there is again a small stretch of intron sequence following exon 8 . underlined bases in the sequence represent mutations for which dna samples are available , which can be used to demonstrate that a dna chip targeted to this region can detect and identify mutations . above the sequences are displayed mutations in hamster ( cho ) cells induced by chemicals and radiation , including a 10 - base deletion ( top line ), single base deletion ( second line ), single base insertion ( third line ) and single base substitutions ( second and third lines ). below the sequences are shown single base differences between hamster and human ( h ) and mouse ( m ). the set of oligonucleotide probes ( of 8 mer - 10 mer in length ) overlapping by two bases across the exon 7 / 8 region is depicted below for seq id nos : 2 - 5 : ---- 2 ---- ---- 4 ---- ---- 6 ---- ---- 1 ---- ---- 3 ---- ---- 5 ---- -- 7 -- - aacagcttgctggtgaaaaggacctctc gaagtgttgg atataggccag ↓ ↓ ↓ ↓ ↓ c a - 10 c a ---- 8 ----- ---- 10 ---- - 12 - - 7 - ---- 9 ----- ---- 11 --- actgtaag ---- tacagttgttggatttg a aattccag a caagtttgttg ↓ ↓ g - -- 12 - ---- 14 --- ---- 16 ---- ---- 18 --- ---- 13 --- ---- 15 --- ---- 17 --- ttggatatgcccttgactat aa tgagtacttcagg g atttgaatgtaat ↓ ↓ ↓ ↓ a + a a a c this set of probes is selected to detect any of the mutations in this region , and the lengths are adjusted to compensate for base composition effects on in duplex stability ( longer probes for at - rich regions ). the sequences of probes and primers are given in table i , as follows : table i oligonucleotides for hprt mutation detection pcr primers for exons 7 & amp ; 8 : name sequence ( 5 - 3 ) mhex71 gttctattgtctttcccatatgtc ( seq id no : 6 ) mhex82 tcagtctggtcaaatgacgaggtgc ( seq id no : 7 ) hex81 ctgtgattctttacagttgttgga ( seq id no : 8 ) hex82 cattaattacattcaaatccctgaag ( seq id no : 9 ) 9mer with amine at 5 ′- end : name sequence ( 5 ′-& gt ; 3 ′) − a ( 554 ) tgctggaat + a ( 586 / 7 ) actcatttata ( seq id no : 10 ) − 10 ( 509 - 518 ) tatatgagag ( seq id no : 11 ) a - g ( 545 ) attccaaatc ( seq id no : 12 ) g - c ( 601 ) caaatgcct 1 agcaagctg 2 tttcaccag 3 aggtccttt 4 cttcgagag 5 tccaacact 6 gcctatatc 7 agtctggc 8 tccaacaact ( seq id no : 13 ) 9 atttcaaatc ( seq id no : 14 ) 10 gtctggaat 11 acaaacttgt ( seq id no : 15 ) 12 tccaacaac 13 gggcatatc 14 tagtcaagg 15 actcattata ( seq id no : 16 ) 16 ctgaagtac 17 caaatccct 18 aattacattca ( seq id no : 17 ) a high - density or ultra - high density microfabricated device according to the above examples is constructed and attachment of oligonucleotide probes is carried out within the bounded regions of the wafer . included are the normal probes ( 1 - 18 ) plus the specific probes that correspond to five different known mutations , including the above mutations ( sites 19 and 20 , respectively ). the foregoing uses two sets of pcr primers ( table i ) to amplify the exons 7 / 8 region of hamster genomic dna . a radioactive label ( 32 p ) is incorporated into the pcr fragments during amplification , which enables detection of hybridization by autoradiography or phosphorimager . fig5 illustrates the results when the above probes are attached at one end to the surface at specific test sites within the dna chip ( numbered as above ). idealized hybridization patterns for two of the mutants ( 10 - base deletion on left and a - g transition on right ) are shown at the bottom . profiling of gene expression using cdna clones arrayed in porous silicon the procedure outlined in example 3 for fabrication of a porous silicon wafer with integral sample wells is followed , to yield a wafer with a 50 × 50 array of 200 μm square patches of pores , spaced 400 μm apart ( center - to - center ) over the surface of the wafer . the pores of the wafer are activated to bind amine - derivatized polynucleotides by reaction with epoxysilane , as described in example 4 . a set of 2 , 500 m13 clones , selected from a normalized human cdna library , is subjected to the polymerase chain reaction ( pcr ) in the presence of 5 ′- hexylamine - dutp to amplify the cdna inserts and incorporate primary amines into the strands . the pcr products are ethanol - precipitated , dissolved in water or 10 mm koh , heat - denatured at 100 ° c . for 5 min ., then quenched on ice and applied to individual sample wells of the porous wafer suing a hamilton microlab 2200 fluid delivery system equipped with an 8 - needle dispensing head . after all cdna fragments are dispensed , a slight vacuum is briefly applied from below to ensure that fluid has occupied the pores . following incubation at room temperature overnight or at 60 ° c . for 30 - 60 minutes , the porous wafer is flushed with warm water , then reacted with 50 mm triethylamine to cap off the unreacted epoxy groups on the surface , then flushed again with warm water and air dried . part c : preparation of labeled pcr fragments representing the 3 ′- regions of expressed genes cytoplasmic rna is extracted from cultured cells by the method of chomczynski and sacchi ( anal . biochem . 162 : 156 - 159 ( 1993 )), treated with dnase i to remove dna contamination , then extracted with phenol / chloroform and ethanol precipitated . reverse transcriptions and pcr are performed as described in the “ differential display ” protocol of nishio et al . ( faseb j . 8 : 103 - 106 ( 1994 )). prior to hybridization , pcr products are labeled by random priming in the presence of [ a - 32 p ] dntps , and unincorporated label is removed by centricon filtration . prior to hybridization , a solution of 1 % “ blotto ” or 50 mm tripolyphosphate is flowed through the porous silicon wafer to minimize the nonspecific binding of target dna , then the porous silicon array is washed with hybridization solution ( 50 mm tris - hcl , ph 7 . 5 , 1 mm edta , 1m nacl ). labeled pcr fragments representing the 3 ′- end of expressed genes are recovered from the centricon filtration units in hybridization buffer , and the entire porous wafer is flooded with this dna solution . the porous hybridization module is placed at 65 ° c . and a peristaltic pump , connected to the lower vacuum chamber , is used to gradually flow the labeled dna through the pores of the wafer over the course of 30 - 60 minutes . the porous wafer is washed three times with hybridization buffer at 65 ° c . following hybridization and washing , the porous wafer is briefly dried , then placed onto the phosphor screen of a phosphorimager and kept in the dark for a period of time determined by the intensity of label . the phosphor screen is then placed into the phosphorimager reader for quantitation of individual hybridization signals arising from each porous region in the array . fig6 illustrates results obtainable from a hybridization experiment . total cytoplasmic mrna is isolated from cells cultured under two conditions and subjected to the “ differential display ” procedure described above to prepare fragments representative of individual mrna species present under the two conditions . these samples are hybridized to two identical cdna arrays , to yield the two hybridization signal patterns shown . these patterns represent the profile of expressed genes under the two different culture conditions ( for example in the presence and absence of a drug or chemical that induces a change in the expression of some genes ). note that overall , the pattern of hybridization is similar for the two conditions , but as expected for a diffential expression of certain genes under the two conditions , there are a few hybridization signals that are seen only for culture condition 1 and a few that are seen only for culture condition 2 . the box in the lower left , reproduced at the bottom of the figure to assist visual comparison , represents several differences in the gene expression profile . the squares represent sites where hybridization has occurred and the darkness of the squares is proportional to the number of labeled fragments present at each site .	8
with reference to the drawings , explanation is now made below on embodiments according to the present invention . referring to fig2 , there is illustrated a block diagram showing a construction of a real - time ultrasonic diagnostic apparatus using a probe incorporating an electronic circuit , according to a first embodiment of the invention . in fig2 , the ultrasonic diagnostic apparatus of this embodiment includes an ultrasonic probe 10 , and an ultrasonic diagnostic apparatus proper 50 to which the ultrasonic probe 10 is connected through a proper - end probe connector 40 . the ultrasonic probe 10 is made up with a probe handle 12 , a probe cable 14 having one end connected to the probe handle 12 , and a probe connector 16 connected to the other end of the probe cable 14 . the probe handle 12 is made up with an ultrasonic vibrator group 20 , a pulser group 22 , a preamplifier group 24 , a sub - array beam former group 26 , and an in - probe - handle control circuit 28 for placing those under control . the ultrasonic vibrator group 20 are arranged , say , in an n × m array form as referred later , to transmit and receive an ultrasonic wave to and from a subject 30 ( e . g . heart ). the pulser group 22 is connected to the ultrasonic vibrator group 20 , to drive the ultrasonic vibrator group 20 in accordance with the different timing generated by the in - probe - handle control circuit 28 , thus generating an ultrasonic beam having a predetermined directivity . due to this , an ultrasonic beam is to be irradiated from the ultrasonic vibrator 20 to the subject 30 , according to an electric signal from the pulser group 22 . the preamplifier group 24 is to perform processing such as low - noise amplification and buffering in order to favorably obtain a weak ultrasonic echo signal to be received at the ultrasonic vibrator group 20 , by transmitting the ultrasonic beam from the ultrasonic vibrator group 20 in a manner to reflect upon an interface where acoustic impedance is different , e . g . boundary of textures of the subject 30 and obtain information about the structure , movement , etc . of the subject 30 . the sub - array beam former group 26 is to sum up the output signals of from the preamplifier group 24 by providing a delay time based on each group of several channels , thereby reducing the number of the output signal lines of from the ultrasonic probe 10 . this reduces the number of probe cables 14 . the in - probe - handle control circuit 28 is to take control the operations of the pulser group 22 , the preamplifier group 24 and the sub - array beam former group 26 . according to the control signal of from the in - probe - handle control circuit 28 , the preamplifier group 24 is set with operating conditions , e . g . bias current , on its element - by - element basis . the probe handle 12 and the probe connector 16 are connected together through the probe cable 14 . the probe connector 16 incorporates therein an electronic circuit group 34 configured by a plurality of electronic circuits and an in - probe - connector control circuit 36 . the electronic circuit group 34 is to perform additional processing , such as amplification , buffering and band adjustment , on the ultrasonic echo signal , as required . meanwhile , the in - probe - connector control circuit 36 is to control the operation of the electronic circuit group 34 , and to generate a control signal , delivered from the in - probe - handle control circuit 28 , on the basis of the control signal received from the ultrasonic diagnostic apparatus proper 50 , referred later . the ultrasonic diagnostic apparatus proper 50 is configured with an in - proper preamplifier group 52 , an in - proper reception - delay addition circuit 54 , a signal processing section 56 , an image processing section 58 , a display section 60 , an in - proper transmission - delay circuit 62 , an in - proper pulser group 64 , an in - proper control circuit 66 and an operation panel 68 . the in - proper preamplifier group 52 is to amplify the ultrasonic echo signals that were first subjected to reception - delay addition at the ultrasonic probe 10 on the group - by - group basis of several channels . the ultrasonic echo signals amplified are matched in timing together by the in - proper reception - delay addition circuit 54 . the ultrasonic echo signals are then detected by the signal processing section 56 , to extract an envelope . furthermore , the ultrasonic echo signals , extracted of the envelope , are transformed in coordinate in accordance with a sectional plane of the subject 30 at the image processing section 58 , processed in intensity level suitably for image display or so , thus being displayed on the display section 35 . this allows the display section 60 to display in real time the shape information about the subject , as shown in fig3 . meanwhile , the in - proper control circuit 66 is to control the operation of the processing sections in the ultrasonic diagnostic apparatus proper 50 and to supply control information to the in - probe - connector control circuit 36 of the probe connector 16 . the operation panel 68 is input means for the operator to input or select information , e . g . to execute a continuous wave doppler ( scw ) mode in which beam steering is available , as an operation mode . incidentally , the in - proper transmission - delay circuit 62 and the in - proper pulser group 64 are to be operated where the ultrasonic probe does not incorporate an electronic circuit , i . e . where the usual probe is connected to drive the ultrasonic vibrators 20 by the ultrasonic diagnostic apparatus proper 50 . it is usually incorporated in the ultrasonic diagnostic apparatus proper 50 but may be omitted to provide . referring to the flowchart of fig4 , description is now made on the ultrasonic diagnostic apparatus according to the first embodiment of the invention . when power is put on by means of a not - shown power supply , the present routine is started . at step s 1 , a control code is transferred to the preamplifier group 24 at all the channels , to establish a basic bias current ib . from the vibrator group 70 in a 2d n × m array arrangement as shown in fig5 a , ultrasonic echo signals amplified at the n × m preamplifier group 24 are transferred to the ultrasonic diagnostic apparatus proper 50 . the in - proper preamplifier group 52 amplifies the ultrasonic echo signals that were first subjected to reception - delay addition at the ultrasonic probe 10 on the group - by - group basis of several channels . the ultrasonic echo signals are matched in timing at the in - proper reception - delay addition circuit 54 and detected by the signal processing section 56 , to extract an envelope . then , the image processing section 58 transforms those in coordinate in accordance with a sectional plane of the subject 30 and processed in intensity level suited for image display . this allows the display section 60 , at step s 2 , to display an image in the usual mode , e . g . b mode . in this state , observation is assumed conducted in the scw mode . thereupon , at step s 3 , the operator is to select an scw mode by operating the operation panel 68 of the ultrasonic diagnostic apparatus proper 50 . in this case , an scw mode is selected by putting on a not - shown switch on the operation panel 68 . based on the input to the operation panel 68 , the in - proper control circuit 66 sets up the ultrasonic diagnostic apparatus proper 50 to operate in the scw mode . simultaneously , a control signal is supplied to the in - probe - connector control circuit 36 of the ultrasonic probe 10 . thereupon , the in - probe - connector control circuit 36 regulates the control signal into a form to be processed by the in - probe - handle control circuit 28 . thus , the regulated control signal ( control code ) is conveyed to the in - probe - handle control circuit 28 . in the in - probe - handle control circuit 28 , the pulser group 22 and the preamplifier group 24 are controlled based on the control signal . this divides the 2d n × m array arrangement of vibrator group 70 , into an area 70 a for transmission of an ultrasonic wave and an area 70 b for reception , as shown in fig5 b . at step s 4 , the in - probe - handle control circuit 28 transfers a control code to turn off the pulser group 22 lying under the scw reception area 70 b . furthermore , at the next step s 5 , the in - probe - handle control circuit 28 transfers a control code to turn off the preamplifier group 24 a lying under the scw transmission area . then , at step s 6 , control is made to add the bias current ib , usually used at the hpreamplifier group 24 a , to the bias current ib to the preamplifier 24 b lying under the scw reception area 70 b as shown in fig5 a . in the usual pulse transmission / reception mode , the 2d n × m array 70 serves for transmission / reception at all of its elements as shown in fig5 a . in such a case , the bias current to the n × m preamplifier group 24 is given ib . in the scw mode , the probe is used separated in region , i . e . a region for transmission and a region for reception . namely , division is as an ( n / 2 )× m array ( scw transmission area ) 70 a and an ( n / 2 )× m array ( scw reception area ) 70 a , as shown in fig5 b . for this reason , the preamplifier group 24 is turned off ( bias current rendered 0 ) at its ( n / 2 )× m elements in a region to be connected to the scw transmission area 70 . the bias current ( ib ), being supplied to the preamplifier group 24 a lying under the scw transmission area , is added to the bias current to the preamplifier group 24 b lying under the scw reception area . namely , the bias current , for the preamplifier group 24 b lying under the scw reception area , is given as ib + ib (= 2ib ). thus , the bias current is increased . incidentally , consumption power does not increase at the incorporated electronic circuit because the increase of bias current corresponds to the amount of consumption at the preamplifiers to be desirably put off . in this embodiment , by controlling the probe - handle 12 consumption power not to exceed a predetermined value , the preamplifiers lying under the area for scw reception can be operated to favorably amplify the extremely slight doppler signal that is superposed on a high - amplitude clutter ( reflection from the heart wall , etc .) at less noise and in an improved dynamic range without increasing the generation heat at the probe handle 12 . as a result , an ultrasonic wave is transmitted at a center frequency f 0 to the blood flowing through the subject . by moving blood corpuscles together with the slow movement of the heart and blood vessel walls , a weak ultrasonic echo based on the transmission beam frequency is favorably received at a frequency f 0 + fd experienced a doppler shift in proportion to the blood velocity , in a state superposed on a great - amplitude clutter component resulting from the slow movement of the heart and blood cell wall , etc . by detecting the doppler shift frequency fd and displaying the change thereof in time , blood velocity information is displayed as an scw doppler image as shown in fig6 . now description is made on a second embodiment according to the invention . in the first embodiment , the ultrasonic vibrator group 20 and preamplifier group 24 were divided by on the software under control of the in - proper control circuit 66 , in - probe - connector control circuit 36 and in - probe - handle control circuit 28 . the second embodiment is to divide the ultrasonic vibrator group 20 and preamplifier group 24 by means of hardware . from now on , the second embodiment of the invention is described . incidentally , the real - time ultrasonic diagnostic apparatus , using a probe incorporating an electronic circuit , is similar in configuration to that of the first embodiment . hence , by attaching identical reference numeral to identical element to thereby omit to explain , i . e . explanation will be made only on the operation . referring to fig7 , there is illustrated a flowchart explaining the operation of the ultrasonic diagnostic apparatus , according to the second embodiment of the invention . when putting on power by means of a not - shown power supply , the present routine is started . at step s 11 , a basic bias current ib is supplied through an exclusive line to the preamplifier group 24 at all the channels . then , the in - proper preamplifier group 52 amplifies the ultrasonic echo signals subjected to the first reception - delay addition on the group - by - group basis of several channels at the ultrasonic probe 10 . the amplified ultrasonic echo signals are matched in timing at the in - proper reception - delay addition circuit 54 and then detected at the signal processing circuit 56 , to be extracted of an envelope . then , those are transformed in coordinate matched to the sectional plane of the subject 30 at the image processing section 58 and processed in intensity level suitably for image display . this allows the display section 60 , at step s 12 , to display an image in the usual mode , e . g . b mode . in this state , observation is conducted at step s 13 in the scw mode . thereupon , the operator selects an scw mode by operating the operation panel 68 of the ultrasonic diagnostic apparatus proper 50 . in this case , scw mode is selected by putting on a not - shown switch on the operation panel 68 . based on the input to the operation panel 68 , the in - proper control circuit 66 sets the ultrasonic diagnostic apparatus proper 50 to operate in the scw mode . simultaneously , a control signal is supplied to the in - probe - connector control circuit 36 of the ultrasonic probe 10 . thereupon , the in - probe - connector control circuit 36 regulates the control signal into a form to be processed by the in - probe - handle control circuit 28 within the probe handle 12 . the regulated control signal ( control code ) is supplied to the in - probe - handle control circuit 28 . based on the control signal , the in - probe - handle control circuit 28 controls the pulse group 22 and the preamplifier group 24 . this divides the 2d n × m array arrangement vibrator group 70 into an area 70 a for transmission of an ultrasonic wave and an area 70 b for reception , as shown in fig5 b . at step s 14 , power is turned off to the pulser group 24 lying under the scw reception area 70 b . namely , the power line or the bias current is shut off by means of a relay or semiconductor switch provided , say , on the in - probe - handle control circuit 28 . furthermore , at the following step s 15 , power is shut off to the preamplifier 24 lying under the scw transmission area . namely , the power line or the bias current is shut off by means of a relay or semiconductor switch provided , say , in the in - probe - handle control circuit 28 . then , at step s 16 , to the preamplifier group 24 is supplied a bias current 2ib in an amount double the bias current ib usually used on the exclusive line as shown in fig5 a . with this structure , consumption power does not increase at the incorporated electronic circuit because the increase of bias current corresponds to the amount of consumption at the preamplifiers that are desirably to be put off . incidentally , in the second embodiment , the hardware was exemplified with the relay or semiconductor switch provided in the in - probe - handle control circuit 28 and for turning off the power to the pulser group 22 and preamplifier group 24 . however , this is not limitative , e . g . it may be provided in the pulser group 22 , the preamplifier group 24 or the like . in the first and second embodiments , the consumption power at the preamplifier group is naturally controlled in its total amount not to exceed the upper limit thereof even if changing the ratio of transmission and reception areas at the ultrasonic vibrators . although the first and second embodiments described the two - dimensional array case of the ultrasonic vibrator group 20 , it is not limitative . application is similarly possible to the array vibrators arranged in a one - dimensional or irregular form . the preamplifier group 24 is not limited to the incorporation in the probe handle 12 . it can be built in the probe connector 16 , in which case effects are similarly obtainable . furthermore , scw mode is not limitative but application is possible quite similarly as to the mode to use by separating the ultrasonic vibrator group 20 into different purposes of operating areas . although the invention was described by way of the embodiment , the invention is to be modified in the scope not departing from the gist thereof besides the embodiment described so far . furthermore , the foregoing embodiment includes various aspects of the invention , wherein various inventions are to be extracted by suitably combining a plurality of constituent elements disclosed . for example , in case certain elements are deleted from all the elements disclosed in the embodiment , the structure deleted of the elements is to be extracted as an invention where the problem mentioned in the introductory part can be solved and the effect therein can be obtained . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .	0
as described above , using a manual override or reset tool an operator can reset a lock cylinder by putting it into a learn mode without requiring a valid key . this reset operation could sometimes prove challenging because of the number of actions to perform while holding a compact lock cylinder . the present invention is a reset cradle for manually resetting a quick rekey cylinder without need of a valid key , thereby allowing easier manual reset thereof , and especially for recovery of a blown cylinder of a rekeyable lock assembly . fig2 is a perspective exploded view of the reset cradle 2 according to one embodiment of the present invention . the reset cradle 2 includes a housing 22 with central recess 24 extending there through configured to receive and seat the lock cylinder 10 . as seen in fig3 the housing 22 further comprises an annular hub 124 rotatably attached to a base 126 . annular hub 124 is a hollow cover that flares outward from a central aperture 125 . the annular hub 124 rotatably seats against a peripheral groove 128 formed in the base 126 , thereby enclosing an upwardly protruding tubular post 130 formed integrally on the base 126 . the post 130 forms a hollow cylinder that defines the central recess 24 for receiving the lock cylinder 10 . post 130 protrudes axially from base 126 so that when hub 124 is seated in groove 128 the cylindrical walls of post 130 conform to the aperture 125 in hub 124 . the base 126 is formed with a recess 127 ( obscured in fig3 , see fig6 ) in its underside immediately beneath the post 130 . a spring - loaded annular driver 160 is rotatably journalled in the recess 127 in base 126 . the driver 160 is a hollow annular member having an inwardly - directed radial pin 161 for engaging the lock cylinder when inserted into the reset cradle 2 . the driver 160 has a flange 168 at the bottom for anchoring an extension spring 166 . the other end of extension spring 166 is connected internally to the base 126 for biasing rotation of the driver 160 with respect to the base 126 , providing a spring - return to a home position . the driver 160 also has an outwardly protruding arm 163 that engages a cam as described below . a washer 162 and screw 164 are secured to the bottom of the base 126 to trap driver 160 within the bottom recess . the driver 160 is held captive in the base 126 by a washer 162 screwed into the bottom of the base 126 . fig4 is an isolated view of the driver 160 with flange 168 there beneath . a compression pin 169 is inserted into a bore hole in the flange 168 for anchoring the extension spring 166 for spring - return to a home position . fig4 also provides perspective of the outwardly protruding arm 163 that engages the cam described below . the inwardly - directed axial pin 161 is inserted into a bore - hole in the wall of driver 160 for engaging the lock cylinder once inserted into the reset cradle 2 . the axial pin 161 fits into a notch formed in the lowermost edge of the lock cylinder for turning the cylinder . the bore - hole may be formed as a slot to give the axial pin 161 a limited degree of freedom in order to accommodate lock cylinders of different lengths . referring back to fig3 , a two - section cam 132 formed of halves 132 a and 132 b is rotatably seated on the post 130 inside base 126 . the cam 132 can move rotationally along with hub 124 with respect to the base 126 . the inner surface of cam 132 comprises a camming surface that radially displaces two operative components mounted in the post 130 of base 126 . as the cam 132 rotates around the post 130 of base 126 to a first position , it radially displaces , within a particular order and timing , the two working components both being housed inside the base 126 as will be described . these working components engage the lock cylinder , and are generally spring biased outward so they will return to their starting position once their particular functions are completed . the cam 132 is also formed with a downwardy - protruding finger 133 for engagement with the arm 163 of driver 160 . note also that the finger 133 protrudes laterally from the cam 132 to key the cam 132 to the hub 124 for rotation therewith . as the cam 132 rotates past the first position to a second position the finger 133 of cam 132 engages arm 163 of driver 160 and rotates the driver , which in turn rotates , the plug 40 ( see fig1 ) with respect to the cylinder body 12 . rotation of the plug 40 by 90 degrees with respect to the cylinder body 12 moves the locking bar 94 into the recess inside the cylinder body 12 , which releases the locking bar 94 , allowing a learn tool 200 to be inserted . fig5 is an enlarged illustration of the bottom of the reset cradle 2 showing the downwardly - protruding finger 133 of cam 132 which , at a predetermined angle of rotation , engages the outwardly protruding arm 163 of driver 160 . the driver 160 wields the inwardly - directed axial pin 161 that engages the edge of the lock cylinder ( here inserted into the reset cradle 2 ). consequently , turning the hub 124 of housing 22 past the first position causes the cam 132 to begin to drive the driver 160 , which in turn engages the pin 161 to rotate the lock cylinder seated therein . the cam 132 is formed with an interior camming surface . as mentioned above , as the cam 132 rotates around the post 130 of base 126 , this camming surface radially displaces , within a particular order and timing , two working components both being housed inside the base 126 . referring back to fig3 , one of these components is a reset member 150 comprising a shoulder with a plurality of protruding prongs . the reset member 150 generally fulfills the function of the rekeying tool 310 described in the background section with regard to fig1 , and the protruding prongs insert into the cylinder body to manually position the cylinder racks and pins to release the locking bar of the lock cylinder . however , in the context of the reset cradle 2 the operation of the reset member 150 becomes automatic . the shoulder of the reset member 150 is rounded and seats within an alcove 137 formed along the inner wall of the cam 132 . the forefront of the reset member 150 is slidably seated in a notch formed through the post 130 in base 126 , and is spring - biased outward by a pair of springs 152 that engage the post 130 . this way , as the hub 124 , and hence cam 132 and alcove 137 are rotated the sidewalls of the alcove 137 will engage the reset member 150 and displace it radial into the post 130 . upon radial displacement the prongs of reset member 150 are inserted through the apertures of the cylinder body , such that the prongs of the reset member 150 engage the racks 92 ( see fig1 ) of the rekeyable lock cylinder 10 . the reset member 150 thereby relocates the plurality of racks 92 , such that the racks are aligned at a common level . at about the same time that the reset member 150 engages , a detent pin 140 also begins to engage to depress the locking bar 94 and allow the plug body to rotate in the cylinder body to the rekeying position . the detent pin 140 is likewise slidably seated in a through bore formed through the post 130 in base 126 , and is spring - biased outward by a spring 142 seated inside the post 130 . referring back to fig3 , the outward end of the detent pin 140 is formed with a rounded cap that engages an arcuate bearing surface 139 protruding inward along the inner wall of the cam 132 . this way , as the cam 132 and bearing surface 139 are rotated the bearing surface 139 will engage the detent pin 140 and displace it radially into the post 130 and into the detent ball 36 ( fig1 ) of the lock cylinder 10 . upon radial displacement the pin 140 displaces the locking bar 94 , thereby fulfilling the function of the bracing tool ( described in the background section ) and allowing the plug body 40 to rotate . with the lock cylinder racks 92 aligned by the reset member 150 as above , the detent pin 140 ( of fig3 ) moves the locking bar 94 into engagement with cut - outs in the racks 92 , thereby preventing relative movement among the racks , and consequently , relative movement between the pins 113 engaged with the racks 92 . this effectively frees the plug body 40 for rotation within the cylinder body 20 and readies the rekeyable lock cylinder 10 for insertion of the learn tool 200 . in the presently - preferred embodiment , the alcove 137 and arcuate bearing surface 139 are formed along the inner wall of the cam 132 in order to move both the reset member 150 and detent pin 140 into the lock cylinder 10 at approximately 33 degrees , and then allow spring - biased retraction of the reset member at approximately 54 degrees while detent pin 140 remains displaced . fig6 is a cross - section of the of the reset cradle 2 of fig2 - 3 with rekeyable lock cylinder 10 removed from the central recess 24 of housing 22 . the hub 124 is rotatably seated on the groove 128 of base 126 , thereby enclosing post 130 of base 126 . the extent of the post 130 is visible as well as its central recess 24 for receiving the lock cylinder 10 . here only cam half 132 a is visible . as well as the detent pin 140 which is slidably seated in the through bore formed through the post 130 in base 126 . the spring 142 encircles the detent pin 140 and abuts a constriction inside the through - bore in post 130 . in use , the user should first ensure that the arrow on the front annular hub 124 is in the starting ( 0 degree ) position , as shown in fig7 . if not , then the front hub 124 should be returned clockwise until it bottoms out ( indicating the starting position shown in fig7 ). the user then rotates the hub 124 of reset cradle 2 from the home position to a first position ( 54 degrees ) which displaces detent pin 140 and reset member 130 into the lock cylinder as described above , and then retracts the reset member 150 , followed by 90 degree rotation to a second 146 degree position which rotates the plug 40 within the cylinder body 20 and readies the rekeyable lock cylinder 10 for insertion of the learn tool 200 . the learn tool 200 may then be inserted and the lock cylinder rekeyed . fig7 - 15 are sequential illustrations of the operation of the reset cradle 2 . specifically , fig7 - 9 are a front view of the reset cradle 2 in the home ( 0 degree ) position , a lower cross - section showing the position of driver 160 , and an upper cross - section showing the positions of the reset member 150 and detent pin 140 relative to post 130 and cam 132 , respectively . an arrow 12 embossed in the front face of the hub 22 of the reset cradle 2 tells the user that the assembly is in the home ( 0 degree ) position , as shown in fig7 . a second arrow 14 tells the user the direction to turn . while in the starting position the rekeyable lock cylinder 10 may be inserted frontally into the reset cradle 2 ( already done so as shown ). thus , as seen in fig8 , the arm 163 of driver 160 is not engaged since the hub 124 must be rotated approximately past the first ( 54 degree ) position before the finger 133 protruding downward from cam 132 engages the arm 163 of the driver 160 . likewise , as seen in fig9 , the reset member 150 remains seated in the alcove 137 of cam 132 and is spring - biased fully outward so as not to engage the lock cylinder , and the detent pin 140 has not yet engaged the cam surface 139 of cam 132 and is spring - biased fully outward so as not to engage the lock cylinder . further rotation to the first ( 54 degree ) position extends both the reset member 150 and the detent pin 140 into the lock cylinder , then retracts the reset member 150 . fig1 - 12 are a front view of the reset cradle 2 in the first ( 54 degree ) position , a lower cross - section showing the position of driver 160 , and an upper cross - section showing the positions of the reset member 150 and detent pin 140 relative to post 130 and cam 132 , respectively . the arrow 12 on the reset cradle 2 tells the user that the assembly has been rotated 54 degrees to the first position , as shown in fig1 , where the arrow 12 is 54 degrees offset from the keyslot of the lock . as seen in fig1 , this rotation turns the cam 132 and at approximately 54 degrees of rotation engages the arm 163 of driver 160 with the finger 133 of the cam 132 . the lock cylinder does not rotate . meanwhile , as seen in fig1 , at approximately 22 degrees the reset member 150 engages the walls of the alcove 137 of cam 132 and is urged inward to engage the lock cylinder . at approximately 33 degrees the detent pin 140 begins to engage the cam surface 139 of cam 132 and is radially extended through the post 130 to engage the lock cylinder . this in turn moves the locking bar 94 ( fig1 ) into engagement with cut - outs in the racks 92 , thereby preventing relative movement among the racks , and consequently , relative movement between the pins 113 engaged with the racks 92 . by full rotation the first 54 degree position the cam 132 frees the reset member 150 . which retracts , but the detent pin 140 remains engaged . while in this configuration it is now necessary to rotate the plug 40 ( fig1 ) approximately 90 degrees within the cylinder body 12 in order to move the locking bar 94 into the recess inside the cylinder body 12 , which in turn releases the locking bar 94 , allowing learn tool 200 to be inserted . this rotation is implemented by operation of the driver 60 . fig1 - 15 are a front view of the reset cradle 2 in a second ( 146 degree ) position , a lower cross - section showing the position of driver 160 , and an upper cross - section showing the positions of the reset member 150 and detent pin 140 relative to post 130 and cam 132 , respectively . the arrow 12 on the reset cradle 2 tells the user that the assembly has been rotated 146 degrees to the third position , which puts the lock cylinder in the learn mode , as shown in fig1 , where the arrow 12 is 146 degrees offset from the starting position . as stated above , at 54 degrees of rotation the arm 163 of driver 160 is engaged with the finger 133 of the cam 132 . consequently , this segment of rotation between 54 - 146 degrees turns the cam 132 as well as the plug along with the hub 124 . this can be seen in fig1 where the plug 40 itself is rotated approximately 90 degrees within the lock cylinder body 12 . meanwhile , as seen in fig1 , as the cam rotates to the third position the cam 132 opens up again for the detent pin 140 , the detent pin 140 falling back into the recess of the cam surface 139 and retracting from the post 130 . this backs the locking bar 94 ( fig1 ) out of engagement with cut - outs in the racks 92 , thereby allowing relative movement among the racks , and consequently , relative movement between the pins 113 engaged with the racks 92 . this effectively readies the rekeyable lock cylinder for insertion of the learn tool 200 . referring back to fig1 , the learn tool 200 may next be inserted into the keyslot in the face of the lock cylinder to configure the lock cylinder to the learn mode . once in the learn mode , the lock cylinder can be removed from the reset cradle 2 and a valid key inserted in the keyway of the lock cylinder . the new key is inserted and rotated clockwise 90 ° to key the lock cylinder 10 to the new key ( the cylinder pins correlating to the new key ). thus , rotating the key back 90 degrees to the home position effectively keys the lock cylinder 10 to the new key . any previously valid key no longer operates the lock cylinder 10 . thus , via the reset cradle 2 , without requiring a valid key , the lock assembly can be rekeyed without removing the plug assembly from the cylinder body . once the lock cylinder is removed from the reset cradle , then the reset cradle is returned to its home position , and indeed the return - bias spring 166 promotes this return . by using the reset cradle 2 the process of rekeying the lock cylinder 10 becomes easier to handle . first the reset cradle 2 holds the lock cylinder 10 in place thereby freeing up one hand of the operator . also , the reset cradle 2 automatically operates the reset member 150 and the bracing bar , thereby eliminating the need for manual manipulation of these components . this facilitates both the operation of engaging the prongs of the reset member 150 against the racks 92 ( fig1 ) and the action of using the bracing bar to move the locking bar 94 ( fig1 ) into engagement with the racks 92 . having now fully set forth the preferred embodiment and certain modifications of the concept underlying the present invention , various other embodiments as well as certain variations and modifications of the embodiments herein shown and described will obviously occur to those skilled in the art upon becoming familiar with said underlying concept . it is to be understood , therefore , that the invention may be practiced otherwise than as specifically set forth in the appended claims .	8
fig1 is a schematic illustration of a video delivery system 100 , in accordance with an exemplary embodiment of the invention . system 100 includes a plurality of video on demand ( vod ) servers 102 , which store video streams and provide them to subscribers , and / or one or more real time video sources , such as integrated receiver decoders ( ird ) 122 . the output of each vod server 102 and / or each ird 122 may feed into one or more rate adapters 104 which adjust the rate of the video stream , according to instructions from a rate controller 106 . rate controller 106 is optionally configured with the identities of a group of streams that are to be delivered together to a client and a channel size allocated for the delivery of the group of streams to the client . the rate controller 106 receives information regarding the streams and / or the streams themselves and accordingly determines how to allocate the channel size to the different streams within the group . it is noted that a single rate adapter 104 may handle a single video stream or a plurality of video streams . in addition , a single video stream may belong to a plurality of different groups of streams transmitted on separate links to separate end - users , and in such cases the stream is rate adapted into a plurality of different channels , by either a single rate adapter 104 or by a plurality of different rate adapters . similarly , rate controller 106 may be configured to handle fitting a single group of streams on one channel , or handle concurrently fitting a plurality of groups of streams into a plurality of respective channel sizes . it is noted that two different groups may include a common video stream and rate controller 106 may allocate different bandwidth allocations to the video stream at the same time , for the different groups . optionally , rate controller 106 is dynamically instructed as to which groups it is to handle . in some embodiments , a session resource manager ( srm ) 146 receives requests from clients for delivery of video streams and accordingly provides rate controller 106 with instructions regarding the groups it is to handle . the rate adapted streams from rate adapters 104 are transmitted through a network 108 as separate single program transport streams ( spts ) to a qam modulator 110 , which optionally combines the streams , modulates the combination and transmits the modulated stream via a hybrid fiber - coax ( hfc ) link 112 , or any other suitable link , toward a set - top box 114 , or other client . the combining of the streams by qam modulator 110 is a simple procedure , as the streams were previously rate adapted to fit with each other onto a channel having the bandwidth of link 112 , or of that portion of link 112 allocated to the group of streams . in the combining of the streams , qam modulator 110 optionally does not perform statistical multiplexing tasks , such as block replacements , timing adjustments or recompression . qam modulator 110 may be a standard modulator which is unaware of the operation of rate adapters 104 , such that embodiments of the invention can be implemented without replacing qam modulators 110 . real time video streams are generated shortly before they are handled by their respective one or more rate adapters 104 , generally less than 5 minutes , but perhaps less than 10 seconds or even less than 5 seconds from when they were generated . servers 102 may all be located next to each other or some or all of the servers 102 may be distanced from each other , possibly being separated by more than 100 meters , more than a kilometer or even more than 10 kilometers . rate adapters 104 are optionally separate units from servers 102 . in an exemplary embodiment , an existing video delivery system including servers 102 and qam modulator 110 is upgraded by adding rate adapters 104 and rate controller 106 , without altering servers 102 and / or qam modulator 110 . optionally , before the adding of rate adapters 104 and rate controller 106 , streams are transmitted to qam modulator 110 as constant bit rate ( cbr ) streams or as non - correlated vbr streams having a size defined by a bounding fixed rate channel . modulator 110 combines the streams into a combined stream having a size equal to the sum of the sizes of the bounding fixed rate channels . after the video delivery system is upgraded by adding rate adapters 104 and rate controller 106 , the streams are provided as size synchronized variable bit rate ( vbr ) streams in separate channels , which are combined by qam modulator 110 into a single multi - stream channel that is smaller than the sum of the bounding sizes of the channels that are combined . due to the rate adjustment , the number of streams delivered to qam modulator 110 after adding rate adapters 104 is optionally at least 20 % or even at least 40 % more than prior to the addition , while retaining a similar quality . alternatively to using rate adapters 104 separate from servers 102 , some or all of servers 102 may be adapted to perform the rate adjustment , responsive to instructions from controller 106 , during or after generation of the stream . rate adapters 104 optionally perform the rate adaptation by recompressing blocks of the video stream that are larger than the bandwidth allocated for them by rate controller 106 . the recompression may be performed using substantially any method known in the art . in some embodiments of the invention , rate adapter 104 receives for some blocks of the video stream ( e . g ., macroblocks , frames , gops ) of the video stream , a plurality of blocks representing the frame at different compression levels , and selects one of the blocks according to the allocated bandwidth . this may be performed , for example , using any of the methods described in above mentioned us patent publication 2006 / 0195881 to segev et al . alternatively or additionally , the rate adaptation includes shifting one or more blocks backwards in the timeline of the video stream such that they are transmitted slightly before they are required , at a time in which other video streams within the same group have lower bandwidth requirements . it is noted , however , that in some cases , no rate adaptation is required , since the received video stream fits onto the allocated bandwidth without size adaptation . in such cases , the processing of the video stream by the rate adapter may consist of merely adding or removing null filler bits or even merely transferring the input of the rate adapter to its output port . rate controller 106 may operate using any method for allocating bandwidth that is known in the art . in some embodiments of the invention , rate controller 106 periodically receives meta - data on each of the streams in a group of streams which are to be size synchronized and accordingly , for each time segment , assigns a portion of the available bandwidth to each of the streams . the allocation is optionally based on an attempt to achieve equal quality for all the streams of the group , for example using methods described in u . s . patent application ser . no . 12 / 152 , 814 , titled “ quality based video encoding ”, filed may 16 , 2008 , the disclosure of which is incorporated herein by reference in its entirety . alternatively or additionally , other stream synchronization methods are used , such as the test model 5 method described in http :// www . mpeg . org / mpeg / mssg / tm5 /, the disclosure of which is incorporated herein by reference . the size of the time segments for which rate controller 106 periodically provides bandwidth allocations to rate adapters 104 , may be defined , for example , in terms of a video portion length or in terms of a time period . for example , for each video stream in the handled group rate controller 106 may provide an indication of the bandwidth it is to use for a next time period . alternatively or additionally , rate controller 106 provides indications of a bandwidth to be used for a next given portion of the video stream , such as the next gop or frame . optionally , in these embodiments , each bandwidth allocation relates to at least the length of a group of pictures ( gop ) or even several gops . alternatively , the allocations relate to shorter portions , for example for a single frame or even for durations shorter than a single frame . while the bandwidth allocation may be performed repeatedly for periods of the same length , this is not mandatory , and the allocation may be performed at different times for segments of different lengths . in some embodiments of the invention , when dealing with non - real - time streams , instead of separately providing bandwidth allocations for each time segment slightly before that time segment , bandwidth allocations are provided at once for a plurality of time segments . possibly , rate controller 106 provides bandwidth allocations in advance for an entire video stream or for a substantial portion thereof , e . g ., at least 10 % or even 20 % of the stream . alternatively to using a rate controller 106 to perform the bandwidth allocation , the allocation is performed in a distributed manner by the rate adapters 104 . in some such embodiments , the rate adapters 104 dynamically select one of them to serve as the rate controller for each given group of streams to be transmitted to a specific client . alternatively , each rate adapter 104 determines on its own the bandwidth allocation it is to use , based on a predetermined distributed algorithm . optionally , in accordance with this alternative , the meta - data of the streams of the groups is sent to all the rate adapters 104 participating in handling streams of the group and accordingly the rate adapters determine the allocations of the streams they handle , possibly as a result of determining the allocations of all the streams of the group . the bandwidth allocation optionally provides equal service to all the streams , for example being directed at achieving equal quality degradation for all the streams and / or equal average bandwidth amounts . alternatively or additionally , the video streams are associated with quality of service ( qos ) ratings and their bandwidth allocations depend on their qos ratings . in some embodiments of the invention , one or more of the video streams in the group may be classified as a high priority stream which is not to be degraded or altered at all . such streams are passed through rate adapters 104 without alterations ; the remaining streams of the groups receiving bandwidth allocations according to the bandwidth remaining after the high priority stream is allocated its bandwidth . as other streams received by rate adapters 104 , the high priority streams may be cbr or vbr streams . as mentioned above , the video streams of a correlated group of streams are transmitted to qam modulator 110 in a plurality of separate channels . optionally , each video stream is transmitted from its rate adapter 104 in a separate channel , although two or more video streams may be transmitted together in a single channel , for example when these video streams are always supplied together . each channel is optionally identified by a separate and unique channel classifier ( e . g ., a unique header ). the different channels optionally have different control signals . for example , the channels may be transmitted on separate physical / link layer interfaces ( e . g ., separate ethernet interfaces ) and / or with separate transport layer ( e . g ., ip , udp ) address and / or port identifiers . in an exemplary embodiment of the invention , the channels are transmitted according to the mpeg - 2 transport stream ( ts ) protocol . in such embodiments , each channel containing a video stream is optionally transmitted as a separate ts stream having a unique channel id . the streams of the correlated group of streams are not necessarily provided from a single server and even not necessarily from a single location . thus , they do not necessarily have the same source network layer address , e . g ., ip address . in some embodiments of the invention , each video stream of the correlated group is transmitted from its server 102 to qam modulator 110 on a separate constant bit rate ( cbr ) channel , adhering to cbr timing constraints , such as those of the mpeg - 2 transport stream protocol . for example , if the streams are originally vbr streams , they are optionally encased in cbr streams with padding bits . the total size of the cbr channels provided to qam modulator 110 is optionally substantially greater than the maximal size of the combination of all the rate adjusted streams , for example at least 20 % or even at least 30 % greater . transmitting the rate adjusted channels to qam modulator 110 in separate cbr channels makes the delivery of the streams simple and easy , while still allowing simple combination of the streams into a suitable size , by qam modulator 110 . in some embodiments of the invention , the video streams are transmitted to qam modulator 110 in a synchronized manner , such that the segments of the video streams are transmitted according to their relative times in the streams . accordingly , if the entire bandwidth of link 112 is utilized by the group of streams , the amount of data belonging to the group transmitted toward qam modulator 110 during each time segment would be substantially equal to the size of the link 112 . optionally , the transmitted segments of the video streams are received by qam 110 according to the relative timing of the segments of the video streams . optionally , the jitter in the transmission of the segments is smaller than a given value , for example less than 50 milliseconds or even less than 10 milliseconds . in other embodiments , qam modulator 110 has a large buffer and / or a large buffer is provided before qam modulator 110 , and stream portions may be transmitted in advance and buffered , before modulator 110 organizes the data for transmission . fig2 is a schematic illustration of three video channels generated by one or more rate adapters 104 ( fig1 ), in accordance with an exemplary embodiment of the invention . based on allocation instructions from rate controller 106 , three streams 202 a , 202 b and 202 c are generated by one or more rate adapters 104 . each stream 202 a - c is packed into a respective cbr channel 204 ( marked 204 a , 204 b and 204 c ) and is transmitted separately to qam modulator 110 . qam modulator 110 extracts the video streams 202 a - c from channels 204 and combines them onto a single combined stream 206 . the padding of the vbr stream into a cbr stream may include null bits which do not carry information , such as null mpeg - 2 transport stream ts packets , or may include packets including additional information beyond that included in the vbr stream , such as packets with additional content , quality enhancement packets and / or packets which aid in further handling of the vbr stream . alternatively to transmitting the streams in cbr channels , one or more of the streams is provided as a vbr stream without padding into a cbr stream . the video stream is optionally transmitted in accordance with any suitable video encapsulation format , such as mp - 4 , avi , flv or mpeg - 2 ts , and / or using any suitable video coding , such as h . 264 , vp6 or vc - 1 . in some embodiments of the invention , the video streams are transmitted in accordance with the real - time protocol ( rtp ). although the above description relates to video streams , the principles of the present invention may be applied to audio streams ( e . g ., high quality audio streams ) and / or other data types . it will be appreciated that the methods described hereinabove may be varied in many ways , including , changing the order of some of the steps , and / or performing a plurality of steps concurrently . it should also be appreciated that the above described description of methods and apparatus are to be interpreted as including apparatus for carrying out the methods and methods of using the apparatus . it should be understood that features and / or steps described with respect to one embodiment may be used with other embodiments and that not all embodiments of the invention have all of the features and / or steps shown in a particular figure or described with respect to one of the embodiments . variations of embodiments described will occur to persons of the art . furthermore , within the claims , the terms “ comprise ,” “ include ,” “ have ” and their conjugates , mean , “ including but not necessarily limited to .” it is noted that some of the above described embodiments may describe the best mode contemplated by the inventors and therefore may include structure , acts or details of structures and acts that may not be essential to the invention and which are described by way of example only . structure and acts described herein are replaceable by equivalents which perform the same function , even if the structure or acts are different , as known in the art . therefore , the scope of the invention is limited only by the elements and limitations as used in the claims .	7
according to fig1 , a bearing housing cover 1 comprises at least one cylindrical fixing region 2 and a disc - like covering region 3 . with the cylindrical fixing region 2 at least one piston ring 4 , 4 ′ or a shaft sealing ring or a bearing ring can be fixed in radial direction . a charging device not shown in the figures as a rule has a turbine housing on the turbine side in whose interior a turbine wheel is arranged and a compressor housing on the compressor side , in whose interior a compressor wheel is positioned . between the turbine and the compressor housing a bearing housing is arranged which serves as rotation - moveable mounting for the shaft of the rotor , which comprises the turbine wheel , the compressor wheel and the shaft . in order to protect a bearing housing interior from the gases flowing in the turbine housing or in the compressor housing , the bearing housing is closed with a bearing housing cover on the turbine side and / or compressor side . here , the bearing housing cover is arranged on the compressor side . as shown in fig1 the bearing housing cover 1 is orientated with its fixing region 2 towards the turbine side or compressor side 6 while the covering region 3 is orientated towards the bearing housing side 5 . by means of fastening elements not shown in fig1 the covering region 3 can be fastened to the bearing housing which is likewise not shown . screws , rivets , press - in studs or the like can be used as fastening elements . it is likewise conceivable that the covering region 3 is glued , welded or joined by brazing , caulking , flanging or collaring - over to the bearing housing . in addition , the covering region 3 can also comprise webs , by means of which the covering region 3 , 7 can be joined to the bearing housing in the manner of a bayonet closure . fastening of the bearing housing cover 1 to the bearing housing by pressing a marginal region 7 of the covering region 3 into a groove on the bearing housing side is likewise conceivable . in addition , as shown in fig2 , the bearing housing cover 1 can have a cylindrical joining region 8 . by means of the joining region 8 the bearing housing cover 1 can be joined to the bearing housing . here , the joining region 8 and the fixing region 2 can be arranged on different sides with respect to the covering region 3 , as shown in fig2 , so that the fixing region 2 is orientated towards the turbine side or compressor side 6 while the joining region 8 is orientated towards the bearing housing side 5 . according to fig3 , another arrangement of the fixing region 2 and the joining region 3 is also possible however . in this embodiment , the fixing region 2 and the joining region 8 are orientated towards the bearing housing side 6 . thus the bearing housing cover 1 can have a cylindrical fixing region 2 and / or a perforated disc - like covering region 3 and / or a cylindrical joining region 8 . preferably , the bearing housing cover 1 is formed of a metal sheet . as material for such a metal sheet , all formable steel types can be utilised , also including bake - hardening sheets . preferably aluminium or an aluminium alloy is used as material . the use of precision - casting sheets is also preferred . however , other metal materials suitable for a forming process can also be used . bake - hardening sheets means sheets of a metal material that is subjected to a hardness increase through heating to temperatures around approximately 200 ° c . here , the bake - hardening sheet is formed prior to heating and hardened through baking after the forming method . particularly preferably metal sheets are used which are formed in the manner of a tailored - blank design . a metal sheet in tailored - blank design means a metal sheet that is composed of different material qualities and / or sheet thicknesses . this prefabricated semi - finished product is subsequently formed into the desired bearing housing cover 1 for example through deep - drawing or through other forming methods . if the bearing housing cover 1 is designed in the manner of a tailored - blank design , the bearing housing cover 1 can be designed in the corresponding regions in accordance with the respective loads in these regions . thus it is conceivable that the bearing housing cover 1 also performs the function of a heat shield for the bearing housing . in this case , precisely those portions that are exposed to a high temperature can be formed of suitably temperature - resistant material by means of the tailored - blank design . preferably , the bearing housing cover 1 is a unitary design of a metal sheet . however , a multiple part design of the bearing housing cover 1 is also possible , wherein the individual part regions are joined to one another through a joining method following the forming of the individual part regions . a part region can for example be the fixing region 2 and / or the covering region 3 and / or the joining region 8 . the embodiment of a bearing housing cover 1 shown in fig4 has a profiling 9 in the covering region 3 , which in the covering region 3 is formed as annular groove 10 . with respect to an axis of rotation 11 of the shaft not shown in fig4 the annular groove 10 runs at a constant radial distance to the axis of rotation 11 in the covering region 3 . such a profiling 9 is used as a radially active clamping element for clamping the bearing housing cover 1 in the bearing housing . thus , a bearing housing cover 1 , as for instance shown in fig4 , can be pressed into the bearing housing and because of the clamping element or the profiling 9 subjected to clamping can be joined to the bearing housing in the manner of a press seat . in this case , fastening by means of fastening elements can advantageously be omitted for example in the covering region 3 . such a profiling 9 can also be designed wave - shaped , while the wave shape has a radial course . thus the profiling 9 together with the joining region 8 forms a joining device 12 by means of which the bearing housing cover 1 can be fastened to the bearing housing . in fig5 a further embodiment of the joining device 12 is shown . in this case , a radial groove 13 is formed in the joining region 8 of the bearing housing cover 1 . in this radial groove 13 a sealing element 14 can be inserted so that the bearing housing cover 1 by means of the sealing element 14 can be joined to the bearing housing . in the case that a sealing element 14 is used , the bearing housing cover 1 can additionally be joined to the bearing house in a tight manner . the sealing element 14 can be designed as sealing ring , o - ring or the like . in this case the joining device 12 is formed through the radial groove 13 and the sealing element 14 , both of which are arranged in the joining region 8 . in a further embodiment a tongue formed on the bearing housing can engage in the radial groove 13 of the bearing housing cover 1 provided the latter is in installation position . in this case no sealing element 14 if applicable is arranged in the radial groove 13 and / or the joining device 12 designed in the manner of a groove / tongue joining device , wherein the joining device 12 in this case comprises a radial groove arranged in the joining region 8 and a tongue on the bearing housing side . in contrast with the annular groove 10 , which has an opening orientated towards the axis of rotation 11 in longitudinal direction , the radial groove 13 is equipped with an opening orientated in radial direction . the joining device 12 can likewise be designed as screw joining device or bayonet joining device . in the case of being designed as screw joining device , an outer thread can be arranged in the joining region 8 by means of which the joining region 8 can be screwed into an inner thread formed on the bearing housing . in the case of being designed as bayonet joining device , webs or bulges interrupted in circumferential direction are formed on the bearing housing cover 1 in the joining region 8 , so that the joining region 8 with its webs or bulges can be joined to the bearing housing in the manner of a bayonet closure . the formation of a radial groove 13 which is interrupted through longitudinal grooves arranged in the joining region 8 is likewise conceivable . in this case the webs or bulges of the bearing housing region can be inserted in the longitudinal grooves and inserted in the radial groove 13 through twisting . thus in this case the bearing housing cover 1 can likewise be fixed to the bearing housing in the manner of a bayonet closure .	5
the present invention relates to a real - time optical imaging system communicatively connected to a microwave energy producing source thereby providing means to record real - time data of biomolecule interactions and reactions in biological systems during the application of a microwave field . the system of the present invention can provide for real - time imaging microwave or radiofrequency driven interaction between protein - protein , dna - protein , rna - protein , dna - rna , chemical - protein , chemical - dna , and chemical - protein interactions at surfaces , in solution , in living organisms , including prokaryotes and eukaryotes . further , the present invention provides for real - time imaging of microwave induced effects on biological systems , induced biomolecular reactions in prokaryotic and eukaryotic organisms , at interfaces , surfaces and in solutions . still further , the present invention provides for real - time imaging of microwave induced transfection of small biomolecules into living organisms , prokaryotes and eukaryotes . the term “ biomolecule ” as used herein means any molecule occurring in nature or a derivative of such a molecule . the biomolecule can be in active or inactive form . “ active form ” means the biomolecule is in a form that can perform a biological function . “ inactive form ” means the biomolecule must be processed either naturally or synthetically before the biomolecule can perform a biological function . exemplary biomolecules include nucleic acids , aromatic carbon ring structures , nadh , fad , amino acids , proteins , peptides , carbohydrates , steroids , flavins , dna , rna , oligonucleotides , nucleic acids , fatty acids , myoglobin , sugar groups such as glucose etc ., vitamins , cofactors , purines , pyrimidines , formycin , lipids , phytochrome , phytofluor , peptides , lipids , antibodies and phycobiliproptein . the term “ receptor - ligand ” as used herein means any naturally occurring or unnaturally occurring binding couple wherein the components have affinity for each other . for example , the binding couple may include an antibody / antigen complex , viral coat ligand / protein cell receptor or any combination of probe and binding partner . the term “ receptor ” refers to a chemical group , molecule , biological agent , naturally occurring or synthetic that has an affinity for a specific chemical group , molecule , virus , probe or any biological agent target in a sample . the choice of a receptor - ligand for use in the present invention will be determined by nature of the disease , condition , or infection to be assayed . the system of the present invention includes a detector molecule or a detectable chemical reaction that is responsive to electromagnetic excitation , chemical excitation , excitation by a light source , or a laser beam of continuous or pulsed excitation to produce luminescence , including chemiluminescence , fluorescence , or phosphorescence emissions . detector molecules include fluorophores that emit electromagnetic energy such as light at a certain wavelength ( emission wavelength ) when the substance is illuminated by radiation of a different wavelength ( excitation wavelength ) and is intended to encompass a chemical or biochemical molecule or fragments thereof that is capable of interacting or reacting specifically with an analyte of interest in a sample to provide one or more optical signals . additionally fluorophore includes both extrinsic and intrinsic fluorophores . extrinsic fluorophore refer to fluorophores bound to another substance . intrinsic fluorophores refer to substances that are fluorophores themselves . exemplary fluorophores include but are not limited to those listed in the molecular probes catalogue which is incorporated by reference herein . representative fluorophores include but are not limited to alexa fluor ® 350 , dansyl chloride ( dns - cl ), 5 -( iodoacetamida ) fluoroscein ( 5 - iaf ); fluoroscein 5 - isothiocyanate ( fitc ), tetramethylrhodamine 5 -( and 6 -) isothiocyanate ( tritc ), 6 - acryloyl - 2 - dimethylaminonaphthalene ( acrylodan ), 7 - nitrobenzo - 2 - oxa - 1 , 3 ,- diazol - 4 - yl chloride ( nbd - cl ), ethidium bromide , lucifer yellow , 5 - carboxyrhodamine 6g hydrochloride , lissamine rhodamine b sulfonyl chloride , texas red ™. sulfonyl chloride , bodipy ®, naphthalamine sulfonic acids including but not limited to 1 - anilinonaphthalene - 8 - sulfonic acid ( ans ) and 6 -( p - toluidinyl ) naphthalen - e - 2 - sulfonic acid ( tns ), anthroyl fatty acid , dph , parinaric acid , tma - dph , fluorenyl fatty acid , fluorescein - phosphatidylethanolamine , texas red - phosphatidylethanolamine , pyrenyl - phophatidylcholine , fluorenyl - phosphotidylcholine , merocyanine 540 , 1 -( 3 - sulfonatopropyl )- 4 -[-. beta .-[ 2 [( di - n - butylamino )- 6 naphthyl ] vinyl ] pyridinium betaine ( naphtyl styryl ), 3 , 3 ′ dipropylthiadicarbocyanine ( dis - c 3 -( 5 )), 4 -( p - dipentyl aminostyryl )- 1 - methylpyridinium ( di - 5 - asp ), cy - 3 lodo acetamide , cy - 5 - n - hydroxysuccinimide , cy - 7 - isothiocyanate , rhodamine 800 , ir - 125 , thiazole orange , azure b , nile blue , al phthalocyanine , oxaxine 1 , 4 ′, 6 - diamidino - 2 - phenylindole ( dapi ), hoechst 33342 , toto , acridine orange , ethidium homodimer , n ( ethoxycarbonylmethyl )- 6 - methoxyquinolinium ( mqae ), fura - 2 , calcium green , carboxy snarf - 6 , bapta , coumarin , phytofluors , coronene , and metal - ligand complexes . representative intrinsic fluorophores include but are not limited to organic compounds having aromatic ring structures including but not limited to nadh , fad , tyrosine , tryptophan , purines , pyrimidines , lipids , fatty acids , nucleic acids , nucleotides , nucleosides , amino acids , proteins , peptides , dna , rna , sugars , and vitamins . additional suitable fluorophores include enzyme - cofactors ; lanthanide , green fluorescent protein , yellow fluorescent protein , red fluorescent protein , or mutants and derivates thereof . any chemiluminescent species may be used in the present invention that provides for a chemical reaction which produces a detectable reaction ( observed emission ) wherein the excited state responsible for the observed emission including , but not limited to the following excitation mechanisms : examples of suitable chemiluminescence detector molecules include but without limitation , peroxidase , bacterial luciferase , firefly luciferase , functionalized iron - porphyrin derivatives , luminal , isoluminol , acridinium esters , sulfonamide and others . a recent chemiluminescent label includes xanthine oxidase with hypoxanthine as substrate . the triggering agent contains perborate , a fe - edta complex and luminol . choice of the particular chemiluminescence labels depends upon several factors which include the cost of preparing labeled members , the method to be used for covalent coupling to the detector molecule , and the size of the detector molecules and / or chemiluminescence label . correspondingly , the choice of chemiluminescence triggering agent will depend upon the particular chemiluminescence label being used . chemiluminescent reactions have been intensely studied and are well documented in the literature . for example , peroxidase is well suited for attachment to the detector molecule for use as a chemiluminescence . the triggering agent effective for inducing light emission in the first reaction would then comprise hydrogen peroxide and luminol . other triggering agents which could also be used to induce a light response in the presence of peroxidase include isobutyraldehyde and oxygen . procedures for labeling detector molecules , such as antibodies or antigens with peroxidase are known in the art . for example , to prepare peroxidase - labeled antibodies or antigens , peroxidase and antigens or antibodies are each reacted with n - succinimidyl 3 -( 2 - pyridyldithio ) proprionate ( hereinafter spdp ) separately . spdp - labeled peroxidase , or spdp - labeled antigen or antibody is then reacted with dithiothreitol to produce thiol - labeled peroxidase , or thiol - labeled antigen or antibody . the thiol derivative is then allowed to couple with the spdp - labeled antigen or antibody , or spdp - labeled peroxidase . generally , any combination of optical imaging systems and microwave based technologies may be used in the present invention . as shown in fig1 the system includes a microwave cavity for placement of a sample and a source for generating electromagnetic energy having a wavelength and frequency in a microwave or radiofrequency range , and more preferably in the microwave range . the application of low level microwave energy for heating of the sample may be used to speed up any biological / biochemical kinetics within the system . notably , low level microwaves do not destroy or denature proteins , dna , or rna , but instead heat the sample sufficiently to provide for accelerated kinetics such as binding , hybridization or chemical interaction . microwaves ( about 0 . 3 to about 300 ghz ) lie between the infrared and radio frequency electromagnetic radiations . it is widely thought that microwaves accelerate chemical and biochemical reactions by the heating effect , where the heating essentially follows the principle of microwave dielectric loss . polar molecules absorb microwave radiation through dipole rotations and hence are heated , where as non - polar molecules do not absorb due to lower dielectric constants are thus not heated . the polar molecules align themselves with the external applied field . in the conventional microwave oven cavity employed in this work , the radiation frequency ( 2450 mhz ) changes sign 2 . 45 × 10 9 times per second . heating occurs due to the tortional effect as the polar molecules rotate back and forth , continually realigning with the changing field , the molecular rotations being slower than the changing electric field . the dielectric constant , the ability of a molecule to be polarized by an electric field , indicates the capacity of the medium to be microwave heated . thus , solvents such as water , methanol and dimethyl formamide are easily heated , where as microwaves are effectively transparent to hexane , toluene and diethylether . in the present invention , microwave radiation may be provided by an electromagnetic source having a frequency in a range between 0 . 3 and 10 ghz , more preferably from about 1 ghz and 5 ghz , and more preferably from 2 ghz to 3 , and a power level in a range between about 10 mwatts and 700 watts , preferably from 30 mwatts to about 500 watts , and more preferably from about 50 watts to 300 watts . any source , known to one skilled in the art may be used , such as a laser having the capacity to emit energy in the microwave range . the microwave radiation may be emitted continuously or intermittently ( pulsed ), as desired . in the alternative , microwave energy can be supplied through a hollow wave guide for conveying microwave energy from a suitable magnetron . the microwave energy is preferably adjusted to cause an increase of heat within the metallic material without causing damage to any biological materials in the assay system . in one embodiment , a sample plate is modified by adhering metallic surfaces fabricated to form a geometric shape such as triangle , square , oblong , elliptical , rectangle , or any shape that provides at least one apex area of the metallic surface . further multiple metallic geometric shapes may be adhered to a surface in the form of a pattern to provide at least one reactive zone positioned between the apex areas . it is envisioned that the apex area includes not only pointed regions but regions with rounded edges such as found in an oblong or elliptical shape . the apex areas are preferably arranged so that one apex area is opposite from another apex area and aligned to cause the reactive zone to be positioned therebetween . the distances between the apex areas may range from 0 . 01 mm to 5 mm , more preferably from 2 mm to about 3 mm and depending on the size of the required reactive zone . the thickness of the metallic geometric shaped forms ranges from 25 nm to about 1000 nm , and more preferably from about 45 nm to about 250 nm . the geometric shapes can be formed on the surface substrate by any means known to those skilled in the art , including masking the surface substrate with subsequent deposition of the metallic material , fixing preformed metallic geometric shapes directly onto the substrate surface , or impregnating a geometric shaped recess in the surface substrate with a metallic material that provides for a continuous planar surface on the substrate . further , the geometric shapes may include a diversity of material including dielectric materials . for example a layer of metallic material can be deposited on a substrate surface with a layer of sio 2 deposited thereon . in another embodiment , the present invention provides enhanced emissions using metalized islands of elliptical , spherical , triangular or rod - like forms . further , the metallic material may be in the form of a porous three dimensional matrix . the three dimensional matrix may be a nano - porous three dimensional matrix . the metallic material may include metal colloid particles and or shaped particles imbedded into the surface of a glass of polymeric polymer matrix . as further shown in fig1 , the system includes a source of electromagnetic energy , communicatively connected to the cavity to transmit irradiating energy to the sample and detector material thereby inducing chemical excitation , electrical excitation , or single or multiphoton excitation to produce characteristic luminescence in the detector material . notably , the source used for applying electromagnetic energy can include any device that applies the necessary frequency or wavelength such as arc lamps , including mercury or xenon ; laser diode and led sources having the ability to generate single or multiple photons in a continuous or pulsing modes , wherein the intensity of said electromagnetic energy corresponds to absorption and subsequent luminescence of said detector molecule or detectable reaction . laser commonly employed are high - intensity monochromatic light sources , however , it should be noted that multiple point lasers are also envisioned . in another embodiment , using 2 - photon excitation at 700 - 1000 nm and also using short pulse width (& lt ; 50 pi ), high repetition rate ( 1 - 80 mhz ), laser diode and led ( 1 ns , 1 - 10 mhz ) sources provide enhanced sensitivity as compared to 1 - photon excitation . if a fluorophore absorbs two photons simultaneously , it will absorb enough energy to be raised to an excited state . the fluorophore will then emit a single photon with a wavelength that depends on the fluorophore used and typically in the visible spectra . the optical imaging / microwave system of the present invention includes not only the light source discussed herein above but also the optics needed to observe the emitted excitation signal , such as fluorescence . the light source emit lights , likely in the ultraviolet range and hits a dichroic mirror that reflects one range of wavelengths and allows another range to pass through . the dichroic mirror reflects the light to the sample for excitation of fluorescence within molecules in the sample and / or detector molecules . an objective lens collects the fluorescent - wavelength light produced . this fluorescent light passes through the dichroic mirror , and preferably a filter that eliminates wavelengths other than fluorescent , making it to the imaging device . preferably , the fluorescence microscope uses an epifluorescence setup wherein the objective lens is used both to focus the irradiating light onto the sample / detector molecule and also collect the fluorescent light emitted from the sample / detector molecule . the structure comprising the microwave cavity is constructed for connectivity to the optical imaging system wherein an opening is fabricated in the cavity for directing the focused light onto the sample and for existing of emitted fluorescent wavelength light . the light source generates a beam of light directed into the objective and preferably the beam of light is passed through a beam expander lens for expansion of the light beam sufficient to provide an expanded beam of excitation light entering into the cavity for focusing on the sample . excited emissions existing the cavity and through the objective can be detected using an optical detector . various optical detectors , such as photodiode , charge - coupled device ( ccd ), photomultiplier tube ( pmt ), or photon counting detector , may be used wherein each has a different degrees of sensitivity . pmt and photon counting detectors can achieve an electronic amplification factor as high as 10 6 - 10 8 . conventional pmts require a ˜ 1 kv power source , but new miniaturized detector requires only a 5 v . most of the chemiluminescence emission wavelengths are in the visible region . a narrow - band optical filter may be used to ensure detecting luminescence wavelengths . the system may further include a microactuator , detector , microprocessor , electronics , a display , and translation stage . the output of the detector may be interfaced to an analog to digital converter and a microprocessor to calculate analyte concentration . further , the system of the present invention may include a sample platform that is movable in xy and z directions . additionally , the use of a multi - point laser is considered for generating an array of point excitation directed to the objective for focusing on the sample , thereby creating an array of multiple focused spots . still further , the system can include means for adjusting lenses in the system to select focal points at different depths within the sample to impinge upon the detector molecule or detectable reaction at the object plane . notably , the systems can include a combination of components for delivering simultaneous or sequential spatially and / or temporally controlled electromagnetic radiation to control the activity of biological or chemical reactions that directly or indirectly relates to any small biomolecule , chemical molecule , any sized or collection of particles composed of any dielectric material , including any nanoparticles or carbon nanotubes , prokaryotic organism , eukaryotic organism and / or combination thereof . still further , the combined optical imaging and microwave system of the present invention may include an optical imaging system including but not limited to fluorescence , luminescence , wide - field , confocal reflected , confocal , two - photon , multiphoton , wide - field , spinning disk , nipkow spinning disk , 4 - pi confocal , fluorescence resonance energy transfer ( fret ) for imaging molecular interactions , total internal reflection fluorescence microscopy ( tirfm ) for imaging interactions of molecules with surfaces , multi - foci , multi - foci multiphoton , near - field , single molecule , spectral imaging , lifetime imaging , fluorescence imaging , fluorescence correlation spectroscopy , raster imaging correlation spectroscopy ( rics ), and image correlation spectroscopy ( ics ). premium quality aps - coated glass slides ( 75 × 25 mm ) were obtained from sigma - aldrich . coverwell imaging chamber gaskets with adhesive ( 2 . 5 mm diameter , 2 mm deep and 5 mm diameter , 2 mm deep for temperature measurements ) were obtained from molecular probes ( eugene , oreg .). ru ( by ) 2 cl 2 salt was obtained from sigma - aldrich . commercially available chemiluminescence materials were purchased from unique industries , inc . at the base of a microwave cavity ( 0 . 7 cu ft , ge compact microwave model : jes735bf , max power 700 w ), a 1 inch hole was drilled and subsequent exposed metal surfaces were covered with white enamel paint to prevent sparking and arcing . using a beam expander the spot size of a 473 nm laser source was expanded to approximately 1 inch and focused to a point with a 175 mm lens at the back aperture of the objective . the incident excitation beam was reflected with a dichroic mirror ( z479 / 532rpc , chroma , brattleboro , vt .) into an infinity corrected brightfield objective ( lwd plan achromat objective − lpl10 × objective / na = 0 . 25 ). the fluorescent emission intensity , which is generated by wide - field excitation working in epifluorescence mode , is collected through the infinity corrected optics and imaged onto a ccd camera using a razor edge 488 nm and a 570 lp filter to block any bleedthrough of the excitation light as shown in fig1 . chemiluminescence intensity images are imaged through the infinity corrected optics and imaged onto a ccd camera in the absence of any optical filters . ccd images were taken with a retiga - srv ccd camera ( qimaging , burnaby , b . c .) with 4 × 4 binning at 10 fps . emission spectra were collected using an ocean optics spectrometer , model sd 2000 ( dunedin , fla .) that is connected to an ocean optics 1000 μm diameter fiber with a na of 0 . 22 ( dunedin , fla .). a collimator is connected to the end of the fiber and positioned to maximize the coupling of the fluorescence emission into the spectrometer . ru ( by ) 2 cl 2 time - dependent emission spectra were collected with an integration time of 100 milliseconds . all exposed metal surfaces of the objective and adaptive optics were coated with white reflective paint to prevent sparking and arcing during the application of microwave pulses . the preparation of glass slides modified with ‘ bow - tie ’ structures has been described previously [ 23 ]. briefly , disjointed ‘ bow - tie ’ equilateral 2 . 5 mm triangles stencils were made from an adhesive mask . the disjointed ‘ bow - tie ’ structure was formed from two inverted 5 mm triangles , such that the distance between the apexes or gap size was approximately 2 - 3 mm , as shown in fig2 . triangle tape masks were affixed to plain glass slides and glass slides modified with ag triangle structures were created by vapor depositing 75 nm of au films on glass using an emf corp . ( ithaca , n . y .) vapor deposition instrument . film thicknesses were monitored during the deposition process with an edwards ftm6 film thickness monitor . glass substrates with and without modified ‘ bowtie ’ metal structures were cut into 10 × 10 mm sample sizes . image wells were placed between the two vapor deposited au triangles 75 nm thick or at the ‘ bowtie ’ gap and on the unmodified plain glass substrates . the samples were subsequently filled with 20 μl of 10 μm ru ( by ) 2 cl 2 solution or 6 μl of chemiluminescence material ( fig2 .). the commercially available glow - sticks contain a phenyl oxalate ester , a fluorescent probe and a glass capsule containing the activating agent ( hydrogen peroxide ). activation of the chemicals is accomplished by breaking an encapsulated glass capsule that contains the peroxide and subsequently mixes the chemicals to begin the chemiluminescence reaction . the hydrogen peroxide oxidizes the phenyl oxalate ester to a peroxyacid ester and phenol [ 24 ]. the unstable peroxyacid ester decomposes to a peroxy compound and phenol , the process chemically inducing an electronic excited state [ 24 ]. previously , ruthenium chloride aqueous solutions have been used to calibrate a temperature imaging system with a ccd sensor [ 25 ]. it is known that the emission intensity of these solutions decrease with temperature . the temperature dependence of the photophysical and photochemical properties of ruthenium chloride aqueous solutions have been described in detail elsewhere [ 26 , 27 ]. subsequently , a pre - calibrated intensity vs . temperature plot of a 10 μm aqueous solutions of ru ( by ) 2 cl 2 was recorded using a cary eclipse fluorescence spectrometer with temperature controller . calibration temperatures were 10 , 20 , 30 , 40 , 50 , 60 , and 70 ° c ., which is within the linear range of the relationship between the relative fluorescence to the temperature , as shown in fig3 [ 25 ]. for the microwave imaging experiments , the intensity of fluorescence emission was measured from 10 μm aqueous solutions of ru ( by ) 2 cl 2 on glass substrates in the presence and absence of the thin continuous metal film triangle geometries 75 nm thick ( fig3 ). ru ( by ) 2 cl 2 aqueous solutions were excited with a 473 nm laser source . before and during the application of a 5 second low power 2 . 45 ghz microwave pulses ( 10 % power ), the spectral emission from the ru ( by ) 2 cl 2 aqueous solutions was recorded at 100 millisecond time intervals for 20 seconds using the fiber detection and spectrometer optical configuration of fig1 . the recorded fluorescence spectral intensity from the ru ( by ) 2 cl 2 aqueous solutions on glass substrates and ‘ bow - tie ’ modified substrates before and during the application of the microwave pulse were normalized , as shown in fig3 . the normalized spectra are superimposed to determine if the microwave fields induce any spectral change to the ru ( by ) 2 cl 2 emission , as shown in fig4 . the ccd time dependent intensities are normalized with respect to the maximum emission intensity ( time = 0 ). normalized intensity ratios are calculated as the ratio of the time dependent emission intensity during to the maximum emission intensity before exposure to short microwave pulse . subsequently , these ratios multiplied by a factor of 0 . 9 ( fig3 , rt ) to reflect the normalized intensity ratio for 10 μm aqueous solutions of ru ( by ) 2 cl 2 at room temperature ( fig4 ). subsequently , the corresponding temperature values for microwave heated solutions on glass substrates and substrates with ‘ bow - tie geometries could be approximated from the pre - calibrated intensity vs . temperature plot of a ru ( by ) 2 cl 2 sample of the same concentration ( fig3 , arrow and dashed line ). total emission intensity images for ru ( by ) 2 cl 2 aqueous solutions and chemiluminescence samples were captured at frame rate of 10 hz using a ccd camera ( fig6 - 10 ). in order to obtain the same initial chemiluminescence emission for all measurements , approximately 6 μl of the chemiluminescence solution was placed inside the imaging chamber . data collection commenced 10 seconds prior to the application of the five second microwave pulse and continued until 20 seconds after microwave exposure . since it is well established that the emission intensity of ru ( by ) 2 cl 2 solutions are inversely proportional to temperature , the emission spectra for ru ( by ) 2 cl 2 solutions was recorded over a range of temperatures [ 28 ]. from these spectra , a linear relationship was observed between the emission intensity and temperature for the 10 μm ru ( by ) 2 cl 2 solutions between 10 ° c . and 70 ° c ., which is consistent with previously published results [ 23 ]. using the fiber detection configuration of the optical scheme ( fig1 ), the fluorescence intensity was recorded from the ru ( by ) 2 cl 2 aqueous solution at 100 millisecond time intervals for approximately 60 seconds . during the 60 second recording , we applied a five second 2 . 45 ghz pulse microwave pulse . normalized intensity vs . temperature plots of the ru ( by ) 2 cl 2 sample of the same concentration ( fig3 ) was fit to a linear function ( data not shown ). the approximate microwave induced maximum temperature increases to the solutions on the glass and ‘ bow - tie sample geometries are marked with an arrow and dashed line , respectively , as shown in fig3 . although only part of the ru ( by ) 2 cl 2 spectra is transmitted in the presence of the dichroic , the superimposed normalized intensity spectra of the ru ( by ) 2 cl 2 before the application of a microwave pulse is shown in fig4 . typically , spectral shifts in chromophore emission are ascribed to the changes in the electronic distribution of the energies of electronic transitions [ 29 ]. since the normalized intensity spectra of ru ( by ) 2 cl 2 solutions before the application of a microwave pulse ( fig4 , black line ) is not permuted during the application of a low power microwave pulse ( fig4 , dotted and dashed lines ), it was concluded that the microwave heating does not create any noticeable change in the photophysical properties of the ru ( by ) 2 cl 2 solutions [ 29 ]. using the ccd imaging configuration , the fluorescence intensity images was recorded of the ru ( by ) 2 cl 2 aqueous solutions on the glass substrates with and without ‘ bow - tie ’ structures in the microwave cavity at a frame rate of 10 hz for 10 seconds ( fig5 ). during image collection , samples were exposed to five second microwave pulses . the pre - microwave fluorescence intensity is averaged over a 100 pixel 2 region selected from the center of the image ( fig5 . insets , box outlines ). the average intensity vs . time data of the ccd images for the 10 μm ru ( by ) 2 cl 2 solution at disjointed ‘ bow - tie ’ junction and on plain glass slides ( control ) is normalized with respect to the maximum pre - microwave fluorescence intensity ( fig5 ) and scaled to the pre - calibrated room temperature normalized intensity ( fig3 and 9 at rt ). during exposure to the microwave pulse , a slight decrease in the fluorescence intensity was observed of the 10 μm ru ( by ) 2 cl 2 solutions on the glass substrates , which corresponds to a temperature increase of about 5 - 8 ° c . ( fig5 — top right , inset ). on the other hand , a significant decrease in the fluorescence intensity was observed of the 10 μm ru ( by ) 2 cl 2 solutions in the gap of a ‘ bow - tie ’ geometry during exposure to the microwave pulse ( fig5 — bottom right , inset ), recalling that emission is inversely proportional to temperature . with respect to calibration curve of the 10 μm ru ( by ) 2 cl 2 solutions intensity versus temperature , the temperature of the solutions on the glass substrate rose slightly above room temperature ( fig3 , glass ), while the change in intensity of the 10 μm ru ( by ) 2 cl 2 solutions in the gap of a ‘ bow - tie ’ geometry corresponds to a dramatic temperature decrease that is outside the linear range of the temperature versus intensity plot ( fig3 , dashed line ). real time movies of the decrease in fluorescence intensity of these solutions during exposure to a low power microwave pulse are shown here to demonstrate the functionality of the fluorescence microscope in a microwave cavity , as shown in fig6 a , b . in addition to real - time imaging of temperature dependent ru ( by ) 2 cl 2 solutions , the local ‘ triggering ’ of chemiluminescent solutions was also imaged to further validate the effectiveness of the microscope in a microwave concept . 6 μl of blue chemiluminescence solution was placed in an imaging well affixed to plain glass substrates and in the 2 mm gap of the continuous gold thin film bow - tie ’ geometry [ 23 , 30 ]. the chemiluminescence emission was recorded over at a frame rate of 10 hz for 10 seconds ( fig7 ). during the 10 second time interval , samples were exposed to a five second microwave pulse , which induces the ‘ triggered ’ emission or dramatic rise in the maximum photon flux , as shown in fig7 . discrete time points are labeled in fig7 and correspond to a ) steady state emission b ) emission upon initial exposure to microwave pulse c ) during the onset of microwave pulse d ) maximum ‘ triggered ’ emission during pulse and e ) final microwave emission . during recording of the disjointed ‘ bow - tie ’ geometries intensity images , the ccd camera gain was decreased by about a factor of 4 . 5 to prevent saturation . subsequently , the resulting ccd pixel intensities for the ‘ bow - tie ’ geometry are scaled accordingly to derive an absolute comparison to recorded chemiluminescence intensities from the glass substrates . ccd images of the chemiluminescence emission at these discrete time points are shown for the plain glass substrates ( fig8 ) and at the disjointed ‘ bow - tie junction ( fig9 ). pixel intensity scales for the both glass and ‘ bow - tie ’ images are equivalent to accurately reflect the dramatic increase in ‘ on - demand ’ photon flux from the chemiluminescent reactions . again , real time movies of the increase in ‘ photon flux ’ form the chemiluminescence solutions during exposure to a low power microwave pulse are shown here to demonstrate the functionality of the fluorescence microscope in a microwave , as shown in fig1 a , b . the feasibility of constructing a fluorescence microscope in a microwave cavity has been demonstrated herein . using this optical configuration , microwave induced real - time temperature decreases in 10 μm ru ( by ) 2 cl 2 solutions were observed on plain glass substrates and in proximity to discrete planar structure geometries . the chemiluminescence emission results show approximately 100 - fold increases in chemiluminescence emission from the ‘ bow - tie ’ geometry . with regards to the ‘ triggering of the chemiluminescent reactions , the ‘ triggered ’ emission commences from the side that is closest to the incident microwave field generated by the magnetron . the ccd images of the chemiluminescent solutions depict the acceleration of the chemiluminescent reactions due to microwave heating or dielectric loss to the chemiluminescence solution . since the right side of the image ( fig9 b ) is oriented closest to the magnetron , it is seen that the ‘ triggered ’ emission commence from the side closest to the microwave source . in a subsequent image ( fig9 c ), it was observed that the triggered emission from the wave reflected from the far wall of the cavity ( note : a standing wave is created in the cavity ). it is important to note that the ‘ bow - tie ’ tips are slightly offset to facilitate the viewing of ‘ triggered ’ emission that results from reflected waves in a microwave cavity . using the herein described microwave focused and triggering technologies , the feasibility of capturing real - time images of microwave induced solution heating and accelerated chemiluminescence reactions was demonstrated . the contents of the references discussed herein are incorporated by reference herein for all purposes . 1 . v . sridar , “ rate acceleration of fischer - indole cyclization by microwave irradiation ,” indian journal of chemistry section b - organic chemistry including medicinal chemistry 36 , 86 - 87 ( 1997 ). 3 . v . sridar , “ microwave radiation as a catalyst for chemical reactions ,” current science 74 , 446 - 450 ( 1998 ). 4 . r . s . varma , “ advances in green chemistry : chemical synthesis using microwave irradiation ,” ( astrazeneca research foundation , india , bangalore , 2002 ). 5 . c . o . kappe , “ high - speed combinatorial synthesis utilizing microwave irradiation ,” current opinion in chemical biology 6 , 314 - 320 ( 2002 ). 6 . d . adam , “ microwave chemistry : out of the kitchen ,” nature 421 , 571 - 572 ( 2003 ). 7 . k . aslan , s . n . malyn , and c . d . geddes , “ multicolor microwave - triggered metal - enhanced chemiluminescence ,” j am . chem . soc . 128 , 13372 - 13373 ( 2006 ). 8 . r . s . varma , “ solvent - free organic syntheses — using supported reagents and microwave irradiation ,” green chemistry 1 , 43 - 55 ( 1999 ). 9 . i . roy , and m . n . gupta , “ applications of microwaves in biological sciences ,” current science 85 , 1685 - 1693 ( 2003 ). 10 . r . gedye , f . smith , k . westaway , h . ali , l . baldisera , l . laberge , and j . rousell , “ the use of microwave - ovens for rapid organic - synthesis ,” tetrahedron letters 27 , 279 - 282 ( 1986 ). 11 . s . jain , s . sharma , and m . n . gupta , “ a microassay for protein determination using microwaves ,” analytical biochemistry 311 , 84 - 86 ( 2002 ). 12 . a . g . whittaker , and d . m . p . mingos , “ microwave - assisted solid - state reactions involving metal powders ,” j chem . soc . dalton trans . 12 , 2073 - 2079 ( 1995 ). 13 . s . caddick , “ microwave assisted organic reactions ,” tetrahedron 51 , 10403 - 10432 ( 1995 ). 14 . m . pagnotta , c . l . f . pooley , b . gurland , and m . choi , “ microwave activation of the mutarotation of alpha - d - glucose — an example of an intrinsic microwave effect ,” journal of physical organic chemistry 6 , 407 - 411 ( 1993 ). 15 . a . b . copty , y . neve - oz , i . barak , m . golosovsky , and d . davidov , “ evidence for a specific microwave radiation effect on the green fluorescent protein ,” biophysical journal 91 , 1413 - 1423 ( 2006 ). 16 . a . shaman , s . mizrahi , u . cogan , and e . shimoni , “ examining for possible non - thermal effects during heating in a microwave oven ,” food chemistry 103 , 444 - 453 ( 2007 ). 17 . r . k . adair , “ biophysical limits on athermal effects of rf and microwave radiation ,” bioelectromagnetics 24 , 39 - 48 ( 2003 ). 18 . k . r . foster , “ thermal and nonthermal mechanisms of interaction of radiofrequency energy with biological systems ,” ieee transactions on plasma science 28 , 15 - 23 ( 2000 ). 19 . r . weissenborn , k . diederichs , w . welte , g . maret , and t . gisler , “ non - thermal microwave effects on protein dynamics ? an x - ray diffraction study on tetragonal lysozyme crystals ,” acta crystallographica section d - biological crystallography 61 , 163 - 172 ( 2005 ). 20 . h . bohr , and j . bohr , “ microwave - enhanced folding and denaturation of globular proteins ,” physical review e 61 , 4310 - 4314 ( 2000 ). 21 . j . gellermann , w . wlodarczyk , b . hildebrandt , h . ganter , a . nicolau , b . rau , w . tilly , h . fahling , j . nadobny , r . felix , and p . wust , “ noninvasive magnetic resonance thermography of recurrent rectal carcinoma in a 1 . 5 tesla hybrid system ,” cancer research 65 , 5872 - 5880 ( 2005 ). 22 . k . hamad - schifferli , j . j . schwartz , a . t . santos , s . g . zhang , and j . m . jacobson , “ remote electronic control of dna hybridization through inductive coupling to an attached metal nanocrystal antenna ,” nature 415 , 152 - 155 ( 2002 ). 23 . m . j . r . previte , and c . d . geddes , “ spatial and temporal control of microwave triggered chemiluminescence : a rapid and sensitive small molecule detection platform ,” analytical chemistry in preparation ( 2007 ). 24 . c . l . r . catherall , t . f . palmer , and r . b . cundall , “ chemi - luminescence from reactions of bis ( pentachlorophenyl ) oxalate , hydrogen - peroxide and fluorescent compounds — kinetics and mechanism ,” journal of the chemical society — faraday transactions ii 80 , 823 - 836 ( 1984 ). 25 . o . filevich , and r . etchenique , “ 1d and 2d temperature imaging with a fluorescent ruthenium complex ,” analytical chemistry 78 , 7499 - 7503 ( 2006 ). 26 . b . durham , j . v . caspar , j . k . nagle , and t . j . meyer , “ photochemistry of ru ( bpy ) 3 2 + ,” journal of the american chemical society 104 , 4803 - 4810 ( 1982 ). 27 . j . vanhouten , and r . j . watts , “ temperature - dependence of photophysical and photochemical properties of tris ( 2 , 2 ′- bypridyl ) ruthenium ( ii ) ion in aqueous solution ,” journal of the american chemical society 98 , 4853 - 4858 ( 1976 ). 28 . o . filevich , and r . etchenique , “ 1d and 2d temperature imaging with a fluorescent ruthenium complex ,” analytical chemistry 78 , 7499 - 7503 ( 2006 ). 29 . n . a . nemkovich , a . n . rubinov , and a . t . tomin , “ inhomogeneous broadening of electronic spectra of dye molecules in solutions ,” in topics in fluorescence spectroscopy , vol . 2 , principles , j . r . lakowicz , ed . ( plenum press , new york , 1991 ), pp . 367 - 428 . 30 . m . j . r . previte , and c . d . geddes , “ microwave - triggered chemiluminescence with planar geometrical aluminum substrates : theory , simulation and experiment ,” journal of fluorescence 17 , 279 - 287 ( 2007 ).	6
hereinafter , embodiments of a navigation apparatus , a navigation server and a navigation system according to the present invention will be described in detail with reference to the drawings . fig1 is a structural diagram illustrating the configuration of the navigation system of the present invention . fig2 to fig4 are functional diagrams of the navigation system of the present invention . the configuration of the navigation system of the present invention will be described with reference to fig1 . the navigation system is comprised of a navigation server 100 , and a navigation apparatus 200 which is mounted in a vehicle ( mobile subject ) q . it should be noted that the navigation apparatus 200 may be mounted in a mobile subject other than a vehicle . it is also acceptable for the navigation apparatus 200 to be carried by a user . the navigation server 100 is comprised of one or a plurality of server computers . the navigation server 100 is provided with a first road traffic information storing element 101 , a second road traffic information storing element 102 , a situation information storing element 103 , a support map storing element 104 , a first support processing element 110 , and a second support processing element 120 . the first road traffic information storing element 101 is stored with first road traffic information ( required moving time , traffic congestion information or the like for an individual link ) on the basis of probe information ( position of an individual probe car at an individual time ) transmitted or uploaded from the navigation apparatus 200 to the navigation server 100 . the navigation apparatus 200 is mounted in a vehicle q which serves as a probe car or a floating car . the second road traffic information storing element 102 is stored with second road traffic information ( traffic regulation information , event information around an individual link , event type information if there were an event and the like , in addition to the required moving time and traffic congestion information for the individual link ) transmitted from a road traffic information center server or the like to the navigation server 100 . the situation information storing element 103 is stored with an area ( a specified area ) where a situation which is possible to exert obstruction against the moving or traveling of the vehicle q is happening or is possible to happen , and situation information of the situation ( summary of the situation , effect extent of the situation against the moving of the vehicle q ). the specified area and the situation information are associated to each other . the specified area and the situation information stored in the situation information storing element 103 may be updated appropriately according to the variations of the specified area and the situation information , respectively . the support map storing element 104 is stored with support map information . in the support map information , the location , shape and posture or the like of an individual link constituting a road are expressed by a series of coordinates (( latitude , longitude ), or ( latitude , longitude , altitude )). moreover , an individual link is tagged with link identification information for identifying the individual link and road type data . the boundary of an individual area is defined according to the series of coordinates of the support map information stored in the support map storing element 104 . the first support processing element 110 searches or retrieves the situation information from the situation information storing element 103 . the second support processing element 120 , on the basis of communication with the navigation apparatus 200 , causes the navigation apparatus 200 to recognize the specified area a and the situation information inf ( a ). the navigation apparatus 200 is comprised of an ecu or a computer mounted in the vehicle q as hardware , and a navigation program which provides the computer with various functions . it should be noted that the navigation program may be pre - installed in the memory ( rom ) in the vehicular computer ; or the entire or a part of the navigation program may be downloaded or broadcasted from a server ( not shown ) via a network or a satellite to the vehicular computer to store in the memory ( eeprom , ram ) or the like thereof at an arbitrary timing when there is a request or the like from the vehicular computer . the navigation apparatus 200 is provided with an input device 201 , an output device 202 , a navigation map storing element 204 , a first processing element 210 , and a second processing element 220 . the input device 201 is comprised of operating buttons disposed in a center console and a microphone in the vehicle q . it is possible for a user to perform various settings by operating or vocally instructing the input device 201 . the output device 202 is a display device disposed in the center console of the vehicle q for displaying or outputting map information or the like . the navigation map storing element 204 is stored with navigation map information or the like to be output to the output device 202 . in the navigation map information , the location , shape and posture or the like of an individual link constituting a road are expressed by a series of coordinates . moreover , an individual link is tagged with the link identification information for identifying the individual link . even the definitions of the coordinates in the navigation map information and the support map information are different due to the different specifications and data architectures therebetween , it is possible to match the links by tagging the identical links with common link identification information . the first processing element 210 searches or defines a navigation route r which is comprised of a plurality of links and joins a present position p 1 and a destination p 2 of the vehicle q . the second processing element 220 recognizes the specified area a and the situation information inf ( a ) representing a situation which will affect the moving of the vehicle q in the specified area a , and outputs the navigation route r defined by the first processing element 210 to the output device 202 . further , the second processing element 220 determines whether an entry position p in to the specified area a is present in the navigation r . on a condition that the presence of the entry position p in is determined , the second processing element 220 displays the entry position p in on a map based on the navigation map information and outputs an icon x having a design corresponding to the situation information inf ( a ) to the output device 202 . furthermore , the second processing element 220 recognizes a distance from the present position p 1 to the entry position p in along the searched navigation route r , and outputs a notification when the distance is equal to or smaller than a predefined distance . note that “ a component of the navigation server 100 or the navigation apparatus 200 which serves as hardware “ recognizes ” information ” means that the component performs a possible information processing on apiece of information to prepare the piece of information ready for other information processing , for example , the component receives the piece of information ; searches the piece of information in a database or memory or retrieves the piece of information from a database or memory ; calculates , estimates , configures , determines , searches the piece of information or the like via arithmetic processing on the basis of the received basic information or the like ; elicits information by decoding packages ; and stores in memory or the like the calculated information or the like . in addition , “ a component serving as hardware “ outputs ” information ” means that the component outputs the information in form of picture , voice , vibration and the like , which may be recognized by a human by means of five senses thereof such as eyesight , hearing , touch , etc . the function of the navigation system with the above - mentioned configuration will be explained with reference to fig2 through fig4 . the first processing element 210 in the navigation apparatus 200 recognizes the present position p 1 and the destination position p 2 of the vehicle q ( fig2 / s 211 ). the present position of the vehicle q is calculated or determined according to an arithmetic computation on gps signals received by a gps receiver , or output signals from a vehicular acceleration sensor or a vehicular gyro sensor . the destination position p 2 of the vehicle q is defined or recognized on the basis of operation signals inputted via the input device 201 to the navigation apparatus 200 or phonetic signals issued by the user . the first processing element 210 retrieves the navigation map information from the navigation map storing element 204 , and receives the road traffic information ( containing the first road traffic information and the second road traffic information ) distributed or broadcasted from the navigation server 100 . thereafter , on the basis of the navigation map information and the road traffic information , the first processing element 210 searches one or a plurality of routes joining the present position p 1 and the destination position p 2 of the vehicle q ( fig2 / s 212 ). the road traffic information contains cost ( required moving time or the like ) for an individual link . if the cost for a link where traffic regulation , for example , is probably conducted is high , a route which does not contain the link may be searched in high priority . accordingly , the navigation route r which joins the present position p 1 and the destination position p 2 of the vehicle q and contains a plurality of links is searched or defined , as illustrated in fig3 , for example . in the navigation server 100 , the first support processing element 110 searches the specified area a and the situation information inf ( a ) from the situation information storing element 103 ( fig2 / s 122 ). thereby , a framed specified area a illustrated in fig3 , for example , is recognized . the situation information inf ( a ) includes weather - relating information or natural phenomenon - relating information , such as “ the precipitation is surpassing 00 mm / h , therefore , it is possible for the floods or the earth - flow disaster to happen .”, “ the vision is bad due to fog .”, “ there is a earth fissure occurred .” and the like , and man - made disaster - related information , such as “ the vehicles involved in the traffic accident are still left on the road .”, “ there is a fire nearby .” and the like . thereafter , the second support processing element 120 distributes or broadcasts the specified area a and the situation information inf ( a ) to the navigation apparatus 200 ( fig2 / arrow a 1 ). accordingly , the second processing element 220 receives or recognizes the specified area a and the situation information inf ( a ) distributed or broadcasted from the navigation server 100 ( fig2 / s 221 ). thereafter , the second processing element 220 determines where the entry position p in to the specified area a is present in the navigation route r searched by the first processing element 210 ( fig2 / s 222 ). for example , in the case where the mobile subject is passing the specified area a in the searched navigation route r as illustrated in fig3 , the presence of the entry position p in is determined . in the case where the presence of the entry position p in is determined ( fig2 / s 222 . . . yes ), the second processing element 220 outputs the icon x indicating the entry position p in at the searched navigation router to the output device 202 ( fig2 / s 223 ). thereby , as illustrated in an example in fig4 , a map with the searched navigation route r , the icon x and the situation information inf ( a ) is displayed on the output device 202 . the design of the icon x is configured in association with the situation information inf ( a ) and is stored in memory . subsequently , the second processing element 220 recognizes or measures a distance from the present position p 1 of the vehicle q to the entry position p in to the specified area a . thereafter , the second processing element 220 determines whether the distance is within a predefined distance ( fig2 / s 224 ). if the determination result is positive ( fig2 / s 224 . . . yes ), an approaching notification indicating an approach to the entry position p in to the specified area a is outputted . thereby , for example , when the distance is equal to or smaller than the predefined distance , a piece of message , such as “ the road ahead is slippery due to rain .” or the like is displayed on the output device ( display device ) 202 ; or the aforementioned message or a pop sound is phonetically output to the output device ( speaker ) 202 . on the other hand , if the entry position p in is determined to be absent ( fig2 / s 222 . . . no ), the second processing element 220 retrieves the navigation route r from memory , overlaps the navigation route r on the map based on the navigation map information and output it to the output device 202 ( fig2 / s 226 ). according to the navigation system exhibiting the functions mentioned above , in the case where the vehicle q enters moves along the searched navigation route r , the enter to the specified area a and the situation information inf ( a ) of a situation happening in the specified area a or possible to happen in the specified area can be recognized by a user via the icon x which has a design corresponding to the situation information inf ( a ) to indicate the entry position p in to the specified area a ( refer to fig2 / s 223 and fig4 ). further , when the vehicle q approaches the entry position p in to the specified area a in the searched navigation route r , it will be recognized by the driver of the vehicle q via the output of the approaching notification ( refer to fig2 / s 225 ). furthermore , it is possible for the user to take an appropriate action according to the situation information , such as determining whether to detour the specified area , issuing a re - searching instruction for another route to the navigation apparatus on the basis of the determination , or detouring along the outputted navigation route . it is acceptable that the present position p 1 and the destination position p 2 of the vehicle q is transmitted or uploaded from the navigation apparatus 200 to the navigation server 100 , together with a navigation identifier for identifying the navigation apparatus 200 , a support route joining the present position p 1 and the destination position p 2 is defined on the basis of the support map information or the like stored in the support map storing element 203 in the navigation server 100 , and a link identifier of an individual link constituting a part of or the entire part of the support route is transmitted or uploaded as the road traffic information from the navigation server 100 to the navigation apparatus 200 having the navigation identifier . thereby , in the navigation apparatus 200 , the first processing element 210 may define a navigation route r which is partially or completely identical or similar to the support route ( refer to fig2 / s 212 and fig3 ). in other words , the navigation route r may be defined or set in the navigation apparatus 200 according to a definition algorithm for defining the support route in the navigation server 100 . although the present invention has been explained in relation to the preferred embodiments and drawings but not limited , it should be noted that other possible modifications and variations made without departing from the gist and scope of the invention will be comprised in the present invention . therefore , the appended claims encompass all such changes and modifications as falling within the gist and scope of the present invention .	6
fig1 illustrates a configuration for a prior art bootstrapping interference canceler which entitled &# 34 ; bootstrapping adaptive cross pol cancelers for satellite communications &# 34 ; in icc &# 39 ; 82 , philadelphia , pa ., at pages 4f . 5 . 1 - 4f . 5 . 5 . in this particular configuration , two cross - coupled interference cancellation loops each use a measure of the correlation between the two output signals as their source of feedback information . in fig1 the input to one rail 10 of the canceler will be designated s ( t )+ bn ( t ) comprising a first one of two orthogonally polarized signals , designated &# 34 ; s &# 34 ;, with some interference from a second one of the two orthogonally polarized signals designated &# 34 ; n &# 34 ;. the input on the other rail 11 is designated cs ( t )+ n ( t ) comprising the second one of the two orthogonally polarized signals , &# 34 ; n &# 34 ;, with some interference from the first one of the two orthogonally polarized signals , &# 34 ; s &# 34 ;. in the above designations , s ( t ) and n ( t ) are the first and second orthogonally polarized complex signals to be separated , and b and c are the complex depolarization coefficients . in the known canceler of fig1 the goal is to adjust a complex cancellation coefficient α so as to obtain an interference - free version of the first signal &# 34 ; s &# 34 ;, and to vary a cancellation coefficient β so as to obtain an interference - free version of the second signal &# 34 ; n &# 34 ;. this is accomplished by taking a sample of the first signal on rail 10 and sending it through a discriminator 12 to provide an output signal representative of the discrimination between the first signal s ( t ) and the interference bn ( t ), which output signal is correlated in correlator 13 with the signal cs ( t )+ n ( t ) found on rail 11 and the result of such correlation is then provided as an input to , for example , a power detector 14 . correlator 13 generally functions to measure the in - phase and quadrature components of the correlation between the signals from discriminator 12 and the signal from rail 11 . power detector 14 takes the result of this correlation and generates an output control signal which is used to appropriately adjust the cancellation coefficient β in circuitry 15 in a cross - over path from rail 10 to rail 11 to introduce a signal into rail 11 which cancels , or substantially reduces , the value of the interference cs ( t ) in the signal on rail 11 . an example of the above - described arrangement for elements 12 - 15 is shown and described in u . s . pat . no . 4 , 283 , 795 issued to m . l . steinberger on aug . 11 , 1981 . a similar arrangement , including a discriminator 16 , a correlator 17 , and a power detector 18 , is used with rail 11 to appropriately adjust the cancellation coefficient α in circuitry 19 in a cross - over path from rail 11 to rail 10 to introduce a signal into rail 10 which cancels , or substantially reduces , the value of the interference bn ( t ) in the signal on rail 10 . in the absence of the discriminator 12 or 16 , the two correlation measurements provided in correlators 13 and 17 would be the same , and the interference canceler could not possibly converge for both directions of cancellation . the purpose of discriminators 12 and 16 , again , is to provide discrimination between the signal and the interference on the appropriate output signal so that the corresponding correlation measurement is more sensitive to the interference than it is to the signal . when the discrimination function is present , then at least one cancellation loop can converge toward the desired cancellation . as the one cancellation loop converges , it provides a cleaner sample of interference to the other cancellation loop . with this cleaner sample of interference , the second cancellation loop can converge towards its desired cancellation , providing a cleaner sample of interference to the first cancellation loop . this allows the first cancellation loop to converge further , and the process is continued until complete interference cancellation has been obtained in both directions . the advantage of the bootstrapping configuration is that neither correlation measurement need be completely sensitive to the corresponding interference and completely insensitive to the signal . instead , all that is required is that there be a discrimination method which is somewhat more sensitive to the appropriate interference than it is to the corresponding signal . in the article &# 34 ; cross - coupled cancellation system for improving cross - polarisation discrimination &# 34 ; by d . h . brandwood in international conf . on antennas & amp ; propagation , london , nov . 1978 at pages 41 - 45 , an arrangement similar to that shown in fig1 is disclosed . in the adaptive cancellation system in fig2 of the article , it is suggested that limiters be used in the phase reference side of the correlators . a similar suggestion was made in the bar - ness et al article , parts of which will be summarized hereinafter for purposes of background understanding of the present invention . the bar - ness et al . article discloses a limiter simulation circuit which introduces two qpsk signals having slightly different baud rates as the two source signals . this limiter simulation circuit is shown in present fig2 for completeness of discussion . in fig2 the two modulators 20 and 21 are asynchronous in both clock and carrier phase . the output from each of modulators 20 and 21 is transmitted through a separate filter 22 and 23 , respectively . in a summation junction 24 , a small but variable amount of signal n , as obtained from filter 22 through a variable attenuating means 25 , was added to signal s , as obtained from filter 23 , and the resultant signal passed through a limiter or some other device under test ( dut ) 26 . the output from a limiter 26 was then correlated in correlators 27 and 28 with the signal s and the signal n , respectively , to obtain the associated output signals . from the bar - ness et al article , it was shown that the inclusion of a limiter provided small signal suppression . if two 64 qam source signals are substituted for the two qpsk source signals provided by modulators 20 and 21 in the limiter simulation circuit of fig2 and first a path which introduces no distortion is substituted as the ( dut ) 26 and a first test run is made , and then an ideal limiter is introduced for the dut 26 and another corresponding test is run , the results shown in fig3 would be obtained . in fig3 the dashed line represents the resultant curve for the ratio n / s of the signals at the input vs . the n / s ratio of the signals at the output in the arrangement of fig2 as found for an undistorted path being used for the limiter , while the solid line represents the resultant curve of the corresponding ratios when an ideal limiter is used as dut 26 . from fig3 it can be seen that the ideal limiter provides a slight amount of signal suppression , which agrees with the results of the bar - ness et al article . more particularly , when the interference is a nearly constant envelope , then the ideal limiter can be expected to display a small signal suppression . however , when the interference has large amplitude fluctuations , the small signal suppression is very slight . if one considers only those times at which the input envelope to the limiter in fig2 is above a given threshold , where presumably the desired signal is greater than both the threshold and the small undesired signal , it should result in greater suppression of the smaller signal . using the limiter arrangement shown in fig4 e . g ., an ecl schmitt - trigger circuit having the p in vs . p out characteristics shown in fig4 for the limiter or dut 26 in the simulation circuit of fig2 the results obtained are shown in fig5 . as shown in fig5 it was found that such limiter arrangement actually enhances the effect of the small signal , rather than suppressing it . in accordance with the present invention , this problem is overcome by the use of a novel noise - blanking limiter of the type shown in fig6 having the p in vs . p out characteristic shown in fig6 rather than the characteristic of the limiter of fig4 . this limiter comprises two ecl comparators 40 and 41 , where each comparator can comprise an operational amplifier including &# 34 ;+&# 34 ; and a &# 34 ;-&# 34 ; input terminals and an output terminal . the input signal to this limiter is applied to the &# 34 ;+&# 34 ; and &# 34 ;-&# 34 ; terminals of comparators 40 and 41 , respectively , via a capacitor 42 . the other input terminal of each of comparators 40 and 41 has applied thereto a separate threshold voltage for purposes of comparison . the output terminal of comparators 40 and 41 are each applied to a separate input terminal of an or gate 43 . the results obtained with the limiter of fig6 when tested as the dut in the arrangement of fig2 is shown in fig7 . as seen in fig7 different small signal suppressions are found over a wide range of thresholds . noise - blankers are well known . in this regard see , for example , u . s . pat . no . 140 , 445 issued to r . t . myers et al in july 7 , 1964 ; and u . s . pat . no . 3 , 699 , 457 issued to l . r . wright on oct . 17 , 1972 . noise blankers are generally used to suppress interference which has a high amplitude , but small duty cycle , such as ignition , impulse , or power line noise . with input cross - polarization signals , however , the interference has essentially ( a ) a one hundred percent duty cycle , and ( b ) a small amplitude which almost never exceeds the amplitude of the desired signal . therefore , with such signal , the application of a noise blanking limiter , as applied in the prior art , would have no effect whatsoever on such cross - polarized signals . fig8 is a block diagram of a bootstrapping cross - polarization canceler in accordance with the present invention which includes a noise - blanking limiter for use as a discriminator and a correlation means to provide interference suppression . the numbering of the elements of fig8 have been related to each of the numbers of the elements of fig1 where possible when a corresponding function exists , to provide an ease of understanding similar parts of the present cross - polarization canceler . in fig8 the input signal on rail 10 is connected to a delay line 50 and a β adjust circuit 15 in the cross - over path between rail 10 and rail 11 . similarly , the input signal on rail 11 is connected to a delay line 51 and an α adjust circuit 19 in the crossover path between rail 11 and rail 10 . delay lines 50 and 51 function to match the delay times encountered in adjusting circuits 19 and 15 , respectively . the outputs from delay line 50 and α adjust circuit 19 are added in an adder 53 , which can comprise a summing amplifier . the result of adding these two input signals in adder 53 is to provide an output signal from adder 53 with a reduced cross - polarization component &# 34 ; bn ( t )&# 34 ; on rail 10 . similarly , the outputs from delay line 51 and β adjust circuit 15 are added in an adder 54 to provide an output signal from adder 54 with a reduced cross - polarization component &# 34 ; cs ( t )&# 34 ; on rail 11 . the output from adder 53 is the output signal on rail 10 from the canceler and is also applied to a noise blanking limiter 12 , of the type shown in fig6 which functions as the discriminator 12 in the arrangement of fig1 . the output from noise blanking limiter 12 is correlated in correlation detector means 13 with the output signal on rail 11 , which can be amplified in an optional buffer amplifier 55 . the output from correlation detector means 13 is then applied to a digital signal processor ( dsp ) means 57 via , for example , an analog - to - digital ( a / d ) converter 58 . similarly , the output from adder 54 is the output signal on rail 11 from the canceler and is also applied to a noise blanking limiter 16 , of the type shown in fig6 which functions as the discriminator 16 in the arrangement of fig1 . the output from noise blanking limiter 16 is correlated in correlation detector means 17 with the output signal on rail 10 , which can be amplified in optional buffer amplifier 56 . noise blanking limiter 16 is shown with dashed lines to signify that only one of either one of noise blanking limiters 12 and 16 is actually required , since the present cross - polarization canceler will operate with only one noise - blanking limiter , but not as well as with both noise blanking limiters which is the preferred embodiment . the output of correlation detector means 17 is then applied to dsp means 57 via an a / d converter 59 . dsp means 57 functions , in accordance with steps stored in an associated eprom 115 , as both the power detecting means 14 and 18 in the arrangement of fig1 to provide appropriate control signals to adjusting circuits 15 and 19 for converging the present cross - polarization canceler . the output from the present cross - polarization canceler on rails 10 and 11 are then applied to a receiver terminal which appropriately demodulates the converged output signal &# 34 ; s ( t )&# 34 ; on rail 10 in a demodulator 60 using a predetermined carrier frequency generated by a carrier signal means 61 , and demodulates the converged output signal &# 34 ; n ( t )&# 34 ; on rail 11 in a demodulator 62 using a predetermined carrier frequency generated by a carrier signal means 61 . the output signals from demodulators 60 and 62 can be applied to optional pseudo error detector means 64 and 65 , respectively , which function to determined the error rate in each output signal . if such detector means are used , the output signal from detector means 64 and 65 , indicating the bit error rate in the output signals on rails 10 and 11 , respectively , can be applied as separate inputs to dsp means 57 . such error rate control signals can be then used by dsp means 57 to determine if such error rate is below or above a predetermined threshold level . if the error rate is below the threshold level , then dsp means 57 can use the control signals from detector means 64 and 65 in aiding in the converging of the canceler by monitoring if the bit error rate is increasing or decreasing . if , however , the error rate is above the threshold level , indicating , for example , an outage or trouble condition , dsp means 57 can be arranged to not use the output signals from detector means 64 and 65 in aiding the converging process of the canceler , for reasons stated previously , and in turn use the correlation measurements of correlation detector means 13 and 17 . in fig8 α and β adjusting means 19 and 15 are shown using a typical arrangement which is for purposes of explanation only and not for purposes of limitation since other and different circuitry can be used to obtain similar results . more particularly , each of adjusting means 15 and 19 are shown as including a tapped delay line with four delay sections 70 , four transversal taps with weighting circuits 71 , two optional recursive taps with weighting circuits 72 , a summing amplifier 73 , and a matching arrangement 74 . each of the optional recursive tap weighting circuit 72 outputs are combined and added to the input signal on the associated rail in summing amplifier 73 to provide a resultant output signal which is provided to the input of the delay line comprising delay sections 70 . the outputs from the weighting circuits 71 associated with the transversal taps are added together and added to the input signal of the other rail in associated added 53 or 54 . each of the weighting circuits 71 and 72 apply a separate predetermined weighting coefficient which is determined by dsp means 57 and transmitted to weighting circuits 71 and 72 via control signals on a tap weight control signal bus 75 . fig9 illustrates a block diagram of a typical noise - blanking limiter and correlation detector means for use in the canceler of fig8 . it is to be understood that the arrangement of fig9 applies to the combination of either one of noise - blanking limiter 12 and correlator detector means 13 or noise - blanking limiter 16 and correlation detector means 17 , since both combinations comprise the same arrangement . however , the discussion hereinafter of the arrangement of fig9 will be directed only toward the combination of noise - blanking limiter 12 and correlation detector means 13 . in fig9 the input signal on rail 10 , designated input a , propagates along rail 10 to the output and is also applied to noise - blanking limiter 12 . noise - blanking limiter 12 as shown in fig9 is an equivalent circuit to that shown in fig6 and comprises a first and second operational amplifier ( op - amp ) 80 and 81 with the input signal on rail 10 being applied to the &# 34 ;+&# 34 ; input terminal of each op - amp and a separate threshold level being applied to each &# 34 ;-&# 34 ; input terminal . the output of op - amp 80 is inverted and added to the non - inverted output from op - amp 81 and the resultant signal is concurrently applied to one input of a first exclusive - or ( ex - or ) gate 82 and through a delay circuit 83 to one input of a second ex - or gate 84 . for purposes of discussion , it will be assumed that the input to ex - or gate 84 is phase shifted by approximately 90 degrees from the input to ex - or gate 82 by delay circuit 83 . ex - or gates 82 and 84 are used to multiply the output of noise - blanking limiter 12 by a &# 34 ;+ 1 &# 34 ; or a &# 34 ;- 1 &# 34 ;, under control of the input control signals designated control 1 and control 2 from dsp 57 . each of the outputs from ex - or gates 82 and 84 are added to the signal propagating on rail 11 , designated signal b , in summing junctions 85 and 86 , respectively , which form part of correlator detector means 13 . the outputs of summing junctions 85 and 86 are , therefore , b ± a and b ± ja , respectively . the outputs from summing junctions 85 and 86 are then passed through a first and second passband filter 87 and 88 , respectively , and then into respective square law devices 89 and 90 . the passband filters 87 and 88 are used to remove higher frequency products from the output of the noise - blanking limiter 12 which would otherwise cause a dc offset in the square law devices 89 and 90 . the outputs from square law devices 89 and 90 can be optionally conditioned by opamp circuits 91 and 92 , respectively . the square law devices can comprise any suitable circuit as , for example , a differential pair of transistors arranged in a current - mirror configuration with the nonlinear element being the base - emitter junction of the input transistor which is biased to a quiescent current . the resultant combination of signals a and b at the output of correlator detector means 13 are shown in fig9 and are then sent to a / d converter 58 as shown in fig8 . to have the bootstrapping mode , however , in order to provide a convergence which is close to the capabilities of the cancellation network , it is preferred the correlation detector measure the correlation at the same number of relative delays as found in the cancellation network of adjusting means 15 or 19 . an exemplary approach is shown in fig1 where both noise - blanking limiters 12 and 16 are shown with the correlation detecting portion of correlator detecting means 13 and 17 . more particularly , noise blanking limiter 12 and 16 each comprise op - amps 80 and 81 connected as shown for limiter in fig9 . two outputs are obtained from this op - amp combination . the first output is the combination of the inverted output of op - amp 80 and the normal output of op - amp 81 , as provided in the arrangement of fig9 and the second output is an inverted output of op - amp 81 which is connected to one input of an ex - or gate 100 , the output of which acts as a true limiter . a similar arrangement is provided for noise blanking limiter 16 comprising op - amps 105 and 106 and ex - or gate 107 . the first output from noise blanking limiter 12 is provided to correlation detector means 17 where it is propagated through a tapped delay line portion thereof comprising separate predetermined delays 101 . each tap provides a first input to a separate ex - or gate 102 with the second input to each gate being provided from the second output from noise - blanking limiter 16 which is the limited signal b on rail 11 . it is to be understood that an ex - or gate can not only multiply a digital signal by &# 34 ;+ 1 &# 34 ; or &# 34 ;- 1 &# 34 ;, as found in gates 100 and 107 , but can also perform a mixing , or multiplication , function on two digital signals as found in gates 102 . therefore , ex - or gates 102 function to perform the correlation of one signal with the output of a noise blanking limiter . additional ex - or gates can be used to obtain both a correlation and its complement , so that the zero point of the correlation detector means could be removed . op - amp circuits 103 may also be required to condition the measured correlation for input to a / d converter 58 or 59 via a low - pass filter . a similar arrangement of delays 101 , ex - or gates 102 and op - amps 103 is provided in a corresponding portion of correlation detector means 13 . it is to be understood that the number of taps formed by delays 101 are preferably the same number as the number of taps found in either one of adjusting means 15 and 19 . each of the delays 101 has a same or different delay from that of the other delays 101 to provide predetermined correlation measurements at different offsets in time . in this manner the increased number of taps provide the added measurement points which improve the acquisition performance of the present canceler . fig1 is a block diagram of an exemplary arrangement of dsp 57 of fig8 . the control algorithm used is somewhat similar to that used in the interference canceler of u . s . pat . no . 4 , 320 , 535 issued to d . m . brady et al on mar . 16 , 1982 . as was stated hereinbefore , prior art cross - polarization cancelers had severe difficulties when the digital terminal lost the carrier and / or clock . if either the carrier or clock were lost , then the error indications from the pseudo error detector 64 or 65 no longer had any meaning and the cross - polarization canceler was without a desirable feedback signal . in the absence of cross - polarization cancellation , the cross - polarization interference prevented the digital terminal from re - acquiring carrier and clock in a timely manner . this problem can be solved with the present cross - polarization canceler by providing an optional primary source of feedback to dsp 57 from optional pseudo error detectors 64 and 65 , and a secondary source of feedback to dsp 57 from correlator detector means 13 and / or 17 , which is the primary source when feedback from detectors 64 and 65 is not present or usable . it is to be understood that the discussion of fig1 hereinafter assumes the use of pseudo error detectors 64 and 65 . however , it is to be understood that such feedback from detectors 64 and 65 is a supplementary feature of the present invention since the present novel canceler arrangement is capable of continuous operation using only the feedback from correlator detector means 13 and 17 . with this in mind , as shown in fig1 , the control signals corresponding to the correlation measurements from correlation detector means 13 and 17 are received and temporarily stored in a buffer 110 , while the control signals corresponding to the error count from optional pseudo error detectors 64 and 65 are temporarily stored in a buffer 111 . a processor 112 , which can comprise any suitable processing means such as a microprocessor or hard - wired circuit , can function to compare the pseudo error count control signals stored in buffer 111 with a predetermined threshold level and determine if an outage condition exists . if no outage condition exists , processor 112 places a switch 113 in a position to output the pseudo error count control signal onto lead 114 to each control channel 117 . if an outage condition exists , then processor 112 positions switch 113 to provide the correlation measurement control signal stored in buffer 110 as an output on lead 114 to each control channel 117 . processor 112 also addresses an associated read - only - memory ( rom ) 115 to obtain a predetermined dither signal corresponding to the error count or correlation measurement which is transmitted along lead 116 to each control channel 117 . a separate control channel 117 is provided for each of the transversal taps 71 and the optional recursive taps 71 in each of adjusting means 15 and 19 . each control channel is shown as including a multiplier 120 which multiplies the feedback control signal on lead 114 with the dither signal from rom 115 on lead 116 . the output signal from multiplier 120 is then filtered by two single pole low pass filtering means . the first filtering means comprises a summing circuit 121 which adds the output signal from multiplier 120 with a feedback signal obtained by multiplying the output from summer 121 in a multiplier 122 with a first constant &# 34 ; a2 &# 34 ; and then delaying the resultant signal by one sample signal period in a delay - by - 1 circuit 123 . the second filtering means is in series with the first filtering means and comprises a similar arrangement of a summing circuit 124 for summing the output from summer 121 with a feedback signal obtained by multiplying the output from summer 124 with a second constant &# 34 ; a1 &# 34 ; in multiplier 125 and delaying the resultant signal by one sample period in a delay - by - one circuit 126 . essentially , one filter is an integrator to provide the loop gain , and the other filter is a higher frequency filter which minimizes the effect of statistical variations in the pseudo error count or correlation measurement . the dither signal on lead 116 is also propagated down a second path 127 where it is multiplied by a constant &# 34 ; k &# 34 ; in multiplier 128 . the output from multiplier 128 is delayed by two sample periods in a delay means 129 to arrive at a summing means 130 at the same time as the twice delayed and adjusted control signal from summer 124 . summing means 130 adds the two signals and provides the output signal from the control channel to the associated tap 71 or 72 in an associated one of adjusting means 15 or 19 . it must be understood that when a dither signal is added to a control signal during a particular program cycle , it does not affect the control voltage until the beginning of the next program cycle . the feedback signal , which results from that dither signal , is , therefore , not available until the end of the second program cycle , and is not processed by the control algorithm until the third program cycle . the correction for this two - cycle delay is , therefore , built into the control algorithm . a switching means 131 , under the control of processor 112 , is provided at the output of the control channels 117 associated with the optional recursive taps 72 in an associated one of adjusting means 15 or 19 for the following reason . in the acquisition mode , using only the measured correlations from detector means 13 and / or 17 , the recursive taps in adjusting means 15 or 19 should be set to zero when present , thus setting the recursive equalizer to unity gain . this is achieved by processor means 112 positioning switch 131 to apply a ground at each of the recursive taps 72 . this is necessary because a recursive equalizer is capable of oscillating , which , if it were to occur , would cause a reduction in the measured correlations . since the dither algorithm is attempting to reduce the measured correlation , it will drive the recursive equalizer further into oscillation , which is undesirable .	7
fig1 shows an exploded view of the inner assembly of an accelerometer with internal temperature compensation . for purposes of clarity the outer package of the accelerometer which typically consists of a metal can and header with electrical connections is not shown . the inner accelerometer assembly includes system electronics 8 , an exemplary quartz proof mass 1 with support ring 9 and two support hinges 6 , bottom pole piece 3 , top pole piece 2 and torque feedback coil 5 . in the completed assembly the two pole pieces and proof mass are clamped together by screws 4 as shown in fig3 . in one embodiment , the support hinges 6 are laser trimmed , as described in the co - pending application entitled “ laser ablation of accelerometer proof mass .” the proof mass 1 is positioned between first and second pole pieces 2 and 3 and is able to move a small amount either toward pole piece 2 or toward pole piece 3 due to application of an acceleration or a pull of gravity . this movement is possible because the proof mass support ring has a slightly increased thickness at the top semicircular end 7 . the position of the proof mass is determined by measuring the capacitance between the top metalized surface of the proof mass and the bottom pole piece and between the bottom metalized surface of proof mass and the top pole piece . the bottom pole piece has a cylindrical permanent magnet 6 mounted within it . a feedback coil 5 is mounted to the proof mass and together with the magnetic field from the magnet produces a torque on the proof mass when energized with a current . the system electronics enables measurement of the two capacitances and equalization of them through application of current to the feedback coil thus continually centering the proof mass and balancing out applied accelerations . fig2 shows an exemplary temperature compensated accelerometer controller 102 . the controller 102 measures the current in the feedback coil 5 of the tba 108 , and the output is suitably filtered and digitized with the low pass filer and a / d converter 212 . the output of the a / d converter 212 is provided to a processor 210 in the controller 102 . the controller 102 may also include a temperature sensor 202 connected to the processor 210 for determining temperature of the environment of the electronic device 102 . it will be appreciated that the temperature sensor 202 may take many forms such as , for example , an electrical resistance thermometer which has a resistance which varies with temperature . the processor 210 runs a temperature adjustment module 110 . in some embodiments , the processor 210 may utilize data stored in a memory 214 of the electronic device 102 , such as a look - up table or formula , to determine a temperature correction factor to correct for bias factor and scale factor variations due to temperature in accordance with the measured temperature . that is , a temperature mapping may be used to determine a temperature compensation factor . because temperature sensitivity may vary between accelerometers , the temperature mapping ( e . g . the look - up table or formula ) for a particular tba may be constructed by measuring the accelerometer output over a range of temperatures in which the tba is intended to operate . the temperature correction factor can then be used to adjust the accelerometer output during measurement to compensate for the temperature sensitivity . the temperature mapping ( e . g . the look - up table or formula ) data may be provided in a memory of the ic , such as eeprom or flash memory . as shown in fig2 a , a digital to analog converter ( d / a converter ) can be driven by the processor 210 to provide analog output corresponding to acceleration . the processor 210 can run a serial communication module 112 that drives serial input / outputs 104 / 106 to communicate with an external processor reading for the acceleration data . the processor 210 may provide an industry standard interface such as an rs - 232 , spi or i2c interface for connecting to an external electronic device . fig3 shows another exemplary circuit with a temperature compensated accelerometer and support electronics . in this embodiment , a microprocessor 230 generates a pulse excitation signal through an amplifier 202 and a matched resistor array 204 whose outputs are provided to an accelerometer proof mass 210 . a differential amplifier 212 is connected to the proof mass 210 and the matched resistors 204 , and the output of the differential amplifier 212 is provided to a synchronous demodulator 214 whose output are is connected to a buffer 216 . the buffer drives a loop compensation unit 218 , which in turn is connected to a driver 220 . the output of the driver 220 is connected to a feedback drive coil 222 to generate an accelerometer analog signal output . an analog to digital converter ( adc ) 226 is connected to the accelerometer analog signal and sense resistor 224 . the processor 230 receives the output of the adc 226 . the processor 230 can also drive a dac 232 to provide temperature calibrated analog output , and the processor 230 reads from a temperature calibration memory 234 . in one exemplary embodiment , the processor 210 can store the following sensor constants in memory : memory constant description of constant 16 accelerometer offset correction ( milligees * 10 ) at − 25 c ., default 0 17 accelerometer offset correction ( milligees * 10 ) 0 c ., default 0 18 accelerometer offset correction ( milligees * 10 ) 25 c ., default 0 19 accelerometer offset correction ( milligees * 10 ) 50 c ., default 0 20 accelerometer offset correction ( milligees * 10 ) 75 c ., default 0 21 accelerometer offset correction ( milligees * 10 ) 100 c ., default 0 22 accelerometer offset correction ( milligees * 10 ) 125 c ., default 0 23 accelerometer offset correction ( milligees * 10 ) 150 c ., default 0 24 accelerometer offset correction ( milligees * 10 ) 175 c ., default 0 25 accelerometer scale factor ( v / gee ) @− 25 c ., default 1 , 000 26 accelerometer scale factor ( v / gee ) @ 0 c ., default 1 , 000 27 accelerometer scale factor ) v / gee ) @ 25 c ., default 1 , 000 28 accelerometer scale factor ( v / gee ) @ 50 c ., default 1 , 000 29 accelerometer scale factor ( v / gee ) @ 75 c ., default 1 , 000 30 accelerometer scale factor ( v / gee ) @ 100 c ., default 1 , 000 31 accelerometer scale factor ( v / gee ) @ 125 c ., default 1 , 000 32 accelerometer scale factor ( v / gee ) @ 150 c ., default 1 , 000 33 accelerometer scale factor ( v / gee ) @ 175 c ., default 1 , 000 the temperature compensated controller 102 enables the scale and offset calibration data to be measured at the factory and stored in the tba internal memory . by adding an internal microprocessor and an analog to digital converter to the tba electronics , the system can temperature - correct the accelerometer digital data output before transmission of the data . in addition by including a digital to analog converter to the system electronics it is possible to output an analog voltage proportional to acceleration that is temperature calibrated . the process of temperature calibration of the tba is lengthy in that it involves cooling and heating the system to various set temperatures e . g . − 25 , 0 , 25 , 50 , 75 , 100 , 125 , 150 , 175 degrees celsius and measuring the scale factor and offset at each temperature . by performing this process at the factory and downloading the calibration data to the tba memory instead of temperature calibrating the tba after it is installed in an external system , considerable time is saved by the user of the tba . in addition performing an external calibration of the tba requires considerable equipment and expertise . internal calibration performed at the factory hence removes the burden of the difficult and time consuming calibration process from the tba user . fig4 shows an exemplary factory calibration methodology . in this process , a plurality of tbas are put into a temperature controlled chamber system and the chamber performs cooling and heating the system to various set temperatures e . g . − 25 , 0 , 25 , 50 , 75 , 100 , 125 , 150 , and 175 degrees celsius . the tbas are interrogated and the factory system determines the scale factor and offset at each temperature for each tba . thus , in fig4 , the temperature range is specified in 302 , and the chamber heats the tbas to the first desired temperature in 304 . the tbas are queried and the factory system determines the scale factor and offset for each tba in 305 ; the measured data is saved in the factory system memory . the factory system checks to determine if all specified temperatures in the range in 310 have been selected and if this is true initiates a cool down to ambient temperature . if all temperatures have not been selected the factory system heats or cools the tbas to the next temperature in 311 and proceeds to measure the scale and offset data when the specified temperature is met . when all temperature measurements have been done , and the tbas have been cooled to ambient temperature , the calibration data is stored in the memory of each tba in 312 . by performing this process at the factory and downloading the calibration data to the tba memory , the user needs not perform the temperature calibration in the field . fig5 shows an exemplary temperature calibration methodology . in this process , the tba electronics system ( es ) determines the accelerometer output in 402 . next , the es determines a temperature corrected scale factor ( e . g . by the use of a look up table and linear interpolation ) in 404 . the es then determines a temperature corrected offset ( e . g . by use of a look up table and linear interpolation ) in 406 . finally the es generates both a temperature compensated digital output in 408 a temperature compensated analog output in 409 . in one illustrative example , the accelerometer analog output voltage is adjusted nominally to be (@ 25 c ) 1v = 1gee , and for the a to d converter , 2 . 5v = 32 , 768 counts . therefore 1 . 000v = 13 , 107 counts the scale factors for temperatures ranging from − 25 c to + 150 c are determined during the calibration process and stored in constants 25 - 33 . to determine the temperature corrected scale factor linear interpolation using constants 25 - 33 is used . these constants are encoded as 1 , 000 * actual scale constant . the values of the offset constants 16 to 24 are also determined during the temperature calibration process . to determine the temperature corrected offset , linear interpolation using constants 16 - 24 is used . offset constants are encoded as 10 times the actual offset value in milligees . temperature calibration example : temperature = 110 c a to d counts per volt = 16 , 000 counts / volt scale correction constant for 75 c , ( constant 30 ) 1 , 002 / 1000 = 1 . 002 v / gee scale correction constant for 125 c , ( constant 31 ) 1 , 007 / 1000 = 1 . 007 v / gee offset correction constant for 100 c constant 21 / 10 = 0 . 003 offset correction constant for 125 c constant 22 / 10 = 0 . 001 uncorrected a to d reading ad = 10 , 450 counts convert counts to volts v = 10 , 450 / 16000 = 0 . 6531 volts convert volts to gees ( linear interpolation ) gt = v /( scale correction constant 31 / 1000 )+( scale correction constant 31 − scale correction constant 30 )/ 1000 )( current temp − low base temp )/ temp bin width ) gt = 0 . 6531 /( 1 . 002 +( 1 . 007 − 1 . 002 )( 110 − 100 )/ 25 ) gt = 0 . 6531 / 1 . 005 = 0 . 6498 gee the scale factors always increase smoothly with increasing temperature because the system torqueing magnet field strength decreases with increasing temperature . offset ( os ) determination ( linear interpolation ) os =( constant 21 )+(( current temp − constant 21 temp )/ temp bin width )( constant 22 − constant 21 ) os = 0 . 003 +(( 110 − 100 )/ 25 )*( 0 . 001 − 0 . 003 ) os = 0 . 0022 temperature corrected scale and offset output , gto gto = g − os = 0 . 6498 − 0 . 0022 = 0 . 6476 gee thus , by adding an internal microprocessor and an analog to digital converter to the tba electronics , the system can perform temperature correct the accelerometer digital data output before transmission of the data . in addition by including a digital to analog converter to the system electronics one embodiment can output an analog voltage proportional to acceleration that is temperature calibrated . by performing this process at the factory and downloading the calibration data to the tba memory instead of temperature calibrating the tba after it is installed in an external system , considerable time is saved by the user of the tba . in addition performing an external calibration of the tba requires considerable equipment and expertise . internal calibration performed at the factory hence removes the burden of the difficult and time consuming calibration process from the tba user . while the present disclosure is primarily described in terms of methods , a person of ordinary skill in the art will understand that the present disclosure is also directed to various apparatus such as a handheld electronic device including components for performing at least some of the aspects and features of the described methods , be it by way of hardware components , software or any combination of the two , or in any other manner . moreover , an article of manufacture for use with the apparatus , such as a pre - recorded storage device or other similar computer readable medium including program instructions recorded thereon , or a computer data signal carrying computer readable program instructions may direct an apparatus to facilitate the practice of the described methods . it is understood that such apparatus , articles of manufacture , and computer data signals also come within the scope of the present disclosure . the embodiments of the present disclosure described above are intended to be examples only . those of skill in the art may effect alterations , modifications and variations to the particular embodiments without departing from the intended scope of the present disclosure . in particular , features from one or more of the above - described embodiments may be selected to create alternate embodiments comprised of a sub - combination of features which may not be explicitly described above . in addition , features from one or more of the above - described embodiments may be selected and combined to create alternate embodiments comprised of a combination of features which may not be explicitly described above . features suitable for such combinations and sub - combinations would be readily apparent to persons skilled in the art upon review of the present disclosure as a whole . the subject matter described herein and in the recited claims intends to cover and embrace all suitable changes in technology .	6
in standard abist designs for single - port array macros , one address counter is exclusively used to stimulate the address port of the array . a multi - port array with a separate read port and write port makes testing more complicated . one solution in the prior art sets up two distinct counters read and write address testing , but expedient increases the overall size of the abist engine significantly and also increases the complexity of the internal logic . as shown in fig1 , a simpler solution used in previous designs has been to hard - wire an inversion ( 4 ) of one bit of the main address port ( 1 ). the write address bits ( 2 ) come from the main address port while the read address bits ( 3 ) contain the low order inversion . this is done in order to make sure that the same address is not undergoing a read and write operation during the same cycle . if this operation , a simultaneous read from and write to the same cell , was to occur , the cell would be written to , but the read operation could not be guaranteed . while a simple inversion solution is acceptable , this does not allow for much flexibility or control of whatever address port is not connected directly to the address counter . a more flexible approach as described herein below increases testability . the method , system , and program product tests a multi - port memory array with an abist engine that provides test patterns to the array . the abist engine includes logic for controlling read and write addresses of the memory array to avoid simultaneously reading from and writing to the same cell . this is accomplished by setting ( through the abist engine ) mode bits for read / write address relationships . in order to accomplish this the abist engine multiplexes the mode bits to select bit or word addressing . the abist engine allows for logic transform from write addressing to read addressing , with the logic controlling a dynamic relationship between the read and write addresses of the macro to avoid simultaneously reading from and writing to the same cell . the control signals provide an address control configuration that avoids simultaneously reading from and writing to the same cell . the circuitry generates the read addresses from multi - port array address configuration logic . in one example the address configuration logic receives inputs indicating the abist engine mode , and if the abist engine is in the write mode outputting control bits and xor the control bits with a write address to produce a read address . the addressing produced by the abist can be an inversion of the write addressing , or equal to the write addressing , or inversions of the write addressing in the low or high order bits , or in the middle order bits . fig2 shows one solution to this problem . the write addresses ( 6 ) are still generated directly from the n - number address generation logic . ( 5 ) however , instead of a simple inversion , the read addresses ( 7 ) is generated from multi - port address reconfiguration logic . ( 8 ) fig3 shows a configuration with m - number latches providing various decoded configurations . scan - only latches ( 9 ) allow bits to be set that control the relationship between the write and read addresses . these bits are then processed through write control and multiplexing logic . ( 10 ) this logic receives inputs from other circuitry to know when the abist engine is in write mode and if the address counter is in bit mode or word mode . the logic block ( 10 ) will output k + 2 control bits , which are xored with n - number write addresses to produce n - number read addresses . ( 11 ) the method , system , and program product of our invention can generate a wide range of addresses . fig4 shows , as an example , what operations are available using only three scan latches . while eight distinct configurations are available , only four prove to be useful . the first configuration enables the read address to be the total inversion of the write address . ( 12 ) data is written from the starting address upward while data is read from the final address downward . these operations would cross over at the middle address of the array , and no array cell will be in read and write mode simultaneously . this is perhaps the most useful and important configuration of the four . the second configuration allows for the read address to equal the write address . ( 13 ) data can never be read from the array , but cells will be written with information . this configuration is used to test if the 2 - port array cell can indeed guarantee a write when the read and write addresses are equal . the third configuration provides for a read address that is equivalent to the write address except for the inversion of the low order bit . ( 14 ) this would allow for the reading and writing of 2 - port cells that are on the same wordline , which would provide meaningful test results . for the fourth illustrated mode of operation , the high order bit of the write address is inverted for the read address . ( 15 ) the reading of data from the array will begin from the middle of the array and will wrap around to the starting address at the end of the array . the writing of data will proceed from the starting address on upward . the other four configurations would provide combinations of inversions of the middle group of read address bits , which would be redundant and confusing to debug . these four modes of operation are a definite improvement over an inversion of a low or high order bit as in the prior art designs . it is also more cost - effective and efficient than having to add extra stand - alone latches for the read address counter . the flow diagrams depicted herein are illustrative examples . there may be many variations to these diagrams or the steps ( or operations ) described therein without departing from the spirit of the invention . for instance , the steps may be performed in a differing order , or steps may be added , deleted or modified . all of these variations are considered a part of the claimed invention . the invention may be implemented , for example , by having the bist read address generator as a software application ( as an operating system element ), a dedicated processor , or a dedicated processor with dedicated code . the code executes a sequence of machine - readable instructions , which can also be referred to as code . these instructions may reside in various types of signal - bearing media . in this respect , one aspect of the present invention concerns a program product , comprising a signal - bearing medium or signal - bearing media tangibly embodying a program of machine - readable instructions executable by a digital processing apparatus to perform a method for bist read address generator . this signal - bearing medium may comprise , for example , memory in a server . the memory in the server may be non - volatile storage , a data disc , or even memory on a vendor server for downloading to a processor for installation . alternatively , the instructions may be embodied in a signal - bearing medium such as the optical data storage disc . alternatively , the instructions may be stored on any of a variety of machine - readable data storage mediums or media , which may include , for example , a “ hard drive ”, a raid array , a ramac , a magnetic data storage diskette ( such as a floppy disk ), magnetic tape , digital optical tape , ram , rom , eprom , eeprom , flash memory , magneto - optical storage , paper punch cards , or any other suitable signal - bearing media including transmission media such as digital and / or analog communications links , which may be electrical , optical , and / or wireless . as an example , the machine - readable instructions may comprise software object code , compiled from a language such as “ c ++”. additionally , the program code may , for example , be compressed , encrypted , or both , and may include executable files , script files and wizards for installation , as in zip files and cab files . as used herein the term machine - readable instructions or code residing in or on signal - bearing media include all of the above means of delivery . while the preferred embodiment to the invention has been described , it will be understood that those skilled in the art , both now and in the future , may make various improvements and enhancements which fall within the scope of the claims which follow . these claims should be construed to maintain the proper protection for the invention first described .	6
referring first to fig1 ( a ) and 1 ( b ), a bag of the present invention is composed of two sidewalls 1 , 2 and a filter sheet 3 . in the embodiment in this drawing , the two sidewalls 1 , 2 are made from two plastic sheets , but these two sidewalls may be constructed by folding one sheet , needless to say . the two sidewalls 1 , 2 are sealed along three edges a1 , a2 and a3 thereof . however , as described hereinafter , the filter sheet 3 is interposed at a position a4 on the bottom sealing edge a3 between the opposite sidewalls 1 , 2 , and therefore the respective sidewalls 1 , 2 are not in contact with each other directly . as shown in fig1 ( b ), the filter sheet 3 is folded in two and its opposite end portions are stuck to the sidewalls 1 , 2 . the portion where the filter sheet 3 is stuck to the sidewall 1 is represented by a symbol b and the portion where it is stuck to the sidewall 2 is represented by a symbol c . at a position a4 where the filter sheet 3 is stuck to the bottom sealing edge a3 , the plastic material constituting the opposite sidewalls 1 , 2 penetrates through the filter sheet 3 , so that the respective portions of the folded filter sheet 3 are joined to each other hermetically at the position a4 , that is , so that the opposite sidewalls 1 , 2 are joined integrally and hermetically to the filter sheet 3 . an embodiment shown in fig2 is identical with the bag in fig1 with the exception that a partition wall d is additionally provided by sealing . this partition wall d can be separated into a portion d1 contacting with the filter sheet 3 and another portion d2 contacting with no filter sheet . at the portion d1 , the opposite sidewalls 1 , 2 are stuck to the filter sheet 3 , but the respective portions of the folded filter sheet 3 are not stuck to each other . at the portion d2 , the opposite sidewalls 1 , 2 are directly sealed . this partition wall d is not used when taking out a sample solution by a pipet but functions to prevent the sample solution from flowing out from the crude solution chamber x when the sample solution is poured from the sample chamber y into another container as in the conventional case . therefore , it is preferred that the partition wall is formed obliquely toward the bottom seal portion a3 in the crude solution chamber x . in the embodiment in fig3 ( a ) and ( b ), a filter sheet 3 is stuck , along the opposite edges thereof , to sidewalls 1 , 2 . the portion where the filter sheet 3 is stuck on the sidewall 1 is represented by a symbol b and the portion where it is stuck on the sidewall 2 is represented by a symbol c . as understood from the comparison with the embodiment in fig1 ( b ), one end portion of the filter sheet 3 is stuck to the sidewall 1 and the other portion thereof is stuck to the sidewall 2 . that is , one surface of the filter sheet 3 is stuck to the sidewall 1 and the other surface thereof is stuck to the sidewall 2 . since fig3 ( b ) shows an opened bag , the filter sheet 3 seems to be in a folded state , but when the bag is closed , the filter sheet 3 is not folded but straight . an embodiment shown in fig4 is identical with the bag in fig3 ( a ) and 3 ( b ) with the exception that a partition wall d is additionally provided . this partition wall d can be separated into a portion d1 contacting with the filter sheet 3 and another portion d2 contacting with no filter sheet 3 . at the portion d1 , the filter sheet 3 is stuck to the sidewall 1 but is not stuck to the sidewall 2 . this bag in fig4 can be used in the same manner as that in fig2 . examples of the usable raw materials for the sidewalls 1 , 2 include plastics such as polyethylenes , polypropylenes , polyesters and the like , and each of these raw materials may be used in the form of a film , a laminate , a film the inside surface of which is coated with a heat - sealing material , or the like . a usable raw material for the filter sheet 3 is a finely porous sheet in which at least either surface has heat - sealing properties and which is permeable to a liquid but impermeable to a solid material , and examples of raw materials for such sheet include synthetic resin nonwoven fabrics , perforated plastic sheets , and the like . the bags of the present invention can be piled , for example , every 10 bags , put in another large bag , sterilized with a radiation such as gamma rays , and then forwarded . when used , the bag of the present invention is opened . this operation can be easily carried out by sliding the opposite sidewalls 1 , 2 on each other at the filter sheet 3 where the sidewalls 1 , 2 do not adhere to each other . then , a specimen such as a piece of bread or the like and a sterilized physiological saline are placed in the crude solution chamber x of the bag . in this case , the total volume of these materials should be limited to one third of the depth of the bag , since when they are too much , the bag is difficult to handle . afterward , the opening inlet of the bag is clamped hermetically , and the bag is shaken to homogenize the contents therein sufficiently . the thus prepared sample solution is taken out by the use of a pipet or the like . a strip - like nonwoven fabric heat pack ( the japan paper industry co ., ltd ., 18 g / m 2 ) having heat - sealing properties on its one side and compo pack ( asahi chemical industry co ., ltd ., 20 g / m 2 ) were thermally stuck to the inside surface of a cylindrical film consisting of a polyester ( 12 μm ) and a polyethylene ( 60 μm ), in order to form a partition wall . next , the bottom portion of the cylindrical film was pressed at a high temperature to melt the polyethylene sufficiently , so that the latter was allowed to penetrate through the nonwoven fabric material and a strong heatsealing state was obtained , thereby preparing two kinds of bags ( which were the same as in fig1 ). a large bag consisting of a polyester ( 12 μm ) and a polyethylene ( 40 μm ) was packed with one hundred of the thus prepared examination bags , and was then irradiated with gamma rays of 1 . 5 mrod , thereby obtaining the product of the present invention . suitable amounts of a potato salad and a sterilized physiological saline were placed in the thus prepared bag of the present invention , and homogenization was then carried out by the use of a stomacher made by a . j . seward , uac house , london , england . as a result , a clean sample solution could be prepared in the sample solution chamber and could be taken out by a pipet . further , the bag was very easily opened at the portion where the filter sheet was present thereon , since at this portion , the films did not adhere to each other . a strip - like nonwoven fabric melfit ( teijin limited , 40 g / m 2 ) having heat sealing properties on its one side was thermally stuck to the inside surface of a cylindrical film consisting of a polyester ( 12 μm ) and a polyethylene ( 60 μm ). next , the bottom portion of the cylindrical film was heated and pressed sufficiently to seal this bottom portion hermetically , thereby preparing bags shown in fig1 . afterward , sterilization was similarly carried out by irradiation with gamma rays . subsequently , a potato salad was used as a specimen , and homogenization was then carried out by the use of a stomacher . as a result , a clean sample solution could be prepared in the sample solution chamber and could be taken out by a pipet . further , the sidewalls of the bag were very easily opened at the portion where the filter sheet was present thereon , since at this portion , the films did not adhere to each other . a strip - like nonwoven fabric bt 0706 w ( teijin limited , 35 g / m 2 ) having heat sealing properties on its opposite sides was stuck to the inside surface of a cylindrical film consisting of a polyester ( 12 μm ) and a polyethylene ( 60 μm ) so that one surface of the fabric material might be thermally stuck to one sidewall of the bag and the other surface thereof might be thermally stuck to the other sidewall of the bag . next , the bottom portion of the cylindrical film was pressed at a high temperature to form a bottom seal , thereby preparing bags ( which were the same as in fig3 ). a large bag consisting of a polyester ( 12 μm ) and a polyethylene ( 40 μm ) was packed with one hundred of the thus prepared examination bags , and was then irradiated with gamma rays of 1 . 5 mrod , thereby obtaining the product of the present invention . suitable amounts of a potato salad and a sterilized physiological saline were placed in the thus prepared bag of the present invention , and homogenization was then carried out by the use of a stomacher made by a . j . seward , uac house , london , england . as a result , a clean sample solution could be prepared in the sample solution chamber and could be taken out by a pipet . further , the bag was very easily opened at the portion where the filter sheet was present thereon , since at this portion , the films did not adhere to each other . as described above , according to the bag of the present invention , a solid material can be separated sanitarily from a crude solution in the bag , and it is possible to take out a sample solution from the bag by a pipet .	1
the present invention presents add - compare - select circuits and methods , and applications thereof . add - compare - select circuits and methods are used to implement digital communications systems such as , for example , digital communications systems employing convolutional encoding with viterbi decoding . convolutional encoding with viterbi decoding is a forward error correction technique that improves the capacity of a digital communications channel . viterbi decoding can be viewed as a process for identifying a most likely transition path through a trellis diagram representing possible state transitions in a digital communications system . fig1 a illustrates an example viterbi decoder 102 that can be implemented using the add - compare - select circuits and methods of the present invention . viterbi decoder 102 includes a branch metric unit 104 , an add - compare - select ( acs ) unit 106 , and a survivor path memory 108 . viterbi decoder 102 implements the viterbi algorithm to decode digital data sequences that have been encoded using a convolutional encoder ( not shown ). the branch metric unit 104 computes minimum or maximum branch metrics , λ ij , for a trellis diagram . as described herein , these branch metrics represent the difference between a received symbol and one or more symbols responsible for a state transition in the trellis diagram . once computed , the branch metrics , λ ij , are passed to the acs unit 106 . the acs unit 106 computes state metrics , γ j . this computation is performed using the branch metrics , λ ij , computed by branch metric unit 104 . acs unit 106 then compares the computed state metrics , γ j , and selects maximum or minimum state metrics , γ j , associated with survivor paths of the trellis diagram . survivor paths represent the paths in the trellis diagram that have the best metric ( e . g ., maximum or minimum state metric ) at a point in time under consideration . the survivor path memory 108 stores the survivor paths selected by acs unit 106 . a final determination of the best path is made from the stored survivor paths residing in the survivor path memory 108 . fig1 b further illustrates the acs unit 106 shown in fig1 a . as illustrated in fig1 b , the acs unit 106 includes an adder 110 , a code converter 112 , and a maximum / minimum select circuit 114 . the adder 10 is used to add state metrics and branch metrics to form new state metrics . these new state metrics are provided to code converter 112 . the code converter 112 re - codes the output of adder 110 ( the new state metrics ) and provides the re - coded output to the maximum / minimum select circuit 114 . this re - coding performed by code converter 112 simplifies the logic needed to implement the maximum / minimum select circuit 114 . in embodiments , the maximum / minimum select circuit 114 compares and selects either a maximum state metric or a minimum state metric from a group of state metrics . circuits according to the invention for implementing acs unit 106 are described in detail below . while only one adder 110 , one code converter 112 , and one maximum / minimum select circuit 114 are shown in fig1 b , it will be apparent to persons skilled in the relevant arts given the description herein that more than one adder 110 , more than one code converter 112 , and more than one maximum / minimum select circuit 114 can be used to implement acs unit 106 without departing from the scope of the present invention ( see , e . g ., fig8 ). fig2 illustrates an example trellis diagram 200 for a four - state viterbi decoder that can be implemented in accordance with the circuits and the methods of the present invention . the four states 0 , 1 , 2 , and 3 at time index “ n ” are indicated along the left side of the trellis diagram 200 . these four states each have an associated state metric ( i . e ., γ 0 ( n ), γ 1 ( n ), γ 2 ( n ), and γ 3 ( n )) that represents the accumulated metric along the shortest or longest path leading to the particular state . the four states 0 , 1 , 2 , and 3 at time index “ n + 1 ” are indicated on the right side of the trellis diagram 200 . as would be known to persons skilled in the relevant arts , the viterbi algorithm implemented by a viterbi decoder can be used to correct data transmission errors in a digital communication system . the viterbi algorithm involves , for example , determining the most likely path taken to reach a particular state of a given trellis diagram such as trellis diagram 200 . in embodiments , this is achieved by calculating all possible metrics for a particular state of the trellis diagram and selecting the path associated with either the maximum metric or the minimum metric as the most likely path taken to reach the particular state . the branch metrics λ ij ( n ) for the trellis diagram 200 are indicated along each path leading from one state at time index “ n ” to another state at time index “ n + 1 ”. the branch metric λ 01 ( n ), for example , represents the metric associated with a transition from state 0 to state 1 along branch 202 . the metric associated with the state 0 , for a transition along branch 202 , is equal to the sum of the metric associated with state 0 ( i . e ., γ 0 ( n )) and the metric λ 01 ( n ). as illustrated in fig2 , a state at time index “ n + 1 ” can be reached from more than one state at time index “ n ”. for example , the state 0 can be reached from 0 or from 1 . the metric for states 0 , 1 , 2 , and 3 of trellis diagram 200 at time index “ n + 1 ” are given by γ 0 ( n + 1 ), γ 1 ( n + 1 ), γ 2 ( n + 1 ), and γ 3 ( n + 1 ), respectively . in an embodiment , the state metrics γ 0 ( n + 1 ), γ 1 ( n + 1 ), γ 2 ( n + 1 ), and γ 3 ( n + 1 ) represent maximum metrics . the maximum metric for each state of trellis diagram 200 at time index “ n + 1 ” can be calculated using eqs . 1 – 4 below . γ 0 ( n + 1 )= max [ γ 0 ( n )+ λ 00 ( n ), γ 2 ( n )+ λ 20 ( n )] eq . 1 γ 2 ( n + 1 )= max [ γ 1 ( n )+ λ 12 ( n ), γ 3 ( n )+ λ 32 ( n )] eq . 2 γ 1 ( n + 1 )= max [ γ 0 ( n )+ λ 01 ( n ), γ 2 ( n )+ λ 21 ( n )] eq . 3 γ 3 ( n + 1 )= max [ γ 1 ( n )+ λ 13 ( n ), γ 3 ( n )+ λ 33 ( n )] eq . 4 where it is desired to identify the minimum metric for each state , the minimum ( min ) function can be used in place of the maximum ( max ) function in eqs . 1 – 4 . as would be known to persons skilled in the relevant arts , the operation of a viterbi decoder is often limited by speed bottlenecks found in add - compare - select circuits . these speed bottlenecks are created , for example , as a result of applying conventional design techniques to the recursive nature of add - compare - select operations . one technique that can be used to accelerate the operating speed of a viterbi decoder is to use an n - step look - ahead network , where n is an integer greater than 0 , to provide inputs to parallel processing pipelines . an advantage of using an n - step look - ahead network is that it will result in a fully connected trellis diagram such as the one illustrated in fig3 . fig3 illustrates a four - state trellis diagram 300 using 2 - steps of look - ahead . eq . 5 illustrates how to calculate the maximum path metric or state metric , γ 0 ( n + 2 ), for state 2 at a time index “ n + 2 ”. γ 0 ( n + 2 )= max [ γ 0 ( n )+ λ ′ 00 ( n + 1 ), γ 1 ( n )+ λ ′ 10 ( n + 1 ), γ 2 ( n )+ λ ′ 20 ( n + 1 ), γ 3 ( n )+ λ ′ 30 ( n + 1 )] eq . 5 where λ ′ ij ( n ) is the combined branch metric of the path i - j . the path metric , γ j ( n + 2 ), for the state “ j ” of trellis diagram 300 is given by eq . 6 . γ j ( n + 2 )= max j [ γ i ( n )+ λ ij ′( n )] ∀ i , j = 0 , 1 , 2 , 3 eq . 6 where it is desired to identify the minimum metric for each state , the minimum ( min ) function can be used in place of the maximum ( max ) function in eq . 6 . fig4 illustrates state transitions for three time - steps of a trellis diagram 402 for a four - state viterbi decoder . trellis diagram 402 can be used , for example , to form the trellis diagram 300 illustrated in fig3 . as described herein , the minimum metric for the states 0 , 1 , 2 , and 3 at time index “ n + 3 ” can be found using eq . 7 below . the computations for the state metrics γ 0 ( n + 2 ), γ 1 ( n + 2 ), γ 2 ( n + 2 ), and γ 3 ( n + 2 ) are given by eqs . 8 – 11 below . the state metric for the state γ 0 ( n + 3 ) is given by eq . 12 below . ⁢ eq . ⁢ 7 γ j ⁡ ( n + 3 ) = max j ⁢ [ γ i ⁡ ( n ) + λ ij ′ ⁡ ( n ) ] ⁢ ⁢ ∀ i , j = 0 , 1 , 2 , 3 ⁢ eq . ⁢ 8 γ 0 ⁡ ( n + 2 ) = min ⁡ [ γ 0 ⁡ ( n ) + { λ 00 ⁡ ( n ) + λ 00 ⁡ ( n + 1 ) } , γ 1 ⁡ ( n ) + { λ 12 ⁡ ( n ) + λ 20 ⁡ ( n + 1 ) } , γ 2 ⁡ ( n ) + { λ 20 ⁡ ( n ) + λ 00 ⁡ ( n + 1 ) } , γ 3 ⁡ ( n ) + { λ 32 ⁡ ( n ) + λ 20 ⁡ ( n + 1 ) } ] ⁢ eq . ⁢ 9 γ 1 ⁡ ( n + 2 ) = min ⁡ [ γ 0 ⁡ ( n ) + { λ 00 ⁡ ( n ) + λ 01 ⁡ ( n + 1 ) } , γ 1 ⁡ ( n ) + { λ 12 ⁡ ( n ) + λ 21 ⁡ ( n + 1 ) } , γ 2 ⁡ ( n ) + { λ 20 ⁡ ( n ) + λ 01 ⁡ ( n + 1 ) } , γ 3 ⁡ ( n ) + { λ 32 ⁡ ( n ) + λ 21 ⁡ ( n + 1 ) } ] ⁢ eq . ⁢ 10 γ 2 ⁡ ( n + 2 ) = min ⁡ [ γ 0 ⁡ ( n ) + { λ 01 ⁡ ( n ) + λ 12 ⁡ ( n + 1 ) } , γ 1 ⁡ ( n ) + { λ 13 ⁡ ( n ) + λ 32 ⁡ ( n + 1 ) } , γ 2 ⁡ ( n ) + { λ 21 ⁡ ( n ) + λ 12 ⁡ ( n + 1 ) } , γ 3 ⁡ ( n ) + { λ 33 ⁡ ( n ) + λ 32 ⁡ ( n + 1 ) } ] ⁢ eq . ⁢ 11 γ 3 ⁡ ( n + 2 ) = min ⁡ [ γ 0 ⁡ ( n ) + { λ 01 ⁡ ( n ) + λ 13 ⁡ ( n + 1 ) } , γ 1 ⁡ ( n ) + { γ 13 ⁡ ( n ) + λ 33 ⁡ ( n + 1 ) } , γ 2 ⁡ ( n ) + { λ 21 ⁡ ( n ) + λ 13 ⁡ ( n + 1 ) } , γ 3 ⁡ ( n ) + { γ 33 ⁡ ( n ) + λ 33 ⁡ ( n + 1 ) } ] ⁢ eq . ⁢ 12 γ 0 ⁡ ( n + 3 ) = min ⁡ [ γ 0 ⁡ ( n ) + min ⁢ { λ 00 ⁡ ( n ) + λ 00 ⁡ ( n + 1 ) + λ 00 ⁡ ( n + 2 ) , λ 01 ⁡ ( n ) + λ 12 ⁡ ( n + 1 ) + λ 20 ⁡ ( n + 2 ) } γ 1 ⁡ ( n ) + min ⁢ { λ 12 ⁡ ( n ) + λ 20 ⁡ ( n + 1 ) + λ 00 ⁡ ( n + 2 ) , λ 13 ⁡ ( n ) + λ 32 ⁡ ( n + 1 ) + λ 20 ⁡ ( n + 2 ) } γ 2 ⁡ ( n ) + min ⁢ { λ 20 ⁡ ( n ) + λ 00 ⁡ ( n + 1 ) + λ 00 ⁡ ( n + 2 ) , λ 21 ⁡ ( n ) + λ 12 ⁡ ( n + 1 ) + λ 20 ⁡ ( n + 2 ) } γ 3 ⁡ ( n ) + min ⁢ { λ 32 ⁡ ( n ) + λ 20 ⁡ ( n + 1 ) + λ 00 ⁡ ( n + 2 ) , λ 33 ⁡ ( n ) + λ 32 ⁡ ( n + 1 ) + λ 20 ⁡ ( n + 2 ) } ] the four - state trellis diagrams of fig3 and fig4 are provided for example only and not limitation . based on the teachings described herein , persons skilled in the relevant arts will recognize that other multi - state n - step look - ahead configurations can be formed and implemented in accordance with the present invention . for example , fig5 illustrates an 8 - state trellis diagram 502 , using 2 - steps of look - ahead , formed from a trellis diagram 504 . fig6 illustrates an 8 - state trellis diagram 602 , using 3 - steps of look - ahead , formed from a trellis diagram 604 . fig7 illustrates a partial 8 - state trellis diagram 702 , using 4 - steps of look - ahead , formed from a trellis diagram 704 . fig8 illustrates a section of an example most - significant - bit ( msb ) first acs unit 800 . acs unit 800 is used for processing 8 - bit words . acs unit 800 performs bit - wise operations . acs unit 800 shows only one bit - slice out of n - slices , where n is the number of states in the viterbi decoder . as shown in fig8 , acs unit 800 is formed from eight acs circuits 802 a – h . each acs circuit 802 includes an adder 110 , a code converter 112 , and a maximum / minimum select ( ms ) circuit 114 . for each acs circuit 802 , a feedback loop 804 couples a state metric output , γ 0 , i ( n + 1 ), of ms circuit 114 to an input of adder 110 . a delay device 806 placed in each feedback path 804 delays the state metrics , γ 0 , i ( n + 1 ), from reaching the input of adder 110 for a period of time ( t ). the eight acs circuits 802 a – h are interconnected as shown in fig8 . in some embodiments of the invention , each adder 110 is replaced by two adders . a first adder is used to perform the carry computation shown in fig8 . the second adder is used to perform the sum computation shown in fig8 . acs unit 800 contains a number of loops or paths . these loops or paths are illustrated in fig9 a – c . fig9 a illustrates a loop 902 . loop 902 includes adder 110 a , code converter 112 a , ms circuit 114 a , feedback path 804 a , and delay device 806 a . as shown in fig9 a , in embodiments , ms circuit 114 a comprises both a maximum / minimum select circuit ( m ) 904 a and a decision logic circuit ( d ) 906 a . the decision logic circuit 906 a is not included in loop 902 . loop 902 is representative of other similar loops in acs unit 800 . fig9 b illustrates a loop 910 . loop 910 includes adder 110 b , code converter 112 a , decision logic circuit 906 a , maximum / minimum select circuit 904 b , feedback path 804 b , and delay device 806 b . as can be seen by comparing loop 910 to loop 902 , loop 910 includes more devices than loop 902 . thus , the settling time of loop 910 following a change in branch metric inputs , λ 00 , j ( n ), is longer than the settling time of loop 902 . loop 902 is representative of other similar loops in acs unit 800 . fig9 c illustrates a path 920 of acs unit 800 . path 920 is a critical path for acs unit 920 ( i . e ., path 920 has the longest path settling time or operating time of any path in acs unit 800 following a change in inputs ). as shown in fig9 c , critical path 920 includes adder 110 a , code converter 112 a , and ms circuits 114 a – h . as can be seen from fig9 c , the critical path 920 of acs unit 800 will grow linearly with word - length if acs unit 800 is used to process longer length words ( e . g ., word lengths of 16 - bits , 32 - bits , or 64 - bits ). acs unit 800 can be retimed , however , to eliminate path 920 as the critical path of acs unit 800 . fig1 illustrates four cut - sets 1002 , 1004 , 10006 , and 1008 that can be used to retime acs unit 800 . the retiming of acs unit 800 using the cut - sets 1002 , 1004 , 1006 , and 1008 leads to the circuit 1100 shown in fig1 . fig1 illustrates the retimed circuit 1100 formed from acs unit 800 . the critical path of circuit 1100 is path 1102 . as shown in fig1 , path 1102 includes adders 110 b and 110 c , code converters 112 a and 112 b , ms circuits 114 a and 114 b , and feedback path 804 b . the settling time of path 1102 is the settling time of two adders , two code converters , and two ms circuits . an advantage of the retimed circuit 1100 is that its critical path will not grow with word - length . in a typical implementation , the computation time for an adder 110 is approximately 0 . 4 ns , the computation time for a code converter 112 is approximately 0 . 15 ns , and the computation time for an ms circuit 114 varies with the total number of states being implemented . for example , in a typical 8 - state viterbi decoder , the computation time for a ms circuit 114 is approximately 1 . 2 ns . a computation time of 1 . 2 ns is attributable to the decision logic circuit 906 and 0 . 8 ns is attributable to the maximum / minimum select circuit 904 . the maximum time of these two computation times is the computation time of ms circuit 114 . in a typical 4 - state viterbi decoder , the computation time for a ms circuit 114 is approximately 0 . 7 ns . this is because 0 . 7 ns is attributable to the decision logic circuit 906 and 0 . 4 ns is attributable to the maximum / minimum select circuit 904 . the increased computation time of the ms circuit 114 in an 8 - state viterbi decoder is due to the extra logic needed to select among a larger number of states . using the typical computation times stated above , the settling time of the critical path 1102 in fig1 ( for an 8 - state viterbi decoder ) is 3 . 1 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 8 ns ), and the computation time of one decision logic circuit 906 ( 1 . 2 ns ). this is greater than the loop bound of circuit 1100 ( i . e ., loop 910 shown in fig9 b ), which is 2 . 55 ns ( i . e ., the computation time of one adder 110 ( 0 . 4 ns ), the computation time of one code converter ( 0 . 15 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 8 ns ), and the computation time of one decision logic circuit 906 ( 1 . 2 ns )). the loop bound of loop 910 is also the iteration bound of circuit 1100 . using the typical computation times stated above for a 4 - state viterbi decoder , the settling time of the critical path 1102 is 2 . 2 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 4 ns ), and the computation time of one decision logic circuit 906 ( 0 . 7 ns ). this is greater than the loop bound of a 4 - state viterbi decoder circuit ( i . e ., loop 910 shown in fig9 b ), which is 1 . 65 ns ( i . e ., the computation time of one adder 110 ( 0 . 4 ns ), the computation time of one code converter ( 0 . 15 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 4 ns ), and the computation time of one decision logic circuit 906 ( 0 . 7 ns )). table 1 below summarizes the iteration bound times and the critical path times of a typical 4 - state viterbi decoder and a typical 8 - state viterbi decoder implemented using the circuits and methods described above . using the circuits and methods of the invention described below , the critical path times shown in table 1 can be further reduced . as described below , the present invention improves the retiming technique applied to acs unit 800 to form circuit 1100 by pipelining the functions of the acs unit . in this way , the acs unit can be retimed to achieve a critical path time that is closer to the iteration bound . fig1 illustrates a detailed view of the critical path 1102 of circuit 1100 . as shown in fig1 , during the retiming of acs unit 800 described above , delay devices 806 were placed between decision logic circuit 906 a and maximum / minimum select circuit 904 b and between decision logic circuit 906 a and between decision logic circuit 906 b . this is because the decision logic circuits 906 and the maximum / minimum select circuits 904 are conventionally not thought of and implemented as a single unit . this is also not so in accordance with the present invention . as shown in fig1 , in accordance with the invention , decision logic device 906 can be divided into a first decision logic segment ( d 1 ) 1302 and a second decision logic segment ( d 2 ) 1304 . this division allows for pipelining of the decision logic computations in accordance with the invention . the first decision logic segment 1302 has a first computation time t d1 . the second decision logic segment 1304 has a second computation time t d2 . by dividing up decision logic circuit 906 into two segments 1302 and 1304 , it becomes possible to place a pipelining delay ( e . g ., a delay 806 ) between segment 1302 and segment 1304 . placing a delay between the two segments 1302 and 1304 shortens the path 1102 formed during retiming of acs unit 800 . this feature of the present invention is further described below with reference to fig1 a and fig1 b . the computation times t d1 , and t d2 represent the time required for each decision logic segment to perform its computation . in an embodiment of the present invention , the computation time t d2 is set equal to a propagation delay time ( t ). the propagation delay time ( t ) is used to ensure that the calculations performed by the decision logic segment 1304 are completed at approximately the same time as the calculations performed in the code converter 112 . since decision logic segment 1304 and code converter 112 each provide an input to a decision logic segment 1302 , it is advantageous in embodiments to have these input values available for input to decision logic segment 1302 at approximately the same time . thus , in embodiments , the decision logic segment 1304 is designed to have a computation time approximately equal to the computation time of an adder 110 and code converter 112 ( i . e ., 0 . 4 ns + 0 . 15 ns = 0 . 55 ns or approximately 0 . 6 ns ). although fig1 illustrates dividing up decision logic circuit 906 , the invention is not limited to dividing up just decision logic circuit 906 to achieve pipelining and better retiming results . decision logic circuit 906 was selected for division in fig1 because it had the longest computation time of the devices included in critical path 1102 . in accordance with the present invention , other devices , units , or circuits in the critical path can be divided to achieve pipelining and better retiming results . fig1 a illustrates a circuit 1400 formed from acs unit 800 by dividing each of the decision logic circuits 906 of the ms circuits 114 into a first decision logic segment 1302 and a second decision logic segment 1304 as shown in fig1 . four cut - sets 1402 , 1404 , 1406 , and 1408 are shown in fig1 a . these four cut - sets are used to retime circuit 1400 and thereby form the circuit 1420 shown in fig1 b . as can be seen in fig1 a , the cut - set 1402 intersects the circuit branch between decision logic segment 1302 a and decision logic segment 1304 a . the cut - set 1404 intersects the circuit branch between decision logic segment 1302 c and decision logic segment 1304 c . the cut - set 1406 intersects the circuit branch between decision logic segment 1302 e and decision logic segment 1304 e . the cut - set 1408 intersects the circuit branch between decision logic segment 1302 g and decision logic segment 1304 g . fig1 b illustrates the retimed circuit 1420 formed from circuit 1400 . for the retimed circuit 1420 , the path 1422 includes adders 110 b and 110 c , code converters 112 a and 112 b , maximum / minimum select circuit 904 a , decision logic segment 1302 a , and feedback path 804 b . using the typical computation times stated above for an 8 - state viterbi decode , the settling time of the path 1422 is approximately 2 . 5 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), the computation time of one maximum / minimum select circuit 904 ( 0 . 8 ns ), and the computation time of one decision logic segment 1302 ( 0 . 6 ns ) ( i . e ., assuming segment 1304 has a computation time of 0 . 6 ns , the approximate computation time of an adder 110 and a code converter 112 ). this is less than the iteration bound of 2 . 55 ns ( see loop 902 in fig9 b ), thus path 1422 is no longer the critical path . two other paths present in circuit 1420 are path 1424 and path 1426 . path 1424 includes two adders 110 , two code converters 112 , and two maximum / minimum select circuits 904 . using the typical computation times stated above for an 8 - state viterbi decode , the settling time of the path 1424 is approximately 2 . 7 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), and the computation time of two maximum / minimum select circuit 904 ( 0 . 8 ns + 0 . 8 ns = 1 . 6 ns ). path 1426 includes one decision logic segment 1304 , one adder 110 , code converter 112 , and two maximum / minimum select circuits 904 . using the typical computation times stated above for an 8 - state viterbi decode , the settling time of the path 1424 is approximately 2 . 75 ns . this time is the computation time of one decision logic segment 1304 ( 0 . 6 ns ), the computation time of one adder 110 ( 0 . 4 ns ), the computation time of one code converter 112 ( 0 . 15 ns ), and the computation time of two maximum / minimum select circuit 904 ( 0 . 8 ns + 0 . 8 ns = 1 . 6 ns ). thus , based on the above stated computation times , path 1424 is the critical path of circuit 1420 . for the retimed circuit 1420 , using the typical computation times stated herein for a 4 - state viterbi decode , the settling time of the path 1424 is approximately 1 . 9 ns . this time is the computation time of two adders 110 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ), the computation time of two code converters 112 ( 0 . 15 ns + 0 . 15 ns = 0 . 3 ns ), and the computation time of two maximum / minimum select circuit 904 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ). the settling time of the path 1424 is approximately 1 . 7 ns . this time is the computation time of one decision logic segment 1304 ( 0 . 35 ns or one - half of the total computation time ( 0 . 7 ns ) of decision logic circuit 906 ), the computation time of one adder 110 ( 0 . 4 ns ), the computation time of one code converter 112 ( 0 . 15 ns ), and the computation time of two maximum / minimum select circuit 904 ( 0 . 4 ns + 0 . 4 ns = 0 . 8 ns ). based on these computation times , path 1424 is the critical path for a 4 - state viterbi decoder . as would be known to persons skilled in the relevant arts , once the critical path of a circuit has been determined , a clock period for the circuit can be set equal to the settling time of the critical path plus a margin factor . table 2 below shows the iteration bound and critical path results for a 4 - state viterbi decoder and an 8 - state viterbi decoder designed in accordance with both the pipelining and retiming techniques of the present invention described herein . as shown in table 2 , the present invention achieves critical path computation times that are close to the iteration bound . such computation times are not possible using conventional design techniques . fig1 illustrates an example circuit 1500 that can be used to implement code converter 112 in embodiments of the invention . circuit 1500 includes an and gate 1502 and an or gate 1504 . circuit 1500 recodes input sum and carry bits as illustrated in table 3 below . the digit ( c , s ) equals ( 1 , 0 ) is not permitted . fig1 illustrates an example circuit 1600 for implementing ms circuit 114 in embodiments of the invention . circuit 1600 performs bit - level maximum - select operations for a four - digit sequence {( c a , s a ), ( c b , s b ), ( c c , s c ), ( c d , s d )}. circuit 1600 operates as follows . a maximum select circuit 1602 is used to select the maximum digit of the digits ( c b , s b ), ( c c , s c ), and ( c d , s d . this maximum digit is shown in fig1 as ( c i max , s i max ) the digit ( c i max , s i max ) is passed to decision logic circuit 1604 . c i max is passed to or gate 1606 . s i max is passed to or gate 1608 . the digit ( c a , s a ) is combined with a preliminary decision value d i p , 0 using and gates 1610 and 1612 to produce a preliminary digit ( c i p , s i p ). c i p is provided to or gate 1606 . s i p is provided to or gate 1608 . or gates 1606 and 1608 are used to select the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) of the two digits ( c i p , s i p ) and ( c i max , s i max ). the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) is fed back to an adder 110 ( not shown ). as shown in fig1 , decision state values d i f , 0 and d i p , 0 are used in the selection of maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ), the value d i f , 0 is a final decision state value . the value d i p , 0 is a preliminary decision state value . when the values of the decision state values d i f , 0 and d i p , 0 equal ( 0 , 0 ), the preliminary digit ( c i p , s i p ) has lost in the comparison to digit ( c i max , s i max ) to be selected as the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ). when the values of the decision state values d i f , 0 and d i p , 0 equal ( 0 , 1 ), the preliminary digit ( c i p , s i p ) still has the potential to be selected over the digit ( c i max , s i max ) as the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ). when the values of the decision state values d i f , 0 and d i p , 0 equal ( 1 , 1 ), the preliminary digit ( c i p , s i p ) is winning the comparison to digit ( c i max , s i max ) to be selected as the maximum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) the decision state values d i f , 0 and d i p , 0 may never equal ( 1 , 0 ). the inputs to the decision logic circuit 1604 include the values c i max , s i max , d i f , d i p , c i f , and s i f . the digit ( c a , s a ) is combined with the final decision value d i f , 0 using and gates 1614 and 1616 to produce the final digit value ( c i f , s i f ). using some or all of these inputs , decision logic circuit 1604 computes two decision state values d i − 1 f , 0 and d i − 1 p , 0 . fig1 illustrates an example circuit 1700 that can be used for the decision logic circuit 1604 shown in fig1 . circuit 1700 includes three stages of 2 - to - 1 multiplexers . the first stage includes 2 - to - 1 multiplexers 1702 a , 1702 b , 1702 c and 1702 d . the second stage includes 2 - to - 1 multiplexers 1704 a , 1704 b , and 1704 c . the third stage includes 2 - to - 1 multiplexers 1706 a and 1706 b . the inputs to the first stage of 2 - to - 1 multiplexers include c i f , s i f , and d i p . the inputs to the second stage of 2 - to - 1 multiplexers include s i max and the outputs of the first stage of 2 - to - 1 multiplexers . the inputs to the third stage of 2 - to - 1 multiplexers include c i max and the outputs of the second stage of 2 - to - 1 multiplexers . circuit 1700 generates the two decision state values d i − 1 f , 0 and d i − 1 p , 0 in accordance with the mapping shown in table 4 below . fig1 illustrates a circuit 1800 formed by applying the pipelining technique of the present invention to the circuit 1700 . as shown in fig1 , circuit 1800 includes four delays 1802 , 1804 , 1806 , and 1808 . delay 1802 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 1702 a to the input of 2 - to - 1 multiplexer 1704 a . delay 1804 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 1702 c to the inputs of 2 - to - 1 multiplexers 1704 a and 1704 b . delay 1806 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 1702 b to the inputs of 2 - to - 1 multiplexers 1704 b and 1704 c . delay 1808 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 1702 d to the input of 2 - to - 1 multiplexer 1704 c . the four delays 1802 , 1804 , 1806 , and 1808 in circuit 1800 divide the circuit 1800 into part of a first decision logic segment 1820 and a second decision logic segment 1840 . the first decision logic segment 1820 includes the four 2 - to - 1 multiplexers 1702 a – d ( shown in fig1 ), the maximum select circuit 1602 ( shown in fig1 ), and the two and gates 1614 and 1616 ( shown in fig1 ). assume the computation time of each 2 - to - 1 multiplexer in circuit 1800 is approximately 0 . 2 ns . further assume , the computation time of and gates 1614 and 1616 are 0 . 2 ns each , and the computation time of maximum select circuit 1602 is 0 . 4 ns . then , the operating time or critical path of decision logic segment 1820 is approximately 0 . 4 ns . the operating time of decision logic segment 1840 is also approximately 0 . 4 ns . fig1 illustrates a circuit 1900 formed by applying the pipelining technique of the present invention to the circuit 1600 . as shown in fig1 , circuit 1900 includes two delays 1902 and 1904 . delay 1902 is located in the circuit branch that connect or gate 1906 to the decision logic circuit 1604 . delay 1904 is located in the circuit branch that connect or gate 1908 to the decision logic circuit 1604 . fig2 illustrates a minimum - select circuit 2000 that can be used to implement a minimum - select embodiment of ms circuit 114 . circuit 2000 operates as follows . a minimum select circuit 2002 is used to select the minimum digit of the digits ( c b , s b ), ( c c , s c ), and ( c d , s d ). this minimum digit is shown in fig2 as ( c i min , s i min ) the digit ( c i min , s i min ) is passed to decision logic circuit 2004 . c i min is passed to and gate 2006 . s i min is passed to and gate 2008 . the digit ( c a , s a ) is combined with a preliminary decision value d i p , 0 using or gates 2010 and 2012 to produce a preliminary digit ( c i p , s i p ). c i p is provided to and gate 2006 . s i p is provided to and gate 2008 . and gates 2006 and 2008 are used to select the minimum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) of the two digits ( c i p , s i p ) and ( c i min , s i min ). the minimum digit ( c i 0 ( n + 1 ) , s i 0 ( n + 1 ) ) is fed back to an adder 110 ( not shown ). features similar to those described above with reference to circuit 1600 are also found in circuit 2000 . fig2 illustrates an example circuit 2100 that can be used for the decision logic circuit 2004 shown in fig2 . circuit 2100 includes three stages of 2 - to - 1 multiplexers . the first stage includes 2 - to - 1 multiplexers 2102 a , 2102 b , 2102 c and 2102 d . the second stage includes 2 - to - 1 multiplexers 2104 a , 2104 b , and 2104 c . the third stage includes 2 - to - 1 multiplexers 2106 a and 2106 b . the inputs to the first stage of 2 - to - 1 multiplexers include c i f , s i f , and d i p . the inputs to the second stage of 2 - to - 1 multiplexers include s i min and the outputs of the first stage of 2 - to - 1 multiplexers . the inputs to the third stage of 2 - to - 1 multiplexers include c i min and the outputs of the second stage of 2 - to - 1 multiplexers . circuit 2100 generates two decision state values d i − 1 f , 0 and d i − 1 p , 0 in accordance with the mapping shown in table 5 below . fig2 illustrates a circuit 2200 formed by applying the pipelining technique of the present invention to the circuit 2100 . as shown in fig2 , circuit 2200 includes four delays 2202 , 2204 , 2206 , and 2208 . delay 2202 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 2102 a to the input of 2 - to - 1 multiplexer 2104 a . delay 2204 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 2102 c to the inputs of 2 - to - 1 multiplexers 2104 a and 2104 b . delay 2206 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 2102 b to the inputs of 2 - to - 1 multiplexers 2104 b and 2104 c . delay 2208 is located in the circuit branch connecting the output of 2 - to - 1 multiplexer 2102 d to the input of 2 - to - 1 multiplexer 2104 c . the four delays 2202 , 2204 , 2206 , and 2208 in circuit 2200 divide the circuit 2200 into part of a first decision logic segment 2220 and a second decision logic segment 2240 . the first decision logic segment 2220 includes the four 2 - to - 1 multiplexers 2102 a – d ( shown in fig2 ), the minimum select circuit 2002 ( shown in fig2 ), and the two and gates 2014 and 2016 ( shown in fig2 ). assume the computation time of each 2 - to - 1 multiplexer in circuit 2200 is approximately 0 . 2 ns . further assume , the computation time of and gates 2014 and 2016 are 0 . 2 ns each , and the computation time of minimum select circuit 2002 is 0 . 4 ns . then , the operating time or critical path of decision logic segment 2220 is approximately 0 . 4 ns . the operating time of decision logic segment 2240 is also approximately 0 . 4 ns . fig2 illustrates a circuit 2300 formed by applying the pipelining technique of the present invention to the circuit 2000 . as shown in fig2 , circuit 2300 includes two delays 2302 and 2304 . delay 2302 is located in the circuit branch that connect and gate 2306 to the decision logic circuit 2004 . delay 2304 is located in the circuit branch that connect and gate 2308 to the decision logic circuit 2004 . referring to fig2 a and fig2 b , it has been observed that a number of common computations are used by the various decision logic circuits and the various maximum / minimum select circuits described herein . these decision logic circuits and maximum / minimum select circuits are represented in fig2 a by a decision logic circuit 2402 and a maximum / minimum select circuit 2404 . accordingly , in an embodiment of the present invention , a preprocessing block 2406 is provided to calculate at least one common computation for use by the decision logic circuit 2402 and the maximum / minimum select circuit 2404 . this allows for the removal of at least some common hardware from decision logic circuit 2402 and the maximum / minimum select circuit 2404 to form the decision logic circuit 2408 and the maximum / minimum select circuit 2409 shown in fig2 b . as described herein , the present invention can be used to design and implement high - speed digital communications circuits and systems that cannot be designed and implemented using conventional circuits and techniques . this point is illustrated by the following example . consider , for a moment , how to implement a 10 gb / s viterbi decoder . as would be known to persons skilled in the relevant arts , in order to implement a 10 gb / s viterbi decoder some form of parallel viterbi decoding using look - ahead or a sliding block viterbi decoder is needed . in a conventional implementation , an 8 - state viterbi decoder requires a clock period of at least 3 . 4 ns . this is based on a 3 . 1 ns critical path and a clock setup / hold time of 0 . 3 ns . unfortunately , this does not permit a 32 - parallel design using conventional msb - first pipelined operations because a 32 - parallel design must be clocked with a clock period of 3 . 2 ns to achieve a decoding speed of 10 gb / s . thus , using conventional circuits and design techniques , a 10 gb / s viterbi decoder must be implemented using either a 64 - parallel design in a look - ahead viterbi decoder or a 48 - parallel design in a sliding - block viterbi decoder . in a look - ahead parallel viterbi decoder , the level of parallelism is constrained to be a power of two ( e . g ., 2 x ). in a sliding - block viterbi decoder , the level of parallelism is assumed to be a multiple of eight ( e . g ., 8 ×). using the circuits and methods of the present invention described herein , an 8 - state viterbi decoder can be implemented that has a critical path of only 2 . 7 ns . how this is achieved is described above . thus , using a clock setup / hold time of 0 . 3 ns , an 8 - state viterbi decoder designed and implemented in accordance with the present invention can be clocked with a clock period of 3 ns . in this way , a 32 - parallel implementation for achieving a 10 gb / s viterbi decoder is feasible . further features and advantages of the present invention will become apparent to persons skilled in the relevant arts given the description herein . various embodiments of the present invention have been described above . it should be understood that these embodiments have been presented by way of example only , and not limitation . it will be understood by those skilled in the relevant arts that various changes in form and details of the embodiments described above may be made without departing from the spirit and scope of the present invention as defined in the claims . thus , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .	7
it will be readily understood that the components of the present invention , as generally described and illustrated in the drawings herein , could be arranged and designed in a wide variety of different configurations . thus , the following more detailed description of the embodiments of the system and method of the present invention , as represented in the drawings , is not intended to limit the scope of the invention , as claimed , but is merely representative of various embodiments of the invention . the illustrated embodiments of the invention will be best understood by reference to the drawings , wherein like parts are designated by like numerals throughout . referring to fig1 , an apparatus 10 in accordance with the invention may include a vessel 12 or distributor 12 . the distributor 12 may be configured to be flexible or may be pre - formed to fit the anatomy of a user . typically , the distributor 12 will be placed on the upper lip of a user to provide the outputs 14 ( e . g ., output ports 14 , or simply ports 14 ) access to the nostrils of a user during breathing . each of the outputs 14 has an opening 15 for delivering nitric oxide directly into the nostrils of a user . typically , sufficient clearance provides a bypass for air in addition to the nitric oxide from the distributor 12 . in certain embodiments of an apparatus in accordance with the invention , a distributor 12 may include a port 16 to operate as an input 16 for receiving nitric oxide from another source . for example , the port 16 may have an opening 17 for receiving from a line 18 a supply of nitric oxide . in the illustrated embodiment , a reactor 20 provides a supply of nitric oxide to the distributor 12 . as illustrated , one end 22 of a line 18 may connect to the input port 16 of the distributor 12 . the opposite end 24 of the line 18 connects to the reactor 20 . the opening 26 of the line 18 provides a lumina 26 value or passage 26 for passing the nitric oxide gas from the opening 28 of the fitting 30 on the reservoir 20 . in certain embodiments , the reactor 20 may be manufactured in a single - dose size . accordingly , the distributor may be reused or disposed of . the reactor 20 may typically be disposed of after a single use . circumferential hoop stresses are not high . accordingly , the distributor 12 , the line 18 , and the reactor 20 may all be fabricated from comparatively lightweight and inexpensive materials such as plastic . parts may be cast , molded , vacuum formed , assembled from film , or the like . referring to fig2 , the distributor 12 may be configured in various cross - sectional shapes . for example , the distributor 12 may typically have a principal wall 32 enclosing a chamber 34 or volume 34 containing all necessary materials for therapy , thereby creating a continuous , or monolithic , distributor 12 containing all necessary materials for therapy . in certain embodiments , the chamber 34 may simply act as a manifold or distributor channel conducting nitric oxide gas . in other embodiments , the chamber 34 may completely enclose the reaction constituents and structures . thus , the distributor 12 may serve as both a distributor 12 and reactor 20 in a single , integrated apparatus 10 ( monolithic apparatus ). in various embodiments , the chamber 34 may include a vessel 36 inside or completely enclosed within the wall 32 and chamber 34 of the distributor 12 . the internal vessel 36 may have a wall 38 that is permeable or impermeable . in certain embodiments , the vessel 36 may have a wall 38 formed of glass to maintain the vessel 36 sealed from the contents of the chamber 34 . accordingly , upon fracture of the wall 38 , the contents of the vessel 36 may be spilled into the chamber 34 to mix with other reactants . in certain embodiments , the chamber 40 formed by the wall 38 of the vessel 36 may contain a reactant . in other embodiments , the chamber 40 may simply contain a liquid . in yet other embodiments , the chamber 40 may contain dry ingredients that will become exposed to liquid from the chamber 34 upon fracture of the wall 38 and exposure of the chamber 40 to the contents of the chamber 34 . all the foregoing roles can likewise be traded or reversed . as can be seen , reactants may be separated to render them inactive . the reactants may later be combined to render them active and initiate a reaction . likewise , the reactants may be maintained in proximity to one another in the chamber 34 , the chamber 30 , or both , or one may be maintained in a chamber 30 , 34 dry and another wet . however , once both reactants are present in the presence of a liquid ( e . g ., transport fluid ) in the opposite chamber 34 , 30 , the reaction to release nitric oxide may begin . any of the embodiments of fig2 may be provided with an adhesive strip 42 . one function of the adhesive strip is to secure the distributor 12 proximate the nostrils of a user in order that the distributor 12 may deliver nitric oxide through the openings 15 of the output ports 14 . for clarity , the adhesive strip 42 has not been illustrated in every embodiment , although it may . nevertheless , each of the embodiments may be provided with an adhesive strip 42 . meanwhile , any of the distributors 12 may be secured by some other method . for example , the distributor 12 may be positioned within a mask covering the nose , the mouth , or both . likewise , the distributor may be positioned by an air inlet to such a mask . in other embodiments , the distributor 12 may be positioned directly near the mouth , nostrils , or both . accordingly , the output ports 14 may be shaped to accommodate the positioning thereof for delivery of nitric oxide to the breathing air stream of a subject . in certain embodiments , an additional volume 48 may be separated within the chamber 34 . for example , a layer 50 or wall 50 may seal the reactants away from one another . the wall 50 may be formed of a film , such as a molecular sieve . such molecular sieves are available from suppliers and may be formed of various materials . one film produced under the trademark nafion ™ operates as a molecular sieve . the value of a molecular sieve is that it is configured to have a pore size that will not permit passage of a compound of nitrogen having more than a single oxygen . accordingly , only nitric oxide may pass through the molecular sieve . the molecular sieve , thus restrains the reactant liquids , any particulate matter , and all constituents larger than the nitric oxide molecule . thus , the nitric oxide molecule may pass through the wall 50 and exit the chamber 34 through the output ports 14 . in yet other embodiments , the basic chamber 34 may be separated away from an additional chamber 48 or volume 48 by a seal 50 or wall 50 . meanwhile , the main chamber 34 may be further subdivided to create an additional volume 52 separated by a wall 54 or seal 54 . in the illustrated embodiment , a volume of a first reactant in the chamber 48 is separated entirely from a volume of a second reactant in a chamber 52 . meanwhile , the remaining volume of the chamber 34 may be left as air space to receive the reactant gas passing through the molecular sieve of the layer 50 . referring to fig2 , embodiment a is configured simply as a distributor 12 in which the chamber 34 enclosed by the wall 32 merely passes the nitric oxide for distribution to the output ports 14 . meanwhile , an adhesive layer 42 is bonded to the wall 32 and may be secured to the skin of a user upon removal of a layer 44 or cover 44 protecting the adhesive properties of the layer 42 from their environment during handling . embodiment b of fig2 includes an additional chamber 40 separated by a wall 36 . in this embodiments , one reactant may occupy the principal chamber 34 , while a second reactant occupies the chamber 40 within the wall 36 . if the wall 36 is formed of glass , then bending the distributor 12 may fracture the wall 36 , exposing the reactants in the chamber 34 to the reactants in the chamber 40 . accordingly , the relative sizes of the chambers 34 , 40 may be configured according to the necessary and appropriate quantities of the reactants contained therein , respectively . the reactants in the chambers 34 , 40 may be dry , wet , or one may be dry and one may be wet . likewise , one chamber 34 , 40 may contain both reactive ingredients mixed together but completely dry , while the other chamber 40 , 34 contains a liquid capable of acting as a transport medium and thus activating the reaction between the dry ingredients . substantially all the illustrated embodiments for a reactor 20 or for a distributor 12 may benefit , as appropriate , from one of the foregoing configurations of dry , wet , or wet and dry ingredients , or dry ingredients and a wet transport material 12 . embodiment c provides for a distributor 12 having one volume 48 enclosed by a molecular sieve layer 50 . meanwhile , a wall 36 encloses another chamber 40 containing another reactant . in this embodiment , the remainder of the volume of the chamber 34 outside the wall 50 of the molecular sieve is available as free space . meanwhile , all reactants are contained within the molecular sieve layer 50 . a fracture of the wall 36 may release the reactants from the chambers 40 , 48 to mix with one another and react . meanwhile , the molecular sieve layer 50 contains all the reactants , as well as species of reaction that may be other than nitric oxide . typically , nitric oxide is the principal output of the proposed reactants . nevertheless , when exposed to the reaction process too long or when provided with outside oxygen , nitric oxide may become a more oxygenated reactant of nitrogen . embodiment d illustrates a more easily bendable shape , that may be more comfortable and more practical for forming about the upper lip of a user . for example , in any illustrated embodiment , any of the materials used to form the wall 32 of the chamber 34 may be comparatively rigid , moderately flexible such as a soft plastic or elastomer , or very flexible such as the materials used to form a toothpaste tube or other collapsible tube for containing a paste or liquid . accordingly , the distributor 12 may be formed to fit the lip a user . internal materials such as a wire imbedded in part of the wall 32 may facilitate bending the distributor 12 to a specific and permanent shape . meanwhile , the adhesive strip 42 may secure a comparatively weak and soft material to the lip of a user and thus maintain the desired shape . in embodiment d , the molecular sieve layer 50 may be a flexible film that provides additional space in the chamber 34 as gas accumulation space , while still containing the volume 48 of one reactant . in the illustrated embodiment , the chamber 40 is maintained within the wall 38 of a vessel 36 . if the vessel 36 has a rigid wall 38 , such as one formed of glass , a simple bending of the distributor 12 may permit mixing of the reactants in the chambers 40 , 48 and discharge of the nitric oxide reactant through the wall 50 to accumulate in the remaining dry portion of the chamber 34 for ultimate discharge through the output ports 14 . embodiment e provides a molecular sieve layer 50 permanently disposed across the chamber 34 separating a portion of the chamber 34 from a cavity 48 or volume 48 containing a reactant . thus , a portion of the chamber 34 remains dry , while a portion is separated off as the volume 48 for containing a reactant . in this embodiment , the volume 40 is likewise contained by a wall 38 as a separate vessel 36 containing one of the reactants . typical reactants are moderate acids such as citric acid , ascorbic acid , acetic acid , or the like . meanwhile , typical reactants may involve compositions of nitrogen such as potassium nitrite , sodium nitrite , or the like . reactants may be disposed as granules , powders , liquids in solution , solutions gelled to thixotropic consistency , or the like . embodiment f illustrates a distributor 12 that contains no reactants and does not act as a reactor 20 or reactant chamber 34 . rather , the chamber 34 of embodiment f is simply an empty cavity for distributing nitric oxide to the output ports 14 . embodiment g may actually be configured in various shapes . however , as a manufacturing matter , alignment , assembly , and the like may be best served by more linear envelopes rather than curved ones . nevertheless , the arrangement of embodiment g may actually be imposed on other shapes . in this embodiment , the chamber 34 may be separated by a molecular sieve layer 50 from a chamber 48 containing one reactant . meanwhile , another seal 54 or wall 54 may separate the ingredients in the chamber 48 from the volume 52 or chamber 52 containing the second ingredient . the entire reaction is contained within the wall 32 , but the individual wall 50 acts a molecular sieve and will not be ruptured . by contrast , in order to initiate the reaction , the wall 54 may be compromised by perforating , fracture , rupture , tearing , cutting , or the like . meanwhile , the remainder of the chamber 34 provides head space for the gas to accumulate for discharge through the output ports 14 . referring to fig3 , a reactor 20 in the apparatus 10 may be configured in any suitable shape . circular cross - sections tend to provide an equalization of hoop stresses . however , the reaction of materials contemplated for an apparatus 10 in accordance with the invention need not operate at an elevated pressure . typically , the reaction may occur at about ambient conditions . in embodiment a of fig3 , the reactor 20 may be configured as a rounded , yet somewhat flattened device having an aspect ration of width to thickness that is substantially larger than unity . thus the width is more than the thickness , and in the illustrated embodiment is several times the thickness . meanwhile , the aspect ratio of height to width may be selected according to space available in a convenient location for holding the reactor 20 . for example , embodiment d may be a suitable configuration for setting on a table top . by contrast , embodiment a may be better suited for slipping into a shirt pocket , jacket pocket , or the like for portability . meanwhile , the reactor 20 of embodiment c may be suitable for holding in a jacket pocket , or sitting on a night stand beside a bed or other flat surface . referring to fig4 , any of the reactors 20 of fig3 may be configured to contain any or all of the chambers of fig2 . the reactor 20 may enclose various individual volumes . for example , in the illustrated embodiment , a volume 58 is enclosed within the wall 56 of the reactor 20 . the volume 58 is bounded below by a layer 60 or sieve layer 60 . optionally , a region of expansion space 62 may exist above a closure layer 64 . the layer 64 initially forms a retainer or seal 64 to contain the volume 66 of a first reactant . the first reactant volume 66 is separated from a volume 68 containing the second reactant by a seal 70 that may be ruptured or otherwise compromised to initiate a reaction . the closure layer 64 may be permeable . alternatively it may be sealed impervious , to be breached in preparation for initiating the reaction in the reactor 20 . it may be burst or otherwise opened or by the reaction . in one embodiment , the layers 64 , 70 may be formed of a polymer film , wax , or the like capable of maintaining the volumes 66 , 68 separated from one another with their reactants . a mechanism such as a plunger , perforator , mixer , spatula , or other apparatus extending through the wall 56 may serve to break , rupture , tear , cut , or otherwise compromise the layer 70 . likewise , the layer 64 may be so opened and compromised in order to make the expansion space 62 available to the reactants . the reactants in the volumes 66 , 68 may be solid , liquid , one of each , or some other combination . for example , an additional layer , possibly even including the volume 62 , may contain a liquid to provide a transport fluid for dry reactants in the volume surface 66 , 68 . by whatever mechanism , the layers 64 , 70 may be opened to expose the volumes 66 , 68 with their reactant contents to one another in order to activate the reactor 20 and begin the chemical reaction to produce nitric oxide . nitric oxide passes through the molecular sieve layer 60 , which may be optional , but is useful in maintaining the purity of nitric oxide . the molecular sieve 60 or the layer 60 may include not only a molecular sieve , such as a film or solid layer , but may also include any other barrier materials suitable to maintain reactants outside of the collection volume 58 collecting the nitric oxide . ultimately , the nitric oxide in the volume 58 is passed through the fitting 30 into a line 18 for delivery into a distributor 12 . notwithstanding the illustrated embodiment of fig4 , any suitable shape may be used for the cross - section of the reactor 20 . accordingly , the reactor of fig4 may actually be configured according to the relations , shapes , or both illustrated in any of the alternative embodiments illustrated in fig1 - 3 . in one alternative embodiment , the wall 56 may be highly flexible . moreover , shape may be selected having an aspect ration of length to width that is comparatively larger than unity . the ratio of width to thickness may also be selected to be substantially larger than unity . accordingly , the reactor 20 may be configured as a comparatively long , narrow tube , of a comparatively smaller thickness . accordingly , the reactor 20 may be rolled up like a toothpaste tube or kneaded in order to rupture the seal layers 64 , 70 and to mix the reactants in the volumes 66 , 68 . if the volumes 66 , 68 are filled with solutions , for example , reactants disposed in a solute liquid , or freely flowing gel , then mixing may readily occur . in other embodiments , diffusion alone may control the migration of reactant species between the volumes 66 , 68 . thus , sealing layers 64 , 70 may be formed , dividing the chambers or volumes 66 , 68 containing reactants , which may then be extruded , mixed , drawn , flown , stirred , or otherwise introduced to one another to increase the available species participating in the reaction . referring to fig5 , one embodiment of an apparatus and method in accordance with the invention may rely on a series of process steps constituting a method 80 or process 80 . for example , providing 82 a distributor 12 may involve any one or more of the required tasks of identifying materials , selecting a shape , selecting a cross - sectional profile and area , selecting aspect ratios of length to width to thickness , and determining the structural and mechanical characteristics for such a distributor 12 . accordingly , providing a distributor 12 may involve design , engineering , manufacture and acquisition of such a device . providing 80 a reactor may involve selection of materials , selection profile and of cross - sectional area , engineering , design , fabrication , acquisition , purchase , or the like of a reactor 20 in accordance with the discussion hereinabove . providing reactants 86 may include selection of reacting species , selecting a configuration , such as granules , powder , liquid , a solution , or the like . likewise , the particular configuration of a solidous configuration of reactants may involve selecting a sieve size for the particles . this site can affect chemical reaction rates . thus , selecting or otherwise providing 86 reactants for the reactor 20 may involve consideration of any or all aspects of chemistry , reaction kinetics , engineering , design , fabrication , purchase or other acquisition , delivery , assembly , or the like . assembling 88 the apparatus may involve a single distributor as an integrated embodiment as described with respect to fig2 , or assembly of a reactor , with a feed line 18 , connected to a distributor 12 . likewise , assembling 88 may also include the disposition of reactants within various locations within a reactor 20 , distributor 12 , or the like as discussed hereinabove . deploying 90 the distributor may involve opening up a package provided during assembly 88 of the apparatus 10 . for example , assembling 88 may also include packaging . accordingly , deploying 90 may involve opening packages , unsealing components , and otherwise rendering the apparatus 10 ready for use . likewise , deploying 90 the distributor 12 may involve positioning the distributor 12 with respect to a user , including , for example , adhering the distributor 12 to the skin of a user proximate the nostrils for inhaling the nitric oxide provided by the distributor 12 . activating 92 the reactants in the reactor 20 may involve , either adding a liquid , mixing the reactant components together , dispersing individual reactants in respective solutes to provide solutions for mixing , adding a liquid transport carrier to dry ingredients in order to initiate exchange between reactants , a combination thereof , or the like . likewise , activation 92 of the reactants may also involve opening valves , opening seals , rupturing or otherwise compromising seals as described hereinabove , or otherwise moving or manipulating reactants with or without carriers in order to place them in chemical contact with one another . in certain embodiments , nitric oxide may be separated 94 from the reactants themselves . for example , the concept of a molecular sieve 60 was introduced hereinabove as one mechanism to separate 94 nitric oxide form other reactants and from other species of nitrogen compounds . in other embodiments , pumps , vacuum devices , or the like may also tend to separate 94 nitric oxide . accordingly , in certain embodiments , a suitably sized pump may actually be connected to the reactor 20 in order to draw nitric oxide away from other species of reactants or reacted outputs . conducting 96 therapy using nitric oxide may involve a number of steps associated with delivery and monitoring of nitric oxide through the distributor 12 . for example , in certain embodiments , conducting 96 therapy may involve activating a reactor 20 or the contents thereof . likewise , conducting 96 a therapy session may involve proper application of the distributor 12 to the person of the user such as by adhering an adhesive strip 42 to the skin of a user in order to position the output ports 14 in the nostrils of a user for receiving nitric oxide therefrom . it may include assembling the necessary conduit 18 or line 18 with the distributor 12 to send nitric oxide from the reactor 20 to the distributor 12 , and ultimately to a user . monitoring may involve adding gauges or meters , taking samples , or the like in order to verify that the delivery of nitric oxide from the reactor 20 to the distributor 12 does meet the therapeutically designed maximum and minimum threshold requirements specified by a medical professional . ultimately , after the expiration of an appropriate time specified , or the exhaustion of a content of a reactor 20 , a therapy session may be considered completed . accordingly , the apparatus 10 may be removed 98 from use , discarded , or the like . accordingly , the removal or discarding 98 of the apparatus 10 may be by parts , or by the entirety . for example , the distributor 12 , if it does not include an integrated reactor therewithin , may simply act as a manifold and be reused with a new reactor 20 . it is contemplated that the reactor 20 may typically be a single dose reactor but need not be limited to such . multiple - dose or reusable reactors may also be used . for example , the reactor 20 may actually contain a cartridge placed within the wall 56 . the internal structure of the cartridge may be ruptured in the appropriate seal locations , such as the seals 64 , 70 by a mechanism associated with the main containment vessel or wall 56 , and thus activated . accordingly , the reactor 20 may be reused by simply replacing the cartridge of materials containing the reactant volumes 66 , 68 . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative , and not restrictive . the scope of the invention is , therefore , indicated by the appended claims , rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .	1
a first aspect of the invention will be described below . fig2 is a side sectional view roughly showing a front loading - type image forming apparatus to which the first aspect of the invention is applied . referring to fig2 reference numeral 1 designates a body of the image forming apparatus of which paper supplying portion la is provided with a plurality of paper supplying decks 2 to be inserted therein and removed therefrom in a multi - step manner from a front side of body 1 . each paper supplying deck 2 is provided with a paper carrying portion 3 having a paper width setting mechanism 4 and a paper supplying roller 5 for supplying paper supplying portion 1a of the body 1 with a paper p carried on paper carrying portion 3 . the body 1 is electrically connected with the paper supplying decks 2 through a drawer - type connector 6 . that is to say , a deck side member 6a and a body side member 6b constituting drawer - type connector 6 are connected with each other under the condition that the paper supplying deck 2 is mounted on paper supplying portion 1a of the body 1 and are separated from each other when the paper supplying deck 2 is dismounted or withdrawn . fig3 is a perspective view roughly showing the paper carrying portion 3 of the paper supplying deck 2 . referring to fig3 reference numeral 7 designates a paper carrying plate provided with a pair of paper end regulating plates 8 constituting the paper width setting mechanism 4 . plates 8 are arranged oppositely and movably in back and forth directions upstream and downstream relative to a moving direction q of the paper supplying deck 2 . the paper end regulating plates 8 are provided with respective racks 9 extending in the back and forth directions and formed at lower ends of plates 8 . thus , plates can be moved in an interlocked relation with a movement of one plate 8 by engaging racks 9 with a pinion 10 pivoted below paper carrying plate 7 . in addition , a variable resistor 11 is arranged in the moving direction of the plates 8 below paper carrying plate 7 , and a sliding tap 11a ( refer to fig1 ) of variable resistor 11 is connected with a lower end of one paper end regulating plate 8 through a connecting member 12 . thus , a resistance value of the variable resistor 11 is variable set in an interlocked relation with movement of the paper end regulating plates 8 , i . e . a width setting operation of the paper width setting mechanism 4 . fig1 is a circuit diagram showing an electric connecting structure between the variable resistor 11 on the side of the paper supplying deck 2 and a controller 13 on the side of the body 1 . referring to fig1 on the side of the paper supplying deck 2 , the variable resistor 11 and an upper limit voltage suppressing resistance 16 are connected in series between a constant voltage power source 14 of 5v and a ground 15 . that is , resistance 16 and the variable resistor 11 are connected in the order described from the side of constant voltage power source 14 , and sliding tap 11a of the variable resistor 11 is connected with deck side member 6a of the drawer - type connector 6 . the upper limit voltage suppressing resistance 16 ensures that a voltage output from the sliding tap 11a is lower than the voltage ( 5v ) of the constant voltage power source 14 even if the resistance value of the variable resistor 11 becomes maximum , i . e . a resistance value r x between the sliding tap 11a and ground 15 becomes equal to a total resistance value r s of the variable resistor 11 . on the other hand , on the side of the body 1 , a constant voltage power source 17 of 5v is connected with body side member 6b of the drawer - type connector 6 through a pull up resistance 18 , and the body side member 6b is connected with one analog input port of a controller 13 . a resistance value r 2 of pull up resistance 18 is set so as to be sufficiently large compared with a resistance value r 1 of the upper limit voltage suppressing resistance 16 and total resistance value r s , that is so that the following relation ( 1 ) occurs : the controller 13 consists of a microcomputer , and a ram 19 for memorizing various types of data is connected with controller 13 . next , an operation under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body in the above described paper supplying device will be described . under the condition that the paper supplying deck 2 is not mounted on the paper supplying portion la of the body 1 , i . e . the deck side member 6a and the body side member 6b forming the drawer - type connector 6 are separated from each other , a voltage v 1out of the body side member 6b is expressed by the following expression : on the contrary , under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , i . e . the deck side member 6a and the body side member 6b of the drawer - type connector 6 are connected with each other , a voltage v 1in of the body side member 6b is expressed by the following expression ( 2 ) on the basis of the expression ( 1 ): wherein r x represents a resistance value from the sliding tap 11a to a ground side terminal in the variable resistor 11 , r 1 represents a resistance value of the upper limit voltage suppressing resistance 16 , and r s represents a total resistance value of the variable resistor 11 . accordingly , under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , the maximum value v 1inmax of voltage v 1in of the body side member 6b of the drawer - type connector 6 is expressed by the following expression ( 3 ): that is , the voltage v 1in input to the controller 13 from the body side member 6b under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , i . e . the paper width detecting signal , is always of low level compared with the voltage v 1out (≈ 5v ) input to the analog input port of the controller 13 from the body side member 6b under the condition that the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 . thus , it can be judged in the controller 13 whether or not the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 . that is to say , it can be judged that when the voltage input to the controller 13 from the body side member 6b of the drawer - type connector 6 has a value close to 5v the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , while it can be judged that when the voltage input to the controller 13 from the body side member 6b of the drawer - type connector 6 has a value lower than 5v the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 . in addition , a plurality of paper width standard data corresponding to the paper widths of respective typical papers p for comparing a paper width detecting signal v in therewith , to judge to which paper width such signal corresponds , are previously written or entered in ram 19 in an assembling step . that is to say , when such paper standard data are entered , the paper width detecting signals v 1in1 , v 1in2 . . . input to the controller 13 through the drawer - type connector 6 are written in the ram 19 as a data map shown in fig4 in correspondence to , for example , respective typical papers b6 , b5 , . . . every time when the respective typical papers p are carried on the paper carrying portion 3 of the paper supplying deck 2 , i . e . when the paper end regulating plates 8 of the paper width setting mechanism 4 are moved to accommodate the width of the respective papers p , thereby setting the paper width . thus , by entering the paper width standard data in the ram 19 in the above described manner , even in the case where the resistance value of the variable resistor 11 is dispersed , it is possible to omit an operation that a semi - fixed resistance is connected in series with the variable resistor 6 and such semi - fixed resistance is regulated so that the previously determined voltage corresponding to the respective typical papers , i . e . the paper width detecting signal , may be obtained . fig5 is a circuit diagram showing a second preferred embodiment of the first aspect of the invention . in a paper supplying device according to this preferred embodiment , on the side of the paper supplying deck 2 the variable resistor 11 and a lower limit voltage rising resistance 21 , used in place of the upper limit voltage suppressing resistance 16 in the above described first preferred embodiment , are connected in series between the constant voltage power source 14 and the ground 15 . that is , resistance 21 and the variable resistor 11 are connected in the order described from the side of the ground 15 . on the other hand , on the side of the body 1 , a pull down resistance 23 is connected between the body side member 6b of the drawer - type connector 6 and the ground 15 in place of the pull up resistance 18 in the first preferred embodiment . a resistance value r 4 of pull down resistance 23 is set so as to be sufficiently large as compared with a resistance value r 3 of the lower limit voltage rising resistance 21 and the total resistance value r s of the variable resistor 11 , that is , so that the following relation ( 5 ) occurs : other constructions of this embodiment are similar to those in the first preferred embodiment . in this second preferred embodiment , under the condition that the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 , a voltage v 2out of the body side member 6b of the drawer - type connector 6 is expressed by the following expression : on the contrary , under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , a voltage v 2in of the body side member 6b is expressed by the following expression ( 6 ) on the basis of the expression ( 5 ): accordingly , under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , the minimum value v inmin of voltage v 2in of the body side member 6b is expressed by the following expression ( 7 ): that is to say , the voltage v 2in input to the controller 13 from the body side member 6b under the condition that the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 , i . e . the paper - width detecting signal , is always high in level as compared with the voltage v 2out (= 0v ) input to the controller 13 from the body side member 6b under the condition that the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 . thus , it can be judged in the controller 13 whether or not the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 . that is to say , it can be judged that when the voltage input to the controller 13 from the body side member 6b of the drawer - type connector 6 has a value of 0v then the paper supplying deck 2 is not mounted on the paper supplying portion 1a of the body 1 , while it can be judged that when the voltage input to the controller 13 from the body side member 6b of the drawer - type connector 6 has a value higher than 0v then the paper supplying deck 2 is mounted on the paper supplying portion 1a of the body 1 . next , a second aspect of the invention will be described . fig7 is a side sectional view roughly showing a front loading - type image forming apparatus to which the second aspect of the invention is applied . referring to fig7 reference numeral 31 designates a body of the image forming apparatus of which paper supplying portion 31a is provided with a plurality of paper supplying decks 32 so as to be inserted therein and withdrawn therefrom in a multi - step manner from a front side of body 31 . each paper supplying deck 32 is provided with a paper carrying portion 33 having a paper width setting mechanism 34 and a paper supplying roller 35 for supplying paper supplying portion 31a of the body 31 with a paper p carried on paper carrying portion 33 . the body 31 is electrically connected with the paper supplying decks 32 through a drawer - type connector 36 . that is to say , a deck side member 36a and a body side member 36b forming drawer - type connector 36 are connected with each other under the condition that the paper supplying deck 32 is mounted on paper supplying portion 31a of the body 31 and are separated from each other when the paper supplying deck 32 is dismounted or withdrawn . fig8 is a perspective view roughly showing the paper carrying portion 33 of the paper supplying deck 32 . referring to fig8 reference numeral 37 designates a paper carrying plate provided with a pair of paper end regulating plates 38 constituting the paper width setting mechanism 34 . plates 38 are arranged oppositely and movable in back and forth directions upstream and downstream relative to a moving direction q of the paper supplying deck 32 . the paper end regulating plates 38 are provided with respective racks 39 extending in the back and forth directions and formed at lower ends of the plates 38 . thus , plates 38 can be moved in an interlocked relation with a movement of plate 38 by engaging racks 39 with a pinion 40 pivoted below paper carrying plate 37 . in addition , a variable resistor 41 is arranged in the moving direction of the plates 38 below paper carrying plate 37 , and a sliding tap 41a ( refer to fig6 ) of variable resistor 41 is connected with a lower end of one paper end regulating plate 38 through a connecting member 42 . thus , a resistance value of the variable resistor 41 is variable set in an interlocked relation with movement of the paper end regulating plates 38 , i . e . a width setting operation of the paper width setting mechanism 34 . in addition , a longitudinal size detecting switch 43 for discriminating the typical papers of centimeter measure , i . e . of b4 from b5 and of a3 from a4 , is arranged at the downstream side of the paper width setting mechanism 34 in a direction transverse to moving direction q of the paper supplying deck 32 , i . e . in a paper supplying direction r . that is to say , when typical papers b5 , a4 size are carried on paper carrying portion 33 with short sides thereof parallel to paper supplying direction r , rear portions thereof are not overlapped on switch 43 . however , when typical papers of b4 , a3 size are carried on the paper carrying portion 33 with short sides ( equal to long sides of typical papers of b5 , a4 size , respectively ) thereof parallel to moving direction q , rear portions thereof are overlapped on the switch 43 . the switch 43 is an always closed switch which is pushed down and switched off by rear portions of the paper p carried on the paper carrying portion 33 and is maintained switched on when not pushed down . fig6 is a circuit diagram showing an electric connecting structure between the side of the paper supplying deck 32 and a controller 44 consisting of a microcomputer included on the side of the body 31 . in fig6 in order to simplify the circuit , the drawer - type connector 6 is omitted . referring to fig6 a resistance 47 , a variable resistor 41 and a resistance 48 are connected in series between a constant voltage power source 45 of 5v and a ground 46 . that is , resistance 47 , variable resistor 41 and resistance 48 are connected in the order described from the side of constant voltage power source 45 . the switch 43 is connected in parallel with the resistance 48 , and a sliding tap 41a of the variable resistor 41 is connected with an analog input port of controller 44 . a resistance value r 22 of the resistance 48 is set to be larger than a total resistance value r s2 of the variable resistor 41 so that a level of a voltage output from sliding tap 41a when the switch 43 is switched off always will be higher than that when the switch 43 is switched on . next , an operation of detecting sizes of typical papers of centimeter measure in the above described paper supplying device will be described . in the case where the papers p carried on the paper carrying portion 33 of the paper supplying deck 2 are b6 , a5 , b5r , a4r , b5 and a4 size , rear portions of such papers are not overlapped on the switch 43 , so that switch 43 is kept under the switched - on condition . accordingly , a width direction size detecting voltage v on2 output from the sliding tap 41a of the variable resistor 41 at such time is expressed by the following expression ( 9 ): wherein r x2 represents a resistance value from the sliding tap 41a to a ground - side terminal in the variable resistor 41 . in such case , width direction size detecting voltage v onmax2 when r x2 becomes the maximum value (= r s2 ) is expressed by the following expression ( 10 ): on the contrary , in the case where the papers p carried on the paper carrying portion 33 of the paper supplying deck 2 are b4 and a3 size , the rear portions of the papers are overlapped on the switch 43 , so that the switch 43 is pushed down and switched off . accordingly , the width direction size detecting voltage v off2 output from the sliding tap 41a at such time is expressed by the following expression ( 11 ): in such case , the width direction size detecting voltage v offmin2 when r x2 becomes the minimum value (= 0 ) is expressed by the following expression ( 12 ): as above described , r 22 is set to be larger than r s2 so that the following expression ( 13 ) occurs , whereby the width direction size detecting voltage v offb4 in the case where the papers p are b4 size , as shown in fig9 is higher than the width direction size detecting voltage v ona4 in the case where the papers p are a4 size , and also the width direction size detecting voltage v offa3 in the case where the papers p are a3 size is higher than v ona4 : in addition , the following relation ( 14 ) occurs between v offb 4 and v offa3 : thus , the controller 44 can discriminate not only papers of b4 size from papers of b5 size but also papers of a3 size from papers of a4 size . in addition , although the case were the paper width setting mechanism 34 and the longitudinal size detecting switch are carried on the paper supplying deck 32 is described above with regard to this preferred embodiment , the paper supplying device according to the present invention also can be employed with an image forming apparatus in which the paper width setting mechanism 34 and the longitudinal size detecting switch 43 are carried on a normal paper supplying cassette not provided with a paper supplying roller .	1
with reference to fig1 - 3 , in accordance with the present invention , a structure for firmly combining cables with a clamping element is provided with locking ribs or locking grooves on the clamping element . the clamping element 10 can be a circular , c - shaped , 6 - shaped or h - shaped section . referring to fig1 , the clamping element 10 is a tubular - like body having a circular section . an outer surface of the clamping element 10 is circumferentially provided with corresponding semi - circular locking ribs 11 . the locking ribs ii are straight and parallel to a central axis of the clamping element 10 . referring to fig2 , the clamping element 10 is a tubular - like body having a circular section . an inner surface of the clamping element 10 is circumferentially provided with corresponding semi - circular locking grooves 12 . the locking grooves 12 are straight and parallel to the central axis of the clamping element 10 . next , with reference to fig3 and 3 a , in practical application , two cables a , and b are inserted into the clamping element 10 of fig1 , and then a press die presses the locking ribs 11 of the clamping element 10 . the compression stress on the inner surface of the clamping element 10 can be effectively reduced , thereby facilitating to firmly crimp the clamping element 10 and the two cables a , and b . as a result , the clamping element 10 can be sufficiently attached on the outer surface of the cables a , and b and kept in the shape of the cables . referring to fig4 , the clamping element 10 has a circular section and a terminal extended from a rear portion thereof . the outer surface of the clamping element 10 is circumferentially provided with corresponding semi - circular locking ribs 11 . the locking ribs 11 are straight and parallel to the central axis of the clamping element 10 . referring to fig5 , the clamping element 10 has a circular section and a terminal extended from a rear portion thereof . the inner surface of the clamping element 10 is circumferentially provided with corresponding semi - circular locking grooves 12 . the locking grooves 12 are straight and parallel to the central axis of the clamping element 10 . next , with reference to fig6 , in practical application , a cable a is inserted into the clamping element 10 of fig4 , and then a press die presses the locking ribs 11 of the circular clamping element 10 . the compression stress on the inner surface of the clamping element 10 can be effectively reduced , thereby facilitating to firmly crimp the clamping element 10 and the cable a . as a result , the clamping element 10 can be sufficiently attached on the outer surface of the cable a , and kept in the shape of the cable . referring to fig7 , a clamping element 20 in accordance with the present invention is a tubular - like body having a c - shaped section . an upper end 21 and a lower end 22 of the clamping element 20 form a first cable groove 23 and a second cable groove 24 , respectively . an outer surface of the upper end 21 and lower end 22 has a semi - circular locking rib 25 , respectively . the locking ribs 25 are straight and parallel to a central axis of the clamping element 20 . referring to fig8 , the clamping element 20 is a tubular - like body having a c - shaped section . an upper end 21 and a lower end 22 of the clamping element 20 form a first cable groove 23 and a second cable groove 24 , respectively . an inner surface of the upper end 21 and lower end 22 has a semi - circular locking groove 26 , respectively . the locking grooves 26 are straight and parallel to the central axis of the clamping element 20 . next , with reference to fig9 , in practical application , two cables a , and b are inserted into the c - shaped clamping element 20 of fig7 , and then a press die presses the locking ribs 25 of the clamping element 20 . the compression stress on the inner surfaces of the two cable grooves 23 , 24 can be effectively reduced , thereby facilitating the first cable groove 23 and the second cable groove 24 to bend on the outer surface of the cables a , and b . thus , both ends of first cable groove 23 and the second cable groove 24 abut against the cables a , and b . as a result , the cables a , and b can be firmly crimped , such that the first cable groove 23 and the second cable groove 24 can be sufficiently attached on the outer surface of the cables a , and b and kept in the shape of the cables referring to fig1 , a clamping element 30 in accordance with the present invention is a tubular - like body having a 6 - shaped section . a partition 31 is provided in the middle of the clamping element 30 . both ends of the clamping element 30 form a first cable groove 32 and a second cable groove 33 , respectively . the first cable groove 32 is of similar circular and provided with a notch 34 . near both ends of the notch 34 of the first cable groove 32 , an outer surface of the clamping element 30 has two semi - circular locking ribs 35 . the second cable groove 33 is of similar semi - circular . the outer surface of the second cable groove 33 of the clamping element 30 has a semi - circular locking rib 35 . the locking ribs 35 are straight and parallel to a central axis of the clamping element 30 . referring to fig1 , the clamping element 30 is a tubular - like body having a 6 - shaped section . a partition 31 is provided in the middle of the clamping element 30 . both ends of the clamping element 30 form a first cable groove 32 and a second cable groove 33 , respectively . the first cable groove 32 is of similar circular and provided with a notch 34 . near one side of the notch 34 of the first cable groove 32 , the inner surface of the clamping element 30 has a semi - circular locking groove 36 . the second cable groove 33 is of similar semi - circular . the inner surface of the second cable groove 33 of the clamping element 30 has a semi - circular locking groove 36 . the locking grooves 36 are straight and parallel to the central axis of the clamping element 30 . next , with reference to fig1 , in practical application , two cables a , and b are inserted into the 6 - shaped clamping element 30 of fig1 , and then a press die presses the locking ribs 35 of the clamping element 30 . the compression stress on the inner surfaces of two cable grooves 32 , 33 can be effectively reduced , thereby facilitating the first cable groove 32 and the second cable groove 33 to bend on the outer surface of the cables a , and b . thus , both ends of first cable groove 32 and the second cable groove 33 abut against the cables a , and b . as a result , the cables a , and b can be firmly crimped , such that the first cable groove 32 and the second cable groove 33 can be sufficiently attached on the outer surface of the cables a , and b and kept in the shape of the cables . referring to fig1 , the clamping element 40 is a tubular - like body having a h - shaped section . each end of the clamping element 40 forms a cable groove 41 with symmetry in vertical direction . an upper end of the cable groove 41 is connected with a cap 42 , and an outside middle surface of the cap 42 is provided with a semi - circular locking rib 43 . the h - shaped clamping element 40 has another semi - circular locking rib 43 on the connection between the upper end of each of the cable grooves 41 and its corresponding cap 42 . referring to fig1 , the clamping element 40 is a tubular - like body having a h - shaped section . each end of the clamping element 40 forms a cable groove 41 with symmetry in vertical direction . an upper end of the cable groove 41 is connected with a cap 42 , and an inside middle surface of the cap 42 is provided with a semi - circular locking groove 49 . the h - shaped clamping element 40 has a semi - circular locking rib 43 on the connection between the upper end of each of the cable grooves 41 and its corresponding the cap 42 . next , with reference to fig1 , in practical application , two cables a , and b are inserted into the h - shaped clamping element 40 of fig1 , and then a press die presses the locking ribs 43 of the clamping element 40 . the cables a , and b can be fixed in the clamping element 40 . further , the locking rib 43 formed on the connection between the upper end of the cable groove 41 and the cap 42 can enhance the strength of the cap 42 , such that it cannot break at the connection of the clamping element 40 . as a result , the cables a , and b can be firmly crimped , such that the clamping element 40 can be sufficiently attached on the outer surface of the cables a , and b and kept in the shape of the cables . although the present invention has been described with reference to the preferred embodiment thereof , it is apparent to those skilled in the art that a variety of modifications and changes may be made without departing from the scope of the present invention which is intended to be defined by the appended claims .	7
select embodiments of the present invention employ a pyrolytic catalytic chemical vapor deposition ( ccvd ) technique . hart , a . j . & amp ; a . h . slocum , rapid growth and flow - mediated nucleation of millimeter - scale aligned carbon nanotube structures from a thin - film catalyst , journal of physical chemistry b 110 ( 16 ), 8250 - 8257 , 2006 . in association with ccvd , silicon single - crystal growth substrates have been used . typically , growth of conventional cnts is associated with a scribed substrate region . chen y . and j . yu , patterned growth of carbon nanotubes on si substrates without pre - deposition of metal catalysts , appl phys lett , 87 ( 3 ): 033103 , 2005 ; fan s . et al ., carbon nanotube arrays on silicon substrates and their possible application , physica e , 8 ( 2 ): 179 - 83 , 2000 ; yu j . and y . chen , “ scratching ” carbon nanotubes onto si substrates , materials research society symposium , san francisco , calif ., materials research society , p . 55 - 60 , 2006 . yue , y . et al ., selecting the growth sites of carbon nanotubes on silicon substrates by ion implantation , appl phys lett 88 ( 26 ): 263115 - 3 , 2006 . some researchers , for specific conditions , state that growth is not possible on the polished and otherwise unprepared side of a silicon ( si ) ( 111 ) wafer . select embodiments of the present invention induce prolific growth localized to a scribed substrate region on silicon and grow cnts on the polished side of a silicon ( 111 ) wafer . select embodiments of the present invention yield structure by depositing on a clean si substrate ( see fig4 a ) silicon particles ( see fig4 b and c ) prior to ccvd growth . 25 in developing select embodiments of the present invention , a modified ccvd method was employed for multiple cnt growth experiments on si ( 111 ) wafers to explore the effect of surface quality on growth behavior . barreiro , a . et al ., thermal decomposition of ferrocene as a method for production of single - walled carbon nanotubes without additional carbon sources , the journal of physical chemistry b 110 ( 42 ), 20973 - 20977 , 2006 ; barreiro , a . et al ., on the effects of solution and reaction parameters for the aerosol - assisted cvd growth of long carbon nanotubes , applied physics a : materials science & amp ; processing 82 ( 4 ), 719 - 725 , 2006 . single - crystal 10 . 2 cm silicon wafers with a ( 111 ) surface orientation were cut into approximately rectangular slides 100 using a diamond - tip scribe and straightedge . the narrower dimension was chosen to be approximately 25 mm in part for convenience of insertion into the fused quartz reaction tube 205 . a wash sequence of acetone followed by methanol and then isopropanol was used to clean the substrate of any debris . nel et al . ( 1998 ). prior to silicon particle deposition and growth , the surface roughness of the silicon single - crystal surface was characterized via profilometry using a sloan dektak3 instrument . the profile of the matte side of the wafer is shown in fig8 . a 500 micron scan shows roughness that spans approximately 125 nm in the dimension perpendicular to the surface . any single surface feature does not , however , appear to exceed approximately 50 microns in lateral extent parallel to the surface . the fact that the perpendicular features are approximately three orders of magnitude smaller than the lateral surface irregularities indicates surface topography varies only slightly . in comparison , the polished side of the silicon single crystal surface was also characterized by profilometry as shown in fig9 . a similar 500 micron scan ( fig9 ) shows considerably less roughness , i . e ., approximately 5 nm perpendicular to the surface . this variation indicates a flatness within two orders of magnitude of atomic scale . sample substrates 100 were left either in this clean state or deposited with silicon particles after cleaning . a 1 . 0 % mol mixture of ferrocene powder in xylene was prepared and loaded into a glass syringe . refer to fig2 . a fused quartz reaction tube 205 ( 610 mm length × 35 mm inner diameter ) was laid in a mullite process tube 206 inside a lindberg 55320 tube furnace 207 inclined at an angle , a , of 10 °. after placing the prepared substrate in the reaction tube 205 at the desired depth of 14 . 0 cm ( 5 . 5 in .) from the entrance of the quartz reaction tube 205 , a ferrocene mixture and ultra - high purity ( uhp ) helium delivery apparatus 201 with a smooth nozzle was inserted into the 25 high end of the quartz tube 205 . helium flow was controlled at 1 . 0 slpm for five minutes before setting the furnace to 875 ° c . refer to fig3 showing the temperature profile of the quartz reaction tube 205 . following a one - hour dwell time , a syringe pump 202 regulated the mixture flow at 0 . 500 ml / minute into a sono - tek 06 - 05108 ultrasonication nozzle 204 from an ultrasonic processor 203 running at 2 . 1 w and 120 khz . after 26 ml of the mixture was dispensed , the pump 202 was halted and the furnace 207 was allowed to cool to 100 ° c . before stopping helium flow . characterization of samples was performed using both sem ( jeol jsm 6390 ) and tem ( jeol 2010lab6 , single tilt stage , operated at 200 kv ). the silicon particles used in experiments were produced by abrading a si ( 111 ) wafer sample . the particles were characterized by both sem imaging and dynamic light scattering ( dls ) techniques . the dls instrument used was a microtrac nanotrac 150 . particles larger than 2 . 75 5 microns did not stay in suspension and were not recorded by the dls instrument . the presumption by the dls instrument of perfectly spherical particles undergoing brownian motion also renders this characterization method as semi - quantitative for non - spherical morphologies . particle separation was achieved using an electrostatically charged polypropylene sheet such as a lid to a silicon wafer carrier . in this manner a differential size separation was achieved , with the larger particles being removed . to investigate the nucleation and growth mechanism , silicon particles were deposited in two different size ranges together with a control sample . in all experiments the si ( 111 ) substrates were exposed to identical growth conditions . the sample position in the furnace was purposefully chosen to include a slight temperature gradient across the wafer , and this positioning was consistently employed . fig3 shows the steady - state temperature profile of the furnace as well as the sample position . the temperature range across the silicon substrate was 750 - 850 ° c . the first substrate was a control , using a published cleaning protocol , and consisted of only the si wafer . nel , j . m . et al ., using scanning force microscopy ( sfm ) to investigate various cleaning procedures of different transparent conducting oxide substrates , appl surf sci , 134 ( 1 - 4 ), 22 - 30 , 1998 . two wafers ( fig4 b and c ), similarly prepared using the same cleaning procedure , had silicon particles of two different size classes deposited thereon . the larger size class ( fig4 b ) was measured to encompass particles 1 - 250 microns in diameter . the smaller silicon particle size class ( fig4 c ) was measured to encompass particles of 1 - 100 microns in diameter . fig4 a - c shows the three prepared substrates immediately prior to growth . note the differing sized scale bars , especially 25 between fig4 b and c . refer to fig4 a - f . depositing large si particles yielded clumped sats growth ( fig4 c , d ) on the cnt forest ( shown by itself in fig4 a , b ) while small si particles contributed individual sats growth ( fig4 e , f ) on the cnt forest . the presence of cnts was confirmed by raman spectroscopy and tem imaging . heller , d . a , et al ., using raman spectroscopy to elucidate the aggregation state of single - walled carbon nanotubes , the journal of physical chemistry b 108 ( 22 ), 6905 - 6909 , 2004 . these new cnt structures erupted from the surface of the dense cnt forest growth ( fig4 a , b ). refer to fig1 a - c depicting the cnt growth regimes initially explored with just the unpolished ( rough ) matte side of a ( 111 ) single - crystal silicon wafer 100 as the substrate ( fig1 a ), then adding large si particles ( fig1 b ) and finally small si particles ( fig1 c ) to the substrate 100 . initially , a uniform and dense forest 101 of multiwall cnts was produced on the unpolished side with no deposits of si particles , as shown in fig1 a . this mode of growth had an additional feature that was not caused by any external alteration of experimental parameters : the formation of discrete and distributed worm - like structures ( see fig4 a ) that erupted from the dense forest 101 . their characterization was performed using scanning electron microscopy ( sem ) ( fig4 a and b ) and raman spectroscopy ( fig4 c ). for fig4 a and b 40 ° of tilt was used on the sample stage . accounting for this alteration in perspective , the actual length of the grown sats is approximately 3 . 0 mm . upon close examination of the inner surface , an intermediate hierarchical structure of regular lateral ridges and larger longitudinal angular sections can be discerned . for fig4 c the sample was placed on a silicon chip . the conditions used for the raman spectroscopy characterization were a laser wavelength of 532 nm set at a power of 44 mw and an exposure time of 600 sec . the d and g bands ( fig4 c ) shown are indicative of the presence of cnts . after growth , the control sample evidenced a uniform and dense multiwall cnt forest growth ( fig4 a and 45b ). some irregularities atop the forest can be observed , but they exhibit no particular or regular structure . in contrast , for the sample deposited with larger silicon particles , profusions of dense clumps of sats structures formed along with individual sats ( fig4 c and d ). for the sample deposited with smaller silicon particles , fewer clumps of sats were present , and more individual and more isolated sats were formed ( fig4 e and f ). these individual sats grew to considerably greater lengths , up to approximately 3 mm . refer to fig4 - 7 . the sats structures were further characterized using tem with 25 progressively increased magnification . fig4 shows an overall view of a single sats 400 . the multi - wall cnts are generally well aligned although not all perfectly parallel . the denser center region could be a result of a greater cross section . fig5 shows detail of both alignment of the cnts 500 and the presence of iron particle debris 501 inherent from the growth method . fig6 shows individual multi - wall cnts 600 , providing a sense of their relative orientation , and also shows residual catalytic iron particles 601 . fig7 shows the multi - wall nature of these cnts 700 . fig4 a shows the surface as prepared with the scratch 4600 inscribed . there were no irregularities other than the scratch 4600 . after growth , a normal cnt forest 4601 is observed ( fig4 b and c ). this result is contrary to results by other researchers who reported growth on single crystal silicon substrates is difficult without either depositing metal catalysts or xenon ion implantation . chen et al . ( 2005 ), yu et al . ( 2006 ), yue et al . ( 2006 ). in addition , many sats structures 4601 are entirely confined to the region of the scribed line 4600 ( fig4 c ). this result further supports the finding that surface roughness is necessary and sufficient to produce sats . refer to fig4 d showing one of a number of holes 4602 with a characteristic morphology in the cnt forest 4601 . these holes 4602 are not spatially associated with the scribed region 4600 and have a uniform surface density of approximately 1 . 5 holes / mm2 . the repeated morphology of these holes 4602 consists of a very regular inner circular hole of approximately 20 microns in diameter , surrounded by a less - regular circular region of denser cnt forest growth with a diameter of approximately 55 microns . the density of this annular region has a radial dependency , appearing to be highest near the center and decreasing outward . there is also a distinct encircling outer narrow ring feature of approximately 75 microns in diameter that is characterized by an absence of cnts . these features may represent failed sats growth sites , or conversely , locations where sats were formed and then subsequently detached . the nearly atomically smooth substrate 100 may imply formation followed consistently by release . thus , the dynamic forces felt at the base during growth likely exceed the bond or adhesion strength . this suggests initiation and growth from the substrate 100 upward versus initiation from the forest surface and growing both downward and upward simultaneously . an alternate explanation may be a mechanism that consistently shears off a proto - sats at the forest surface . such a mechanism could be associated with gaseous reactant release from the encircling annular break ( hole ) 4602 in the cnt forest 4600 . common to all cases , effects from the flow of gaseous reactants within and through the cnt forest 4600 need be considered . the interaction among inhomogeneities , irregularities , and surface roughness is almost 25 certain to change the gaseous reactant flow properties and hence the localized reaction conditions . for the above specific growth conditions , formation of the sats is associated with surface roughness or a locally “ enhanced ” surface area such as the inscribed scratch 4600 . as shown in fig4 b and c , the roughness is provided by the si particles . roughness in the form of a scribe - damaged surface 4600 ( fig4 a ) is also shown as a means to promote sats growth . while iron is also present in the system , as derived from the ferrocene catalyst , it is only observed as very small particles 601 common to individual multi - wall cnts ( fig6 ). given that sats are observed , in the instance of these experiments , only when si particles are present , and are not observed in the control sample , any direct contribution of iron to the surface roughness effect is negligible . however , iron may have a collaborative and contributory role when used with silicon particles . the intentional production of surface roughness being both necessary and sufficient to form sats for these specific catalytic cvd growth conditions is established . with either the inscribed irregularities or deposited silicon particles , heterogeneous nucleation sites are formed , i . e ., these “ irregularities ” decrease the free energy needed for formation of the sats . this preferentially promotes formation of a hierarchal tube structure . while initiation of growth at the substrate surface is highly likely , interactions and effects from the forest top surface may be possible . a contributing factor may include the evolving conditions of gaseous reactant flow , both above and especially below the forest surface during the growth process . musso , s . et al ., fluid dynamic analysis of gas flow in a thermal - cvd system designed for growth of carbon nanotubes , j cryst growth , 310 ( 2 ): 477 - 83 ; 2008 . for tensile testing , each sats was laid on a tab of standard cardstock across a central horizontal disposed rectangular cut - out , producing a gage length of approximately 500 microns . while spanning the cut - out , both ends of the sats were attached to the cardstock using loctite fixmaster epoxy pak ( as detailed in astm d3379 - 75 , withdrawn 1998 ). specimens were then loaded into the tensile apparatus ( not shown separately ), which consisted of a lever arm , a counterweight , and a sartorius type 1602 mp 8 - 1 balance . the upper and lower tabs were gripped by pelco reverse tweezers at both the lever arm end and fixed counterweight points . the two sides of the card stock were then cut with the balance zeroed . the lever arm was then pushed downward a fixed distance past the fulcrum using a calibrated micrometer screw gauge to provide a known displacement . on the opposite side , this lifted the attached counterweight off the balance under the support of the sats only . 25 in addition , the sats were characterized by measurement of their ultimate tensile strength ( uts ). a preliminary value of 140 mpa was obtained . without optimization , this is approximately 32 % of the uts for a common commercial steel ( i . e ., aisi 1018 ). fig1 is an example of the tensile failure surface 1000 on the left side . in this case there is no evidence of permanent deformation , suggesting a brittle failure mechanism . a different sats sample that failed during preparation also suggests brittle failure . fig1 shows the result of some uncharacterized lateral loading . here a number of longitudinal fractures 1100 are evident , suggesting the presence of only weak cross bonding perpendicular to the long axis . further investigation involved using more control to prepare the surface of the substrate 100 . standard photo - resist and processing techniques from the semi - conductor industry used deep reactive ion etching ( drie ) to produce a very regular array of square 25 × 25 micron towers , 75 microns high . column spacing for four different configurations of 12 . 5 , 25 , 37 , and 50 microns were designed , examples of all these configurations are described below and represented in the figures . refer to fig1 - 18 and 20 - 22 for examples of the towers . a first array was grown using a position in the reactor tube 205 that placed the leading edge of the prepared substrate 22 cm from the entrance of a 20 ml xylene / ferrocene flow at a rate of 0 . 75 l / min to the reactor tube 205 with a 37 . 5 micron column spacing and 25 micron column width . fig2 - 32 show results of the tower growth . fig2 shows the tops of the towers at the leading edge enlarged at 250 ×. fig2 is an elevation view of the tops of the towers showing the formation of cubes on each side of the tops of the towers enlarged at 250 ×. fig2 is an elevation view of the tops of the towers showing the formation of cubes on each side of the tops of the towers enlarged at 500 ×. fig2 shows the tops of the towers at the midpoint enlarged at 200 ×. fig2 shows the tops of the towers at the midpoint enlarged at 250 ×. fig3 shows the tops of the towers at the midpoint enlarged at 100 ×. fig3 shows a close - up of the tops of the towers at the trailing edge enlarged at 1000 ×. fig3 shows the tops of the towers at the trailing edge enlarged at 250 ×. a second array was grown using a position in the reactor tube 205 that placed the leading edge of the prepared substrate 20 cm from the entrance of a 25 ml xylene / ferrocene flow at a rate of 0 . 75 l / min to the reactor tube 205 with a 25 micron column spacing and 25 micron column width . fig3 - 46 show results of the tower growth . fig3 shows the tops of the towers with some dislodged towers at the leading edge enlarged at 75 ×. fig3 shows the tops of the towers at the leading edge enlarged at 75 × with some partially grown towers . fig3 shows the tops of the 25 towers enlarged at 250 ×. fig3 shows a close - up of the top of a tower at the leading enlarged at 2500 ×. fig3 shows the tops of the towers at the midpoint enlarged at 100 ×. fig3 shows the tops of the towers at the trailing edge enlarged at 100 ×. fig3 shows a perspective view of the towers at the trailing edge enlarged at 75 ×. fig4 shows the tops of the towers at the trailing edge enlarged at 1000 ×. fig4 shows the surrounding rim of a dense , long cnt forest that held together even as the underlying substrate 100 cracked off while being removed from the quartz tube 205 . fig4 shows the surrounding cnt forest rim , with cnt length of approximately 1170 microns , on the leading edge enlarged at 200 ×. a third array was grown using a position in the reactor tube 205 that placed the leading edge of the prepared substrate 20 cm from the entrance of a 20 ml xylene / ferrocene flow at a rate of 0 . 75 l / min to the reactor tube 205 with a 12 . 5 micron column spacing and 25 micron column width . fig1 - 24 show results of the tower growth . fig1 shows the tops of the towers at the leading edge enlarged at 100 ×. fig1 is close - up of the tops of the towers at the leading edge enlarged at 100 ×. fig1 is a perspective view of the towers enlarged at 250 ×. fig1 shows a perspective view of the towers at the midpoint enlarged at 100 ×. fig1 shows the tops of the towers at the midpoint enlarged at 100 ×. fig1 shows the tops of the towers at the midpoint enlarged at 500 ×. fig1 shows a close - up of the tops of the towers at the midpoint enlarged at 5000 ×. fig2 is a perspective view of the towers at the trailing edge enlarged at 30 ×. fig2 is an elevation view of the towers at the trailing edge enlarged at 500 ×. fig2 is a perspective view of a broken off piece of towers at the trailing edge enlarged at 150 ×. fig2 is a close - up of a broken off piece of towers at the trailing edge enlarged at 1000 ×. fig2 shows pieces of iron among the towers at the trailing edge enlarged at 250 ×. a fourth array was grown using a position in the reactor tube 205 that placed the leading edge of the prepared substrate 20 cm from the entrance of a 25 ml xylene / ferrocene flow at a rate of 0 . 75 l / min to the reactor tube 205 with a 50 micron column spacing and 25 micron column width . fig4 a , 47 b , 47 c & amp ; 47 d show results of the tower growth , and are all views from the top side of the substrate . fig4 a shows the claimed quad configuration and is from the leading edge , 47 b , 47 c & amp ; 47 d are from the middle . fig4 a shows the trailing edge of the top of the substrate and resembles the quad configuration , albeit with “ softened ” edges . fig4 b , 48 c & amp ; 48 d show results from the bottom of the substrate . fig4 a shows yet another view of the quad configuration , fig4 b and 49c show instances where non - sats material grows on the substrate between the substrate and the sats material and fig4 d is an excellent perspective of two towers with 50 micron spacing . fig5 a shows the quad configuration after compression testing and fig5 c shows an enlarged view of a central section of the tested section . fig5 d shows the diagonal propagation of the fracture outside the testing area of a portion of fig5 b above it . fig5 shows the plot of the claimed compression testing results , the solid line to the left being in accordance with the claimed invention and the dotted line to the right being a control . note the “ splitting ” behavior after some amount of sats growth . at the 37 . 5 micron spacing ( see fig2 ) above this takes the form of reproducing the square base geometry in each of the four faces . assuming any kind of surface reaction ( gas or liquid ) this could yield considerable specific area . other possibilities for preparing a substrate include surface rows with a power law or log normal type of increasing spacing , or a variation employing concentric circles . a wide variety of patterns or features could be prepared and then cnts grown on them . one purpose would be to grow patterns , such as fractal patterns , to have a set of discrete responses for producing radio wave passive sensors . upon external perturbation or some other sensing reaction , the patterned cnt 25 forest is disturbed and the em signature altered , permitting remote detection . there are many potential uses for and applications of the sats structure . directed growth of interconnects for integrated circuits may be possible . through control of chirality the conductive properties could be further designed for purpose . given appropriate substrate material , sats may be employed in electronic connections or sequential semiconductor junctions . applications could include “ super ” capacitors , strain sensing , piezoelectric coated generation including a variation with dielectric elastomers , and conductive ic - chip interconnects and the like . further , sats may be incorporated in hybrid structures that employ both electrical conduction and controlled micro - fluidics to mimic nervous system activity . possibilities include use as a boundary layer surface treatment to affect fluid flow and heat transfer . medical applications include scaffolding for blood vessel or nerve cells , kidney structures , cochlear implants to restore hearing , and the like . sats - 1 . a self - assembled tube structure grown on a substrate under specified process conditions comprising an elongate body comprising a plurality of carbon nanotubes , said elongate body having a longitudinal axis and a proximal end and a distal end opposite said proximal end , said proximal end attached to said substrate either directly or indirectly ( indirectly = attached to the substrate by non sats material ), said sats being either hollow ( having a central cavity ) or solid , said sats being generally symmetrical around said longitudinal axis . sats - 2 . the sats of sats - 1 , when viewed in an axial cross - section , i . e ., a section taken perpendicular to and at a midpoint along said longitudinal axis , may be in the shape of a circle , an oval , a square , a rectangle , a triangle , a polygon , a sheet , or other geometric forms . sats - 3 . the sats of any of sats - 1 to sats - 2 , when viewed in an axial cross - section at said distal end , i . e ., a section taken perpendicular to said longitudinal axis , may expand into a cross section larger in area than said midpoint axial cross section . sats - 4 . the sats of any of sats - 1 to sats - 3 wherein a shape of said expanded distal end is selected from the group consisting of a flared end , a flower like end , at least one petal - shaped element , at least one petal shaped end terminating in a square , frayed rope , and combinations thereof . sats - 5 . the sats of sats - 1 wherein said midpoint axial cross - section is in the shape of a cross . sats - 6 . the cross - shaped sats of sats - 5 comprised of five sections , a central core , and four appendage sections in contact with said central core , said five sections being substantially similar in shape and area and in the form of squares , said four appendage sections each being positioned at 0 degrees , 90 degrees , 180 degrees and 270 degrees , respectively . sats - 7 . the cross - shaped sats of sats - 5 comprised of at least four sections (“ n ”), one of said sections being a central core , and the remaining appendage sections (“ n − 1 ”) in contact with said central core , said remaining (“ n − 1 ”) sections being substantially similar in shape and area , and being positioned at positions in contact with said core , and equidistant from each other by an angular amount determined by the formula ( 360 degrees /( n − 1 ))= angular amount . sats - 8 . the cross - shaped sats of any of sats - 5 to sats - 7 wherein the central section of said cross is hollow . sats - 9 . the cross - shaped sats of any of sats - 5 to sats - 7 wherein the central section of said cross is solid . sats - 10 . the sats of sats - 1 having a cavity therein in the shape of the sats . sats - 10 . the sats of sats - 1 having a cavity therein in a different shape than the sats . sats - 11 . the sats of sats - 1 having a cavity with a cross - sectional area comprising 50 % to 90 % of the cross - sectional area of the sats . sats - 12 . the sats of sats - 1 having a cavity with a cross - sectional area comprising 10 % to 50 % of the cross - sectional area of the sats . sats - 13 . the sats of sats - 1 with a cross - sectional area , the longest linear dimension of which taken in any direction being less than about 25 microns . sats - 14 . the sats of sats - 1 with a cross - sectional area , the longest linear dimension of which taken in any direction being less than about 50 microns . sats - 15 . the sats of sats - 1 with a cross - sectional area , the longest linear dimension of which taken in any direction being less than about 100 microns . sats - 16 . the sats of sats - 1 having an ultimate tensile strength of 20 , 000 psi . sats - 17 . the sats of sats - 1 having a distance from proximal end to distal end of at least 3 millimeters . array - 1 . an array of at least 4 sats of any of the preceding ( sats ) claims in a 2 × 2 configuration . array - 2 . the array of array - 1 wherein the sats are in contact with each other . array - 3 . the array of array - 1 wherein the sats are circular in cross section and are separated from each other in every direction by a distance at equal to or greater than their diameter . array - 3 . the array of array - 1 wherein the sats are square in cross section and are separated from each other in every direction by a distance at equal to or greater than their edge dimension . the quad array . an array of at least 4 cross - shaped sats in a 2 × 2 configuration , each of said at least 4 cross - shaped sats comprised of five sections , a central core , and four appendage sections in contact with said central core , said five sections being substantially similar in shape and area and in the form of squares , said four appendage sections each being positioned at 0 degrees , 90 degrees , 180 degrees and 270 degrees , respectively , and wherein an axis taken through the center of the 0 degree and 180 degree appendage of one of said sats is aligned with an axis taken through the center of the 0 degree and 180 degree appendage of an adjacent sats , and said 0 degree appendage is in contact with said 180 degree appendage of said adjacent cross - shaped sats , and wherein an axis taken through the center of the 90 degree and 270 degree appendage of one of said sats is aligned with an axis taken through the center of the 90 degree and 270 degree appendage of an adjacent sats , and said 90 degree appendage is in contact with said 270 degree appendage of said adjacent cross - shaped sats , thus forming a square shaped cavity central to said array having an area four times the area of an appendage . the quad array 2 . the quad array having a greater stress versus deflection compressive stiffness of at least 20 %, relative to a non - sats control array , beginning at about 20 mpa of stress and continuing to at least about 50 mpa . the quad array 3 . the quad array having fracture behavior wherein the fracture appears at a 45 degree angle and spreads through said array in a diagonal direction and through diagonally oriented cross - shaped sats and travels outside the area of applied force . a method of producing a self - assembled tube structure ( sats ), said sats comprising an elongate body comprising a plurality of carbon nanotubes , said elongate body having a longitudinal axis and a proximal end and a distal end opposite said proximal end , said proximal end attached to said substrate either directly or indirectly ( indirectly = attached to the substrate by non sats material ), said sats being either hollow ( having a central cavity ) or solid , said sats being generally symmetrical around said longitudinal axis , said method comprising the steps of : providing a prepared substrate in a reaction zone introducing a catalyst into said reaction zone , said catalyst functioning to build said sats providing a source of carbon into said reaction zone providing an atmosphere of shield gas into said reaction zone to keep oxygen away from said reaction zone , and providing heat to said reaction zone , wherein at least one sats is produced . the method of producing sats wherein said prepared substrate is a silicon substrate with silicon particles distributed thereon . the method of producing sats wherein said prepared substrate is a silicon substrate having channels and towers and is prepared by deep reactive ion etching . the method of producing sats wherein said carbon source and said catalyst are combined and are selected from the group consisting of ferrocene and metallocene , and are in solution , said solution being introduced into said reaction zone by atomization . the method of producing sats wherein said atomization is performed by an ultrasonic device . the method of producing sats wherein said reaction zone is a tubular furnace . the method of producing sats wherein the temperature measured at the substrate is in the range of 800 degrees c . to 850 degrees c . the method of producing sats wherein the temperature measured at the substrate is about 820 degrees c . the method of producing sats wherein said shield atmosphere is selected from the group consisting of hydrogen , helium , argon and nitrogen . the abstract of the disclosure is provided to comply with the rules requiring an abstract that will allow a searcher to quickly ascertain the subject matter of the technical disclosure of any patent issued from this disclosure . ( 37 cfr § 1 . 72 ( b )). any advantages and benefits described may not apply to all embodiments of the invention . while the invention has been described in terms of some of its embodiments , those skilled in the art will recognize that the invention can be practiced with modifications within the spirit and scope of the appended claims . for example , although the system is described in specific examples for growing sats , it may be used for producing any type of cnts that may be useful in such diverse applications as electronics , medical devices and treatment , security systems , military systems and the like . in the claims , means - plus - function clauses are intended to cover the structures described herein as performing the recited function and not only structural equivalents , but also equivalent structures . thus , although a nail and a screw may not be structural equivalents in that a nail employs a cylindrical surface to secure wooden parts together , whereas a screw employs a helical surface , in the environment of fastening wooden parts , a nail and a screw may be equivalent structures . thus , it is intended that all matter contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative rather than limiting , and the invention should be defined only in accordance with the following claims and their equivalents .	8
the present invention provides a novel synthesis of irbesartan and analogues thereof , including the step of reacting a 2 -( 5 - tetrazoyl ) phenylboronic acid with a 3 -( haloaryl )- 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one . the step is carried out in the presence of a palladium or nickel catalyst . such a synthetic step is known by one of skill in the art as a suzuki coupling reaction . see , e . g ., n . miyaura et al ., tetrahedron letters 1979 , 3437 . see also , n . miyaura , a . suzuki , chem . commun . 1979 , 866 . the step can be carried out in a two - phase reaction system having first and second liquid phases . the first and second phases include first and second solvents , respectively , which are substantially immiscible in each other so that , when combined in a reaction vessel , a two - phase system is formed . solvents are substantially immiscible in each other when equal volumes of them are mixed together , a two - phase system is formed in which the volume of the two phases is essentially equal . preferably , substantially immiscible solvents are soluble in each other to the extent of about 1 % ( weight basis ) or less . the first solvents are organic solvents . examples of preferred organic solvents include , but are not limited to : ether solvents such as 1 , 2 - dimethoxyethane ( dme ), diethoxymethane , ( glymes ), and tetrahydrofuran ( thf ); formals such as diethyl formal ; and hydrocarbon solvents such as , toluene , m - xylene , o - xylene , the tetralins ; and mixtures of any of the foregoing . other hydrocarbons useful as first solvents in the practice of the present invention will be apparent to the skilled artisan . diethyl formal is the preferred formal . 1 , 2 - dimethoxyethane ( dme ) is the preferred glyme and is particularly preferred as an ether first solvent , especially in combination with thf when the catalyst includes a palladium complex . the second solvent can be water , or , preferably , an inorganic base combined with water . when an inorganic base is used , the preferred inorganic base is potassium carbonate . potassium hydroxide and sodium hydroxide are other examples of inorganic bases . the novel synthesis of irbesartan , and analogues thereof , of the present invention includes the step of reacting a protected ( e . g . tritylated ) 2 -( 5 - tetrazoyl ) phenylboronic acid with a 3 - haloaryl - 1 , 3diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one . a preferred 2 -( 5 - tetrazoyl ) phenylboronic acid is 2 -( 5 -( 1 - trityl - 1h - tetrazole )) phenylboronic acid ( irb - 07 ), structure ii . a preferred 3 - haloaryl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 3 - 4 - one is 2 - butyl - 3 -( 4 ′- bromobenzyl )- 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 3 - one ( irb - 05 ), structure iii . the step is carried out in a two - phase reaction system having first and second liquid phases . a catalyst is combined with the first liquid phase , preferably including an ether solvent . any known catalyst for the suzuki reaction can be used . preferably , the catalyst is selected from palladium and nickel complexes . most preferred catalysts include pd ( o ( o ) cch 3 ) 2 , pdcl 2 and nicl 2 . when a palladium complex such as pd ( o ( o ) cch 3 ) 2 [ e . g . pdoac 2 ] is used , the catalyst also includes a triaryl phosphine , especially triphenyl phosphine . when the catalyst includes a palladium complex , the first solvent preferably includes an ether solvent , like dme , that can form a complex with pd . as described above , the first liquid phase is an organic solvent phase , most preferably and particularly when the catalyst includes a palladium complex , the first liquid phase is a mixture of 1 , 2 - dimethoxyethane and thf . the ratio of 1 , 2 - dimethoxyethane : thf can be from about 10 : 1 to about 1 : 5 , the most preferred ratio of 1 , 2 - dimethoxyethane : thf is from about 6 : 1 to about 2 : 1 . the reaction is carried out in the presence of a catalyst . subsequently , irb - 07 is combined with the solvent mixture . water , a base , and irb - 05 are added , preferentially sequentially , to the reaction mixture , and a two - phase reaction system having a first organic solvent phase and a second aqueous phase is formed . the reaction mixture is heated under reflux conditions for a reaction time of between 2 to 4 hours . after the reaction time , the reaction mixture is allowed to cool , and the two phases are separated . if desired , the aqueous phase can be extracted one or more times with toluene and the extract ( s ) combined with the first ( aromatic hydrocarbon ) phase . the first phase is evaporated to obtain crude residue of product irb - 03 . in embodiments in which 2 -( 1 - trityl - 1h - tetrazol - 5 - yl ) phenylboronic acid , ( irb - 07 ), is the phenylboronic acid , the synthetic method of the present invention can and preferably does include a further step in which the trityl group is cleaved from the tetrazole ring to produce irbesartan ( irb - 00 ), or an analogue thereof . crude residue produced in the synthetic step described above is dissolved in a suitable water - miscible solvent . a solvent is water miscible if it is miscible with water at least in any proportion from 80 : 20 to 20 : 80 ( weight basis ). acetone is a preferred water - miscible solvent . the resulting solution is acidified and agitated at a temperature between about 15 ° c . and about 30 ° c . the time of the cleavage reaction can be conveniently monitored using thin layer chromatography . the acid is neutralized with a molar excess of base , preferably aqueous koh or naoh , and the water - miscible solvent is evaporated , preferably at reduced pressure . the trityl alcohol formed is separated and the liquid phase is acidified ( e . g . to a ph of about 4 ), preferably with mineral acid , most preferably with hcl or h 2 so 4 . the resulting suspension is cooled and the product recovered by , for example , filtration . if desired , the isolated product can be washed with an organic solvent , preferably a lower aliphatic alcohol , most preferably iso - propanol or butanol , and dried , preferably at reduced pressure . the 2 -( 5 - tetrazoyl ) phenylboronic acid and 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 3 -( haloaryl )- 4 - one which are reacted in the method of the present invention to produce irbesartan or an analogue thereof , can be prepared by methods known in the art , or by the following synthetic procedures . the 2 -( tetrazol - 5 - yl ) phenylboronic acid can be prepared by first reacting a 5 - phenyl - 1h - tetrazole with chlorotriphenylmethane in the presence of a base , especially an amine ( e . g . triethylamine ) in a suitable solvent system to provide a 5 - phenyl - 1 - trityl - 1h - tetrazole . a preferred 5 - phenyl - 1 - trityl - 1h - tetrazole is irb - 06 ( structure shown in examples ). suitable solvents for the solvent system include organic solvents . a particularly preferred solvent system is a mixture of thf and triethyl amine as the base . following removal of by - products , the 5 - phenyl - 1 - trityl - 1h - tetrazole , such as irb - 06 , can be isolated prior to use in the next step of the synthesis , or used in solution form . the protected tetrazole so formed is subsequently reacted with a suitable borate in the presence of a base , to form the desired boronic acid derivative , such as 2 -( 1 - trityl - 1h - tetrazol - 5 - yl ) phenylboronic acid ( irb - 07 ; structure shown in examples ). the reaction is carried out in solution , preferably in an organic solvent . the organic solvent is most preferably thf . suitable bases will be apparent to the skilled artisan . a preferred base is butyllithium . the preparation can be at any suitable temperature , preferably at a temperature lower than about − 20 ° c . the reaction is allowed to proceed for a time that the skilled artisan will know to adjust according to the reaction temperature . the 3 - haloaryl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one can be prepared by combining a 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one acid addition salt , preferably a hydrochloride salt , with a haloaryl compound . a preferred 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one acid addition salt is 2 - butyl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one hydrochloride ( irb - 01 ). a preferred haloaryl compound is 4 - bromobenzyl bromide . reaction of 2 - butyl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one hydrochloride ( irb - 01 ) with 4 - bromobenzyl bromide leads to the production of 2 - butyl - 3 -( 4 ′- bromobenzyl )- 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one ( irb - 05 ). 2 - butyl - 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one is known in the art and is disclosed , for example , in u . s . pat . no . 5 , 559 , 233 , which is incorporated herein by reference . the reaction is carried out in a two - phase reaction system having first and second liquid phases . a first liquid phase comprising the haloaryl compound and a phase transfer catalyst in a suitable solvent is prepared . the solvent may be an organic solvent . a most preferred solvent is toluene . phase transfer catalysts are well known to one skilled in the art of organic synthesis . phase transfer catalysts are of particular utility when at least first and second compounds to be reacted with each other have such different solubility characteristics that there is no practical common solvent for them and , accordingly , combining a solvent for one of them with a solvent for the other of them results in a two - phase system . typically , when such compounds are to be reacted , the first reactant is dissolved in a first solvent and the second reactant is dissolved in a second solvent . because the solvent for the first reactant is essentially insoluble in the solvent for the second reactant , a two - phase system is formed and reaction occurs at the interface between the two phases . the rate of such an interfacial reaction can be greatly increased by use of a phase transfer catalyst ( ptc ). several classes of compounds are known to be capable of acting as phase transfer catalysts , for example quaternary ammonium compounds and phosphonium compounds , to mention just two . tetrabutylaminonium hydrogensulfate is a preferred ptc for use in the practice of present invention . a second liquid phase comprising a 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one acid addition salt , water and a base , preferably an inorganic base , most preferably , koh . the base is present in an amount between about 1 and about 6 molar equivalents relative to the number of moles of 1 , 3 - diazaspiro [ 4 . 4 ] non - 1 - ene - 4 - one acid salt . the first and second solutions are combined to form a reaction system ( mixture ) that has first and second phases . the combining can be in any suitable vessel that is equipped with means for vigorous agitation of the reaction system to maximize the interfacial area between the two phases . the combining can be at any temperature from about 20 ° c . to about 95 ° c ., preferably at about 90 ° c . the reaction is allowed to proceed in the two phase system for a time that the skilled artisan will known to adjust according to the reaction temperature . when the reaction temperature is about 90 ° c ., a reaction time between about 1 and about 2 hours is usually sufficient . after the reaction time , the reaction system is allowed to cool , the two phases are separated . if desired , the aqueous phase can be extracted one or more times with toluene and the extract ( s ) combined with the first ( aromatic hydrocarbon ) phase . the first phase is evaporated to obtain crude residue . the present invention can be illustrated in one of its embodiments by the following non - limiting example . to a preheated ( 90 ° c .) solution of 4 - bromobenzyl bromide and phase transfer catalyst ( bu 4 nhso 4 ) in toluene was added a prestirred ( 40 min at room temperature ) solution of koh and irb - 01 in water . the resulting two - phase mixture was heated for 1 hour at 90 ° c . with vigorous stirring . the mixture was cooled to room temperature , water ( 500 ml ) was added and the mixture was stirred for additional 30 min . the phases were separated and the aqueous phase was extracted with an additional portion of toluene ( 100 ml ). the combined organic portions were washed with water and brine , dried over na 2 so 4 and evaporated under reduced pressure . 74 . 0 g of irb - 05 was obtained as a colorless oil . the yield was 94 %, with a purity of 94 %. to a solution of 5 - phenyl - 1h - tetrazol and triethylamine in dry thf was added , in one portion , chlorotriphenylmethane . the reaction was slightly exothermic , about 40 ° c . the resulting suspension was stirred under argon for 2 hours ( tlc monitoring ; hex / etoac 4 : 1 ). the mixture was cooled to 0 ° c ., stirred for 30 min and the precipitated triethylammonium chloride was filtered and washed with cold thf ( 100 ml ). the filtrate was evaporated under reduced pressure and the yellow solid residue ( approx . 180g ) was crystallized from acetonitrile ( 800 ml ) to give 141 . 5 g . the yield was 94 %, with a purity of 94 %. the solution of 5 - phenyl - 1 - trityl - 1h - tetrazole ( irb - 06 ) in dry thf ( prepared in example 1b ) was cooled to − 20 ° c . under argon . traces of water were quenched with n - butyllithium ( approx . 5 ml ). when the mixture remained red for 5 minutes the addition was stopped . the main charge of n - butyllithium was then added dropwise at temperature below − 15 ° c . and the resulting red suspension was stirred for additional 30 minutes at − 20 ° c . the mixture was cooled to − 30 ° c ., and triisopropyl borate was slowly added , with the reaction temperature maintained at below − 20 ° c . at this point , the slurry was dissolved and the resulting red solution was stirred for 30 minutes at − 25 ° c ., and then warmed to room temperature over 40 minutes . the solvents were evaporated under reduced pressure and the yellow semisolid residue was extracted with isopropyl alcohol ( ipa ) ( 200 ml ) and cooled to 0 ° c . saturated aqueous nh 4 cl ( 40 ml , approx . 180 mmol ) was slowly added , keeping the temperature below 10 ° c ., and the slurry of boronic acid was warmed to room temperature . water ( 160 ml ) was added over 20 minutes , and the resulting suspension was stirred for 2 hours at room temperature . the solid was filtered , washed with ipa / h 2 0 / et 3 n 50 : 50 : 2 ( 2 × 50 ml ) and dried under reduced pressure at 40 ° c . until constant weight to give 47 . 0 g of irb - 07 as the 1 : 0 . 5 thf - h 2 o solvate ( off - white solid ) that was used without additional purifications . the yield was 92 %, with a purity of 94 . 5 %. a mixture of dme and thf was degassed by vacuum / nitrogen purges ( 3 times ) and ph 3 p was added in one portion . after the triphenylphosphine dissolved , pd ( oac ) 2 was added , and the yellow - green mixture was degassed again ( 2 times ), and stirred for 30 min at room temperature . irb - 07 was suspended , and stirring was continued for 10 min at room temperature . the water was added , and the slurry was stirred for additional 30 min . powdered k 2 co 3 and irb - 05 were then added sequentially and the resulting mixture was degassed ( 3 times ), and refluxed ( approx . 80 ° c .) for 3 hours ( tlc monitoring : hex / etoac 2 : 1 ). the solvents were evaporated under reduced pressure , and toluene ( 20 ml ) and water ( 20 ml ) were added . after separation , the aqueous phase was extracted with toluene ( 10 ml ) and the combined organic phases were washed with water and brine , dried over na 2 so 4 and evaporated under reduced pressure to give 2 . 1 g of the semisolid residue . the crude material was crystallized from ipa ( 15 ml ) to give 1 . 6 g of irb - 03 as a white solid . the yield was 90 %, with a purity of 98 %. irb - 03 ( as produced in example 1d ) was dissolved in acetone and 3n hcl , and stirred for 2 hours at room temperature ( tlc or hplc monitoring ). a solution of koh in 3 ml of water was slowly added , and acetone was evaporated under reduced pressure . the precipitate ( trityl alcohol ) was filtered and washed with water ( 2 × 5 ml ). the combined aqueous filtrate washed with 5 ml of ethyl acetate , and slowly acidified to ph 4 with 3n aqueous hcl . the resulting suspension was cooled down to 0 - 4 ° c ., stirred for additional 30 min and filtered . the cake was washed several times with water and dried under reduced pressure at 50 - 60 ° c . the yield was 0 . 58 g of irb - 00 .	2
fig1 - 9 show an apparatus 1 for minimising bunching or entanglement of any elongate means ( unit ) 2 which can be used in combination with a retracting and extending mechanism 3 which can retrofitted or made in combination therewith . apparatus 1 for minimising bunching or entanglement includes a support means ( unit ) and moving means ( unit ). the support means can include at least one first shaft 4 having a length and defining a first rotating axis . the moving means ( unit ) includes at least one or two rollers 5 & amp ; 6 . first shaft 4 is adapted to be stationary and rollers 5 & amp ; 6 are adapted to be rotatably supported by shaft 4 such that in use , the rollers 5 & amp ; 6 are able to slideably move about the shaft axis parallel to the length , in response to movement of the elongate means 2 . each roller 5 & amp ; 6 as shown in fig6 & amp ; 7 includes a groove portion that can be circumferential groove 8 being adapted and constructed to receive and guide an elongate means ( unit ). groove 8 can be at least part way circumferential in extent . the elongate means ( unit ) 2 can be any type of elongate means that enables an object to be pulled / retracted or extended . typically elongate means can be a cable or wire or rope and the object to be pulled or extended can be a cover 9 such as a pool cover or an awning for a building / shelter . in this example the elongate means can be a flexible elongate means ( unit ) in the form of a cable or rope attachable to the cover as two separate lengths 10 and 11 . the apparatus 1 for minimising bunching or entanglement can be attached to any retractable or extendable mechanised cover system 3 . typically cover 9 can be rectangular in shape having sides and ends . other cover shapes are equally possible . each side of the cover can have at least one cable 10 and 11 attached to each side of the cover such that there are two separate cable lengths . the apparatus 1 for minimising bunching or entanglement as described is adapted to be retro - fitted or combined with an existing retractable and extending cover mechanism 3 . apparatus 1 can be sold as a kit for ready attachment by way of attachment means . the retractable and extending cover mechanism 3 can include an activating means 12 , support 13 , a cable retracting means and extending means and locating means 15 . activating means ( unit ) 12 can comprise a motor or similar with the operating means ( unit ) being any system that can operate the motor . for example this can be electricity , both mains or portable , a fuel based system , solar or wind or hydraulics or pneumatics system . support 13 can include any suitable structure like for example a housing 16 having a frame 17 and bracketing 18 which can be suitably removably connected together in any shape or dimensions as required . locating means 15 includes at least one guide roller ( 19 , 20 , 21 ) rotatable fixedly mounted on separate support shafts ( not shown ) which is not rotatable but in other options may be rotatable . fig1 and 2 show the cable guide having for example three rollers 19 - 21 . the cable retractable and extendable mechanism 3 includes a driving shaft 30 having at least two pulleys 31 & amp ; 32 mounted thereon . other features can also be included with the mechanism 3 such as a drum 33 mounted on the drive shaft 30 for the cover or covers 9 . the drive shaft 30 having a motor end 34 and non motor end 35 . an electrical limit switch 36 with chain sprocket 37 can be located at the non motor end 35 of the drive shaft 30 . there can also be fixing brackets 38 to support the non motor end of the drive shaft 30 . at the motor end 34 of the drive shaft 30 the motor 12 can be operatively connected to a gear box 39 , which is operatively connected to a housing 40 having within , locking collars 41 , cable pulleys 31 , 32 , a 3 - pin male dog clutch 42 and 3 - pin female dog clutch 43 being operatively connected to the apparatus for minimising bunching and entanglement of elongate means 1 or a rope retainer ( see fig3 , 4 and 5 ). other parts or components can be included as is necessary to enable the drive shaft to work such as bearings 44 and drums 45 . the bunching and entangling apparatus shaft 4 can also be positioned parallel to the other drive shaft 20 placing the apparatus 1 on the side of the housing and guide means being positioned on top of the housing . in use the cable has a distal end when compared to the apparatus which is removably anchored to the distal end of the cover . the size of the cover can also have slideable attachment means to the cable — not shown . the proximal cable end can be located on each pulley via and in consecutive order through each guide roller through to the bunching entanglement apparatus roller through to a respective adjacent pulley . the pulley can be activated by activating the motor which rotates the pulley drive shaft in either a clockwise or anti - clockwise direction . normally both pulleys will be activated to rotate in a similar direction such that the cable and hence the cover can either be retracted or extended . in another aspect of the mechanism the distal end of the cable can have a further roller support device ( not shown ) which enables the cover to slideably move either in a retracted or extending orientation by virtue or roller supports that are supported by the sides of a pool if it is a pool cover or by a tracking system ( not shown ) if we are using the apparatus in an awning . in other variations there can be extra rollers per shaft if the cover is of certain dimensions . also the mechanism or the apparatus can have further framing parts that enable shafts to be correctly supported while not moving . there can also be further devices which enable the apparatus to be remotely controlled through wire or wireless operation . the apparatus is also designed to be retrofitted to existing retracting and extendable pool cover mechanisms . the rollers can be made from any suitable material such as nylon or teflon . apparatus 1 for minimising bunching and or entanglement as shown in fig4 and 5 includes a guard structure or rope retainer 50 that can be used to movably hold elongate means 2 in groove 8 for each and or both rollers . this is especially important when the elongate means is not in tension when being retracted or extended though equally at any other point whenever the elongate means is in tension . the guard or rope or elongate means retainer 50 includes a shaft attaching portion 51 and holding portion 52 . attaching portion 51 can have apertures shaped to receive shaft 4 . holding portion 42 can include an elongate portion shaped to be able to cover groove 8 of each roller 5 and or 6 . for example holding portion 52 can be a strip or angled or elongate member and attaching portion 51 can be at least one ring shaped members 53 , 54 and 55 . other means of attachment to the shaft are equally possible as long as the elongate means is held in place in the groove 8 . the strip member can be curved as shown in fig4 , to match the outer surface of the roller 5 or 6 and rings 53 , 54 and 55 and better hold the elongate means in place . the strip member can be affixed to the rings both removably or permanently by welding for example . the apparatus for minimising bunching and or entanglement can be attached to any other mechanism . the apparatus can be designed to include remote and or automatic control such that the cover can always be automatically extended to provide a safe barrier to unwanted trespassers , thereby negating the need for expensive pool fencing . in this regard the cover can be designed to allow walking thereon . as the apparatus provides minimal entanglement or bunching and an even tension in any extending or retracting of cover cabling , this type of cover is then adapted to be easily and dependably extended or retracted . the apparatus for minimising bunching and or entanglement can include sensors 56 which serve to facilitate automatic operation , whereby non - use or unwanted use of the pool for a specified time period can be prevented . in operation the apparatus or motor can be initiated to start and extend the pool cover to completely cover the pool or water . this feature enables the pool to always be covered and be an alternative or addition to pool fencing . additionally security coding can also be used in combination with the apparatus , to further secure the pool against unwanted use . for example , the sensors can be heat or movement activated and can be set up to extend or retract the cover . in another aspect there is a method of inserting a cable via the apparatus 1 to minimise tangling and bunching . the method may include feeding the cable ( s ) via a guide and then through the retracting and extending apparatus followed by going through and being supported by the apparatus 1 and back to the cover . other variations of this method of installation are equally possible such as feeding the cable in a different order as described . to those skilled in the art to which the invention relates , many changes in construction and widely differing embodiments and applications of the invention will suggest themselves without departing from the scope of the invention as defined in the appended claims . the disclosures and the description herein are purely illustrative and are not intended to be in any sense limiting . throughout the description and claims of this specification the word “ comprise ” and variations of that word , such as “ comprises ” and “ comprising ”, are not intended to exclude other additives , components , integers or steps . the apparatus and method for minimising bunching and or entanglement and / or retracting or extending mechanism can have some of the following advantages : 1 . simple operation . 2 . reduced maintenance . 3 . quick operation . 4 . safe operation . 5 . less likelihood of twisting covers . 6 . retro - fitting is possible . 7 . able to be included in new machines during manufacture . 8 . able to be sold as a kit . 9 . few parts . 10 . modest cost of manufacture . 11 . automatic control . 12 . dependable long life .	1
in order to reduce the time it takes to add a fluid to a dispensing container , a flexible container having a flexible pouch with a valve assembly is provided for refilling a dispensing container . the fluid in the flexible pouch can pass from the flexible pouch through the valve assembly into the dispensing container . the flexible pouch of the dispensing container provides an improved manner of transferring a viscous liquid or fluid to a dispensing container . with the valve assembly open , the flexible pouch may be squeezed , there by applying pressure to the viscous fluid invoicing the same through the opening valve assembly into the dispensing container , which is attached to the valve assembly . with a flexible refilling container , transportation is greatly simplified , whether the container is or empty . with the flexible refilling container being shipped as full , such flexibility permits more compact shipping in that more containers can be stored or shipped in the same shipping space . also , when empty , this flexible refilling container is even more compact and can be shipped in less space . thus , the empty containers are more easily transported for either recycling or reuse . clearly such containers can also be refilled if desired . in a preferred form , the valve assembly provides for a secure attachment to a dispensing container . the squeezing of flexible pouch permits fluid to be forced from flexible container out of flexible pouch through valve assembly into a dispensing container . by the same token , the valve assembly further permits securing so that the flexible refilling container may itself be a dispensing container and have a plurality of uses as a refilling container . also in a preferred form , the valve assembly attached to the flexible refilling container has a vent passage . this debt passage permits entry of air into the transfer area of the fluid passing between the flexible container and the dispensing container . a further preferred valve assembly is one - piece . the one - piece valve may be formed by injection molding . such formation minimizes the assembly requirements of the valve assembly . it is also possible for both an accumulated valve , or a washer valve to be injection molded , but supported by a washer . referring now to fig1 flexible refilling container 100 has accumulated valve assembly 120 mounted on flexible pouch 150 . accumulated valve assembly 120 combines with flexible pouch 150 in order to permit a release of a desired amount of fluid from the flexible pouch 150 . adding fig2 to the consideration , valve assembly 120 has a connector cap 122 with a spout 124 extending therefrom . spout 124 communicates with flexible pouch 150 through connector cap 122 . closing cap 128 fits over spout 124 onto male spout threads 130 . closing cap 128 includes female cap threads 132 . clearly female cap threads 132 can be attached to or released from male spout threads 130 as desired . with fig3 additionally considered , spout 124 is closed with cap 128 . connector cap 122 is held in place between spout base 136 and neck base support 172 , thereby allowing connector cap 122 to turn freely . adjacent to spout base 136 is washer gasket 140 . neck base nozzle 174 is secured to spout 124 , by glue , sonic weld or another suitable bonding system . washer gasket 140 seals the connection between refilling pouch 100 and dispensing container 110 of fig5 . from male spout threads 130 extends spout 124 . spout 124 communicates with flexible pouch 150 and permits refilling of dispensing container 110 . from fig4 a fixed seal 154 can close spout 124 . with cutting device 152 , fixed seal 154 can be separated from spout 124 and permit flow from flexible refilling container 100 to dispensing container 110 of fig5 . with fig5 and fig6 the connection of flexible refilling pouch 100 to dispensing container 110 can be seen . such a tight seal is due to the gasket 140 with the structure of accumulated valve assembly 120 . female valve threads 160 are secured to male dispensing container threads 162 , thereby providing a tight seal as required . in fig6 and fig7 the connection of flexible refilling pouch 100 is assisted by base vent 176 . in this manner , the vacuum created by the fluid transfer is minimized . with fig7 showing an exploded view of valve assembly 120 , the structure becomes even more clear . neck base 170 is secured to flexible pouch 150 , and provides support for the balance of accumulated valve assembly 120 to the secured thereto . connector cap 140 fits over neck base 170 and onto neck base support 172 and around that neck base nozzle 174 . over neck base nozzle 174 fits dispensing nozzle 162 . then , the gasket 140 and cap 160 may be attached in the previously described fashion . flexible pouch 150 is shown as opened with a first flap 180 and second flap 182 . first flap 180 can be folded over second flap 182 at fold 184 . opposite fold 184 is first seal 186 . adjacent to first seal 186 is base seal 188 to close bottom 190 of flexible pouch 150 . top seal 192 receives accumulated valve assembly 120 and seals flexible pouch 150 therearound . more specifically , neck base 170 both receives top seal 192 and locks the accumulated valve assembly 120 in flexible pouch 150 . thus , flexible refilling container 100 can be completely emptied and reused . turning now to fig8 and fig9 washer valve assembly 200 has a structure similar to accumulated valve assembly 120 . however , instead of the variety of pieces for accumulated valve assembly 120 attachable to flexible pouch 150 in order to form flexible refilling container 100 , washer valve assembly 200 is injected molded or otherwise shaped to form all elements of accumulated valve assembly 120 . if desired , washer valve assembly 200 has inserted therein a vented gasket 202 . vented gasket 202 has a vent aperture 204 which aligns with housing aperture 206 and threaded base 208 . the threaded base 208 forms a top portion of threaded attachment 210 , which secures washer valve assembly 200 to dispensing container 110 . fig1 and fig1 combined to show the preferred unitary valve assembly 230 attachable to flexible pouch 150 in order to form flexible refilling container 100 of this invention . this unitary valve assembly 230 may simply be molded and requires no assembly or insertion of any washer . the structure of this unitary valve assembly 230 is similar to accumulated valve assembly 120 . however , with the one step molding process , no assembly is required . the structure present in the accumulated valve assembly 120 is provided by the structure of the mold . this application — taken as a whole with the abstract , specification , claims , and drawings being combined — provides sufficient information for a person having ordinary skill in the art to practice the invention as disclosed and claimed herein . any measures necessary to practice this invention are well within the skill of a person having ordinary skill in this art after that person has made a careful study of this disclosure . because of this disclosure and solely because of this disclosure , modification of this method and device can become clear to a person having ordinary skill in this particular art . such modifications are clearly covered by this disclosure .	1
we consider the problem of controlling a team of n planar auvs to collaboratively track the material lines that separate regions of flow with distinct fluid dynamics . this is similar to the problem of tracking the stable ( and unstable ) manifolds of a general nonlinear dynamical system where the manifolds separate regions in phase space with distinct dynamical behaviors . we assume the following 2d kinematic model for each of the auvs : where x i =[ x i , y i ] t is the vehicle &# 39 ; s planar position , v i and θ i are the vehicle &# 39 ; s linear speed and heading , and u i =[ u i , v i ] t is the velocity of the fluid current experienced / measured by the i th vehicle . additionally , we assume each agent can be circumscribed by a circle of radius r , i . e ., each vehicle can be equivalently described as a disk of radius r . in this work , u i is provided by a 2d planar conservative vector field described by a differential equation of the form in essence , u i = f x ( x i ) and v i = f y ( x i ). let b s and b u denote the stable and unstable manifolds of eq . ( 2 ). in general , b s and b u are the separating boundaries between regions in phase space with distinct dynamics . for 2d flows , b * are simply one - dimensional curves where * denotes either stable ( s ) or unstable ( u ) boundaries . for a small region centered about a point on b , the system is unstable in one dimension . finally , let ρ ( b ) denote the radius of curvature of b * and assume that the minimum of the radius of curvature ρ min ( b )& gt ; r . this last assumption is needed to ensure the robots do not lose track of the b due to sharp turns . the objective is to develop a collaborative strategy to enable a team of robots to track b * in general 2d planar conservative flow fields through local sampling of the velocity field . while the focus is on the development of a tracking strategy for b s , the method can be easily extended to track b u since b u are simply stable manifolds of eq . ( 2 ) for t & lt ; 0 . the method of the invention originates from the proper interior maximum ( pim ) triple procedure , h . e . nusse and j . a . yorke , “ a procedure for finding numerical trajectories on chaotic saddles ,” physica d nonlinear phenomena , vol . 36 , pp . 137 - 156 , 1989 ( hereinafter “ nusse et al .”)— a numerical technique designed to find stationary trajectories in chaotic regions with no attractors . while the original procedure was developed for chaotic dynamical systems , the approach can be employed to reveal the stable set of a saddle point of a general nonlinear dynamical system . the procedure consists of iteratively finding an appropriate pim triple on a saddle straddling line segment and propagating the triple forward in time . given the dynamical system described by eq . ( 2 ), let d ∈ r 2 be a closed and bounded set such that d does not contain any attractors of eq . ( 2 ). given a point x ∈ d , the escape time of x , denoted by t e ( x ), is the time x takes to leave the region d under the differential map given by eq . ( 2 ). let j be a line segment that crosses the stable set b s in d , i . e ., the endpoints of the j are on opposite sides of b s . let { x l , x c , x r } denote a set of three points in j such that x c denotes the interior point . then { x l , x c , x r } is an interior maximum triple if t e ( x c )& gt ; max { t e ( x l ), t e ( x r )}. furthermore , { x l , x c x r } is a proper interior maximum ( pim ) triple if it is an interior maximum triple and the interval [ x l , x r ] in j is a proper subset of j . then the numerical computation of any pim triple can be obtained iteratively starting with an initial saddle straddle line segment j 0 , let x t0 and x r0 denote the endpoints of j 0 and apply an ε 0 & gt ; 0 discretization of j 0 such that x l0 = q 0 & lt ; q 1 & lt ; . . . & lt ; q m = x r0 . for every point qi , determine t e ( q i ) by propagating q i forward in time using eq . ( 2 ). then the pim triple in j 0 is given by the points { q k − 1 , q k , q k + 1 } where q k = argmax i = 1 , . . . , m t e ( q i ). this pim triple can then be further refined by choosing j 1 to be the line segment containing { q k − 1 , q k , q k + 1 } and reapplying the procedure with another ε 1 & gt ; 0 discretization where ε 1 & lt ; ε 0 . given an initial saddle straddling line segment j 0 , it has been shown that the line segment given by any subsequent pim triple on j 0 is also a saddle straddling line segment [ h . e . nusse and j . a . yorke , “ a procedure for finding numerical trajectories on chaotic saddles ,” physica d nonlinear phenomena , vol . 36 , pp . 137 - 156 , 1989 .]. furthermore , if we use a pim triple x ( t )={ x l , x c , x r } as the initial conditions for the dynamical system given by eq . ( 2 ) and propagate the system forward in time by δt , then the line segment containing the set x ( t + δt ), j t + δt , remains a saddle straddle line segment . as such , the same numerical procedure can be employed to determine an appropriate pim triple on j t +≢ t . this procedure can be repeated to eventually reveal the entire stable set b s and unstable set b u within d if time was propagated forwards and backwards respectively . furthermore , since the procedure always begins with a valid saddle straddling line segment , by construction , the procedure always results in a non - empty set . building upon the pim triple procedure , as described below the invention utilizes a cooperative saddle straddle control strategy for a team of n ≧ 3 robots to track the stable ( and unstable ) manifolds of a general conservative time - independent flow field f ( x ). the invention differs from the pim procedure where it relies solely on information gathered via local sensing and shared through the network . in contrast , a straight implementation of the pim triple procedure necessitates global knowledge of the structure of the system dynamics throughout a given region given its reliance on computing escape times . consider a team of three robots and identify them as robots { l , c , r }. while the robots may be equipped with similar sensing and actuation capabilities , we propose a heterogeneous cooperative control strategy . let x ( 0 )=[ x l t ( 0 ), x c t ( 0 ), x r t ( 0 )] t be the initial conditions for the three robots . assume that x ( 0 ) lies on the line segment j 0 where j 0 is a saddle straddle line segment and { x l ( 0 ), x c ( 0 ), x r ( 0 )} constitutes a pim triple . similar to the pim triple procedure , the objective is to enable the robots to maintain a formation such that a valid saddle straddle line segment can be maintained between robots l and r . instead of computing the escape times for points on j 0 as proposed by the pim triple procedure , robot c must remain close to b s using only local measurements of the velocity field provided by the rest of the team . as such , we refer to robot c as the tracker of the team while robots l and r maintains a straddle formation across the boundary at all times . robots l and r may be thought of herding robots , since they control and determine the actions of the tracking robot . the controller for the straddling robots consists of two discrete states : a passive control state , u p , and an active control state , u a . the robots initialize in the passive state u p where the objective is to follow the flow of the ambient vector field . therefore , v i = 0 for i = l , r . robots execute u p until they reach the maximum allowable separation distance d max from robot c . when ∥ x i − x c ∥& gt ; d max robot i switches to the active control state , u a , where the objective is to navigate to a point p i on the current projected saddle straddle line segment ĵ i such that ,∥ p i − p c \|= d min and p c denotes the midpoint of ĵ i . when robots execute u a , v i =∥ p i − x i − u i ∥ and θ i ( t )= α i ( t ) where α i is the angle between the desired , ( p i − x i ), and current heading , u i , of robot i as shown in fig1 . in summary , the straddling control strategy for robots l and r is given by we note that while the primary control objective for robots l and r is to maintain a straddle formation across b s , robots l and r are also constantly sampling the velocity of the local vector field and communicating these measurements and their relative positions to robot c . robot c is then tasked to use these measurements to track the position of b s . let û l ( t ), û c , and û c ( t ) denote the current velocity measurements obtained by robots l , c , and r at their respective positions . let d (•,•) denote the euclidean distance function and assume that d ( x c , b s )& lt ; ε such that ε & gt ; 0 is small . given the straddle line segment j t such that x l ( k ) and x r ( k ) are the endpoints j t , we consider an ε t & lt ; ε discretization of j t such that x l = q 1 & lt ; q 2 & lt ; . . . & lt ; q m = x r . the objective is to use the velocity measurements provided by the team to interpolate the vector field at the points q 1 , . . . , q m . since eq . ( 2 ) has c l continuity and if x c is ε - close to b s , then the point q b = argmax k = 1 , . . . , m u ( q k ) t û c ( t ) should be δ - close to b s where ε & lt ; δ & lt ; a and a is a small enough positive constant . while there are numerous vector field interpolation techniques available ( j . c . agui and j . jimenez , “ on the performance of particle tracking ,” journal of fluid mechanics , vol . 185 , pp . 447 - 468 , 1987 , and e . j . fuselier and g . b . wright , “ stability and error estimates for vector field interpolation and decomposition on the sphere with rbfs ,” siam j . numer . anal ., vol . 47 , pp . 3213 - 3239 , 2009 ), we employ the inverse distance weighting method . for a given set of velocity measurements û i ( t ) and corresponding position estimates { circumflex over ( x )} i ( t ), the velocity vector at some point q k is given by where w ij =∥{ circumflex over ( x )} i ( j )− q i ∥ − 2 . rather than rely solely on the current measurements provided by the three robots , it is possible to include the recent history of û i ( t ) to improve the estimate of u ( q k ), i . e ., û i ( t − δt ), û i ( t − 2δt ), and so on , where δt is the sampling period and i ={ l , c , r }. thus , the control strategy for the tracking robot c is given by v c =∥[( q b + bû b )− x c ]− u c ∥ ( 4a ) where β c denotes the difference in the heading of robot c and the vector ( q b − û b ) and b & gt ; r is a small number . the term bû b is included to ensure that the control strategy aims for a point in front of robot c rather than behind it . as such , the projected saddle straddle line segment ĵ t at each time step is given by p c = q c + bu c with ĵ t orthogonal to b s at q c and ∥ ĵ t ∥ chosen to be in the interval [ 2d min , 2d max ]. regarding the implementation of the saddle straddle control strategy , we begin with the following key assumption on the robots &# 39 ; initial positions . assumption 1 given a team of three robots { l , c , r }, assume that d ( x c ,( 0 ), b s )& lt ; ε for a small value of ε & gt ; 0 , ∥ x l − x c ∥=∥\| x r − x ∥= d min with d min & gt ; 2r , and robots l and r are on opposite sides of b s . in other words , assume that the robots initialize in a valid pim triple formation and their positions form a saddle straddle line segment orthogonal to b s . our main result concerns the validity of the saddle straddle control strategy . theorem 1 given a team of 3 robots with kinematics given by eq . ( 1 ) and u i given by eq . ( 2 ), the feedback control strategy eq . ( 3 ) and eq . ( 4 ) maintains a valid saddle straddle line segment in the time interval [ t , t + δt ] if the initial positions of the robots , x ( t ), is a valid pim triple . the above theorem guarantees that for any given time interval [ t , t + δt ] the team maintains a valid pim triple formation . as such , the iterative application of the proposed control strategy leads to the following proposition . proposition 1 given a team of 3 robots with kinematics given by eq . ( 1 ) and u i given by eq . ( 2 ), the feedback control strategy results in an estimate of b s , denoted as { circumflex over ( b )} s , such that & lt ; b s , { circumflex over ( b )} s & gt ; l2 & lt ; w for some w & gt ; 0 where & lt ;•,•& gt ; l2 denotes the inner product ( which provides an l 2 measure between the b s and { circumflex over ( b )} s curves ). from theorem 1 , since the team is able to maintain a valid pim triple formation across b s for any given time interval [ t , t + δt ], this ensures that an estimate of b s in the given time interval also exists . applying this reasoning in a recursive fashion , one can show that an estimate of b s can be obtained for any arbitrary time interval . preferably , one also determines the bound on w such that { circumflex over ( b )} s results in a good enough approximation since w depends on the sensor and actuation noise , the vector interpolation routine , the sampling frequency , and the time scales of the flow dynamics . we illustrate the proposed control strategy given by eq . ( 3 ) and eq . ( 4 ) with the following simulation results . fig2 a shows the trajectories of three robots tracking a sinusoidal boundary while fig2 b shows the team tracking a 1d star - shaped boundary . we note that throughout the entire length of the simulation , the team maintains a saddle straddle formation across the boundary . in both examples , u =− a ∇ φ − b ∇× ψ where a , b & gt ; 0 and •( x ) is an artificial potential function such that φ ( x )= 0 for all x ∈ b • and φ ( x )& lt ; 0 for any x ∈ r 2 / b •. the vector ψ is a 3 × 1 vector whose entries are given by [ 0 , 0 , γ ( x , y )] t where γ ( x , y ) is the curve describing the desired boundary . lastly , the estimated position of the boundary is given by the position of the tracking robot , i . e ., robot c . in these examples , we filtered the boundary position using a simple first - order low pass filter . we also implemented the control strategy on our multi - robot testbed . the testbed consisted of three msrv - 1 robots in a 4 . 8 × 5 . 4 meter workspace . the msrv - 1 are differential - drive robots equipped with an embedded processor , color camera , and 802 . 11 wireless capability . localization for each robot was provided via a network of overhead cameras . fig3 a shows the trajectories of the robots tracking a star shaped boundary . fig3 b is a snapshot of the experimental run . next , we consider the system of 3 robots with kinematics given by eq . ( 1 ) where u i is determined by the wind - driven double - gyre flow model with noise when ε = 0 , the double - gyre flow is time - independent , while for ε ≠ 0 , the gyres undergo a periodic expansion and contraction in the x direction . in eq . ( 5a - c ), a approximately determines the amplitude of the velocity vectors , ω / 2π gives the oscillation frequency , ε determines the amplitude of the left - right motion of the separatrix between the gyres , ψ is the phase , μ determines the dissipation , s scales the dimensions of the workspace , and η i ( t ) describes a stochastic white noise with mean zero and standard deviation σ =√{ square root over ( 2i )}, for for noise intensity i . in this work , η i ( t ) can be viewed as either measurement or environmental noise . fig4 shows the phase portrait of the time - independent double - gyre model . fig5 a - 5h show trajectories of the team of 3 robots tracking lagrangian coherent structures of the system described by eq . ( 5a - c ) with a = 10 , μ = 0 . 005 , ε = 0 . 1 , ψ = 0 , i = 0 . 01 , and s = 50 . the trajectories of the straddling robots are shown in black and the estimated lcs is shown in white . while the present invention has been described with respect to exemplary embodiments thereof , it will be understood by those of ordinary skill in the art that variations and modifications can be effected within the scope and spirit of the invention .	6
reference will now be made in detail to the present preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers are used in the drawings and the description to refer to the same or like parts . this invention uses a self - aligned method in the production of vias , and so the conventional photolithographic and etching steps are no longer needed . therefore , problems caused by the misalignment of via are eliminated , and considerations for the extension rules can be lifted . furthermore , the dimensions of the vias will be unaffected by the optical systems used in the production , and a lower resistance will be obtained for the vias . hence , the invention provides a step towards future device miniaturization . fig2 is a top view showing a layout of a via structure according to a first preferred embodiment of this invention . as shown in fig2 a number of vias 21 are distributed in the dielectric layer 20 . underneath the dielectric layer 20 are a number of conductive lines 22 ( shown in dashed lines ), which are connected electrically to a metallic layer ( not shown ) through vias 21 . comparing this via structure 21 with the conventional via structure 11 ( as shown in fig1 ), the via structure 21 here do not need to consider the extension rules , nor has to allow an extra width d around the via 21 . therefore , space occupied by the devices can be greatly reduced , and the level of integration in wafers can be greatly increased . fig3 a through 8a are top views showing the progression of manufacturing steps in the production of a via structure according to the first preferred embodiment of this invention , fig3 b through 6b are perspective views of fig3 a through 6a respectively ; and fig7 b and 8b are cross - sectional views along line aa &# 39 ; of fig7 a and 8a respectively . first , as shown in fig3 a and 3b , a semiconductor substrate 30 is provided , then a conductive layer 31 is formed over the substrate . next , a dielectric layer 32 is formed over the conductive layer 31 . the dielectric layer 32 is formed by depositing silicon nitride or an oxide using a chemical vapor deposition method , and the thickness is preferably between 500 å to 2000 å . next , as shown in fig4 a and 4b , hollow cavities are etched in the dielectric layer 32 , for example , a first cavity 33 and a second cavity 34 . the length and width of the each cavity are determined by the size of the via and the desired conductive lines . for example , the length of the first cavity 33 is about ( 2 × desired width of the conductive line + desired distance between two conductive lines + 0 . 1 ˜ 0 . 2 μm ), and its width is about the same as the desired width of the via ; the length of the second cavity 34 is about ( desired width of the via + 0 . 1 ˜ 0 . 2 μm ) and its width is about ( 2 × desired width of the via + desired distance between two conductive lines ); and here , 0 . 1 ˜ 0 . 2 μm is the necessary tolerance . next , as shown in fig5 a and 5b , photolithographic processing is performed by forming a photoresist layer 35 over the dielectric layer 32 , the first cavity 33 and the second cavity 34 . then , the photoresist layer 35 is patterned such that the photoresist layer 35 forms an overlapping region 36a with the first cavity 33 , and the photoresist layer 35 forms another overlapping region 36b with the second cavity 34 . next , as shown in fig6 a and 6b , the dielectric layer 32 is then etched in a first etching operation using the photoresist layer 35 as a mask . then , the conductive layer 31 is etched in a second etching operation also using the photoresist layer 35 as a mask to expose the substrate 30 and forming conductive lines 31a and dielectric lines 32a . next , as shown in fig7 a and 7b , a selective liquid phase deposition ( lpd ) is performed to deposit an oxide layer 37 over the substrate 30 . the deposited oxide layer is preferably silicon dioxide , and the lpd is carried out at about 35 ° c . because the liquid phase deposition will selectively deposit oxide on silicon dioxide layers , and not on other materials , for example , photoresist material , the oxide will form in the region above the substrate away from the photoresist layer . next , as shown in fig8 a and 8b , the photoresist layer 35 is removed to form via structures 38 of this invention at the former overlapping locations 36a or 36b . the oxide layer 37 and the dielectric layer 32a form the insulating layer surrounding the conductive lines 31a . the vias 38 formed here is not restricted by any extension rules . furthermore , because the vias 38 are formed at the overlapping locations 36a or 36b , size of the vias 38 are determined only by the first cavity 33 ( or the second cavity 34 ) and the conductive lines 31a . therefore , the via alignment and photolithographic exposure problems of a convention method can be completely avoided . fig9 a through 16a are top views showing the progression of manufacturing steps in the production of a via structure according to the second preferred embodiment of this invention ; fig9 b through 12b are perspective views of fig9 a through 12a respectively , and fig1 b through 16b are cross - sectional views along line bb &# 39 ; of fig1 a through 16a respectively . first , as shown in fig9 a and 9b , a semiconductor substrate 90 is provided , then a conductive layer 91 is formed over the substrate . next , a dielectric layer 92 is formed over the conductive layer 91 . the dielectric layer 92 can be , for example , a silicon nitride layer having a thickness preferably between 500 å to 2000 å . next , as shown in fig1 a and 10b , a first etching operation is perform to etch the dielectric layer 92 forming a first protruding pad 93a and a second protruding pad 93b , for example . the length and width of the protruding pads are determined by the size of the via and the desired conductive lines . for example , the length of the first protruding pad 93a is about ( 2 × desired width of the conductive line + desired distance between two conductive lines + 0 . 1 ˜ 0 . 2 μm ), and its width is about the same as the desired width of the via , the length of the second protruding pad 93b is about ( desired width of the via + 0 . 1 ˜ 0 . 2 μm ) and its width is about ( 2 × desired width of the via + desired distance between two conductive lines ). next , as shown in fig1 a and 11b , photolithographic processing is performed by forming a photoresist layer 94 over the dielectric layer 92 , the first protruding pad 93a and the second protruding pad 93b . then , the photoresist layer 94 is patterned such that portions of the photoresist layer 94 forms overlaps 95a with the first protruding pad 93a , and the photoresist layer 94 forms another overlaps 95b with the second protruding pad 93b . next , as shown in fig1 a and 12b , using the photoresist layer 94 as a mask , the conductive layer 91 is etched to form conductive lines 91a in a second etching operation . next , as shown in fig1 a and 13b , the photoresist layer 94 is removed , and in fig1 a and 14b , a thin first insulating layer 96 is deposited over the substrate 90 . the first insulating layer 96 , for example , can be an undoped teos layer formed using a chemical vapor deposition method with tetraethyl orthosilicate ( teos ) as the reactive gas . next , as shown in fig1 a and 15b , a second insulating layer 97 is formed over the first insulating layer 96 . the second insulating layer 97 can be an oxide layer , for example . subsequently , portions of the second insulating layer 97 are removed to expose surfaces of the first protruding pad 93a and the second protruding pad 93b . the second insulating layer 97 can be removed using an etching back method or a chemical - mechanical polishing ( cmp ) method . next , as shown in fig1 a and 16b , the first protruding pad 93a at the original overlapping locations 95a and the second protruding pad 93b at the original overlapping locations 95b are removed using a selective etching method . thus , the via structures 98 of this invention are formed at the former overlapping locations 95a and 95b , whose sidewalls are the first insulating layer 96 . the vias 98 formed here is not restricted by any extension rules . furthermore , because the vias 98 are formed at the overlapping locations 95a or 95b , size of the vias 98 are determined only by the first protruding pad 93a ( or the second protruding pad 93b ) and the conductive lines 91a . therefore , the via alignment and photolithographic exposure problems of a convention method can be avoided . as a summary , the self - aligned via structure provided by this invention includes the following advantages ( 1 ) no photolithographic and etching operations are used in forming the via structure of this invention . therefore , there is no need to consider via misalignment problems and the extension rules . in addition , resistance of the via is lower and the devices can be further miniaturized , thus raising the level of integration . ( 2 ) there is no rounding of corners for the vias and production is not limited by the optical processing . therefore , this invention provides impetus for future miniaturization . it will be apparent to those skilled in the art that various modifications and variations can be made to the structure of the present invention without departing from the scope or spirit of the invention . in view of the foregoing , it is intended that the present invention cover modifications and variations of this invention provided they fall within the scope of the following claims and their equivalents .	7
reference is made to fig1 in which the reference numeral 10 designates generally the coupled cavity type traveling wave tube that includes a known arrangement of magnets 12 , pole pieces 13 and spacer members 15 , which is to be described in detail later . it is sufficient at this point in the description to state that the spacer members and internal portions of the pole pieces function as a slow wave structure for propagating an electromagnetic wave with a phase velocity substantially less than the velocity of light and substantially equal to the velocity of an electron beam . and the magnets and pole pieces constitute a periodic permanent magnet focusing system for focusing the electron beam traversing the length of a slow wave structure . an input coaxial transducer 14 is coupled to the input end of the slow wave structure and is adapted for coupling the assembled traveling wave tube to an external microwave transmission line , not illustrated . the construction of the coupling includes a microwave seal , not illustrated , transparent to microwave energy but capable of maintaining the vacuum within the traveling wave tube and is essentially of a known structure . a waveguide type output transducer 20 , including an impedance step transformer 22 and a coupling flange 24 is coupled to the output end of the slow wave structure . the coupling flange includes a microwave window , not illustrated , transparent to microwave energy but capable of maintaining the vacuum within the traveling wave tube and is essentially of a known structure . an electron gun 28 , illustrated partially in section , is disposed at one end of the traveling wave tube and functions in operation to generate and propel a beam of electrons along longitudinal axis 31 of tube 10 . the electron gun contains a cathode 29 of electron emissive material and may be of any conventional construction well known in the art , such as exemplified by the electron gun illustrated in u . s . pat . no . 2 , 985 , 792 and u . s . pat . no . 2 , 936 , 393 . at the opposite end of traveling wave tube 10 , a cooled collector structure 16 , illustrated in section , is provided . the collector may be of any conventional structure and functions to collect those spent electrons from the beam which have passed through the tube &# 39 ; s interaction region . inasmuch as the details of the collector are not necessary to an understanding of the invention , reference may be made to collectors described in u . s . pat . nos . 2 , 985 , 792 and 2 , 860 , 277 for exemplary constructions and structure . the tube includes circuit &# 34 ; severs &# 34 ; 11 of conventional construction at several locations which , as is known , function to isolate the output signal from the input signal in a known manner . the permanent magnets 12 used in the traveling wave tube construction disclosed are pill - shaped magnets , a known alternative to the ring - shaped permanent magnets illustrated in the patents earlier herein cited , and has the purpose of extending a magnetic field through the pole pieces into the vacuum region of the traveling wave tube . each pole piece has essentially four corner portions and a permanent magnet is located at each corner sandwiched between adjacent pole pieces , with the polarity of the magnets arranged in the same direction parallel to the tube axis . the set of magnets is poled oppositely to the set of magnets situated between the common pole piece and the next adjacent pole piece . this is a conventional prior art magnetic focusing structure . the cutaway section of fig1 reveals the arrangement of pole pieces 13 and nonmagnetic electrically conductive metal spacers 15 which together form serially axially spaced interaction cavities 17 coupled by coupling holes 19 located off - axis of a central electron beam passage . the pole piece assembly , as presented in the front view of fig2 to an enlarged scale , includes a first portion 32 of iron , a ferromagnetic material , and a second circular portion 34 , also of iron . portion 34 contains a protruding cylindrical lip 36 surrounding a circular cylindrical passage 30 . a hollow cylindrical - shaped liner of copper material 38 is fixed within lip 36 and lines the passage walls . and a kidney - shaped coupling slot 35 extends through the pole piece . to insure an understanding of the relationship , the position of one of the pill - shaped magnets 12 &# 39 ; is represented in dash lines in fig2 . magnets such as 12 &# 39 ; are included at each of the four corners of the pole piece in the completed tube . fig3 which shows in cross - section the pole piece of fig2 taken along line 2 -- 2 thereof and in which identical elements are identically labeled shows in section the pole piece portion 34 containing the lip 36 , the main pole piece section 32 which similarly contains a protruding lip portion 27 at the pole piece back wall in the form of an annulus or lip surrounding passage 30 , which was not visible in fig2 . copper liner 38 is of a hollow cylinder geometry which extends through the length of passage 30 between the ends of lips 27 and 36 . sandwiched in between the flat surfaces of pole piece sections 32 and 34 is a washer - shaped copper member 40 . the copper member is seen to be in a thermal conducting relationship with the liner 38 as well as with portions 34 and 32 . although not labeled , very thin brazing material is situated between each of the surfaces of member 40 and pole piece sections 32 and 34 , liner 38 , and each of the pole piece sections and the member 40 as well . as is recognized , the metal iron material possesses magnetic properties , more specifically ferromagnetic properties , as well as being electrically conductive , has certain heat or thermal conductivity characteristics and certain coefficient or expansion . the copper metal is nonmagnetic but is electrically conductive and has substantially better thermal conductivity characteristics than iron , as well as a larger thermal coefficient of expansion . the overall relationship of the elements of the pole piece is more apparent from the exploded view presented in fig4 to which reference is now made . the exploded view illustrates the assembly of the pole piece in an intermediate stage . when fully assembled according to the teachings of the specification , including the formation of a coupling slot , such as 35 in fig2 the configuration of fig2 results . thus , pole piece section 32 contains cylindrical passage 30 along the axis 31 and a cylindrical well 33 of a predetermined depth , t b , which depth t b is less than the total thickness , t a , of pole piece portion 32 and is of a predetermined diameter , d 1 . the well 33 is coaxial with cylindrical passage 30 which opens into the well . the copper washer - shaped member 40 contains a central circular passage 41 of essentially slightly larger radius than passage 30 and the member is a thickness , t c . the outer diameter of member 40 , d 2 , is slightly less than said d 1 of well 33 . intermediate the pole piece section 32 and copper member 40 and represented in dash lines , is a washer - shaped wafer 37 of brazing material , typically a known 50 / 50 copper - gold alloy brazing composition , which serves to join elements 32 and 40 together . the thickness of this brazing material is usually very small , on the order of 0 . 038 millimeters . the washer - shaped pole piece portion 34 containing the cylindrical protruding lip 36 is illustrated . pole piece portion 34 is of an outer diameter , d 3 , slightly larger than the diameter of washer member 40 but barely less than the diameter d 1 of well 33 in pole piece section 32 , described as a &# 34 ; clearance &# 34 ; fit . for example , it is desired that the relationship between the diameters be as follows : d 3 ≅ d 1 & gt ; d 2 and suitably \| d 3 - d 2 \| ≅ 0 . 012 inch , \| d 3 - d 1 \|≅ 0 . 002 inch . another thin washer - shaped member 39 of 50 / 50 brazing material essentially identical to member 37 is located between elements 34 and 40 and is represented in dash lines which serves to join together elements 40 and 34 . brazing washers 37 and 39 are of essentially the same thickness . the hollow cylindrical copper liner 38 is illustrated in the most left hand portion of this figure . suitably the outer diameter of liner 38 , d 4 , is less than that of the diameter of passage 30 by an amount sufficient to just accommodate sandwiching of a thin hollow cylinder of brazing material 43 , represented in dash lines . the brazing material 43 is approximately the same length as metal copper liner 38 and serves to join the liner to each of the members 34 , 32 and 40 . the component elements heretofore described and illustrated are formed to the desired shape and dimension , as represented by block 51 in fig5 using conventional machining techniques , including milling on a milling machine and turning in a lathe , which need not be described in detail . the washer - like or annular portion of member 34 is of a thickness , t c , essentially equal to the thickness , t d , of the underlying annular base portion of well 33 in pole piece portion 32 . the elements are assembled together , as represented by block 53 in fig5 by inserting brazing material 37 in well 33 , followed consecutively by the copper washer 40 , brazing material 39 , washer - shaped pole piece portion 34 which , as was earlier noted , fits snugly in the well 33 . then the copper liner 38 and brazing cylinder 43 are pushed into place within passage 30 . as is represented by block 55 in fig5 the assembly of metal elements is brazed together in suitable conventional brazing apparatus , not illustrated . in brazing , the temperature of the assembly is raised to the vicinity of 970 ° centigrade , sufficient to melt the brazing material 37 and 39 , without melting the other iron and copper elements . as those skilled in the art are aware , the thermal coefficient of expansion of copper is greater than that of iron . as earlier described , the outer diameter d 2 of copper member 40 was slightly less than the diameter d 1 of well 33 in pole piece portion 34 . accordingly , the copper washer expands to reduce the clearance between its periphery and the walls of well 33 , but with enough clearance remaining at the brazing temperature to allow the brazing material on each side of member 50 to flow into the space between the washer and the iron walls bounding well 33 . additionally , brazing material flows throughout the length of the copper liner 38 , including that space between copper washer 40 and liner 38 . thereafter in the brazing process the assembly is allowed to cool so that the brazing material solidifies and forms a strong mechanical and thermally conductive bond between the surfaces of the adjoining elements . hence , the resulting structure may be referred to as a laminate or integral structure . because copper washer member 40 expanded to a greater degree during the heating portion of the brazing step , it should during cooling contract more than the iron portions 32 and 34 , presenting a pulling force on the walls of well 33 . for this reason , it is important that the thickness of the iron portion 34 be the same as the thickness remaining between the bottom of well 33 and the opposite side of pole piece portion 32 so as to achieve a balance and minimize the possibility of warpage or bowing of the surfaces . as a finishing step , represented as block 57 in fig5 the pole piece assembly is placed in a lathe and turned so as to flatten the pole piece surfaces ; to cut off any bowed portion . and the kidney - shaped coupling slot , element 35 in fig2 is cut through the assembly in the position illustrated in fig2 . additionally , it is sometimes desired to taper the outer surface of the protruding lips , such as 27 and 36 in fig2 for known purposes . that additional cutting operation may conveniently be performed at this stage of the fabrication process . it is found that if the pole piece is reheated to the high temperatures that are expected within the operating environment of the completed traveling wave tube , and less than the brazing temperatures , that the re - expansion of copper member 40 does not cause significant bending of the surfaces of the iron portion of the pole piece . a particular coupled cavity traveling wave tube constructed with the improved pole pieces obtained performance of a 6 percent duty cycle at about 7 kilowatts average power and about 150 kilowatts peak power . even though a portion of the iron material of the pole piece essentially was deleted to effectively reduce the cross - section of magnetic material available to conduct the magnetic flux from the magnets and is replaced by the copper material , a nonmagnetic material , it was found that the cross - section of magnetic material remaining was still sufficient to conduct the flux provided by the magnets , without magnetically saturating the magnetic path , at the desired intensity to the ferrule or lip portion of the pole pieces . understanding the foregoing described structure of my invention , the reader skilled in the art may easily grasp its significance . in contrast to the external copper patches of the prior art discussed in connection with the background to this invention , during the brazing steps the present structure essentially &# 34 ; traps &# 34 ; the copper material with its greater thermal coefficient of expansion within the iron &# 34 ; shell &# 34 ; formed between the main pole piece portion 32 and washer - shaped portion 34 , which are of the iron material , and that effect leads to a more complete braze between those elements with less ensuing warpage of the assembly . and the final machining is performed only after completion of the brazing steps so as to maintain accuracy of dimension and shape in the laminated pole piece structure . a further result grasped by the reader is that any errant electrons which stray off the beam axis and which would otherwise strike the beam passage walls within the pole piece including the ferrule or lip portions thereof , as in the prior art devices , do so by striking the copper liner 38 . the heat so generated is transmitted in great part through the copper liner 38 to the sandwiched copper portion 40 by means of which it may be conducted external of the traveling wave tube . there is thus no need for the heat to pass through iron ferrule or lip portions of the pole pieces and the main heat conducting path is a copper to copper path . this i regard as a significant advantage . lastly , it appears that the copper liner 38 has the effect of magnetically shielding the iron lip portions from the electron beam . thus the high gradient of magnetic field which appears near the pole piece ferrule tip or lip portions does not significantly affect the electron beam and i believe that effect beneficial in maintaining focusing of the electron beam during operation of the traveling wave tube . it is believed that the preceding description of a preferred embodiment of my invention is presented in such detail as to enable one skilled in the art to practice the invention . it is expressly understood however that the details presented for the foregoing purpose are not intended to restrict the scope of my invention , inasmuch as various changes , modifications or substitutions of equivalents , all of which embody the invention , suggest themselves to those skilled in the art upon reading this specification . it is therefore respectfully requested that my invention be broadly construed within the full spirit and scope of the claims appended hereto .	8
in the description which follows , like parts are marked throughout the specification and drawing with the same reference numerals , respectively . the drawing figures are not necessarily to scale and certain elements may be shown in somewhat schematic form in the interest of clarity and conciseness . referring to fig1 , there is illustrated a flagpole ornament in accordance with the invention and generally designated by the numeral 10 . the flagpole ornament 10 is illustrated mounted on the peak of a vertical oriented flagpole 12 having a conventional upper bracket or truck assembly 14 suitably mounted thereon . truck assembly 14 includes a somewhat inverted cup - shaped truck member 16 mounted on the peak of flagpole 12 in a conventional manner and supporting a conventional rotatable pulley 18 over which is trained a flag halyard 20 . flagpole ornament 10 is characterized as a generally spherical member or ball 11 and includes an upstanding post member 22 suitably connected to the truck member 16 as will be described in further detail herein . referring now to fig2 , the flagpole ball 11 is characterized by opposed hollow , shelllike , hemispherical parts 24 and 26 which are interengaged to form a substantially spherical member . hemispherical parts 24 and 26 are each , preferably formed of relatively thin - walled aluminum , for example , and are fabricated in a conventional manner by suitable forming technique , known to those skilled in the art . however , hemispherical ornament part 26 includes a slightly radially inwardly displaced circular rim 28 delimited by a circumferential edge 30 and dimensioned to fit snugly within and engaged with the inside wall 24 a of part 24 , as illustrated . the radially inwardly displaced rim 28 provides an annular shoulder 32 which is adapted to engage circumferential edge 25 of part 24 in a snug - fitting relationship to form the spherical ball member 11 . ball member 11 is held in assembly and strengthened against deformation by an internal diametral column or brace member 34 preferably comprising a cylindrical aluminum rod which is provided with opposed axially extending internally threaded bores or tapped holes 36 and 38 , as shown . hemispherical part 24 is preferably somewhat flattened at a circular portion 24 b opposite another somewhat flattened circular portion 26 b of part 26 . parts 24 and 26 are also provided with fastener receiving openings 24 c and 26 c , respectively . a pan - head machine screw 40 is operable to be inserted through opening 24 c and threadedly engaged with brace member 34 at threaded bore 36 , as shown , for securing part 24 to brace member 34 . referring further to fig2 , ornament post member 22 includes an externally threaded end part 23 which is shown threadedly engaged with truck member 16 and suitably locked in engagement therewith by a conventional hex - shaped locknut 43 . the opposite end of post member 22 includes an internally threaded bore 27 opening to a transverse end - face 29 of post member 22 which is engageable with the flattened part 26 b of hemispherical ornament part 26 . an externally , continuous threaded or “ allthread ” fastener member 46 extends through opening 26 c , is threadedly engaged with brace member 34 at threaded bore 38 and is threadedly engaged with post member 22 at threaded bore 27 . fastener member 46 is preferably formed of steel while post member 22 and , as mentioned previously , brace member 34 are preferably formed of aluminum . generally planar transverse end faces 34 a and 34 b of brace member 34 are tightly engaged with the respective flattened or planar circular portions 24 b and 26 b of the hemispherical parts 24 and 26 . accordingly , the head 41 of fastener 40 may be in complete area contact with a surface of the hemispherical part 24 and the end - face 29 of post member 22 is also in substantially total area contact with the flattened or planar portion 26 b of hemispherical part 26 . in this way , upon assembly of the ornament 10 , the brace member 34 is in engagement with the hemispherical parts 24 and 26 over relatively large areas to distribute stresses thereon while aiding in maintaining the assembly as a consequence of tightening the fastener 40 and tightening the post 22 against hemispherical part 26 , thanks to the allthread fastener member 46 . still further , the flagpole ornament 10 may advantageously utilize thread locking and sealant compositions coated on the cooperating threads of the brace member 34 and the fasteners 40 and 46 , including a thread locking composition available under the trademark loctite , for example . referring briefly to fig3 , an alternate embodiment of a post member for use with the ornament 10 , in place of post member 22 , is illustrated and generally designated by the numeral 52 . post member 52 includes a transverse end face 53 , an internally threaded bore 54 and an axially extending externally threaded part 55 which may be of a different thread size than the threaded portion 23 of post member 22 . in this way , post members may be interchanged as required by the particular flagpole upper bracket or truck member to which the ornament 10 is to be connected . as previously mentioned , parts 24 and 26 are preferably formed of relatively thin - walled aluminum . for a ball diameter of about 4 . 0 inches , the wall thickness may be about 0 . 030 inches and the height “ x ” of the rim 28 , fig2 , is preferably about 0 . 38 to 0 . 50 inches . the brace member 34 and the post members 22 or 52 may be formed of aluminum cylindrical rod having a diameter of about 0 . 625 inches . the overall length of the post members 22 and 52 may be about 4 . 0 inches with the externally threaded portions being about 2 . 0 inches and the internally threaded portions 27 and 54 being about 1 . 0 inch deep and being of a thread size 5 / 16 - 18nc , for example . the allthread faster member 46 is preferably at least about 1 . 0 inches to 2 . 0 inches in length . fabrication and assembly of the ornament 10 , based on the foregoing description , is believed to be within the purview of one skilled in the art . referring now to fig4 , another embodiment of a flagpole ball ornament in accordance with the invention is illustrated and generally designated by the numeral 60 . the flagpole ornament 60 , utilizes the components of the flagpole ball ornament 10 , as indicated in fig4 , including the opposed hemispherical parts 24 and 26 and the post or column member 22 . however , the internal brace member 34 has been replaced by a similar brace member 34 g , which is provided with a fastener clearance bore 38 a for receiving an elongated machine screw or bolt 62 having a distal threaded portion 63 engageable with threaded bore 27 of post member 22 . brace member 34 g also includes the opposed transverse end faces 34 a and 34 b . machine screw or bolt 62 includes a conventional hexhead 64 and is of a diameter slightly less than the diameter of the bore 38 a . accordingly , fastener 62 comprising the hexhead machine screw or bolt is operable to secure the hemispherical parts 24 and 26 tightly together and braced by the brace member 34 g and further wherein a single fastener may be utilized to secure the ball ornament to the post or column member 22 . when assembling the flagpole ornament 60 , a thread locking and sealant composition as mentioned hereinabove is preferably used on the threads of the threaded shank part 63 and / or the bore 27 . the brace member 34 g may , in fact , be identical to the brace member 34 except for the bore 38 a , which may be of the same diameter as required for pre - drilling the brace member 34 to accommodate the threaded bores 36 and 38 when such bores are tapped in the brace member 34 . although preferred embodiments of the invention have been described in detail herein , those skilled in the art will recognize that various substitutions and modifications may be made without departing from the scope and spirit of the appended claims .	8
the preferred embodiment of the present invention is illustrated by way of example in fig1 and 2 . with specific reference to fig1 the cooling plant load reduction device 10 is shown comprising blower 12 , which collects returned air 14 from a building at approximately 75 degrees fahrenheit . blower 12 directs this 75 degree return air to freon vaporizer / expansion device 16 . vaporizer 16 has piping 18 that contains liquid freon 20 under pressure from pump 22 . waste heat in return air 14 heats the liquid freon 20 under pressure in freon vaporizer 16 so that the liquid freon 20 is vaporized . freon vapor 24 is then directed to turbine 26 where , because of lower pressure on the exhaust side 28 of turbine 26 , freon vapor 24 is expanded . turbine 26 is connected to generator 30 so that when freon vapor 24 passes through turbine 26 generator 30 produces electricity . turbine 26 is also mechanically connected to blower 12 and liquid pump 22 and drives them . freon vapor 24 , having left turbine 26 at the exhaust side 28 is then directed to condenser 32 . condenser 32 is maintained at a lower condensing temperature by utilization of chilled water 34 from a central chilling plant 36 ( not shown ) of a typical building cooling system . in the typical design of a central cooling plant 36 known in the art , chilled water / liquid 34 leaves the cooling plant 36 at 35 to 40 degrees fahrenheit . this chilled water 34 is then typically pumped directly to an air handling unit and chill coil ( not shown ) where heat from return air stream 14 at 75 degrees fahrenheit would be directly by a blower , such as blower 12 , to a coil ( not shown ) where heat is transferred to the chilled liquid . this is the system whereby the building air supply is cooled in the typical system . the net cooling effect of the air is proportional to the quantity and temperature rise of the liquid passing through the chill coil . in the typical case , the liquid , chilled water is at a temperature of 40 degrees entering and 55 degrees leaving . as is known in the art , the fuel source to produce chilled liquid in the central chilling plant 36 and the power required to operate blower 12 may be made from fossil fuel , nuclear energy or the like . the intended purpose of the central cooling plants , known in the art , is to produce chilled liquid at a temperature low enough so that heat may be transferred from the higher temperature in the space to be cooled to the lower temperature of the chilled liquid so that heat may be removed from an area where it is not desired to an area where it is less objectional , i . e . outdoors . the present invention better utilizes natural and recovered &# 34 ; waste &# 34 ; heat energy that is accumulated or generated within the structure to be cooled . as illustrated in this invention , the device may be assembled in the space to be cooled , consisting of freon vaporizer / expansion device 16 , turbine 26 , electrical generator 30 , condenser 32 , and feed pump 22 . this invention then , takes advantage of the temperature difference between building return air 14 load at 75 degrees fahrenheit and the 40 degree fahrenheit chilled liquid 34 produced by central chilling plant 36 for the primary purpose of cooling the structure . as fig1 indicates , the cooling plant load reduction device 10 of the present invention can transfer the same quantity of heat from building return air 14 at 75 degrees fahrenheit by means of blower 12 and pass return air 14 through freon vaporizer / expansion device 16 which causes liquid freon 20 to change phase to freon vapor 24 while the desired pressure is maintained by feed pump 22 . because of the enthalpy decrease experienced through turbine 26 as work energy is removed from the freon vapor 24 and transformed to shaft horsepower to do work on blower 12 and liquid pump 22 and electrical generator 30 , the capacity requirements for chilled water / liquid 34 from central chilling plant 36 is reduced . a key element of the novelty of this invention is the &# 34 ; host &# 34 ; arrangement of the structure of the invention within a building so that it takes advantage of the temperature drop between the building &# 39 ; s return air 14 at 75 degrees fahrenheit and the chilled water 34 , at about 40 degrees fahrenheit , supplied by the central chilling plant 36 which is produced by a separate fuel source for the purpose of cooling the structure . utilization of the device of this invention provides for simultaneous additional cooling of the building and the production of electricity which may be used for purposes other than the production of cooling . additional cooling is accomplished by removing the required volume heat energy from building return air 14 , transferring this energy to the liquid freon 20 which results in freon vapor 24 which increases enthalpy and which is then directed to turbine 26 where enthalpy is decreased by work done to drive blower 12 and liquid pump 22 and produce electricity with generator 30 . most importantly , the heat source that allows production of electricity with generator 30 and eliminates the requirements for electricity to drive blower 12 is what is known in the art as &# 34 ; waste &# 34 ; heat . that is , solar energy that is accumulated in the atmosphere within a structure and heat energy given off by the human body that is converted from food intake by the body and is absorbed into the cooler atmosphere of the structure at 75 degrees fahrenheit . these &# 34 ; waste &# 34 ; sources of heat may also include heat generated within a structure by electrical apparatus such as computers , motors and any other processes that require steam motivation , result in friction of mechanical parts within devices , etc . all of this &# 34 ; waste &# 34 ; heat is gathered in the return air 14 stream and transferred by blower 12 into freon vaporizer / expansion device 16 which contains liquid freon 20 under pressure by pump 22 . freon vapor 24 is directed from freon vaporizer 16 to the turbo expander , turbine 26 , which forcefully drives generator 30 and blower 12 and liquid pump 22 and which , ultimately , converts the accumulated &# 34 ; waste &# 34 ; heat energy , such as solar heat , body heat and the like , that is generated within a structure , to electricity and shaft horsepower to drive blower 12 and liquid pump 22 . simultaneously , extra cooling is being produced . this cycle is completed by the direction of the freon vapor 24 from turbine 26 by means of exiting through the exhaust side 28 of turbine 26 to condenser 32 where sufficient heat is removed by chilled water 34 at approximately 40 degrees fahrenheit to allow condensation of freon vapor 24 into freon liquid 20 so that the liquid freon 20 can be recirculated by pump 22 back to freon vaporizer 16 to continue the cycle . referring now to fig2 the physical properties of the invention are demonstrated by means of an enthalpy diagram . starting at position number 1 , the diagram demonstrates heat in equalling approximately 70 degrees with the source being the return air stream 14 handling a building load at 75 degrees fahrenheit . the descending vertical line from 1 to 2 illustrates the enthalpy drop of work done in turbine 26 as freon vapor 24 passes therethrough . the vertical line from number 2 to number 3 demonstrates the effect of the condenser 32 wherein reversible constant pressure heat transfer from vapor is shown ending in freon liquid 20 . the connecting lines from number 3 to number 4 demonstrates work added by pump 22 to provide liquid freon 20 under pressure . finally , from number 4 to 1 , the horizontal line demonstrates the reversible constant pressure heat transfer to liquid resulting in the transformation of liquid freon 20 to freon vapor 24 . demonstration of the thermal efficiency of this cycle can be shown using the following mathematical equations . ## equ1 ## thermal efficiency of the rankine cycle = network out divided by heat supplied . ## equ2 ## therefore , work turbine ( wt ) is greater than work pump ( wp ) and by utilizing &# 34 ; waste &# 34 ; heat from return air 14 , useful shaft work is done simultaneously while the central chilling plant 34 cools the building . because heat out by condenser 32 ( lines 2 - 3 in fig2 ) is less than heat in ( line 4 - 1 in fig2 ) because of work removed by turbine ( lines 1 - 2 in fig2 ), less cooling capacity is required from central chilling plant 36 and the efficiency of central chilling plant 36 is thereby enhanced . in summary then , the cooling plant load reduction device 10 of the present invention accomplishes its purposes by arranging a blower 12 for directing return air 14 to a heat exchanger , such as freon vaporizer 16 , connected to a vapor expanding engine , such as turbine 26 , which is connected to condenser 32 connected to liquid feed pump 22 which pumps liquid freon 20 back to the starting point and the heat exchanger of the air handling unit . this arrangement forms a closed loop section which is well know as a &# 34 ; rankine &# 34 ; cycle . the heat source for this &# 34 ; rankine &# 34 ; cycle , however , is &# 34 ; waste &# 34 ; heat absorbed from the air at approximately 75 degrees in the building space to be cooled . the &# 34 ; heat sink &# 34 ; for the condenser 32 of this cycle is provided by the lower temperature of the chilled liquid , chilled water 34 , provided by the refrigeration part of the standard building air conditioning plant , central chilling plant 36 . this chilled liquid , chilled water 34 , is maintained , typically , at approximately 35 degrees fahrenheit . when motive fluids , such as refrigerant 502 and the like , are incorporated into this closed loop cycle , pressure drops are achieved at this stated temperature difference of 75 degrees to 40 degrees fahrenheit that is sufficient to substantially drive both blower 12 and liquid feed pump 22 . this then , substantially eliminates the need to purchase external energy sources to operate the air handling unit of the present invention . as a result , the operating cost of providing air conditioning is reduced . this cost is reduced again by this invention because of the decrease in entropy associated with the drop of pressure through the turbine 26 that drives the blower 12 and liquid feed pump 22 . this is true because in a rankine cycle , the heat out of a turbine or expander equals the heat in minus work done by the turbine . while the present invention has been disclosed in connection with the preferred embodiment thereof , it should be understood that there may be other embodiments which fall within the spirit and scope of the invention as defined by the following claims .	5

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.